A Role of High Mobility Group Box 1 Protein. Sweta Adhikary April

Mechanism of Methamphetamine-Induced Neuroinflammation: A role of High Mobility Group Box 1 Protein.

Sweta Adhikary April 2, 2014 University of Colorado at Boulder Department of Psychology and Neuroscience

Thesis Advisor Dr. Steven Maier, Department of Psychology and Neuroscience

Committee Members Dr. Steven Maier, Department of Psychology and Neuroscience Dr. Ryan Bachtell, Department of Psychology and Neuroscience Dr. Angela Thieman-Dino, Department of Anthropology Dr. Teresa Foley, Department of Integrative Physiology

1 Table of Contents

Abstract...... 4

Introduction...... 5

Background…...... 8

Dopamine Mesolimbic Pathway ...... 8

DAT mediated METH effects...... 8

VMAT-2 mediated METH effects ...... 9

METH-induced neurotoxicity ...... 9

Role of dopamine in neurotoxicity ...... 10

Role of DAT and VMAT-2 in METH-induced toxicity ...... 10

Innate Immunity in the Central Nervous System ...... 11

Microglia ...... 11

High Mobility Group Box 1 Protein (HMGB1) ...... 12

Cytokine activity of HMGB1 ...... 13

HMGB1 receptors and signaling ...... 14

Redox state and cytokine activity of HMGB1 ...... 14

Cytokine activity of HMGB1 ...... 14

Summary and Objectives ...... 15

Methods...... 16

Animals...... 16

Reagent...... 16

In Vitro effect of METH on microglia (Experiment 1) ...... 16

Tissue collection ...... 16

Ex vivo immune stimulation of striatal microglia with METH...... 17

Real time (RT-PCR) measurement of gene expression...... 17

IL-1β ELISA...... 18

In vivo effect of METH on HMGB1 and IL-1 beta (Experiment 2) ...... 18

2 Intraperitoneal Injection of METH...... 18

Tissue processing ...... 18

Total protein quantification...... 19

HMGB1 ELISA...... 19

Statistics...... 19

Results...... 19

Experiment 1. Effect of METH on the microglia pro-inflammatory response in

vitro...... 20

Experiment 2. Effect of METH on HMGB1 and IL-1β in

brain...... 20

Discussion ...... 21

Acknowledgements...... 23

Figure Legends...... 24

Figures...... 28

References...... 33

3 Abstract

Methamphetamine (METH) abuse is a serious public health issue, yet much regarding its neuroinflammatory role is unknown. This study investigates the mechanism underlying METH- induced neuroinflammation. Two experiments were designed to investigate the role of microglia and high mobility group box 1 (HMGB1) protein in METH-induced neuroinflammation. Striatal microglia cell were isolated and cells were incubated with METH (10, 100, 1000, and 10,000 ng/ml) or media alone for 24 h at 37° C, 5% CO2. In secondary experiments, microglia were exposed to higher concentrations to METH (0.001, 0.01, 0.1, 1 and 10 mM). IL-1β mRNA and protein levels were measured using Real-Time PCR and an ELISA, respectively. The main effect of METH on IL-1β mRNA and protein levels was not significant. In experiment two, rats were injected with 1 of 3 doses of METH (10, 5, 2.5, and 0 mg/kg, i.p.) to investigate the effect of different doses of METH on HMGB1 protein levels. HMGB1 protein was measured in ventral tegemental area (VTA), nucleus accumbens (NAC) and pre-frontal cortex (PFC) using an

ELISA. The main effect of METH on HMGB1 protein was significant at the 10 mg/kg dose and the main effect of METH on IL-1β protein was significant compared to the vehicle. Furthermore, there was a dose dependent decrease in HMGB1 after METH injection. Together, these findings suggest that HMGB1 plays a crucial role in mediating METH-induced neuroinflammation. Since it is known that HMGB1 binds to Toll-Like Receptors 2 and 4 in microglia cell surface, this paper proposes a potential mechanism for METH-induced neuroinflammation via HMGB1.

Introduction

4 Abuse of the psychostimulant methamphetamine (METH ) has become an international health problem with an estimated 16 million people abusing the substance worldwide (United

Nations Office on Drugs and Crime, 2007). Additionally, the cost of METH use in United States was estimated to be $23.4 billion in 2005 (RAND Drug Policy Research Center, 2009). The increased number of people abusing METH, coupled with the rising burden of the drug on the economy, signifies the global effect METH can have in a population. However, it is important to keep in mind the effect of this drug on the individual. Beside the high rate of addiction after long-term METH abuse, METH also induces other debilitating effects including significant anxiety, confusion, mood disturbances, insomnia, psychotic symptoms, and violent behavior

(National Institute on Drug Abuse, NIDA, 2013). Addicts that attempt to abstain from further drug use suffer from both physiological and psychological effects such as depression, anxiety, fatigue, and the most obvious – intense craving for the drug (NIDA, 2013). Given the wide array of biological, psychological, and sociological factors underlying both METH addiction and withdrawal, it is easy to understand why treatments for METH abuse are limited. Therefore, it is crucial to continue research on METH and to use research methods that examine METH addiction in novel ways.

One of the new ways to further understanding of METH addiction is to explore the mechanisms underlying the pro-inflammatory effects of the drug. Psychostimulants are able to activate specific components of the innate immune system following both chronic and acute exposure (Clark et al., 2012). Therefore, it is not surprising that METH is neuroinflammatory

(Krasnova & Cadet, 2010), and indeed, METH causes activation of microglia in the striatum, cortex and hippocampus two hours after an acute subcutaneous administration of 10 mg/kg dose

(Escubedo et al., 1998). Importantly, these findings suggest a role for microglia in inducing

5 neuroinflammation. Furthermore, METH can also cause an increase in the levels of interleukin -

1β (IL-1β), a pro-inflammatory cytokine (Numachi et al., 2007; Yamaguchi et al., 1991), primarily produced by the microglial cells in the brain. However, although there is ample evidence implicating METH as a neuroinflammatory substance, the mechanism(s) underlying

METH-induced neuroinflammation is unknown.

In sum, it is known that METH activates microglia in vivo, and that microglia are key in the neuroinflammatory process. Thus, an obvious strategy to investigate the mechanism underlying METH-induced neuroinflammation is to study the activation of microglia after direct

METH exposure in vitro (experiment 1). The advantage of this strategy is that molecular mechanisms are far easier to study in vitro.

Additionally, METH-induced neurotoxicity can lead to necrosis and neuroinflammation in dopaminergic brain regions. Rats treated acutely with various doses of METH show long- lasting decreases in DA levels (Bittner et al., 1981; Cappon et al., 2000; Chapman et al., 2001;

Eisch et al., 1992; Fukumura et al., 1998; Green et al., 1992; Kogan et al., 1976; Morgan and

Gibb, 1980; Ricaurte et al., 1980; Richards et al., 1993; Truong et al., 2005; Wagner et al., 1979,

1980; Walsh and Wagner, 1992), long-term reductions in the activity of tyrosine hydroxylase

(TH) (Hotchkiss and Gibb, 1980; Hotchkiss et al., 1979; Morgan and Gibb, 1980), and marked decreases in the number of dopamine transporters (DAT) (Eisch et al., 1992; Guilarte et al.,

2003; Wagner et al., 1980) in the striatum. Additionally, there are many other ways in which

METH can lead to dopamine terminal degeneration within the synapse (Figure 1; the details on

METH neurotoxicity will be explained in detail below).

