Molecular Characterization and Pathological Studies of Brucella Species in Naturally Infected Animals

MOLECULAR CHARACTERIZATION AND PATHOLOGICAL STUDIES OF BRUCELLA SPECIES IN NATURALLY INFECTED ANIMALS

Asim Shahzad M. Phil. Pathology

Thesis submitted in partial fulfillment of the requirements for the award of the degree of

DOCTOR OF PHILOSOPHY

PATHOLOGY

DEPARTMENT OF PATHOLOGY FACULTY OF VETERINARY SCIENCE UNIVERSITY OF AGRICULTURE FAISALABAD PAKISTAN 2017

DECLARATION

I hereby declare that the contents of the Thesis ―Molecular characterization and pathological studies of Brucella species in naturally infected animals‖ are a product of my own research and no part has been copied from any published source (except the references, standard mathematical or genetic models/ equations/ formulate/ protocols etc.). I further declare that this work has not been submitted for the award of any other diploma/degree. The University may take action if the information provided is found inaccurate at any stage. (In case of any default the scholar will be proceeded against as per HEC plagiarism policy).

Asim Shahzad Reg. No. 2004-ag-1642 Department of Pathology, University of Agriculture, Faisalabad.

iii

Dedication

I would love to dedicate this manuscript to my loved ones: my loving family, mentors, special friends and loves of my life. All

are truly the bright stars in my life.

ACKNOWLEDGEMENTS

All praises and humble thanks to ALMIGHTY ALLAH, The Creator of the universe, the most Generous, the most Compassionate whose blessings and exaltations flourished my thoughts, hose praise cannot be expressed even if oceans turn into ink and all of the trees become pawns. "He, 'Who is (Beneficent and 'Merciful 'Whose Blessings enabled me to complete this study. Countless salutations to the Holy Prophet Hazrat Muhammad (PBUH), "the city of knowledge", 'Who is forever a model of guidance and knowledge for humanity. 'Who has guided his "Ummah" to seek the knowledge from the cradle to grave". I feel great pleasure to express my gratitude to my honorable research supervisor Prof. Dr. Ahrar Khan, Department of Pathology for His able guidance, dynamic supervision, enlightening views for this study, inventive teaching, polite behavior and valuable suggestions throughout the course of my studies and research work. I do not have words in my command to thank the members of my supervisory committee Prof. Dr. M. Zargham Khan, Department of Pathology and Dr. Muhammad Saqib, Department of Clinical Medicine and Surgery for their kind, sympathetic behavior, valuable suggestions, technical guidance and keen interest during the course of my research work. I express my profound sense of appreciation to Prof. Dr. Muhammad Tariq Javed, Professor Department of Pathology for his technical guidance and constructive criticism during the course of my study. I am so thankful to Dr. Shafia Tehseen Gul Assistant Professor, Dr. M. Kashif Saleemi Assistant Professor and Dr. Farzana Rizivi Associate Professor for their kind support and encouragement throughout the research. Friends are asset of life, especially when they work together. A sense of special and sincere thanks and appreciation is own to my friends for their support, encouragement and untiring affectionate behavior in my research and thesis work. MY special gratitude to Senior and Junior students for their cooperation and contribution to my research work. I also record my thanks to Lab assistants for providing cooperation and assistance. Last but not least a gooey tribute to my beloved and ever affectionate Family for their moral support and countless prayers throughout the course of my study. My word's fail to give credit to my Parents whose prayers, Cove, patience, sacrifice, encouragement and spiritual inspiration was a great source of motivation for the quest of knowledge at every stage of my education. My success is reality fruit of my parent’s derailed-prayers. I am greatly indebted and submit my earnest thanks to them, they had potentially tolerated agony and all miseries.

Asim Shahzad

LIST OF TABLES

Table TITLE PAGE No No 2.1 Prevalence of brucellosis in livestock in neighboring countries 23 3.1 Sampling plan to detect Brucella species in different animal species from 47 different districts of Punjab, Pakistan 3.2 List of primer pairs for the detection and differentiation of Brucella 54 species 3.3 Tissue processing protocol for histopathology 55 3.4 Detailed procedures of H&E staining protocols for histopathology 56 4.1 Overall prevalence of brucellosis in livestock species of Punjab Pakistan 61 4.2 Prevalence of brucellosis in cattle in different regions of Punjab Pakistan 61 4.3 Prevalence of brucellosis in relation to their sex in cattle of Punjab 62 Pakistan 4.4 Prevalence of brucellosis in relation to their age in cattle of Punjab 62 Pakistan 4.5 Prevalence of brucellosis in relation to their history of reproductive 62 disorders in cows of Punjab Pakistan 4.6 Prevalence of brucellosis in relation to their pregnancy status in cows of 65 Punjab Pakistan 4.7 Prevalence of brucellosis in relation to their parity number in cows of 65 Punjab Pakistan 4.8 Prevalence of brucellosis in relation to their regions in buffalo of Punjab 67 Pakistan 4.9 Prevalence of brucellosis in relation to their sex in buffalo of Punjab 67 Pakistan 4.10 Prevalence of brucellosis in relation to their age in buffalo of Punjab 69 Pakistan 4.11 Prevalence of brucellosis in relation to their history of reproductive 69 disorders in buffalo of Punjab Pakistan 4.12 Prevalence of brucellosis in relation to their pregnancy status in buffalo of 72 Punjab Pakistan 4.13 Prevalence of brucellosis in relation to their parity number in buffalo of 72 Punjab Pakistan 4.14 Prevalence of brucellosis in relation to their regions in camel of Punjab 77 Pakistan 4.15 Prevalence of brucellosis in relation to their sex in camel of Punjab 77 Pakistan 4.16 Prevalence of brucellosis in relation to their age in camel of Punjab 78 Pakistan 4.17 Prevalence of brucellosis in relation to their Health in camel of Punjab 78

vii

Pakistan 4.18 Prevalence of brucellosis in relation to their pregnancy status in camel of 79 Punjab Pakistan 4.19 Prevalence of brucellosis in relation to their parity number in camel of 79 Punjab Pakistan 4.20 Summary of results of conventional PCR for brucellosis 81 4.21 Summary of results of Real time PCR for brucellosis 82

viii

LIST OF PLATES

Plate TITLE PAGE No No 2.1 Global distribution of Brucella abortus (OIE, 2015) 24 2.2 Global distribution of Brucella melitensis (OIE, 2015) 24 3.1 Map of Punjab, Pakistan showing sampling plan to detect Brucella 48 species in different animal species from different districts 4.1 Photograph of selected samples positive for Brucella 81 4.2 Photograph of selected samples positive for Brucella species 81 4.3 Amplification Plots of RT-PCR for Brucella genus 82 4.4 Amplification Plots of RT-PCR for Brucella abortus 82 4.5 The evolutionary trends of Brucella isolates (PAK-CAMEL, Brucella 84 PAK-CATTLE1, PAK-CATTLE2, PAK-BUFFALO1 and PAK- BUFFALO2) are represented by the Neighbor-Joining method (Saitou and Nei, 1987) conducted with MEGA7 (Kumar et al., 2016). The evolutionary distance is estimated with Tamura 3-parameter method (Tamura, 1992). 4.6 Multiple sequence alignment of BCSP31 performed with the ClustalW 85 program (http://www.ebi.ac.uk). The identical sequences are shown by asterisks at the top 4.7 I-TASSER based predicted structure of BCSP31 protein. 86 4.8 Detection of the organism from the blood of experimental goats 88 4.9 Detection of the organism from the different organs in experimental 88 goats 4.10 Photomicrograph of lungs of goat infected with B. melitensis showing 89 thickened alveolar walls (arrow), emphysema (E) and alveoli‘s filled with fibrinous exudate (arrow head) 4.11 Photomicrograph of lungs of goat infected with B. melitensis showing 89 Emphysema (E), fibrinous exudate (asterisk) and infiltration of inflammatory cells (arrow) 4.12 Photomicrograph of lungs of goat infected with B. melitensis showing 90 Fibrinous exudate (asterisk), alveoli filled with RBCs and polymorphonuclear neutrophil (Arrow) 4.13 Photomicrograph of lungs of goat infected with B. melitensis showing 90 thickened and hemorrhagic pleural walls 4.14 Photomicrograph of liver of goat infected with B. melitensis showing 91 cloudy swelling (arrow), collapsed sinusoidal spaces and individual cell necrosis of hepatocytes (arrow head) 4.15 Photomicrograph of liver of goat infected with B. melitensis showing 91 Hemorrhages around the central vein (C) and mild mononuclear cell infiltration (I) 4.16 Photomicrograph of liver of goat infected with B. melitensis showing 92 areas of necrosis (N), hemorrhages and mild mononuclear cell

infiltration (I) 4.17 Photomicrograph of liver of goat infected with B. melitensis showing 92 multiple degenerating areas and active von kupffer cells 4.18 Photomicrograph of kidneys of goat infected with B. melitensis 93 showing Necrosis with infiltration of granular and multilobed cells in glomeruli (arrow) and tubules with pretentious material (P) 4.19 Photomicrograph of kidneys of goat infected with B. melitensis 93 showing mild to moderate congestion (C) of medullary area 4.20 Photomicrograph of spleen of goat infected with B. melitensis showing 94 red pulp filled with lymphocytes, macrophages and plenty of RBC‘s 4.21 Photomicrograph of spleen of goat infected with B. melitensis showing 94 hyperplasia of the many germinal follicles, proliferation of the cells with lightly stained cytoplasm and increased population of macrophages 4.22 Photomicrograph of uterus of goat infected with B. melitensis showing 95 Necrotic debris comprised of intense inflammatory infiltrate (arrow), dead tissue 4.23 Photomicrograph of uterus of goat infected with B. melitensis showing 95 multiple foci of degenerating areas specifically below the epithelium

ABSTRACT

Brucellosis is a globally distributed zoonotic problem mostly spreads by ingestion of unpasteurized dairy products of farm animals and human. It mimics many illnesses and presents difficulties in diagnosis. In livestock, it results in reduced productivity, abortion, weak offspring and is a major impediment for the trade. Almost all domestic species are affected. The aim of the present study was to know the prevalence of brucellosis, determination of associated factors and to detect the species of Brucella involved in the local areas in food animals including cattle, buffalo, sheep, goats and camel. For this purpose, 3590 serum samples were collected from various private livestock farms from throughout the Punjab. Rose Bengal plate test (RBPT) was used for initial screening and then samples positive for Brucella antibodies were subjected to Competitive Enzyme Linked Immunosorbent Assay (c-ELISA). The seroprevalence of brucellosis were determined in relation to age, sex, parity number and number of lactation. Thus the data collected was interpreted and subjected to statistical analysis. DNA was extracted from c-ELISA positive serum samples and analyzed by conventional polymerase chain reaction (c-PCR) and Real Time (RT-PCR) using genus and species specific primers. Phylogenetic analysis of the positive amplicons was carried out to check strain/DNA homology. Experimental infection was induced in goats (n=8) to study the gross and histo-pathological changes in different organs. Results showed overall sero-prevalence of brucellosis in livestock species as 13.56% and 12.55% respectively through RBPT and cELISA. Highest sero-prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. Out of 423 samples analyzed through conventional PCR 13.71% (n=58) of samples were positive for Brucella genus. Among these, 10.87% (n=46) were detected positive for Brucella abortus and 0.23% (n=1) was detected as Brucella melitensis. The rest of the samples 2.60 (n=11) could not be speciated. The sequences were aligned with reported sequences in NCBI GeneBank and revealed 100% sequence homology with BCSP-31 genes of Brucella reported from other parts of the world. In experimental studies granulomatous lesions with pneumonia were observed in the lungs. Histopathologically, lesions are generalized, affecting various organs and not limited to reproductive organs only.

CHAPTER 1

INTRODUCTION

Brucellosis is an infectious and highly contagious disease that affects humans and numerous animal species. The significance of disease is very high as it has zoonotic importance (Liu et al., 2014). The genus Brucella is Gram negative, facultative intracellular, non-motile, non-sporulating and coccobacilli in shape (Osman et al., 2016). High degree of DNA homology (>90%) has been observed among members of Brucella genus. The species of the genus Brucella includes B. abortus (primarily infects cattle, buffalo, camel, horses and human), B. melitensis (sheep, goat and human), B. suis (swine and human), B. canis (dogs and human), B. ovis (sheep), B. neotomae (desert wood rat) and other species including B. pinnipedialis, B. ceti, B. inopinata and B. microti are of marine importance (Banai and Corbel, 2010). Nonetheless, B. melitensis has a broad host range and has been isolated from sea mammals (dolphins). The several biotypes of these species have also been familiar on the basis of phenotypic features, biochemical and antigenic properties (Foster et al., 2007; Dahouk et al., 2010).

Brucellosis leads to huge economic losses in terms of reduced productivity, late term abortion, stillborn, weak calves, temporary or permanent infertility, reduced milk yield, prolonged calving interval and trade implications (Xavier et al., 2010; Santos et al., 2013; Singh et al., 2015). The disease affects a wide-ranging mammalians, as well as domesticated animals, sea mammals (Figueiredo et al., 2015; Adamu et al., 2016), fresh water fish (El- Tras et al., 2010) and also wildlife species (Van Campen and Rhyan, 2010; Godfroid et al., 2013a; White et al., 2015).

The disease mostly transmitted through the utilizations of raw/unpasteurized milk and milk products like yogurt, cheese and ice cream of the infected animals. Further sources of infection are aborted fetuses, fetal membranes and uterine secretions (Coelho et al., 2015; Gul et al., 2015). Infection also transmitted through contact with diseased animals or contaminated equipments/utensils. In developing countries, the disease impact is very high due to poor health and management conditions (Godfroid et al., 2013b).

The disease is typified by late abortion (during the last trimester), placentitis and reproductive failure. In infected males, orchitis, epididymitis and seminal vesiculitis are not uncommon clinical entities (Lopes et al., 2010) and may lead to permanent sterility/loss of sperms. Other clinical manifestations include: high frequency of still births, severe debilitation, disability, fever, anorexia, polyarthritis, pneumonia, abortion, reduced milk yield, retained placenta and prolonged calving interval with shedding of the pathogen in the milk and uterine discharges (Nielsen, 2002). The occasional occurrence of arthritis and hygroma are also observed (England et al., 2004). Deaths may take place as a consequence of retained fetal membranes or acute metritis (Megid et al., 2010). Signs and symptoms of the disease in humans include undulant fever, arthritis, spondylitis, endocarditis, meningitis and hepatosplenic abscesses in human (Tumwine et al., 2015).

Gross pathological lesions in brucellosis are primarily observed in the uterus, including hemorrhagic placentomes with multifocal fibrinous exudation. In advance cases, generalized lymphadenopathy, pleuritis and run-down appearance are also observed (Enright et al., 1984; Preman et al., 2013). Histologically lymph nodes showed hyperplasia and granulomatous lymphadenitis and placentomes with necrotic debris and several bacterial colonies surrounded by an intense inflammatory infiltrate (Nasruddin et al., 2014). Granulomatous inflammatory processes are also observed in mammary glands, liver, spleen, and kidney. Central nervous system with multifocal or diffuse histiocytic meningitis, lymphoid depletion in thymus, lungs with diffusely thickened alveolar walls and interstitial inflammatory infiltrate are reported (Xavier et al., 2010; Ahmed et al., 2012).

Diagnosis depends mainly on serological tests based on antigen/antibodies response, culture and DNA detection through different molecular detection techniques like PCR in milk and blood/serum (Abubakar et al., 2012; Gupte and Kaur, 2015). However, isolation of the organism still considered as confirmatory diagnosis. This is a low-yield process with extended requirement of time and posess severe threat to laboratory workers (Bhat and Asha, 2016). Different serological diagnostic techniques are suitable for screening large herds which are easy to perform and cheap and convenient in cost. Yet, false positive reactions may be observed due to cross-reactions with non-specific antibodies (Tuba et al., 2013; Ahmed et al., 2016). Techniques directing detection of different conserved genome

(16SrRNA, BCSP31, OMPs and IS711) of Brucella have been established. Identification and detection of Brucella expanded by means of using different types/forms of PCR assays (Yu and Nielsen, 2010; Dahouk et al., 2013; Hemade and Gandge, 2016; Ma et al., 2016).

From a public health point of view, it is one of the major zoonotic disease over the globe, accounting more than 500,000 cases of occurrence throughout the world and is one of the Select Agent pathogens (Pappas et al., 2006; Franco et al., 2007; Mantur and Amarnath, 2008; Salem et al., 2010). Virtually every case of human brucellosis is the potentially animal origin, thus considered to be an occupational disease and control is primarily a veterinary concern (Nicoletti, 2002).

Brucellosis has been eliminated from the most parts of the developed world, including Australia, Canada, Japan, New Zealand, Europe and parts of the USA. Nevertheless, the disease is still endemic in Africa, Asia, Middle East, Eastern Europe and Latin America (OIE, 2015). The disease problem is rooted in the developing countries due to lack of effective disease control program, frail public health programs and inadequate diagnostic services (Thakur et al., 2002). Rose Bengal plate agglutination test (RBPT) is economical, rapid and simple screening assay for animal brucellosis. However, in view of high sensitivity (>99%) serological cross reactivity may occur which give rise to false positive reactions. That is why the present OIE guidelines recommend that all positive RBPT results be confirmed by quantitative assays like CFT and ELISA (Corbel et al., 2006).

Many reports are available on the occurrence of brucellosis in dairy animals (cow and buffalo) in Pakistan (Hussain et al., 2008; Asif et al., 2009; Aslam, 2009; Wadood et al., 2009; Munir et al., 2011; Shafee et al., 2011; Manzoor et al., 2013; Ali et al., 2013a; Gul et al., 2014; Gul et al., 2015; Mahmood et al., 2016a). Few reports are available in other animal species, including camels, sheep and goats (Din et al., 2013; Ahmad et al., 2013; Iqbal et al., 2013; Hayat et al., 2014; Ali et al., 2015). Serologic reports of human brucellosis are available in the literature, which translate into 6.9 to 32.9% prevalence in animal herders and slaughterhouse workers (Ali et al., 2013b; Din et al., 2013; Asif et al., 2014; Shahid et al., 2014; Mahmood et al., 2016b). In a contemporary report, B. abortus was recognized as the primary reason of brucellosis in cattle and buffalo in Pakistan (Ali et al., 2014). In view of

3 increasing reports of brucellosis from different parts of Pakistan, the disease is considered to be as a resurging problem in dairy animals (cattle and buffaloes). Moreover, most of the previous studies are based on serological investigations and data are scanty on predominant Brucella species implicated in animal brucellosis in Pakistan. Furthermore, studies to explore various lesions of brucellosis (Brucella melitensis) in organs of native goats are also lacking. In view of the foregoing, the present study was planned to:

1. Determine sero-prevalence in cattle, buffaloes, sheep, goats and camels in Punjab, 2. Investigate the occurrence of Brucella species in naturally infected (serologically positive animals, including cattles, buffalo, sheep, goat and camels), 3. Determine the genetic homology of Brucella by sequence analysis and 4. Investigate pathology in experimentally induced brucellosis in goats.

CHAPTER 2 REVIEW OF LITERATURE

Brucellosis is the most dreadful zoonotic disease around the world (Schelling et al., 2003). Brucellosis is known by different names including Malta fever, undulant fever, contagious abortion, epizootic abortion, enzootic abortion and Bang‘s disease. Brucellosis in domestic animals has been known as bovine contagious abortion, enzootic abortion, epizootic abortion, contagious abortion, infectious abortion, ram epididymitis and Bang‘s disease (Din et al., 2013). In human, the disease is also familiar as Malta fever, undulant fever, gastric fever, Mediterranean fever, Cyprus fever, intermittent typhoid fever, intermittent gastric fever, Gibraltar-Rock fever, Neapolitan fever and pseudotyphus (Ray and Steel, 1979). This disease may cause serious infection in livestock animals such as cattle, buffalo, sheep, goat and camel; hence caused heavy economic losses which may reflect the significance of this disease (Wadood et al., 2009).

The disease could also occur in other ruminants and aquatic mammals. In animals, brucellosis presents different clinical manifestations, including late abortions, stillbirth, weak calves, placentitis and infertility in female, epididymitis and orchitis in males (Lopes et al., 2010). Brucellsis is devastating trans-boundary disease which causes colossal economic losses through trade barriers (Gul and Khan, 2007) and also got considerable socioeconomic impact in developing countries like Pakistan, where rural income relies on dairy products and livestock breeding (Maadi et al., 2011). Considering deprived infrastructure of health and manpower in rural areas, the major emphasis should be on the establishment of remedial health care services coupled with development of preventive measures for treatment and control of the disease (Aulakh et al., 2008). Studies using several serological techniques reported the prevalence of brucellosis is increasing, particularly in large dairy herds (Abubakar et al., 2012; Ali et al., 2013c; Islam et al., 2013).

The causative agent of brucellosis was first discovered from the diseased soldiers during the Crimean war in the Mediterranean island of Malta in 1887 by a British scientist David Bruce and named the organism ―Micrococcus melitensis‖ (Alton, 1990a; Wyatt, 2009). After this encounter, the Maltese medical physician Temi Zammit had revealed that

5 the causal agent of brucellosis was transmitted from goats carrying infection to humans through contaminated milk (Wyatt, 2005, 2011). After one decade Danish researcher Bernhard Bang also isolated the organisms in bovine aborted fetuses with similar properties as identified by Dr. Bruce and named it as ―Bacillus abortus‖ later ―Brucella abortus” (Bang, 1897).

The disease can be transferred from one animal to another and to human from infected animals either by contact with animals or their products. Dairy products formed through contaminated milk of diseased animals are the chief source of transmission of infection to the end consumer (Meltzer et al., 2010). The concentration of viable count of the organism is high in milk of infected sheep and goats, which may become concentrated in products like soft cheese. Such routes of transmission have been documented in Turkey (Ongor et al., 2006; Turgut et al., 2006). In livestock direct contact is a well-established source of transmission of the disease. Disease may transfer through abrasions, skin cuts, via inhalation and through conjunctiva. Further sources of disease transmission are aborted fetuses, fetal membranes and uterine secretions infected with Brucella infection (Coelho et al., 2015). Transmission of infection is common in veterinarians, farmers and butchers, who are in contact with diseased animals and animal products of infected animals.

A sero-epidemiological study was conducted in 2013 by Ali on 262 individuals at high risk (milkers, veterinary personnel, livestock farmers, abattoir workers, drivers and security guards) in the Potohar plateau, northeastern Pakistan. The study revealed that 6.9% people were seropositive who consumed raw milk for Brucella antibodies. Another study was conducted in 1971 by Ogutman on 2626 individuals in Erzurum (Turkey). The study also revealed that 1.5% people were seropositive who displayed no signs of clinical brucellosis and were in close contact with the animals. Whereas, 1.3% of peoples having no clinical indication of brucellosis and no contact with animals were seropositive for Brucella antibodies. Individuals (18%) who have close contact with meat and meat products and had no clinical evidence of brucellosis were observed, whereas a low level of 7.4% prevalence was recorded in individuals who had no direct contact with animals or meat or meat products. Very high level of prevalence was observed in workers who slaughtered cattle (11.7%) and sheep (39.9%) (Ogutman, 1972). A different study of sero-prevalence of brucellosis in

6 different occupational groups, including veterinarians, assistants, and workers of slaughterhouse revealed high sero-prevalence of 4.8% in the occupational group as compared with non-occupational people, all samples positive for Brucella are of veterinarians. This infectious nature of Brucella sorts brucellosis a common laboratory-acquired problem in research and diagnostic laboratories (Ergonul et al., 2004). Poor laboratory practices and lack of proper safety equipment are the main reasons for these infections.

2.1 Classification of Brucella

Complete understanding of current taxonomy, nomenclature, structure and general characteristics are a prerequisite to study the molecular diversity of the genus Brucella. Among scientists classification of the genus Brucella as single specie genus or multiple species has been a reason of controversial debate. Structurally, it is anaerobic, non-motile, Gram-negative coccobacilli which are short and slender with rounded ends and straight axis with convex sides. The length of organism may vary about 0.5 - 0.7 μm and breadth may vary from 0.5 - 1.5 μm, occurring in short chains, singly/pairs (Leslie et al., 1998). Being facultative intracellular pathogens, the organism is predominantly found in the reproductive and reticulo-endothelial systems (Jarvis et al., 2002; Albayrak and Albayrak, 2011). Most of the Brucella species grow very slowly on ordinary nutrient media even though the addition of blood or serum improved their growth. There is a direct association of ability of Brucella to persist and replicate in cells of the host and bypasses innate and adaptive immunity (Fichi, 2003). Presence of smooth or rough Lipo-polysaccharide relates to disease virulence.

The Brucella genus has genetically closely related group of bacteria that are classified into six species based on host preference and biochemical characteristics. Genomic DNA hybridization investigations have shown a high level of homogeneity among all species and they may be classified as single specie in the past (Verger et al., 1987). Afterward, worldwide recognized species of the genus Brucella includes B. melitensis, affects mostly goats and sheep, B. abortus, affects principally cattle, B. ovis, B. suis, B. canis and B. neotomae (Corbel, 1998). Transmission of the disease can take place among goats, sheep, cattle, camels, dogs, swine, horses and other wild species including reindeer and bison (FAO, 2003). Genetic fingerprinting techniques, like multilocus sequence typing (MLST) analyses

7 and pulsed-field gel electrophoresis (PFGE), have shown little variability among isolates of known species of Brucella (Nemoy et al., 2005). Though, MLST has been valuable in finding the relatedness between species and biovars within species, and creating support in the classification into the six known species, with one new species representing the newer marine strains of Brucella (Whatmore et al., 2007). In 1985, due to high genetic relatedness, it was proposed to combine all Brucella species into one specie recognized as B. melitensis, whilst the other species of Brucella were documented as biovars like B. melitensis biovar Abortus 1 (Verger et al., 1985). Pre-1986 nomenclature was implemented in 2003 universally by subcommittee on the taxonomy of Brucella genus as six classical Brucella species (Osterman and Moriyo´n, 2006). B. pinnipedialis and B. ceti which preferentially infects pinnipeds and cetaceans, respectively, were recognized in 2007 as new species of genus Brucella (Foster et al., 2007). In 2008, from the common vole a new Brucella specie known as Brucella microti was isolated first time (Scholz et al., 2008a) and afterwards from a breast implant of a clinically infected woman B. inopinata was isolated (Scholz et al., 2010). The occurrence of later species in animals is yet to be investigated. Forthcoming Brucella have also been identified from Australian rats (Tiller et al., 2010) and in non-human primates, two cases of stillbirth also detected (Schlabritz-Loutsevitch et al., 2009).

All Brucella species are fastidious and growth is seen in agar media within 48-72 hours of incubation at an optimal temperature of 37 °C with 5-10 % CO2 in supplemented air. It is an aerobic, non-fermentative, non-encapsulated, catalase and oxidase positive organism with variable urease activity (Mugizi et al., 2015). Genetic evidence shows that species of the Brucella genus are related closely that all the six terrestrial species are actually biovars of a single specie (Halling et al., 2005). Four species of genus Brucella including B. melitensis, B. abortus, B. canis and B. suis are pathogenic to humans and among these B. melitensis is highly communicable to humans (He, 2012).

2.1.1 Brucella abortus

Bovine brucellosis is commonly caused due to Brucella abortus. It was isolated in 1897 by Bernhard Bang and named as Bacillus abortus later renamed as Brucella abortus in 1920. Its main consequences in cattle are infertility, premature calving and spontaneous

8 abortion (Poester et al., 2013). Brucella species are mostly associated with certain hosts; though, they can cause infections in other species. B. abortus primarily causes infections in cattle, buffalo, bison, elk, feral pig and camels (Gul and Khan, 2007). Several species of Brucella can turn out to be "spill-over" hosts in enzootic regions. Horses, chamois, sheep, raccoons, goats, dogs, opossums, wolves, foxes and coyotes are also found hosts for Brucella abortus (Hernández-Mora et al., 2013). Experimentally infected animals can be Moose and llamas (Forbes and Tessaro, 1996). The disease has been eradicated in Australia, Canada, Japan, some European countries, Israel and New Zealand, but worldwide, it is endemic in cattle-raising regions (OIE, 2015).

In humans the disease can transfer from diseased animals through direct contact, especially at the time of parturition. Placenta tissues, aborted fetus, uterine discharges and fetal fluids are the primary source of the pathogens (Gupte and Kaur, 2015). Animals become chronic carriers during subsequent pregnancies and they continue to shed the organism in milk, urine, semen, feces and fluid from hygromas. Some animals can shed Brucella in milk long-term or lifelong, and may be intermittent. Typical transmission is by oral ingestion of infected material and through mucous membranes, but abraded skin can also be a source of transmission of B. abortus (Hassan, 2005). Colonization of mammary gland with B. abortus has generally occurred in the course of infection. In utero and venereal transmission was also recognized. Transmission through contaminated semen by artificial insemination is also reported (Corbel, 2006). Brucella abortus can spread on fomites as well as water and feed. The viability of Brucella is increased to numerous months in manure, water, hay, aborted fetuses, wool, clothes, equipment, high humidity, low temperatures and no sunlight (Spickler, 2010).

Human brucellosis is usually caused by drinking contaminated unpasteurized milk. The other important route is contact with abortion discharges of infected ruminants. The disease can not transfer horizontally from one person to another. However, occasional transmission of disease can occur in very in a spontaneous setting. In brucellosis patient's typical signs include intermittent fever, weakness, headache, malaise, chills, drenching, sweating, generalized aches and weight loss (Tumwine et al., 2015).

It is mainly a disease of adult cows, but entire bulls can also be infected, without readily transmitting the disease. Major sites of infection are testicles in the bulls and udder, uterus and lymph nodes in the female. This organism is responsible for abortions in cattle in the second half of pregnancy, retained placenta and weak calving (Enright, 1990). Abortions in cows infected with brucellosis, normally occur once and in subsequent normal pregnancies with healthy or weak calves are born. More or less infected ruminants give birth to normal calves and did not show clinical signs of disease. A very high number of organisms are present in the uterine fluids and fetal fluids of abortions and calving (Neta et al., 2015). In healthy cattle disease spread is occurring through consumption of contaminated feed or by licking aborted fetuses or calves from infected cattle. Brucella abortus can cross infect different species, including various livestock species and humans (Young, 1995). It results in high economic losses in livestock, owing to abortions and decreased milk production in cattle. Brucella abortus is also listed as a military, civilian and agricultural bio threat agent (Lista et al., 2011).

2.1.2 Brucella melitensis

It mainly causes infection with abortion in female sheep and goats whereas it causes unilateral orchitis in male animals and intermittent fever in humans (Alton, 1990a). It was discovered first time by David Bruce in 1887 as the causative agent of brucellosis in the Mediterranean region, causing intermittent or Malta fever in the British army during the Crimean War (Moreno and Moriyoyyn, 2002). Afterward Brucella bears his name together with ―melitensis‖ Latin for Malta. Brucella melitensis is mainly widespread in Middle Eastern countries, Mediterranean and through South America and Africa as well as in China, India and Central Asia (OIE, 2015). Goat and sheep are the natural hosts of B. melitensis although in few European countries and central Asia in ruminants it has arose as a significant problem (Álvarez et al., 2011). Consumption of unpasteurized milk of goat and sheep and their products is the chief cause of infection in human. B. melitensis produces similar disease in goats as like B. abortus produces disease in infected cattle (Enright, 1990). Infection due to Brucella melitensis is more challenging as vaccines against B. abortus do not effectively produce resistance against the infection (Yang et al., 2013). That is why infection of B. melitensis in large ruminants is emerging as a gradually more severe public health problem in

10 some countries with the spread of the disease through contaminated milk and dairy products (Wareth et al., 2014). Main clinical outcomes of B. melitensis are abortions, stillbirths, retained fetal membranes and birth of weak offspring. Animal generally abort only once, however the organism invades the uterus and sheds in subsequent pregnancies in uterine fluids. Reduced milk production is also evident in animals that abort and animals with infected udder. Acute epididymitis and orchitis can arise in male animals, and may produce in permanent/temporary infertility. Arthritis is occasionally seen in infected animals, whereas many non-pregnant goat and sheep show no clinical signs and remain asymptomatic (European Commission, 2001).

Brucella melitensis is highly pathogenic to a variety of animal species and making it serious zoonoses throughout the world. Intermittent fever and weakness are the most well- known symptoms in humans. In untreated cases, the disease remains persistent for many months, but is hardly ever fatal in humans. Vaccines used for animals are pathogenic to human and no human vaccine has so far been made. It is easily transmissible disease very difficult to treat as the organism is intracellular and highly contagious infection in human which make it an ideal bioterrorism organism (CDC, 2008).

2.1.3 Brucella suis

Brucella suis was isolated by Traum in 1914 in Indiana from swine herds. Initially, it was thought to be B. abortus but later by Huddleson it was named as B. suis (Alton, 1990b). Genome of B. Suis closely related to B. melitensis however, exhibited some genomic variations that are responsible for the variation in host preference and virulence between these two organisms (Paulsen et al., 2002). Wild and domestic swine are natural hosts of B. suis (Becker et al., 1978). A major indication of the disease in sows is the abortion, which follows at any period of the pregnancy. Sow may deliver some dead born or weak piglets die after birth and have some healthy live piglets. In case of boars, Brucella may be excreted out in the semen without showing any symptoms of disease. There may also be atrophy of the epididymis, unilateral swelling resulting in infertility. Swollen joints, lameness and paralysis due to abscesses in the spine have also been reported. A common route of transfer of disease in B. suis infection is the venereal transmission through which infection is transferred from

11 infected boar to the uninfected sows (Alton, 1990b). The disease in humans is mainly occupational hazard and disease is transferred from animals to abattoir workers and farmers. Among Brucella species, it was first used as a bioweapon, which was developed in the USA in 1950s. It is perceived as a possible bioterrorism organism used to target civilians, military workforces or food supplies (Paulsen et al., 2002).

2.1.4 Brucella ovis

It is a rough form of Brucella primarily causes brucellosis in sheep. It was isolated first time in Australia and New Zealand. Brucella ovis has also been present in the South Africa, Mexico, USA, Canada, South America, Europe and parts of Asia. It may be spread through venereal route from infected ewe to non-infected ram. It can also be transmitted by sharing of pens, direct contact, or through shearing wounds from one sheep to another (Blasco, 1990). In ewes little proportion of animals abort and infected animals rarely show any symptoms of the disease (Grilló et al., 1999). Though, few ewes may develop placentitis which may lead to delivery of weak lambs (Thoen et al., 1993). In mature rams, it produces orchitis, epididymitis and infertility. Only rams with low antibody titers excrete the organism in semen, in contrast to animals with high antibody titer (West et al., 2002).

2.1.5 Brucella canis

Brucella canis was first isolated in the 1960s as a cause of reproductive failure and abortions, also in addition, documented in several countries (Carmichael, 1990). The organism is mainly common in South and Central America, southern states of the USA and Mexico. Brucella canis have been identified in research and commercial breeding kennels in many other countries including the People's of China and Japan. In Europe the infection has also been reported infrequently (Wanke, 2004). Canine species, mainly dogs are the primary host of Brucella canis however, humans may also be infected. Although it does not naturally results in an animal's death, but it does cause reproductive failure (Hollett, 2006).

It is mainly transmitted in dogs through sexual contact. B. canis can survive in the uterine and vaginal tissues in female dogs and is often excreted for life, whereas in the male organism got survives in the epididymis and the prostate gland (Wanke, 2004). The infected

12 animal show no symptoms of disease and are clinically healthy, however, can transmit the organism through aborted fetuses, urinary secretions and through breeding which is a common route of transfer of disease. It can result in abortion in infected animal after gestation length of 45-55 days and perinatal mortality of fetus leading to subsequent infertility (Carmichael and Joubert, 1988). In male dogs, organism persists in the seminal fluids of testicles and spread via semen and urine (Moore and Kakuk, 1969). Male dogs infected with Brucella exhibited no clinical signs excluding advanced cases where scrotal dermatitis, testicular atrophy, epididymitis and infertility may be seen (Carmichael, 1990). In infected male during first three months after infection semen usually contains huge numbers of inflammatory cells and abnormal sperm. In chronic cases infected males may have decreased the number of immature sperm or no sperm.

2.1.6 Brucella neotomae

Brucella neotomae was first isolated in 1957 from the desert wood rat and named firstly as Neotoma lepida by Stoenner and Lackman (Cameron and Meyer, 1958). Afterward, on the basis of conventional genus speciation like H2S production, CO2 requirements and organisms behavior of differential dye media it was recognized as new species of Brucella. The bacterium was found to be markedly dissimilar from the three main species (B. suis, B. melitensis and B. abortus) and sub-classifications within these species (Huddleson et al., 1957).

2.1.7 Marine Mammal Species

Recent isolates of Brucella species from the marine mammal doesn‘t match or have some different properties as other recognized species have. In 2007, B. pinnipedialis and B. ceti which preferentially infects pinnipeds and cetaceans, respectively, documented as new species of Brucella (Foster et al., 2007). In 2008, Brucella microti was first identified from the common vole (Scholz et al., 2008a). These strains will eventually be identified as biovars of existing species, but this is not clearly identified. These new species of Brucella have been identified from marine mammal species largely seals otter, cetaceans. These isolates are from Scotland and the coast around northern England and also from California from the bottle- nosed dolphin (Ewalt et al., 1994). Isolation and identifications are primarily based on

13 culture characteristics, phage typing, staining, metabolic phenotype and serology (Vizcaino et al., 2004). Isolations and characterization of these species failed to assess the prevalence of infection, distribution, pathogenicity and zoonotic potential of these mammalian marine species (Ewalt et al., 1994; Foster et al., 1996). The literature elaborate about some brucellosis in marine mammals, but this bacterium has not yet been isolated from the reproductive organs of the marine mammals. There are very rare cases in which infection has linked with the clinical signs. In wild Atlantic white-sided dolphin and captive bottlenose dolphins, Brucella associated abortions and placentitis have been reported. Brucella has likewise been isolated from a dead dolphin calf in New Zealand. Epididymitis accounted for orchitis suspected to be brucellosis has also been accounted to cause infection in minke whales (Clavareau et al., 2009).

