DISTRIBUTION, POPULATION DYNAMICS, HABITAT ASSOCIATIONS, AND THE INFLUENCE OF FOREST MANAGEMENT ON MOUNTAIN BEAVERS
Project # R2003-0123 Annual Report: March 31st, 2003
to
Principal Investigator: Douglas B. Ransome, Ph.D.
DBR Forestry-Wildlife Integrated Management 33477 1st Avenue Mission, B.C. Canada, V2V 1H1 Phone: (604) 814-2690 Email: [email protected]
FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 1
TABLE OF CONTENTS
1.0 ACKNOWLEDGEMENTS 2
2.0 EXECUTIVE SUMMARY 3
3.0 INTRODUCTION 5
4.0 METHODS 7 4.1 Overall Distribution of Aplodontia rufa 7 4.2 Demarcating the Zone of Integration Between Subspecies 9
5.0 RESULTS and DISCUSSION 11 5.1 Overall Distribution of Aplodontia rufa 11 5.1.1 Reliability of the Survey 14 5.1.2 Limits of Presence/Not Detected Surveys 15 5.2 Demarcating the Zone of Integration Between Subspecies 17 5.2.1 Subspecies Classification 17 5.2.2 Zone of Integration 18
6.0 PROJECT EVALUATION & COMPLETION IN 2003 19 6.1 Project Evaluation 19 6.2 Project Continuation in 2003/2004 21 7.0 LITURATURE CITED 22
8.0 TABLES 26
9.0 FIGURES 27
10.0 APPENDIX 1 34
11.0 APPENDIX 2 40
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 2
1.O ACKNOWLEDGEMENTS We thank the Forestry Innovation Investment (FII) Program for financial support, through FII’s Forest Research Program, and Cattermole Timber for additional financial support. We thank International Forests Products Ltd.; Ministry of Forests, Chilliwack Forest District; Cattermole Timber; Darly Kelleher; Keystone Wildlife Research; Kari Nelson (MWLAP), and Les Gyug for their valuable input and access to data bases, maps, and GIS support. Many thanks to research associates P. Lindgren, C. Zabek, and Z. Zabek for their excellent field work. Cowan Vertebrate Museum (University of British Columbia) kindly provided mountain beaver specimens for genetic analyses. Many thanks to Allyson Miscampbell and Dr. Carol Ritland (Director of the Genetic Data Centre, U.B.C.) for their excellent work with the genetic analyses. Special thanks to Paul Zakora for loaning his A. r. rainieri specimen for genetic analysis.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 3
2.0 EXECUTIVE SUMMARY
Mountain beavers (Aplodontia rufa) are the world’s most primitive living rodent and are found exclusively in North America, with Canada’s only population endemic to the southwest corner of B.C. Two subspecies of mountain beavers occur in British Columbia: the red listed A. r. rufa and blue listed A. r. rainieri. Their designation implies that they require special management of critical habitat to maintain or restore their abundance and distribution. However, we lack adequate baseline inventory information (distribution, abundance, population dynamics, and habitat associations) to determine whether B.C.’s mountain beaver population, and their habitat, are increasing, decreasing, or stable. In absence of this information it is difficult to design effective and appropriate strategies to protect their populations and critical habitat. The following knowledge gaps currently exist for mountain beavers: • Current distribution of mountain beavers, especially A. r. rufa, in B. C.; • Baseline population dynamics for mountain beavers; • The influence of forest management activities on mountain beavers; and, • Identification of critical resources required by mountain beavers. This study was designed to determine the overall distribution of mountain beavers in British Columbia and to demarcate the zone of integration between A. r. rufa and A. r. rainieri. Surveys were conducted throughout the Lower Mainland of British Columbia from January to March 2003. Presence/Not Detected surveys were performed according to the Inventory Methods for Mountain Beaver, Bushy-tailed Woodrat & Porcupine (Standards for Components of British Columbia’s Biodiversity No. 27). Greater than 281 locations were surveyed throughout the Lower Mainland of British Columbia for mountain beavers. The results from these surveys were coupled with information previously published to develop the most complete distribution maps available for mountain beavers in British Columbia. The western extent of an abundant and persistent population of mountain beavers is Sumas Mountain/Chilliwack Mountain northeast of Abbotsford and Vedder Mountain southeast of Abbotsford. No evidence
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 4
was observed of successful and permanent colonization of suitable areas north of the Fraser River. We used genetic analyses to reexamine the subspecies classification and to develop an effective tool to accurately identify individuals to the subspecies level. Fresh tissue samples (9 A. r. rufa, 1 A. r. rainieri) were collected from live-trapped individuals. The D-loop region of mitochondrial DNA of A. rufa was isolated and sequenced, a previously unsequenced region for mountain beavers. The D-loop region of A. rufa is 996-997 base pairs in length. A. r. rainieri can be distinguished from all A. r. rufa at 3 D- loop sites, while A. r. rufa form 3 distinct groups by location: Sumas subpopulation, Chilliwack subpopulation and a third group that can be found at both locations Sumas/Chilliwack subpopulation. These results would be strengthened significantly with the analysis of additional samples, especially A. r. rainieri. The Zone of Integration between the two subspecies may have been identified through surveys for sign. An extremely low abundance of mountain beavers was noted along the Silverhope Valley southeast of Hope (Silverhope Creek/Silver Skagit Road and Maselpanik Creek FSR). Extensive surveys have been conducted in this area with only 3 active nests located. An accumulation of snow prevented survey completion and the collection of tissue required for genetic confirmation that this valley may represent the Zone of Integration. The next phase of the proposed research will document the baseline population dynamics of mountain beavers and the influence that forest management activities may have on them. Previous observations have indicated that forest management activities may enhance critical habitat for this species of concern. This comprehensive investigation will provide the necessary information needed to design effective and appropriate strategies to protect their populations and critical habitat. This research will also promote how forest management and wildlife management can be integrated to benefit a species of concern.
Key Words: Aplodontia rufa, mountain beaver, distribution, species of concern, Lower Mainland, red listed, blue listed, DNA analysis, identify wildlife species
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 5
3.0 INTRODUCTION
Mountain beavers (Aplodontia rufa), a medium-sized fossorial rodent, have a general appearance of a muskrat (Ondatra zibthicus) except the tail is well furred, exceedingly short, and they have well developed claws for burrowing (Figure 1). Mountain beavers are the world’s most primitive living rodent and are found exclusively in North America, with Canada’s only population endemic to British Columbia (Carraway and Verts 1993; McGrew 1941; Taylor 1918). This distinction is based upon its primitive morphology and their inability to conserve water by concentrating urine. Two subspecies of mountain beavers occur in British Columbia: the provincially red listed A. r. rufa and blue listed A. r. rainieri (B.C. Conservation Data Centre). Both subspecies are classified federally as ‘Special Concern’ because of characteristics that make it particularly sensitive to human activities or natural events. They are also classified provincially as ‘Identified Wildlife’ (endangered, threatened, or vulnerable) because they require special management of critical habitat in order to maintain or restore their abundance and distribution. The current abundance and distribution of mountain beavers in British Columbia is poorly understood (Cannings et al. 1999; Orchard 1984). A. r. rufa is found south of the Fraser River and its range may extend from Hope to Langley in the Lower Mainland of B.C. A. r. rainieri is found east of the Fraser River and Hope, and extends west to Princeton and along the Cascade Mountains from the Canada-US border north to Merritt and Lytton. The exact geographic delineation of the species and between subspecies is poorly understood. No records confirmed their presence north or northwest of the lower Fraser River; however, unverified records of their occurrence in these areas have been noted (Cosco 1980; Gyug 2000). Furthermore, it is thought that the extent and quality of mountain beaver habitat is probably deteriorating at lower elevations due to agricultural, urban, and industrial development; however, its habitat may be improving at higher elevations due to harvesting and silvicultural practices (Gyug 2000; Nyberg pers. com. c.f. Orchard 1984). Relatively few studies on the population dynamics of mountain beavers have been conducted in North America (Carraway and Verts 1993) and none have been conducted
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 6
in Canada. Consequently, we lack adequate baseline inventory information (distribution, abundance, population dynamics, and habitat associations) to determine whether B.C.’s mountain beaver population, and its habitat, is increasing, decreasing, or stable (Cannings et al. 1999; Orchard 1984). This information is required to recommend informed management options for A. r. rufa, A. r. rainieri, and the habitats they occupy. In absence of this information it is difficult to design effective and appropriate strategies to protect their populations and critical habitat; or to direct forest operations in areas occupied by mountain beavers. This information is vital as some silvicultural practices may have the potential to enhance mountain beaver populations while increasing the amount of timber available for current and future harvest. As a result of the mountain beaver’s primitive kidney, they require large quantities of succulent vegetation, or free water, be readily available for its survival (reviewed by Carraway and Verts 1993). Therefore, as closed canopy stands are reduced in density through harvesting or silvicultural practices, more light reaches the forest floor, which stimulates understory vegetation. Mountain beavers could benefit from this enhanced forage, and populations may expand in both area and density (Cafferata 1992). Most authorities agree that populations attain peak densities in areas of early- to mid-seral stages vegetated by second-growth trees, shrubs, and forbs (Dice 1932; Hooven 1977; Scheffer 1929; Svihla and Svihla 1933). The ecology of the mountain beaver provides a unique opportunity for B.C.’s forest industry. Its designation as red and blue listed, coupled with the possibility that some harvesting and silvicultural practices have the potential to significantly enhance their abundance, provides an excellent opportunity to demonstrate how forest management can be used to enhance wildlife populations. The following knowledge gaps exist for mountain beavers: • Current distribution for both species in British Columbia; • Baseline population dynamics for mountain beavers; • The influence of forest management activities on the population dynamics of mountain beavers; and, • Identification of critical resources required by mountain beavers.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 7
This study was designed to determine the overall distribution of the mountain beaver in British Columbia and to demarcate the zone of integration between A. r. rufa and A. r. rainieri. This report outlines the progress and advancements made since the study was initiated in November 2002.
