DOCSLIB.ORG

Mouse Cfap206 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Cfap206 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Cfap206 Knockout Project (CRISPR/Cas9) Objective: To create a Cfap206 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cfap206 gene (NCBI Reference Sequence: NM_027041 ; Ensembl: ENSMUSG00000028294 ) is located on Mouse chromosome 4. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000108136). Exon 2~8 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from the coding region. Exon 2~8 covers 63.49% of the coding region. The size of effective KO region: ~9864 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 8 11 Legends Exon of mouse Cfap206 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 1151 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 8 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(1151bp) | A(25.63% 295) | C(19.37% 223) | T(34.67% 399) | G(20.33% 234) Note: The 1151 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(20.55% 411) | C(23.7% 474) | T(32.9% 658) | G(22.85% 457) Note: The 2000 bp section downstream of Exon 8 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 1151 1 1151 1151 100.0% chr4 - 34728904 34730054 1151 browser details YourSeq 76 648 884 1151 74.0% chr11 - 69384625 69384795 171 browser details YourSeq 68 636 870 1151 74.7% chr8 - 110940345 110940477 133 browser details YourSeq 63 787 904 1151 88.0% chr2 - 12420778 12420909 132 browser details YourSeq 57 467 887 1151 61.4% chr3 - 130249750 130249894 145 browser details YourSeq 56 788 885 1151 87.1% chr14 - 9231674 9231778 105 browser details YourSeq 55 806 1008 1151 89.9% chr4 - 45367585 45368010 426 browser details YourSeq 55 714 798 1151 91.0% chr4 - 43838639 43838726 88 browser details YourSeq 52 636 888 1151 70.5% chr1 - 29714236 29714401 166 browser details YourSeq 51 711 781 1151 91.7% chr13 - 64324561 64324633 73 browser details YourSeq 49 729 824 1151 90.0% chr7 - 66111773 66111869 97 browser details YourSeq 48 788 884 1151 85.3% chr1 + 74650560 74650661 102 browser details YourSeq 47 804 884 1151 79.0% chr3 + 76598142 76598214 73 browser details YourSeq 46 745 821 1151 76.3% chr11 + 79797690 79797756 67 browser details YourSeq 45 804 870 1151 88.2% chr16 - 89852911 89852981 71 browser details YourSeq 45 769 824 1151 94.2% chr14 + 65080104 65080160 57 browser details YourSeq 44 737 824 1151 94.0% chr4 - 108588496 108588585 90 browser details YourSeq 43 768 831 1151 93.9% chrX - 73331166 73331231 66 browser details YourSeq 42 804 861 1151 86.0% chr7 - 115997419 115997474 56 browser details YourSeq 42 848 911 1151 90.4% chr5 - 126159352 126159419 68 Note: The 1151 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr4 - 34717045 34719044 2000 browser details YourSeq 290 253 609 2000 90.6% chr15 + 16129347 16129696 350 browser details YourSeq 261 769 1068 2000 95.4% chrY - 17147830 17516351 368522 browser details YourSeq 257 771 1068 2000 93.5% chr12 - 90871100 90871389 290 browser details YourSeq 255 777 1070 2000 96.9% chr8 - 17974431 17974742 312 browser details YourSeq 247 771 1070 2000 95.5% chr8 - 31791843 31792182 340 browser details YourSeq 241 771 1070 2000 93.3% chr12 - 90870915 90871260 346 browser details YourSeq 233 789 1070 2000 94.9% chrY + 18366162 18366474 313 browser details YourSeq 230 795 1070 2000 95.2% chrY + 13654630 13654936 307 browser details YourSeq 228 807 1068 2000 97.2% chr8 - 17974466 17974742 277 browser details YourSeq 227 789 1068 2000 93.4% chrY - 12435931 12436218 288 browser details YourSeq 224 801 1070 2000 95.8% chrY + 7017191 7017522 332 