Brucella-related meningoencephalitis has been accounted in a species of dolphins (three striped). Indications of Brucella related systemic signs have been found in white-sided dolphins with splenic rot and sores of hepatic, lymphadenitis and mastitis (González et al., 2002). Brucella has likewise been distinguished as a conceivable optional trespasser or entrepreneurial pathogen in incapacitated seals, dolphins and porpoises. It has been confined from subcutaneous abscesses. What's more, this living being has been found in organs with no minuscule or gross injuries, and in clearly solid creatures (Palmer et al., 1996a).

2.2 Modes of disease transmission

The aborted animals expel Brucella into Placental tissues, fetal fluids and vaginal discharges with a plenty of pathogens excreated at the event of parturition or during abortion (Coelho et al., 2015). Aborted goats shed the organisms for a prolonged period (2-3 months). In contrast, sheep discharge the organisms for maximum of 3 weeks post parturition (Alton, 1990a, Duran-Ferrer, 1998). Body secreations including milk, colostrum and semen of infected animals sheds Brucella pathogen. Organism sheds intermetently in the udder secreations owing to localization in supramammary lymph nodes. Similarly different body tissues like lymph nodes and synovial fluids have been found positive for Brucella (European Commission, 2001).

The environment and husbandry practices markedly influence the spread of the disease in a herds/flock as lambing in enclosures and congested facility. In most of instances, disease is introduced in a diseased free farm upon inclusion of infected animals (Godfroid et al., 2013a). Communal grazing and the practice of transhumance are strongly correlated with disease (Corbel, 2006).

2.3 Mode of infection

Two modes of infection viz. direct and indirect are recognized in the pathophysiology of brucellosis in animals. The direct transmission occurs through the ingestion of viable bacterium. However, transmission may also ocuur through contaminated semen or infected embryos or through aerosols (Henning et al., 2012; Poester et al., 2013). Dogs can act as mechanical and biological vectors (FAO/WHO Expert Committee on Brucellosis, 1986). The organisms are rarely spread through waterways. Although, shedding of bacterium is low in milk but is sufficient to infect lambs and kids and humans (Philippon et al., 1971). Majority of spontaneous infections are acquired via ingesting of udder secreations (colostrum and milk), in utero infections are seen in small proportion in small ruminants. Subsequently infected animals may shed organism in their intestinal contents. However a self-curing mechanism has been suggested in the animals those acquire infection in utero/early life before reaching to their sexual maturity (Grilló et al., 1997). Immunotolerance to infection with B. melitensis has been reported and this may account, in part, to the difficulty in eradicating the disease (Dolan, 1980).

In vaccinated animals, infection may be rapidly eliminated and sheep are reported to have a strong resistance to reinfection following recovered from infection with B. melitensis (Alton, 1990a). Long lasting immunity has also been demonstrated in experimentally infected sheep (Durán-Ferrer, 1998).

In the placenta, Brucella invades trophoblasts and utilizes iron for their replication, which may lead to placental disruption resulting in abortion or weak offspring. Erythritol is also assumed to play an important role to determine tissue tropism for Brucella (Williams et al., 1964; Keppie et al., 1965; Acha and Szyfres, 2003) and this may be linked with iron acquisition for virulence in ruminants. Compared to other non spore forming bacteria, B.

15 melitensis has a relatively higher ability to persist outside the host. Favorable environmental conditions include high humidity with a pH > 4, low temperatures and the absence of direct sunlight. The infectivity of the organisms may persist for several months in contaminated water, aborted materials, liquid manure, wool, hay, contaminated equipment and clothes. Under dry conditions, B. melitensis may remain viable in dust and soil. Contaminated fomites (equipment and utensils) can be sterilized by autoclaving at 121 °C and liquid manure treated by xylene and calcium cyanide for 2 to 4 weeks. Caustic soda, 2 % formaldehyde and 2.5 % sodium hypochlorite can destroy the organisms on contaminated surfaces (European Commission, 2001). In milk and dairy products, survival of Brucella depends on the type and age of products, their pH, humidity, temperature and storage conditions (Carrère et al., 1960). Prolonged boiling and pasteurization inactivates the bacteria (Davies and Casey, 1973). In fermented cheese, Brucella does not survive for long, however the optimal time of fermentation to ensure safety is not exactly known, although it has been estimated to be around three months (Nicoletti, 1989). Radiation of colostrum by gamma rays is effective in inactivating Brucella (Garin-Bastuji et al., 1990). In contrast to dairy products, the life span of Brucella in meat is short due to the lower pH. Disinfectants, including phenol (10 g/L), formaldehyde and xylene (1 ml/L), are effective in inactivating the bacterium. For exposed skin, ethanol, diluted hypochlorite solution and iodophores are used for decontamination. On pasture Brucella can survive for up to 4 days if there is direct sunlight and up to 6 days in the shade (WHO, 1986).

2.4 Clinical Manifestation of Brucellosis in animals and humans

The incubation period highly varies with stage of gestation and species responsible for infection. Reproductive damages characteristically take place during the second half of the pregnancy with stillbirths or abortions occurring after infection from a few weeks to five months. In case of dogs the abortion occurs from seven to nine weeks during gestation whilst in pigs, abortions can arise at any stage of gestation. Generally, brucellosis is a chronic infectious disease of the reproductive tract leading to abortion, reduced fertility, retained fetal membranes, orchitis, epididymitis and / or impaired fertility in cattle (Lopes et al., 2010). Abortion storms can reach up to 80% infected herds of cows (Cunningham, 1977). Subsequently, the number of abortions dwindles as cows which have aborted in one year may

16 deliver normal calves in subsequent years (Berman, 1981; Stevenson and Hughes, 1988). Crawford et al. (1990) reported that 3% of infected females would lose their calves in subsequent years.

Although much has been written about bovine brucellosis, little has been written about the gross pathological lesions seen in naturally infected animals. In calves and non pregnant cattle, the course of the disease is typically subclinical (Cheville et al. 1992). In experimental studies, pathological lesions were not observed in calves challenged with vaccinal strains including 2308 and RB51 (Palmer et al., 1996b; Cheville et al., 1996). However, in the study of Palmer et al. (1996a) large numbers of bacteria were isolated from the lung, lymph nodes, allantoic fluid and rectal swabs of fetuses. The authers observed that 8 of 10 pregnant cattle which were experimentally infected with B. abortus (RB51) @ 1 x 1010 cfu remained febrile (temperature 39.1 to 41.1C) during the first 24 to 48 hours after challenge, although no signs of depression or loss of appetite were apparent. In contrast, Cheville et al. (1992) demonstrated that after calves were challenged with 5-7 x 109 cfu of B. abortus strain 2308, no calves developed fever or other clinical signs, even though they developed high levels of persistent antibody titers.

Following abortions, retained placenta is a frequently reported complication in brucellosis (Beveridge, 1983), which has been ascribed to, premature parturition instead of uterine infection (Cunningham, 1977). Nevertheless different authers demonstrated tropism of B. abortus for the bovine placental trophoblasts which leads to inflammation of plasentomes resulting in premature birth (Payne, 1959; Mollelo et al., 1963; Palmer et al., 1996a). In experimental infection in cattle, Cheville et al. (1993) reported severe acute purulent inflammation of placentomes and necrosis.

Following abortion, Acha and Szyfres (2003) reported that metritis could lead to permanent infertility. Infected female animals after infection may fail to show signs of oestrus (Huddleson, 1943). The organism may also leads to subclinical mastitis which may be shed in the milk of infected animals. In male cattle B. abortus infection may fail to produce the clinical signs (Beveridge, 1983). In other animals clinical sgins including epididymitis, seminal vesiculitis and orchitis results in reduced libido (Plant et al., 1976).

Hygromas have been reported in infected cattle (England et al., 2004) and Van der Schaff and Roza (1940) reported that they were common especially in Zebu cattle a common breed in Java, Indonesia.

Brucella melitensis among all species is highly infectious and mainly causes abortions, birth of weak offspring, stillbirths and retained fetal membranes. The animal usually aborts once after infection, however organism reinvade uterus constantly secreted out during subsequent pregnancies. Economic losses occur due to decreased milk yield in animals which abort and in animals with infected udder. Though, signs of mastitis rarely develop during infection. In males, epididymitis and orchitis may develop which result in loss of fertility, whereas, arthritis is seen infrequently in both males and females (Acha and Szyfres, 2003).

Brucella canis can bring about premature and stillbirths in pregnant bitches. Most premature births happen in late stage of gestation, especially at mid 7-9 week of growth. Premature births are generally trailed by serosanguinous, mucoid/green vaginal secreations that persist for 6 weeks. Some pups are conceived alive, however feeble and most pass on not long after birth. In male dogs, scrotal edema, epididymitis, poor sperm quality and orchitis are observed. In few cases scrotal dermatitis can be observed due to the self-injury of the animals due to scrathing of skin. One-sided or reciprocal infection of the testis can be seen in diseased animals and infertility occurs in a few cases of infection in males (Carmichael, 1990). In common, the major clinical indication of brucellosis in creatures is irresistible premature birth as a consequence of the microscopic organisms attacking the placenta and newborn. The contaminated creatures viably remain bearers for whatever is left of their lives, despite the fact that they may prematurely end just once. Amid this time they discharge huge quantities of bacteria in their milk, and also in the results of the ensuing, clearly ordinary, parturitions. Disease in people can happen through the ingestion of crude drain or drain items, or by taking care of contaminated creatures, particularly around the season of parturition. Sanitization adequately ensures the urban populace in many districts; however stockowners and their families who frequently drink unpasteurized/crude milk are in danger of getting infection of brucellosis (Anon, 2014).

Horses are also attacked by B. abortus which commonly results in bursitis characterized by poll evil and fistulous withers. Cohen et al. (1992) reported that nine (37.5 %) of 24 horses with fistulous withers were seropositive to B. abortus. Although abortion has been recorded in horses, subclinical infection was the most common form of brucellosis in this species (Mair and Divers, 2013).

The infection in humans manifests initially as an acute febrile illness or undulant fever. However, the clinical signs in humans are not pathognomonic for the disease (Megid et al., 2010), and include fever, chills, weakness, general aches and pains, neck pain, sweating, headaches, weight loss, anorexia, constipation, nervousness and mental depression (Tumwine et al., 2015). Stevenson and Hughes (1988) considered that, because of the non-specific nature of the symptoms, patients often delayed seeking medical attention and consequently diagnosis was often delayed. Young (1983) considered that fever and lymphadenopathy were the most common clinical signs presented in patients suffering from brucellosis. However the variable symptoms and the occurrence of subclinical and atypical infections in both the acute and the chronic stages make the clinical diagnosis of human brucellosis difficult (Matar et al., 1996). In contrast to cattle, abortion in women from brucellosis is uncommon and this may be due to lack of erythritol in their placenta and uterus (Ruben et al., 1991). Local skin lesions have also been described in humans at the site of accidental inoculations with B. abortus strain 19 vaccine (Corbel, 1989). Hepatomegaly and splenomegaly observed in a substantial number of patients. In the chronic form of disease, a varied range of pathological conditions may observe including meningo-encephalitis, endocarditis and spondylitis (Pappas et al., 2005).

2.5 Necropsy findings and microscopic lesions

Granulomatous inflammatory lesions are frequently seen in affected organs and lymphoid tissues (Payne, 1959; Berman, 1981), although lesions such as necrotizing placentitis, testicular alteration including orchitis and epididymitis which may be present are not pathognomonic for brucellosis (Enright et al., 1984; Preman et al., 2013). In fetuses of large animals, the liver and spleen may be enlarged with lungs exhibiting fibrous pleuritis and pneumonia (Cheville et al., 1993). Abortions caused due to Brucella are characteristically

19 going together with the presence of placentitis. The cotyledons may be yellow, red, necrotic or normal. In small ruminants and cattle, the intercotyledonary region shows wet appearance and is typically leathery with focal thickening (Huddleson, 1943).

Granulomatous to purulent lesions may be found in the reproductive tracts of male and female infected animals, supramammary lymph nodes, mammary glands and other lymph nodes, bones and vital organs (Runells and Huddleson, 1925; Enright, 1990). Sever to moderate endometriosis may be seen after abortions (Palmer et al., 1996a), males can have bilateral or unilateral orchitis or epididymitis (Lambert et al., 1964; Crawford et al., 1990b). Hygromas may be formed on the hock, stifles, knees, angle of the haunch, and between the nuchal ligament and the primary thoracic spines of cattle infected with B. abortus (Bracewell and Corbel, 1980).

2.6 Worldwide distribution of brucellosis

Brucellosis accounts around 500,000 cases throughout world in humans and animals equally, every year (Pappas et al., 2006). Although distribution of brucellosis is worldwide; however, it is more prevalent in countries with poor public and animal health programs. The disease is completely eradicated from developed countries, including Canada, USA, New Zealand, Japan and Israel through adoption of better control and eradication strategies, conversely the problem remains uncontrolled in extremely pervasive areas where cattle rearing are mostly preferred like Asia, Africa, Latin America and Middle East (McDermott and Arimi, 2002).

The occurrence of brucellosis was highest in bovines whereas prevalence of brucellosis ranged from 0.85-23.3% ascribed from various parts of the world in different studies from throughout the world. Likewise prevalence range of 0.0-17.20% has been stated in camels from widespread countries (Refai, 2000). In Central American countries cattle and buffaloes are most affected with 10-25% of prevalence range at the level of herds while it is more thoughtful disease in livestock and humans in Mexico else than that the development of strategies to control the disease at national level. In Latin American countries, it has been a serious disease with infection rate of 10-25% (Memish and Balkhy 2004). The incidence of brucellosis has been declining in Italy, Ireland and France, but the Brucella positive herds

20 were still present (Godfroid et al., 2002). Small ruminants still remain a huge reservoir of brucellosis infection whereas bovines are less important reservoir of Brucella in western European countries, specifically Macedonia, Greece, Bulgaria and Yugoslavia (Taleski et al., 2002). The brucellosis exist in most of the African countries in bovine, ovine, caprine and porcine. The exact prevalence of brucellosis is either completely unknown or poorly reported in African countries (OIE, 2015). By the end of the century England and Netherlands were believed out to be free of infection of brucellosis (Godfroid and Kashbohrer, 2002).

Among the all organisms of genus Brucella species including B. suis, B. melitensis and B. abortus are not specific to host and are capable to infect a varied collection of host species, including humans (Bricker and Halling, 1994; Corbel, 1997; FAO, 2003; Alton et al., 1988). It produces a bacteraemic phase of different durations, grows in the intracellular environment followed by enterance and localization in genital tract and mammary tissue. Typical clinical sign in pregnant females is abortion, whereas epididymitis and orchitis in males (Cunningham, 1977; Enright et al., 1984; Cheville et al., 1993; Corbel, 1998a). Sexually mature female animals are at higher risk of the infection exhibiting abortion if pregnant (England et al., 2004).

Brucella species are sustained in a a small number of reservoir hosts including camels, bison, buffalo, cattle, feral pigs and elk (Crawford et al., 1990b; Meagher and Meyer, 1994). Brucella suis have a broader specificity of host and contains more varied isolates than other Brucella species (Priadi et al., 1985). In domesticated pigs biovars 1, 2 and 3 are responsible for causing the disease, whereas before 1 and 2 were isolated from pigs. Biovar 2 also been isolated and identified from European hares and wild boar. Reindeer and caribou maintained biovar 4 and biovar 5 is found in small rodents.

Though brucellosis is widely present over the globe (Figure), however, data regarding its distribution and prevalence in many parts of the world are very few (Beveridge, 1983; Corbel, 1997), primarily attributable to its stealthy nature and a deficiency of resources to inspect the disease when compared with more spectacular diseases, such as pest des Petits Ruminantsm, sheep pox, Rift Valley fever and foot-and-mouth disease.

Both Brucella abortus and Brucella melitensis appears to be highly endemic in the

Mediterranean region (Al-Majali, 2005), the Arabian Peninsula, central Asia and Mongolia. Peru, Mexico and parts of Argentina and Latin America are also afected (Corbel, 1997). In different parts of the Africa and India the occurrence of disease has also been reported (Johnson et al., 1984; Corbel, 1989) (Figure 1, 2). Most of North America and many countries in northern Europe are believed to be free from the Brucella melitensis (Crawford et al., 1990b; Corbel, 1997; OIE, 2015). Whereas sporadic cases of Brucella abortus still occurs in North America in domestic animals and disease constantly present in the feral animals (OIE, 2015). Developed countries like New Zealand and Australia are also considered free from both key infection species of Brucella (Corbel, 1997).

Brucellosis in human is endemic in Mediterranean countries and 50,000 cases in humans were reported in 2003 (Pappas et al., 2006). In Mediterranean countries and the Middle Eastern incidence of 78 cases/100,000 people have been reported per year (Hartigan, 1997). The true incidence of brucellosis of human is not known precisely and expected to vary between different areas of the world (Alton, 1990). In humans the disease is primarily present and restricted to veterinarians, laboratory workers, farmers, persons who work with animal products and abattoir workers who are dead-end hosts and are occupationally exposed to the disease (Osoro et al., 2015). Infected aborted fetuses, uterine excretions, placenta and fresh dairy products, are a major source of organism/infection. Thus, lambing or kidding period is the major period for transmission of disease. Cheese made from goat and sheep's unpasteurized milk is a critical source of infection for the persons without occupational contact with animals (Leong et al., 2015). The epidemiology of the disease in animal population reflects the brucellosis prevalence among humans. Economic impact and public health of brucellosis remains a concern in underdeveloped countries like West Asia, Africa and parts of Latin America (Glynn and Lynn, 2008). Nearly all affected countries with endemic disease have made an attempt to control and eradicate brucellosis using different control strategies and approaches with different levels of success. In some countries prevalence of the organism is gradually decreasing, however increase in the incidence rate has been reported by different authers in the southern Mediterranean and Gulf countries. Brucellosis is important and notifiable disease in so many of developing countries where the disease prevalence is underestimated due to misdiagnosis or under-reporting (Hartigan, 1997). Brucellosis in animals leads to impair the socioeconomic development of

22 livestock owners and inserts obstruction to trade of animals and animal products between countries.

Various reports from Sub-continent chiefly Pakistan and India have been available describing high incidence of brucellosis (Gul et al., 2014). Reports of the occurrence of brucellosis in Pakistan and contiguous countries are summarized in the (Table 2.1). The true rate of occurrence of brucellosis is not known in Pakistan, but it varies from 3.25-4.4% in various regions of Pakistan (Abubakar et al., 2012). In Pakistan, incidence rate of brucellosis is increasing in dairy herds where the number of animals is high. Numerous studies have been directed to use sero-diagnostic procedures to determine the prevalence rate of the infection of brucellosis in different government and private livestock farms of various districts of the provinces. About the prevalence of brucellosis limited literature is available countrywide. Table 2.1 Prevalence of brucellosis in livestock in contiguous countries Country Species Prevalence (%) References Iran Cattle 0.85 Zowghi et al. (1990) Goat 10.18 Camel 8.00 Iraq Sheep 15.00 Al-Ani et al. (1998) Cattle 3.00 Camel 17.20 Pakistan Buffalo 8.01 Gul et al. (2014) Cattle 6.94 Goat 6.73 Sheep 1.91 Camel 2.00 Bangladesh Cattle 3.70 Islam et al. (2013) Buffalo 4.00 Goat 3.60 Sheep 7.30 India Bovine 6.37 Sharma et al. (1979) Sheep 3.42 Goat 5.53 Nepal Cattle 32.00 Pandeya et al. (2013) Buffaloes 13.40 Goats 2.60

Figure 2.1 Global distribution of Brucella abortus (OIE, 2015)

Figure 2.2 Global distribution of Brucella melitensis (OIE, 2015)

2.7 Laboratory diagnosis

Generally, brucellosis can be diagnosed by indirect methods of serological tests and direct methods of diagnosis including culture and PCR assays. Brucella species and biovars are further identified respectively by nucleic acid technology and bio-typing (OIE, 2016).

2.7.1 Serodiagnosis

For diagnosis of brucellosis, the most common diagnostic method is via the detection of antibodies against Brucella infection in different animal species. However, some serological tests are not specific as cross-reactions with other bacteria may occur. The buffered Brucella antigen tests including, Rose Bengal Plate test (RBPT), enzyme linked immunosorbent assay (ELISA) and complement fixation test (CFT) are mainly used for screening of whole herds and also individual animals for antibodies, however none of these tests are suitable for all epidemiological situations. Indirect ELISAs and Interferon gamma consuming wild rough strains of Brucella antigen reported to be capable tests to differentiate the disease from other cross-reacting bacteria with similarities of antigenic properties (Nielsen et al., 1989; Weynants et al. 1996a).

To check the humoral immune response with infection of B. abortus different serological tests are widely used. However, false results due to < 100% sensitivity and specificity posses a problem in the better diagnosis of the disease. In animals infected with Yersinia enterocolitica 0:9 having similar LPS (O-chain) protein, false positive reactions may occur. Similarly in animals infected with organisms including Streptomonas maltophilia, E. coli O:157, Francisella tularensis, vibrio cholera O:1, Bordetella bronchiseptica and E. hermani false positive results may also be observed (Weynants et al., 1996b). Upon induction of vaccine false positive results are another challenge in the diagnosis of the disease through serological tests.

No serological test has been developed solely for B. melitensis. Diagnostic assays developed for detecting infection of cattle with B. abortus have also been used to detect infection of B. melitensis in sheep and goat. Consequently, the RBPT and the CFT are tests used widely for diagnosis of Brucella infection in sheep and goats (MacMillan, 1990). These

25 serological tests mostly detect antibodies produced to counter smooth lipopolysaccharide (S- LPS) of the Brucella (OIE, 2016). However, the sensitivity of the CFT test is lower than that of both the RBT and ELISA assays in small ruminants including sheep and goat (Blasco et al., 1994a; Blasco et al., 1994b). In addition, both the RBPT and CFT tests lack specificity when used for testing sera from domesticated small ruminants including sheep and goats vaccinated with Rev-1, the only available vaccine against B. melitensis (Fensterbank, et al., 1982; Díaz-Aparicio et al., 1994). Although this issue is less if the Rev-1 vaccine is applied via the conjunctiva (De Bagués et al., 1992; Díaz-Aparicio et al., 1994; Benkirane et al., 2014).

Several reports have confirmed the adequate sensitivity of the different ELISAs for the identification of brucellosis in goat. In general, for surveillance indirect ELISAs are good in countries which are in latter phases of control and eradication and countries where vaccination use is present no longer. However, these ELISAs lack specificity when used in vaccinated animals, particularly when Rev-1 is used in adult animals. In these conditions, only the Native Hapten (NH) gel precipitation test is useful for determining infection in vaccinated animals (Díaz, et al., 1979; OIE, 2016). Although the competitive ELISA is promising, this test also lacks specificity in vaccinated animals and those infected with Y. enterocolitica O:9 (Marín et al., 1999; Muñoz et al., 2005).

Low-income countries would profit from improved vaccines and simple, specific, and inexpensive diagnostic tests. Consequently, interest in brucellosis research is waning in first- world countries, despite the disease imposing a severe burden elsewhere. Because of this, the WHO has classified brucellosis amongst seven neglected zoonotic diseases, which are a huge threat to human (Maudlin and Weber, 2006).

2.7.1.1 Rose Bengal Plate Test (RBPT)

In ruminants the RBPT is often used to screen entire herds for evidence of infection with brucellosis (Alton et al., 1975b; Sutherland, 1980; Alton et al., 1988; MacMillan, 1990). The principle of the test depends on an antigen-antibody reaction resulting in agglutination. Smooth Brucella culture stained with Rose Bengal dye is mixed in a buffered acidic suspension and mixed with an equal volume (drops) of serum (Sutherland, 1980; Alton et al.,

1988). The acidic buffer is used to decrease the problems associated with non-specific agglutination (Corbel, 1972). The sensitivity of the test may be influenced by high temperature and consequently the laboratory is the ideal place to run the test (MacMillan, 1990). However, as the test is easy to run and requires little equipment, it has been widely used in the field as a pen-side test for cattle and other species (Brinley-Morgan et al., 1969). Similar to other serological tests, the RBPT can give incorrect results and cannot distinguish between vaccinated and infected cases (Brinley-Morgan et al., 1969; Alton et al., 1975b; Sutherland, 1980; Alton et al., 1988). Furthermore the lower specificity of the test may result in more false positive reactions, which are tested negative on other assays (Brinley-Morgan et al., 1969; Mylrea, 1972; Browne, 1974). The RBPT may be interfered by infection with Salmonella, E. coli O:157 (Nielsen et al., 1980) and Y. enterocolitica O:9 (Mittal and Tizard, 1979).

One study tested the sera of 300 cows that had aborted and which had been cultured for B. abortus with the RBPT, CFT and SAT. Of the sera 91.4%, 92.7% and 66.9% were positive, respectively (MacMillan, 1990). Sutherland and Searson (1990) reported that the sensitivity of the RBPT was 78% and the specificity 71%. In contrast, MacMillan (1990) reported a sensitivity and specificity of 97 and 92.7%, respectively in an automated RBPT. Koh and Morley (1981) reported a specificity of 97.9 to 99.1% in vaccinated and non- vaccinated herds. As a consequence of this specificity, the RBPT is not recommended for testing individual animals (Alton et al., 1988).

The RBPT primarily detects IgG (Corbel, 1972). However, it can also detect immunoglobulin M (Allan et al., 1976). High sensitivity of RBPT is its significant feature with only 0.4 to 1.8% of RBPT seronegative animals testing positive on the CFT (Mylrea, 1972; Brinley-Morgan et al., 1978). During initial stage of infection (first week) false negative results may be observed (MacMillan, 1990). The test is ideal screening test because RBPT is inexpensive and easily performed and has reasonable sensitivity and specificity.

2.7.1.2 Complement Fixation Test (CFT)

The test usually utilizes the whole cell of the B. abortus. Several authors have revealed that complement fixing antibodies in infected animals are mostly IgG and IgM

(Anderson et al., 1964; Brinley-Morgan et al., 1969). However, different authors have reported that IgM has reduced ability to fix compliment when sera is heated at 56°C which may restrict the early detection of infection (Alton et al., 1988). The Prozone effects are also an obstacle associated with sera where the ratio of the two types of IgG (IgG1 and IgG2) is high in sera. This may result in blocking the fixation of compliment (Hobbs, 1985; Alton et al., 1988). The sensitivity of the CFT is high compared with culture and this test has been considered to be the most superior serological test (Nicoletti, 1969; Alton et al., 1975b). Furthermore, the CFT‘s specificity is high compared with the SAT (serum agglutination test), RBPT, and Indirect ELISA (Dohoo et al., 1986). Huber and Nicoletti (1986) reported that in adult vaccinated cows, the CFT had the highest sensitivity and specificity compared with the rivanol and milk ring tests. Among 10,508 non-vaccinated cattle from non-infected herds, only 0.04% were seropositive by the CFT (specificity of 99.96%) and a 99.8% specificity was reported in vaccinated non–infected herds. However, the CFT along with the RBPT, have limitations of being unable to discern between vaccinated and infected animals. The test is not easy to perform sensitive, require skilled and experienced scientists and fail to diagnose latent carrier infections some times (Christie, 1969). The test can detect antibodies after two weeks of infection hence false negative reactions may results in the initial phase of the disease (Sutherland, 1980).

2.7.1.3 Enzyme linked Immunosorbent Assays (ELISAs)

The ELISAs are dependent upon the identification of antibodies and antibodies isotypes in the serum of the suspected animals or vaccinated animals (Hobbs, 1985). For detection of B. abortus ELISAs have been frequently utilized with other serological tests (Engvall and Perlmann, 1971). In ELISA complete cell as antigen or semi purified and crude LPS or non-LPS antigens are used for the detection of Brucella (Letesson et al., 1997). Several types of ELISA have been developed and been widely used as diagnostic tool, including the competitive (direct) and indirect. ELISA‘s to detect antibodies against Brucella in milk have also been developed and are been used (Thoen et al., 1995; Nielsen et al., 1996). ELISA is evaluated in vaccinated animals, infected animals getting infection naturally (Abalos et al., 1996; Uzal et al., 1996) as well as in human beings (AlShamahy and Wright, 1998).

Although the ELISA is not a cheap test, several authors have highlighted several advantages in using this assay. Firstly, it has high sensitivity and specificity (Saunders and Clinard, 1976; Cargill et al., 1985; Sutherland et al., 1986). Secondly, and unlike the CFT, the ELISA is not affected by haemolysis, prozone and anticomplimentary effects (Reynolds, 1987) and finally the technique is not complicated and is commercially available.

The sensitivity and specificity of the ELISA have been found to be much better than the Milk Ring Test (MRT) when testing milk for evidence of infection in lactating cows. It also has a higher specificity of the test as well as sensitivity than the CFT (Sutherland et al., 1986). Although Cargill et al. (1985) reported that the ELISA and CFT had similar specificities. Nicoletti and Tanya (1993) reported that the ELISA was an efficient test for the early detection of brucellosis, although its use in field diagnosis was not as efficient.

Although cross-reactions have been highlighted with Y. enterocolitica O:9, use of a competitive ELISA using monoclonal antibody against LPS of B. abortus eliminates this problem. Depending on its sensitivity and its ease of performance, Nielsen et al. (1995) concluded that the ELISA is the most suitable diagnostic test for the confirmation of brucellosis in individual animals. However, as with other assays, caution must be taken with its use in areas where vaccination has been undertaken.

In an investigation carried out by Hornitzky and Searson (1986), the usefulness of the ELISA was highlighted in cattle that were culture positive, non-vaccinated RBPT negative reactors or low CFT titer animals. Heck et al. (1984) reported that the ELISA and Haemolysis In Gel Test (HIGT) were able to detect antibodies in 92 to 96% of animals, respectively, within four weeks of experimental challenge of vaccinated cows, and almost 100% were detected ten weeks after inoculation. However, with the SAT, CFT and rivanol tests, less than 88.6% were positive after 24 weeks of infection. In contrast, in non- vaccinated challenged cows, 93 and 90% were positive on the ELISA and HIGT, respectively, four weeks post infection while less than 62% were positive by other tests.

2.7.1.4 The Serum Agglutination Test (SAT)

The SAT was used as a standard assay for the detection of Brucella antibodies before

29 the RBPT was developed (Brinley-Morgan, 1967; Davies, 1971; Alton, 1977a, b; Sutherland,

1980). The assay was more efficient to detect IgM than IgG1, and subsequently it is found more effective in detection of infection at early stage of the disease in different reports (Allan et al., 1976). In cattle vaccinated with strain 19, SAT was also found to detect more IgM than IgG antibody and it was recommended by Alton (1977 a, b) to take this feature into account when using the SAT in areas where strain 19 had previously been used. However, several disadvantages to use the SAT have been demonstrated. These include the prozone phenomenon which can result in false negative reactions, especially where the IgG1 concentration is high (MacMillan, 1990). Nicoletti (1969) also stated that the SAT was less effective in the diagnosis of individuals, as it failed to detect 48% of culture positive animals in one study. Cross-reaction with Y. enterocolitica O:9 and E. coli O:157 has also been reported (Mittal and Tizard, 1980). In culture positive animals Sutherland and Searson (1990) demonstrated that the SAT had a specificity and sensitivity of 95% and 70%, respectively. As a consequence of these limitations, several countries test samples with confirmatory tests such as the CFT (Sutherland, 1980). In contrast, Jiwa et al. (1996) recommended the use of the SAT as it is a simple, inexpensive technique that can be performed by untrained personnel.

2.7.1.5 Milk Ring Test (MRT)

Milk ring test is a simple test that can detect antibodies in the milk of infected cows (Beveridge, 1983). It detects antibodies attached to fat globules of the milk by using whole cell haematoxylin-stained killed Brucella antigen. Milk samples and antigen are mixed and the antigen-antibody complex rises to the surface of the milk forming a ring in the cream layer (Sutherland, 1980; MacMillan, 1990). The sensitivity of the test has been reported to be high (Beveridge, 1983), however false negative reactions have been described (Christie, 1969; Brinley-Morgan et al., 1978), although testing of bulk milk samples from dairy farms helps decrease the false negative reactions. Thoen et al. (1995) reported that the MRT was less useful in areas where the prevalence of brucellosis was low and Cunningham (1968) reported that the test was also less effective where animals had been vaccinated with strain 19 and in animals with mastitis.

Although the MRT has several disadvantages, it is a simple, inexpensive assay used for initial screening of dairy settings by non-skilled personnel (Sutherland, 1980; Beveridge, 1983; Nielsen et al., 1996).

2.7.2 Culturing of Brucella on media

Although several media have been developed for culturing Brucellae (Mayfield et al., 1990), standard basal medium is considered to be the ideal medium for this pathogen. Corbel and Brinley-Morgan (1984) found that the primary isolation of Brucella could be accelerated by adding 5-10% normal serum to the medium. Atmospheric conditions required for growth are 10% CO2, except for strain 19, at 37 °C, although growth can be seen between 20 and 40 °C. The optimal pH ranges between 6.6 and 7.4 for growth of the organism (Corbel and Brinley-Morgan, 1984).

Farrell‘s medium, a selective medium containing antibiotics such as bacitracin, cycloheximide, nalidixic acid, nystatin, polymixin B and vancomycin with 5% horse serum has been used for the isolation of Brucella from contaminated tissues. Culturing on solid media limits the interference by faster growing microbes as the media discourages dissociation which facilitates the recognition of colonies. Alton et al. (1988) reported that colonies were observable on nutrient agar 3 days after incubation, although routinely examination is not undertaken until the fourth or fifth day of culturing. Brucella colonies appear transparent or pale honey colored on serum dextrose agar. Colonies are upraised and convex with a smooth, shiny surface. The growth of Brucella in liquid medium was poor and culturing on static liquid medium accelerated the dissociation of smooth to non-smooth forms. Furthermore culturing in liquid medium has reported to require a longer incubation period (Mayfield et al. 1990).

Biphasic medium of Farrell‘s medium and a liquid phase of Bordie Sinton‘s medium are commonly used as additional growth medium for the isolation and identification of Brucella from heavily mix contaminated samples. It has been found that culturing on biphasic medium increases detection (positive cultures) by 64.8%, compared to isolation on solid medium (Corner et al., 1985; Hornitzky and Searson, 1986).

2.7.3 Biotypes of Brucella

The importance of biotyping Brucella is to provide epidemiological information, to establish the agent‘s characteristics and to facilitate control programs (Crawford et al., 1990). Each type of Brucella consists of several biovars or biotypes. Brucella abortus is composed of eight biovars and B. melitensis nine (Corbel and Brinley-Morgan, 1984). Each biovar may contain many different strains. Biovar 1 of B. abortus is the most prevalent biovar in cattle, but is also found in other species, including sheep and goats, buffalo, horses, camels, and humans (Hendricks and Meyer, 1975; Shaw, 1976). The Biovar 2 has also been isolated from cattle in New South Wales (Hornitzky and Searson, 1986).

The two common ways for biotyping are phage typing, which depends on lysis of the bacterium by phages, and a comparison of oxidative metabolic profiles on selected amino acids and carbohydrate substrates (Alton et al., 1988). However the latter method can be hazardous, time consuming and requires specific facilities. Biovars of B. abortus can also be differentiated by their utilization of CO2, production of H2S, growth on media with dyes and reactions with monospecific antisera (Corbel et al., 1983; Crawford et al., 1990).

Corbel and Brinley-Morgan (1984) demonstrated a significant amount of DNA homology in species within the genus and similar polynucleotide sequences have been detected. As a result, the usual biotyping tests may not always reveal the full extent of the differences between biovars, especially where the differences rely upon a single characteristic. Aldrick (1968) highlighted the importance of biotyping isolates as soon as possible after culturing due to the unstable nature of colonies which may not be visible after repeated subculturing.

2.7.4 Molecular detection and identification

Even though several tests have been developed for diagnosis of brucellosis, still there are various challenges facing its diagnosis. Inability to detect Brucella antibodies in latent and chronic carriers and at an early stage of infection and cross-reactions are limitations of serological tests. The other drawback is no distinction in the vaccinated and animals naturally infected. The cost of the assay, the epidemiological situations present, facilities available and

32 experiences of the personnel involved in the laboratory must all be considered when deciding which test or tests to adopt. The ELISA and CFT are the preferred tests for confirming results of the RBPT, which is an ideal screening test because of its high sensitivity. Detection and identification of Brucella have been established on phenotype characteristic analysis (biotyping) and cultural analysis. Even though these tests provide valued information about the organism, biotyping is a time consuming and extremely specialized method which requires skilled staff and performed in biological controlled laboratory using non-commercial reagents and well-optimized tests (Bricker and Halling, 1994; Mercier et al., 1996).

The polymerase chain reaction (PCR) is used worldwide, which is one most common diagnostic tool to detect, identify and differentiate the various species and strains of Brucella (Allardet-Servent et al., 1988). PCR has got many advantages over conventional techniques used for identification and differentiation of the organism. PCR is performed in less time and results being obtained within a few hours. Furthermore, it did not require handling of infectious samples, not expensive and can be automated.

PCR assays initially were constructed on the basis of detection of bcsp31 genes and 16S rRNA (Baily et al., 1992; Herman and Deridder, 1992). Techniques founded on detection of the bcsp31 genes and 16S rRNA amplify a DNA segment, which is common in all Brucella species (Velasco et al., 1998; Scholz et al., 2008b). The IS711 molecular element has become the ideal target for identification by reason of its restricted occurrence in Brucella organism, permitting matchless sensitivity and can be used directly on clinical samples for testing Brucella (Halling et al., 1993; Ouahrani-Bettache et al., 1993).