It is known that the dying cells release various intracellular substances after undergoing necrosis. One of these substances is an alarmin/Danger Associated Molecular Pattern (DAMP)

6 called high mobility group box 1 protein (HMGB1). HMGB1 can activate microglia by ligating

Toll Like Receptors (TLRs) expressed by microglia, thereby inducing inflammation. Since it is known that METH causes death of dopaminergic neurons, METH -induced neuroinflammation may be indirectly mediated by the neurotoxic effects of METH through release of alarmins such as HMGB1, which then induce a pro-inflammatory response in microglia. The role of HMGB1 in METH -induced neuroinflammation has not been studied and is a focus of the present investigation. (experiment 2).

Fig 1. Schematic rendering of cellular and molecular events involved in METH -induced DA terminal degeneration and neuronal apoptosis within the striatum. The figure summarizes findings of various studies that have addressed the role of DA, oxidative stress, and other mechanisms in METH toxicity. METH enters dopaminergic neurons via DAT and passive diffusion. Within these neurons, METH enters synaptic vesicles through VMAT-2 and causes DA release into the cytoplasm via changes in pH balance. In the cytoplasm, DA auto-oxidizes to form toxic DA quinones with generation of superoxide radicals and hydrogen peroxides via quinone cycling. Subsequent formation of hydroxyl radicals through interactions of superoxides and hydrogen peroxide with transition metals leads to oxidative stress, mitochondrial dysfunctions and peroxidative damage to presynaptic membranes. The involvement of endogenous DA in METH neurotoxicity is supported by findings that the TH inhibitor, METH yl-p-tyrosine, which blocks DA synthesis, affords protection against METH toxicity. In addition, the role of DA is supported by observations that use of the MAO inhibitor, clorgyline, and of the irreversible inhibitor of vesicular transport, reserpine, which results in increases in cytoplasmic DA levels can exacerbate METH -induced toxicity. Together, these events are thought to be partly responsible for the loss of DA terminals. DA release from the terminals is also involved because the DAT inhibitor, amphonelic acid, which blocks METH - induced DA release from DA terminals can also prevent damage to DA axons. The toxic effects of released DA might occur through activation of DA receptors because DA receptor antagonists block degeneration of DA terminals. Interactions of DA with D1 receptors on post-synaptic membrane cause activation of various transcription factors and subsequent upregulation of death cascades in postsynaptic neurons. These death cascades can be inhibited, in part, by the DA D1 antagonist, SCH23390. (Krasanova et al., 2009). Background

Dopamine Mesolimbic pathway

7 METH, like many other addictive drugs, has a profound effect on the mesolimbic dopamine pathway (VTA, NAC, PFC). More specifically, METH primarily causes the release of monoamines, dopamine, serotonin, and norepinephrine (Paneka et al., 2012; Fig. 2). It has been thought that METH not only blocks the norepinephrine, dopamine, and serotonin transporters in the brain like other psychostimulants, it also reverses these transporters to increase the levels of monoamines in the synapse (Koob & Moal, 2006). More specifically, METH modulates dopamine release by acting at two main molecular substrates on dopamine neuronal terminals: the vesicular monoamine transporter-2 (VMAT-2) and the plasmalemmal dopamine transporter

(DAT) (Kahlig & Galli, 2003; Fig 2).

DAT mediated METH effects

Because DAT can transport dopamine bidirectionally, and the concentration of dopamine is much greater inside than outside the cell, the binding of METH on the extracellular side causes cytosolic dopamine to be reverse-transported outside the cell (Fleckenstein et al., 2007).

Furthermore, DAT can also cause non-vesicular release of dopamine (Paneka et al., 2012). DAT can undergo a conformational change that enables brief bursts of dopamine efflux at a concentration resembling vesicular exocytotic release (Khalig et al., 2005). Lastly, DAT can also be internalized as a part of an endocytoic recycling pathway, thereby removing it from the plasmalemmal membrane, and ultimately hampering its capacity to decrease synaptic levels of dopamine (Paneka et al., 2012).

VMAT-2 mediated METH effects

8 VMAT-2 is an integral membrane protein that transports monoamines from the intracellular cytosol into synaptic vesicles (Brown et al., 2001; Fleckenstein et al., 2009;

Weiland-Fiedler et al., 2004). METH causes synaptic vesicles to leak monoamines into the surrounding cytosol by disrupting a proton gradient set up by a hydrogen pump (Fleckenstein et al., 2007). Furthermore, METH, at physiological concentrations, also binds VAMT-2 and competitively inhibit vesicular monoamine uptake (Schwartz et al., 2006; Sulzer et al., 1993).

This binding decreases sequestration of dopamine and thus leads to an increased cytosolic and synaptic monoamine concentration (Schwartz et al., 2006; Sulzer et al., 1993).

Ultimately, these high levels of monoamines in the synapse, acute and long-term, due to action at DAT and VMAT-2, contribute to the many psychological and behavioral effects of

METH. Furthermore, high doses of METH can not only lead to addiction, it can also cause neurotoxicity in dopaminergic cells (Krasnova et al., 2009).

METH-induced neurotoxicity

METH can cause long-term destruction of presynaptic dopaminergic and serotoninergic terminals (Krasnova & Cadet, 2010). METH enters the terminals/neurons via dopamine or serotonin transporters (DAT and SERT, respectively), and displaces both vesicular and intracellular DA/5-HT (Davidson et al., 2001). The displaced amines are oxidized by monoamine oxidase (MAO) to reactive oxygen species (ROS) (Cubells et al., 1990), with further production of ROS via hydrogen peroxide and nitric oxide (NO) (Bowyer et al., 1994). Additionally, METH causes depletions of 5-HT levels in rat striatum (Bakhit et al., 1981; Cappon et al., 2000;

Friedman et al., 1998; Fukumura et al., 1998; Ricaurte et al., 1980; Richards et al., 1993; Walsh and Wagner, 1992), and also causes decreases in VMAT-2 binding (Guilarte et al., 2003).

9 Furthermore, the neurotoxic damage to striatal axonal terminal is accompanied by astrocytosis

(Bowyer et al., 1994; Cappon et al., 2000; Fukurama et al., 1998), and interestingly, microglial activation (Pubill et al., 2002). These processes ultimately leads to necrotic cell death (Davidson et al., 2001).

Role of Dopamine in METH toxicity

The role of dopamine in the mediation of METH toxicity is supported by studies showing that METH causes reactive oxygen species (ROS) production and oxidative stress in cultures containing dopamine neurons, but not in cultures devoid of dopamine neurons (Cubells et al.,

1990). Additionally, studies showing that METH-induced ROS in normal but not in dopamine depleted striatal synaptosomes further supports the involvement of dopamine in METH toxicity

(Pubill et al., 2005). Furthermore, after its displacement into the cytoplasm by METH, dopamine rapidly auto-oxidizes to form super radicals, hydroxyl radicals, and hydrogen peroxides

(Krasnova & Cadet, 2010). Ultimately, dopamine plays an integral role in METH induced neurotoxicity.