browser details YourSeq 218 773 1070 2000 94.8% chrY + 15684941 15685294 354 browser details YourSeq 218 773 1070 2000 94.8% chrY + 11000465 11000815 351 browser details YourSeq 210 803 1068 2000 92.4% chr10 + 123484255 123484540 286 browser details YourSeq 203 845 1068 2000 98.2% chr8 - 17974502 17974742 241 browser details YourSeq 190 845 1070 2000 96.2% chr10 + 55387176 55387422 247 browser details YourSeq 185 845 1070 2000 94.5% chr16 + 66221219 66221468 250 browser details YourSeq 172 877 1070 2000 97.5% chrY - 9891283 9891517 235 browser details YourSeq 171 841 1070 2000 93.5% chr12 - 119867429 119867660 232 Note: The 2000 bp section downstream of Exon 8 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Cfap206 cilia and flagella associated protein 206 [ Mus musculus (house mouse) ] Gene ID: 69329, updated on 12-Aug-2019 Gene summary Official Symbol Cfap206 provided by MGI Official Full Name cilia and flagella associated protein 206 provided by MGI Primary source MGI:MGI:1916579 See related Ensembl:ENSMUSG00000028294 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as AU024269; 1700003M02Rik Expression Restricted expression toward testis adult (RPKM 129.5) See more Orthologs human all Genomic context Location: 4; 4 A5 See Cfap206 in Genome Data Viewer Exon count: 13 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 4 NC_000070.6 (34688574..34730263, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 4 NC_000070.5 (34658581..34677455, complement) Chromosome 4 - NC_000070.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 6 transcripts Gene: Cfap206 ENSMUSG00000028294 Description cilia and flagella associated protein 206 [Source:MGI Symbol;Acc:MGI:1916579] Gene Synonyms 1700003M02Rik Location Chromosome 4: 34,688,559-34,730,206 reverse strand. GRCm38:CM000997.2 About this gene This gene has 6 transcripts (splice variants), 223 orthologues, is a member of 1 Ensembl protein family and is associated with 7 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Cfap206- ENSMUST00000029971.11 2246 622aa ENSMUSP00000029971.5 Protein coding CCDS84713 Q6PE87 TSL:5 201 GENCODE basic APPRIS P1 Cfap206- ENSMUST00000108136.7 1688 504aa ENSMUSP00000103771.1 Protein coding CCDS18031 Q6PE87 TSL:1 202 GENCODE basic Cfap206- ENSMUST00000137514.2 765 210aa ENSMUSP00000116947.1 Protein coding - Z4YM47 CDS 3' 204 incomplete TSL:5 Cfap206- ENSMUST00000162495.7 628 46aa ENSMUSP00000124760.1 Nonsense mediated - E0CXC1 TSL:3 206 decay Cfap206- ENSMUST00000135563.1 690 No - lncRNA - - TSL:5 203 protein Cfap206- ENSMUST00000160209.1 557 No - lncRNA - - TSL:3 205 protein Page 7 of 9 https://www.alphaknockout.com 61.65 kb Forward strand 34.68Mb 34.70Mb 34.72Mb 34.74Mb Genes Gm22849-201 >misc RNA (Comprehensive set... Contigs AL928738.8 > Genes (Comprehensive set... < Slc35a1-201protein coding < Cfap206-201protein coding < Slc35a1-204lncRNA < Cfap206-203lncRNA < Cfap206-206nonsense mediated decay < Slc35a1-203protein coding < Cfap206-202protein coding < Slc35a1-202lncRNA < Cfap206-204protein coding < Slc35a1-205lncRNA < Cfap206-205lncRNA Regulatory Build 34.68Mb 34.70Mb 34.72Mb 34.74Mb Reverse strand 61.65 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene processed transcript Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000108136 < Cfap206-202protein coding Reverse strand 18.85 kb ENSMUSP00000103... Coiled-coils (Ncoils) Pfam Cilia- and flagella-associated protein 206 PANTHER Cilia- and flagella-associated protein 206 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 504 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 9 of 9.