First PCR assays to identify and differentiate between different species of Brucella was established by Bricker and Halling in 1994 and named as AMOS-PCR, which differentiate the most important species included Brucella abortus–melitensis–ovis–suis. For numerous years, various diagnostic test centers utilized AMOS-PCR to differentiate pure cultures isolates as Brucella abortus–melitensis–ovis–suis. Identification of all Brucella species and all their biovars could not be attained through this PCR. During the last decade Garcia-Yoldi and coworkers developed novel conventional Bruce-ladder multiplex PCR utilizing primer pairs (eight) in one step which differentiate all species and biovars of

Brucella (Garcia-Yoldi et al., 2006; Lopez-Goni et al., 2008; Mayer-Scholl et al., 2010). Even though improved Bruce-ladder multiplex PCR permits correct species delineation, disparity at the biovars, or below, is not possible. Correct species and biovars demarcation can be accomplished by multilocus sequence analysis or MultiLocus Sequence Typing (MLST) and Single Nucleotide Polymorphism (SNP) analysis. Phylogenetic reconstructions of various species of Brucella can be constructed through the use of multilocus sequence analysis, due to the clonal growth and evolution of species of Brucella. In outbreak investigations both species detection and distinction of field isolates can be done through the multilocus variable number tandem repeats analysis and hence signifies seamless first-line important molecular epidemiological tool (Whatmore et al., 2007). In recent times, whole genome sequencing used increasingly and replaced single nucleotide polymorphism typing for the reason that it delivers a rapid detection and incomparable wealth of data at unbiased approach and cost closer to earlier termed assays. Numerous isolates are at present being analyzed and sequenced for whole genome SNP discovery (Gopaul et al., 2008). These novel methodologies assist in further understanding of the host specificity, evolution and pathogenicity of the genus Brucella. Many assays based on SNP have been defined in recent times that can identify very rapidly Brucella isolates upto their species and strains (Foster et al., 2008), differentiate vaccine strains from the non-vaccine organism strains (Gopaul et al., 2010) and also recognize and classify the organism up to biovars (Fretin et al., 2008). Moreover, advanced foremost modern genome-driven development is the exploitation and identification of tanem repear in DNA as typing tools. Based on Variable Number of Tandem Repeat (VNTR) typing technique are valuable in identification of Brucella which which have no trace-back records (Bricker et al., 2003; Le Flèche et al., 2006; Whatmore et al., 2006). Both VNTR and MLSA based studies demand the identification of few biovars to be recognized by microbiological isolation mainly of B. melitensis biovars (Al Dahouk et al., 2007a). In the long run the use of these methods should permit the detection of transmission chains, of internationally or nationally prevalent clusters and detection of emerging and new strains. The VNTR analysis also used to identify risk factors and pathogenic properties of different genotypes as it link genotypes of the organism to background epidemiological data. It's also proven extremely efficient in confirming infection acquired professionally or from the laboratory (Valdezate et al., 2010; Marianelli et al., 2008), in illustrating outbreaks

(Lucero et al., 2010), in differentiating decline after re-infection (Kattar et al., 2008), in measuring solidity of the vaccine (Garcia-Yoldi et al., 2006) and identifying different genotypic associations with profile of different pathogens (Nöckler et al., 2009).

Although Bricker and Halling (1994) reported that the sensitivity of the PCR could be reduced by contamination, Da Costa et al. (1996) considered that its sensitivity was its main advantage. However, the assay has to be performed under strict standardized conditions which are not always available in laboratories. Pulsed field gel electrophoresis (PFGE) is a endonuclease restriction investigation that has been used to study the relationship between strains of Brucella species. The technique has been found to be helpful in classifying the genus as it detects differences between DNA fingerprints of species and biovars. Unlike other techniques which produce a large number of small DNA segments, Tcherneva et al. (1996) demonstrated that the PFGE could split DNA into a small number of large segments. The enzymes (Xho I) and (XbaI) have been shown to divide, the DNA into more than 25 bands of different intensities (Allardent-Servent et al., 1988). After digestion by XbaI, Brucella can be clearly differentiated into species based on their unique DNA fingerprints. However, the technique was unable to clearly differentiate biovars (Allardent-Servent et al., 1988). However, in the study by Jensen et al. (1995) it was demonstrated that the PFGE could distinguish field isolate of B. abortus biovars 1, 2 and 4 from that of RB51 vaccine strain. Although PFGE has several advantages, it suffers from the disadvantage that the concentration of DNA cannot be altered after the agarose is prepared and therefore the migration of the DNA molecules is influenced by the total DNA concentration (Li et al., 1989). Consequently the technique has been modified by immersing cells in agarose prior to lysis. This keeps the large DNA molecules intact during the diffusion of the detergent and protease (Schwartz and Cantor, 1984).

2.8 Treatment, prevention and control of Brucellosis

2.8.1 Treatment

Treatment of animal brucellosis is very difficult as the organism is intracellular which resides in macrophages (Metcalf et al., 1994). Although there is no effective treatment for bovine or swine brucellosis, canine brucellosis has been treated successfully through the

35 administration of combinations of antibiotics. Sulfadiazine with streptomycin and oxytetracycline are commonly used drugs to treat the infection. Treatment of udder of diseased cattle with infusions of antibiotics also been used, though successful control of the disease was not achieved (Corbel, 1977; Radostits et al., 2000). de Bagues et al. (1991) and Radwan et al. (1995) have also established the effectiveness of streptomycin and oxytetracycline to treat animals from infection of B. melitensis or B. abortus. Oral subtherapeutic use of chlortetracycline and vaccination with strain 19 did not restrict the development of antibodies against the disease (Nicoletti et al., 1987). Progressive effect of S19 vaccince was demonstrated when used with injection of oxytetracycline (Smith et al., 1983; Nicoletti, 1990). In end, unless the animals have significant value treatment is not feasible and practical.

In contrast to domesticated animals, treatment of humans with brucellosis with antibiotics has been shown to be successful (Robson et al., 1993; Hendricks et al., 1995; Solera et al., 1997a; b). A prolonged regime of aminoglycosides and doxycycline has been used to treat infected people, including pregnant women. A combination of rifampicin and cotrimoxazole has also been shown to be effective in children (Ariza, 1996).

In general, inadequate treatment can result in debilitating chronic progressions. Therefore, focus of treatment is not only to cure acute ailment, but as well as to avoid relapses and complications. Antibiotics including streptomycin, doxycycline, rifampin and co-trimoxazole are used for longer period of time as chemotherapeutic treatments. Regimens of treatment in humans recommended are: a mixture of oral rifampicin 15 mg/kg/day and doxycycline 100 mg 12 hourly over 6-week duration. The administration has the benefit of lower relapse rates. For effective treatment therapy of chronic disease and focal complications, a combination of three or four of the antimicrobial drugs listed earlier for a longer period of time (>45 days) is recommended (Corbel, 2006; Ariza et al., 2007).

2.8.2 Prevention and control of brucellosis

Brucellosis is usually introduced to a herd through direct interaction with infected animals and or semen of diseased males. To prevent its introduction new animals should be purchased from Brucella-free herds and new animals should be isolated and screened before

36 they are added to the herd. Semen also should be evaluated or collected from disease free bulls before it is used for artificial insemination. However, managing the disease in endemic areas where animals co-graze can be difficult unless a vaccination program is also implemented.

The Rev-1 vaccine (live-attenuated B. melitensis) is only vaccine existing for B. melitensis, and shown to give response in preventing brucellosis in sheep and goats (Blasco, 1997). However, when administered by the classic subcutaneous route (individual doses of 1×109–2×109 cfu), a lifelong serological response of Brucella helps in eradication of disease based on test and slaughter policy. When the same vaccine is administered by the conjunctiva (at the same dose, but in a smaller volume), the immunity produced is similar to that persuaded by the classic s/c method, even though the serological response is significantly decreased making it suitable for use in an eradication program (Blasco, 1997). However, this type of program is still out of the reach of many countries that have only elementary veterinary services and limited economic resources. In these cases, a mass vaccination campaign is the only reasonable alternative to control brucellosis. Unfortunately, pregnant animal vaccinated (Rev-1 vaccine) subcutaneously can result in abortions and the excretion of Rev-1 strain in milk (Blasco, 1997). Reduction of the Rev-1 dose (103 to 106 cfu administered subcutaneously) has been reported to avoid these significant adverse reactions while still inducing effective protection (Al Khalaf et al., 1992). However, field and experimental data suggest otherwise. As an alternate to vaccine decreased dose as compared to standard dose of Rev-1 should not be recommended (Fensterbank et al., 1982). Due to the risk of abortion, no safe strategy of mass vaccination is yet designed. Even vaccination through conjunctiva is not safe to be used irrespective of the animal pregnancy status. It is recommended that Rev-1 should not be used in mid-gestation animals, the main critical period for abortions. However, this is impractical under field conditions, and some of the risks have to be assumed if the objective is to control the disease. Vaccination through conjunctiva before the start of the mating season, during the late stages of the lambing season, or during lactation are the safest approaches to performing a whole-flock/herd vaccination program (Blasco, 1997). This modified-live vaccine also has a very slight chance of infecting humans (Blasco and Díaz, 1993).

Accordingly, some Biosafety measures (wearing protective glasses and gloves) and educational campaigns are needed to reduce the risk of infection in humans. In the situation of accidental injection with Rev-1strain, a combined doxycycline-gentamicin or doxycycline- rifampin treatment should be administered (Blasco and Diaz, 1993; Ariza et al., 2007).

One of the key disadvantages of vaccination is the potential interference with serological assays. The diagnostic epitopes involved are located in the O-polysaccharide section (a homopolymer of N-formylperosamine) of the B. melitensis S-LPS immunodominant surface antigen (González et al., 2008). Research to improve the vaccines by removing these S-LPS epitopes (i.e., to develop a rough-R-vaccines) has been conducted. Live rough Brucella acquired by common attenuation methods, is the B. abortus RB-51 vaccine. However, its efficacy and safety with regard to bovine brucellosis is questionable (Mainar-Jaime et al., 2008). Finally, Villarroel et al. (2000) described human infections with RB51 and the strain is resistant to rifampicin, an antibiotic commonly used to treat ailment of human brucellosis. Therefore, it is recommended that RB51 should not be used for vaccinating small ruminants. Other research efforts in developing R vaccines have resulted in candidates of low overall efficacy . Whereas, R candidate vaccines do not interfere with the classic serological tests (RBPT and CFT) this is not the case for the ELISAs. Using Smooth lipopolysaccharides (S-LPS) or its hydrolytic LPS as antigens, a section of ewes vaccinated with R candidates have been classified as seropositive to an indirect ELISA (Barrio et al., 2009). This outcome was not unexpected, as R mutants produce antibodies to the core epitopes also present in the wild-type Smooth lipopolysaccharides (S-LPS) and hydrolytic LPS. Core epitopes are not easily reached on the complete S Brucella which is used as antigen in CFT and RBPT, nevertheless core epitopes exposed on adsorption to ELISA plates and, hence, avert a distinction of the R and S Brucella antibody responses. This problem is likely to affect all R vaccines, including RB51. Mainar-Jaime et al. (2008) reported that a significant proportion of cows abort as a consequence of vaccination with RB51 and also develop antibodies which react on ELISA tests. In conclusion, the potential advantages for R vaccines are questionable because these are not safe in pregnant animals and excreted in milk of vaccinated animals and reduced efficacy as compared with S19 and Rev-1 vaccines and may also infect humans (Moriyón et al., 2004).

To develop new-generation vaccines further approaches such as the creation of DNA- based vaccines and recombinant strains with missing relevant proteins are also being studied. Rev-1 vaccine strain with a deletion of the gene coding for BP26 protein (differential indicator) has been revealed to induce the similar protective efficacy of the Rev-1 vaccine in small ruminants (Jacques et al., 2007). It also showed efficacy against B. ovis infection in rams, however evaluation of the performance of the BP26-based differential diagnostic test is limited (Grilló et al., 2009).

However, none of the new-generation vaccines have been shown to have improved efficacy and safety over the classic Rev-1 vaccine and it has been recommended that Rev-1 should remain the reference vaccine for the control and prevention of brucellosis in small ruminants (Blasco, 2006).

Independent of their origin, the Rev-1 vaccine and the tests used to diagnose the disease should always be submitted for quality control to internationally recognized laboratories, and should fulfill the minimal requirements described by World Organization for Animal Health (OIE, 2016). A country‘s veterinary services must select a control or eradication approach compatible with the socioeconomic conditions and infection status of that country. The effect of brucellosis on both the livestock economy and human health as well as the costs of the different strategies must be evaluated as part of this practice. Several aspects, such as knowledge of livestock management and breeding practices, the habits of the community and the availability of adequate human resources to carry out the program, must also be evaluated. Moreover, cooperation between all related stakeholders is of paramount importance and should be promoted. Teamwork among the veterinary services and public health has encouraged by the formation of a national zoonoses organization (Metcalf et al., 1994).

Although vaccination can interfere with serological testing, this strategy is central to protect susceptible livestock. However, this interference is minimized when animals are vaccinated at a younger age. In endemic countries, several strategies have been designed to eradicate and or control the disease. Technical training is required for any sanitary strategies to be implemented and campaigns for awareness of general population as well as farmers.

The most common strategies to control infection with B. melitensis in small ruminants include blanket whole-flock/herd vaccination or testing and slaughtering (Blasco and Molina, 2011).

The use of vaccination to increase disease resistance in herds is important in these strategies and it has been demonstrated that in cattle, vaccination was the most effective control measure. In California the prevalence in dairy and beef herds was nearly 87% lower after vaccination for ten years (Nelson, 1977). However, a study has shown that for any successful prevention, 70% of a herd‘s population needs to be immunized (Berman, 1981). However Metcalf et al. (1994) reported that vaccination alone, without the adoption of any other control measures, was of doubtful value. Consequently, other measures, including movement restrictions and management changes, are also required to be adopted in conjunction with a vaccination campaign.

Many attempts to control and eradicate B. melitensis infection or to reduce prevalence of brucellosis at a minimum acceptable level has been made in several countries. In 1995, test-and-slaughter approach to control the disease in of goats was initiated in Algeria; though after three year duration was replaced with a mass vaccination campaign. Regardless of age mass vaccination with Rev-1 strain through conjunctival route was carried out all over the country (Tunisia), to prevent spread of epizootic infection of brucellosis in 1991. A similar methodology for control was also executed in 1996 in eastern Morocco. Concurrently, an epidemiological survey to check the prevalence of brucellosis was conducted which confirmed the nonappearance of infection in small ruminants throughout the country (Benkirane, 2006). Sheep and goats kept under an intensive farming system was tested and identified with the RBPT and SAT in 1983 in Iran. Positive animals identified were then culled. After this campaign animals were vaccinated with Rev-1. Strategy gave rise to decrease of brucellosis disease burden from 3.2 to 0.5% between the years 1983 to 1996. For flocks kept under an extensive husbandry system young animals were vaccinated with Rev-1, although seropositive animals were not removed. In this group the proportion of seropositive animals had reduced from 3% in 1994 to 2.2% in 1998. Kuwait also started yearly basis mass vaccination program in 1993, applying a lesser amount of Rev-1 vaccine that is 1/50th dose, administered s/c (Al-Khalaf et al., 1992; Crowther et al., 1977).

Several vaccines have been produced to protect cattle, sheep and goats and swine against infection with Brucella. In endemic areas, RB51 and S19 are the most common vaccines to control B. abortus infection while Rev-1 vaccine is mostly used to control infections with B. melitensis.

2.8.2.1 Vaccines and vaccination

2.8.2.1.1 Strain 19 vaccine (S19)

Strain 19 vaccine is used extensively for prevention of B. abortus infection throughout the world and considered as reference vaccine. The vaccine was produced initially in 1939 in USA and was applied in the field conditions in 1941. It contains a live attenuated organism which was subcultured 19 times and isolated from milk (Nicoletti 1990). The S19 strain was immunogenic, less virulent, grow in absence of erythritol and remain viable after lypholisation (Jones et al., 1965; Sangari et al.; 1996). Vaccine is directed as a single s/c dose having 5-8 x 1010 cfu at three to six months at age of calves. To animals of any age group vaccine can be administered at less dose of 3 x 109 cfu via the conjunctival route. Conjunctival route is more advantageous as compared to others as it has gor less chances of abortion, it provokes protection without persistent antibodies present in the blood stream and lastly the organism is not expelled in the milk.

Besides of S19 vaccines so many advantages, many of limitations boundries of the vaccine have also been documented in the literature. Among these, first and most important is that if the vaccine is given in late period of the pregnancy it could result in clinical infection (Crawford et al., 1978; Nicoletti et al., 1978a). Secondly, few authers stated that vaccine could result in excretion of the organism in the milk after vaccination and ultimately increases the risk of transfer of the disease organism to other animals and associated persons (Breitmeyer et al. 1992). Nicoletti (1977), Corner and Alton (1981) discribed that vaccination may also results in infection. Crawford et al. (1978) isolated the vaccinal strain after 5 months of vaccination from cattle kept in farm settings; in adult beef cattle the organism was not isolated from the LN (lymph nodes). Nicoletti (1977), Beckett and MacDiarmid (1985) observed as a major drawback of the vaccine that it may result in abortion in pregnant cows. Though, others scientists worked to check the vaccinal strain have

41 not detected any bad influence of the organism on the pregnancy of the animals (Corner and Alton, 1981).

Erythritol tolerant mutants produced from S19 vaccinal strain as result from passage of the organism are believed to be cause of the side effects. In vaccinated pregnant cows S19 mutants are thought to be a reason of abortions or infection. Though, except few authers many of others scientists checked and recommended S19 vaccine at any stage of the gestation in animals (Barton and Lomme, 1980; Nicoletti, 1976).

Another limitation of S19 is the presence of persistent antibodies which may interfere with serological assays. Nicoletti (1985) reported that the presence of these antibodies was influenced by the age and pregnancy status of the animal at vaccination and the dose administered. Alton et al. (1980) found that approximately 0.5% of animals vaccinated at a young age developed persistent antibodies. However, Beckett and MacDiarmid (1985) demonstrated that cattle vaccinated as calves had a lower titer than did those vaccinated as adults. As a consequence of these persistent antibodies, false positive reactions must be considered when interpreting the results of serological surveys. Therefore, Nicoletti (1990b) recommended a decrease in the disease burden of bacteria in the vaccine in order to decrease these undesirable antibodies. Several authors have demonstrated that the antibody level decreases six months post-vaccination eventually reaching non-detectable levels. Consequently, it is recommended that the time of vaccination be accounted for when considering serological results and that all vaccinated animals should be identified (Worthington et al., 1973; Nicoletti et al., 1978a).

The pathogenicity of S19 vaccine for humans is also a disadvantage of the vaccine as it can lead to necrosis and swelling of infected tissues. It also causes orchitis in male cattle during the first 10 days of vaccination and post vaccinal arthritis in calves. However the protective nature of S19 has been highlighted by many authors (Alton 1978; Erasmus 1995) if administered at 4 to 8 months of age.

In conclusion, although S19 has some limitations, the vaccine is ideal for the control of bovine brucellosis and it is relative safe, easy to use and has high immunogenicity leading to stimulation of immunity in a range of animals.

2.8.2.1.1 Strain RB51 vaccine

RB51 vaccine is a mutant of infectious strain of B. abortus (S2308) which are deficient in O-antigen. To prevent and better control and to overwhelmed the limitations and disadvantages of the strain S19 vaccine the RB51 vaccine was proposed and been used widely over the globe to control the brucellosis especially in cattle (OIE, 2016). Nevertheless, regarding the efficacy of vaccine different authers have observed conflicting results. RB51 vaccine was demonstrated to result in abortions in a few cases as compared to S19 strain vaccine (Palmer et al., 1996a). False positive results in serological tests may be observed in RB51 vaccines cellular immunity. Additionally, vaccinated animals and naturally infected animals are differentiated because of lack of O-antigen in the vaccinal strain.

In defferent countries the dose rate and route of administration of vaccine varies. In calves RB51 vaccine was used widely in USA at four to twelve months of age and injected with 1-3 x 1010 cfu of dose subcutaneously. Nonetheless, adult cattle and calves in other countries vaccinated with 2 times in a year to improve immunity of the vaccinated animals. Palmer et al. (1996) have detected the vaccinated RB51 strain in milk and reported abortion in the vaccinated bison and cattle (Palmer et al., 1996b). That is why, it is not recommended to vaccinate the animal at an early stage of pregnancy except the dose is decreased from its normal dose. However, no side effects are observed in the late stage pregnant animals administered with decreased dose of vaccine and the organism may shed in the secreations in significant amount.

RB51 is likely to produce infection in humans as S19 strain vaccine in human. However, studies related to RB51 vaccinal effects in humans are very limited. As RB51 strain is resistant to so many of the antibiotics including streptomycin and rifampicin, so the infection developed through this organism is very difficult to treat. Similarly, infection in humans requires a specific test for the diagnosis of the disease (Villarroel et al., 2000).

2.8.2.1.1 Brucella abortus strain 45/20 vaccine

The inactivated vaccine 45/20 was initially made through dissociation of a rough strain after passaging strain 45 in guinea pigs (Avila-Calderon et al., 2013). Although the

43 vaccine has good immunogenicity, it is not widely used due to several drawbacks. Firstly, the vaccine organism can revert to a smooth form resulting in infections. Secondly, non- agglutinating antibodies play a role in blocking the antigen of smooth strains resulting in delayed clearance and increasing the likelihood of chronic cases developing. Finally, a lesion can develop at the injection site. After the priming vaccination no serologically response is detectable, although low levels of antibodies are stimulated within 10 days of administering a second dose (Hall et al., 1976). The vaccine can be used at any age and during pregnancy (Alton, 1978).

2.8.2.2 Control of B. melitensis

Although the application of a test and slaughter strategy can be an effective way for the control and eradication of B. melitensis, this method is not always applicable in areas where the prevalence of disease is high and where socioeconomic obstacles exist for the disease control. Consequently, control programs based on vaccination are suitable to reduce the prevalence of the disease to an acceptable level prior to implementing an eradication campaign. It is now recommended that a combination of vaccination of young animals and culling of infected adults is the most practical way to control B. melitensis (Blasco and Moriyon, 2005).

2.8.2.2.1 Classical B. melitensis REV-1 vaccine

Rev-1 is an attenuated strain of virulent B. melitensis obtained in the 1950‘s (Elberg and Faunce, 1957) and is reported to be the best isolate of B. melitensis for incorporation into a vaccine (Blasco, 2006). Alton and Elberg (1967) demonstrated the efficacy of the vaccine after vaccination of cattle 3 to 6 months of age as well as in adult animals. The vaccine has been shown to induce a high and durable immune response (Blasco, 1997).

The vaccine can be administered via the subcutaneous (S/C) or conjunctival route in both young and adult animals. However the S/C vaccination of young animals (3 to 6 months of age) with a standard full dose can result in persistent infection, which interferes with the subsequent serologic assays (Fensterbank et al., 1982). However, this is not an issue if the aim is to induce the highest level of immunity in animals and not eradication of infection. In

44 contrast, vaccination via the conjunctival route confers adequate protection in young animals without interfering with serological assays (Marin et al., 1999).

Although Rev-1 has some advantages it can result in infection of humans if accidentally inoculated (Blasco and Diaz, 1993) and has the potential to infect rams (European Commission, 2001). The vaccine may also induce abortions in sheep and goats if animals are vaccinated during pregnancy. Even reduced doses of Rev-1 are not totally safe and may not induce effective protection in sheep (Fensterbank et al., 1982). Blasco (1997) recommended the use of a standard (full) dose via the conjunctival route to minimize the risk of abortion.

In conclusion, vaccines (S19 and Rev1) are useful for the control of brucellosis, especially if used in young animals (3 to 6 months) in countries with a high prevalence and limited resources. However, the level of protective immunity developed, safety issues in both male and females, interference with serological assays, duration of immunity and the standardization of the vaccine are potential areas of concern with brucellosis vaccines.

CHAPTER 3 MATERIALS AND METHODS

The present study was undertaken to determine sero-prevalence, detect Brucella species in naturally infected animals (cattle, buffalo, sheep, goat and camels) and experimental study of patho-morphological changes in goats. Since the primary objective of the study is to detect Brucella species involved in the causation of disease in animals, an inclusive protocol was followed to collect samples from farm of animals at risk or have a history of recent abortion. To this end, blood samples were collected from cattle, buffaloes, sheep, goats and camels residing in different locations/farms in Punjab, Pakistan. The samples were first screened with RBPT and then further confirmed by cELISA. Molecular detection through conventional and real time PCR using genus and specie specific primers was performed. For patho-morphological studies, goats were given infection of Brucella melitensis through the conjunctiva. The animals were observed for signs and symptoms of brucellosis and dynamics of the disease. After three weeks of inoculation, the morbid tissue samples were collected for observations of histomorphological changes in different organs.

3.1. Study Area

Pakistan is one of the countries located in subcontinent which covers 796,095 sq. km of area. It shares borders in the south with the Arabian Sea. In the north it stretches to the Karakoram and Hindukush Mountains ranges. Pakistan shares borderline with India in the East. It shares borders with Afghanistan in the North West and in the West with Iran. It also shares borders with China in the North. Above the tropic Pakistan is situated mostly in the temperate zone of the world. The climate differs from temperate to tropical (subtropical), and temperature extremes are also highly varied. Similarly, rainfall varies from as high as 150 inches in year to as low as 10 inches in a year. Pakistan has five provinces, i.e., Khyber Pakhtunkhwa (KPK), Sindh, Baluchistan, Punjab and .

Among these provinces second largest province in relation to area (205,344 km2) is Punjab after Baluchistan which has 36 districts. Most of the areas province Punjab has warm winters, accompanied by rain few times in a season. The largest and capital city of the Punjab

46 is Lahore. Other vital and big cities of province Punjab include Faisalabad, Multan, Sialkot, Sheikhupura, Rawalpindi, Jhelum and Gujranwala.

3.1.1. Study Locales and Sampling

Since the primary objective of the study was to detect Brucella species involved in causation of disease in animals, a purposive sampling was undertaken was followed to collect samples from farms of animals with history of recent abortion with consent of the farmer to have collection on positive samples for molecular analysis. Therefore, farms with history of ongoing abortion were pulled out from the sampling farm. To this end, blood samples (n=3643) were collected in gel and clot activator vaccutainers (Xinle®, China) from different animal species including cattle, buffalo, sheep, goat and camel from different districts of Punjab, Pakistan (Table 3.1) and transferred to laboratory. The samples were subjected to centrifugation (5000 rpm for 8 min) for curing serum. The serum samples were preserved at - 40 °C till further testing.

Both animal and herd level information was registered by the candidate on a structured questionnaire as described elsewhere (Appendix-1). The important information, including location, type (single/mixed), size of herd, vaccination history and methods of disposal of abortive fetuses at farm was recorded. Significant animal level data, including age, breed, breeding method, lactation status, pregnancy status and other reproductive disorders were also collected from the animal records.

Table 3.1 Sampling plan to detect Brucella species in different animal species from different districts of Punjab, Pakistan

Sr. Animal Samples District where from samples collected No. Species collected 1 Cattle 1149 Faisalabad, Gujrat, Gujranwala, Okara, Sahiwal, Sargodha and Hafizabad 2 Buffalo 360 Faisalabad, Okara, Nankana and Toba Tek Singh 3 Sheep 281 Layyah 4 Goat 1092 Faisalabad, Layyah, Muzafargarh 5 Camel 761 Faisalabad, Jhang, Muzafargarh, Bhakkar, Layyah and Bahawalpur

Figure 3.1 Map of Punjab Pakistan showing sampling plan to detect Brucella species in different animal species from different districts (1. Cattle, 2. Buffalo, 3. Sheep, 4. Goat, 5. Camel)

3.1.2. Serological and Molecular investigations a. Rose Bengal Plate Agglutination Test (RBPT)

Reagents

For serologic testing, RBPT antigen was procured from Veterinary Research Institute, Lahore and control sera was raised in rabbits against RBPT antigen.

Materials and Equipment

Micro titration pipettes, mechanical rotator, applicator sticks, glass slides and light source.

Procedure

For Rose Bengal plate test (RBPT) control positive sera was raised in three rabbits following the protocol mentioned below, using the Rose Bengal antigen procured from VRI, Lahore:

Day Dose (mL)/Route Intravenous 1 0.2 3 0.4 5 0.6 7 0.8 9 1.0

At day 14, post booster, blood samples were collected and serum was separated and stored at -40 °C for further use as control positive. The RBPT was performed following the procedure described by Brown (1974). Briefly, i. A drop (~30 µL) of the serum was placed in the center of a clean glass slide. ii. A drop (~30 µL) of each of negative and positive control sera was delivered at the corners of same slide. iii. One drop (~30 µL) of antigen suspension was placed along the side of each drop of test, negative and positive control sera. iv. After mixing separately, result of agglutination was noted after 2 to 4 min.

b. Competitive Enzyme Linked Immunosorbent Assay (cELISA) All samples tested positive in screening were subjected to commercial ELISA (Savanova®, Sweden) for confirmation. Manufacturer instructions of conducting ELISA were strictly followed for testing (Brucella-Ab cELISA, art # 10-2701-10). i. Sample dilution buffer (45 µL) was added to control wells and then 5 µL of strong positive, weak positive and negative control serum were added to marked duplicate pre-coated antigen wells. Two wells were designated as Conjugate Control.

ii. After it, 50 μL of mAb-Solution was added into all wells used for controls and samples.

iii. Plate was sealed and then by tapping the plate the reagents were mixed thoroughly, after that the plate was incubated at room temperature (18-25 °C) for 30 minutes.

iv. After incubation, PBS (Tween buffer) was used to rinse the plate for 4 times.

v. Conjugate (100 μL) having antibodies with HRP enzyme was added and then again the plate was incubated at room temperature for a period of 30 min.

vi. Plate was washed again with PBS four times, and vii. Substrate (100 μL) solution (tetramethylbenzidine) was added to the plate and plate was kept at room temperature for 10 min. viii. Finally, 50 μL of stop solution was pipeted.

ix. Ooptical densities (OD) of test-sample and control were measured at 450 nm wavelength with ELISA plate reader (Bio-Rad®).

Results were interpreted accordingly.

(Mean OD of Sample/Cont. X 100) PI (percent inhibition) = ------Mean OD of Conjugate Control Cc

For serum samples, a PI more or equal than 30% was taken as positive.

c. Molecular detection and identification

DNA Extraction

Genomic DNA was isolated from all ELISA positive serum samples by commercially available DNA extraction kit (Favorgen®, FABGK001) using the manufacturer‘s protocol.

1. Sample (200 μL) was added with 200 μL of Cell lysis buffer (FATG) and 20 μL of Proteinase K. Mixed thoroughly by pulsed vortexing to obtain a homogeneous solution and Incubated at 60 °C for 1 hr with pulsed vortexing after each 15 min interval. 2. Absolute ethanol (200 μl) was mixed by pulsed-vortexing. 3. Sample was transferred to column tube assembled in a clean tube and Centrifuged at 10,000 x g for 1 min. 4. Then the column was shifted to new clean tube. 5. Wash Buffer (500 μL) was added to the column and centrifuged at 10,000 x g for 1 min. 6. Column washing was repeated once again with wash buffer (500 μL). 7. Column was then shifted to a micro centrifuge tube.

8. Preheated Elution Buffer (100 μL) was poured onto membrane of column and incubated for 2 min and then centrifuged for 1 min at 10,000 x g to elute DNA. 9. The extracted DNA samples were stored at -40 °C till analysis.

Molecular Analysis through conventional Polymerase chain reaction (c-PCR)

During the primary runs, samples were tested for the detection of genus the Brucella using primer set of BCSP-31 gene. The samples tested positive for Brucella genus, were subjected to PCR using further two sets of primers including BMEII0466 and BruAb2_0168 for the differentiation of species involved (Table 3.2). Conventional PCR reactions were executed in Thermal Cycler (BIORAD®) machine in 25 μL reaction mixture containing 12.5

μL premix (55 mM KCl, 22 mM Tris-HCl, 1.65 mM MgCl2, 220 μM dATP, 220 μM dGTP, 220 μM dCTP, 220 μM dTTP, stabilizers and Taq DNA Polymerase 22 U /mL), 10 pmol of each primer and 2.0 μL of test DNA template. PCR reactionn mixture was exposed to initial denaturation of 94 °C for 2 min, followed by 35 cycles of (denaturation at 94 °C for 15 sec, annealing at 57 °C for 30 sec, and elongation at 72 °C for 1 min) in a thermal cycler. A final extension at 72 °C for 15 min was performed.

Gel Electrophoresis

1. Preparation of agarose gel a. Agarose (0.4 gm) was dissolved in TAE Buffer (40 mL) under heat in a microwave (several short intervals) until the solution becomes clear. b. Gel liquid solution was cooled to 50-55 °C, swirl the flask infrequently to uniformly cool the agarose solution. c. Then 1 % Ethidium Bromide 1.5 µl (0.5 ng/mL of gel) was added into the liquid gel solution to stain the DNA. d. Both ends of gel casting tray were sealed with tray dams. e. The liquid agarose gel was decanted in gel casting tray and 8 slots were made using a comb and then left to cool until it is solidified. f. After solidification of gel prudently remove the combs and pull out the tray dams and gel was then positioned in the chamber of electrophoresis.

g. TAE Buffer was poured in the electrophoresis chamber to completely dip the gel into the buffer. 2. Loading of the gel a. PCR reaction product (20 μL) was mixed with loading buffer (5 μL) and dye was transferred into each slots of the gel. b. 3 μL of DNA ladder (100 bp DNA ladder, MBI Fermentas) was poured into one slot of each run. 3. Running the gel a. The gel electrophoresis apparatus was conducted into a power pack (Volts = 60 for 45 minutes). b. Lid connecting the electrodes was then placed on the box containing gel. c. Power supply was then turned on to about 60 volts for 45 min. d. The amplicons were pictured under ultraviolet illumination (BDH) using gel documentations system. e. Amplified product fragments were recognized by relating the bands of the amplified products with known DNA size marker and positive control.

DNA Sequencing

DNA sequencing of Positive amplicons were performed through commercial sequencing services, Macrogen®, Korea. Sequence analysis was carried out for confirmation and to detect inter-organism homology.

Sequence Analysis

DNA Sequencing informations obtained were examined by several different servers and bioinformatics tools. At first, sequences were examined by bioinformatics tool named ChromasPro (Technelysium™ Pty Ltd). Later sequence of complementary strands from sequence of reverse strand was generated through online program (http://reverse- complement.com/). Using softwares Basic Local Alignment Search Tool (BLAST), National Center for Biotechnology Information (NCBI) program (http://blast.ncbi.nlm.nih.gov/) sequences were aligned (Tamura et al., 2011; Kumar et al., 2008). Aligned sequences were then linked with other existing sequences on Integrated Microbial Genomes (IMG,

52 http://img.jgi.doe.gov/cgi-bin/w/main.cgi) and using BLAST program (http://blast.ncbi.nlm.nih.gov/) on GenBank. Aligned sequences of the study were then ultimately submitted to GenBank by using BankIt for allotment of Accession Numbers (http://www.ncbi.nlm.nih.gov/WebSub/?tool=barcode). Evolutionary studies based on Neighbor Joining Method (NJM) were carriedout using Molecular Evolutionary Genetics Analysis (MEGA) (Kumar et al., 2008; Tamura et al., 2011) and online available phylogeny analysis program (http://phylogeny.lirmm.fr/phylo_cgi/simple_phylogeny.cgi). Structural elucidations were achieved by using I-TASSER (Zhang, 2008; Roy et al., 2010; Yang et al., 2015; Yang and Zhang, 2015) server.

Molecular Analysis through Real Time Polymerase chain reaction (qRT-PCR)

Reactions of qPCR were carried out by using SYBR® Green Real-Time PCR technique. Each PCR reaction mixture of 25 µl (duplicate) was having 12.5 µl of 2× SYBR Green PCR Super Mix (Life Technologies®, UK), 1.0 µl (20 pmol) of each forward and reverse primers and 2 µl (100 ng) of template DNA was prepaired. The qPCR was carried out in Thermo Scientific PikoReal 96 Real-Time PCR system (Waltham, Massachusetts, USA). Two-step cycling protocol was used in thermal cycling machine preset. It comprised of 2 min at 50°C, 10 min at 95°C, followed by 35 cycles of 15 sec at 95°C and 1 min at 60°C. The target genes and their forward and reverse primers are mentioned in table 3.2.

Table 3.2 List of primer pairs for the detection and differentiation of Brucella species Target Primer Sequence (5’-3’) Target References Gene Name Length(bp) BCSP31 B4(F) TGGCTCGGTTGCCAATATCAA 223 Baily et al. B5(R) CGCGCTTGCCTTTCAGGTCTG 1992 BMEII0466 F TCGCATCGGCAGTTTCAA 67 Hinic et R CCAGCTTTTGGCCTTTTCC al., 2008 BruAb2_0168 F GCACACTCACCTTCCACAACAA 81 R CCCCGTTCTGCACCAGACT

3.1.3. Pathological Studies

This experiment was intended in accordance with all national legislation regarding the animal welfare protection and shadowed guiding principles set by Graduate Studies and Research Board (GSRB) of the University. All experimental protocols are approved by GSRB. For this part of study, goats (n=8) were utilized for patho-morphological and molecular studies. To this end, clinically healthy goats free from apparent ailment were utilized. Animals were kept in control house with temperature (24±2 °C), humidity (45-70 %) and 12 hr light-dark cycle. Water and green fodder was accessible to the animals around the clock. Animals used in the study were tested for presence of antibodies against brucellosis by both RBPT and ELISA prior to start of the experiment. Three animals were kept as control and inoculated with 0.5 mL of sterile normal saline through conjunctiva. Five animals were given infection of Brucella melitensis through conjunctiva @ 0.5 mL/animal having bacterial concentration of 1 x 109/mL viable counts. Throughout the experiment animals were keenly observed for any clinical signs and symptoms like dynamics of rectal temperature twice a day, while hematological parameters (RBC, PCV, HB, total leukocyte count and differential leukocytic count) and presence of antibodies against Brucella through RBPT and cELISA were determined on alternative days. After three weeks of inoculation, the morbid tissues were preserved in neutral buffered formalin (10%) after humane slaughtering includes lymph nodes (mammary, internal iliac, bronchial), mammary gland, liver, spleen, lung, and reproductive organs.