Role of DAT and VMAT-2 in METH-induced toxicity

As mentioned above, METH interacts with both DAT and VMAT-2 to release monoamines into the extracellular space (Sulzer et al., 2005). Therefore, one can suppose that these proteins play a pivotal role in METH-induced toxicity. Indeed, several studies have shown that a DAT inhibitor was able to protect against METH-induced striatal dopamine depletion

(Marek et al., 1990). Furthermore, DAT knockout mice are also protected against dopamine depletion, astrocytosis, and ROS production in the striatum (Fumagalli et al., 1998).

10 Additionally, pretreatment with reserpine, an irreversible inhibitor of vesicular transport, exacerbates toxicity of the psychostimulant, suggesting a role of VMAT-2 in METH-induced toxicity (Albers & Sonsalla, 1995).

Ultimately, there are multiple mechanisms of METH-induced neurotoxicity, and almost all of these processes can lead to necrosis. As previously mentioned, when a cell undergoes necrosis, it doesn’t die a “quiet” death. Rather, it releases various intracellular substances to

“warn” other cells of potential danger. This warning signal is primarily produced by immune cells, and in this case, the innate immune system of the brain.

Innate Immunity in the Central Nervous System

Microglia

The innate immune system is he first line of defense against “danger” (Janeway, 2006), and microglia are the resident immune cell of the central nervous system (CNS). In a healthy

CNS, the microglia are in a quiescent (surveillant) state, and when they encounter danger, they become activated and secrete various inflammatory mediators, such as pro-inflammatory cytokines (e.g. IL-1β), nitric oxide, chemokines, and reactive oxygen species (Colton, 2009).

Microglia express many of the same receptors as do peripheral macrophages, including pattern recognition receptors (PRRs) that allow them to identify danger and foreign microorganisms.

Among these PRRs, TLRs are the most extensively characterized (Barton and Kagan, 2009).

TLRs are a family of highly conserved membrane or cytosolic proteins that transduce signals through a family of cytosolic Toll adapter proteins that link to downstream signaling cascades

(Barton and Kagan, 2009). The activation of many of the TLR family members ultimately activates NF-kB as well as other transcription factors (Kawai and Akira, 2010; Salminen et al.,

11 2008; Fig. 3). Of the PRRs, TLR2 and TLR4 have been the most intensively studied within the

CNS and are densely expressed on microglia (Aravalli et al., 2007). Although TLRs bind many pathogenic substances, they also bind the alarmin HMGB1.

High Mobility Group Box-1 Protein

High Mobility Group Box-1 (HMGB1) is a nuclear protein that is ubiquitous in eukaryotic cells. In the nucleus, it functions to stabilize nucleosome formation and acts as a transcription factor-like protein that regulates the expression of several genes (West et al., 2004

& Stros et al., 2004). It is to some degree also cytoplasmically expressed, as it shuttles back and forth from the nucleus (Stros 2010). More specifically , HMGB1 has recently been demonstrated to be involved in autophagy and in inflammasome activation in the intracellular compartment

(Yang et al., 2012). Additionally, several recent studies have now found that HMGB1 is secreted by active macrophages, mature dendritic cells, and natural killer (NK) cells in response to injury, infection, or other inflammatory stimuli (Lotze & Tracey, 2005). Because of its extensive role in peripheral immunological function, HMGB1 is considered one of the main prototypes of danger associated molecular patterns (DAMPS) (Seong & Matzinger, 2004). DAMPs are naturally expressed in the cytosol or the nucleus, and currently include S100 proteins, heat-shock proteins

(HSPs) and HMGB1. When released extracellularly, these proteins signal to the host that there is tissue damage (Lotze & Tracey, 2005). More specifically, extracellular HMGB1 is involved in a variety of immune responses, acting as a prototypic alarm signal (Yang et al.,2013). Given these distinct functions of HMGB1, one can assume that this protein has compartment-specific functions.

12 As a nuclear protein, HMGB1 is important for the regulation of transcription (Lotze &

Tracey, 2005). It facilitates the binding of several regulatory protein complexes to DNA (Zeh &

Lotze, 2005; Pasqualini, Sterner, Mercat & Allfrey, 1989; Prendergast, Onate, Christensen,

Edwards, 1994; Zhang, Krieg, & Shapiro 1999), integrates transposons (Zayed, Izsvak, Khare,

Heinemann & Lvics, 2003), enhances the interaction of other proteins with DNA, and enhances transcriptional activation (Knapp et al., 2004).

Cytokine Activity of HMGB1

HMGB1 is now recognized as a cytokine because it mediates systemic inflammatory responses, is secreted by activated immune cells, activates inflammatory response in immune and endothelial cells, and transduces cellular signals through receptor for advance glycation end- products (RAGE), TLR2 and TLR4 (Lotze & Tracey, 2005; Fig. 4). HMGB1 can be released in two different ways: it can be secreted actively after DNA acetylation in the nucleus, or it can be released passively by cells undergoing necrosis (Lotze & Tracey, 2005; Fig 2). Since the focus of this project is necrosis induced HMGB1 release after METH exposure, only this aspect of

HMGB1 release will be discussed.

Necrotic cells, as opposed to apoptotic cells, can alert the immune system to danger because they lose membrane integrity and release their intracellular contents (Kono & Rock,

2008). As previously mentioned, one of these contents is the DAMP HMGB1. HMGB1 released passively by injured or necrotic cells, acts as a pro-inflammatory cytokine and functions as a major stimulus of necrosis-induced inflammation (Scaffidi, Misteli & Bianchi, 2002). When cells undergo necrosis, HMGB1 diffuses out into the extracellular space and drives inflammation

13 (Lotze & Tracey, 2005), by binding to TLR2 and TLR4 in human neutrophils and macrophages

(Park et al., 2003).

HMGB1 receptors and signaling

TLR4 is the primary receptor involved in macrophage activation, cytokine release, and tissue damage in response to HMGB1 (Yang et al., 2010). However, HMGB1 can also form heterocomplexes with other molecules, such as IL-1, CXCL12, DNA, RNA, or histones, which generate synergistic responses compared with those produced by individual components (Yang et al., 2013). Thus, both HMGB1 directly binding to TLRs or heterocomplexing with other molecules initiates innate immune response such as chemotactic activity and release of pro- inflammatory cytokines. At this point, it is important to note that there are two distinct molecular structures of HMGB1 and that these structures determine its role in inflammation and immunity.

Redox state and cytokine activity of HMGB1

Extracellular HMGB1 can act both as a chemoattractant for leukocytes and as a pro- inflammatory mediator to release TNF, IL-1, IL-6 and other cytokines (Venereau et al., 2012).