4.0 METHODS
4.1 Overall distribution of Aplodontia rufa
The distribution of mountain beavers was most efficiently established by Presence/Not Detected Sampling as recommended by Inventory Methods for Mountain Beaver, Bushy-tailed Woodrat & Porcupine (Standards for Components of British Columbia’s Biodiversity No. 27, SCBCB#27). Mountain beavers leave conspicuous sign throughout their home range. This sign consisted of numerous burrows (Figure 2), freshly clipped vegetation at the entrance of burrows (Figure 3), and numerous clipped stems adjacent entrances to burrows (Figure 4). Freshly clipped vegetation at burrow entrances was indicative of active home ranges. Mountain beavers appear to have a strong habitat association with wet or moist areas adjacent to seepage areas and small streams (Cosco 1980, Orchard 1984; Todd 1992). In addition, the highest abundance of mountain beavers appears to occur in early seral stages (Carraway and Verts 1993). Consequently, we selected areas with these characteristics to survey for mountain beaver sign (as recommended by SCBCB#27) from January to March 2003. Survey routes were established through the Abbotsford, Langley, and Aldergrove area to identify the western extent of the distribution of mountain beavers. On lands managed by the Ministry of Forests, logging roads functioned as survey routes. Wet or moist areas and early seral stages of forest development were searched for signs of mountain beaver activity. Each survey was conducted until obvious sign was noted or until a minimum of 20 minutes had elapsed. Most surveys were conducted by two observers (recommended by SCBCB#27), resulting in a minimum survey time of 40 minutes in areas where mountain beavers were absent. Due to the extent of private lands throughout this area, survey routes were limited to Municipal and Provincial parks;
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 8
municipal, provincial, and federal lands; and numerous private lands. Survey times for these areas varied with the size of the property and ranged from 20 minutes to 3 hours. Survey routes varied in elevation ranging from valley bottoms to the highest elevation possible that permitted an effective survey due to snow accumulation. Universal Transverse Mercator (UTM) coordinates were recorded for all areas surveyed with the aid of a hand-help GPS unit. Initially, 2 GPS units were used to ensure consistency in location coordinates. Surveyed areas were spaced approximately 3 to 5 km apart when possible. If the surveyed area had no evidence of mountain beaver activity, adjacent areas were surveyed. If adjacent areas had positive sign the initial area was removed from the dataset. Mountain beavers were classified as ‘present’, ‘not detected’, and ‘potential’. A general description of survey areas was recorded including: dominant vegetation, seepage areas, stand characteristics (when relevant), and species of vegetation at burrow entrances when present. The category ‘potential’ incorporated sign that varied from the classical sign left by mountain beavers, which included burrows that varied from the usual dimensions (diameter & abundance) or were not accompanied by clipped vegetation. This category may represent sign resulting from abandoned home ranges or that created by other species. The western extent of the mountain beaver’s distribution was predicted to exist between Langley and Abbotsford. This area is characterized by extensive private property through urbanization and agricultural operations. Consequently, a systematic and thorough survey throughout this region was not possible. To increase the likelihood of locating active or historic home ranges in this area, an advertisement was placed in the local paper. In addition, members of the Greater Vancouver Regional Parks and Fraser Valley Regional Parks, along with local naturalist clubs were contacted about known or historic locations of mountain beavers. All locations thought to have active mountain beavers were examined. If the habitat was atypical to that which they normally occupy, location information was not recorded. Survey routes were also established throughout the region extending from Abbotsford to Hope (pending access and depth of snow). This information was required to determine whether the distribution of mountain beavers was continuous throughout
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 9
its range or was composed of a few isolated populations. Surveys were conducted north of the Fraser River from Maple Ridge to Hope and west of the Fraser River north of Hope to determine whether the Fraser River represented the northern boundary of their distribution. Supplemental data was collected from other sources. International Forest Products Ltd. provided access (through Keystone Wildlife Research) to their wildlife survey plot information that noted the presence/not detected information for mountain beavers for numerous plots throughout three Landscape Units within the range of mountain beavers. Les Gyug (Okanagan Wildlife Consulting) provided additional information from the thorough surveys he had conducted for mountain beavers throughout the Merritt Forest District.
4.2 Demarcating the Zone of Integration Between Subspecies
The current segregation of mountain beavers into subspecies is based upon morphological analyses: cranial measurements and external morphological features (pelage colour, weight, length). However, due to individual and geographic variation, and the tendency for integration to occur between subspecies, it is nearly impossible to distinguish between A. r. rufa and A. r. rainieri by external appearance and sign (Cosco 1980). Consequently, the zone of integration between the two subspecies cannot be determined from live individuals or sign surveys. Cosco (1980) recommends basing the classification of individuals on location coupled with morphological features. However, we currently do not know where the eastern distribution of A. r. rufa ends and the western distribution of A. r. rainieri begins, thus making it impossible to classify individuals as one subspecies or the other throughout their zone of integration. Molecular techniques are useful for delineating systematic relationships among populations and subspecies (Avise 1994) and serve as an independent test of the classification based on morphological analyses. Tissues samples were collected from individual A. r. rufa live trapped from Sumas Mountain (Abbotsford, B.C.) and Cultus Lake (Chilliwack, B.C.) for genetic analyses. A. r. rainieri were live trapped from the Tulameen River area (Coalmont,
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 10
B.C.). Active home ranges were located in these areas and 2 to 5 traps were placed at burrows that appeared to be in use. Initially, doubled-door Tomahawk live-traps (Model 206 Tomahawk Live Trap Company, Tomahawk, Wisconsin) were placed at entrances to burrows or inside tunnels. Single-door Tomahawk live-traps (Model 201) were later used when the extra size provided by the 206 was deemed unnecessary. Traps were baited with rabbit chow, alfalfa cubes, and whole apple; then covered with plastic to shelter trapped individuals from the rain. Apple pieces were placed in the tunnels ahead of the traps. Traps were set in the afternoon of day one and checked on the morning of each day the traps were set. Once an individual was captured, traps were removed with as little disturbance as possible to tunnel and burrow networks. Captured individuals were transferred to a handling cone and ear-tagged, weighed and hind-foot measured when possible (Figures 1b,c). Fresh tissues and blood samples were collected from all live-trapped individuals, as well as a hair sample. Individuals were released at points of capture and additional apple was left in the burrow. Due to snow accumulation, coupled with the fact that mountain beavers nearly cease above-ground activity in winter (Caraway and Verts 1993), no A. r. rainieri individuals were captured. However, a tissue sample was collected from a road mortality from the Tulameen area. Tissue samples consisted of a small notch removed from the ear and blood was absorbed by filter paper. Tissue samples were placed in a vial containing 100% ethanol while blood samples were air-dried. Tissue samples were the most reliable source of genetic material since many individuals bled minimally from the ear notch. Tissue samples were forwarded to the Genetic Data Centre (Dept. of Forest Sciences, University of British Columbia) for analysis. Additional tissue samples were collected from specimens of known subspecies classification residing in the Cowan Vertebrate Museum (University of British Columbia). Mitochondrial primers from the D-loop region unique to each subspecies can be used to classify subspecies. The D-loop region is a small section of the DNA sequence located on mitochondrial DNA (mtDNA), comprising approximately 7% of the mitochondrial genome. This region has a particularly high mutation rate, thus scientists can analyze this relatively short sequence and still resolve differences between closely
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 11
related sequences. It is this region that is examined in mtDNA analysis for forensic purposes. However, these primers did not exist for mountain beavers. Consequently, mtDNA was isolated from tissue samples and the D-loop region was isolated and sequenced. Sequences were aligned with the ESEE version 3.2S (Cabot 1998) and searched by eye (for verification) for base differences between samples. Differences in base pairs were then grouped based upon similarity. These groups were compared to subspecies classification to determine whether the grouping based upon genetic analysis reflected subspecies classification based on morphological analyses. Appendix 1 provides a detailed description of the methodology used for the genetic analyses.
5.0 RESULTS and Discussion
5.1 Overall Distribution of Aplodontia rufa
Intensive surveys for sign have been conducted throughout the Lower Mainland from Langley eastward to the Skagit Valley and north of the Fraser River from Maple Ridge to Harrison Lake. A total of 281 locations have been classified as having sign consistent with that made by mountain beavers, no sign detected, or sign potentially made by mountain beavers (Appendix 2). Historically, only 17 locations have been documented as having positive sign of mountain beaver activity, with numerous specimens from each locale. This information was combined with that presented in other publications (Cosco 1980; Gyug 1999, 2000; Gyug, pers. com.) to generate the most complete distribution maps currently available for mountain beavers in British Columbia (Figures 5 - 7). Cosco (1980) reported that the western-most record for mountain beavers in the literature was Aldergrove, while the B.C. Provincial Museum contains a skull from the Langley area. Glen Ryder, a well known B.C. naturalist and artist, indicated that he had seen evidence of mountain beavers in Tynehead, Glen Valley, and Campbell Valley Parks in the 1960's (pers. comm.). Results from our survey supported the historic
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 12
records that the distribution of mountain beavers extended as far west as Langley. One property owner had mountain beavers on his property as recently as 20 years ago (confirmed by Wildlife Branch and SFU). Another property owner captured, and subsequently released, an individual on their property in south Langley in 2001 (confirmed through pictures of the individual). These two occurrences were the only positive ones documented during the survey in the lowlands of the Fraser Valley. Although a sporadic occurrence of mountain beavers may occur in this area, they may more accurately represent temporary inhabitants rather than a stable, persistent population. This prediction is based on the rapid rate of urbanization in these areas reducing both the amount of potentially suitable habitat and the ability for individuals to successfully disperse between suitable habitats. Furthermore, as urbanization continues, the amount of potentially suitable habitat will gradually be restricted to Regional Parks. However, these areas are primarily dominated by mature forests which provide marginal habitat for mountain beavers (Carraway and Verts 1993; Hooven 1973,1977). In these habitats, they are usually confined to openings associated with overstory mortality (Rochelle and Bunnell 1978), stream courses (Dalquest 1948; Hooven and Black 1976), road openings, and root-rot centers (pers. obs.). Observations noted during our sign surveys supported the above observations. The majority of mountain beaver sign associated with mature forests were confined to these openings. Abundance of sign decreased significantly within a few meters from these openings. Mountain beavers, although historically present, may have always maintained a low abundance in lowland areas of the Lower Mainland. They were rarely seen in the Sumas and Chilliwack valley in the early 1900s, but were common in the foothills and higher mountain habitats (reviewed by Cosco 1980 and Gyug 2000). We noted the same trend during our surveys. The abundance of sign increased substantially at higher elevations, even though suitable habitat was abundant at lower elevations. The western extent of an abundant and persistent population of mountain beavers is Sumas Mountain/Chilliwack Mountain northeast of Abbotsford and Vedder Mountain southeast of Abbotsford (Figure 6). However, the long-term persistence of
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 13
mountain beavers on Sumas Mountain and Chilliwack Mountain may be unpredictable. The lower slopes of Sumas Mountain and a large part of Chilliwack Mountain are currently being developed as residential property. These mountains are quite isolated from the larger and more-extensive population to the south (Figure 7). The ability for individuals to immigrate between these populations has been greatly reduced by development of the valley bottom. This may, in turn, explain some of the unique observations noted in the genetic analyses (Section 5.2). We did not detect evidence of mountain beavers north of the Fraser River, nor did Cosco (1980). However, Glen Ryder noted evidence of mountain beaver activity adjacent to Stave Lake, north of the Fraser River (Cosco 1980). Ryder’s observation may have represented a temporary occurrence from a single individual that dispersed northward across the Fraser River as suggested by Gyug (2000). Even though mountain beavers enter water readily and swim very well (Carraway and Verts 1993; pers. obs.), no evidence was observed of successful and permanent colonization of suitable areas north of the Fraser River. Gyug (2000) noted that mountain beaver nests became uncommon and were found in fewer and fewer areas of otherwise apparently suitable habitat as the northern and eastern limits of the range were approached. He suggested that the likelihood of establishing large populations outside the range may be low because the habitat is too dry and is probably physiologically limiting to mountain beavers. He noted the highest abundance of A. r. rainieri occurs just north of Manning Provincial Park. Plants used by mountain beavers are extremely varied, but sword fern (Polystichum munitum) constitutes the greatest proportion of their winter diet (reviewed by Carraway and Verts 1993; Cosco 1980). During our surveys sword fern was often found stored at the entrances to mountain beaver burrows. Other species found in these hay piles on the coast included: western red cedar (Thuja plicata), western hemlock (Tsuga heterophylla), and licorice fern (Polypodium glycyrrhiza). Falsebox (Paxistima myrsinites) was noted in haypiles in the interior. We noted a strong association between mountain beavers and areas dominated by salmonberry (Rubus spectabilis). Salmonberry was used heavily by mountain beavers, as indicated by the
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 14
extensive clipping of this species adjacent to their burrows. The presence of sword fern and salmonberry are indications of sites that are water-receiving and water collecting site (Klinka et al. 1989), an important characteristic of sites inhabited by mountain beavers.