Characterization through PCR

DNA was also extracted from above mentioned tissues utilizing commercially available DNA extraction kit (Favorgen®, FABGK001) using the manufacturer‘s protocol and amplified using B4/B5 primers mentioned above for molecular detection of Brucella in these organs to check the localization of the organism.

Histopathology

Histopathologic changes were identified and lesions were recorded and classified in samples by routine method (Table 3.3). Fixed morbid tissues were sliced (5 mm) and washed in tap water overnight to take out the formalin. Then the pieces of tissues were dehydrated in ascending grades of ethyl alcohol. The samples were cleared afterwards in xylene. Infiltration and embedding of tissues was carried out in Paraffin wax. Paraffin embedded tissues were sectioned (3-4 µm) and ribbon of sectioned tissues was placed in water bath (45 °C). On egg albumin smeared slides tissues were then transferred and slides were placed in oven at 60 °C overnight to remove water and to melt the wax present on the slide.

Table 3.3 Tissue processing protocol for histopathology

Protocol Chemicals Time (hours) Washing Tap water 12 Dehydration Alcohol 70 % 8 Alcohol 85 % 8 Alcohol 95 % 4 Absolute Alcohol – 1 2 Absolute Alcohol – 2 2 Clearing Xylene-1 30 Xylene-2 15 Xylene-3 15 Infiltration Paraffin-1 1 Paraffin-2 2 Paraffin-3 2 Embedding (Tissue- Paraffin wax Immediately and stored at 4 °C Tek®, Sakura, Japan)

Slides were stained (Table 3.4) by using method of routine staining through hematoxylin and eosin (Bancroft and Gamble, 2008). After the slides are been stained through H&E staining cover slips were mounted by DPX. The slides were placed at 50 °C for 2 hrs to stand and fix correctly.

Table 3.4 Detailed procedures of hematoxylin and eosin staining protocol

Step No. Staining Agent Time (Minutes) 1 Xylene-1 3 2 Xylene-2 3 3 Absolute Alcohol-1 3 4 Absolute Alcohol-2 3 5 Alcohol 70% 3 6 Water 4 7 Hematoxylin 8 8 Water 5 9 Acid Alcohol 3 Dips 10 Water 3 11 Ammonia Alcohol 3 12 Water 3 13 Alcohol 70% 3 14 Eosin y 2 15 Alcohol 70% 3 16 Absolute Alcohol-1 3 17 Absolute Alcohol-2 3 18 Xylene-1 3 19 Xylene-1 3

3.1.4. Statistical analysis

The Chi-square test for independence was used to determine if the prevalence varied between different genders, age groups, locations, lactation number and pregnancy status. The Fisher‘s exact test was used if any of the cells were less than 5 in a 2 x 2 table. Confidence intervals (CI) were calculated using the Exact Binomial Method for prevalence estimates. Odds ratios (OR) and along with 95 % CI were derived to determine the association between factors and the presence of antibodies to brucellosis. The associations between the outcome response variables (seropositivity) and explanatory variables (information recorded through the Performa) were estimated using binary logistic regression (MINITAB 16 for Windows®).

CHAPTER 4

RESULTS

The present study was undertaken to determine sero-prevalence, detect Brucella species in naturally infected animals (cattle, buffalo, sheep, goat and camels) and experimental study of patho-morphological changes in goats. Since the primary objective of the study is to detect Brucella species involved in causation of disease in animals, an inclusive protocol was followed to collect samples from farms of animals at risk or have history of recent abortion. To this end, blood samples (n=3643) were collected from cattle (n=1149), buffaloes (n=360), sheep (n=281), goats (n=1092) and camels (n=761) residing in different locations/farms in Punjab, Pakistan for serological studies and molecular investigations. Furthermore, experimental study was designed in goats for patho- morphological and molecular studies.

Results of the present study have been presented in following format

4.1: Sero-prevalence of Brucellosis in Livestock species

4.2: Molecular investigations of Brucellosis in Livestock species

4.3: Histo-pathological changes in experimentally induced infection

4.1 Sero-prevalence of Brucellosis in Livestock species in Punjab, Pakistan

Overall sero-prevalence of brucellosis in livestock species including cattle, buffalo, sheep, goat and camel was 12.90% (n=470, 95% CI 11.83-14.03) and 11.83% (n=431, 95% CI 10.80-12.92) through Rose Bengal plate test (RBPT) and competitive enzyme linked immunosorbent assay (cELISA), respectively. Initial screening through RBPT resulted in sero-prevalence of brucellosis in different species as, 26.19 (n= 301, 95% CI 23.67-28.84), 38.88 (n=140, 95% CI 33.82-44.14), 3.41 (n=26, 95% CI 2.24-4.97), 0.23 (n=3, 95% CI 0.06-0.80) and 0.00 (n=0, 95% CI 0.00-1.30) percent in cattle, buffalo, camel, goat and sheep, respectively. Highest sero-prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. In different species sero-prevalence was significantly different in all animal species (χ2(4df)=482.57, p=0.00) statistically. The odds ratio shows that the

57 chances of occurrence of brucellosis in cattle are 0.56 times lower as compared to the buffaloes through RBPT. Similarly, chances of disease in camel and goat population are 0.06 and 0.01 times lower, respectively, as compared with buffaloes (Table 4.1).

Sero-prevalence observed using cELISA was 24.90 (n=286, 95% CI 22.41-27.50), 34.44 (n=124, 95% CI 29.54-39.60), 2.36 (n=18, 95% CI 1.41-3.71), (n=3, 95% CI 0.06- 0.80) and 0.00 (n=0, 95% CI 0.00-1.30) percent in cattle, buffaloes, camel, goat and sheep, respectively. Similar pattern of sero-prevalence was observed with cELISA as that in RBPT, that is, higher prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. Statistically, sero-pevalence was statistically significant (χ2(4df) = 460, p=0.00) among the species under study. Odds ratio of these species as compared to the buffaloes indicates that probability of the brucellosis is 0.63, 0.05, 0.01 times lower in cattle, camel, goat and sheep, respectively (Table 4.1).

4.1.1 Prevalence of Brucellosis in Cattle

Overall, 26.19% (n=301, 95% CI 23.67-28.84) of cattle were seropositive with RBPT and 24.90% (n=286, 95% CI 22.41-27.50) of cattle were seropositive with cELISA. In cattle, prevalence of brucellosis has been determined in relation to different factors like geographical source, sex, age, pregnancy status, lactation number and history of reproductive disorders of sampled animal.

4.1.1.1 Geographic distribution of Brucellosis in Cattles

Samples of cattle were collected from well-organized private dairy farms from seven districts including Faisalabad, Gujrat, Gujranwala, Okara, Sahiwal, Sargodha and Hafizabad of Punjab, Pakistan. Out of 301 (26.19%) positive test samples through RBPT 58.71% (n=64, 95% CI 48.88-68.06) from Okara, 33.65% (n=35, 95% CI 24.68-43.58) from district Gujrat, 30.04% (n=70, 95% CI 24.23-36.37) from Gujranwala, 23.11 (n=52, 95% CI 17.77-29.18) from Sargodha, 17.69% (n=40, 95% CI 12.96-23.31) from district Faisalabad, 18.01% (n=40, 95% CI 13.20-23.72) from Sahiwal. No animal from Hafizabad was found sero-positive for Brucella antibodies. These differences were significantly different in different districts (χ2(6df) =49.01, p=0.00) (Table 4.2).

In cELISA, of 301 (24.90%) positive test samples 16.37% (n=37, 95% CI 11.80- 21.85) from district Faisalabad, 30.76% (n=32, 95% CI 22.09-40.58) from district Gujrat, 28.32% (n=66, 95% CI 22.64-34.58) from Gujranwala, 58.71% (n=64, 95% CI 48.88-68.06) from Okara, 22.22 (n=50, 95% CI 16.97-28.23) from Sargodha, 16.66% (n=37, 95% CI 12.01-22.23) from Sahiwal no sample was sero-positive for Brucella antibodies from Hafizabad. These differences were significantly different in different districts (χ2(6df) =52.36, p=0.00) (Table 4.2).

Results of RBPT and cELISA indicated highest sero-prevalence in district Okara as compared to cattle farms sampled from other regions and the difference in prevalence among different regions was statistically significant (P<0.05) both with RBPT and cELISA. The probability of sero-positivity through RBPT was 2.36, 2.00, 6.61, 1.40 and 1.02 times higher in Gujrat, Gujranwala, Okara, Sargodha and Sahiwal, respectively, as compared with Faisalabad. The chance of occurrence disease through cELISA was 2.27, 2.02, 7.26, 1.40 and 1.02 times higher in Gujrat, Gujranwala, Okara, Sargodha and Sahiwal, respectively, as compared with Faisalabad (Table 4.2).

4.1.1.2 Sex based sero-prevalence of brucellosis in Cattles

Prevalence of brucellosis in relation to sex was 17.52% (n=17, 95% CI 10.55-26.57) in male animals through RBPT. In females, prevalence was 26.99% (n=284, 95% CI 10.55- 26.57) through RBPT. Similarly, prevalence of brucellosis through cELISA was higher in females 25.57% (n=269, 95% CI 22.96-28.32) as compared to male 17.52% (n=17, 95% CI 10.55-26.57) animals. The difference in prevalence both through RBPT and cELISA was statistically non-significant (P>0.05). However, disease prevalence probability was <1 (0.57) in male animals as compared to the female animals using RBPT and probability of disease is 0.62 times less in male as compared to female cattle (Table 4.3).

4.1.1.3 Age based sero-prevalence of brucellosis in cattles

Cattle were divided into four age groups (<3 year, 3-<7 years, 7-<10 years, >10 years). Prevalence of brucellosis was higher in mature animals as compared to younger animals through both diagnostic tests. Through RBPT, Prevalence of the disease was 13.20

(n=33, 95% CI 9.26-18.04), 28.65 (n=102, 95% CI 24.01-33.65), 30.04 (n=76, 95% CI 24.46-36.10) and 31.03% (n=90, 95% CI 25.76-36.71) in <3, 3-<7, 7-<10 and >10 years animals, respectively. Through cELISA, sero-prevalence of brucellosis recorded was 12.00 (n=30, 95% CI 8.24-16.69), 26.68 (n=95, 95% CI 22.16-31.60), 29.24 (n=74, 95% CI 23.72- 35.27) and 30.0% (n=87, 95% CI 24.78-35.63) in <3, 3-<7, 7-<10 and >10 years animals, respectively. These differences were significant in different age groups both using RBPT (χ2 (3df) =17.95, p=0.00) and cELISA (χ2 (3df) =19.10, p=0.00). Logistic regression analysis of RBPT and cELISA based results showed that the disease prevalence probability are 2.64, 2.82 and 2.96 times more in 3-<7 years, 7-<10 years, >10 years animals as compared to <3 years old animals through RBPT. However, cELISA results indicates that probability of occurrence of brucellosis is 2.67, 3.03 and 3.14 times more in 3-<7 years, 7-<10 years, >10 years animals as compared to <3 years old animals (Table 4.4).

Table 4.1: Overall prevalence of brucellosis in livestock species of Punjab Pakistan

Parameter/ Total Percentage SE Co- P Odds 95 % CI Positive Coefficient Specie samples (%) ef Value Ratio RBPT Cattle 1149 301 26.19 -0.58 0.13 0.00 0.56 23.67-28.84 Buffalo 360 140 38.88 -0.45 0.11 0.00 - 33.82-44.14 Camel 761 26 3.41 -2.89 0.23 0.00 0.06 2.24-4.97 Goat 1092 3 0.23 -5.44 0.59 0.00 0.00 0.06-0.80 Sheep 281 0 0.00 -21.68 2312.7 0.99 0.00 0.00-1.30 Total 3643 470 12.90 11.83-14.03 Chi-Square = 482.57 , P-value = 0.00, df = 4 cELISA Cattle 1149 286 24.90 -0.46 0.13 0.00 0.63 22.41-27.50 Buffalo 360 124 34.44 -0.64 0.11 0.00 - 29.54-39.60 Camel 761 18 2.36 -3.08 0.26 0.00 0.05 1.41-3.71 Goat 1092 3 0.23 -5.25 0.59 0.00 0.01 0.06-0.80 Sheep 281 0 0.00 -21.57 2406 0.99 0.00 0.00-1.30 Total 3643 431 11.83 10.80-12.92 Chi-Square = 460.85 , P-value = 0.00, df = 4

Table 4.2: Prevalence of brucellosis in cattle in different regions of Punjab Pakistan

Parameter/ Total Percentage SE Co- P Odds 95 % CI Positive Coefficient Region samples (%) ef Value Ratio RBPT Faisalabad 226 40 17.69 -1.54 0.17 0.00 - 12.96-23.31 Gujrat 104 35 33.65 0.86 0.27 0.00 2.36 24.68-43.58 Gujranwala 233 70 30.04 0.69 0.23 0.00 2.00 24.23-36.37 Okara 109 64 58.71 1.89 0.26 0.00 6.61 48.88-68.06 Sargodha 225 52 23.11 0.33 0.24 0.16 1.40 17.77-29.18 Sahiwal 222 40 18.01 0.02 0.25 0.93 1.02 13.20-23.72 Hafizabad 30 0 0 -19.99 5242 0.97 0.00 0.00-11.57 Total 1149 301 26.19 23.67-28.84 Chi-Square = 49.01 , P-value = 0.00, df = 6 cELISA Faisalabad 226 37 16.37 -1.63 0.17 0.00 - 11.80-21.85 Gujrat 104 32 30.76 0.82 0.28 0.00 2.27 22.09-40.58 Gujranwala 233 66 28.32 0.70 0.23 0.00 2.02 22.64-34.58 Okara 109 64 58.71 1.98 0.26 0.00 7.26 48.88-68.06 Sargodha 225 50 22.22 0.38 0.24 0.12 1.46 16.97-28.23 Sahiwal 222 37 16.66 0.02 0.25 0.93 1.02 12.01-22.23 Hafizabad 30 0 0 -19.94 5346 0.98 0.00 0.00-11.57 Total 1149 286 24.90 22.41-27.50 Chi-Square = 52.36 , P-value = 0.00, df = 6

Table 4.3 Prevalence of brucellosis in relation to their sex in cattle of Punjab Pakistan

Parameter/ Total SE Co- P Odds 95 % CI Positive Percentage Coefficient Sex samples ef Value Ratio RBPT Male 97 17 17.52 -0.554 0.276 0.045 0.57 10.55-26.57 Female 1052 284 26.99 -0.995 0.069 0.000 - 24.33-29.79 Total 1149 301 26.19 23.67-28.84 Chi-Square = 2.57 , P-value = 0.11, df = 1 cELISA Male 97 17 17.52 -0.480 0.276 0.082 0.62 10.55-26.57 Female 1052 269 25.57 -1.068 0.071 0.000 - 22.96-28.32 Total 1149 286 24.90 22.41-27.50 Chi-Square = 1.95 , P-value = 0.16, df = 1

Table 4.4 Prevalence of brucellosis in relation to their age in cattle of Punjab Pakistan

Parameter/ Total SE Co- P Odds 95 % CI Positive Percentage Coefficient age samples ef Value Ratio RBPT <3 year 250 33 13.20 -1.883 0.187 0.000 - 9.26-18.04 3-<7 years 356 102 28.65 0.971 0.227 0.000 2.64 24.01-33.65 7-<10 years 253 76 30.04 1.038 0.231 0.000 2.82 24.46-36.10 >10 years 290 90 31.03 1.085 0.226 0.000 2.96 25.76-36.71 Total 1149 301 26.19 23.67-28.84 Chi-Square = 17.95 , P-value = 0.00, df = 3 cELISA ≤3 year 250 30 12.00 -1.992 0.195 0.000 - 8.24-16.69 3-7 years 356 95 26.68 0.982 0.226 0.000 2.67 22.16-31.60 7-10 years 253 74 29.24 1.109 0.239 0.000 3.03 23.72-35.27 >10 years 290 87 30.00 1.145 0.233 0.000 3.14 24.78-35.63 Total 1149 286 24.90 22.41-27.50 Chi-Square = 19.10 , P-value = 0.00, df = 3

Table 4.5 Prevalence of brucellosis in relation to their history of reproductive disorders in cows of Punjab Pakistan Parameter/ 95 % CI Total SE Co- P Odds Health Positive Percentage Coefficient samples ef Value Ratio status RBPT Yes 281 178 63.34 2.383 0.162 0.000 10.84 57.42-68.99 No 771 106 13.74 -1.836 0.105 0.000 - 11.40-16.38 Total 1052 284 26.99 24.33-29.79 Chi-Square = 128.26 , P-value = 0.00, df = 1 cELISA Yes 281 170 60.49 2.341 0.162 0.000 10.40 54.52-66.25 No 771 99 12.84 -1.915 0.108 0.000 - 10.56-15.41 Total 1052 269 25.57 22.96-28.32 Chi-Square = 126.93 , P-value = 0.00, df = 1

4.1.1.4 Health based sero-prevalence of brucellosis in Cows

The difference in prevalence of brucellosis was statistically significant (χ2 (1df) =128.26, p=0.00) in animals with history of reproductive disorders than healthy ones using RBPT. Prevalence based on RBPT was 63.34 (n=178, 95% CI 57.42-68.99) and 13.74 (n=106, 95% CI 11.40-16.38) in animals having history of reproductive disorders and animals having no history of abortion, respectively.

Odds ratio indicates that the brucellosis is 10.84 times higher in animals having history of reproductive disorder as compared to animals with no history of reproductive disorders. Through cELISA, highest prevalence 60.49 (n=170, 95% CI 54.52-66.25) was recorded in animals having history of reproductive disorders then 12.84 (n=99, 95% CI 10.56-15.41) percent prevalence in animals having no reproductive disorder history. Logistic regression analysis using cELISA indicates that the disease prevalence chances are 10.40 times higher in animals having history of reproductive disorders as compared to animals with no history (Table 4.5).

4.1.1.5 Pregnancy status based sero-prevalence of brucellosis in Cows

Prevalence through RBPT of brucellosis in two groups based upon pregnancy status was 27.10 (n=161, 95% CI 23.57-30.87) and 26.85 (n=123, 95% CI 23.57-30.87) in pregnant and non-pregnant animals, respectively. The difference among these two groups was statistically non-significant (χ2 (1df) =0.00, p=0.94). Odds ratio indicates that the chances of disease prevalence are equal in pregnant animals as compared with non-pregnant animals. Prevalence through cELISA of brucellosis in two groups based upon pregnancy status was 25.42 (n=151, 95% CI 21.96-29.12) and 25.76 (n=118, 95% CI 21.82-30.03) in pregnant and non-pregnant animals, respectively. The difference among these two groups was statistically non-significant (χ2 (1df) =0.01, p=0.92) (Table 4.6).

4.1.1.6 Parity based sero-prevalence of brucellosis in Cows

For parity based analysis, cows were divided into four groups viz., 1-2, 3-4, 5 and >5). Prevalence of brucellosis was higher in animals with more number of lactations as compared to animals with less number of parities through both RBPT and cELISA. Through

RBPT, Prevalence of the disease was 19.14 (n=36, 95% CI 13.79-25.51), 28.67 (n=82, 95% CI 23.50-34.29), 38.84 (n=94, 95% CI 32.67-45.30) and 31.44% (n=72, 95% CI 25.49-37.89) in animals with 0, 1-2, 3-4 and 5 or more number of lactations, respectively. Through cELISA, sero-prevalence of brucellosis recorded was 16.48 (n=31, 95% CI 11.49-22.58), 26.92 (n=77, 95% CI 21.87-32.46), 37.60 (n=91, 95% CI 31.48-44.03) and 30.56% (n=70, 95% CI 24.67-36.98) in animals with 0, 1-2, 3-4 and 5 or more number of lactations, respectively. These differences were significant in different groups both using RBPT (χ2 (3df) =10.98, p=0.01) and cELISA (χ2 (3df) =13.75, p=0.003). Logistic regression analysis of RBPT based results showed that the disease prevalence probability are 0.52 and 0.88 times less in 0 and 1-2 parity number and 1.38 times more in animals with 3-4 parity numbers as compared to animals with 5 or more parity numbers. Similarly, cELISA based results showed that the disease prevalence probability are 0.45 and 0.84 times less in 0 and 1-2 parity number and 1.37 times more common in animals with 3-4 parity numbers as compared to animals with ≥ 5 (Table 4.7).

Table 4.6 Prevalence of brucellosis in relation to their pregnancy status in cows of Punjab Pakistan

Parameter/ 95 % CI Total SE Co- P Odds Pregnancy Positive Percentage Coefficient samples ef Value Ratio status RBPT Pregnant 594 161 27.10 0.012 0.140 0.928 1.01 23.57-30.87 Non 22.85-31.17 458 123 26.85 -1.002 0.105 0.000 - pregnant Total 1052 284 26.99 24.33-29.79 Chi-Square = 0.00 , P-value = 0.94, df = 1 cELISA Pregnant 594 151 25.42 -0.018 0.142 0.899 0.98 21.96-29.12 Non 21.82-30.03 458 118 25.76 -1.058 0.107 0.000 - pregnant Total 1052 269 25.57 22.96-28.32 Chi-Square = 0.01 , P-value = 0.92, df = 1

Table 4.7 Prevalence of brucellosis in relation to their parity number in cows of Punjab Pakistan

Parameter/ Total SE Co- P Odds Parity Positive Percentage Coefficient 95 % CI samples ef Value Ratio number RBPT 0 188 36 19.14 -0.660 0.234 0.005 0.52 13.79-25.51 1-2 286 82 28.67 -0.131 0.193 0.495 0.88 23.50-34.29 3-4 242 94 38.84 0.326 0.194 0.093 1.38 32.67-45.30 5 or more 229 72 31.44 -0.780 0.142 0.000 - 25.49-37.89 Total 1052 284 26.99 24.33-29.79 Chi-Square = 10.98 , P-value = 0.01, df = 3 cELISA 0 188 31 16.48 -0.802 0.243 0.001 0.45 11.49-22.58 1-2 286 77 26.92 -0.178 0.196 0.363 0.84 21.87-32.46 3-4 242 91 37.60 0.314 0.195 0.108 1.37 31.48-44.03 5 or more 229 70 30.56 -0.820 0.144 0.000 24.67-36.98 Total 1052 269 25.57 22.96-28.32 Chi-Square = 13.75 , P-value = 0.003, df = 3

4.1.2 Prevalence of brucellosis in Buffalo

Overall 38.88% (n=140, 95% CI 33.82-44.14) of buffalo were seropositive with RBPT and 34.44% (n=124, 95% CI 29.54-39.60) of buffalo were seropositive with cELISA. In buffaloes, prevalence of brucellosis was determined in relation to different factors like geographical source, sex, age, pregnancy status, lactation number and history of reproductive disorders of sampled animal.

4.1.2.1 Source based sero-prevalence of brucellosis in Buffalo

Samples of buffalo were collected from well-organized private dairy farms from four districts including Faisalabad, Okara, Nankana and Toba Tek Singh of Punjab, Pakistan. Out of 140 (38.88%) positive test samples through RBPT 25.92% (n=28, 95% CI 17.97-35.25) from Faisalabad, 8.92% (n=5, 95% CI 2.96-19.62) from Okara, 36.11% (n=26, 95% CI 25.12-48.29) from Nankana and 65.32% (n=81, 95% CI 56.25-73.64) from Toba Tek Singh was positive for Brucella antibodies. These differences were significantly different in different districts (χ2 (3df) =29.15, p=0.00) (Table 4.8).

Through cELISA, Out of 124 (34.44%) positive test samples 22.22% (n=24, 95% CI 14.79-31.24) from Faisalabad, 5.35% (n=3, 95% CI 1.12-14.87) from Okara, 27.77% (n=20, 95% CI 18.40-40.62) from Nankana and 62.09% (n=77, 95% CI 52.95-70.65) from Toba Tek Singh was positive for Brucella antibodies. These differences were significantly different in different districts (χ2 (3df) =34.60, p=0.00) (Table 4.8).

Results of RBPT and cELISA indicated highest sero-prevalence in district Toba Tek Singh as compared to buffalo farms sampled from other regions and the difference in prevalence among different regions was statistically significant (P<0.05) both with RBPT and cELISA. The probability of sero-positivity through RBPT was 1.61 and 5.38 times higher in Nankana and toba Tek Singh, respectively, whereas 0.28 time less in Okara as compared with Faisalabad. The probability of sero-positivity through cELISA was 1.35 and 5.73 times higher in Nankana and toba Tek Singh, respectively, whereas 0.20 time less in Okara as compared with Faisalabad (Table 4.8).

Table 4.8 Prevalence of brucellosis in relation to their regions in buffalo of Punjab Pakistan

Parameter/ Total Percentage SE Co- P Odds 95 % CI Positive Coefficient Region samples (%) ef Value Ratio RBPT Faisalabad 108 28 25.92 -1.05 0.22 0.00 - 17.97-35.25 Okara 56 5 8.92 -1.27 0.52 0.02 0.28 2.96-19.62 Nankana 72 26 36.11 0.48 0.33 0.15 1.61 25.12-48.29 Toba Tek 124 81 65.32 1.68 0.29 0.00 5.38 56.25-73.64 Singh Total 360 140 38.88 33.82-44.14 Chi-Square = 29.15 , P-value = 0.00, df = 3 cELISA Faisalabad 108 24 22.22 -1.25 0.23 0.00 - 14.79-31.24 Okara 56 3 5.35 -1.62 0.64 0.01 0.20 1.12-14.87 Nankana 72 20 27.77 0.30 0.35 0.40 1.35 18.40-40.62 Toba Tek 52.95-70.65 124 77 62.09 1.75 0.30 0.00 5.73 Singh Total 360 124 34.44 29.54-39.60 Chi-Square = 34.60 , P-value = 0.00, df = 3

Table 4.9 Prevalence of brucellosis in relation to their sex in buffalo of Punjab Pakistan

Parameter/ Total SE Co- P Odds Positive Percentage Coefficient 95 % CI Sex samples ef Value Ratio RBPT Male 30 2 6.66 -2.309 0.740 0.002 0.10 0.82-22.07 Female 330 138 41.81 -0.330 0.112 0.003 - 36.44-47.35 Total 360 140 38.88 33.82-44.14 Chi-Square = 8.02 , P-value = 0.004, df = 1 cELISA Male 30 2 6.66 -2.106 0.741 0.004 0.12 0.82-22.07 Female 330 122 36.96 -0.534 0.114 0.000 - 31.75-42.43 Total 360 124 34.44 29.54-39.60 Chi-Square = 6.75 , P-value = 0.009, df = 1

4.1.2.2 Sex based sero-prevalence of Brucellosis in Buffalo in relation to sex

The RBPT based prevalence of brucellosis in relation to sex was 6.66% (n=2, 95% CI 0.82-22.07) in male animals. The corresponding values were 41.81% (n=138, 95% CI 36.44- 47.35) buffaloes. Similarly, prevalence of brucellosis through cELISA was higher in females 36.96% (n=122, 95% CI 31.75-42.43) as compared to male 6.66% (n=2, 95% CI 0.82-22.07) animals. The prevalence estimates highly significantly respectively for ELISA (p>0.009) and RBPT (P<0.004). However, the chances (probability) of disease prevalence were 0.10 times less in male animals as compared to the female animals using RBPT and probability of disease is 0.12 times less in male as compared to female cattle (Table 4.9).

4.1.2.3 Sero-Prevalence of Brucellosis in Buffalo in relation to age

Buffaloes were divided into four age groups (<3 year, 3-<7 years, 7-<10 years, >10 years). Prevalence of the disease was higher in mature as compared to younger animals. Through RBPT, Prevalence of the disease was 22.82 (n=21, 95% CI 14.72-32.75), 36.90 (n=31, 95% CI 26.63-48.13), 40.69 (n=35, 95% CI 30.22-51.83) and 54.08% (n=53, 95% CI 43.71-64.20) in <3, 3-<7, 7-<10 and >10 years animals, respectively. Using cELISA, sero- prevalence of brucellosis recorded was 19.56 (n=18, 95% CI 12.03-29.15), 30.95 (n=26, 95% CI 21.31-41.98), 37.20 (n=32, 95% CI 27.02-48.30) and 48.97% (n=48, 95% CI 38.74- 59.28), respectively in <3, 3-<7, 7-<10 and >10 years animals. Nevertheless, differences in occurrence of brucellosis were significant for different age groups when tested with RBPT (χ2 (3df) =8.86, p=0.03) and cELISA (χ2 (3df) =9.35, p=0.02). Logistic regression analysis of RBPT and cELISA based results showed that the disease prevalence probability are 1.98, 2.32 and 3.98 times more in 3-<7 years, 7-<10 years, >10 years animals as compared to <3 years old animals through RBPT. The ELISA results indicates that probability of brucellosis prevalence is 1.84, 2.44 and 3.95 times more in 3-<7 years, 7-<10 years, >10 years animals as compared to <3 years old animals (Table 4.10).

Table 4.10 Prevalence of brucellosis in relation to their age in buffalo of Punjab Pakistan

Parameter/ Total SE Co- P Odds Positive Percentage Coefficient 95 % CI age samples ef Value Ratio RBPT <3 year 92 21 22.82 -1.218 0.248 0.000 - 14.72-32.75 3-<7 years 84 31 36.90 0.682 0.336 0.042 1.98 26.63-48.13 7-<10 year 86 35 40.69 0.842 0.331 0.011 2.32 30.22-51.83 >10 years 98 53 54.08 1.382 0.321 0.000 3.98 43.71-64.20 Total 360 140 38.88 33.82-44.14 Chi-Square = 8.86 , P-value = 0.03, df = 3 cELISA ≤3 year 92 18 19.56 -1.414 0.263 0.000 - 12.03-29.15 3-7 years 84 26 30.95 0.611 0.353 0.083 1.84 21.31-41.98 7-10 years 86 32 37.20 0.891 0.345 0.010 2.44 27.02-48.30 >10 years 98 48 48.97 1.373 0.332 0.000 3.95 38.74-59.28 Total 360 124 34.44 29.54-39.60 Chi-Square = 9.35 , P-value = 0.02, df = 3

Table 4.11 Prevalence of brucellosis in relation to their history of reproductive disorders in buffalo of Punjab Pakistan

Parameter/ 95 % CI Total SE P Odds Health Positive Percentage Coefficient samples Co-ef Value Ratio status RBPT Yes 75 51 68 1.412 0.286 0.000 4.10 56.22-78.31 No 255 87 34.11 -0.658 0.132 0.000 - 28.32-40.29 Total 330 138 41.81 36.44-47.35 Chi-Square = 10.1 , P-value = 0.001, df = 1 cELISA Yes 75 45 60 1.244 0.272 0.000 3.47 48.04-71.15 No 255 77 30.19 -0.838 0.136 0.000 - 24.62-36.23 Total 330 122 36.96 31.75-42.43 Chi-Square = 9.16 , P-value = 0.002, df = 1

4.1.2.4 Sero-Prevalence of Brucellosis in Buffalo in relation to history of reproductive disorder

The difference in prevalence of brucellosis was statistically significant (χ2 (1df) =10.1, p=0.001) in animals with history of reproductive disorders. Prevalence based on RBPT was 68.00 (n=51, 95% CI 56.22-78.31) and 34.11 (n=87, 95% CI 28.32-40.29) in animals having history of reproductive disorders and animals having no history of abortion, respectively.

Odds ratio indicates that the brucellosis is 4.10 times higher in animals having history of reproductive disorder as compared to animals with no history of reproductive disorders. cELISA, highest prevalence 60.00 (n=45, 95% CI 48.04-71.15) was recorded in animals having history of reproductive disorders then 30.19 (n=77, 95% CI 24.62-36.23) percent prevalence in animals having no reproductive disorder history. Logistic regression analysis using cELISA indicates that the disease prevalence chances are 3.47 times higher in animals having history of reproductive disorders as compared to animals with no history (Table 4.11).

4.1.2.5 Sero-Prevalence of Brucellosis in Buffalo in relation to Pregnancy status

RBPT based prevalence of brucellosis in pregnant versus non-pregnant animals was 43.35 (n=62, 95% CI 35.10-51.89) and 40.64 (n=76, 95% CI 33.53-48.05). The difference among these two groups was statistically non-significant (χ2 (1df) =0.10, p=0.75). Odds of occurrence of the diseases was higer (OR=1.12)1.12 time more in pregnant than that of non- pregnant animals. Prevalence through cELISA of brucellosis in two groups based upon pregnancy status was 37.76 (n=54, 95% CI 29.80-46.25) and 36.36 (n=68, 95% CI 29.47- 43.70) in pregnant and non-pregnant animals, respectively. The difference among these two groups was statistically non-significant (χ2 (1df) =0.03, p=0.85) (Table 4.12).

4.1.2.6 Sero-Prevalence of Brucellosis in Buffalo in relation to Parity number

Animals were divided into four groups based on parity number (0, 1-2, 3-4, 5 or more). Prevalence of brucellosis was higher in animals with more number of lactations as compared to animals with less number of parities through both RBPT and cELISA. Through RBPT, Prevalence of the disease was 34.66 (n=26, 95% CI 24.04-46.54), 36.36 (n=28, 95%

CI 25.70-48.12), 42.85 (n=48, 95% CI 33.55-52.55) and 54.54% (n=36, 95% CI 41.81-66.86) in animals with 0, 1-2, 3-4 and 5 or more number of lactations, respectively. Through cELISA, sero-prevalence of brucellosis recorded was 29.66 (n=23, 95% CI 20.53-42.38), 28.57 (n=22, 95% CI 18.85-40.00), 39.28 (n=44, 95% CI 30.19-48.96) and 50.00% (n=33, 95% CI 37.43-62.57) in animals with 0, 1-2, 3-4 and 5 or more number of lactations, respectively. These differences were statistically non-significant in different groups both using RBPT (χ2 (3df) =2.76, p=0.43) and cELISA (χ2 (3df) =3.90, p=0.27). Logistic regression analysis of RBPT based results showed that the disease prevalence probability are 0.44, 0.48 and 0.63 times less in 0, 1-2 and 3-4 parity number as compared to animals with 5 or more parity numbers. Similarly, cELISA based results showed that the disease prevalence probability are 0.44, 0.40 and 0.65 times less in 0, 1-2 and 3-4 parity number as compared to animals with 5 or more parity numbers (Table 4.13).

Table 4.12 Prevalence of brucellosis in relation to their pregnancy status in buffalo of Punjab Pakistan

Parameter/ 95 % CI Total SE Co- P Odds Pregnancy Positive Percentage Coefficient samples ef Value Ratio status RBPT Pregnant 143 62 43.35 0.111 0.225 0.620 1.12 35.10-51.89 Non 33.53-48.05 187 76 40.64 -0.379 0.149 0.011 pregnant Total 330 138 41.81 36.44-47.35 Chi-Square = 0.10 , P-value = 0.75, df = 1 cELISA Pregnant 143 54 37.76 0.059 0.230 0.794 1.06 29.80-46.25 Non 29.47-43.70 187 68 36.36 -0.560 0.152 0.000 - pregnant Total 330 122 36.96 31.75-42.43 Chi-Square = 0.03 , P-value = 0.85, df = 1

Table 4.13 Prevalence of brucellosis in relation to their parity number in buffalo of Punjab Pakistan

Parameter/ 95 % CI Total SE Co- P Odds Parity Positive Percentage Coefficient samples ef Value Ratio number RBPT 0 75 26 34.66 -0.816 0.346 0.018 0.44 24.04-46.54 1-2 77 28 36.36 -0.742 0.342 0.030 0.48 25.70-48.12 3-4 112 48 42.85 -0.470 0.312 0.132 0.63 33.55-52.55 5 or more 66 36 54.54 0.182 0.247 0.461 - 41.81-66.86 Total 330 138 41.81 36.44-47.35 Chi-Square = 2.76 , P-value = 0.43, df = 3 cELISA 0 75 23 29.66 -0.816 0.351 0.020 0.44 20.53-42.38 1-2 77 22 28.57 -0.916 0.352 0.009 0.40 18.85-40.00 3-4 112 44 39.28 -0.435 0.313 0.164 0.65 30.19-48.96 5 or more 66 33 50 -0.000 0.246 1.000 - 37.43-62.57 Total 330 122 36.96 31.75-42.43 Chi-Square = 3.90 , P-value = 0.27, df = 3

4.1.3 Prevalence of brucellosis in Camels

Overall 3.41% (n=26, 95% CI 2.24-4.97) of camels were seropositive with RBPT and 2.36% (n=18, 95% CI 1.41-3.71) were seropositive in cELISA. Prevalence of brucellosis has been determined in relation to different factors like geographical source, sex, age, pregnancy status, lactation number and health status.

4.1.3.1 Source based sero-prevalence of Brucellosis in Camels

Samples were collected from four districts including Faisalabad, Jhang, Bhakar, Muzaffargarh, Layyah and Bahawalpur of Punjab, Pakistan. Out of 26 (3.41%) positive samples, 9.03% (n=15, 95% CI 5.15-14.47), 3.54% (n=10, 95% CI 1.71-6.42) and 1.96% (n=1, 95% CI 0.05-10.45) were respectively positive in RBT from Faisalabad, Jhang and Muzaffargarh. None of the samples from Bhakar, Layyah and Bahawalpur was positive for brucellosis. These differences were significantly different in different districts (χ2 (5df) =23.35, p=0.00) (Table 4.14).

Through cELISA, Out of 14 (8.43%) positive test samples 8.43% (n=14, 95% CI 4.69-13.75) from Faisalabad, 1.06% (n=3, 95% CI 0.22-3.08) from Jhang, 1.96% (n=1, 95% CI 0.05-10.45) from Muzaffargarh were positive for Brucella antibodies. The results of ELISA on samples from Bhakar, Layyah and Bahawalpur were same as detected in RBPT. These differences were significantly different in different districts (χ2 (5df) =23.35, p=0.00) (Table 4.14).