Load more

Recommended publications
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Molecular Characterization of Acute Myeloid Leukemia by Next Generation Sequencing: Identification of Novel Biomarkers and Targets of Personalized Therapies
    Alma Mater Studiorum – Università di Bologna Dipartimento di Medicina Specialistica, Diagnostica e Sperimentale Dottorato di Ricerca in Oncologia, Ematologia e Patologia XXX Ciclo Settore Scientifico Disciplinare: MED/15 Settore Concorsuale:06/D3 Molecular characterization of acute myeloid leukemia by Next Generation Sequencing: identification of novel biomarkers and targets of personalized therapies Presentata da: Antonella Padella Coordinatore Prof. Pier-Luigi Lollini Supervisore: Prof. Giovanni Martinelli Esame finale anno 2018 Abstract Acute myeloid leukemia (AML) is a hematopoietic neoplasm that affects myeloid progenitor cells and it is one of the malignancies best studied by next generation sequencing (NGS), showing a highly heterogeneous genetic background. The aim of the study was to characterize the molecular landscape of 2 subgroups of AML patients carrying either chromosomal number alterations (i.e. aneuploidy) or rare fusion genes. We performed whole exome sequencing and we integrated the mutational data with transcriptomic and copy number analysis. We identified the cell cycle, the protein degradation, response to reactive oxygen species, energy metabolism and biosynthetic process as the pathways mostly targeted by alterations in aneuploid AML. Moreover, we identified a 3-gene expression signature including RAD50, PLK1 and CDC20 that characterize this subgroup. Taking advantage of RNA sequencing we aimed at the discovery of novel and rare gene fusions. We detected 9 rare chimeric transcripts, of which partner genes were transcription factors (ZEB2, BCL11B and MAFK) or tumor suppressors (SAV1 and PUF60) rarely translocated across cancer types. Moreover, we detected cryptic events hiding the loss of NF1 and WT1, two recurrently altered genes in AML. Finally, we explored the oncogenic potential of the ZEB2-BCL11B fusion, which revealed no transforming ability in vitro.
    [Show full text]
  • Novel Gene Discovery in Primary Ciliary Dyskinesia
    Novel Gene Discovery in Primary Ciliary Dyskinesia Mahmoud Raafat Fassad Genetics and Genomic Medicine Programme Great Ormond Street Institute of Child Health University College London A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy University College London 1 Declaration I, Mahmoud Raafat Fassad, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Primary Ciliary Dyskinesia (PCD) is one of the ‘ciliopathies’, genetic disorders affecting either cilia structure or function. PCD is a rare recessive disease caused by defective motile cilia. Affected individuals manifest with neonatal respiratory distress, chronic wet cough, upper respiratory tract problems, progressive lung disease resulting in bronchiectasis, laterality problems including heart defects and adult infertility. Early diagnosis and management are essential for better respiratory disease prognosis. PCD is a highly genetically heterogeneous disorder with causal mutations identified in 36 genes that account for the disease in about 70% of PCD cases, suggesting that additional genes remain to be discovered. Targeted next generation sequencing was used for genetic screening of a cohort of patients with confirmed or suggestive PCD diagnosis. The use of multi-gene panel sequencing yielded a high diagnostic output (> 70%) with mutations identified in known PCD genes. Over half of these mutations were novel alleles, expanding the mutation spectrum in PCD genes. The inclusion of patients from various ethnic backgrounds revealed a striking impact of ethnicity on the composition of disease alleles uncovering a significant genetic stratification of PCD in different populations.