5.1.1 Reliability of the Survey
The most conspicuous signs left by mountain beavers are the extensive burrowing system, clipped vegetation, and food-storage piles at burrow entrances (Figures 2 - 4). Burrows are often very numerous with as many as 10-30 entrances, and occasionally exceeding 100 entrances, within a small area (Carraway and Verts 1993). Numerous subsurface runways, 15-40 cm below the surface, connect the entrances with a variety of chambers used for nesting, latrines, and food storage (reviewed by Cosco 1980). Sections of these tunnels have often collapsed or have been eroded by water increasing the visibility of the burrowing system. Mountain beavers frequently clip lateral branches from shrub and seedling stems > ½ cm to heights of 3 m or more, leaving short projections from the main stem (Lawrence et al. 1961; Nolte and Otto 1996). This sign is concentrated around burrow entrances. In addition, clipped vegetation is occasionally stored at the entrances of burrows. Although other species leave similar sign, their sign is readily distinguishable from that left by mountain beavers. Muskrats often burrow into banks adjacent to riparian areas; however, entrances to their burrows are few in number and exit beneath the water surface (Eder and Pattie 2001). Burrows created by marmots (Marmota sp.; weight 2-7 kg) are much larger than those created by mountain beavers (weight 0.3-1.4 kg) and often have 3 or fewer entrances. Connections between burrows are above ground in well-defined trails (Frase and Hoffman 1980). Pikas (Ochotona princeps) live below ground and maintain food-storage piles at entrances; however, they do not dig burrows. Pikas are habitat specific to talus or piles of broken rock fringed by suitable vegetation. Their den sites are natural openings within the talus (Smith and Weston 1990).
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 15
The serrated oblique cut produced by mountain beavers when they feed is characteristic to all rodents and are indistinguishable from lagomorphs (Figure 4A; Lawrence et al. 1961; Sullivan undated). However, the size of the tooth marks is only consistent with that produced by mountain beavers and lagomorphs. Lagomorphs clip stems of 0.25 cm or less and damage is limited to a height of 0.5 m distinguishing this damage from that caused by mountain beavers. Snowshoe hares (Lepus americanus) often leave fecal pellets adjacent feeding sites while mountain beavers seldom defecate in areas other than their belowground latrines (Voth 1968 cited in Cafferata 1992). All locations classified as ‘Present’ had clear evidence of numerous burrows, clipped vegetation, and often contained fresh plant material at entrances to burrows. Locations classified as ‘Not detected’ had no evidence of these signs. Three points were classified as ‘potential’ as the sign varied from the classical sign describes above. These locations had 1 - 3 burrows (low number) and adjacent to riparian areas but lacked evidence of clipped vegetation or hay piles. These sites may have represented abandoned home ranges, recently established home ranges, or sign left by other species. Traps were placed at two of these locations but no individuals were captured. The classification of one of these locations was changed to ‘Not Detected’. The second location was left as ‘potential’ since fecal pellets were recently observed in the entrance. Since mountain beavers leave unique and conspicuous sign, presence/not detected surveys base on sign are quite reliable and can be used to accurately delineate their distribution.
5.1.2 Limits of Presence/Not Detected Surveys
Mountain beavers are solitary animals but will aggregate together if enough suitable habitat is available. Home ranges vary from 0.03 to 0.3 ha in size with individuals moving less than 45 m during general activity patterns (Martin 1971). Even though mountain beavers leave conspicuous sign, it is restricted to a small area.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 16
Consequently, individual home ranges may have been missed during the surveys. In areas of greater importance, lowlands of the Lower Mainland and north of the Fraser River, a greater amount of time was spent searching for mountain beaver sign. Often the time was sufficient to examine a large majority of the suitable habitat (municipal lands, private residences, and regional parks). The surveys were conducted during the winter when very little vegetation existed to obscure mountain beaver sign if present. However, individual home ranges could have been overlooked. The western extent of the mountain beaver’s distribution was predicted to exist between Langley and Abbotsford (Cosco 1980; Gyug 1999, 2000). This area is characterized by extensive private property, urbanization and agricultural operations. Consequently, a systematic and thorough survey throughout this region was not possible. Individuals may inhabit some of these private lands. Individuals may immigrate into areas that they currently have not been detected in. One individual, located at the junction of Zero Avenue and 230 Avenue, Langley appeared in a residence’s garden in summer 2001. In all probability it originated from the undeveloped lands south of Zero Avenue (Washington, USA). Campbell Valley Regional Park (216 Ave and 4th Ave, Langley) is approximately 2 km north of Zero Avenue. This park contained mountain beavers in the 1960s (Glen Ryder, pers. comm.). Similarly, a private residence between Zero Avenue and the park contained mountain beavers as early as 20 years ago. Aldergrove Lake Regional Park (272 Ave. and Zero Ave. Aldergrove) is immediately adjacent to Zero Ave. Potentially, individuals from the undeveloped lands in northern Washington USA may immigrate to suitable habitats in south Langley, south Aldergrove, or south Abbotsford. For the reason state above, the term ‘Not Detected’ may be better interpreted as indicating a very low abundance and does not represent a stable or persistent subpopulation over time. It should not be interpreted to mean mountain beavers are absent from an area.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 17
5.2 Demarcating the Zone of Integration Between Subspecies
5.2.1 Subspecies Classification
Initially, (reviewed by Cosco 1980) mountain beavers in British Columbia were classified as one subspecies (1862 - A. leporine; 1886 - A. rufa). In 1916, 2 subspecies were thought to occur in B.C., until 1929, when their distribution was changed again to reflect one subspecies (A. r. rainieri). In 1945, two subspecies were once again recognized, and are currently accepted in British Columbia; A. r. rufa and A. r. rainieri. This classification is based upon morphological analyses: cranial measurements and external morphological features (pelage colour, weight, length). Cosco (1980) examined the morphological differences between the two subspecies using museum specimens. He found that A. r. rainieri, on average, was slightly larger than A. r. rufa; however, the ranges in measurements overlapped. He concluded that due to individual and geographic variation and the tendency for integration to occur between subspecies, it is nearly impossible to distinguish between races by general appearance. We used genetic analysis to reexamine their subspecies classification and to develop an effective tool to accurately identify individuals to the subspecies level. Blood and ear tissue samples were collected from 25 individuals (24 A. r. rufa and 1 A. r. rainieri; Table 1) representing 2 subspecies. In addition, tissue samples from 6 museum specimens (1 A. r. rufa and 5 A. r. rainieri) were collected and submitted for analyses. The preliminary analysis was initiated with the first 10 fresh tissue samples collected: 9 A. r. rufa, and 1 A. r. rainieri. The following is a summary of the DNA analyses (Appendix 1). The D-loop region of mitochondrial DNA of A. rufa was isolated and sequenced, a previously unsequenced region for mountain beavers. Only 9 of the 10 tissue samples amplified, the 10th sample was not used. The D-loop region of A. rufa is 996-997 base pairs in length (Figure 2 in Appendix 1). Ten primers have been identified that can be combined and compared to segregate subspecies (highlighted and numbered 1-10; Figure 2 in Appendix 1). The individual A. r. rainieri can be
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 18
distinguished from all A. r. rufa at 3 D-loop sites (sites 4, 5, & 8; Table 2 in Appendix 1), while A. r. rufa form 3 distinct groups by location: Sumas haplotype (SRU), Chilliwack haplotype (CRU) and a third group that can be found at both locations Sumas/Chilliwack haplotype (CSR). The variation between these three groups is greater than that between A. r. rufa and A. r. rainieri. In summary, A. r. rainieri appears to be readily distinguishable from A. r. rufa through DNA analysis (based on one individual) and there may be 3 unique ecotypes or subpopulations within A. r. rufa. One of these subpopulations is limited to Sumas Mountain (northeast of Abbotsford, Figure 7). However, more individuals from each subspecies and subpopulation, especially A. r. rainieri, should be analyzed to better establish a pattern of genetic variation within A. rufa. The remaining 15 samples, plus those collected from the museum specimens, are currently being analyzed.