Results of RBPT and cELISA indicated highest sero-prevalence in district Faisalabad as compared to other regions and the difference in prevalence among different regions was statistically significant (P<0.05) both with RBPT and cELISA. The probability of sero- positivity through RBPT was 0.37 and 0.20 times less in Jhang and Muzaffargarh, respectively, as compared with Faisalabad. The probability of sero-positivity through cELISA was 0.12 and 0.22 times less in Jhang and Muzaffargarh, respectively, as compared with Faisalabad (Table 4.14).

4.1.3.2 Sex based sero-prevalence of Brucellosis in Camels

The RBPT based prevalence of brucellosis in relation to sex was 1.21% (n=3, 95% CI 0.25-3.52) in male animals. The corresponding values were 4.46% (n=23, 95% CI 2.25-6.63) buffaloes. Similarly, prevalence of brucellosis through cELISA was higher in females 3.10% (n=16, 95% CI 1.79-5.00) as compared to male 0.81% (n=2, 95% CI 0.10-2.91) animals. The prevalence estimates are significant for RBPT (χ2 (1df) =5.02, p=0.03) and non-significant for ELISA (χ2 (1df) = 3.65, p=0.06). However, the chances (probability) of disease prevalence were 0.26 times less in male animals as compared to the female animals both in RBPT and ELISA results (Table 4.15).

4.1.3.3 Age based sero-prevalence of Brucellosis in Camels

Buffaloes were divided into four age groups (<1 year, 1-<3 years, 3-<7 years, >7 years). Prevalence of the disease was higher in mature as compared to younger animals. Through RBPT, Prevalence of the disease was 3.27% (n=2, 95% CI 0.40-11.35), 2.04 (n=3, 95% CI 0.25-3.51), 1.77% (n=6, 95% CI 0.65-3.82) and 6.98% (n=15, 95% CI 3.96-11.25) in <1 year, 1-<3 years, 3-<7 years, >7 years animals, respectively. Using cELISA, sero- prevalence of brucellosis recorded was 1.63% (n=1, 95% CI 0.04-8.80), 1.36% (n=2, 95% CI 0.17-4.83), 1.47% (n=5, 95% CI 0.48-3.42) and 4.65% (n=10, 95% CI 2.25-8.39), respectively in <1 year, 1-<3 years, 3-<7 years, >7 years animals. Nevertheless, differences in occurrence of brucellosis were significant for different age groups when tested with RBPT (χ2 (3df) =10.88, p=0.01) and non-significant with cELISA (χ2 (3df) =6.40, p=0.09). Logistic regression analysis of RBPT and cELISA based results showed that the disease prevalence probability are 0.61, 0.53 times less and 3.98 times more in 1-<3 years, 3-<7 years, >7 years animals as compared to <1 years old animals through RBPT. The ELISA results indicates that probability of brucellosis prevalence is 0.83, 0.90 times less and 2.93 times more, respectively in 1-<3 years, 3-<7 years, >7 years animals as compared to <1 years old animals (Table 4.16).

4.1.3.4 Health status based sero-prevalence of Brucellosis in Camels

The difference in prevalence of brucellosis was statistically significant (χ2 (2df) =3.13, p=0.01) in animals with different health condition. Prevalence based on RBPT was 6.67% (n=12, 95% CI 3.49-11.36), 4.20% (n= 13, 95% CI 2.26-7.09) and 0.36% (n=1, 95% CI 0.01-2.03) in animals having poor, moderate and good health condition, respectively. Odds ratio indicates that the brucellosis is 0.61 and 0.05 times less in animals with moderate and good health condition, respectively as compared to animals with poor health condition.

Using cELISA, highest prevalence 5.56% (n=10, 95% CI 2.70-9.98) was observed in animals with poor than 2.58% (n= 8, 95% CI 1.12-5.04) in moderate health condition. No animal found positive for Brucella antibodies with good health condition. Logistic regression analysis using cELISA indicates that the disease prevalence chances are 0.45 times less in animals with moderate health status (Table 4.17).

4.1.3.5 Pregnancy status based sero-prevalence of Brucellosis in Camels

RBPT based prevalence of brucellosis in pregnant versus non-pregnant animals was 2.87 (n=5, 95% CI 0.94-6.58) and 5.28 (n=18, 95% CI 3.16-8.21). The difference between these two groups was statistically non-significant (χ2 (1df) =1.44, p=0.23). Odds of occurrence of the diseases was <1 (0.53) time in pregnant than that of non-pregnant animals. Prevalence through cELISA of brucellosis in two groups based upon pregnancy status was 2.29 (n=4, 95% CI 0.63-5.78) and 3.51 (n=12, 95% CI 1.83-6.07) in pregnant and non- pregnant animals, respectively. The difference among these two groups was statistically non- significant (χ2 (1df) =0.54, p=0.46) (Table 4.18).

4.1.3.6 Parity based sero-prevalence of Brucellosis in Camels

Animals were divided into three groups based on parity number (0, 1, 2 or more). Prevalence of brucellosis was higher in animals with more number of lactations as compared to animals with less number of parities through both RBPT and cELISA. Through RBPT, Prevalence of the disease was 2.53 (n=6, 95% CI 0.93-5.43), 3.57 (n=4, 95% CI 0.98-8.89) and 7.83% (n=13, 95% CI 4.24-13.02) in animals with 0, 1 and 2 or more number of lactations, respectively. In cELISA, sero-prevalence of brucellosis recorded was 1.27 (n=3,

95% CI 0.26-3.65), 3.57 (n=4, 95% CI 0.98-8.89) and 5.42% (n=9, 95% CI 2.51-10.04) in animals with 0, 1 and 2 or more number of lactations, respectively. These differences were statistically significant in different groups both using RBPT (χ2 (2df) =6.03, p=0.04) whereas non-significant with cELISA (χ2 (2df) =5.34, p=0.07). Logistic regression analysis of RBPT based results indicated that the disease prevalence probability are 0.31 and 0.44 times less in 0 and 1 parity number as compared to animals with 2 or more parity numbers. Similarly, cELISA based results showed that the disease prevalence probability are 0.65 and 0.22 times less in 0 and 1 parity number as compared to animals with 2 or more parity numbers (Table 4.19).

Table 4.14 Prevalence of brucellosis in relation to their regions in camel of Punjab Pakistan

Parameter/ Total +ve Percentage Coefficient SE Co- P Value Odds 95% CI Region samples ef Ratio RBPT Faisalabad 166 15 9.03 -2.31 0.27 0.00 - 5.15-14.47 Jhang 282 10 3.54 -0.99 0.42 0.02 0.37 1.71-6.42 Bhakar 191 0 0 -21.09 5283 0.99 0.00 0.00-1.91 Muzaffargarh 51 1 1.96 -1.60 1.05 0.13 0.20 0.05-10.45 Layyah 20 0 0 -21.09 16324 0.99 0.00 0.00-16.84 Bahawalpur 51 0 0 -21.09 10228 0.99 0.00 0.00-6.98 Total 761 26 3.41 2.24-4.97 Chi-Square = 23.35, P-value = 0.00, df = 5 cELISA Faisalabad 166 14 8.43 -2.38 0.28 0.00 - 4.69-13.75 Jhang 282 3 1.06 -2.15 0.64 0.001 0.12 0.22-3.08 Bhakar 191 0 0 -20.87 4922 0.99 0.00 0.00-1.91 Muzaffargarh 51 1 1.96 -1.53 1.05 0.15 0.22 0.05-10.45 Layyah 20 0 0 -20.87 15210 0.99 0.00 0.00-16.84 Bahawalpur 51 0 0 -20.87 9525 0.99 0.00 0.00-6.98 Total 761 18 2.36 1.41-3.71 Chi-Square = 32.06, P-value = 0.00, df = 5

Table 4.15 Prevalence of brucellosis in relation to their sex in camel of Punjab Pakistan

Parameter/ Total Positive Percentage Coefficient SE P Value Odds 95% CI Sex samples Co-ef Ratio RBPT Male 246 3 1.21 -1.33 0.62 0.031 0.26 0.25-3.52 Female 515 23 4.46 -3.06 0.21 0.00 - 2.85-6.63 Total 761 26 3.41 2.24-4.97 Chi-Square = 5.02, P-value = 0.03, df = 1 cELISA Male 246 2 0.81 -1.36 0.75 0.07 0.26 0.10-2.91 Female 515 16 3.10 -3.44 0.25 0.00 - 1.79-5.00 Total 761 18 2.36 1.41-3.71 Chi-Square = 3.65, P-value = 0.06, df = 1

Table 4.16 Prevalence of brucellosis in relation to their age in camel of Punjab Pakistan

Parameter/ Total Positive Percentage Coefficient SE P Value Odds 95% CI age samples Co-ef Ratio RBPT <1 year 61 2 3.27 -3.38 0.72 0.00 - 0.40-11.35 1-<3 years 147 3 2.04 -0.49 0.96 0.59 0.61 0.25-3.51 3-<7 years 338 6 1.77 -0.63 0.83 0.44 0.53 0.65-3.82 7->7 years 215 15 6.98 0.79 0.77 0.30 2.21 3.96-11.25 Total 761 26 3.41 2.24-4.97 Chi-Square = 10.88, P-value = 0.01, df = 3 cELISA <1 year 61 1 1.63 -4.09 1.00 0.00 - 0.04-8.80 1-<3 years 147 2 1.36 -0.19 1.23 0.88 0.83 0.17-4.83 3-<7 years 338 5 1.47 -0.10 1.10 0.93 0.90 0.48-3.42 7->7 years 215 10 4.65 1.07 1.06 0.31 2.93 2.25-8.39 761 18 2.36 1.41-3.71 Chi-Square = 6.40, P-value = 0.09, df = 3

Table 4.17 Prevalence of brucellosis in relation to their Health in camel of Punjab Pakistan

Parameter/ Total +ve Percentage Coefficient SE P Value Odds 95% CI health status samples Co-ef Ratio RBPT Good 272 1 0.36 -2.96 1.05 0.005 0.05 0.01-2.03 Moderate 309 13 4.20 -0.49 0.41 0.24 0.61 2.26-7.09 Poor 180 12 6.67 -2.63 0.29 0.00 - 3.49-11.36 Total 761 26 3.41 2.24-4.97 Chi-Square = 3.13, P-value = 0.01, df = 2 cELISA Good 272 0 0.00 -20.93 5304 0.99 0.00 0.00-1.35 Moderate 309 8 2.58 -0.79 0.48 0.101 0.45 1.12-5.04 Poor 180 10 5.56 -2.83 0.33 0.00 - 2.70-9.98 Total 761 18 2.36 1.41-3.71 Chi-Square = 13.83, P-value = 0.01, df = 2

Table 4.18 Prevalence of brucellosis in relation to their pregnancy status in camel of Punjab Pakistan

Parameter/ Total Positive Percentage Coefficient SE P Value Odds 95% CI Pregnancy samples Co-ef Ratio status RBPT Pregnant 174 5 2.87 -0.63 0.51 0.218 0.53 0.94-6.58 Non 341 18 5.28 -2.89 0.24 0.00 - 3.16-8.21 pregnant Total 515 23 4.46 2.85-6.63 Chi-Square = 1.44, P-value = 0.23, df = 1 cELISA Pregnant 174 4 2.29 -0.43 0.59 0.454 0.65 0.63-5.78 Non 341 12 3.51 -3.31 0.29 0.00 - 1.83-6.07 pregnant Total 515 16 3.10 1.79-5.00 Chi-Square = 0.54, P-value = 0.46, df = 1

Table 4.19 Prevalence of brucellosis in relation to their parity number in camel of Punjab Pakistan

Parameter/ Total Positive Percentage Coefficient SE P Value Odds 95% CI parity samples Co-ef Ratio number RBPT 0 237 6 2.53 -1.19 0.50 0.02 0.31 0.93-5.43 1 112 4 3.57 -0.83 0.59 0.16 0.44 0.98-8.89 2 or more 166 13 7.83 -2.47 0.29 0.00 - 4.24-13.02 Total 515 23 4.46 2.85-6.63 Chi-Square = 6.03, P-value = 0.04, df = 2 cELISA 0 237 3 1.27 -1.49 0.67 0.03 0.22 0.26-3.65 1 112 4 3.57 -0.44 0.61 0.48 0.65 0.98-8.89 2 or more 166 9 5.42 -2.86 0.34 0.00 - 2.51-10.04 Total 515 16 3.10 1.79-5.00 Chi-Square = 5.34, P-value = 0.07, df = 2

4.2 Molecular investigations

Molecular identification of genus Brucella was carried out utilizing B4/B5 primer for the expected amplified product of 223 bp (for the region of the sequence encoding a 31 kDa periplasmic immunogenic bcsp31 gene). The positive samples were further analyzed using specie specific primers to identify weather positive PCR samples are of B. abortus or B. melitensis. In over study there were 13.68% (n=59) of samples were positive for Brucella genus among all tested samples by conventional PCR (Figure 3). Out of these 10.90% (n=47) were detected positive for Brucella abortus and 0.23% (n=1) was detected as Brucella melitensis (Figure 4). Rest of the samples (n=11; 2.60%) could not be speciated neither as B. abortus nor B. melitensis (Table 4.20).

There were 33.64% (n=145) cases positive for Brucella genus among all tested samples by real-time PCR (Figure 5) (Table 4.21). Among these 26.91 (n=116) samples, were positive for B. abortus and 0.47% (n=2) were positive for B. melitensis (Figure 6). All those samples which have ct value above 15 up to 40 were considered as positive. Among 143 positive samples 89 samples have ct (cycle threshold) above 20 but below 30 which were translated in to strong positive (have high amount of genomic DNA of Brucella in those samples). The rest 54 Brucella PCR positive samples have ct value 30 to 40 indicating that they are weak positive.

Positive samples in real-time PCR for Brucella were further subjected to B. abortus and B. melitensis identification. Among 82 samples 67 were very strong positive for B. abortus having ct value below 30 and the rest samples were having ct value in between 30- 38. Two samples detected positive for B. melitensis having ct value in between 30-38.

Figure 4.1 Photograph of selected samples positive for Brucella

Lanes description: 1 and 8 ladder (100bp), 2 control +ve, 3 control –ve, 4-7 positive test samples

Figure 4.2 Photograph of selected samples positive for Brucella species

Lanes description: 1 and 8 ladder (50bp), 2 positive test samples B. melitensis, 3-7 positive test samples B. abortus

Table 4.20 Summary of results of conventional PCR for brucellosis

Brucella B. abortus B. melitensis B. Spp. Species Total # % # % # % # % Cattle 286 43 15.03 35 12.23 - - 8 2.79 Buffalo 124 14 11.29 10 8.06 1 0.80 3 2.41 Camel 18 2 11.11 2 11.11 - - - - Goat 3 ------Total 431 59 13.68 47 10.90 1 0.23 11 2.55

Figure 4.3 Amplification Plots of RT-PCR for Brucella genus

Figure 4.4 Amplification Plots of RT-PCR for Brucella abortus

Table 4.21 Summary of results of Real time PCR for brucellosis

Brucella B. abortus B. melitensis B. Spp. Species Total # % # % # % # % Cattle 286 102 35.66 79 27.62 - - 23 8.04 Buffalo 124 39 31.45 35 28.22 2 1.61 2 1.61 Camel 18 4 22.22 2 11.11 - - 2 11.11 Goat 3 ------Total 431 145 33.64 116 26.91 2 0.46 27 6.26

Sequence Analysis and Phylogenetic Studies:

For the molecular analysis of amplicons randomly 5 different amplicons of camel, buffalo and cattle origin were dispatched to Mcrogen® Korea for Dideoxy (Sangar) based DNA sequencing.

Initially, obtained sequences were analyzed by ChromasPro® (Technelysium Pty Ltd) for the detection of any sequencing errors. The error free sequences were further analyzed by online available DNA data banks (GenBank, NCBI), by using BLAST program. Finally, five different Brucella sequences were submitted to GenBank by BankIt for the allotment of Accession Numbers. The GenBank submitted sequences were Brucella PAK-CAMEL (Accession No. KX618687), Brucella PAK-CATTLE1 (Accession No. KX618688), Brucella PAK-CATTLE2 (Accession No. KX618689), Brucella PAK-BUFFALO1 (Accession No. KX618690) and Brucella PAK-BUFFALO2 (Accession No. KX618691).

Molecular homology and evolutionary studies were conducted on the amino acid sequence rather than DNA, due to functional nature of BCSP31. According to protein based homology search tools the Brucella PAK-CAMEL harbors highest levels of identity up to 100% with B. abortus (Accession No. ACS36254.1) previously reported from Pakistan, followed by B. abortus (Accession No. AMD02876.1, 99% identity levels) of cattle origin isolated from India and Brucella ovis ATCC 25840 (Accession No. ABQ61023.1, 99% identity levels) isolated from USA. Brucella PAK-CATTLE1 displayed maximum levels of identity up to 100% with cattle origin B. abortus (Accession No. AMD02876.1) and B. abortus (Accession No. D65310.1) isolated from India, followed by B. ceti (Accession No. AHB01896.1). The strain submitted as Brucella PAK-CATTLE2 revealed nearly 100% identity with B. abortus (Accession No. ACS36254.1) isolated from Pakistan and Indian origin B. abortus (Accession No. AMD02876.1). The Brucella PAK-BUFFALO1 harbors same levels of identity with B. abortus (Accession No. ACS36254.1), B. abortus (Accession No. AMD02876.1), B. abortus (Accession No. ABD65310.1), B. ovis (Accession No. ABQ61023.1) and B. ceti (Accession No. AHB01896.1). The Brucella PAK-BUFFALO2 displayed same levels B. abortus (Accession No. AMD02876.1), B. abortus (Accession No.

ACS36254.1), B. ceti (Accession No. AHB01896.1) and B. abortus (Accession No. ABD65310.1) (Figure 4.5).

Figure 4.5 The evolutionary trends of Brucella isolates (PAK-CAMEL, Brucella PAK- CATTLE1, PAK-CATTLE2, PAK-BUFFALO1 and PAK-BUFFALO2) are represented by Neighbor-Joining method (Saitou and Nei, 1987) conducted with MEGA7 (Kumar et al., 2016). The evolutionary distance is estimated with Tamura 3-parameter method (Tamura, 1992).

Computational Analysis of BCSP31:

Later on, using bcsp31 amino acid sequences Multiple Sequence Alignment was performed. According to amino acid alignment studies, BCSP31 protein belongs to superfamily cl21456 with pfam16868 (NMT1_3) harboring type 2 periplasmic binding protein fold. Such proteins are specialized prokaryotic proteins of periplasmic region. Moreover, signature amino acids can be seen from alignment files (Figure 4.6).

Figure 4.6 Multiple sequence alignment of BCSP31 performed with ClustalW program (http://www.ebi.ac.uk). The identical sequences are shown by asterisks at the top. The accession numbers are as follows: B. abortus BMA2008 (Accession No. ACS36254.1), B. abortus H11 (Accession No. AMD02876.1), B. abortus S99 (Accession No. ABD65310.1), B. ceti (Accession No. AHB01896.1), B. inopinata (Accession No. WP_008505584.1), B. melitensis (Accession No. WP_004685692.1), B. neotomae (Accession No. WP_032451162.1), B. ovis (Accession No. ABQ61023.1), B. vulpis (Accession No. WP_059243827.1).

According to available literature, structure of BCSP31 is not yet solved. For structural elucidation of BCSP31 protein various protein structure prediction and molecular modeling tools were used. According to Protein Structure Prediction Server (http://biomine.ece.ualberta.ca/1D/1D.html) BCSP31 contains different α-helices rich enzyme. Moreover, the three-dimensional (3D) structure of BCSP31 was constructed by an online available server I-TASSER (Iterative Threading ASSEmbly Refinement), Zhang Laboratories (Ref). According to I-TASSER analysis BCSP31 has highest levels of structural homology Ehrlichia chaffeensis immunogenic protein (PDB ID No. 4DDD), followed by Thermus thermophilus periplasmic Glutamate/Glutamine-Binding protein (PBD ID No. 1US5) (Figure 4.7). According to ligand binding analysis, BCSP31 depicted closed structural homology with Neisseria gonorrhoeae Tri-nuclear oxo-iron clusters of periplasmic ferric binding protein (PDB ID No. 1R1N).

Figure 4.7 I-TASSER based predicted structure of BCSP31 protein.

4.3 Experimental study of patho-morphological changes in goats

In infected animals, fever was recorded after 24 hours of inoculation of the organism which was persistent for two days. Afterwards, rectal temperature became normal throughout the experiment. A significant increase in the leukocytes with increase in neutrophils was also observed in infected animals at day 7 of experiment which peeks at day 17 of infection and then starts to decrease to its normal level. Other hematological parameters including red blood cell count, hemoglobin concentration and packed cell volume remains normal as compared to control group (data not shown). The infected animals were seropositive at day 9 post inoculation through RBPT and cELISA and attain maximum titer at day 12 of experiment which remains persistently high throughout the period of experiment. Animals kept as control shows no clinical, gross and histomorphological illness (data not shown). Grossly, Granulomatous lesions and edema was observed in lungs. Other organs including liver, spleen, heart and spleen were normal observed during necropsy. In molecular investigations the organism was successfully detected from the blood of the infected goats from day 2 to throughout the experiment (Figure 4.8). At the end of the experiment the organism was detected positive from tissues including liver, lungs, spleen, uterus, sub mandibular lymph nodes, bronchial lymph nodes, whereas, the organism was not detected positive in test tissue samples including kidneys, ovary, mammary glands, supra mammary lymph nodes, internal ileac lymph nodes, scapular lymph nodes (Figure 4.9).

However, histopathological alterations were observed in organs including lungs, liver, uterus and kidneys. Histo-pathologically, liver showed hepatocytes are with centrally placed nuclei and granular cytoplasm with cloudy swelling give rise to collapsed synosydal spaces and individual cell necrosis of hepatocytes. Areas of necrosis and hemorrhages around central vein with active von kupffer cells and mild mononuclear cells infiltration were also evident (Figure 4.14, 4.15, 4.16, 4.17).

Lungs showed diffusely thickened alveolar walls, fibrinous exudate containing macrophages, mononuclear cells and granulocytes in alveolar spaces, interstitial inflammatory infiltrate in the parenchyma of the lungs, congestion, dilatation of blood vessels, bronchioles containing fibrinous fluid, pleura thickened, edematous, congested and hemorrhagic just below pleura (Figure 4.10, 4.11, 4.12, 4.13). Kidneys showed infiltration of granular and multilobed cells in glomeruli obliterating the glomerular space with mild to moderate congestion of medullary area. Proximal as well as medullary tubules showed pinkish colored pretentious material and areas of necrosis are also evident at some places (Figure 4.18, 4.19). Spleen showed hyperplasia of the many germinal follicles, proliferation of the cells with lightly stained cytoplasm and increased population of macrophages, red pulp filled with lymphocytes, macrophages and plenty of RBC‘s (Figure 4.20, 4.21). Mammary gland showed focal interstitial infiltration of lymphocytes, macrophages, and neutrophils. Uterus showed placentome with necrotic debris comprised of intense inflammatory infiltrate, dead tissue, multiple foci of degenerating areas specifically below the epithelium, glands are degenerated mixed with inflammatory cells, blood vessels are congested (Figure 4.22, 4.23).

Figure 4.8 Detection of the organism from the blood in experimental goats

Lanes description: 1 and 9 ladder (100bp), 2 and 10 negative control, 3 and 11 positive control, 3-8 positive test samples, 12-14 negative test samples

Figure 4.9 Detection of the organism from the different organs in experimental goats

Lanes description: 1 and 9 ladder (100bp), 2 positive control, 3 negative control, Positive test samples: 4 liver, 5 lungs, 7 spleen, 11 uterus, 14 sub mandibular LN, 16 bronchial LN Negative test samples: 6 Kidneys, 8 ovary, 10 mammary glands, 12 supra mammary LN, 13 internal ileac LN, 15 scapular LN

Figure 4.10 Photomicrograph of lungs of goat infected with B. melitensis showing thickened alveolar walls (arrow), emphysema (E) and alveoli’s filled with fibrinous exudate (arrow head). H & E stain. 100 X.

Figure 4.11 Photomicrograph of lungs of goat infected with B. melitensis showing Emphysema (E), fibrinous exudate (asterisk) and infiltration of inflammatory cells (arrow) (H & E stain 100 X)

Figure 4.12 Photomicrograph of lungs of goat infected with B. melitensis showing Fibrinous exudate (asterisk), aleveli’s filled with RBCs and polymorphonuclear neutrophil (Arrow) (H & E stain 400 X)

Figure 4.13 Photomicrograph of lungs of goat infected with B. melitensis showing thickened and hemorrhagic pleural walls (H & E stain 400X)

Figure 4.14 Photomicrograph of liver of goat infected with B. melitensis showing cloudy swelling (arrow), collapsed synosydal spaces and individual cell necrosis of hepatocytes (arrow head) (H & E stain 400 X)

Figure 4.15 Photomicrograph of liver of goat infected with B. melitensis showing Hemorrhages around central vein (C) and mild mononuclear cells infiltration (I) (H & E stain 100 X)

Figure 4.16 Photomicrograph of liver of goat infected with B. melitensis showing Areas of necrosis (N) and hemorrhages and mild mononuclear cells infiltration (I) (H & E stain 100 X)

Figure 4.17 Photomicrograph of liver of goat infected with B. melitensis showing multiple degenerating areas and active von kupffer cells (H & E stain 200 X)

Figure 4.18 Photomicrograph of kidneys of goat infected with B. melitensis showing Necrosis with infiltration of granular and multilobed cells in glomeruli (arrow) and tubules with pretentious material (P) (H & E stain 200 X)

Figure 4.19 Photomicrograph of kidneys of goat infected with B. melitensis showing mild to moderate congestion (C) of medullary area (H & E stain 100 X)

Figure 4.20 Photomicrograph of spleen of goat infected with B. melitensis showing red pulp filled with lymphocytes, macrophages and plenty of RBC’s (H & E stain 200 X)

Figure 4.21 Photomicrograph of spleen of goat infected with B. melitensis showing hyperplasia of the many germinal follicles, proliferation of the cells with lightly stained cytoplasm and increased population of macrophages (H & E stain 100 X)

Figure 4.22 Photomicrograph of uterus of goat infected with B. melitensis showing Necrotic debris comprised of intense inflammatory infiltrate (arrow), dead tissue (H & E stain 100 X)

Figure 4.23 Photomicrograph of uterus of goat infected with B. melitensis showing multiple foci of degenerating areas specifically below the epithelium (H & E stain 400 X)

CHAPTER 5

DISCUSSION

Brucellosis is highly contagious bacterial disease and most dreadful zoonotic disease around the world (Seleem et al., 2010; Liu et al., 2014). It leads to huge economic losses in terms of reduced productivity, late term abortion, stillborn, weak calves, temporary or permanent infertility, reduced milk yield, prolonged calving interval and trade implications (Xavier et al., 2010; Abubakar et al., 2012). Brucella affects widespread range of mammalian species like domesticated animals, sea mammals (Bricker et al, 2003a; McDonald et al, 2006), fresh water fish (El-Tras et al, 2010) and also wild life species (Thorpe et al, 1965; Godfroid, 2002; Godfroid et al, 2010; Van Campen and Rhyan, 2010).

Despite the disease is completely eradicated from developed countries, including Canada, USA, New Zealand, Japan and Israel through adoption of better control and eradication strategies, conversely the problem remains uncontrolled in extremely pervasive areas where cattle rearing are mostly preferred like Asia, Africa, Latin America and Middle East (McDermott and Arimi, 2002). The occurrence of brucellosis was highest in bovines whereas prevalence of brucellosis ranged from 0.85-23.3% ascribed from various parts of the world in different studies from throughout the world (Refai, 2000). Problem is more considerate in the developing countries owing to deficiency of animal health programs, non availability of effective public health measures and lake of diagnosis (Thakur et al., 2002).

Diagnosis may eagerly be missed as no characteristic signs and symptoms exists (Young, 1992; Thakur et al., 2002). Rose Bengal plate agglutination test (RBPT) is simple, rapid and economical screening test performed with a stained B. abortus (Purified protein derivatives) suspension and bare serum. According to current OIE guidelines for testing that positive RBPT results should be confirmed by quantitative and more specific assays including CFT and ELISA (Corbel et al., 2006). Since lack of anti-camel IgGs, competitive ELISA was used for confirmation of RBPT results.

The prevalence of brucellosis in different livestock animals in Pakistan has been reported by various investigators (Hussain et al., 2008; Asif et al., 2009; Aslam, 2009;

Wadood et al., 2009; Munir et al., 2011; Shafee et al., 2011; Manzoor et al., 2013; Ali et al., 2013a; Gul et al., 2014; Gul et al., 2015; Mahmood et al., 2016a). At national level a limited literature is present relevant to the prevalence rate of the disease although infection has been confirmed in cattle, buffalo, goats, sheep, camel and humans. As far as it could be ascertained, very limited data is available on the molecular investigations. Thus the present was undertaken to determine sero-prevalence, detect Brucella species in naturally infected animals (cow, buffalo, sheep, goat and camels). Furthermore, studies to explore various lesions of brucellosis (Brucella melitensis) in organs of native goats are also lacking. An inclusive protocol was followed to collect samples from animals of farms with a history of abortion. To this end, blood samples (n=3643) were collected from cattle (n=1149), buffaloes (n=360), sheep (n=281), goats (n=1092) and camels (n=761) residing in different locations/farms in Punjab, Pakistan.

5.1 Sero-prevalence of brucellosis in different livestock species

Overall sero-prevalence of brucellosis in livestock species including cattle, buffalo, sheep, goat and camel was 12.90% and 11.83% respectively through RBPT and cELISA. Initial screening through RBPT resulted in sero-prevalence of brucellosis in different species as, 26.19, 38.88, 3.41, 0.23 and 0.00 percent in cattle, buffalo, camel, goat and sheep, respectively. Highest sero-prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. The odds ratio indicated that the chances of occurrence of brucellosis are higher in buffaloes. Sero-prevalence observed with cELISA was 24.90, 34.44, 2.36, 0.23 and 0.00 percent in cattle, buffaloes, camel, goat and sheep, respectively. Similar pattern of sero- prevalence as that in RBPT was observed with cELISA that is, significant higher prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. The results are in accordance with the results of previous reports shows that the prevalence of brucellosis in large ruminants is higher as associated to the other species (Akbarmehr and Ghiyamirad, 2011; Hamidullah et al., 2009; Abubakar et al., 2010; Shafee et al., 2011 Abubakar et al., 2012). The higher differences in prevalence of brucellosis in different livestock species may be attributed to the Brucella species prevalent in different geographic region, intensive farming system and husbandry practices (Baek et al., 2003; Mantur and Amarnath, 2008;

Lopes et al., 2010). Moreover, the higher prevalence of the disease in cattle and buffalo may be attributed to the prolonged history of abortion on the farms under study.

In the present study, sero-prevalence in cattle was 26.19 and 24.90 in RBPT and cELISA, respectively which is higher than the previously reported sero-prevalence ranging between 10.32 to 22.7% (Nasir et al., 2005; Hamidullah et al., 2009; Gul et al., 2014). Whilst sero-prevalence of brucellosis was recorded higher in buffalo as 38.88 and 34.44 %, respectively, with RBPT and cELISA. Prevalence of brucellosis is very higher than the previously published report which is 7.74-12.39% (Abubakar et al., 2010; Gul et al., 2014). This may attributed owing to a long history of infection of brucellosis at selected buffalo farms which infect a huge number of animals at farm. Other possible reasons may be intensive farming and poor management conditions.

In the current study, 3.41% of camels were seropositive with RBPT and 2.36% of camels were seropositive with cELISA. Previous studies reported a very high level prevalence of brucellosis in camels. However, most of these studies were targeted to high risk population and that is why reported higher prevalence rate (Radwan et al., 1992a; Omer et al., 2000; Megersa et al., 2005; Al-Majali et al., 2008; Mohammed et al., 2011). In Pakistan few available studies regarding brucellosis in camel reported 2.0-3.07% prevalence similar to our study (Aslam, 2009; Gul et al., 2014).

5.1.1 Risk factors analysis of brucellosis in different livestock species in Punjab, Pakistan

Many factors, including host, agent and environmental factors, directly or indirectly influence the prevalence, distribution and transmission of a disease (Burridge, 1981). A large herd size, a high stocking density, older animals, frequent introduction of untested livestock, unrestricted grazing and grazing of communal pastures can all be associated with a high sero- prevalence of brucellosis (Nicoletti, 1976; Breitmeyer et al., 1992; Kadohira et al., 1997).

In order to estimate the effects of risk factors on the sero-prevalence of disease, several parameters were structured in form of a questionnaire (Appendix 1) and the results are presented in Tables (4.1 to 4.19). Information on disease is often collected from two

98 sources: the owner and direct observation of herds/flocks. However in Pakistan, the quality of information collected from these sources may be questionable. In the current study, most private livestock owners had no systematic herd records or an animal identification system. Consequently no reliable data were available regarding the number of births, early mortalities, the birth of weak young or stillbirths or the number of abortions occurring each year in the flocks/herds. Most of the sampled herds were managed by illiterate expatriate workers who were not familiar with the origin of the animals if they had been purchased.

Several factors were analyzed as potential risk factors at individual level. In this study the individual animal factors including geographic source, age, sex, parity, pregnancy status and individual animal history of reproductive disorders were analyzed. Questionnaire based information (Appendix 1) collected during this study indicated that several factors could be considered as potential risk factors for the disease increasing the risk of an animal being infected with brucellosis. However, the risk factors associated with sero-positivity varied between species at individual levels in the univariable analyses.

5.1.2 Source based analysis of brucellosis in different livestock species in Punjab, Pakistan

In cattle, highest sero-prevalence of brucellosis was recorded in 58.71% in Okara, which is significantly different in different regions of Punjab. Similarly, prevalence of brucellosis was very high in Toba Tek Singh (65.32%) in buffalo. Camels in District Faisalabad were more likely to be seropositive (9.03%) than camels from other districts. These results highlight the prevalent nature of brucellosis in central Punjab. This may be attributed to close contact of livestock species, deficiency in effective health program of herds, poor management system, introduction of high yielding animals in the herds without adaptation of good quarantine mesures, higher population density of livestock and shared grazing along with poor management practices adopted by farmers in this region (Abu Damir et al., 1984; Kudi et al., 1997; Nasir et al., 2004; Munir et al., 2011; Mohammed et al., 2011; Sikder et al., 2012). It is well documented that the disease transmit betweeen species (Erdenebaatar et al., 2004; Dawood, 2008) and these findings are in accordance with previous reports of higher prevalence levels in camels kept along with large and small

99 ruminants (Ismaily et al., 1988; Radwan et al., 1992b; Abou-Eisha, 2000; Musa and Shigid, 2001; Al-Majali et al., 2008; Mohammed et al., 2011).

5.1.3 Age based analysis of brucellosis in different livestock species in Punjab, Pakistan

Age is recognized as one of the basic factors persuading sero-prevalence of brucellosis (Megersa et al., 2011). In the present study, sero-prevalence of brucellosis in cattle and buffalo was recorded significantly higher through RBPT and cELISA. Logistic regression analysis of RBPT and cELISA based results show that the disease prevalence chances are more in older age groups as compared to younger animals. Infection may occur in camels of all ages but more persistent in sexually mature animals (Dhand et al., 2005; Aulakh et al., 2008; Abubakar et al., 2010). The study reveals significant difference between young and adult age groups. Significantly higher prevalence of brucellosis in adult age groups was observed as compared to lower age groups similar to previous studies (Kadohira et al., 1997; Megersa et al., 2005; Muma et al, 2006; Dawood, 2008; Chimana et al, 2010; Rahman et al., 2011; Balcha and Fentie, 2011). Animals are more expected to be exposed to the disease with increase in their age. With the increased age of the animal increased level of hormones and erythritol may attribute the enhanced growth of Brucella (Poester et al., 2013). Similarly Younger animals have a tendency to be resistant to the brucellosis and frequently clear infections though latent infections may occur. Moreover, chances of occurrence of disease are more in animals which graze freely on contaminated pasture as compared to young animals which have not reached reproductive productive age. (Radostits et al., 2000; Walker, 1999).

5.1.4 Sex based analysis of brucellosis in different livestock species in Punjab, Pakistan

In this study, sero-prevalence of brucellosis in cattle in relation to sex was significantly high in females as compared to male animals through all tests. In buffaloes, similar observations as that in cattle are evident in current study that is prevalence of brucellosis was higher in female animals as compared to male. These results are similar to the previous reports indicating significantly higher prevalence in females than in males (Agab, 1997; Khan et al., 2009; Junaidu et al., 2011). Omer et al. (2010) also reported that high prevalence of brucellosis in female (40.1%) camels as compared with male (28.2%). In

100 the present study prevalence of brucellosis in camel was evident in female animals only. Higher sero-prevalence was also evident in female animals in previous studies (Yagoub et al., 1990; Muma et al., 2007; Tolosa et al., 2008; Bayemi et al., 2009; Hadush et al., 2013). Females are generally kept for longer period of time than males and this is likely to have increased opportunity to exposure to the bacterium (Mekonnen et al., 2010). Relatively higher vulnerability of female animals could also be for the reason that females have more physiologically anxious than male animals (Walker, 1999). Moreover, cows are maintained in the semi-intensive systems for production for longer period of time as related to bulls. However, there are reports with prevalence of disease as frequent in males as in females (Kubuafor et al., 2000; Akbarmehr and Ghiyamirad, 2011; Gul and Khan, 2007).