However, recent studies have shown the pro-inflammatory activity of HMGB1 depends on the redox state of three cysteine residues (Yang et al., 2012). More specifically, the oxidation of cysteines C23 and C45 results in a disulfide bond within the first HMG-box domain of HMGB1

(also known as Box A) and the unpaired C106 must be in a thiol state for the protein to be pro- inflammatory (Yang et al., 2012). Additionally, the all-thiol form of HMGB1 acts only as a chemotactic mediator. It is important to note that HMGB1 can switch between mutually exclusive redox states, where reduced cysteines make HMGB1 a chemoattractant, and a disulfide

14 bond makes it a pro-inflammatory cytokine (Venereau et al., 2012). Moreover, the pro- inflammatory or partially oxidized form of HMGB1 binds to TLR4 and induces TNF release and

NF-kB activation (Yang et al., 2012). Interestingly, the fully oxidized form of HMGB1

(oxidation of C23, C45, and C106) exhibits neither chemotactic nor pro-inflammatory activity.

In sum, HMGB1 is a complex protein whose activity is not only compartment specific

(nuclear vs. cytosolic vs. extracellular), it is also dependent on the redox state of the protein.

Summary and Key Research Objectives

Given the effects of METH on the innate immune system within the CNS, the role of microglia in METH-induced neuroinflammation is pivotal. As previously mentioned, microglia express various PRRs on their surfaces to bind pathogen, foreign substances, and alarmins.

Furthermore, METH in high doses has neurotoxic effects causing dopamine cell necrosis, followed by the release of alarmins. Given these two points, one can now try to elucidate the mechanism underlying METH-induced neuroinflammation. The inflammation can be caused by the direct binding of METH to various PRRs in microglia, or due to the release of HMGB1 from necrotic cells, and subsequent binding of HMGB1 to TLRs on microglia. Given these two potential mechanisms by which METH can induce neuroinflammation, this project had two key objectives:

1. Determine whether the neuroinflammatory response to METH is due to the induction of

pro-inflammatory cytokines through direct activation of striatal microglia, or

2. Determine whether the neuroinflammatory response in the VTA, PFC, and NAC, is due

to the release of alarmins after cell apoptosis and necrosis after METH induced

neurotoxicity.

15 Methods

Animals

Male Sprague-Dawley rats, weighing approximately 275 grams (60-90 days old; Harlan

Sprague-Dawley, Inc., Indianapolis, IN, USA) were pair-housed with food and water available ad libitum. The colony was maintained at 25 °C on a 12-h light/dark cycle (lights on at 07:00 h).

All experimental procedures were conducted in accord with the University of Colorado

Institutional Animal Care and Use Committee.

Reagents

METH was obtained from Sigma (St.Louis, MO).

In vitro effect of METH on microglia (Experiment 1)

Tissue collection

Animals were given a lethal dose of sodium pentobarbitaland then transcardially perfused with ice-cold saline (0.9%) for 3 min to remove peripheral immune leukocytes from the CNS vasculature. Brains were rapidly extracted and placed on ice, striatum dissected, and microglia were immediately isolated.

Ex vivo immune stimulation of striatal microglia with METH

Striatal microglia were isolated using a Percoll density gradient as previously described

(Frank et al., 2006). It has been previously shown (Frank et al., 2006) that this microglia isolation procedure yields highly pure microglia (Iba-1+/MHCII+/CD163-/GFAP-). Microglia were suspended in DMEM+10% FBS and microglia concentration determined by trypan blue

16 exclusion. Microglia concentration was adjusted to a density of 5 x 10^3/100 µl and added to individual wells of a 96-well v-bottom plate. METH was utilized to challenge microglia ex vivo.

METH was dissolved in tissue culture media (DMEM+10% FBS). In initial experiments, cells were incubated with METH (10, 100, 1000, and 10,000 ng/ml) or media alone for 24 h at 37°

C, 5% CO2. In secondary experiments, microglia were exposed to higher concentrations to

METH (0.001, 0.01, 0.1, 1 and 10 mM). The plate was centrifuged at 1000 x g for 10 min at 4

°C to pellet cells. Supernatant was removed for ELISA analysis of IL-1β protein. Cells were washed 1x in ice cold PBS and centrifuged at 1000 x g for 10 min at 4 °C. Cell lysis/homogenization and cDNA synthesis was performed according to the manufacturer’s protocol using the SuperScript III CellsDirect cDNA Synthesis System (Invitrogen, Carlsbad,

CA).

Real time (RT-PCR) measurement of gene expression

A detailed description of the PCR amplification protocol has been published previously

(Frank et al., 2006). cDNA sequences were obtained from Genbank at the National Center for

Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov). Primer sequences were designed using the Operon Oligo Analysis Tool (http://www.operon.com/technical/toolkit.aspx) and tested for sequence specificity using the Basic Local Alignment Search Tool at NCBI. Primers were obtained from Invitrogen. Primer specificity was verified by melt curve analyses. All primers were designed to span exon/exon boundaries and thus exclude amplification of genomic

DNA. IL-1β (F- CCTTGTGCAAGTGTCTGAAG, R- GGGCTTGGAAGCAATCCTTA), β-

Actin (F- TTCCTTCCTGGGTATGGAAT, R- GAGGAGCAATGATCTTGATC)

PCR amplification of cDNA was performed using the Quantitect SYBR Green PCR Kit (Qiagen,

17 Valencia, CA). Formation of PCR product was monitored in real time using the MyiQ Single-

Color Real-Time PCR Detection System (BioRad, Hercules, CA). Relative gene expression was determined by taking the expression ratio of the gene of interest to β-Actin.

IL-1β ELISA

IL-1β protein was measured using a commercially available ELISA kit (R & D Systems,

Minneapolis, MN). IL-1β protein was assayed according to the manufacturers’ protocol.

In vivo effect of METH on HMGB1 and IL-1 beta (Experiment 2)

Intraperitoneal Injection of METH

Rats were injected with 1 of 3 doses of METH (10, 5, 2.5, and 0 mg/kg, i.p.) to investigate the effect of different doses of METH on HMGB1 protein levels in the brain. Two hours later, the rats were perfused with saline and whole brains were dissected. Brains were immediately placed into chilled isopentane to flash freeze the tissue. The tissues were stored at -

80o C.

Tissue Processing

Tissue micropunches from ventral tegmental area (VTA), nucleus accumbens (NAc), and prefrontal cortex (PFC) were sonicated in 100 ul of tissue extraction buffer (Invitrogen,

Camarillo, CA) containing a protease inhibitor cocktail (Sigma, St. Louis, IL). Sonicated samples were centrifuged at 14,000 rpm, 4o C for 10 min. Supernatants were collected and stored at -80o C.

18 Total Protein Quantification

The protein concentrations from each sample were determined using a Bradford protein assay.

HMGB1 ELISA

HMGB1 protein was measured using a commercially available ELISA kit (Chondrex,).

HMGB1 protein was assayed according to the manufacturers’ protocol.

Statistical analysis and data presentation

All data are presented as mean ± SEM. For experiment 1, statistical analysis consisted of a one-way ANOVA followed by post-hoc tests (Tukey's). For experiment 2, a mixed design

ANOVA was conducted with brain region as the within subjects factor and METH dose as the between subjects factor followed by post-hoc tests (Tukey's). Statistical analysis was performed using Prism 5 (Graphpad Software, Inc., La Jolla, CA). Threshold for statistical significance was set at α = 0.05. All data were normalized (log scaled) before doing statistical analysis.