5.2.2 Zone of Integration
Historically, mountain beaver specimens have not been collected from a relatively large area extending from Chilliwack to Manning Park. Consequently, morphological analyses have not been conducted on individuals from this region. It is in this region that the transition between subspecies occurs. Cosco (1980) suggested that the boundary between subspecies occurs just west of Manning Park. Gyug (2000) recommended additional specimens be collected from this area and examined to clarify the nature and location of the subspecies boundary. Surveys for mountain beaver sign were initiated in the area suggested by Cosco (1980) and Gyug (2000): that is, along the Wahleach Creek/Jones Creek FSR, Silverhope Creek/Silver Skagit Road, and Maselpanik Creek FSR just west of the Skagit Valley Recreation Area. Live traps were also established at these locations and pre-baited for tissue collection and subsequent DNA analyses. Heavy snowfall delayed a more-detailed survey of these areas, as well as tissue collection. However, a significant reduction in mountain beaver sign was noted along the Silverhope Creek/Silver Skagit Road and Maselpanik Creek FSR (Figure 6 and 7). Only a few
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 19
sites along this valley had characteristics similar to other locations inhabited by mountain beavers. After 3 days of surveys, only two locations contained evidence of mountain beaver activity. These sites were prebaited for tissue collection. International Forest Products Ltd provided their wildlife survey plot information (provided by Keystone Wildlife Research), that included mountain beaver sign, collected along this valley. This information (plotted on Figures 5 - 7) supported our findings of a significant reduction in the abundance of mountain beavers in this valley. The extreme slope of the eastern side of this valley (Figure 7), coupled with the very low abundance of suitable habitat throughout the valley, may have established a geographic barrier between subspecies. However, current surveys have only been completed to the junction of Silver-Skagit Road and Maselpanik Creek FSR. It is unknown whether this trend continues to the US border and if so, along which drainage: Maselpanik Creek or Silver-Skagit Road (Klesilkwa River) in the Skagit Valley Recreation Area. In addition, tissue samples must be collected from individuals in this valley and the adjacent valleys east and west, for DNA analyses. Assisted by DNA analyses, conclusive evidence will be available to confirm or reject the hypothesis that the transition between subspecies occurs in this valley.
6.0 PROJECT EVALUATION & COMPLETION IN 2003
6.1 Project evaluation
The key objective outlined for this phase of the project was the determination of the current distribution of A. r. rufa and A. r. rainieri in British Columbia. Key outcomes expected by March 31st, 2003 were:
1. Delineate the western and northern boundary of mountain beavers,
2. Determine whether A. r. rufa and A. r. rainieri can be distinguished from one another based upon DNA sequence data.
Outcomes that were expected by March 31st, 2003 + 2 additional budget cycles were:
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 20
3. Demarcation of the overall distribution of mountain beavers in B.C.,
4. Demarcation of the Zone of Integration between A. r. rufa and A. r. rainieri.
The first 3 deliverables have been completed and significant advancement has been made in completing deliverable 4. A summary for each deliverable follows.
The delineation of the western and northern extent of the distribution for mountain beavers has been completed and is shown on Figures 5 - 7. No evidence of mountain beavers was noted north of the Fraser River. The western extent of an abundant and persistent population of mountain beavers is Sumas Mountain/Chilliwack Mountain northeast of Abbotsford and Vedder Mountain southeast of Abbotsford (Figure 6). Due to heavy snow accumulation, surveys for mountain beaver sign could not be completed in 2 key areas, the 1st being the Skagit Valley Recreational Area - Maselpanik Creek FSR. Information from this area is required to confirm the low abundance of mountain beavers throughout this valley (possible zone of integration). Additional surveys in the 2nd area, Chilliwack Lake area, would yield complete coverage of the range primarily occupied by A. r. rufa, the red listed species. The additional surveys would require 1 to 1.5 weeks field work, during the snow-free period. Preliminary genetic analyses indicated that A. r. rainieri could be distinguished from all A. r. rufa. However, given the variability and existence of three identifiable populations within A. r. rufa, and only one tissue sample for A. r. rainieri, this deliverable would be strengthened significantly by analyses of additional samples. The most difficult objective, with respect to the genetic analysis, was to identify reliable genetic markers that can be used to distinguish between the two subspecies. This information was not previously available. Now that these genetic markers have been identified, classifying individuals as one subspecies (or ecotype) or the other is relatively inexpensive ($25-30/individual). Demarcation of the overall distribution of mountain beavers in B.C. has been completed (Figure 5). The information collected during this project was combined with that presented in other publications/surveys (INTERFOR, Cosco 1980; Gyug 1999,
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 21
2000; Gyug, pers. com.) to generate the most complete distribution maps currently available for mountain beavers in British Columbia (Figures 5 - 7).
Finally, significant advancement has been made towards demarcating the Zone of Integration between A. r. rufa and A. r. rainieri. To confirm whether the Silver-Skagit Road, and possibly the Maselpanik Creek FSR, represents the zone of transition between subspecies, live trapping, coupled with tissue collection, should be conducted along this valley and the valleys to the east and west. Genetic analyses should confirm whether this hypothesis is correct. The additional surveys and tissue collection would require 2 weeks fieldwork to complete, during the snow-free period.
6.2 Project Continuation in 2003/2004
Mountain beavers are listed as Special Concern by COSEWIC while provincially the 2 subspecies are red listed and blue listed. However, there is uncertainty in the reliability of the current knowledge base used to direct decisions concerning this species of concern. The following knowledge gaps exist for mountain beavers: • Current distribution for both species in British Columbia; • Baseline population dynamics for mountain beavers; • The influence of forest management activities on the population dynamics of mountain beavers; and, • Identification of critical resources required by mountain beavers.
We lack adequate baseline inventory information (distribution, abundance, population dynamics, and habitat associations) to determine whether B.C.’s mountain beaver population, and its habitat, is increasing, decreasing, or stable (Orchard 1984). This information is critical to designing effective policies aimed at maintaining or enhancing populations of mountain beavers and the habitat they require. The current research addressed one of the key uncertainties: the distribution of mountain beavers in B.C. This information will form the benchmark to determine whether their future distribution has expanded or contracted.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 22
The next phase of the proposed research will document the baseline population dynamics of mountain beavers and the influence that forest management activities may have on them. Most authorities agree that populations attain peak densities in areas of early- to mid-seral stages vegetated by second-growth trees, shrubs, and forbs. These observations indicate that the influence of forest management activities may enhance critical habitat for this species of concern. Addressing all knowledge gaps for mountain beavers will provide the information needed to develop effective and efficient policies that will ensure the continued presence of this unique species. In addition, this information will help direct forest management operations that may be used to enhance critical habitat for this species.
7.0 LITURATURE CITED
Avise J. C. 1994. Molecular markers, natural history and evolution. Chapman Hall, N. York.
Cabot, E. 1998. ESEE: Eyeball sequence editor, version 3.2. Distributed by E. Cabot, Department of Biological Sciences, Simon Fraser University, Vancouver, BC. Canada.
Cafferata, S. L. 1992. Mountain beavers. Pages 231-252 in H. C. Black, Ed. Silvicultural approaches to animal damage management in Pacific Northwest forests. Gen. Tech. Rep. PNW-GTR-287. Portland, OR., US Dep. Agric., For. Serv., PNW Research Station.
Cannings, S. G., L. R. Ramsay, D. F. Fraser, and M. A. Fraker. 1999. Rare amphibians, reptiles, and mammals of British Columbia. Wildlife Branch and Resource Inventory Branch, B.C. Ministry of Environment, Lands, and Parks, Victoria B.C.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 23
Carraway, L. N., and B. J. Verts. 1993. Aplodontia rufa. Mammalian Species, No. 431: 1-10.
Cosco, J. 1980. Mountain beaver (Aplodontia rufa): its biology and implications to forestry in British Columbia. B.S.F. Thesis, Faculty of Forestry, University of British Columbia.
Dalquest, W. W., and V. B. Scheffer. 1948. The systematic status of the races of the mountain beaver Aplodontia rufa in Washington. The Murrelet 25:34-37.
Dice, L. R. 1932. Mammals collected by F. M. Gaige in 1919 at Lake Cushman and vicinity, Olympic Peninsula, Washington. The Murrelet, 13:47-49.
Eder, T., and D. Pattie. 2001. Mammals of British Columbia. Lone Pine Publishing, Vancouver, B.C., Canada.
Frase, B. A., and R. S. Hoffmann. 1980. Marmota flaviventris. Mammalian Species. No. 135.
Gyug, L. W. 1999. COSEWIC status report on mountain beavers (Aplodontia rufa). Committee on the Status of Endangered Wildlife in Canada, Ottawa, Ont. 23 pp.
Gyug, L. W. 2000. Status, distribution, and biology of the Mountain Beaver, Aplodontia rufa, in Canada. Canadian Field Naturalist, 114:476-490.
Hooven, E. F. 1973. A wildlife brief for the clearcut logging of Douglas-fir. Journal of Forestry, 71(4).
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 24
Hooven, E. F. 1977. The mountain beaver in Oregon: its life history and control. Oregon State University, Forest Research Laboratory, Research Paper, 30:1- 20.
Hooven, E. F, and H. C. Black. 1976. Effects of some clearcutting practices on small mammal populations in western Oregon. Northwest Science, 50:187-200.
Klinka, K., V. J. Krajina, A. Ceska, and A. M. Scagel. 1989. Indicator plants of coastal British Columbia. University of British Columbia Press, Vancouver, B.C.
Lawrence, W. H., N. B. Kverno, and H. D. Hartwell. 1961. Guide to wildlife feeding injuries on conifers in the Pacific Northwest. Western Forestry and Conservation Association, Portland Oregon.
Martin, P. 1971. Movements and activities of the mountain beaver (Aplodontia rufa). Journal of Mammalogy, 52:717-753.
McGrew, P. O. 1941. The Aplondontoidea. Geology Series, Field Museum of Natural History 9:1-30.