5.1.5 Reproductive disorder based analysis of brucellosis in different livestock species in Punjab, Pakistan

The sero-prevalence of disease in cattle and buffalo with a history of reproductive disorders was significantly higher than those without an reproductive disorders history. This was expected, as the disease usually manifests itself as abortions (Mahajan and Kulshreshtha, 1986; Arda et al, 1987; Kenar et al, 1990). Fensterbank (1977) reported that one infected cow at parturition could shed enough bacteria to infect up to 600,000 animals and the antibodies induced by infection are likely to last for the duration of the animal‘s life (Alton, 1990a; Duran-Ferrer, 1998). In the present investigation, a statistically non-significant higher seropositivity was recorded in animals with poor health status consequently moderate and good health status. In other studies association between health status and Brucella infection in camels has been described (Musa and Shigid, 2001; Mohammed et al., 2011).

5.1.6 Parity based analysis of brucellosis in different livestock species in Punjab, Pakistan

Sero-prevalence of brucellosis in groups based upon lactation number was higher in animals having more number of lactations as compared to those having less number of lactations. Difference among these groups was statistically significant in case if cattle and camel but non-significant in case of buffalo. However, in present study odds ratio indicates that the chances of disease prevalence in animal species including cattle, buffalo and camel

101 are higher in animals having more number of lactations with both RBPT and cELISA. These results are supported by the results of Matope et al. (2011) and Sikder et al. (2012). In the present study, animals with more parity number had non-significantly higher prevalence rate of brucellosis as in age groups. Animals with more parity numbers were found more likely to be seropositive as compared to animals with less parity number. Similar observations were reported by others (Gul et al. 2014; Mohammed et al., 2011).

5.1.7 Pregnancy Status based analysis of brucellosis in different livestock species in Punjab, Pakistan

The present study indicated non-significant difference of occurrence of the disease in pregnant to non-pregnant animals in all animal species under study including cattle, buffalo and camel. Exposure seems to be more common in sexually mature animals and possibility of infection increases with pregnancy as the period of pregnancy increases (Crawford et al., 1990).

5.2 Molecular investigations

Diagnosis of brucellosis in clinical cases cannot be achieved easily. There are several tests based on serology for the diagnosis of brucellosis but cross reactivity is major problem in case of serological tests. Isolation of the organism still is the gold standard for the conclusive diagnosis of the disease which is time consuming and it could be hazardous. Moreover, this procedure is laborious and entails a considerable turnover time (~ 1 week). This also requires a biosafety level 3 laboratory and skilled technical personnel. Handling of live Brucella cultures contains high laboratory-acquired risk of getting infections, therefore, strict rules of biosafety must be observed.

Molecular diagnostic methods (e.g. PCR) have considerably reduced this risk and are the most reliable tools in terms of sensitivity and specificity (Leyla et al., 2003). More than 400 scientific reports are available in the literature for rapid detection of organism to differential identification of species and strains of brucellosis (Yu and Nielsen, 2010; Poester et al., 2010). Although PCR tests have high sensitivity and specificity, serological assays are easier to use and more widely adopted in the field.

102

Several types of primer pairs have been used to identify the genus Brucella. The primer sequences have been derived from polymorphic regions of genomes and include sequences encoding BCSP-31 (B4/B5), 16SrRNA(F4/R2), 16S–23S intergenic transcribed spacers (Bru ITS-S/Bru ITS-A), 16S-23S rDNA interspace (ITS66/ITS279), IS711 (IS313/IS639), per (bruc1/bruc5), omp2 (JPF/JPR) and outer membrane proteins (omp31, omp 2b and omp2a) (Baily et al., 1992; Fekete et al., 1992; Romero et al., 1995; Bricker et al., 2000; Hénault et al., 2000; Bogdanovich et al., 2004; Imaoka et al., 2007; Keid et al., 2007). The diagnostic sensitivity and specificity of these sets of primers have been found to be inconsistent. PCR assays targeted at the 16S-23S rRNA operon and Brucella BCSP-31 gene are highly conserved in Brucella genus and are often used for screening of brucellosis in humans, animals and food samples (e.g. serum, blood and milk) (Bricker, 2002). Comparative analyses of three genus-specific PCR assays (16S rRNA, bcsp31 and omp2 gene sequences), revealed a poor diagnostic efficiency of 16S rRNA on bovine blood samples, while bcsp31 was most sensitive and had similar sensitivity to omp2 PCR (Mukherjee et al., 2007). A combined use of these two primers (bcsp31 and omp2) significantly augmented the diagnostic specificity and sensitivity of the test.

For rapid recognition and differentiation, a novel PCR assays has been developed (Hinic et al., 2009). In this study, rapid and accurate recognition of Brucella multiple insertion part of gene known as BCSP31, which is stable in location in the chromosomes, was targeted. For differentiation of B. abortus and B. melitensis unique genetic sequences were chosen. This PCR assay is reported to be highly accurate and proper for both conventional and real time PCR formats (Yu and Nielsen, 2010).

In the present study, Bcsp-31 (B4/B5) derived from polymorphic region for genus and a novel PCR was employed to identify Brucella at the species levels were utilized. Out of 431 samples analyzed through conventional PCR 13.68% (n=59) of samples were positive for Brucella genus. Among these 10.90% (n=47) were detected positive for Brucella abortus and 0.23% (n=1) was detected as Brucella melitensis. Rest of the samples 2.55 (n=11) could not be speciated.

The sequences were aligned with already reported sequences available in NCBI

103

GeneBank and revealed nearly 100% amino acid sequence based identity with bcsp31 gene of Brucella reported from other parts of the world. According to molecular analysis the bcsp31 gene isolated from camel, cattle and buffalo harbors significant levels of identity, clearly depicting divergence from common ancestor. Moreover, the isolates displayed significant levels of identity with various Brucella species reported from Indian Continent. Such molecular results indicate the trans-boundary nature of brucellosis. Furthermore, structural modeling and homology search displays its close resemblance to various periplasmic proteins. Present study, justifies evolution of BCSP31 proteins from some protein of periplasmic origin.

Further analysis of samples was carried out by real time PCR which many fold more sensitive and specific method than conventional-PCR. It is faster, accurate and more sensitive than serological methods. In present study, with real-time PCR 33.64% (n=145) cases positive for Brucella genus among 431 tested samples which are positive with cELISA. Among these 26.91 (n=116) samples, were positive for B. abortus and 0.46% (n=2) were positive for B. melitensis. Previous study in human reported out of 18 individuals positive for the two serological tests, 15 were found to be positive in genus-specific BCSP-31 and species-specific IS-711 for B. abortus qRTPCRs (Ali et al., 2013a).

It showed by both contemporary studies that B. abortus is the main cause of brucellosis in Pakistan. This statement is further reinforced by another study in cattle and buffalo in Pakistan which proves that B. abortus biovar 1 is prevalent on the basis of species specific PCR and biochemical analysis (Ali et al., 2013b, Ali et al., 2013c). The present study also identified Brucella melitensis from buffalo, which is first ever report of detection of the organism in Pakistan.

Possible explanation of the difference of percentage of detection out of serological positive samples could be due to stage of the disease. In acute cases molecular methods are useful techniques to detect the organism at early stage of the disease. Whereas in chronic cases, when the organism is not present in the blood stream serological tests are helpful. RT- PCR is 89% more sensitive and specific technique than RBPT. The results of present study

104 showed that real-time PCR assay is a more significant technique than others for efficient diagnosis of clinical cases of brucellosis.

The endemicity of the disease in Pakistan is of concern as livestock from one region are a potential source of infection for livestock in the disease free regions. Since inter-strain genomic variability was not observed, the occurrence of the disease would appear to be a result of the transportation of diseased animals. Investigations on the role of vaccine strains associated abortions in Pakistan have not been investigated, and in this region livestock are widely vaccinated with RB-51 as part of the control program. Isolation of B. melitensis Rev-1 from milk and aborted fetuses of small ruminants has been reported elsewhere (Blasco, 1997; European Commission, 2001; Bardenstein et al, 2002; Pishva and Salehi, 2008). In conclusion, natural infection is not only cause of brucellosis in Pakistan and it is likely that B. abortus is of importance in the country. 5.3 Gross and Histopathology Clinically brucellosis is hardly seen by the pathologist because of pathogenesis of the disease. In histological lesions it produces granulomatous lesions which may be caseating or non-caseating, abscesses may also be observed and chronic inflammation. Soft tissues including lungs and liver as most affected. Grossly, granulomatous lesions with pneumonia were seen in the lungs only. Similar lesions were observed by Akhtar (2001) and Theegarten et al. (2008) in humans. Clinical signs and macroscopic lesions are in disagreement to those reported earlier by Nasruddin et al. (2014) in experimentally infected bucks with Brucella melitensis. On gross observations all other organs including spleen, liver, testes, mammary glands and kidneys were normal during necropsy probably due to the shorter exposure time and route of infection used. While histo-pathological lesions were observed in liver showed hepatocytes with centrally placed nuclei and granular cytoplasm with cloudy swelling give rise to collapsed synosydal spaces with individual cell necrosis of hepatocytes. Areas of necrosis and hemorrhages around central vein with active von kupffer cells and mild mononuclear cells infiltration were also evident. Similar lesions were also described earlier in cattle by Ewalt et al. (1997) and in bucks by nasruddin et al. (2014). Lungs showed diffusely thickened alveolar walls, fibrinous exudate containing macrophages, mononuclear cells and granulocytes in alveolar spaces, interstitial inflammatory infiltrate in the parenchyma of the lungs, congestion, dilatation of blood

105 vessels, bronchioles containing fibrinous fluid, pleura thickened, edematous, congested and hemorrhagic just below pleura. Various reports of Brucella experimental infection and natural infection in different species showed similar results (Chavez and Veach, 1976; Ewalt et al., 1997; Al-Anazi et al., 2005; Theegarten et al., 2008). Kidneys showed infiltration of granular and multilobed cells in glomeruli obliterating the glomerular space with mild to moderate congestion of medullary area. Proximal as well as medullary tubules showed pinkish colored pretentious material and areas of necrosis are also evident at some places. These results are in accordance with results of previous reports in humans (Hartigan et al., 1997; Colmenero et al., 2002) and in animals (Mense et al.,

2004). Spleen showed hyperplasia of the many germinal follicles, proliferation of the cells with lightly stained cytoplasm and increased population of macrophages, red pulp filled with lymphocytes, macrophages and plenty of RBC‘s. A study in rhesus macaques in experimentally induced by aerosol exposure of brucellosis also described similar increased numbers of lymphohistiocytic cells (Mense et al., 2004). In another study by Ahmed et al., (2012) lymphoid depletion was reported in spleen of naturally infected bovine which were sero-positive for brucellosis. These differences observed may be attributed to duration/course of the disease. Uterus showed placentome with necrotic debris comprised of intense inflammatory infiltrate, dead tissue, multiple foci of degenerating areas specifically below the epithelium, glands are degenerated mixed with inflammatory cells, blood vessels are congested. The results are in accordance with Xavier et al. (2009) and Meador et al. (1989) observations recorded in Brucella abortus infected cattle and goats. Mammary gland showed focal interstitial infiltration of lymphocytes, macrophages and neutrophils. Alton (1990) also described inflammation of the mammary gland in goats with acute natural infections.

106

CHAPTER 6

SUMMARY

Brucellosis is highly contagious bacterial disease and most dreadful zoonotic disease around the world. Brucellosis leads to huge economic losses in terms of reduced productivity, late term abortion, stillborn, weak calves, temporary or permanent infertility, reduced milk yield, prolonged calving interval and trade implications. The disease affects wide range of mammalian species including domesticated animals, sea mammals, fresh water fish and also wild life species. The disease problem is more thoughtful in the developing countries owing to deficiency of effective domestic animal health programs, public health measures and proper diagnostic facilities.

The pervasiveness of brucellosis in all livestock animals in Pakistan has been reported by various authors. At national level a limited literature is present relevant to the prevalence rate of the disease although infection has been confirmed in cattle, buffalo, goats, sheep, camel and humans. As far as could be ascertained, very limited data is available on the molecular investigation and virtually it is considered that Brucella abortus is the sole cause of brucellosis in all animal species. Furthermore, studies to explore various lesions of brucellosis (Brucella melitensis) in organs of native goats are also lacking.

In view of the foregoing, present study has been planned to determine sero- prevalence, detect Brucella species in naturally infected animals (cow, buffalo, sheep, goat and camels) and experimental study of patho-morphological changes in goats. Since primary objective of the study is to detect Brucella species involved in causation of disease in animals, an inclusive protocol was followed to collect samples from animals from farms at risk or have history of recent abortion. To this end, blood samples (n=3643) were collected from cattle (n=1149), buffaloes (n=360), sheep (n=281), goats (n=1092) and camels (n=761) residing in different locations/farms in Punjab, Pakistan.

107 as, 26.19, 38.88, 3.41, 0.23 and 0.00 percent in cattle, buffalo, camel, goat and sheep, respectively. Highest sero-prevalence was observed in buffalo followed by cattle, camel and sheep, respectively. The higher differences in prevalence of brucellosis in different livestock species may be attributed to the Brucella species prevalent in different geographic region, intensive farming system and husbandry practices.

In the present study, sero-prevalence in cattle was 26.19 and 24.90 in RBPT and cELISA, respectively. Whereas, sero-prevalence of brucellosis was recorded higher in buffalo as 38.88 and 34.44 %, respectively, with RBPT and cELISA. Statistically, this difference was highly significant that may be due to prolonged history of infection of brucellosis at selected buffalo farms which infect a huge number of animals at farm, intensive farming and poor management conditions. In the current study, 3.41% of camels were seropositive with RBPT and 2.36% of camels were seropositive with cELISA.

Many factors, including host, agent and environmental factors, directly or indirectly influence the prevalence, distribution and transmission of a disease. A large herd size, a high stocking density, older animals, frequent introduction of untested livestock, unrestricted grazing and grazing of communal pastures can all be associated with a high sero-prevalence of brucellosis. Several factors were analyzed as potential risk factors at individual level. In this study the individual animal factors analyzed included geographic source, age, sex, parity, pregnancy status and individual animal history of abortion or reproductive disorders. Questionnaire based information collected during this study indicated that several factors could be considered as potential risk factors for the disease increasing the risk of an animal being infected with brucellosis. However, the risk factors associated with sero-positivity varied between species at individual levels in the univariable analyses.

108 program of the herds, poor management system, introduction of high production animals without application of proper quarantine measures, higher population density of livestock and shared grazing along with poor management practices adopted by farmers in this region.

In present study, prevalence rate of brucellosis in cattle and buffalo was recorded significantly higher through RBPT and cELISA. Logistic regression analysis of RBPT and cELISA based results show that the disease prevalence chances are more in older age groups as compared to younger animals. Infection may occur in camels of all ages but more persistent in sexually mature animals.

In this study, sero-prevalence of brucellosis in cattle in relation to sex was significantly high in females as compared to male animals through all tests. In buffaloes, similar observations as that in cattle are evident in current study that is prevalence of brucellosis was more in female animals as related to male. Prevalence of brucellosis in camel was frequentely occur in female animals. Females are generally kept for longer period of time than males and this is likely to have increased opportunity to exposure to the bacterium. Relatively higher vulnerability of female animals could also be for the reason that females have more physiologically anxious than male animals and cows are contained for production (dairy purpose) for prolonged duration of time.

The sero-prevalence of disease in cattle and buffalo with a history of reproductive disorders was significantly higher than those without an reproductive disorders history. This was expected, as the disease usually manifests itself as abortions. In the present investigation, statistically significant higher seropositivity was recorded in animals with poor health status consequently moderate and good health status.

109

For more confirmed picture of Brucellosis, a more sensitive and specific method (Real-time PCR) than conventional-PCR was used in current study. Real-time PCR substantiated to be a valued diagnostic test when other tests like culture or serological tests fail whose results are indecisive because of cross-reaction of antibodies of different similar antigens. It is faster, accurate and more sensitive than serological methods. In present study, with real-time PCR 33.64% (n=145) cases positive for Brucella genus among 431 tested samples which are positive with cELISA. Among these 26.91 (n=116) samples, were positive for B. abortus and 0.46% (n=2) were positive for B. melitensis. Results showed by both conventional and real time PCR, that B. abortus is the main cause of brucellosis in Pakistan. The present study also identified Brucella melitensis from buffalo, which is the first ever report of detection of the organism in Pakistan.

In experimental studies, serologically through RBPT and cELISA goats showed positive results at 9 days of post inoculation of Brucella. Grossly, soft tissues including lungs and liver are the most affected organs. Grossly, granulomatous lesions with pneumonia were recognized in lungs. Histopathologically, liver showed cloudy swelling give rise to collapsed synosydal spaces and individual cell necrosis of hepatocytes. Areas of necrosis and hemorrhages around central vein with active von kupffer cells and mild mononuclear cells infiltration were also evident. Lungs showed diffusely thickened alveolar walls, fibrinous

110 exudate containing macrophages, mononuclear cells and granulocytes in alveolar spaces, interstitial inflammatory infiltrate in the parenchyma of the lungs, pleura thickened, edematous, congested and hemorrhagic just below pleura. Kidneys showed infiltration of granular and multilobed cells in glomeruli obliterating the glomerular space with mild to moderate congestion of medullary area. Proximal as well as medullary tubules showed pinkish colored pretentious material and areas of necrosis are also evident at some places. Spleen showed hyperplasia of the many germinal follicles, proliferation of the cells with lightly stained cytoplasm and increased population of macrophages, red pulp filled with lymphocytes, macrophages and plenty of RBC‘s. Uterus showed placentome with necrotic debris comprised of intense inflammatory infiltrate, dead tissue, multiple foci of degenerating areas specifically below the epithelium, glands are degenerated mixed with inflammatory cells and blood vessels are congested.

Cross reactivity is major problem in case of serological tests. Isolation of the organism still is the gold standard for the definitive diagnosis of the disease which is time consuming and it could be hazardous. Moreover, this procedure is laborious and entails a considerable turnover time (~ 1 week). This also requires a biosafety level 3 laboratory and skilled technical personnel. Handling of live Brucella cultures involves high risk of laboratory-acquired infections, therefore, very strict biosafety rules must be observed. Molecular diagnostic methods (e.g. PCR) have considerably reduced this risk and are the most reliable tools in terms of sensitivity and specificity. The current study suggests the combination of both serological and molecular methods are helpful in the better diagnosis of the stage and status of the disease. In acute cases molecular methods are useful techniques to detect the organism at early stage of the disease. Whereas, in chronic cases, when the organism is not present in the blood stream serological tests are helpful. It has great potential to enhance efficiency of diagnosis at early stage of disease and rapid conformation of brucellosis. The results of the present study showed that real-time PCR assay is more significant technique than others for efficient diagnosis of clinical cases of brucellosis.

111 result of the transportation of diseased animals. Investigations on the role of vaccine strains associated abortions in Pakistan have not been investigated. In conclusion, natural infection is not only cause of brucellosis in Pakistan and it is likely that B. abortus is of importance in the country. This Brucella melitensis can be eradicated through test and slaughter policy. However, due to lack of resources test and slaughter policy cannot be adopted in our country B. abortus and should be controlled by vaccination programe, culling of infected animals and prevention of transmission of the disease to non-infected herds by hygienic practices.

112

BIBLIOGRAPHY

Abalos P, L Ibarra, L Pinochet, F Navia and X Boisier, 1996. Residual anti-Brucella abortus strain 19 antibodies detected in adult cattle by two indirect-Elisa tests. Vet Rec, 138: 140. Abou-Eisha MJ, 2000. Brucellosis in camels and its relation to public health. Assiut Vet Med J, 44: 54-64. Abubakar M, M Mansoor and MJ Arshed, 2012. Bovine brucellosis: Old and new concepts with Pakistan perspective. Pak Vet J, 32: 147-155. Abubakar M, MJ Arshed, M Hussain, Ehtisham-ul-Haq and Q Ali, 2010. Serological evidence of Brucella abortus prevalence in Punjab province, Pakistan a cross- sectional study. Transboundry Emerg Dis, 57: 443-447. Abu-Damir H, SJ Kenyon, EA khalfalla and FO Idris, 1984. Brucella antibodies in Sudanese camels. Trop Anim Health Prod, 16: 209-212. Acha PN and B Szyfres, 2003. Zoonoses and communicable diseases common to man and animals. 2nd ed., Pan Am Health Organ. Washington DC, USA, 24-45. Adamu SG, NN Atsanda, AO Tijjani, AM Usur, AG Sule and IA Gulani, 2016. Epidemiological study of bovine brucellosis in three senatorial zones of Bauchi state, Nigeria. Vet World, 9: 48-52. Agab H, 1997. Clinical signs of animal brucellosis in Eastern Sudan. Revue d Elevage et de Medecine Veterinaire des Pays Tropicaux (Paris), 50: 97-98. Ahmad MUD, I Muhammad and S Shakera, 2013. Seroepidemiological investigation, risk factors analysis of brucellosis in ruminants and their owners in district Buner of Pakistan. Buffalo Bull, 32: 1104-1109. Ahmed R and MA Munir, 1995. Epidemiological investigations of brucellosis in horses, dogs, cats and poultry. Pak Vet J, 15: 85-88. Ahmed WA, SA Majeed, AH Abdul-Ameer, ND Mahmmod, NI Saeed and LY Hanaa, 2016. Sensitivity and specificity of various serological tests for detection of brucella spp. infection in male goats and sheep. Adv Microbiol, 6: 98-103. Ahmed YFS, M Sokkar, HM Desouky and AA Madbouly, 2012. Pathological studies on buffalo-cows naturally infected with Brucella melitensis. Global Vet, 9: 663-668.

113

Akbarmehr J and M Ghiyamirad, 2011. Serological survey of brucellosis in livestock animals in Sarab City (East Azarbayjan province), Iran. Afr J Microbiol Res, 5: 1220-1223. Akhtar M, 2001. Histopathological features. In: Madkour MM (ed) Makour‘s brucellosis. Springer, Berlin, 65-73. Al Dahouk S, HC Scholz, H Tomaso, P Bahn, C Göllner, W Karges, B Appel, A Hensel, H Neubauer and K Nöckler, 2010. Differential phenotyping of Brucella species using a newly developed semi-automated metabolic system. BMC Microbiol, 269: 1471-81. Al Dahouk S, K Nockler, HC Scholz, M Pfeffer, H Neubauer and H Tomaso, 2007. Evaluation of genus-specific and species-specific real-time PCR assays for the identification of Brucella spp. Clin Chem Lab Med, 45: 1464-1470. Al Dahouk S, LD Sprague and H Neubauer, 2013. New developments in the diagnostic procedures for zoonotic brucellosis in humans. Rev Sci Tech Off Int Epiz, 32: 177- 188. Al Khalaf SA, BT Mohamad and P Nicoletti, 1992. Control of brucellosis in Kuwait by vaccination of cattle, sheep and goats with Brucella abortus strain 19 or Brucella melitensis strain Rev-1. Trop Anim Health Prod, 24: 45-49. Al-Anazi AR, S Aziz and MA Fouda, 2005. Brucellosis: haemorrhagic pleural effusion. Med Princ Pract, 14: 118-120. Al-Ani FK, M Al-Sharrifi and F Khalil, 1998. Serological survey on camel brucellosis in Iraq. Camel Newslett, 14: 32-33. Albayrak A and F Albayrak, 2011. Hepatic granulomas associated with brucellosis. Hepat Mon, 11: 1-2. Aldrick SJ, 1968. Typing of Brucella strains from Australia and Papua New Guinea received by the regional WHO brucellosis centre. Aust Vet J, 44: 130-133. Ali S, Q Ali, EN Abatih, N Ullah, A Muhammad, I Khanand and S Akhter, 2013a. Sero- prevalence of Brucella abortus among dairy cattle and buffaloes in Pothohar Plateau, Pakistan. Pak J Zool, 45: 1041-1046. Ali S, Q Ali, F Melzer, I Khan, S Akhter, H Neubauer and SM Jamal, 2014b. Isolation and identification of bovine brucella isolates from pakistan by biochemical tests and pcr. Trop Anim Health Prod, 46: 73-78.

114

Ali S, Q Ali, H Neubauer, F Melzer, M Elschner, I Khan, EN Abatih, N Ullah, M Irfan and S Akhter, 2013b. Seroprevalence and risk factors associated with brucellosis as a professional hazard in Pakistan. Foodborne Pathog Dis, 10: 500-505. Ali S, S Akhter, H Neubauer, F Melzer, I Khan, Q Ali and M Irfan, 2015. Serological, cultural, and molecular evidence of Brucella infection in small ruminants in Pakistan. J Infect Dev Countries, 9: 470-475. Allan GS, RJ Chappel, P Williamson and DJ McNaught, 1976. A quantitative comparison of the sensitivity of serological tests for bovine brucellosis to different antibody classes. J Hyg Camb, 76: 287-298. Allardet-Servent A, G Bourg, M Ramuz, M Pages, M Bellis and G Roizes, 1988. DNA polymorphism in strains of the genus Brucella. J Bacteriol, 170: 4603-4607. Al-Majali AM, 2005. Seroepidemiology of caprine brucellosis in Jordan. Small Ruminant Res, 58: 13-18. Al-Majali AM, AQ Talafha and MM Ababneh, 2009. Seroprevalence and risk factors for bovine brucellosis in Jordan. J Vet Sci, 10: 61-65. AL-Majali AM, MK AL-Qudah, AL AL-Tarazi and FO Rawashdeh, 2008. Risk factors associated with camel brucellosis in Jordan. Trop Anim Health Prod, 40: 193-200. AlShamahy HA and SG Wright, 1998. Enzyme linked immunosorbent assay for Brucella antigen detection in humans. J Med Microbiol, 47: 169-172. Alton GG and S Elberg, 1967. Rev.1 Brucella melitensis vaccine. A review of ten years study. Vet Bull, 37: 793-800. Alton GG, 1977a. The national brucellosis programme of Australia, in: Crawford, RP and RJ Hidalgo, (Eds.), Bovine Brucellosis. An International Symposium. Texas A and M University Press, USA, 335-345. Alton GG, 1977b. Development and evaluation of serological test, in: Crawford RP, RJ Hidalgo, (Eds.), Bovine Brucellosis. An International Symposium. Texas A and M University Press, USA, 61-78. Alton GG, 1978. Recent developments in vaccination against bovine brucellosis. Aust Vet J, 54: 551-557. Alton GG, 1990. Brucella melitensis. In: Nielsen KH and JR Duncan, Animal brucellosis, Boca Raton, CRC, pp: 383-422.

115

Alton GG, 1990a. Brucella melitensis. In: Animal Brucellosis. Nielsen K and JR Duncan, CRC Press, Florida, USA, 379-382. Alton GG, 1990b. Brucella Suis, in: Animal Brucellosis. Nielson K and JR Duncan. CRC Press, Florida, USA, 421-422. Alton GG, J Maw, BA Rogerson and GG McPherson, 1975. The serological diagnosis of bovine brucellosis. An evaluation of the complement fixation, serum agglutination and Rose Bengal test. Aust Vet J, 51: 57-63. Alton GG, LA Corner and P Plackett, 1980. Vaccination of pregnant cows with low doses of Brucella abortus strain 19 vaccine. Aust Vet J, 56: 369-372. Alton GG, LM Jones, RD Angus and JM Verger, 1988. Techniques for the brucellosis laboratory diagnosis. Insitut National de la Recherche Agronomique, Paris. Álvarezg J, JL Sáez, N García, C Serrat, M Pérez-Sancho, S González, MJ Ortega, J Gou, L Carbajo, F Garrido, J Goyache and L Domínguez, 2011. Management of an outbreak of brucellosis due to B. melitensis in dairy cattle in Spain. Res Vet Sci, 90: 208-211. Anderson RK, R Jennes, HP Brumfield and P Gough, 1964. Brucella agglutinating antibodies. Relation of mecaptoethanol stability to complement fixation. Science, 143: 1334. Anon, 2014. Consumption of raw or unpasteurized milk and milk products by pregnant women and children. Committee on Infectious Diseases; Committee on Nutrition; Am Acad Pediatr, 133: 175-179. Arda M, W Bisping, N Aydin, E Isanbulluogha, O Akay, M Izgur, Z Karaer, S Diker and G Kirpal, 1987. Aetiological studies on abortions in ewes with particular reference to detection of Brucella, Campylobacter, Salmonella, Listeria, Leptospira, and Chlamydia. Berliner and Miinchener Tier'~rztliche Wochen-schrift, 100: 405-408. Ariza J, 1996. Brucellosis. Curr Opin Infect Dis, 9: 126-131. Ariza J, M Bosilkovski, A Cascio, J Colmenero and M Corbel, 2007. Prospectives for the treatment of brucellosis in the 21st century: The Ioannina Recommendations. PLoS Med, 4: 317. Asif M, AR Awan, ME Babar, A Ali, S Firyal and QM Khan, 2009. Development of genetic marker for molecular detection of Brucella abortus. Pak J Zool, 9: 267-271.

116

Asif M, U Waheed and M Farooq, T Ali and QM Khan, 2014. Frequency of brucellosis in high risk human groups in Pakistan detected through polymerase chain reaction and its comparison with conventional slide agglutination test. Int J Agric Biol, 16: 986- 990. Aslam R, 2009. Seroprevalence of brucellosis in camels and associated personnel and comparison of serological tests. M. Sc. (Hons) Thesis. Veterinary Microbiology, University of Agriculture, Fasialabad, Pakistan. Aulakh HK, PK Patil, S Sharma, H Kumar, V Mahajan and KS Sandhu, 2008. A Study on the Epidemiology of bovine brucellosis in Punjab (India) using milk-ELISA. Acta Vet Brno, 77: 393-399. Avila-Calderon ED, A Lopez-Merino, N Sriranganathan, SM Boyle and A Contreras- Rodríguez, 2013. A history of the development of Brucella vaccines. Bio Med Res Int, Article ID 743509, 8 pages. Baek BK, MS Lim and MS Rahman, 2003. B. abortus infection in indigenous Korean dogs. Can J Vet Res, 67: 312-314. Baily GG, JB Krahn, BS Drasar and NG Stoker, 1992. Detection of Brucella melitensis and Brucella abortus by DNA amplification. J Trop Med Hyg, 95: 271-275. Balcha T and T Fentie, 2011. Seroprevalence of camel brucellosis in pastoral areas of Afar, Somali and Oromia regions, Ethiopia. Bull Anim Health Prod Afr, 59: Banai M and M Corbel, 2010. Taxonomy of Brucella. Open Vet Sci J, 4: 85-101. Bancroft JD and M Gamble, 2008. Theory and practice of histological techniques. 6th Ed. Churchill Livingstone/Elsevier, Philadelphia, USA. Bang B, 1897. The etiology of epizootic abortion. J Comp Pathol Ther, 10: 125-149. Bardenstein S, M Mandelboim, TA Ficht, M Baum and M Banai, 2002. Identification of the Brucella melitensis vaccine strain Rev.1 in animals and humans in Israel by PCR analysis of the PstI site polymorphism of its omp2 gene. J Clin Microbiol, 40: 1475- 1480. Barrio MB, MJ Grilló, PM Muñoz, I Jacques, D González, MJ de Miguel, CM Marín, M Barberán, JJ Letesson, JP Gorvel, I Moriyón, JM Blasco and MS Zygmunt, 2009. Rough mutants defective in core and O-polysaccharide synthesis and export induce antibodies reacting in an indirect ELISA with smooth lipopolysaccharide and are less

117

effective than Rev 1 vaccine against Brucella melitensis infection of sheep. Vaccine, 27: 1741-1749. Bayemi PH, EC Webb, MV Nsongka, H Unger and H Njakoi, 2009. Prevalence of Brucella abortus antibodies in serum of Holstein cattle in Cameroon. Trop Anim Health Prod, 41: 41-144. Becker HN, RC Belden, T Breault, MJ Burridge, WB Frankenberger and P Nicoletti, 1978. Brucellosis in feral swine in Florida. J Am Vet Med Assoc, 173: 1181-1182. Beckett FW and SC MacDiarmid, 1985. The effect of reduced-dose Brucella abortus strain 19 vaccination in accredited dairy herds. Br Vet J, 141: 507-514. Benkirane AH, 2006. Ovine and caprine brucellosis: World distribution and control or eradication strategies in West Asia/North Africa region. Small Ruminant Res, 62: 19- 25. Benkirane AH, El Idrissi, A Doumbia and K de Balogh, 2014. Innocuity and immune response to Brucella melitensis Rev.1 vaccine in camels (Camelus dromedarius). Open Vet J, 4: 96-102. Berman D, 1981. Brucellosis, in: Ristic M, WI McIntyre, (Eds.), Diseases of cattle in the Tropics. Martinus, Nijhoff Publishers, Hague, 271-286. Beveridge WJB, 1983. Brucellosis, in: Animal health in Australia. Australian government publishing service, 20-33. Bhat UP and A Asha, 2016. Brucellosis: An Under Diagnosed Zoonosis. Int J Curr Microbiol App Sci, 5: 309-311. Blasco JM and B Molina-Flores, 2011. Control and eradication of Brucella melitensis infection in sheep and goats. Vet Clin North Am Food Anim Pract, 27: 95-104. Blasco JM and I Moriyon, 2005. Letter to the editor, Comparative Immunol Microbiol Infec Dis, 28: 371-373. Blasco JM and R Díaz, 1993. Brucella melitensis Rev 1 vaccine as a cause of human brucellosis. Lancet, 342: 805. Blasco JM, 1990. Brucella ovis. In: Animal brucellosis. Edited by Nielsen K and JR Duncan. CRC Press, Florida, USA, 351-378. Blasco JM, 1997. A review of the use of B. melitensis Rev-1 vaccine in adult sheep and goats. Prev Vet Med, 31: 275-281.

118

Blasco JM, 2006. Existing and future vaccines against brucellosis in small ruminants. Small Ruminant Res, 62: 33-37. Blasco JM, B Garin-Bastuji, CM Marin, G Gerbier, J Fanlo, MP Jiménez de Bagués and C Cau, 1994a. Efficacy of different Rose Bengal and complement fixation antigens for the diagnosis of Brucella melitensis infection in sheep and goats. Vet Rec, 134: 415- 420. Blasco JM, C Marín, M Jiménez de Bagués, M Barberán, A Hernández, L Molina, J Velasco, R Díaz and I Moriyón, 1994b. Evaluation of allergic and serological tests for diagnosing Brucella melitensis infection in sheep. J Clin Microbiol, 32: 1835-1840. Bogdanovich T, M Skurnik, PS Lubeck, P Ahrens, J Hoorfar and Validated, 2004. 5′ nuclease PCR assay for rapid identification of the genus Brucella. J Clin Microbiol, 42: 2261-2263. Bracewell CD and MJ Corbel, 1980. An association between arthritis and persistent serological reactions to Brucella abortus in cattle from apparently brucellosis-free herds. Vet Rec, 106: 99-101. Breitmeyer RE, DW Hird and TE Carpenter, 1992. Serologic and bacteriologic test results after adult vaccination with strain 19 in three dairy herds infected with brucellosis. J Am Vet Med Assoc, 200: 806-811. Brew SD, LL Perrett, JA Stack, AP MacMillan and NJ Staunton, 1999. Human exposure to Brucella recovered from a sea mammal. Vet Rec, 144: 483. Bricker BJ and SM Halling, 1994. Differentiation of Brucella abortus (biovars 1, 2, and 4), Brucella melitensis, Brucella ovis, and Brucella suis (biovar 1) by the polymerase chain reaction. J Clin Microbiol, 32: 2660-2666. Bricker BJ, 2002. PCR as a diagnostic tool for brucellosis. Vet Microbiol, 90: 435-46. Bricker BJ, DR Ewalt and SM Halling, 2003a. Brucella ―HOOF-Prints‖: strain typing by multi-locus analysis of variable number tandem repeats (VNTRs). BMC Microbiol, 3: 15. Bricker BJ, DR Ewalt, SC Olsen and AE Jensen, 2003b. Evaluation of the Brucella abortus species-specific polymerase chain reaction assay, an improved version of the Brucella-AMOS polymerase chain reaction assay for cattle. J Vet Diagn Invest, 15: 374-378.

119

Brinley-Morgan WJ, 1967. The serological diagnosis of bovine brucellosis. Vet Rec, 80: 612-621. Brinley-Morgan WJ, DJ MacKinnon, KPW Gill, SGM Gower and PIW Norris, 1978. Brucellosis Diagnosis– Standard Laboratory Techniques, 2nd Edition, Central Veterinary Laboratory, Weighbridge UK. Brown EN, 1974. An adaptation of the Rose Bengal Plate Test for the diagnosis of brucellosis at abattoirs. Aust Vet J, 50: 127. Burridge MJ, 1981. Epidemiological approaches to disease control. In: Diseases of cattle in the tropics. Economic and zoonotic relevance. Edited by Ristic M and I McIntyre, Martinus Nijhoff Publishers. The Hague, Boston, London, 53-64. Cameron HS and ME Meyer, 1958. Metabolic studies on Brucella neotomae (Stoenner and Lackman). J Bacteriol, 76: 546-548. Cargill C, K Lee and I Clarke, 1985. Use of an enzyme-linked immunosorbent assay in a bovine brucellosis eradication program. Aust Vet J, 62: 49-52. Carmichael LE and JC Joubert, 1988. Transmission of Brucella canis by contact exposure. Cornell Vet, 78: 63-73. Carmichael LE, 1990. Brucella canis, in: Nielsen K, JR Duncan, Animal Brucellosis. CRC Press, Florida, USA, 335-350. Carrére L, H Lafenêtre, H Quatrefages and F de-Noronha, 1960. Durée de la survie des Brucella dans le fromage de Roquefort. Bull Acad Vet, 33: 469-473. CDC, Centers for Disease Control and Prevention Centers for Disease Control and Prevention, 2008. Brucellosis (Brucella melitensis, abortus, suis, and canis); available at http://www.cdc.gov/search.do?q=biological+warfare%2C+B.+melitensis&spell=1&ie =utf8. Accessed 5 April 2014. Chavez CA and GE Veach, 1976. Brucellosis. Localized pulmonary nodule due to Brucella suis. J Kansas Med Soc, 76: 434-437. Cheville NF, AE Jensen, SM Halling, FM Tatum, DC Morfitt, SG Hennager, WM Frerichs and G Schurig, 1992. Bacterial survival, lymph node changes, and immunologic responses of cattle vaccinated with standard and mutant strains of Brucella abortus. Am J Vet Res, 53: 1881-1888.