Results

Experiment 1: Effect of METH on the microglia pro-inflammatory response in vitro

The main effect of METH on IL-1β protein expression was not significant (Fig. 4) (F =

0.40; p = 0.81), and the main effect of METH on IL-1β mRNA expression was not significant (F

= 1.1; p = 0.40).

19 Experiment 1B: Effect of higher METH concentration on the microglia pro-inflammatory response in vitro

The main effect of METH on IL-1β protein expression, even at the higher doses of

METH, did not show a dose dependent increase. (Fig. 4).

Experiment 2: Effect of METH on HMGB1 and IL-1β in brain

HHMGB1

The main effect of METH on HMGB1 protein was significant at the 10 mg/kg dose, regardless of the brain region (F = 4.54; p = 0.0154), when compared to the vehicle (Fig. 5).

METH significantly decreased HMGB1 levels. The main effect of METH on HMGB1 protein was not significant at any other dose. There was a dose dependent decrease of HMGB1 levels.

The interaction between brain region and METH dose was significant (F = 2.374, p = 0.049).

IL-1β.

The main effect of METH on IL-1β protein was significant (F=5.898, p=.0057), when compared to vehicle (Fig. 5). METH significantly increased IL-1β levels. The interaction between brain region and IL-1β protein level was significant (F=2.374, p=.0482).

Post-hoc comparison within brain region

Post-hoc analyses were then conducted separately for each brain region. For NAC, 10 mg/kg METH significantly increased IL-1b compared to vehicle control (p < 0.01) and the 2.5 mg/kg METH dose (p < 0.01). For PFC, 2.5 mg/kg METH significantly increased IL-1b compared to vehicle control (p < 0.05). For VTA, 10 mg/kg METH significantly increased IL-

20 1b compared to vehicle control (p < 0.05). The main effect of METH on Il-1β was significant

(F=2.374; p=.0492), when compared to the vehicle.

Discussion

The aim of this project was to study the mechanism underlying METH-induced neuroinflammation. Since microglia was not activated after METH introduction, the present study has shown that METH-induced neuroinflammation is not directly mediated by microglia.

However, because there was a dose dependent decrease in HMGB1 after METH injection, neuroinflammation could be indirectly mediated by HGMB1. Since there was a dose dependent decrease in HMGB1 after METH injection, the role of HMGB1 must be investigated further.

However, there are some key caveats that we must keep in mind when talking about the role of

HMGB1 in METH-induced neuroinflammation.

Limitations of the experiment

First, given the nature of the study, total HMGB1 was measured, instead of differentiating between the nuclear, cytoplasmic, and extracellular compartments. Ideally, in order to measure the amount of HMGB1 released, extracellular HMGB1 pre and post METH injection should have been measured. However, given the large size of HMGB1, using microdialysis was not possible.

Furthermore, as previously mentioned, only the oxidized form of HMGB1 has the capacity to act as a cytokine to mediate pro-inflammatory responses. Therefore, using mass spectrometry to differentiate between the oxidized and chemotactic HMGB1 would have better delineated the role of HMGB1 in METH-induced neuroinflammation.

21 Additionally, instead of observing an increase in HMGB1 levels as hypothesized, a dose dependent decrease was measured. One of the reasons for a decrease in HMGB1 could be because of the protein heterocomplexing with other molecules after its release. In this case, the

HMGB1 could not have been detected by the ELISA assay.

Furthermore, the dose dependent decrease in total HMGB1 levels could also be attributed to the fact that the protein was rapidly degraded once it was released into the extracellular space.

Previous studies have demonstrated the time-dependent decrease of HMGB1 after the onset of brain ischemia (Qui et al., 2008). The authors posited that HMGB1 was rapidly released from the cytosol after brain ischemia and was then degraded. Therefore, the decrease in HMGB1 following METH exposure can be interpreted as an increase in extracellular HMGB1 levels.

Despite the limitations in the experiment, there is a clear relationship between HMGB1 and neuroinflammation following acute METH injection. Having said that, we posit a potential mechanism underlying METH-induced neuroinflammation, mediated by HMGB1. A) As the cells undergo necrosis, they passively release HMGB1 into the extracellular space. B) HMGB1 then binds to the TLR2 and TLR4 on microglia cells. C) This binding activates microglia cells to induce NF-kB transcription, subsequently producing IL-1β. However, further studies must be done to fully understand the role HMGB1 plays in METH-induced neuroinflammation.

Future studies

This experiment measured HMGB1 protein levels, but measuring HMGB1 mRNA levels would provide key insights into the role that HMGB1 plays in neuroinflammation. Additionally, in order to establish whether HMGB1 is necessary to mediate METH-induced neuroinflammation, an antagonist must be used to block its activity in the brain. Anti-HMGB1 antibodies have been used in other studies to investigate the role of HMGB1 in sepsis (Yang et

22 al., 2003), therefore, blocking HMGB1 using anti-HMGB1 antibodies via microinjection in the brain would be a crucial next step to better understand the role of HMGB1 in METH-induced neuroinflammation.

Ultimately, this study provided the first step in studying the role of HMGB1 in METH- induced neuroinflammation. Because METH addiction and toxicity are increasingly becoming a bigger public health issue, studying this drug of abuse through a inflammatory point of view could provide key insights in METH addiction, and subsequently clinical usage.

ACKNOWLEDGEMENTS

This research project would not have been possible without the constant support and mentorship of my thesis advisor, Dr. Steven Maier, and direct supervisor, Dr. Matt Frank. I would also like to thank Dr. Jasmine Yap for her invaluable insights on the project and incredible support throughout this process. This honors thesis was supported by funds from the Undergraduate

Research Opportunities Program at the University of Colorado, Boulder.

23 Figure Legends

Figure 1. Schematic rendering of cellular and molecular events involved in meth-induced DA terminal degeneration and neuronal apoptosis within the striatum. The figure summarizes findings of various studies that have addressed the role of DA, oxidative stress, and other mechanisms in METH toxicity. METH enters dopaminergic neurons via DAT and passive diffusion. Within these neurons, METH enters synaptic vesicles through VMAT-2 and causes

DA release into the cytoplasm via changes in pH balance. In the cytoplasm, DA auto-oxidizes to form toxic DA quinones with generation of superoxide radicals and hydrogen peroxides via quinone cycling. Subsequent formation of hydroxyl radicals through interactions of superoxides and hydrogen peroxide with transition metals leads to oxidative stress, mitochondrial dysfunctions and peroxidative damage to presynaptic membranes. The involvement of endogenous DA in METH neurotoxicity is supported by findings that the TH inhibitor, methyl-p- tyrosine, which blocks DA synthesis, affords protection against METH toxicity. In addition, the role of DA is supported by observations that use of the MAO inhibitor, clorgyline, and of the irreversible inhibitor of vesicular transport, reserpine, which results in increases in cytoplasmic

DA levels can exacerbate METH-induced toxicity. Together, these events are thought to be partly responsible for the loss of DA terminals. DA release from the terminals is also involved because the DAT inhibitor, amphonelic acid, which blocks METH-induced DA release from DA terminals, can also prevent damage to DA axons. The toxic effects of released DA might occur through activation of DA receptors because DA receptor antagonists block degeneration of DA terminals. Interactions of DA with D1 receptors on post-synaptic membrane cause activation of various transcription factors and subsequent upregulation of death cascades in postsynaptic

24 neurons. These death cascades can be inhibited, in part, by the DA D1 antagonist; SCH23390.