Nolte, D. L., and I. J. Otto. 1996. Materials and supplies for management of wildlife damage to trees. USDA For. Serv. Missoula Techn. & Develop. Cent., Missoula, MT. Tech. Rep 9624-2808-MTDC.
Orchard, S. 1984. Status report on the mountain beaver, Aplodontia rufa. Committee on the Status of Endangered Wildlife in Canada.
Rochelle, J. A., and F. L. Bunnell. 1979. Plant management and vertebrate wildlife. Pp. 389-411 in E. W. Ford, D. C. Malcolm, and J. Atterson, eds. The ecology of even aged forest plantations. Inst. of Terrestrial Ecology, UK.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 25
Scheffer, T. H. 1929. Mountain beavers in the Pacific Northwest, their habits, economic status, and control. U.S. Dept. of Agriculture, Farmer’s Bulletin 1598.
Smith, A. T., and M. L. Weston. 1990. Ochotona princeps. Mammalian Species. No. 352.
Sullivan, T. P. Undated. Identification and management of wildlife damage in forests of the Pacific Northwest. Applied Mammal Research Inst. Summerland, B.C. Canada.
Svihla, A., and R. D. Svihla. 1933. Mammals of Clallam County, Washington. The Murrelet, 14:37-41.
Todd, P. A. 1992. Mountain beaver habitat use and management implications in Yosemite National Park. Natural Areas Journal, 12:26-31.
Taylor, W. P. 1918. Revision of the rodent genus Aplodontia. University of California Publication in Zoology, 17:435-504.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 26
8.0 TABLES
Table 1. Location, weight, and hind-foot length (HFL) of Aplodontia rufa rufa live trapped in the Lower Mainland of British Columbia, Dec. 2002 – Mar. 2003.
Species # Location UTMN UTME Weight (kg) HFL (mm)
6337 Sumas Mnt 5440126 559353 0.80 35.29 6349 Sumas Mnt 5439622 560220 0.71 35.90 6366 Sumas Mnt 5439622 560220 0.74 36.22 6388 Sumas Mnt 5440126 559353 1.05 33.28 6340 Tamahi FSR 5435447 586711 1.13 37.14 6341 Parminter FSR 5436834 572841 1.17 35.43 6342 Tamahi FSR 5435189 588919 1.06 35.31 6343 Tamahi FSR 5435447 586711 0.82 23.05 6345 Tamahi FSR 5435189 588919 1.18 36.85 7301 A. r. rainieri near Princeton – road mortality 6177 Sumas Mnt 5439783 560866 1.20 35.14 6164 Straiton Rd 5436948 555593 0.80 34.54 6168 Sumas Mnt 5439795 562205 0.95 33.45 6162 Sumas Mnt 5439783 560866 0.95 35.51 S01 Sumas Mnt 5440007 561166 0.67 - S02 Sumas Mnt 5440504 561901 1.05 - 6346 Chilliwack Mnt 5445272 571566 0.77 - 6347 Chilliwack Mnt 5445094 571909 1.10 - 6179 Chipmunk Crk 5440679 598196 1.06 - 6181 Vedder Mnt 5436661 571881 0.93 - 6170 Parminter FSR 5436834 572841 0.79 - 6175 Vedder Mnt 5432686 567924 0.99 - 3333 Chipmunk Crk 5444025 595022 1.04 - 9999 Chipmunk Crk 5444573 595319 0.85 - JL01 Jones Lake 5461201 600382 ? 37.39
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 27
9.0 FIGURES
Figure 1. Photographs of mountain beavers (Aplodontia rufa rufa) showing the general appearance of the species, including: A) a well furred, exceedingly short tail, B) well developed claws for burrowing, and C) size of an individual being weighed. Note stand characteristics in background. (Photos A & C by D. Blevins1)
Figure 2. Photograph of burrows constructed by mountain beavers. A burrow system may have as many as 10-30 entrances with some exceeding 100/0.5 ha. (Photo by Dale Steele2).
Figure 3. Photograph of clipped vegetation at the entrance of burrows constructed by mountain beavers (Photograph by Dale Steele).
Figure 4. Photograph of clipped vegetation adjacent burrows constructed by mountain beavers. Photo A shows the multiple diagonal cuts made by mountain beavers resulting in an serrated oblique cut characteristic of rodents (Photo by D. Blevins). Mountain beavers frequently clip lateral branches from stems > ½ cm to heights of 3 m or more, leaving short projections from the main stem, distinguishing this damage from that caused by hares and rabbits (Photo B; Lawrence et al. 1961; Nolte and Otto 1996).
Figure 5. Distribution of mountain beavers, Aplodontia rufa, in British Columbia, Canada.
Figure 6. Distribution of mountain beavers, Aplodontia rufa, in the Lower Mainland of British Columbia, Canada.
Figure 7. Distribution of mountain beavers, Aplodontia rufa, in the Lower Mainland of British Columbia, Canada with hillshade imagery.
1 Photos used with permission; Please obtain permission before use: David Blevins
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 28
A.
B.
C.
Figure 1.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 29
Figure 2.
Figure 3.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 30
A. B.
Figure 4.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 31
Figure 5.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 32
Figure 6
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 33
Figure 7.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 34
10.0 Appendix 1
Preliminary report on the Genetic Analyses for Mountain Beaver Project:
Objectives: To use molecular sequencing techniques to differentiate two subspecies of Mountain beaver, Aplodontia rufa rufa and A. rufa rainieri, in British Columbia.
Materials and Methods: DNA isolation: Blood and ear clip tissue samples were collected from 10 individuals representing 2 subspecies of Mountain beaver during January 2003 (Table 1). We isolated DNA from 10 individuals from ear clips only, according to standard proteinase K enzyme/phenol: chloroform extraction methods; 0.01-0.05g tissue was incubated in STE buffer (0.1M Tris, 50mM EDTA, 100mM NaCl, 1% SDS) and proteinase K enzyme (20 mg/ml) at 54 oC for 24 hours, then DNA was extracted with phenol and chloroform and precipitated with ethanol (Sambrook et al 1989).
Primer design: Since specific mitochondrial primers in the D-loop region for Aplodontia rufa do not exist, we designed these primers for this study. We first aligned mitochondrial DNA (mtDNA) sequences spanning the cytochrome b and 12S RNA genes, including tRNAs and the mtDNA control region (D-loop), of Sciurus vulgaris and Rattus norvegicus (Genbank database accession numbers NC002369 and X14848) and the cytochrome b and 12S RNA genes of A. rufa (accession numbers AJ389528 and AJ389541). Primers targeting the D-loop of A. rufa were designed in the conserved genes (ie. cytochrome b and 12 S RNA) flanking this more variable mtDNA region (see Figure 1). Alignment of these two other rodent species in addition to A. rufa allowed the design of primer sequences specific only to A. rufa. These primers (CYTBARF- GCCAGTTGAATACCCATTTATTGC and 12SAR2R- GCATTTTCACTGGGGCGAGGAGT) amplified the entire D-loop. We used D-loop sequences obtained from A. rufa rufa to design internal primers (DLP5ARF- CCATAAAACTCTACCTTCACTG and DLP3ARRb-
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 35
GATTGTGGGGGATAAGAGGTACTG) to amplify and confirm sequences from both the 5’ and 3’ directions.
Polymerase chain reaction (PCR): PCR amplification was performed in 20ul reactions containing 50ng DNA, 20 pmol of each primer, 0.2 mM each dNTP, 1X reaction buffer
(10X buffer =100mM Tris-HCl, 15mM MgCl2, 500 mM KCl) and 1 U Taq polymerase. PCR conditions consisted of one cycle of 5 min at 94oC, followed by 45 cycles of 45s at 94oC, 45s at 58oC, 45s at 72oC and one cycle of 5 min at 72oC.
Sequencing: Sequences were generated using SequiTherm Excel II DNA sequencing kits (Epicentre®) and the products were electrophoresed in 6% polyacrylamide gel on a LI-COR 4200 automated sequencer (Lincoln, NB).
Sequence comparison: Sequences were aligned with the ESEE version 3.2S program (Cabot 1998) and searched by eye for base differences between the samples. The ends of the D-loop region were determined by comparison with mtDNA sequences of A. rufa (cytochrome b and 12S genes), squirrel and rat (cytochrome b and 12S genes, tRNAs and D-loop sequences).
Results: The D-loop of A. rufa is 996-997bp in length (Figure 2). Comparison of DNA sequences obtained from 9 individuals (sample number 6343 did not amplify even after 4 trials) revealed 10 variable sites within Aplodontia rufa. This suggests the individuals examined in this study form 4 distinct mtDNA groups (haplotypes) (Table 2). Aplodontia rufa raineri (RRA) can be distinguished from all A. rufa rufa at 3 D-loop sites, while A. rufa rufa form 3 separate groups by location: Chilliwack/Sumas (CSR) including individuals 6366, 6341 and 6345, Chilliwack (CRU) including 6340 and 6342, and Sumas (SRU) including 6337, 6349, 6388. There is more variation within A. rufa rufa (e.g. CRU and CSR differ at 7 of the 10 variable sites) than between A. r. rainieri and some A. rufa rufa (e.g. RRA and CSR differ at only 4 sites). We believe with many more
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 36
samples for each subspecies we can be more confident about the separation of these subspecies and possibly identifying ecotypes.
Future research: The small sample size for this study was the result of unseasonable weather limiting access to the study sites and the reclusive nature of mountain beavers. Genetic analysis of more individuals from all populations, especially A. rufa raineiri, is necessary to better establish a pattern of genetic variation within A. rufa. Our primary goal was to distinguish between A. rufa rufa and A. rufa rainieri, therefore our efforts were focused on the fresh tissue collected from the current study area. Obtaining DNA from museum specimen tissue samples could allow further comparison of A. rufa subspecies. Great care in DNA isolation and analysis must be taken if museum specimens are used as there is a higher risk of DNA degradation and human contamination with this tissue.
Recommendations for future research leading from these preliminary results include: 1) More samples (up to 20/population) and populations (up to 10) per subspecies will be analysed using D-loop sequences. 2) Data will be used to resolve phylogenetic relationships between, and possibly within, populations. This increases the likelihood that unique subspecies differences will be found to support the differences already identified here. 3) Other useful genetic markers such as cross species microsatellites (e.g. from Sciuridae) and possible AFLP markers will be tested and applied to the question of genetic differences between A. rufa rufa and A. rufa rainieri.