120

Cheville NF, MG Stevens, AE Jensen, FM Tatum and SM Halling, 1993. Immune responses and protection against infection and abortion in cattle experimentally vaccinated with mutant strains of Brucella abortus. Am J Vet Res, 54: 1591-1597. Cheville NF, SC Olsen, AE Jensen, MG Stevens, MV Palmer and AM Florance, 1996. Effects of age at vaccination on efficacy of Brucella abortus strain RB51 to protect cattle against brucellosis. Am J Vet Res, 57: 1153-1156. Chimana HM, JB Muma, KL Samui, BM Hangombe, M Munyeme, G Matope, AM Phiri, J Godfroid, E Skjerve and M Tryland, 2010. A comparative study of the seroprevalence of brucellosis in commercial and small-scale mixed dairy-beef cattle enterprises of Lusaka province and Chibombo district, Zambia. Trop Anim Health Prod, 42: 1541- 1545. Christie TE, 1969. Eradication of brucellosis in Northern Ireland: field problems and experience. Vet Rec, 85: 268. Christopher S, BL Umapathy and KL Ravikumar, 2010. Brucellosis: review on the recent trends in pathogenicity and laboratory diagnosis. J Lab Phy, 2: 55-60. Clavareau C, V Wellemans, K Walravens, M Tryland, JM Verger, M Grayon, A Cloeckaert, JJ Letesson and J Godfroid, 2009. Phenotypic molecular characterization of Brucella strain isolated from minke whale (Balaenoptera acutorostrata). Microbiology, 144: 3267-3273. Coelho AC, JG Díez and AM Coelho, 2015. Risk Factors for Brucella spp. in Domestic and Wild Animals. http://dx.doi.org/10.5772/61325 Cohen ND, GK Carter and WC McMullan, 1992. Fistulous withers in horses: 24 cases (1984-1990). J Am Vet Med Assoc, 201: 121-124. Colmenero JD, MI Queipo-Ortuño and J Maria Reguera, 2002. Chronic hepatosplenic abscesses in Brucellosis. Clinico-therapeutic features and molecular diagnostic approach. Diagn Microbiol Infect Dis, 42: 159-67. Corbel MJ and WJB Brinley-Morgan, 1984. Brucella, In: Krieg NR and JG Holt, (Eds.), Bergey‘s Manual of Systemic Bacteriology. Williams and Wilkins, Baltimore, USA, 377-388. Corbel MJ, 1972. Characterization of antibodies active in the Rose Bengel plate test. Vet Rec, 9: 484-485.

121

Corbel MJ, 1983. Brucellosis: epidemiology and prevalence worldwide, In: Young EJ and MJ Corbel, (Eds.), Brucellosis clinical and laboratory aspects. CRC Press, Boca Raton, Florida, USA, 25-40. Corbel MJ, 1989. Brucellosis: Epidemiology and prevalence worldwide. In: Brucellosis: Clinical and laboratory aspects. Edited by Young EJ and MJ Corbel, CRC Press, Florida, 25-40. Corbel MJ, 1997a. Recent advances in brucellosis. J Med Microbiol, 46: 101-103. Corbel MJ, 1997b. Brucellosis: an overview. Emerg Infect Dis, 3: 213-221. Corbel MJ, 1998. Brucella. J Syst Bacteriol, 2: 842-844. Corbel MJ, 2006. Brucellosis in humans and animals. WHO/CDS/EPR/2006-7. Available from http://www.who.int/entity/csr/resources/publications/Brucellosis.pdf. Corner LA and GG Alton, 1981. Persistence of Brucella abortus strain 19 infection in adult cattle vaccinated with reduced doses. Res Vet Sci, 31: 342-344. Corner LA, GG Alton and H Iyer, 1985. An evaluation of a biphasic medium for the isolation of Brucella abortus from bovine tissues. Aust Vet J, 62: 187-189. Crawford RP, JD Huber and BS Adams, 1990. Epidemiology and surveillance, In: Animal Brucellosis. 131-151. Crawford RP, RC Heck and JD Williams, 1978. Experiences with Brucella abortus strain 19 vaccine in adult Texas cattle. J Am Vet Med Assoc, 173: 1457-1461. Crowther RW, A Orphanides and K Polydorou, 1977. Vaccination of adult sheep with reduced doses of Brucella melitensis strain Rev1 : Safety and serological responses. Trop Anim Health Prod, 9: 85-91. Cunningham BA, 1968. The control and eradication of brucellosis. 1. Serological response in cattle following vaccination with S19 and a killed Brucella 45/20 adjuvant vaccine. Vet Rec, 82: 7-11. Cunningham BA, 1977. A difficult disease called brucellosis, in: Bovine Brucellosis - An International Symposium. College Station, Texas A&M University Press, USA, 11- 20. Da Costa M, JP Guillou, B Garin-Bastuji, M Thiébaud and G Dubray, 1996. Specificity of six gene sequences for the detection of the genus Brucella by DNA amplification. J Appl Bacteriol, 81: 267-275.

122

Danks AG, 1943. Brucella abortus strain 19 and orchitis in bull. Cornell Veterinarian 33: 381. Cited by Nicoletti P, 1990. Vaccination. In Animal Brucellosis. Nielsen K and JR Duncan. Animal Disease Research Institute Agriculture Canada Nepean Ontario, CRC Press, 283-299. Davies G and A Casey, 1973. The survival of Brucella abortus in milk and milk products. Br Vet J, 129: 345-353. Davies G, 1971. The Rose Bengal Test. Vet Rec, 88: 447. Dawood AH, 2008. Brucellosis in Camels (Camelus dromedorius) in the south province of Jordan. Am J Agric Biol Sci, 3: 623-626. De Bagués MPJ, CM Marin and JM Blasco, 1991. Effect of antibiotic-therapy and strain-19 vaccination on the spread of Brucella melitensis within an infected dairy-herd. Prev Vet Med, 11: 17-24. De Bagués MPJ, CM Marín and JM Blasco, 1992. An ELISA with Brucella lipopolysaccharide antigen for the diagnosis of B. melitensis infection in sheep and for the evaluation of serological responses following subcutaneous or conjunctival B. melitensis Rev-1 vaccination. Vet Microbiol, 30: 233-241. Denny HR, 1973. A review of brucellosis in the horse. Equine Vet J, 5: 121-125. Dhand NK, SG Singh, BB Aradhana, MS Bal, H Kumar, DR Sharma, J Singh and KS Sandhu, 2005. A study on the epidemiology of brucellosis in Punjab (India) using survey toolbox. Revue scientifique et technique, 24: 879-885. Díaz R, P Garatea, LM Jones and I Moriyon, 1979. Radial immunodiffusion test with a Brucella polysaccharide antigen for differentiating infected from vaccinated cattle. J Clin Microbiol, 10: 37-41. Díaz-Aparicio E, C Marín, B Alonso-Urmeneta, V Aragón, S Pérez-Ortiz, M Pardo, JM Blasco, R Díaz and I Moriyón, 1994. Evaluation of serological tests for diagnosis of Brucella melitensis infection of goats. J Clin Microbiol, 32: 1159-1165. Din AMU, SA Khan, I Ahmad, R Rind, T Hussain, M Shahid and S Ahmed, 2013. A study on the seroprevalence of brucellosis in human and goat populations of district Bhimber, Azad Jammu and Kashmir. J Anim Plant Sci, 23: 113-118.

123

Dohoo IR, PF Wright, GM Ruckerbauer, BS Samagh, FJ Robertson and LB Forbes, 1986. A comparison of five serological tests for bovine brucellosis. Am J Vet Res, 50: 485- 493. Dolan LA, 1980. Latent carriers of brucellosis. Vet Rec, 106: 241-243. Durán-Ferrer M, 1998. Comparación entre métodos inmunológicos de diagnóstico de la brucelosis ovina por Brucella melitensis y eficacia de la inmunización de ovejas adultas con la vacuna Rev.1 por vía conjuntival. PhD Thesis, University of Murcia, Spain. Elberg SS and K Faunce, 1957. Immunization against Brucella infection.VI Immunity conferred on goat by a non-dependent mutant from a streptomycin-dependent mutant strain of Brucella melitensis. J Bacteriol, 73, 211-217. El-Tras WF, AA Tayel, MM Eltholth and J Guitian, 2010. Brucella infection in fresh water fish: Evidence for natural infection of Nile catfish, Clarias gariepinus, with Brucella melitensis. Vet Microbiol, 141: 321-325. England T, L Kelly, RD Jones, A MacMillan and M Wooldridge, 2004. A simulation model of brucellosis spread in British cattle under several testing regimes. Prev Vet Med, 63: 63-73. Engvall L and P Perlmann, 1971. Enzyme-linked immunosorbent assay (ELISA): quantitative assay of immunoglobulin G. Immunochemistry, 8: 871. Enright FM, 1990. The pathogenesis and pathobiology of Brucella infection in domestic animals, in: Animal Brucellosis. CRC Press, Florida, USA, 302-320. Enright FM, JV Walker, G Jeffers and BL Deyoe, 1984. Cellular and humoral responses of Brucella abortus infected bovine fetuses. Am J Vet Res, 45: 424-430. Erasmus JA, 1995. Bovine brucellosis in the high veld veterinary region: a preliminary report on the seroprevalence of brucellosis amongst adult beef cows in the region. J South Afr Vet Assoc, 66: 2-5. Erdenebaatar J, B Bayarsaikhan, A Yondondorj, M Watarai, T Shirahata, E Jargalsaikhan, K Kawamoto and S Makino, 2004. Epidemiological and serological survey of brucellosis in Mongolia by ELISA using sarcosine extracts. Microbiol Immunol, 48: 571-577.

124

Ergonul A, D Celikbas, E Tezeren, B Guvener and Dokuzoguz, 2004. Analysis of risk factors for laboratory-acquired Brucella infections. J Hosp Infect, 56: 223-227. European Commission, 2001. Brucellosis in sheep and goats (Brucella melitensis). Report of the Scientific Committee on Animal Health and Welfare of the European Commission 2001. Ewalt DR, JB Payeur, BM Martin, DR Cummins and WG Miller, 1994. Characteristics of a Brucella Species from a Bottle-Nosed-Dolphin (Tursiops-Truncatus). J Vet Diagn Investig, 6: 448-452. Ewalt DR, JB Payeur, JC Rhyan and PL Geer, 1997. Brucella suis biovar 1 in naturally infected cattle: a bacteriological, serological, and histological study. J Vet Diagn Invest, 9: 417-420. FAO, 2003. Guidelines for coordinated human and animal brucellosis surveillance. Fassi-Fehri M, 1975. Development and factors of spreading of brucellosis in Morocco. Maroc Med, 55: 28-32. Fekete A, JA Bantle, SM Halling and RW Stich, 1992. Amplification fragment length polymorphism in Brucella strains by use of polymerase chain reaction with arbitrary primers. J Bacteriol, 174: 7778-7783. Fensterbank R, 1977. Diagnostic allergique de la brucellose bovine. 2 Utilisation du test allergique dans les troupeaux infectes. Ann Rech Vet, 8: 195. Fensterbank R, P Pardon and J Marly, 1982. Comparison between subcutaneous and conjunctival route of vaccination with Rev. 1 strain against Brucella melitensis infection in ewes. Ann Rech Vet, 13: 295-301. Fichi TA, 2003. Intracellular survival of Brucella: defining the link with persistence. Vet Microbiol, 92: 213-223. Figueiredo YZ, TA Ficht, A Rice-Ficht, CA Rossetti and LG Adams, 2015. Pathogenesis and immunobiology of brucellosis review of Brucella host interactions. Am J Pathol, 185: Flores-Tena F, AL Guerrero-Barrera, FJ Avelar-González, EM Ramírez-López and MC Martínez-Saldaña, 2007. Pathogenic and opportunistic Gram-negative bacteria in soil, leachate and air in San Nicolás landfill at Aguascalientes, Mexico. Rev Latinoam Microbiol, 49: 25-30.

125

Forbes LB and SV Tessaro, 1996. The existing and potential importance of brucellosis and tuberculosisin Canadian wildlife. Can Vet J, 37: 415. Foster G, BS Osterman, J Godfroid, I Jacques and A Cloeckaert, 2007. Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts. Int J Syst Evol Microbiol, 57: 2688-2693. Foster G, KL Jahans, RJ Reid and HM Ross, 1996. Isolation of Brucella species from cetaceans, seals and an otter. Vet Rec, 138: 583-586. Foster JT, RT Okinaka, R Svensson, K Shaw, BK De, RA Robison, WS Probert, LJ Kenefic, WD Brown and P Keim, 2008. Real time PCR assays of single nucleotide poly morphisms defining the major Brucella clades. J Clin Microbiol, 46: 296-301. Franco MP, M Mulder, RH Gilman and HL Smits, 2007. Human brucellosis. The Lancet Infect Dis, 7: 775-786. Fretin D, AM Whatmore, S Al Dahouk, H Neubauer, B Garin-Bastuji, D Albert, M Van Hessche, M Ménart, J Godfroid, K Walravens and P Wattiau, 2008. Brucella suis identification and biovar typing by real-time PCR. Vet Microbiol, 131: 376-385. Garcia-Yoldi D, CM Marin, MJ de Miguel, PM Munoz, JL Vizmanos, I Lopez-Goni, L Ferrao-Beck, R Cardoso, PM Munoz, MJ de Miguel and D Albert, 2006. Multiplex PCR assay for the identification and differentiation of all Brucella species and the vaccine strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1. Clin Chem, 52: 779-781. Garin-Bastuji B, B Perrin, MF Thorel and JL Martel, 1990. Evaluation of γ-rays irradiation of cow colostrum for B. abortus, E. coli K99, Salmonella dublin and Mycobacterium paratuberculosis decontamination. Lett Appl Microbiol, 3: 163-166. Garrity GM, 2001. Bergey‘s Manual of Systematic Bacteriology, second ed. Springer, New York. 721 pp. Ghani M, M Siraj, A Zeb and M Naeem, 1995. Seroepidemiological study of brucellosis among goats and sheep at Peshawar district. Asian_Aust J Anim Sci, 8: 489. Glynn MK and TV Lynn, 2008. Brucellosis. J Am Vet Med Assoc, 233: 900-908. Godfroid J and A Kasbohrer, 2002. Brucellosis in the European Union and Norway at the turn of the twenty-first century. Vet Microbiol, 90: 135-145.

126

Godfroid J, B. Garin-Bastuji, C. Saegerman and JM Blasco, 2013a. Brucellosis in terrestrial wildlife. Rev sci tech Off int Epiz, 2013a, 32: 27-42. Godfroid J, C Saegerman, V Wellemans, K Walravens, J Letesson, A Tibor, A McMillan, S Spencer and M Sanna, 2002. How to substantiate eradication of bovine brucellosis when a specific serological reactions occur in the course of brucellosis testing. Vet Microbiol, 90: 461-477. Godfroid J, K Nielsen and C Saegerman, 2010. Diagnosis of brucellosis in livestock and wildlife. Croatian Med J, 51: 296-305. Godfroid J, S Al Dahouk, G Pappas, F Roth, G Matope, J Muma, T Marcotty, D Pfeiffer and E Skjerve, 2013b. A "One Health" surveillance and control of brucellosis in developing countries: moving away from improvisation. Comp Immunol Microbiol Infect Dis, 36: 241-8. González D, MJ Grilló, MJ De Miguel, T Ali, V Arce-Gorvel, RM Delrue, R Conde-Alvarez, P Muñoz, I López-Goñi, M Iriarte, CM Marín, A Weintraub, G Widmalm, M Zygmunt, JJ Letesson, JP Gorvel, JM Blasco and I Moriyón, 2008. Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O-polysaccharide synthesis and export. PLoS One, 3: 2760. González L, IA Patterson, RJ Reid, G Foster, M Barberán, JM Blasco, S Kennedy, FE Howie, J Godfroid, AP MacMillan, A Schock and D Buxton, 2002. Chronic meningoencephalitis associated with Brucella sp. infection in live stranded striped dolphins (Stenella coeruleoalba). J Comp Pathol, 126: 147-52. Gopaul KK, J Sells, BJ Bricker, OR Crasta and AM Whatmore, 2010. Rapid and reliable single nucleotide polymorphism-based differentiation of Brucella live vaccine strains from field strains. J Clin Microbiol. 48: 1461-1464. Gopaul KK, MS Koylass, CJ Smith and AM Whatmore, 2008. Rapid identification of Brucella isolates to the species level by real time PCR based single nucleotide polymorphism (SNP) analysis. BMC Microbiol, 8: 86-100. Gotuzzo E, C Carrillo, J Guerra and L Llosa, 1986. An evaluation of diagnostic methods for brucellosis-the value of bone marrow culture. J Infect Dis, 153: 122-125. Grilló MJ, CM Marin, M Barberan and JM Blasco, 1999. Experimental Brucella ovis infection in pregnant ewes. Vet Rec, 144: 555-558.

127

Grilló MJ, CM Marín, M Barberán, MJ de Miguel, K Laroucau, I Jacques and JM Blasco, 2009. Efficacy of bp26 and bp26/omp31 B. melitensis Rev.1 deletion mutants against Brucella ovis in rams. Vaccine, 27: 187-191. Grilló MJ, M Barberán and JM Blasco, 1997. Transmission of Brucella melitensis from sheep to lambs. Vet Rec, 140: 602-605. Gul ST and A Khan, 2007. Epidemiology and epizootology of brucellosis: A review. Pak Vet J, 27: 145-151. Gul ST, A Khan, F Rizvi and I Hussain, 2014. Sero-prevalence of brucellosis in food animals in the Punjab, Pakistan. Pak Vet J, 34: 454-458. Gul ST, A Khan, M Ahmad and I Hussain, 2013. Seroprevalence of brucellosis and associated hemato-biochemical changes in Pakistani horses. Pak J Agri Sci, 50: 745- 750. Gul ST, A Khan, M Ahmad, F Rizvi, A Shahzad and I Hussain, 2015. Epidemiology of brucellosis at different livestock farms in the Punjab, Pakistan. Pak Vet J, 35: 309- 314. Gupte S and T Kaur, 2015. Diagnosis of human brucellosis. J Trop Dis, 4: 185. Hadush A, M Pal, T Kassa and F Zeru, 2013. Seroepidemiology of camel brucellosis in the African region of northeast Ethiopia. J Vet Med Anim Health, 5: 269-275. Hall WH, 1989. History of Brucella as a human pathogen, in: Young EJ and MJ Corbel, (Eds.) Brucellosis clinical and laboratory aspects. CRC Press, Florida, USA, 1-10. Hall WT, CG Ludford and WH Ward, 1976. Infection and serological responses in cattle given 45/20 vaccine and later challenged with Brucella abortus. Aust Vet J, 52: 409- 413. Halling SM, BD Peterson-Burch, BJ Bricker, RL Zuerner, Z Qing, LL Li, V Kapur, DP Alt and SC Olsen, 2005. Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis. J Bacteriol, 187: 2715-2726. Halling SM, FM Tatum and BJ Bricker, 1993. Sequence and characterization of an insertion sequence, IS711, from Brucella ovis. Gene, 133: 123-127. Hamidullah M, R Khan and I Khan, 2009. Seroprevalence of brucellosis in animals in district kohat NWFP and comparison of two serological tests. Pak J Sci, 61: 242-243.

128

Hartigan P, 1997. Human brucellosis, epidemiology, and clinical manifestations. Ir Vet J, 50: 179-180. Hartigan P, 1997. Human brucellosis: epidemiology and clinical manifestations. Irish Vet J, 50: 179-80. Hassan AAM, 2005. Comparative study on conventional and polymerase chain reaction based diagnosis of bovine brucellosis. Department of Preventive Medicine and Public Health, Faculty of Veterinary Medicine, University of Khartoum. Hayat S, MA Hussain, H Hayat, T Khan, MS Sarwar, J Iqbal and MU Rehman, 2014. Seroprevalence of caprine brucellosis using PCR at district Tor Ghar, Khyber Pukhtunkhwa, Pakistan. Lasbela Uni J Sci Tech, 3: 21-25. He Y, 2012. Analyses of Brucella pathogenesis, host immunity, and vaccine targets using systems biology and bioinformatics. Front Cell Infect Microbiol, 2: 2-3. Heck FC, KH Nielsen, JD Williams, RP Crawford and LG Adams, 1984. Sensitivity of serological methods for detecting antibody in vaccinated and non-vaccinated Brucella infected cows. Aust Vet J, 61: 265-266. Hemade MV and RS Gandge, 2016. Molecular typing of Brucella species by PCR-RFLP and SSCP. Ind J Anim Sci, 86: 502-507. Hénault S, D Calvez, M Thiébaud, M Bouličre and B Garin-Bastuji, 2000. Validation of a nested-PCR based on the IS6501/711 sequence for the detection of Brucella in animal samples. Proceedings of the Brucellosis 200 International Research Conference 9I including the 53rd Brucelllosis Reserach Conference Nimes, France. Hendricks MK, EM Perez, PJ Burger and PA Mouton, 1995. Brucellosis in childhood in the Western Cape. S Afr Med J, 85: 176-178. Hendricks SL and ME Meyer, 1975. Brucellosis, in: Disease transmitted from animals to man. CC Thomas, Springfield, Illinois, USA, 10-32. Henning LN, KT Gillum, DA Fisher, RE Barnewall, RT Krile, MS Anderson, MJ Ryan and RL Warren, 2012. The Pathophysiology of inhalational brucellosis in Balb/c Mice. Sci Rep 2, Article number: 495. Herman L and H De Ridder, 1992. Identification of Brucella spp. by using the polymerase chain reaction. Appl Environ Microbiol, 58: 2099-2101.

129

Hernández-Mora G, JD Palacios-Alfaro and R González-Barrientos, 2013. Wildlife reservoirs of brucellosis: Brucella in aquatic environments. Rev sci tech Off int Epiz, 32: 89-103. Hinic V, I Brodard, A Thomann, Z Cvetnic, PV Makaya, J Frey and C Abril, 2008. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis and B. neotomae suitable for both conventional and real-time PCR systems. J Microbiol Methods, 75: 375-378. Hobbs IF, 1985. Comparison of the indirect enzyme-linked immunosorbent assay (ELISA) with the complement fixation test (CFT) for the serodiagnosis of bovine brucellosis. NZ Vet J, 33: 112-116. Hollett RB, 2006. Canine brucellosis: outbreaks and compliance. Theriogenology, 66: 575- 587. Hornitzky M and J Searson, 1986. The relationship between the isolation of Brucella abortus and serological status of infected, non-vaccinated cattle. Aust Vet J, 63: 172-174. Huddleson IF, 1943. Brucellosis in man and animals. Revised edition. The Common wealth Fund, New York, USA. Huddleson IF, RS Breed, WGD Murrary and NR Smith, 1957. Bergey‘s Manual of Determinative Bacteriology, 7th ed. The Williams & Wilkins Co, Baltimore, MD, USA. Hussain I, MI Arshad, MS Mahmood and M Akhtar, 2008. Seroprevalence of brucellosis in human, cattle, and buffalo populations in Pakistan. Turk J Vet Anim Sci, 32: 315-318. Imaoka K, M Kimura, M Suzuki, T Kamiyama and A Yamada, 2007. Simultaneous detection of the genus Brucella by combinatorial PCR. Jpn J Infect Dis, 60: 137-139. Iqbal Z, H Jamil, ZA Qureshi, M Saqib, LA Lodhi, MS Waqas and M Safdar, 2013. Seroprevalence of ovine brucellosis by modified Rose Bengal test and ELISA in Southern Punjab, Pakistan. Pak Vet J, 33: 455-457. Islam MA, MM Khatun, SR Werre, N Sriranganathan and SM Boyle, 2013. A review of Brucella seroprevalence among humans and animals in Bangladesh with special emphasis on epidemiology, risk factors and control opportunities. Vet Microbiol, 166: 317-26.

130

Ismaily SI, HA Harby and P Nicoletti, 1988. Prevalence of Brucella antibodies in four animal species in the Sultanate of Oman. Trop Anim Health Prod, 20: 269-270. Jacques I, JM Verger, K Laroucau, M Grayon, N Vizcaino, A Peix, F Cortade, F Carreras and LA Guilloteau, 2007. Immunological responses and protective efficacy against Brucella melitensis induced by bp26 and omp31 B. melitensis Rev.1 deletion mutants in sheep. Vaccine, 25: 794-805. Jarvis BW, TH Harris, N Qureshi and GA Splitter, 2002. Rough lipopolysaccharide from Brucella abortus and Escherichia coli differentially activates the same mitogen- activated protein kinase signaling pathways for tumor necrosis factor alpha in RAW 264.7 macrophage-like cells. Infect Immunol, 70: 7165-7168. Jensen AE, NF Cheville, DR Ewalt, JB Payeur and CO Thoen, 1995. Application of pulsed- field gel electrophoresis for differentiation of vaccine strain RB51 from field isolates of Brucella abortus from cattle, bison and elk. Am J Vet Res, 56: 308-312. Jiwa SFH, RR Kazwala, R Tungaraza, SI Kimera and WJ Kalaye, 1996. Bovine brucellosis serum agglutination test prevalence and breed disposition according to prevalent management systems in the Lake Victoria zone of Tanzania. Prev Vet Med, 26: 341- 346. Johnson DW, M Fassi-Fehri and A Taoudi, 1984. Brucellosis control in an infected herds by serological testing, removal of reactors, vaccination with reduced dose of strain 19 and improved hygiene, Dev Biol Stand, 56: 749. Jones LM, 1982. Review of current diagnostic techniques, in: 3rd International Conference for Goat Production and Diseases. Tucson, Arizona, USA, 431-432. Jones LM, V Montgomery and JB Wilson, 1965. Characteristics of carbon-dioxide- independent cultures of Brucella abortus isolated from cattle vaccinated with strain 19. J Infect Dis, 115: 312-320. Junaidu AU, SI Oboegbulem and MD Salihu, 2011. Serological survey of Brucella antibodies in breeding herds. J Microbiol Biotechnol Res, 1: 60-65. JY Ma, H Wang, XF Zhang, LQ Xu, GY Hu, H Jiang, F Zhao, HY Zhao, DR Piao, YM Qin, BY Cui and GH Lin, 2016. MLVA and MLST typing of Brucella from Qinghai, China. Infect Dis Poverty, 5: 26.

131

Kadohira M, JJ McDermott, MM Shoukri and MN Kyule, 1997. Variations in the prevalence of antibody to Brucella infection in cattle by farm, area and district in Kenya. Epidemiol Infect, 118: 35-41. Kattar MM, RF Jaafar, GF Araj, P Le Flèche, GM Matar, R Abi Rached, S Khalife and G Vergnaud, 2008. Evaluation of a multilocus variable-number tandem-repeat analysis scheme for typing human Brucella isolates in a region of brucellosis endemicity. J Clin Microbiol, 46: 3935-3940. Keid LB, RM Soares, SA Vasconcellos, DP Chiebao, VR Salgado and J Megid, 2007. A polymerase chain reaction for detection of Brucella canis in vaginal swabs of naturally infected bitches. Theriogenology, 68: 1260-1270. Kenar B, O Erganis, O Kaya and E Guller, 1990. Bacteriological and serological investigation on Brucella, Campylobacter, Salmonella and Chlamydia, as causes of abortions in sheep in Kenya region. Turk Vet J, 1: 17-20. Keppie J, AE Williams, K Witt and H Smith, 1965. The role of erythritol in the tissue localization of the Brucellae. Br J Exp Pathol, 46: 104. Khan A, M Rabbani, K Muhammad, A Maqbool and MZ Shabbir, 2009. Seroprevalence of brucellosis in buffalo and human in Swat valley, NWFP, Pakistan. Pak J Zool, 9: 111- 114. Koh SH and FH Morley, 1981. The effect of calfhood vaccination with strain 19 on the serological diagnosis and eradication of bovine brucellosis. Aust Vet J, 57: 551-3. Kubuafor DK, B Awumbila and BD Akanmori, 2000. Seroprevalence of brucellosis in cattle and humans in the Akwapim-South district of Ghana: public health implications. Acta Trop, 76: 45-48. Kudi AC, DJU Kalla, MC Kudi and GI Kapio, 1997. Brucellosis in camels. J Arid Environ, 37: 413-417. Kumar S, G Stecher and K Tamura, 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol, msw054. Kumar S, M Nei, J Dudley and K Tamura, 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief bioinform, 9: 299-306. Lambert G, BL Deyoe and GM Painter, 1964. Postvaccinal persistence of Brucella abortus strain 19 in two bulls. J Am Vet Med Assoc, 145: 909-911.

132

Le Flèche P, I Jacques, M Grayon, S Al Dahouk, P Bouchon, F Denoeud, K Nöckler, H Neubauer, LA Guilloteau and G Vergnaud, 2006. Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay. BMC Microbiol, 6: 9. Leal-Klevezas DS, IO Martínez-Vázquez, A López-Merino and JP Martínez-Soriano, 1995. Single-step PCR for detection of Brucella spp. from blood and milk of infected animals. J Clin Microbiol, 33: 3087-3090. Leong KN, TS Chow TS, PS Wong, SH Hamzah, N Ahmad and CC Chng, 2015. Outbreak of human brucellosis from consumption of raw goats milk in Penang, Malaysia. Am J Trop Med Hyg, 93: 539-41. Leslie C, A Balows and M Sussman, 1998. Microbiology and microbial infections. Syst Bacteriol, 2: 829-830. Letesson JJ, P Lestrate, RM Delrue, I Danese, F Bellefontaine, D Fretin, B Taminiau, A Tibor, A Dricot, C Deschamps, V Haine, S Leonard, T Laurent, P Mertens, J Vandenhaute and X De Bolle, 2002. Fun stories about Brucella: the ―furtive nasty bug‖. Vet Microbiol, 90: 317-328. Leyla G, G Kadri and O Umran, 2003. Comparison of polymerase chain reaction and bacteriological culture for the diagnosis of sheep brucellosis using aborted fetus samples. Vet Microbiol, 93: 53-61. Li XS, J Cui, SH Xinag, XJ Ning, SL Han, XF Liu and YX Liao, 1989. Studies on Yersinia enterocolitica. Chinese J Vet Med, 15: 2-5. Lista F, FAG Reubsaet, RD Santis, RR Parchen, AL de Jong, J Kieboom, AL Laaken, IAI Voskamp-Visser, S Fillo, H Jansen, JV Plas and A Paauw, 2011. Reliable identification at the species level of Brucella isolates with MALDI-TOF-MS. BMC Microbiol, 11: 267. Liu Q, L Cao and XQ Zhu, 2014. Major emerging and re-emerging zoonoses in China: a matter of global health and socioeconomic development for 1.3 billion. Int J Infect Dis, 25: 65-72. Lopes LB, R Nicolino and JPA Haddad, 2010. Brucellosis - Risk factors and prevalence: A review. Open Vet Sci J, 4: 72-84. López-Goni I, D García-Yoldi, CM Marín, MJ de Miguel, PM Muñoz, JM Blasco, I Jacques, M Grayon, A Cloeckaert, AC Ferreira, R Cardoso, MI Corrêa de Sá, K Walravens, D

133

Albert and B Garin-Bastuji, 2008. Evaluation of a multiplex PCR assay (Bruce- ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol, 46: 3484-3487. Lucero NE, R Corazza, MN Almuzara, E Reynes, GI Escobar, E Boeri and SM Ayala, 2010. Human Brucella canis outbreak linked to infection in dogs. Epidemiol Infect, 138: 280-285. Luchsinger DW, RD Angus, CS Gue and R Anderson, 1973. The utilization of Brucella abortus culturing and biotyping results in the epizootiologic investigation of bovine brucellosis, in: 77th Annual Meeting of The United States of America, Animal Health Association, Virginia. 86. Maadi H, M Moharamnejad and M Haghi, 2011. Prevalence of brucellosis in cattle in Urmia, Iran. Pak Vet J, 31: 81-82. MacMillan A, 1990. Conventional serological tests, in: Nielsen K and JR Duncan, (Eds.), Animal brucellosis. CRC Press, Florida, USA, 153-197. Mahajan NK and RC Kulshreshtha, 1986. Counter immunoelec-trophoresis for the detection of Brucella antigens in fetal stomach contents of aborted sheep. Vet Rec, 119: 455- 456. Mahmood R, T Ali, U Waheed, M Asif, QM Khan, 2016b. Application of serum based PCR and fluorescence polarization assay for diagnosis of brucellosis among people occupationally at risk to disease. Int J Agric Biol, 18: 377-384. Mahmood R, U Waheed, T Ali, KK Gopaul, AC Dainty, JK Muchowski, MS Koylass, SD Brew, LL Perrett, AM Whatmore and QM Khan, 2016a. Serological and nucleic acid based detection of brucellosis in livestock species and molecular characterization of Brucella melitensis strains isolated from Pakistan. Int J Agri Biol, 18: 311-318. Mainar-jaime RC, CM Marín, MJ De Miguel, PM Muñoz and JM Blasco, 2008. Experiences on the use of RB51 vaccine in Spain, in: Brucellosis. International Conference, Royal Holloway College, University of London, UK, 10-13 September, 40. Mair TS and TJ Divers, 2013. Brucellosis in the horse. In: infectious diseases of the horse: diagnosis, pathology, management, and public health. By van der Kolk JH and Veldhuis Kroeze EJB, CRC Press, pp: 275-280. Mantur BG and SK Amarnath, 2008. Brucellosis in India-a review. J Biosci, 35: 539-547.

134

Manzoor S, A Nadeem, M Javed and ME Babar, 2013. Disease susceptibility of buffalo in Pakistan. Buffalo Bull, 32: 1110-1113. Marianelli C, A Petrucca, P Pasquali, F Ciuchini, S Papadopoulou and P Cipriani, 2008. Use of MLVA-16 typing to trace the source of a laboratory-acquired Brucella infection. J Hosp Infect, 68: 274-6. Marín CM, E Moreno, I Moriyón, R Díaz and JM Blasco, 1999. Performance of competitive and indirect enzyme-linked immunosorbent assays, gel immunoprecipitation with native hapten polysaccharide, and standard serological tests in diagnosis of sheep brucellosis. Clin Diagn Lab Immunol, 6: 269-272. Masoumi JP, MA Sheikh, R Ahmad, M Naeem, M Ahmad and I Hussain, 1992. Seroprevalence of brucellosis in sheep, goats and man in Lahore area. Ind J Dairy Sci, 45: 298-299. Matar GM, IA Khneisser and AM Abdelnoor, 1996. Rapid laboratory confirmation of human brucellosis by PCR analysis of a target sequence on the 31-kilodalton Brucella antigen DNA. J Clin Microbiol, 34: 477-478. Matope G, E Bhebhe, JB Muma, A Lund and E Skjerve, 2011. Risk factors for Brucella spp. infection in small holder household herds. Epidemiol Infec, 139: 157-164. Maudlin I and S Weber, 2006. The control of neglected zoonotic diseases: a route to poverty alleviation. Report of a Joint WHO/DFID-AHP meeting with the participation of FAO and OIE. WHO, Geneva (Switzerland). 54. Mayer-Scholl A, A Draeger, C Göllner, HC Scholz and K Nöckler, 2010. Advancement of a multiplex PCR for the differentiation of all currently described Brucella species. J Microbiol Methods, 80: 112-114. Mayfield JE, JA Bantle, DR Ewalt, VP Meador, Tabatabai, 1990. Detection of Brucella cells and cell components, in: Nielson K and JR Duncan (Eds.), Animal brucellosis. CRC Press, Florida, USA. 97-120. McDermott JJ and SM Arimi, 2002. Brucellosis in sub-Saharan Africa: epidemiology, control and impact. Vet Microbiol, 90: 111-134. McDonald WL, R Jamaludin, G Mackereth, M Hansen, S Humphrey, P Short, T Taylor, J Swingler, CE Dawson, AM Whatmore, E Stubberfield, LL Perrett and G Simmons, 2006. Characterization of a Brucella sp. strain as a marine-mammal type despite

135

isolation from a patient with spinal osteomyelitis. NZ J Clin Microbiol, 44: 4363- 4370. Meador VP, BL Deyoe and NF Cheville, 1989. Pathogenesis of Brucella abortus infection of the mammary gland and supramammary lymph node of the goats. Vet Pathol, 26: 357-368. Meagher M and ME Meyer, 1994. On the origin of brucellosis in bison of Yellowstone National Park- A review. Conservation Biol, 8: 645-653. Megersa B, B Molla and L Yigezu, 2005. Seroprevalence of brucellosis in camels (Camelus dromedaries) in Borena lowland, Southern Ethiopia. Bull Anim Health Prod Afr, 53: 252-257. Megersa B, D Biffa, F Niguse, T Rufael, K Asmare and E Skjerve, 2011. Cattle brucellosis in traditional livestock husbandry practice in Southern and Eastern Ethiopia, and its zoonotic implication. Acta Vet Scand, 53: 24. Megid J, LA Mathias and CA Robles, 2010. Clinical manifestations of brucellosis in domestic animals and humans. Open Vet Sci J, 4: 119-126. Mekonnen H, S Kalayou and M Kyule, 2010. Serological survey of bovine brucellosis in barka and arado breeds (Bos indicus) of Western Tigray, Ethiopia. Prev Vet Med, 94: 28-35. Meltzer E, Y Sidi, G Smolen, M Banai, S Bardenstein and E Schwartz, 2010. Sexually transmitted brucellosis in humans. Clin Infec Dis, 51: 12-15. Memish ZA and HH Balkhy, 2004. Brucellosis and international travel. J Travel Med, 11: 49-55. Mense MG, H Richard, CL Wilhelmsen, ML Pitt, DL Hoover, 2004. Pathologic changes associated with brucellosis experimentally induced by aerosol exposure in rhesus macaques (Macaca mulatta). Am J Vet Res, 65: 644-652. Mercier E, E Jumas-Bilak, A Allardet-Servent, D O'Callaghan and M Ramuz, 1996. Poly- morphism in Brucella strains detected by studying distribution of two short repetitive DNA elements. J Clin Microbiol, 34: 1299-1302. Metcalf HE, DW Luchsinger and WC Ray, 1994. Brucellosis. In: Handbook of Zoonoses, Second Edition, Section A: Bacterial, Rickettsial, Chlamydial, and Mycotic Zoonoses. CRC Press, London, Uk, 9-39.