(Krasnova et al., 2009).

Figure 2. Physiological mechanisms by which methamphetamine increases synaptic levels of monoamines, principally dopamine. Mechanisms include the redistribution of monoamines from synaptic vesicles to the cytosol (1), and the reverse transport of neurotransmitter through plasma membrane transporters. In addition, amphetamines have been shown to block the activity of dopamine transporters (DATs) (2), similar to cocaine, and decrease expression of dopamine transporters at the cell surface (3). Amphetamines can increase cytosolic levels of monoamines by inhibiting the activity of monoamine oxidase (MAO) (4), and increase activity and expression of tyrosine hydroxylase (5) (Paneka et al., 2013).

Figure 3. TLR4 signal transduction requires recruitment of myeloid differentiation factor 2

(MD-2) and soluble CD14 that flows in the bloodstream. The resulting complex confers an intracellular signal via the Toll/IL-1 receptor (TIR) domain that either follows a MyD88- dependent or MyD88-independent pathway. In the MyD88-dependent pathway, the resulting signal is then transduced to IL-1 receptor- associated kinases (IRAKs) that facilitate subsequent phosphorylations. These phosphorylations ultimately cause IκB-α, a cytoplasmic protein that binds the nuclear localization sequence of the p65 subunit of NF-κB, to dissociate from NF-κB.

Binding of TLR4 also activates the PI3K/Akt/NF-κB pathway. NF-κB then translocates to the nucleus to promote transcription of pro-inflammatory cytokines such as IL-1β and IL-6. TLR2 activity requires CD14 and contributes to NF-κB activation. (Gangloff et al., 2003; Shimazu et al., 1999; Zhang, 2011).

Figure 4. Cellular events associated with disease, injury, or toxicant-induced gliosis. Neural elements of the CNS (neurons or glia) serve as targets for neurotoxic insults. The damaged cells serve as a source of signals that activate microglia or astroglia, cellular responses collectively referred to as gliosis. Gliosis is characterized by the expression of a variety of glial genes and proteins. The possibility exists that neurotoxic exposures directly activate microglia and astroglia

(large downward arrow), with the en- suing elaboration of glia-derived neuroinflammatory mediators (large upward arrow) causing damage to neural targets. bFGF: basic fibroblast growth factor; FcR: Fc receptor; GDNF: glia-derived neurotrophic factor; GFAP: glial fibrillary acidic protein; GLUT: glucose transporter; HSP: heat-shock protein; ICAM: intercellular cell-adhesion molecule; iNOS: inducible nitric oxide synthase: MCP-1: monocyte chemoattractant protein

(CCL2 in new nomenclature); MHC: major histocompatibility complex; MRF: microglial response factor; NGF: nerve growth factor; TNF: tumor necrosis factor. (O’Callaghan, Sriram, &

Miller, 2008).

Figure 5. Striatal microglial cells were exposed to 0, 10, 100, 1000, 10000 ng/ml of METH for

24 hours. Il-1β mRNA expression (Figure 3A) and protein expression (Figure 3B) were measured using ELISA as a percentage of media control. An MTT Assay was performed to test cell viability, and METH failed to significantly alter cell viability (Figure 3D).

Figure 6. Twenty-four animals were given four doses of METH (0, 2.5, 5, 10 mg/kg) via acute injection. Brains were dissected two hours later and HMGB1 and IL-1β proteins levels measured

26 in NAc, PFC, and VTA. The main effect of Meth on HMGB1 protein was significant at 10 mg/kg dose regardless of the brain region (F=5.11; p=.0088), when compared to the vehicle

(Figure 4A). There was no main effect of Meth on HMGB1 when looking at brain regions independently (p=.1715), when compared to the vehicle. The main effect of meth on Il-1β was significant (F=2.374; p=.0492), when compared to the vehicle (Figure 4B).

27 Figures

28 3.

29 A. mRNA expression

250

200

150

100

% media control

IL-1Beta mRNA expression 50

0 10 100 1000 10000

METH (ng/mL)

B. Protein expression

IL-1Beta (pg/mL) 5

0 0 10 100 1000 10000

METH (ng/mL)

Figure 5

30 C. Il-1β Protein expression

IL-1 beta (pg/ml) 4

0 0 0.001 0.01 0.1 1 10

METH Concentration (mM)

D. Cell viability

120

100

20 Cell Viability (% of media control)

0 0 1 uM 10 uM 100 uM 1 mM 10 mM Meth Concentration Figure 5

31 A. HMGB1 Protein expression

5 4.5

3.5 3 * 2.5 NAcc

2 PFC 1.5 VTA 1 0.5

HMGB1 Protein (ng/mg total protein) 0 0 2.5 5 10 METH Dose (mg/kg)

B. Il-1β Protein expression

3.5 3

2.5

2 NAcc PFC 1.5 VTA 1

0.5

IL-1 beta protein (pg/mg total protein) 0 0 2.5 5 10 METH (mg/kg)

Figure 6

32 References

Albers DS, Sonsalla PK. Methamphetamine-induced hyperthermia and dopaminergic neurotoxicity in mice: pharmacological profile of protective and nonprotective agents. J. Pharmacol. Exp. Ther 1995;275:1104–1114. [PubMed: 8531070]

Aravalli, R.N., Peterson, P.K., Lokensgard, J.R., 2007. Toll-like receptors in defense and damage of the central nervous system. J. Neuroimmune Pharmacol. 2, 297– 312

Bakhit C, Morgan ME, Peat MA, Gibb JW. Long-term effects of methamphetamine on the synthesis and metabolism of 5-hydroxytryptamine in various regions of the rat brain. Neuropharmacology 1981;20:1135–1140. [PubMed: 6172742]

Barton, G.M., Kagan, J.C., 2009. A cell biological view of toll-like receptor function: regulation through compartmentalization. Nat. Rev. Immunol. 9, 535–542.

Bittner SE, Wagner GC, Aigner TG, Seiden LS. Effects of a high-dose treatment of methamphetamine on caudate dopamine and anorexia in rats. Pharmacol. Biochem. Behav 1981;14:481–486. [PubMed: 6940202]

Brown, J.M., Hanson, G.R., Fleckenstein, A.E., 2001. Regulation of the vesicular Monoamine transporter-2: a novel mechanism for cocaine and other psychostimulants. J. Pharmacol. Exp. Ther. 296, 762–767.