References:
Cabot, E. 1998. ESEE: Eyeball sequence editor, version 3.2. Distributed by E. Cabot, Department of Biological Sciences, Simon Fraser University, Vancouver, BC. Canada.
DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 37
Sambrook, J. Fritsch, E.F. Maniatus, T. 1989. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbour Laboratory Press. NY, New York.
primer A>
cytochrome b Thr Pro D-loop Phe 12S RNA Figure 1. Mitochondrial DNA regions examined in this study. Primers designed in the conserved cytochrome b gene region (primer A=CYTBARF) and 12S RNA gene region (primer B= 12SAR2R) amplified 996-997 bp of the more variable D-loop region in A. rufa subspecies. DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 38 Cytochrome b> CCATTTATTGCTATTGGTCAACTGGCCTCTATCTTATATTTCCTCTTGATCCTTTTTTATAATACCACTTACT Thr> AGTCTAATAGAAGATAAACTCCTAAAATGATAGTCCTGATAGTATACTTATTACCCCGGTCTTGTAAACC Pro> GGAAATGGAGACTAAGCCTCCTCAAGACAAATTCAGGGAAGAAATTAACATTCCACCGTCAACTCCCAA Dloop> AGCTGATATTCTATTTTAAACTACTCCCTGATTCACTAATCTATAATATTTAATTTTTATTGGGTAT 2 GTATATCGTGCATTAATGCACCACCACATGAATATCATGTATATACTAAATATTCTTAATAGTACATAGTA 9 CATATTATGTATATAGTACATTAACCCCCCCCTCCCCCCGCATATAAGCCAGGCCACAACATCCATAATA 3 4 5 CCCATAAACCATAAAACTCTACCTTCACTGAAACTTCTCTTCCAATCGGATAAGCTTTTCCCCTCATCATT 10 CTTACAGTACATAGCACATTAATTCATATATCGTACATACCCCATTTTAGTCATAGTAAGTCCTTGTCCAA ATGACTATCCTCCTCCAACCGTGGTCTCTTAATCTACCACCCTCCGTGAAACCATCAACCCGCCCAATACG TGTCCCTCTTCTTGACCTGATCCCATACAATCTTGGGGGTAGCTACCCTCGTACTTCATCAGACATCTGGT TCCTACCTCAGGGCCATTAATGCGTTATCGCCCATACGTTCCCCTTAAATAAGACATCACGATGGATTAGT TACTAATCAGCCCATGCTCACACATAACTGAACTGTCATACCTGTGGTAGGTTTTTTTTTGGGGGGATGCT TCCACTCAGCATTGGCCGTCAAAGGCCCCGTCGCAGTCAACCCAATTGTAGCTGGACTTATAAGTCACCT TTCTTTCTCCTCAAGTTTCTACCATGGTGCATATATATTCATGTTTTGGGACCAGAAATTTGCCAATACAG 7 8 AAATCATACATGACTTTTTTTTTTCCTTAAAAATATTTTTTTTATTTTTCTTATATAGAGATCCTTTATCTTG 1 ACTCTTATATCAGTACCTCTTATCCCCCACAATCAACTCCTCAAAATATAGACATTTCACCTGACACGAAT 6 AGAGAATTTCTACTTACCTGTCAGTTATGATACTTACATAATACTCCTACTTAATCAACCCATATAAGATG Phe> TCCGAGTACATAAATTATCACCTCACATTTGCAACTCGTTAATGTAGCTTAATCTAAAGCAAAGCA CTGAAAATGCTTAGATGGGTATTTTAG Figure 2. Mitochondrial DNA sequence obtained in this study from A. rufa rufa, spanning the cytochrome b gene (partial sequence), threonine (Thr) and proline tRNA genes, D-loop, and phenylalanine (Phe) tRNA gene (partial sequence). Shaded areas with numbers indicate variable sites found within the D-loop of A. rufa. DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 39 Table 1. Mountain beaver samples collected for DNA sequence analysis. 1. ID Location Species Tissue Type 6337 Sumas R.R Aplodontia rufa rufa live, ear clip + blood 6340 Sumas Upper B A. rufa rufa live, ear clip + blood 6341 Sumas Upper A A. rufa rufa live, ear clip + blood 6342 Sumas A. rufa rufa live, ear clip + blood 6343 Chilliwack Riv. #1 A. rufa rufa live, ear clip + blood 6345 (Chilliwack) A. rufa rufa live, ear clip + blood 6349 (Chilliwack) A. rufa rufa live, ear clip + blood 6366 (Chilliwack) A. rufa rufa live, ear clip + blood 6388 (Chilliwack) A. rufa rufa live, ear clip + blood 7301 Near Princeton, BC A. rufa rainieri roadkill, ear clip Table 2. Variable sites found in the mtDNA D-loop of two Mountain beaver subspecies. 2. D Location Species 1 2 3 4 5 6 7 8 9 10 Group* 6337 Sumas R.R Aplodontia rufa rufa C C C T T C T T C T SRU 6349 Sumas Upper B A. rufa rufa C C C T T C T T C T SRU 6366 Sumas Upper A A. rufa rufa C T T T T T T T C C CSR 6388 Sumas A. rufa rufa C C C T T C T T C T SRU 6340 Chilliwack Riv. #1 A. rufa rufa T C C T T C _ T T T CRU 6341 (Chilliwack) A. rufa rufa C T T T T T T T C C CSR 6342 (Chilliwack) A. rufa rufa T C C T T C _ T T T CRU 6343 (Chilliwack) A. rufa rufa T ** 6345 (Chilliwack) A. rufa rufa C T T T T T T T C C CSR 7301 Near Princeton, BC A. rufa rainieri C T T C C C T A C C RRA *SRU: Sumas A. rufa rufa CSR: Chilliwack/Sumas A. rufa rufa CRU: Chilliwack A. rufa rufa RRA: A. rufa rainieri **6343 entire D-loop did not amplify, only internal D-loop (site 10) available DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 40 11.0 Appendix 2 ID # UTM_ZONE UTM_E UTM_N P/ND SOURCE DATE LOCATION MB1108 10 612145 5489919 A INTERFOR 00/08 - 01/07 Yale MB1109 10 610142 5488679 A INTERFOR 00/08 - 01/08 Yale MB1110 10 612121 5485891 A INTERFOR 00/08 - 01/09 Yale MB1111 10 614643 5485567 A INTERFOR 00/08 - 01/10 Yale MB1112 10 614513 5486147 A INTERFOR 00/08 - 01/11 Yale MB1113 10 613286 5484771 A INTERFOR 00/08 - 01/12 Yale MB1114 10 611562 5484649 A INTERFOR 00/08 - 01/13 Yale MB1115 10 611922 5484594 A INTERFOR 00/08 - 01/14 Yale MB1116 10 611842 5484604 A INTERFOR 00/08 - 01/15 Yale MB1117 10 611807 5484349 A INTERFOR 00/08 - 01/16 Yale MB1118 10 612258 5484694 A INTERFOR 00/08 - 01/17 Yale MB1119 10 612238 5484829 A INTERFOR 00/08 - 01/18 Yale MB1120 10 608209 5479515 A INTERFOR 00/08 - 01/19 Yale MB1121 10 608469 5479750 A INTERFOR 00/08 - 01/20 Yale MB1122 10 608649 5479826 A INTERFOR 00/08 - 01/21 Yale MB1123 10 605660 5479468 A INTERFOR 00/08 - 01/22 Yale MB1124 10 606345 5481526 A INTERFOR 00/08 - 01/23 Yale MB1125 10 611714 5481759 A INTERFOR 00/08 - 01/24 Yale MB1126 10 560220 5439622 P DBR 2002-12 Sumas Mountain MB1127 10 560220 5439622 P DBR 2002-12 Sumas Mountain MB1128 10 559353 5440126 P DBR 2002-12 Sumas Mountain MB1129 10 559374 5440080 P DBR 2002-12 Sumas Mountain MB1130 10 559374 5440080 P DBR 2002-12 Sumas Mountain MB1131 10 586711 5435447 P DBR 2002-12 Chilliwack, Tamahi FSR MB1132 10 586711 5435447 P DBR 2002-12 Chilliwack, Tamahi FSR MB1133 10 588919 5435189 P DBR 2002-12 Chilliwack, Tamahi FSR MB1134 10 588919 5435189 P DBR 2002-12 Chilliwack, Tamahi FSR MB1135 10 572841 5436834 P DBR 2002-12 Cultus Lake - Parminter MB1136 10 666706 5486431 P DBR 2002-12 Coalmont, B.C MB1137 10 657015 5490103 P DBR 2002-12 Tulameen, B.C. MB1138 10 658052 5490148 P DBR 2002-12 Tulameen, B.C. MB1139 10 649182 5485637 P DBR 2002-12 Tulameen, B.C. MB1140 10 651010 5487170 P DBR 2002-12 Tulameen, B.C. MB1141 10 523141 5429528 A DBR 2003-01-07 Peace Arch Golf Course MB1142 10 531581 5438184 A DBR 2003-01-15 Dieter Blum MB1143 10 529564 5449634 A DBR 2003-01-15 Derby Reach Regional Park MB1144 10 523262 5437931 A DBR 2003-01-16 High Knoll Park MB1145 10 534553 5443126 A DBR 2003-01-15 Ponder Park MB1146 10 531629 5441236 A DBR 2003-01-16 Robert Williams Park MB1147 10 525511 5429791 A DBR 2003-01-16/30 Campbell Valley Park DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 41 MB1148 10 530946 5427803 P DBR 2003-01-25 Utendales - zero Ave MB1149 10 526258 5428006 H DBR 2003-02-18 116-210th St. Langley MB1150 10 555593 5436948 P DBR 2003-02-05 Sumas Mnt. Straiton Road MB1151 10 556025 5437108 P DBR 2003-01-29 Sumas Mnt, Straiton Road MB1152 10 525511 5429791 A DBR 2003-01-30 Campbell Valley Park MB1153 10 539055 5428921 A DBR 2003-01-31 Aldergrove Park MB1154 10 596329 5432489 P DBR 2003-02-03 Chilliwack Sleese FSR MB1155 10 596503 5433435 P DBR 2003-02-03 Chilliwack Sleese FSR MB1156 10 597272 5432720 P DBR 2003-02-03 Chilliwack Sleese FSR MB1157 10 596203 5434975 A DBR 2003-02-03 Chilliwack Sleese FSR MB1158 10 592543 5433804 A DBR 2003-02-03 