    [Show full text]
  • The Role of Lamin Associated Domains in Global Chromatin Organization and Nuclear Architecture
    THE ROLE OF LAMIN ASSOCIATED DOMAINS IN GLOBAL CHROMATIN ORGANIZATION AND NUCLEAR ARCHITECTURE By Teresa Romeo Luperchio A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March 2016 © 2016 Teresa Romeo Luperchio All Rights Reserved ABSTRACT Nuclear structure and scaffolding have been implicated in expression and regulation of the genome (Elcock and Bridger 2010; Fedorova and Zink 2008; Ferrai et al. 2010; Li and Reinberg 2011; Austin and Bellini 2010). Discrete domains of chromatin exist within the nuclear volume, and are suggested to be organized by patterns of gene activity (Zhao, Bodnar, and Spector 2009). The nuclear periphery, which consists of the inner nuclear membrane and associated proteins, forms a sub- nuclear compartment that is mostly associated with transcriptionally repressed chromatin and low gene expression (Guelen et al. 2008). Previous studies from our lab and others have shown that repositioning genes to the nuclear periphery is sufficient to induce transcriptional repression (K L Reddy et al. 2008; Finlan et al. 2008). In addition, a number of studies have provided evidence that many tissue types, including muscle, brain and blood, use the nuclear periphery as a compartment during development to regulate expression of lineage specific genes (Meister et al. 2010; Szczerbal, Foster, and Bridger 2009; Yao et al. 2011; Kosak et al. 2002; Peric-Hupkes et al. 2010). These large regions of chromatin that come in molecular contact with the nuclear periphery are called Lamin Associated Domains (LADs). The studies described in this dissertation have furthered our understanding of maintenance and establishment of LADs as well as the relationship of LADs with the epigenome and other factors that influence three-dimensional chromatin structure.
    [Show full text]
  • The Highly Conserved FOXJ1 Target CFAP161 Is Dispensable for Motile
    www.nature.com/scientificreports OPEN The highly conserved FOXJ1 target CFAP161 is dispensable for motile ciliary function in mouse and Xenopus Anja Beckers1, Franziska Fuhl2, Tim Ott2, Karsten Boldt3, Magdalena Maria Brislinger2,7, Peter Walentek4, Karin Schuster‑Gossler1, Jan Hegermann5, Leonie Alten1,8, Elisabeth Kremmer6,9, Adina Przykopanski1,10, Katrin Serth1, Marius Uefng3, Martin Blum2* & Achim Gossler1* Cilia are protrusions of the cell surface and composed of hundreds of proteins many of which are evolutionary and functionally well conserved. In cells assembling motile cilia the expression of numerous ciliary components is under the control of the transcription factor FOXJ1. Here, we analyse the evolutionary conserved FOXJ1 target CFAP161 in Xenopus and mouse. In both species Cfap161 expression correlates with the presence of motile cilia and depends on FOXJ1. Tagged CFAP161 localises to the basal bodies of multiciliated cells of the Xenopus larval epidermis, and in mice CFAP161 protein localises to the axoneme. Surprisingly, disruption of the Cfap161 gene in both species did not lead to motile cilia‑related phenotypes, which contrasts with the conserved expression in cells carrying motile cilia and high sequence conservation. In mice mutation of Cfap161 stabilised the mutant mRNA making genetic compensation triggered by mRNA decay unlikely. However, genes related to microtubules and cilia, microtubule motor activity and inner dyneins were dysregulated, which might bufer the Cfap161 mutation. Cilia are extensions that protrude from the cell surface of most vertebrate and some invertebrate cell types into the extracellular space. Tey can be broadly grouped into nonmotile and motile cilia1. Nonmotile cilia, also referred to as primary cilia, are present on virtually every cell of vertebrates and are critical for signal transduction and sensing of external stimuli (reviewed in2,3).