Brown JM, Quinton MS, Yamamoto BK. Methamphetamine-induced inhibition of Mitochondrial complex II: roles of glutamate and peroxynitrite. J. Neurochem 2005;95:429–436.[PubMed: 16086684]

Bowyer JF, Davies DL, Schmued L, Broening HW, Newport GD, Slikker W Jr, Holson RR. Further studies of the role of hyperthermia in methamphetamine neurotoxicity. J. Pharmacol. Exp. Ther 1994;268:1571–1580. [PubMed: 8138969]

Bowyer JF, Holson RR, Miller DB, O'Callaghan JP. Phenobarbital and dizocilpine can block methamphetamine-induced neurotoxicity in mice by mechanisms that are independent of thermoregulation. Brain Res 2001;919:179–183. [PubMed: 11689178]

Cappon GD, Pu C, Vorhees CV. Time-course of methamphetamine-induced neurotoxicity in rat caudate- putamen after single dose treatment. Brain Res 2000;863:106–111. [PubMed: 10773198]

Chapman DE, Hanson GR, Kesner RP, Keefe KA. Long-term changes in basal ganglia function after a neurotoxic regimen of methamphetamine. J. Pharmacol. Exp. Ther 2001;296:520 527. [PubMed: 11160639]

33 Clark KH, Wiley CA, Bradberry CW. (2013). Psychostimulants abuse and neuroinflammation: emerging evidence of their interconnection. Neurotoxicity Journal , 22(2), 174-188. doi: 10.1007/s12640-012-9334-7

Colton, C.A., 2009. Heterogeneity of microglial activation in the innate immune response in the brain. J. Neuroimmune Pharmacol. 4, 399–418.

Cubells JF, Rayport S, Rajendran G, Sulzer D. Methamphetamine neurotoxicity involves vacuolation of endocytic organelles and dopamine-dependent intracellular oxidative stress. J. Neurosci 1994;14:2260–2271. [PubMed: 8158268]

Davidson, C., Gow, A., Lee, T., & Ellinwood, E. (2001). Methamphetamine neurotoxicity: necrotic and apoptotic mechanisms and relevance to human abuse and treatment. Brain Res Brain Res Rev. ,36(1), 1-22. [PubMed: 11516769]

Eisch AJ, Gaffney M, Weihmuller FB, O'Dell SJ, Marshall JF. Striatal subregions are differentially vulnerable to the neurotoxic effects of methamphetamine. Brain Res 1992;598:321–326. [PubMed: 1486494]

Escubedo E, Guitart L, Sureda FX, Jimenez A, Pubill D, Pallas M, Camins A, Camarasa J. Microgliosis and down-regulation of adenosine transporter induced by methamphetamine in rats. Brain Res1998;814:120–126. [PubMed: 9838075]

Fukumura M, Cappon GD, Pu C, Broening HW, Vorhees CV. A single dose model of methamphetamine- induced neurotoxicity in rats: effects on neostriatal monoamines and glial fibrillary acidic protein. Brain Res 1998;806:1–7. [PubMed: 9739098]

Fleckenstein, A.E., Volz, T.J., Hanson, G.R., 2009. Psychostimulant-induced alterations in vesicular monoamine transporter-2 function: neurotoxic and therapeutic implications. Neuropharmacology 56 (Suppl. 1), 133–138.

Fleckenstein, A.E., Volz, T.J., Riddle, E.L., Gibb, J.W., Hanson, G.R., 2007. New insights into the mechanism of action of amphetamines. Annu. Rev. Pharmacol. Toxicol. 47, 681–698.

Frank, M.G., et al., Microglia serve as a neuroimmune substrate for stress-induced potentiation of CNS pro-inflammatory cytokine responses. Brain Behav Immun, 2007. 21(1).

Fumagalli F, Gainetdinov RR, Valenzano KJ, Caron MG. Role of dopamine transporter in methamphetamine-induced neurotoxicity: evidence from mice lacking the transporter. J. Neurosci 1998;18:4861–4869. [PubMed: 9634552]

Green AR, De Souza RJ, Williams JL, Murray TK, Cross AJ. The neurotoxic effects of methamphetamine on 5-hydroxytryptamine and dopamine in brain: evidence for the protective effect of chlormethiazole. Neuropharmacology 1992;31:315–321. [PubMed: 1381816]

Guilarte TR, Nihei MK, McGlothan JL, Howard AS. Methamphetamine-induced deficits of brain monoaminergic neuronal markers: distal axotomy or neuronal plasticity. Neuroscience 2003;122:499–513. [PubMed: 14614914]

Hotchkiss AJ, Morgan ME, Gibb JW. The long-term effects of multiple doses of methamphetamine on neostriatal tryptophan hydroxylase, tyrosine hydroxylase, choline acetyltransferase and glutamate decarboxylase activities. Life Sci 1979;25:1373–1378. [PubMed: 42834]

Hotchkiss AJ, Gibb JW. Long-term effects of multiple doses of methamphetamine on tryptophan hydroxylase and tyrosine hydroxylase activity in rat brain. J. Pharmacol. Exp. Ther 1980;214:257– 262. [PubMed: 6104722]

Ito M, Numachi Y, Ohara A, Sora I. Hyperthermic and lethal effects of methamphetamine: Roles of dopamine D1 and D2 receptors. Neurosci. Lett 2008;438:327–329. [PubMed: 18486343]

Janeway CA. Immunobiology. 2008.

Kahlig, K.M., Galli, A., 2003. Regulation of dopamine transporter function and plasma membrane expression by dopamine, amphetamine, and cocaine. Eur. J. Pharmacol. 479, 153–158.

Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on toll-like receptors. Nat. Immunol. 11, 373–384.

Knapp, S. et al. The long acidic tail of high mobility group box 1 (HMGB1) protein forms an extended and flexible structure that interacts with specific residues within and between the HMG boxes. Biochemistry 43, 11992–11997 (2004).

Krasnova, I., & Cadet, J. (2009). Methamphetamine neurotoxicity and messenger of death. Brain Res Rev, 60(2), 379–407. doi: doi:10.1016/j.brainresrev.2009.03.002

Krasnova, I.N., Justinova, Z., Ladenheim, B., Jayanthi, S., McCoy, M.T., Barnes, C., Warner, J.E., Goldberg, S.R., Cadet, J.L., 2010. Methamphetamine self- administration is associated with persistent biochemical alterations in striatal and cortical dopaminergic terminals in the rat. PLoS ONE 5, e8790.

Kogan FJ, Nichols WK, Gibb JW. Influence of methamphetamine on nigral and striatal tyrosine hydroxylase activity and on striatal dopamine levels. Eur. J. Pharmacol 1976;36:363 371.[PubMed: 6286]

Kono, H., & Rock, K. (2008). How dying cells alert the immune system to danger. Nat Rev Immunol., 8(4), 279-89. doi: 10.1038/nri2215

35 Koob GF, Le Moal M (2006). Neurobiology of Addiction. Academic Press: London.

Lotze MT, Tracey KJ (2005) High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat Rev Immunol 5:331–342.

Marek GJ, Vosmer G, Seiden LS. Dopamine uptake inhibitors block long-term neurotoxic effects of methamphetamine upon dopaminergic neurons. Brain Res 1990;513:274–279. [PubMed: 2140952]

Morgan ME, Gibb JW. Short-term and long-term effects of methamphetamine on biogenic amine metabolism in extra-striatal dopaminergic nuclei. Neuropharmacology 1980;19:989–995. [PubMed: 6106905]

National Institute on Drug Abuse. Drug Facts: Methamphetamine. January 2014.