Chilliwack Sleese FSR MB1159 10 593863 5435008 P DBR 2003-02-03 Chilliwack Sleese FSR MB1160 10 594764 5436125 A DBR 2003-02-03 Chilliwack Sleese FSR MB1161 10 572374 5445532 P DBR 2003-02-05 Chilliwack Mountain RD MB1162 10 571887 5445287 P DBR 2003-02-05 Chilliwack Mountain RD MB1163 10 571136 5445193 P DBR 2003-02-05 Chilliwack Mountain RD MB1164 10 571427 5445598 P DBR 2003-02-05 Chilliwack Mountain RD MB1165 10 571477 5445352 P DBR 2003-02-05 Chilliwack Mountain RD MB1166 10 570378 5445011 P DBR 2003-02-05 Chilliwack Mountain RD MB1167 10 570084 5444895 P DBR 2003-02-05 Chilliwack Mountain RD MB1168 10 569843 5443609 A DBR 2003-02-05 Chilliwack Mountain RD MB1169 10 565995 5442457 A DBR 2003-02-05 Dyke west of Chilliwack Mn MB1170 10 566616 5440843 A DBR 2003-02-05 Industrial Rd/Way, Chilliwack MB1171 10 560311 5434442 A DBR 2003-02-05 Vedder Canal MB1172 10 557871 5436665 A DBR 2003-02-05 Access to new subdivision MB1173 10 557268 5437464 P DBR 2003-02-05 Dawson Road - Sumas Mnt. MB1174 10 558861 5440226 P DBR 2003-02-06 Sumas Mnt. MB1175 10 560164 5440550 P DBR 2003-02-06 Sumas Mnt. - Brown Rd MB1176 10 559863 5439956 P DBR 2003-02-06 Sumas Mnt. MB1177 10 560977 5440503 P DBR 2003-02-06 Sumas Mnt. MB1178 10 561417 5440283 P DBR 2003-02-06 Sumas Mnt. MB1179 10 560797 5440449 P DBR 2003-02-06 Sumas Mnt. MB1180 10 561332 5440108 P DBR 2003-02-06 Sumas Mnt. MB1181 10 561817 5440102 P DBR 2003-02-06 Sumas Mnt MB1182 10 562280 5440158 P DBR 2003-02-06 Sumas Mnt. MB1183 10 562036 5440585 P DBR 2003-02-06 Sumas Mnt. MB1184 10 561492 5440828 P DBR 2003-02-06 Sumas Mnt. MB1185 10 562472 5440665 P DBR 2003-02-06 Sumas Mnt MB1186 10 563342 5440907 P DBR 2003-02-06 Sumas Mnt. Top MB1187 10 563371 5441150 P DBR 2003-02-06 Sumas Mnt. Top MB1188 10 571881 5436661 P DBR 2003-02-07 Vedder Mnt. Eastward MB1189 10 569252 5434531 P DBR 2003-02-07 Vedder Mnt. Eastward MB1190 10 567924 5432686 P DBR 2003-02-07 Vedder Mnt. Eastward DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 42 MB1191 10 567209 5431544 P DBR 2003-02-07 Vedder Mnt. Eastward MB1192 10 569910 5432970 P DBR 2003-02-07 Vedder Mnt. Eastward MB1193 10 572940 5435532 P DBR 2003-02-07 Vedder Mnt. Eastward MB1194 10 573283 5431833 P DBR 2003-02-07 Cultus Lake - Along highway MB1195 10 571295 5429741 P DBR 2003-02-07 Cultus Lake - Frost Rd. MB1196 10 571214 5431505 P DBR 2003-02-07 Cultus Lake - highway MB1197 10 566414 5429447 P DBR 2003-02-07 Cultus Lake - Columbia Valley MB1198 10 584850 5435522 A DBR 2003-02-07 Cultus Lake - Liumchen FSR MB1199 10 586002 5435102 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1200 10 586494 5432006 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1201 10 588572 5429672 A DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1202 10 588918 5429637 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1203 10 590784 5428471 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1204 10 592299 5425681 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1205 10 582200 5436057 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1206 10 582723 5435845 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1207 10 583434 5435261 P DBR 2003-02-09 Cultus Lake - Liumchen FSR MB1208 10 579214 5448606 A DBR 2003-02-18 Chilliwack - Hope River Road MB1209 10 578763 5448358 A DBR 2003-02-18 Chilliwack - Hope River Road MB1210 10 578939 5448425 A DBR 2003-02-18 Chilliwack - Hope River Road MB1211 10 563862 5429511 A DBR 2003-02-18 Abbotsford south MB1212 10 584814 5436643 A DBR 2003-02-19 Chilliwack - Sleese FSR MB1213 10 586138 5437354 A DBR 2003-02-19 Chilliwack - Army FSR MB1214 10 589014 5438075 P DBR 2003-02-19 Chilliwack - Mnt Thurston FSR MB1215 10 585672 5439693 P DBR 2003-02-19 Chilliwack - Mnt Thurston FSR MB1216 10 590013 5437586 P DBR 2003-02-19 Chilliwack - Mnt Thurston FSR MB1217 10 591226 5437613 P DBR 2003-02-19 Chilliwack - Mnt Thurston FSR MB1218 10 598196 5440679 P DBR 2003-02-19 Chipmunk Creek FSR MB1219 10 597319 5441691 P DBR 2003-02-19 Chipmunk Creek FSR MB1220 10 596775 5442256 P DBR 2003-02-19 Chipmunk Creek FSR MB1221 10 595022 5444025 P DBR 2003-02-19 Chipmunk Creek FSR MB1222 10 594347 5444504 P DBR 2003-02-19 Chipmunk Creek FSR MB1223 10 595319 5444573 P DBR 2003-02-19 Chipmunk Creek FSR MB1224 10 584735 5439565 P DBR 2003-02-19 Chipmunk Creek FSR MB1225 10 601055 5437633 P DBR 2003-02-20 Chilliwack - Centre Creek FSR MB1226 10 600811 5438074 P DBR 2003-02-20 Chilliwack - Centre Creek FSR MB1227 10 619008 5434682 A DBR 2003-02-20 Chilliwack - Centre Creek FSR MB1228 10 592154 5447973 P DBR 2003-02-21 Bridal Falls FSR MB1229 10 590214 5448058 A DBR 2003-02-21 Bridal Falls - Short Rd. MB1230 10 592043 5447487 P DBR 2003-02-21 Bridal Falls FSR MB1231 10 591148 5447390 P DBR 2003-02-21 Bridal Falls FSR MB1232 10 592349 5447265 P DBR 2003-02-21 Bridal Falls FSR MB1233 10 600154 5462977 P DBR 2003-02-21 Jones Lake Rd. MB1234 10 600424 5461148 P DBR 2003-02-21 Jones Lake Rd. MB1235 10 600762 5458613 P DBR 2003-02-21 Jones Lake Rd. DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 43 MB1236 10 601619 5455049 P DBR 2003-02-21 Jones Lake Rd. MB1237 10 601706 5457160 P DBR 2003-02-21 Jones Lake Rd. MB1238 10 557836 5442862 A DBR 2003-02-27 Mission - Fraser River MB1239 10 561558 5449947 A DBR 2003-02-27 Mission, Norris Creek MB1240 10 560116 5450109 A DBR 2003-02-27 Mission, Norris Creek MB1241 10 566562 5457724 A DBR 2003-02-27 Mission, Norris Creek MB1242 10 566734 5458364 A DBR 2003-02-27 Mission, Norris Creek MB1243 10 618193 5454000 A DBR 2003-02-28 Silverhope - Silver Skait FSR MB1244 10 619183 5449017 A DBR 2003-02-28 Silverhope - Hicks Creek FSR MB1245 10 621033 5447931 A DBR 2003-02-28 Silverhope - Hicks Creek FSR MB1246 10 620841 5444697 A DBR 2003-02-28 Upper Silver Hope Creek FSR MB1247 10 625628 5443549 A DBR 2003-02-28 Upper Silver Hope Creek FSR MB1248 10 633625 5442137 A DBR 2003-02-28 Upper Silver Hope Creek FSR MB1249 10 624349 5444903 A DBR 2003-02-28 Upper Silver Hope Creek FSR MB1250 10 620061 5448725 A DBR 2003-03-04 Maselpanik Creek FSR MB1251 10 627297 5441028 A DBR 2003-03-04 Maselpanik Creek FSR MB1252 10 627406 5441524 A DBR 2003-03-04 Maselpanik Creek FSR MB1253 10 627634 5442230 A DBR 2003-03-04 Maselpanik Creek FSR MB1254 10 627573 5443050 A DBR 2003-03-04 Maselpanik Creek FSR MB1255 10 566249 5460600 A DBR 2003-03-06 Mission, Norris Creek MB1256 10 542032 5448262 A DBR 2003-03-10 Mission - Rolly/Hatzic Lake MB1257 10 543218 5449682 A DBR 2003-03-10 Mission - Rolly/Hatzic Lake MB1258 10 545129 5453960 A DBR 2003-03-10 Mission - Rolly/Hatzic Lake MB1259 10 546569 5453545 A DBR 2003-03-10 Mission - Florence FSR MB1260 10 546047 5456053 A DBR 2003-03-10 Mission - Florence FSR MB1261 10 543309 5456716 A DBR 2003-03-10 Mission - Florence FSR MB1262 10 562205 5439795 P DBR 2003-03-11 Sumas MB1263 10 571705 5451645 A DBR 2003-02-20 Lake Errock MB1264 10 587310 5454477 A DBR 2003-02-20 Agassiz MB1265 10 588083 5452779 A DBR 2003-02-20 Agassiz MB1266 10 588667 5450716 A DBR 2003-02-20 Agassiz MB1267 10 592544 5454871 A DBR 2003-02-20 Glen Mnt. MB1268 10 598208 5464365 A DBR 2003-02-20 Seabird Island MB1269 