    [Show full text]
  • Supplementary Information
    Supplementary Information Supplementary Figure 1 2 Supplementary Figure 2 3 Supplementary Figure 3 4 Supplementary Figure 4 5 Supplementary Figure 5 6 Supplementary Figure 6 7 Supplementary Figure 7 8 Supplementary Table 1 9 Supplementary Table 2 23 Supplementary Table 3 25 Supplementary References 26 1 Supplementary Figure 1 Supplementary Figure 1. Testing cell-specific dataset by differential expression analysis and known marker genes for gene transcriptions. (A) Differential gene expression analysis of human spermatogenesis dataset provided by Xia B., et al. (2020) shows unique expression sets among individual cell stages defined by binary logarithmic Fold Change (log2FC) of gene expression at a threshold of 0.25. (B) PCA-based trajectory analysis is consistent with gene sets for cell-stage identifications as reported in human single-cell atlas (Guo et al., 2018). List of gene marker clusters in individual stages is provided in Supplementary Table 1. (C,D,E) Normalized 2 absolute spermatogenesis transcriptome shows total cellular gene transcription, mitochondrial gene transcription, and RNF20 expression known for TCEA inhibition. [all statistical analysis provided in the figure was tested by Pearson’s correlation at a cut-off p-value < 0.001] Supplementary Figure 2 Supplementary Figure 2. TCEA expression profile in human embryogenesis. (A,B) TCEA expression profile of human embryogenesis classified by days [day 3-7] (left) and tissue types [epiblast, not applicable, primitive endoderm, and trophectoderm] (right) provided by (Sladitschek et al., 2020). (C,D) Correlation analyses between embryogene-related gene transcription and TCEA1 (left) and TCEA2 (right). [all statistical analysis provided in the figure was tested by Pearson’s correlation at a cut-off p-value < 0.001] 3 Supplementary Figure 3 Supplementary Figure 3.
    [Show full text]
  • C6orf165 (CFAP206) (NM 001031743) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207308 C6orf165 (CFAP206) (NM_001031743) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C6orf165 (CFAP206) (NM_001031743) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CFAP206 Synonyms: C6orf165; dJ382I10.1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C6orf165 (CFAP206) (NM_001031743) Human Tagged ORF Clone – RC207308 ORF Nucleotide >RC207308 representing NM_001031743 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCCAACTCAGGCCGAAAGTGTTATAAGGAGTATTATACGAGAAATAGGACAAGAATGTGCAGCCC ATGGAGAGATTGTTTCTGAAACTCTGATTGCTTTTATGGTGAAAGCTGTTGTCCTGGATCCAAGTAATGG CTTTAACATGGATAGAACCCTCATGAAAAGTGATGTGCAGAATCTTGTTAAGCTTTGTATGACTCGGCTA TTGGATACTAAAAATCCATCCCTGGACACTATTAAGATGCAAGTCTACTTCGATATGAATTATACGAATC GAGTGGAATTTCTCGAAGAACATCACCGGGTCCTAGAGTCTAGATTAGGCTCTGTTACCCGAGAAATTAC AGATAACAGAGCATGTGCTAAAGAAGAATTGGAAAGCCTCTACCGGAAGATTATCAGCTATGTGTTACTC CGCTCTGGCCTTGGATCCCCTACAGACATCAAGACTGTCAGAGAGGTAACAGCTGCTCTACAGAGTGTTT TTCCTCAGGCAGAGCTTGGGACATTTCTAACTCTTTCTAAGAAGGACAAAGAACGCCAGCTGAAAGAACT
    [Show full text]
  • Evaluation of Male Fertility-Associated Loci in a European Population of Patients with Severe Spermatogenic Impairment