Park, J. S. et al. Activation of gene expression in human neutrophils by high mobility group box 1 protein. Am. J. Physiol. Cell Physiol. 284, C870–C879 (2003).

Paneka, W., Procyshyn, R., Lecomte, T., MacEwan, G., Flynn, S., Horner, W., & Barr, A. (2012). Methamphetamine use: A comprehensive review of molecular, preclinical and clinical findings. Drug and Alcohol dependence , 129, 167-179. Retrieved from http://dx.doi.org/10.1016/j.drugalcdep.2012.11.016

Pasqualini, J. R., Sterner, R., Mercat, P. & Allfrey, V. G. Estradiol enhanced acetylation of nuclear high mobility group proteins of the uterus of newborn guinea pigs. Biochem. Biophys. Res. Commun. 161, 1260–1266 (1989).

Prendergast, P., Onate, S. A., Christensen, K. & Edwards, D. P. Nuclear accessory factors enhance the binding of progesterone receptor to specific target DNA. J. Steroid Biochem. Mol. Biol. 48, 1–13 (1994).

Pubill D, Chipana C, Camins A, Pallas M, Camarasa J, Escubedo E. Free radical production induced by methamphetamine in rat striatal synaptosomes. Toxicol. Appl. Pharmacol 2005;204:57–68. [PubMed: 15781294]

Pubill D, Verdaguer E, Sureda FX, Camins A, Pallas M, Camarasa J, Escubedo E. Carnosine prevents methamphetamine-induced gliosis but not dopamine terminal loss in rats. Eur. J. Pharmacol 2002;448:165–168. [PubMed: 12144937]

Qui, J. (2008). Early release of hmgb-1 from neurons after the onset of brain ischemia. Journal of Cerebral Blood Flow & Metabolism, 28, 27–938. doi: 10.1038/sj.jcbfm.9600582

RAND Drug Policy Research Center. The Economic Cost of Methamphetamine Use in the United States, 2005. RAND Drug Policy Research Center; 2009.

36 Richards JB, Baggott MJ, Sabol KE, Seiden LS. A high-dose methamphetamine regimen results in long- lasting deficits on performance of a reaction-time task. Brain Res 1993;627:254 260. [PubMed: 8298969]

Ricaurte GA, Schuster CR, Seiden LS. Long-term effects of repeated methylamphetamine administration on dopamine and serotonin neurons in the rat brain: a regional study. Brain Res 1980;193:153–163. [PubMed: 7378814]

Salminen, A., Huuskonen, J., Ojala, J., Kaarniranta, K., Suuronen, T., 2008. Activation of innate immunity system during aging: NF-kB signaling is the molecular culprit of aging. Ageing Res. Rev. 7, 83–105.

Schwartz, K., Weizman, A., Rehavi, M., 2006. The effect of psychostimulants on [3H]dopamine uptake and release in rat brain synaptic vesicles. J. Neural Transm. 113, 1347–1352.

Scaffidi P1, Misteli T, Bianchi ME. (2000). Release of chromatin protein hmgb1 by necrotic cells triggers inflammation. Nature, 30(467), 191-5.

Seong, S. Y. & Matzinger, P. Hydrophobicity: an ancient damage-associated molecular pattern that initiates innate immune responses. Nature Rev. Immunol. 4, 469–478 (2004).

Stros M (2010) HMGB proteins: interactions with DNA and chromatin. Biochim Biophys Acta 1799:101–113

Stros, M., Muselikova-Polanska, E., Pospisilova, S. & Strauss, F. High-affinity binding of tumor-suppressor protein p53 and HMGB1 to hemicatenated DNA loops. Biochemistry 43, 7215–7225 (2004).

Sulzer, D., Maidment, N.T., Rayport, S., 1993. Amphetamine and other weak bases act to promote reverse transport of dopamine in ventral midbrain neurons. J. Neurochem. 60, 527–535.

Truong JG, Wilkins DG, Baudys J, Crouch DJ, Johnson-Davis KL, Gibb JW, Hanson GR, Fleckenstein AE. Age-dependent methamphetamine-induced alterations in vesicular monoamine transporter-2 function: implications for neurotoxicity. J. Pharmacol. Exp. Ther 2005;314:1087–1092. [PubMed: 15901804]

United Nations Office on Drugs and Crime. World drug report volume 1. Analysis. Vienna: United Nations Office on Drugs and Crime; 2007.

Venereau, E. (2012). Mutually exclusive redox forms of hmgb1 promote cell recruitment or proinflammatory cytokine release. The Journal of Experimental Medicine, 209(9), 1519 1528. doi: 10.1084/jem.20120189

37 Wagner GC, Seiden LS, Schuster CR. Methamphetamine-induced changes in brain catecholamines in rats and guinea pigs. Drug Alcohol Depend 1979;4:435–438. [PubMed: 510182]

Wagner GC, Walsh SL. Evaluation of the effects of inhibition of monoamine oxidase and senescence on methamphetamine-induced neuronal damage. Int. J. Dev. Neurosci 1991;9:171–174. [PubMed: 1905457]

West, K. L., Castellini, M. A., Duncan, M. K. & Bustin, M. Chromosomal proteins HMGN3a and HMGN3b regulate the expression of glycine transporter 1. Mol. Cell. Biol. 24, 3747 3756 (2004).

Yamaguchi T, Kuraishi Y, Minami M, Nakai S, Hirai Y, Satoh M. Methamphetamine-induced expression of interleukin-1 beta mRNA in the rat hypothalamus. Neurosci. Lett 1991;128:90–92. [PubMed: 1922954]

Yang, H., H.S. Hreggvidsdottir, K. Palmblad, H. Wang, M. Ochani, J. Li, B. Lu, S. Chavan, M. Rosas-Ballina, Y. Al-Abed, et al. 2010. A critical cysteine is required for HMGB1 binding to Toll-like receptor 4 and activation of macrophage cytokine release. Proc. Natl. Acad. Sci. USA. 107: 11942–11947. http://dx.doi.org/10.1073/pnas.1003893107

Yang, H., P. Lundbäck, L. Ottosson, H. Erlandsson-Harris, E. Venereau, M.E. Bianchi, Y. Al Abed, U. Andersson, K.J. Tracey, and D.J. Antoine. 2012. Redox modification of cysteine residues regulates the cytokine activity of high mobility group box-1 (HMGB1). Mol. Med. 18: 250–259. http://dx.doi.org/10.2119/molmed.2011.00389

Zayed, H., Izsvak, Z., Khare, D., Heinemann, U. & Ivics, Z. The DNA-bending protein HMGB1 is a cellular cofactor of Sleeping Beauty transposition. Nucleic Acids Res. 31, 2313–2322 (2003).

Zeh, H. J. & Lotze, M. T. Addicted to death: invasive cancer and the immune response to unscheduled cell death. J. Immunother. 28, 1–9 (2005).