136

Mittal KR and IR Tizard, 1980. Studies on the relationship between Yersinia enterocolitica IX and Brucella abortus in naturally infected animals. Res Vet Sci, 28: 311. Mittal, KR and IR Tizard, 1979. A simple technique to differentiate between animals infected with Yersinia enterocolitica IX and those infected with Brucella abortus. Res Vet Sci, 26: 248-250. Mohammed FU, S Ibrahim, I Ajogi and BJ Olaniyi, 2011. Prevalence of bovine brucellosis and risk factors assessment in cattle herds in Jigawa State. ISRN Vet Sci, doi: 10.5402/2011/ 132897. Mollelo JA, R Jensen, JR Collier and JC Flint, 1963. Placental pathology III. Placental lesions of sheep experimentally infected with Brucella abortus. Am J Vet Res, 24: 915-921. Moore JA and TJ Kakuk, 1969. Male dogs naturally infected with Brucella canis. J Am Vet Med Assoc, 155: 1352-1358. Moreno E and I Moriyon, 2002. Brucella melitensis: a nasty bug with hidden credentials for virulence. Proc Natl Acad Sci USA, 99: 1-3. Moriyón, I, MJ Grilló, D Monreal, D González, C Marín, I López-Goñi, RC Mainar-Jaime, E Moreno and JM Blasco, 2004. Rough vaccines in animal brucellosis: structural and genetic basis and present status. Vet Res, 35: 1-38. Mugizi DR, S Muradrasoli, S Boqvist, J Erume, GW Nasinyama, C Waiswa, G Mboowa, M Klint and U Magnusson, 2015. Isolation and molecular characterization of Brucella isolates in cattle milk in Uganda. Bio Med Res Int, Article ID 720413, http://dx. doi.org/10.1155/2015/720413. Mukherjee F, J Jain, V Patel and M Nair, 2007. Multiple genus-specific markers in PCR assays improve the specificity and sensitivity of diagnosis of brucellosis in field animals. J Med Microbiol, 56: 1309-1316. Muma JB, KL Samui, J Oloya, M Munyeme and E Skjerve, 2007. Risk factors for brucellosis in indigenous cattle reared in livestock-wildlife interface areas of Zambia. Prev Vet Med, 80: 306-317. Muma JB, KL Samui, VM Siamudaala, J Oloya, G Matop, MK Omer, M Munyeme, C Mubita and E Skjerve, 2006. Prevalence of antibodies to Brucella spp. and individual

137

risk factors of infection in traditional cattle, goats and sheep reared in livestock- wildlife interface areas of Zambia. Trop Anim Health Prod, 38: 195-206. Munir R, U Farooq, Z Fatima, M Afzal, Z Anwar and M Jahangir, 2011. Sero-prevalence of brucellosis in bovines at farms under different management conditions. Br J Dairy Sci, 2: 35-39. Muñoz PM, CM Marín, D Monreal, D González, B Garin-Bastuji, R Díaz, RC Mainar-Jaime, I Moriyón and JM Blasco, 2005. Efficacy of several serological tests and antigens for diagnosis of bovine brucellosis in the presence of false-positive serological results due to Yersinia enterocolitica O:9. Clin Diagn Lab Immunol, 12: 141-151. Musa MT and TA Shigidi, 2001. Brucellosis in camels in intensive animal breeding areas of Sudan. Implications in abortion and early-life infections. Revue d Elev Med Vet pays Trop, 54: 11-15. Mylrea PJ, 1972. The diagnosis of brucellosis in dairy herds. Aust Vet J, 48: 369-375. Nasir AA, Z Parveen, MA Shah and M Rashid, 2004. Seroprevalence of brucellosis in animals at government and private livestock farms in Punjab. Pak Vet J, 24: 144. Nasir AA, Z Perveen and M Ikram-ul-Haq, 2005. Comparative study of standard and modified serum agglutination tests for the diagnosis of brucellosis in animals. Pak Vet J, 25: 33-34. Nasrin M, H Afzal and M Siddique, 1998. Sero-prevalence of Brucella abortus and Brucella melitensis in camels. J Anim Plant Sci, 8: 61-62. Nasruddin NS, M Mazlan, MZ Saad, H Hamzah and J Sabri, 2014. Histopathology and immunohistochemistry assessments of acute experimental infection by Brucella melitensis in Bucks. Open J Pathol, 4: 54-63. Nelson C, 1977. Immunity to Brucella abortus. In: Bovine brucellosis. An international symposium. Edited by Crawford RP and RJ Hidalgo. Texas A & M University Press, 177-188. Nemoy LL, M Kotetishvili, J Tigno, A Keefer-Norris, AD Harris, EN Perencevich, JA Johnson, D Torpey, A Sulakvelidze, JG Morris Jr and OC Stine, 2005. Multilocus sequence typing versus pulsed-field gel electrophoresis for characterization of extended-spectrum beta-lactamase-producing Escherichia coli isolates. J Clin Microbiol, 43: 1776-81.

138

Neta AVC, JPS Mol, MN Xavier, TA Paixão, AP Lagea and RL Santos, 2010. Pathogenesis of bovine brucellosis. Vet J, 184: 146-155. Nicoletti P and AJ Winter, 1990b. The immune response to B. abortus: The cell-mediated response to infections, in: Nielson K, JR Duncan, (Ed.), Animal brucellosis. CRC Press, Florida, USA, 83-95. Nicoletti P and V Tanya, 1993. Comparison of enzyme-labeled immunosorbent assay and particle concentration fluorescence immunoassay with standard serologic methods and bacteriologic culture for detection of Brucella sp-infected cows in herds with brucellosis. J Am Vet Med Assoc, 202: 1975-1977. Nicoletti P, 1969. Further evaluation of serologic test procedures used to diagnose brucellosis. Am J Vet Res, 30, 1811-1816. Nicoletti P, 1976. A preliminary report on the efficacy of adult cattle vaccination using strain 19 in selected dairy herds in Florida, in Proceedings of the US Animal Health Association 80: 91-106. Cited by Crichton R and NE Medveczky, 1987. The identity, distribution and epizootiological significance of Brucella isolates in Australia. Aust Vet J, 64: 48-52. Nicoletti P, 1977. Use of 45/20 bacterin to detect latent infection in brucellosis, in: Crawford RP, RJ Hidalgo, (Eds.), Bovine Brucellosis - An International Symposium. Texas A & M University Press, USA. 72-78. Nicoletti P, 1986. Report on the review and evaluation of the brucellosis project survey in Oman. Mission Report. Ministry of Agriculture and Fisheries, Sultanate of Oman. Nicoletti P, 1989. Relationships between animal and human disease. In: Brucellosis: Clinical and laboratory aspects. Edited by Young EJ and MJ Corbel. CRC Press, Florida, 41- 51. Nicoletti P, 1990. Vaccination, in: Crawford RP and RJ Hidalgo, (Eds.), Bovine brucellosis - An International Symposium. Texas A & M University Press, USA, 283-299. Nicoletti P, FW Milward, E Hoffmann, and L Altvater, 1985. Efficacy of long-acting oxytetracycline alone or combined with streptomycin in the treatment of bovine brucellosis. J Am Vet Med Assoc, 187: 493-495.

139

Nicoletti P, LM Jones and DT Berman, 1978a. Comparison of the subcutaneous and conjunctival route of vaccination with Brucella abortus strain 19 vaccine in adult cattle. J Am Vet Med Assoc, 173: 1450-1456. Nicoletti P, RMJ Mason and J Tehrani, 1987. Antibodies in calves on feed supplemented with chlortetracycline after vaccination with Brucella abortus strain 19. J Am Vet Med Assoc, 190: 1002-1003. Nicoletti PL, JJ Mahler and WK Scarratt, 1982. Study of agglutinins to B. abortus, B. Canis and Actinobacillus equuli in horses. Eq Vet J, 14: 302-304. Nielsen K, 2002. Diagnosis of brucellosis by serology. Vet Microbiol, 90: 447-459. Nielsen K, BS Samagh and B Stemsborn, 1980. Agglutination of Brucella abortus cells by sera from cattle experimentally infected with Escherichia coli. Vet Microbiol, 5: 123. Nielsen K, D Gall, M Jolley, G Leishman, S Balsevicius, P Smith, P Nicoletti and F Thomas, 1996. A homogeneous fluorescence polarization assay for detection of antibody to Brucella abortus. J Immunol Methods, 195: 161-168. Nielsen K, JW Cherwonogrodzky, JR Duncan and DR Bundle, 1989. Enzyme-linked immunosorbent assay for differentiation of the antibody response of cattle naturally infected with Brucella abortus or vaccinated with strain 19. Am J Vet Res, 50: 5-9. Nielsen KH, L Kelly, D Gall, P Nicoletti and W Kelly, 1995. Improved competitive enzyme immunoassay for the diagnosis of bovine brucellosis. Vet Immunol Immunopathol, 46: 285-91. Nöckler K, R Maves, D Cepeda, A Draeger, A Mayer-Scholl, J Chacaltana, M Castañeda, B Espinosa, R Castillo, E Hall, S Al Dahouk, RH Gilman, F Cabeza and HL Smits, 2009. Molecular epidemiology of Brucella genotypes in patients at a major hospital in central Peru. J Clin Microbiol, 47: 3147-3155. Ogutman R, 1972. Brucellosis in eastern Turkey. J Clin Pathol, 25: 552. OIE, Office International des Epizooties, 2015. World Animal Health Information System (WAHID) Version 1. Available online at http://www.oie.int/wahis. OIE, Office International des Epizooties, 2016. Manual of diagnostic tests and vaccines for terrestrial animals. Available online at http://www.oie.int/international-standard- setting/ terrestrial-manual/access-online/

140

Omer MK, E Skjerve, G Holstad, Z Woldehiwet and AP MacMillan, 2000. Prevalence of antibodies to Brucella spp. in cattle, sheep, goats, horses and camels in the state of Eritrea; influence of husbandry systems. Epidemiol Infec, 125: 447-453. Omer MM, MT Mussa, MR Bakhiet and L Perrett, 2010. Brucellosis in camels, cattle and humans: associations and evaluation of serological tests used for diagnosis of the disease in certain nomadic localities in Sudan. Revue Scientifique et Technique, 29: 663-669. Öngör H, B Çetinkaya, M Karahan and H Bulut, 2006. Foodborne pathogens and disease. 3: 245-250. Osman AY, FF Jesse, A Abdul-Kadir and AA Saharee, 2016. The epidemiology and immunopathophysiology of brucellosis in small ruminant. Pertanika J Sch Res Rev, 2: 11-21. Osoro EM, P Munyua, S Omulo, E Ogola, F Ade, P Mbatha, M Mbabu, Z Ng'ang'a, S Kairu, M Maritim, SM Thumbi, A Bitek, S Gaichugi, C Rubin, K Njenga and M Guerra, 2015. Strong association between human and animal Brucella seropositivity in a linked study in Kenya, 2012–2013. Am J Trop Med Hyg, 93: 224-231. Osterman B and I Moriyo´n, 2006. International committee on systematics of prokaryotes; subcommittee on the taxonomy of Brucella. Minutes of the meeting, 17 September 2003, Pamplona, Spain. Int J Syst Evol Microbiol, 56: 1173-1175. Ouahrani-Bettache S, S Michaux, J Sri Widada, G Bourg, R Tournebize, M Ramuz and JP Liautard, 1993. Identification and sequence analysis of IS6501, an insertion sequence in Brucella spp. relationship between genomic structure and the number of IS6501 copies. J Gen Microbiol, 139: 3265-3273. Palmer MV, NF Cheville and AE Jensen, 1996a. Experimental infection of pregnant cattle with the vaccine candidate Brucella abortus strain RB51: pathologic, bacteriologic, and serologic findings. Vet Pathol, 33: 682-691. Palmer MV, SC Olsen, MJ Gilsdorf, LM Philo, PR Clarke and NF Cheville, 1996b. Abortion and placentitis in pregnant bison (Bison bison) induced by the vaccine candidate, Brucella abortus strain RB51. Am J Vet Res, 57: 1604-1607.

141

Pandeya YR, DD Joshi, S Dhakal, L Ghimire, BR Mahato, S Chaulagain, RC Satyal and SK Sah, 2013. Seroprevalence of brucellosis in different animal species of Kailali district, Nepal. Int J Infect Microbiol, 2: 22-25. Pappas G, N Akritidis, M Bosilkovski and E Tsianos, 2005. Brucellosis. N Engl J Med, 352: 2325-36. Pappas G, P Papadimitriou, N Akritidis, L Christou and EVT Sianos, 2006. The new global map of human brucellosis. Lancet Infect Dis, 6: 91-99. Paulsen IT, R Seshadri, KE Nelson, JA Eisen, JF Heidelberg, TD Read, RJ Dodson, L, Umayam, LM Brinkac, MJ Beanan, SC Daugherty, RT Deboy, AS Durkin, JF Kolonay, R Madupu, WC Nelson, B Ayodeji, M Kraul, J Shetty, J Malek, SE Van Aken, S Riedmuller, H Tettelin, SR Gill, O White, SL Salzberg, DL Hoover, LE Lindler, SM Halling, SM Boyle and CM Fraser, 2002. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc Natl Acad Sci USA, 99: 13148-13153. Payne JM, 1959. The pathogenesis of experimental brucellosis in the pregnant cow. J Pathol Bacteriol, 78: 447. Philippon A, G Renoux and M Plommet, 1971. Brucellose bovine expérimentale, V - Excrétion de Brucella abortus par le colostrum et le lait. Ann Rech Vet, 2: 59-67. Pishva E and M Salehi, 2008. First report of isolation of Brucella melitensis, Vaccine strain Rev.1 as a source of cattle infection in Iran. J Sci, 19: 19-23. Plant JW, PD Claxton, D Jakovljevic and W de Saram, 1976. Brucella abortus infection in the bull. Aust Vet J, 52: 17-20. Poester FP, LE Samartino and RL Santos, 2013. Pathogenesis and pathobiology of brucellosis in livestock. Rev sci tech Off int Epiz, 32: 105-115. Poester FP, VCF Figueiredo and JR Lôbo, 2009. Prevalence studies on bovine brucelosis according to Brazilian national program for the control and eradication of bovine brucellosis and tuberculosis: Introduction. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, 61: 1-5. Poester, FP, K Nielsen and LE Samarino, 2010. Diagnosis of brucellosis. Open Vet Sci J, 4: 46-60.

142

Preman P, S Sanyal and S Das, 2013. Histological changes In mammalian uterus in brucellosis. Asian J Biomed Pharm Sci, 3: 58-61. Radostits OM, CC Gay, DC Blood and KW Hinchcliff, 2000. Veterinary Medicine, 9th ed. ELBS Bailliere Tindall, London, Philadelphia. pp: 870-871. Radwan AI, SI Bekairi, AA Mukayel, AM Albokmy, PVS Prasad, FN Azar and ER Coloyan, 1995. Control of Brucella melitensis infection in a large camel herd in Saudi Arabia using antibiotherapy and vaccination with Rev 1 vaccine. Bull Off int Epiz, 14: 719- 732. Radwan AI, SI Bekairi and AA Mukayel, 1992a. Treatment of Brucella melitensis infection in sheep and goats with oxytetracycline combined with streptomycin. Rev Sci Tech, 11: 845-57. Radwan AI, SJ Bekairi and PVS Prasad, 1992b. Serological and bacteriological study of brucellosis in camels in central Saudi Arabia. Revue Scientiﬁque et Technique de l Ofﬁce International des Epizooties 11: 837-844. Rahman MS, MO Faruk, M Her, JY Kim, SI Kang and SC Jung, 2011. Prevalence of brucellosis in ruminants in Bangladesh. Veterinarni Medicina, 56: 379-385. Ray WC and JH Steele, 1979. Brucellosis (due to Brucella abortus and B. suis), in: Handbook Series in Zoonoses. Section A, Bacterial, Richettsial, and Mycotic Diseases. Volume 1. CRC Press, Boca Raton, Florida, USA, 99-183. Refai M, 2000. Control of brucellosis in animals in Egypt. In: Proc. 2nd Int Symp cum Workshop of the Germany–Egypt-Region Inter-Alumni-Net (GEAR), St. Catherine, Germany. Refai M, 2003. Application of biotechnology in the diagnosis and control of brucellosis in the Near East region. World J Microbiol Biotechnol, 19: 443-449. Rijpens NP, G Jannes, M Van Asbroeck, R Rossau and LM Herman, 1996. Direct detection of Brucella spp. in raw milk by PCR and reverse hybridization with 16S-23S rRNA spacer probes. Appl Environ Microbiol, 62: 1683-1688. Robson JM, MW Harrison, RN Wood, MH Tilse, AB McKay and TR Brodribb, 1993. Brucellosis-reemergence and changing epidemiology in Queensland. Med J Aust, 159: 153-158.

143

Romero C, C Gamazo, M Pardo and I Lopez-Goni, 1995. Specific detection of Brucella DNA by PCR. J Clin Microbiol, 33: 615-7. Roy A, A Kucukural and Y Zhang, 2010. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc, 5: 725-738. Ruben B, JD Band, P Wong and J Colville, 1991. Person-to-person transmission of Brucella melitensis. Lancet, 337: 14-15. Ruiz-Castaneda M, 1986. Brucellosis, 3rd Ed. México: Copilco-Universidad, Ediciones Científicas, Prensa Médica Mexicana. Runells RA and IF Huddleson, 1925. The nature of Bacterium abortus infection in the udder of the bovine. Cornell Veterinarian, 15: 376. Saitou N and M Nei, 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol, 4: 406-425. Sangari FJ, J Agüero and JM García-Lobo, 1996. Improvement of the Brucella abortus B19 vaccine by its preparation in a glycerol based medium. Vaccine, 14: 274-276. Santos RL, TM Martins, ÁM Borges and TA Paixão, 2013. Economic losses due to bovine brucellosis in Brazil. Pesq Vet Bras, 33: Saunders GC and EH Clinard, 1976. Rapid micromethod of screening for antibodies to disease agents using the indirect enzyme-labeled antibody test. J Clin Microbiol, 3: 604-608. Schelling E, C Diguimbaye, S Daoud, J Nicolet, P Boerlin, M Tanner and J Zinsstag, 2003. Brucellosis and Q-fever seroprevalences of nomadic pastoralists and their livestock in Chad. Prev Vet Med, 61: 279-293. Schlabritz-Loutsevitch NE, AM Whatmore, CR Quance, MS Koylass, LB Cummins, EJ Dick, CL Snider, D Cappelli, JL Ebersole, PW Nathanielsz and GB Hubbard, 2009. A novel Brucella isolate in association with two cases of stillbirth in non-human primates - first report. J Med Primatol, 38: 70-3. Scholz HC, K Nockler, C Gollner, P Bahn, G Vergnaud, H Tomaso, S Al-Dahouk, P Ka¨mpfer, A Cloeckaert, M Maquart, MS Zygmunt, AM Whatmore, M Pfeffer, B Huber, HJ Busse and BK De, 2010. Brucella inopinata sp nov., isolated from a breast implant infection. Int J Syst Evol Microbiol, 60: 801-808.

144

Scholz HC, S Al Dahouk, H Tomaso,H Neubauer, A Witte, M Schloter, P Kämpfer, E Falsen, M Pfeffer and M Engel, 2008b. Genetic diversity and phylogenetic relationships of bacteria belonging to the Ochrobactrum-Brucella group by recA and 16S rRNA gene-based comparative sequence analysis. Syst Appl Microbiol, 31: 1-16. Scholz HC, Z Hubalek, I Sedlácek, G Vergnaud, H Tomaso, S Al Dahouk, F Melzer, P Kämpfer, H Neubauer, A Cloeckaert, M Maquart, MS Zygmunt, AM Whatmore, E Falsen, P Bahn, C Göllner, M Pfeffer, B Huber, HJ Busse and K Nöckler, 2008a. Brucella microti sp. nov., isolated from the common vole Microtus arvalis. Int J Syst Evol Microbiol, 58: 375-382. Schwartz DC and CR Cantor, 1984. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell, 37: 67-75. Seleem MN, SM Boyle and N Sriranganathan, 2010. Brucellosis: A re-emerging zoonosis. Vet Microbiol, 140: 392-398. Shafee M, M Rabbani, AA Sheikh, MD Ahmad and A Razzaq, 2011. Prevalence of bovine brucellosis in organized dairy farms, using milk ELISA, in Quetta city, Balochistan, Pakistan. Vet Med Int, doi: 10.4061/2011/358950. Shahid M, A Basit and MA Khan, . Prevalence of brucellosis among the hospital patients of Peshawar, Khyber Pakhtunkhwa. J Infec Mol Biol, 2: 19-21. Sharma VD, MS Sethi, MP Yadav and DC Dube, 1979. Sero-epidemiologic investigations on brucellosis in the states of Uttar Pradesh (UP) and Delhi (India). Int J Zoonoses, 6: 75-81. Shaw WB, 1976. Brucella abortus infection in sheep. Field case. Br Vet J, 132: 18-20. Sikder S, A Rahman, MR Faruque, MA Alim, S Das, AD Gupta, BC Das, MI Uddin and MAM Prodhan, 2012. Bovine brucellosis: an epidemiological study at Chittagong, Bangladesh. Pak Vet J, 32: 499-502. Singh BB, NK Dhand and JPS Gill, 2015. Economic losses occurring due to brucellosis in Indian livestock populations. Prev Vet Med, 119: 211-215. Solera J, A Espinosa, E Martinezalfaro, E Navarro, P Geijo and L Sanches, 1997a. Failure of short antimicrobial treatments for human brucellosis. Antimic. Agents. Chemoth, 41: 1621-1622.

145

Solera, J, E Martinezalfaro and A Espinosa, 1997b. Recognition and optimum treatment of brucellosis. Drugs. 53: 245-256. Spickler AR, 2010. Emerging and Exotic Diseases of Animals. 4th ed, Centre f Food Security and Public Health, Iowa State University. Spink WW, 1956. The nature of brucellosis. University of Minnesota Press, Minneapolis. Staszkiewicz J, CM Lewis, J Colville, M Zervos and J Band, 1991. Outbreak of Brucella melitensis among microbiology laboratory workers in a community hospital. J clin microbial, 29: 287-290. Stevenson WJ and KL Hughes, 1988. Brucellosis, in: Synopsis of Zoonoses in Australia. Commonwealth Department of Community Services and Health. Australian Government Publishing Service, Canberra. 15-22. Sutherland SS and J Searson, 1990. The immune response to B. abortus: the humoral immune response, in: Nielson K and JR Duncan, (Eds.), Animal Brucellosis. CRC Press, Florida, USA, pp. 65-81. Sutherland SS, 1980. Immunology of bovine brucellosis. Vet Bull, 50: 359-368. Sutherland SS, RJ Evans and J Bathgate, 1986. Application of an enzyme-linked immunosorbent assay in the final stages of a bovine brucellosis eradication program. Aust Vet J, 63: 412-415. Taleski V, L Zerva and T Kantradjiev, 2002. An overview of the epidemiology and epizootology of brucellosis in selected countries of Central and Southeast Europe. Vet Microbiol, 90: 147-155. Tamura K, 1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+ C-content biases. Mol Biol Evol, 9: 678-687. Tamura K, D Nicholas, P Glen, S Masatoshi, N and K Sudhir, 2011. MEGA5: molecular evolutionary genetics analysis using likelihood, distance, and parsimony methods. Mol Biol Evol, 28: 2731-2739. Tcherneva E, N Rijpens, C Naydensky, L Herman, 1996. Repetitive element sequence based polymerase chain reaction for typing of Brucella strains. Vet Microbiol, 51: 169-178. Thakur SD, R Kumar and DC Thapliyal, 2002. Human brucellosis: a review of an under- diagnosed animal transmitted disease. J Commun Dis, 34: 287-301.

146

Theegarten D, S Albrecht, M Tötsch, H Teschler, H Neubauer and S Al Dahouk, 2008. Brucellosis of the lung: case report and review of the literature. Virchows Archive, 452: 97-101. Thoen CO, CA Haas, RD Angus and AS Townsend, 1995. Evaluation of a potassium chloride extract of Brucella abortus in an ELISA for detecting Brucella antibodies in bulk tank milk samples from cows. Vet Microbiol, 45: 185-189. Thoen CO, FM Enright and FN Cheville, 1993. Brucella. In Pathogenesis of bacterial infections in animals. In: CL Gyles and CO Thoen, eds. Iowa State University Press, Iowa, 236-247. Thorpe BD, RW Sidwell, JB Bushman, KL Smart and R Moyes, 1965. Brucellosis in Wildlife and Livestock of West Central Utah. J Am Vet Med Assoc, 146: 225-232. Tiller RV, JE Gee, MA Frace, TK Taylor, JC Setubal, AR Hoffmaster and BK De, 2010. Characterization of novel Brucella strains originating from wild native rodent species in North Queensland, Australia. Appl Environ Microbiol, 76: 5837-5845. Tolosa T, F Regassa and K Belihu, 2008. Seroprevalence study of bovine brucellosis in extensive management system in selected sites of Jimma zone, western Ethiopia. Bull anim Health Prod Afr, 56: 25-37. Tounkara K, S Maiga, A Traore, BM Seck and AJ Akakpo, 1994. Epidemiology of bovine brucellosis in Mali - Serological survey and initial isolation of Brucella abortus strains. Bull de Off Int des Epi, 13: 777-786. Tuba D, MK Celen, C Ayaz, MS Dal, S Kalkanli, D Mert, N Yildirim, Erayaktas and Nevalarserim, 2013. Brucellosis is a major problem: a five years experience. Acta Medica Mediterranea, 29: 665. Tumwine G, E Matovu, JD Kabasa, DO Owiny and S Majalija, 2015. Human brucellosis: sero-prevalence and associated risk factors in agro-pastoral communities of Kiboga District, Central Uganda. BMC Public Health, 15:900. Turgut M, AT Turgut and U Koşar, 2006. Spinal brucellosis: Turkish experience based on 452 cases published during the last century. Acta Neurochir, 148: 1033-44. Uzal FA, AE Carrasco, K Nielson, S Echaide and RF Cabrera, 1996. An indirect ELISA using a monoclonal anti IgG1 enzyme conjugate for the diagnosis of bovine brucellosis. Vet Microbiol, 52: 175-180.

147

Valdezate S, A Navarro, P Villalon, G Carrasco and JA Saez-Nieto, 2010. Epidemiological and phylogenetic analysis of Spanish human Brucella melitensis strains by multiple- locus variable-number tandem-repeat typing, hyper variable octameric oligonucleotide fingerprinting and rpoB typing. J Clin Microbiol, 48: 2734-2740. Van Campen H and J Rhyan, 2010. The role of wildlife in diseases of cattle. Vet Clin North Am Food Anim Pract, 26: 147-161. Van der Schaaf A and M Roza, 1940. Brucellosis and onchocerciasis in connection with chronic joint infection in cattle. Overgedrukt uit Ned-Indische Bl voor Diergeneeskd, 52: 1. Velasco J, C Romero, I López-Goñi, J Leiva, R Díaz and I Moriyón, 1998. Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium spp. nov., a new species with a closer relationship to Brucella spp. Int J Syst Bacteriol, 3: 759-768. Verger JM, F Grimont, PAD Grimont and M Grayon, 1985. Brucella, a monospecific genus as shown by deoxyribonucleic acid hybridization. Int J Syst Bacteriol, 35: 292-295. Verger JM, F Grimont, PAD Grimont and M Grayon, 1987. Taxonomy of the genus Brucella. Ann Inst Pasteur Microbiol, 138: 235-238. Villarroel M, M Grell and R Saenz, 2000. Isolation and identification of Brucella abortus RB51 in human: first report in Chile. Arch Med Vet, 32: 89-91. Vizcaino N, P Caro-Hernandez, A Cloeckaert and L Fernandez-Lago, 2004. DNA polymorphism in the omp25/omp31 family of Brucella spp. identification of a 1.7-kb inversion in Brucella cetaceae and of a 15.1-kb genomic island, absent from Brucella ovis, related to the synthesis of smooth lipopolysaccharide. Microbes Infect, 6: 821- 834. Wadood F, M Ahmad, A Khan, ST Gul and N Rehman, 2009. Seroprevalence of brucellosis in horses in and around Faisalabad. Pak Vet J, 29: 196-198. Walker RL, 1999. ‗Brucella‘, in CH Dwright and ZY Chunge (eds.), Vet Microbiol, Blackwell Science, Massachusetts. pp. 196-203 Wanke MM, 2004. Canine brucellosis. Anim Reprod Sci, 82: 195-207.

148

Wareth G, F Melzer, MC Elschner, H Neubauer and U Roesler, 2014. Detection of Brucella melitensis in bovine milk and milk products from apparently healthy animals in Egypt by real-time PCR. J Infect Dev Countries, 15: 1339-43. West DM, AN Bruere and AL Ridler, 2002. The sheep: health, disease and Production, 2nd ed. Veterinary Continuing Education Publication No. 223. Plamerston North, NZ: Massey University, Veterinary Continuing Education. Weynants V, A Tibor, PA Denoel, C Saegerman, J Godfroid, P Thiange and JJ Leteson, 1996b. Infection of cattle with Yersinia enterocolitica O/9 a cause of the false positive serological reactions in bovine brucellosis diagnostic tests. Vet Microbiol, 48: 101-112. Weynants V, D Gilson, A Cloeckaert, PA Denoel, A Tibor, P Thiange, JN Limet and JJ Letesson, 1996a. Characterization of a monoclonal antibody specific for Brucella smooth lipopolysaccharide and development of a competitive enzyme-linked immunosorbent assay to improve the serological diagnosis of brucellosis. Clin Diag Lab Immunol, 3: 309-314. Whatmore AM, LL Perrett and AP MacMillan, 2007. Characterisation of the genetic diversity of Brucella by multilocus sequencing. BMC Microbiol, 7: 34. Whatmore AM, N Davison, A Cloeckaert, S Al Dahouk, MS Zygmunt, SD Brew, LL Perrett, MS Koylass, G Vergnaud, C Quance, HC Scholz, EJ Dick, G Hubbard and NE Schlabritz-Loutsevitch, 2014. Brucella papionissp. nov., isolated from baboons (Papio spp.). Int J Syst Evol Microbiol. 64: 4120-8. Whatmore AM, SJ Shankster, LL Perrett, TJ Murphy, SD Brew, RE Thirlwall, SJ Cutler and AP MacMillan, 2006. Identification and characterization of variable-number tandem- repeat markers for typing of Brucella spp. J Clin Microbiol, 44: 1982-1993. White PJ, DE Hallac, RL Wallen and JR White, 2015. Brucellosis: A nonnative disease hindering the restoration of Yellowstone bison. in Yellowstone bison—Conserving an American icon in modern society. Edited by White PJ, RL Wallen, DE Hallac and JA Jerrett. Yellowstone Association, Yellowstone National Park, Mammoth, Wyoming. Pp: 19-43. WHO, World Health Organization, 1986. Joint FAO/WHO Expert Committee on Brucellosis, Technical Report 740, Geneva, 86-88.

149

Williams AE, J Keppie and J Smith, 1964. The relation of erythritol usage to virulence in the Brucella. J Gen Microbiol, 30: 285-292. Worthington RW, MSG Mulders and IS McFarlane, 1973. A serological investigation on adult cattle vaccinated with Brucella abortus strain 19. Onderstepoort J Vet Res, 40: 7-12. Cited by Barton CE and JR Lomme JR, 1980. Reduced-dose whole herd vaccination against brucellosis: A review of recent experience. J Am Vet Med Assoc, 177: 1218-1220. Wyatt HV, 2005. How Themistocles Zammit found Malta fever (brucellosis) to be transmitted by the milk of goats. J R Soc Med, 98: 451-454. Wyatt HV, 2009. Brucellosis and Maltese goats in the Mediterranean. J Maltese Hist, 1: 4- 18. Wyatt HV, 2011. The curious affair of the identity of Fioravanti Sammut (b.1863) and Temistocle Zammit (d.1935). J Med Biogr, 19: 128-131. Xavier MN, TA Paixao, AB den Hartigh, RM Tsolis and RL Santos, 2010. Pathogenesis of Brucella spp. Open Vet Sci J, 4: 109-118. Xavier MN, TA Paixao, FP Poester, AP Lage and RL Santos, 2009. Pathological, immune- histochemical and bacteriological study of tissues and milk of cows and fetuses experimentally infected with Brucella abortus. J Com Path, 140: 149-157. Yagoub IA, AA Mohamed and MO Salim, 1990. Serological survey of Brucella abortus antibody prevalence in the one-humped camel (Camelus dromedarius) from eastern Sudan. Revue D'élevage et de Médecine Vétérinaire Des Pays Tropicaux, 43: 167- 171. Yagupsky P, 1999. Detection of Brucellae in blood cultures. J Clin Microbiol, 37: 3437- 3442. Yang J and Y Zhang, 2015. I-TASSER server: new development for protein structure and function predictions. Nucleic Acids Res, 43: 174-181. Yang J, R Yan, A Roy, D Xu, J Poisson and Y Zhang, 2015. The I-TASSER Suite: Protein structure and function prediction. Nat Methods, 12: 7-8. Yang X, JA Skyberg, C Ling, C Beata, T Theresa and DW Pascual, 2013. Progress in Bru- cella vaccine development. Front Biol, 8: 60-77. Young EJ, 1983. Human brucellosis. Rev Infect Dis, 5: 821-842.

150

Young EJ, 1992. Brucellosis. In: Feigin RD and JD Cherry, Textbook of Pediatric Infectious Diseases, WB Saunders, Philadelphia. USA, pp: 1068-1072. Young EJ, 1995. An overview of human brucellosis. Clin Infect Dis, 21: 283-289. Yu WL and K Nielsen, 2010. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J, 51: 306-313. Zhang Y, 2008. I-TASSER server for protein 3D structure prediction. BMC Bioinform, 9: 40. Zowghi E, A Ebadi and B Mohseni, 1990. Isolation of Brucella organisms from the milk of seronegative cows. Rev Sci Tech, 9: 1175-1178.

151

Appendix-1

Herd # Date / / Farm name

City

Farm Manager Contact No.

Farm Health & Management Information

Species Type of Farm Herd Type Animal species herded: Contact

LS Dairy Together Cattle + small ruminats

Cattle+small Agr & LS Meat Separate ruminat+camel Mixed camel kept out Small ruminant+ camel

Total Number of Animals Replacement through: Prefer to purchase from:

Local 1 Cattle Breeding Market Company 2 Sheep Purchased

3 Goat Both Farmer

4 Camel

Is AI used for cattle in Animal Species That 5 Dog Housing if not Shed farm? May Share Feed Cattle & small 6 Poultry Yes No Cattle Fence + Open Ruminant 7 Horse Source of Semen Small R Fence + Open Sheep&Goat

Cattle+Small 8 Dobkey Govt. Camel Fence + Open ruminat+camel Small ruminant Private Poultry Shed/Barn Loose + Camel 9 Others (specify) Compa Name & Add. Ruminants + ny Other a Specify if needed equines

Breeds Kept if not local Feed Watering Pattren Feeding pattren Contamination Cattle Cross Imported through: Cattle Seprate Comm.

Sheep Cross Imported Cattle Pasture pen Mixed Faeces S. Rumi Seprate Comm.

Goat Cross Imported Small Pasture Pen Mixed Dust Camel Seprate Comm. Rumin Camel Cross Imported Camel Pasture Pen Mixed Urine Others Seprate Comm.

If there is cat seen If there is a dog Farming System Farm environment inside farm in & around: Frequenlty Farm Dog Nomadi Transhumance Dry & Dusty

Sometimes Stray Dog Small F Hill Rea Village Moist & Damp

Never No Comme Other (Specify) Optimum

152

When new animal Aborted fetus & Floor Cleaning Mortality Disposal introduced Calves/kids membranes Reared Daily Burried Quarantined Burried/burnt

Separa Weekly Thrown No Quarantine Thrown te Other Other Never heard of With Other (Specify) (Specify) (Specify) this dams

History of abortion No. of Most frequent disorder observed in herd Abortions/year Cattle Cattle Cattle Abortio Diarrhe Ectopar Other (Specify)

Sheep Sheep Sheep Abortio Diarrhe Ectopar Other (Specify)

Goat Goat Goat Abortio Diarrhe Ectopar Other (Specify)

Camel Camel Camel Abortio Diarrhe Ectopar Other (Specify)

Deworming eworming Interv resence of Ticks o Vaccination Performed (Name) Performed Cattle Cattle Cattle Cattle

Sheep Sheep Sheep Sheep

Goat Goat Goat Goat

Camel Camel Camel Camel

Dog Dog Dog Dog

Animal Health Informations

Animal Cattle Sheep Goat Camel Age

Sex Male Female Breed Local Imported Crossbred

Tag No.

Vaccinated for Yes No Appearance Bright Dull Lethargic Others Brucellosis

Appetite Normal Reduced off feed

Temperature °F Pulse /min

Female Cattle Sheep Goat Camel

Status Cattle Sheep Goat Camel Abort Hist Abort Hist Abort Hist Abort Hist

Lactating Lactating Lactating Lactating Never Abort Never Abort Never Abort Never Abort

Pregnant Pregnant Pregnant Pregnant Lameness Lameness Lameness Lameness

Dry Dry Dry Dry Other Other Other Other

Bull Ram Buck Bull

Male Cattle Sheep Goat Camel

Orhchitis Orhchitis Orhchitis Orhchitis

Infertility Infertility Infertility Infertility

Lameness Lameness Lameness Lameness

Other Other Other Other

153