10 572413 5451461 A DBR 2003-02-20 Harrison Hill MB1270 10 572317 5452089 A DBR 2003-02-20 Harrison Hill MB1271 10 551841 5452240 A DBR 2003-02-20 Bear Mnt MB1272 10 551439 5452101 A DBR 2003-02-20 Bear Mnt MB1273 10 592666 5467507 A DBR 2003-02-25 Harrison MB1274 10 594228 5468846 A DBR 2003-02-25 Harrison MB1275 10 590714 5472660 A DBR 2003-02-25 Harrison MB1276 10 589239 5484566 A DBR 2003-02-25 Harrison MB1277 10 589943 5480826 A DBR 2003-02-25 Harrison MB1278 10 589821 5481673 A DBR 2003-02-25 Harrison MB1279 10 615379 5464713 A DBR 2003-03-05 Silverhope DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 44 MB1280 10 614329 5465286 A DBR 2003-03-05 Silverhope MB1281 10 613542 5466455 A DBR 2003-03-05 Silverhope MB1282 10 616432 5461184 A DBR 2003-03-05 Silverhope MB1283 10 617068 5456123 A DBR 2003-03-05 Silverhope MB1284 10 622198 5447022 A DBR 2003-03-05 Silverhope MB1285 10 627293 5441027 P DBR 2003-03-05 Silverhope MB1286 10 548649 5451010 A DBR 2003-03-06 Mission MB1287 10 548953 5451517 A DBR 2003-03-06 Mission MB1288 10 548264 5449516 A DBR 2003-03-06 Mission MB1289 10 547608 5450131 A DBR 2003-03-06 Mission MB1290 10 552489 5451461 A DBR 2003-03-06 Mission MB1291 10 552161 5455170 A DBR 2003-03-06 Mission MB1292 10 546643 5453462 A DBR 2003-03-10 Stave Lake MB1293 10 544810 5456516 A DBR 2003-03-10 Stave Lake MB1294 10 543434 5456847 A DBR 2003-03-10 Stave Lake MB1295 10 543561 5457068 A DBR 2003-03-10 Stave Lake MB1296 10 544194 5457136 A DBR 2003-03-10 Stave Lake MB1297 10 544549 5457548 A DBR 2003-03-10 Stave Lake MB1298 10 544839 5457276 A DBR 2003-03-10 Stave Lake MB1299 10 545854 5458772 A DBR 2003-03-10 Stave Lake MB1300 10 546072 5458451 A DBR 2003-03-10 Stave Lake MB1301 10 547141 5459458 A DBR 2003-03-10 Stave Lake MB1302 10 548794 5468450 A DBR 2003-03-10 Stave Lake MB1303 10 549708 5469751 A DBR 2003-03-10 Stave Lake MB1304 10 580027 5454030 A DBR 2003-03-11 Harrison - Kent MB1305 10 581261 5454936 A DBR 2003-03-11 Harrison - Kent MB1306 10 581654 5455657 A DBR 2003-03-11 Harrison - Kent MB1307 10 571909 5445094 P DBR 2003-03-11 Chilliwack Mnt MB1308 10 571479 5445124 P DBR 2003-03-11 Chilliwack Mnt MB1309 10 571566 5445272 P DBR 2003-03-12 Chilliwack Mnt MB1310 10 551244 5432661 A DBR 2003-03-12 Abbotsford MB1311 10 552082 5430869 A DBR 2003-03-12 Abbotsford MB1312 10 550190 5433909 ? DBR 2003-03-12 Abbotsford MB1313 10 571566 5445272 P DBR 2003-03-13 Chilliwack Mnt MB1314 10 571909 5445094 P DBR 2003-03-13 Chilliwack Mnt MB1315 10 617326 5455557 A INTERFOR 2001-05 to 08 Silverhope MB1316 10 617725 5454490 A INTERFOR 2001-05 to 08 Silverhope MB1317 10 618045 5453607 A INTERFOR 2001-05 to 08 Silverhope MB1318 10 618454 5452729 A INTERFOR 2001-05 to 08 Silverhope MB1319 10 618726 5451474 A INTERFOR 2001-05 to 08 Silverhope MB1320 10 618949 5450995 A INTERFOR 2001-05 to 08 Silverhope MB1321 10 618832 5451011 A INTERFOR 2001-05 to 08 Silverhope MB1322 10 616051 5454398 A INTERFOR 2001-05 to 08 Silverhope MB1323 10 616786 5453160 A INTERFOR 2001-05 to 08 Silverhope DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 45 MB1324 10 617596 5453582 A INTERFOR 2001-05 to 08 Silverhope MB1325 10 624214 5444620 A INTERFOR 2001-05 to 08 Silverhope MB1326 10 623324 5445191 A INTERFOR 2001-05 to 08 Silverhope MB1327 10 624329 5444105 A INTERFOR 2001-05 to 08 Silverhope MB1328 10 614353 5465074 A INTERFOR 2001-05 to 08 Silverhope MB1329 10 622825 5444210 A INTERFOR 2001-05 to 08 Silverhope MB1330 10 622936 5444496 A INTERFOR 2001-05 to 08 Silverhope MB1331 10 618168 5447441 A INTERFOR 2001-05 to 08 Silverhope MB1332 10 618228 5447401 A INTERFOR 2001-05 to 08 Silverhope MB1333 10 618411 5442567 A INTERFOR 2001-05 to 08 Silverhope MB1334 10 618353 5442249 A INTERFOR 2001-05 to 08 Silverhope MB1335 10 618419 5442187 A INTERFOR 2001-05 to 08 Silverhope MB1336 10 618537 5441997 A INTERFOR 2001-05 to 08 Silverhope MB1337 10 618071 5441382 A INTERFOR 2001-05 to 08 Silverhope MB1338 10 621214 5446861 A INTERFOR 2001-05 to 08 Silverhope MB1339 10 621369 5446646 A INTERFOR 2001-05 to 08 Silverhope MB1340 10 618582 5448485 A INTERFOR 2001-05 to 08 Silverhope MB1341 10 618287 5448414 A INTERFOR 2001-05 to 08 Silverhope MB1342 10 621476 5446472 A INTERFOR 2001-05 to 08 Silverhope MB1343 10 621916 5446381 A INTERFOR 2001-05 to 08 Silverhope MB1344 10 621816 5446391 A INTERFOR 2001-05 to 08 Silverhope MB1345 10 621716 5446437 A INTERFOR 2001-05 to 08 Silverhope MB1346 10 621801 5446076 A INTERFOR 2001-05 to 08 Silverhope MB1347 10 621896 5446056 A INTERFOR 2001-05 to 08 Silverhope MB1348 10 620935 5447897 A INTERFOR 2001-05 to 08 Silverhope MB1349 10 609751 5468252 A INTERFOR 2001-05 to 08 Silverhope MB1350 10 618212 5437624 A INTERFOR 2001-05 to 08 Silverhope MB1351 10 618354 5437903 A INTERFOR 2001-05 to 08 Silverhope MB1352 10 618574 5439355 A INTERFOR 2001-05 to 08 Silverhope MB1353 10 617708 5439051 A INTERFOR 2001-05 to 08 Silverhope MB1354 10 617578 5439302 A INTERFOR 2001-05 to 08 Silverhope MB1355 10 617579 5439869 A INTERFOR 2001-05 to 08 Silverhope MB1356 10 616860 5457529 A INTERFOR 2001-05 to 08 Silverhope MB1357 10 616723 5458026 A INTERFOR 2001-05 to 08 Silverhope MB1358 10 616773 5459718 A INTERFOR 2001-05 to 08 Silverhope MB1359 10 616810 5459301 A INTERFOR 2001-05 to 08 Silverhope MB1360 10 616723 5460296 A INTERFOR 2001-05 to 08 Silverhope MB1361 10 610741 5451651 A INTERFOR 2001-05 to 08 Silverhope MB1362 10 626922 5437744 A INTERFOR 2001-05 to 08 Manning MB1363 10 626876 5438019 A INTERFOR 2001-05 to 08 Manning MB1364 10 610753 5452662 A INTERFOR 2001-05 to 08 Silverhope MB1365 10 626721 5439278 A INTERFOR 2001-05 to 08 Manning MB1366 10 626832 5443255 A INTERFOR 2001-05 to 08 Manning MB1367 10 626735 5443026 A INTERFOR 2001-05 to 08 Manning MB1368 10 628525 5443364 A INTERFOR 2001-05 to 08 Manning DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices FII Project # R2003-0123: Distribution, Population Dynamics, … Mountain Beavers. 46 MB1369 10 623119 5445144 A INTERFOR 2001-05 to 08 Silverhope MB1370 10 622816 5444930 A INTERFOR 2001-05 to 08 Silverhope MB1371 10 627474 5443497 A INTERFOR 2001-05 to 08 Manning MB1372 10 627474 5443562 A INTERFOR 2001-05 to 08 Manning MB1373 10 613225 5457198 A INTERFOR 2001-05 to 08 Silverhope MB1374 10 618740 5452090 A INTERFOR 2001-05 to 08 Silverhope MB1375 10 616680 5457530 A INTERFOR 2001-05 to 08 Silverhope MB1376 10 615750 5452120 A INTERFOR 2001-05 to 08 Silverhope MB1377 10 620070 5448608 A INTERFOR 2001-05 to 08 Silverhope MB1378 10 621960 5447340 A INTERFOR 2001-05 to 08 Silverhope MB1379 10 623050 5445060 A INTERFOR 2001-05 to 08 Silverhope MB1380 10 622520 5445900 A INTERFOR 2001-05 to 08 Silverhope MB1381 10 612300 5466620 A INTERFOR 2001-05 to 08 Silverhope MB1382 10 613420 5465680 A INTERFOR 2001-05 to 08 Silverhope MB1383 10 615650 5463750 A INTERFOR 2001-05 to 08 Silverhope MB1384 10 532127 5431629 ? DBR 2002-01-29 Langley MB1385 10 531500 5458000 A DBR 2003-03015 Maple Ridge MB1386 10 531500 5463000 A DBR 2003-03-15 Maple Ridge DBR FORESTRY-WILDLIFE INTEGRATED MANAGEMENT Researching and Integrating Wildlife- and Forest-Management Practices