    Journal of Personalized Medicine Article Evaluation of Male Fertility-Associated Loci in a European Population of Patients with Severe Spermatogenic Impairment Miriam Cerván-Martín 1,2,†, Lara Bossini-Castillo 1,2,†, Rocío Rivera-Egea 3,4, Nicolás Garrido 4,5, Saturnino Luján 5 , Gema Romeu 5 , Samuel Santos-Ribeiro 6,7, IVIRMA Group ‡, Lisbon Clinical Group ‡, José A. Castilla 2,8,9, M. Carmen Gonzalvo 2,8, Ana Clavero 2,8, F. Javier Vicente 2,10, Andrea Guzmán-Jiménez 1, Cláudia Costa 11,12, Inés Llinares-Burguet 1, Chiranan Khantham 13, Miguel Burgos 1, Francisco J. Barrionuevo 1, Rafael Jiménez 1, Josvany Sánchez-Curbelo 14 , Olga López-Rodrigo 14, M. Fernanda Peraza 14, Iris Pereira-Caetano 15, Patricia I. Marques 11,12, Filipa Carvalho 11,16, Alberto Barros 11,16, Lluís Bassas 14, Susana Seixas 11,12 , João Gonçalves 15,17 , Sara Larriba 18 , Alexandra M. Lopes 11,12, Rogelio J. Palomino-Morales 2,19,*,§ and F. David Carmona 1,2,*,§ 1 Departamento de Genética e Instituto de Biotecnología, Universidad de Granada, 18016 Granada, Spain; [email protected] (M.C.-M.); [email protected] (L.B.-C.); [email protected] (A.G.-J.); [email protected] (I.L.-B.); [email protected] (M.B.); [email protected] (F.J.B.); [email protected] (R.J.) 2 Instituto de Investigación Biosanitaria ibs.GRANADA, 18012 Granada, Spain; [email protected] (J.A.C.); [email protected] (M.C.G.); [email protected] (A.C.); [email protected] (F.J.V.) 3 Andrology Laboratory and Sperm
    [Show full text]
  • Elucidating the Mechanism of NUAK1 Function in Ovarian Cancer Metastasis Jamie Fritz the University of Western Ontario
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository August 2019 Elucidating the mechanism of NUAK1 function in Ovarian Cancer Metastasis Jamie Fritz The University of Western Ontario Supervisor Dr. Trevor Shepherd The University of Western Ontario Graduate Program in Anatomy and Cell Biology A thesis submitted in partial fulfillment of the requirements for the degree in Master of Science © Jamie Fritz 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Cancer Biology Commons Recommended Citation Fritz, Jamie, "Elucidating the mechanism of NUAK1 function in Ovarian Cancer Metastasis" (2019). Electronic Thesis and Dissertation Repository. 6364. https://ir.lib.uwo.ca/etd/6364 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Epithelial ovarian cancer (EOC) has a unique mode of metastasis, where upon shedding from the primary tumor, cells form spheroids and spread through the peritoneal cavity. There is a need to elucidate pathways driving spheroid formation to identify novel therapeutic targets. We previously showed that LKB1 is required for EOC metastasis. Using multiplex inhibitor bead-mass spectrometry, we identified NUAK1 as a top LKB1 substrate candidate. We confirmed LKB1 maintains NUAK1 phosphorylation and expression. NUAK1KO cells had lower cell adhesion and generated spheroids with reduced integrity. We identified a cell attachment pathway that was enriched in parental compared with NUAK1KO spheroids. The FN1 gene, encoding fibronectin, exhibited the greatest differential expression in NUAK1KO spheroids.
    [Show full text]
  • Key Genes Associated with Diabetes Mellitus and Hepatocellular Carcinoma T ⁎ ⁎ Gao-Min Liu , Hua-Dong Zeng, Cai-Yun Zhang, Ji-Wei Xu
    Pathology - Research and Practice 215 (2019) 152510 Contents lists available at ScienceDirect Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp Key genes associated with diabetes mellitus and hepatocellular carcinoma T ⁎ ⁎ Gao-Min Liu , Hua-Dong Zeng, Cai-Yun Zhang, Ji-Wei Xu Department of Hepatobiliary Surgery, Meizhou People’s Hospital, No. 38 Huangtang Road, Meizhou 514000, China ARTICLE INFO ABSTRACT Keywords: Accumulating evidence indicates a strong correlation between type 2 diabetes mellitus (T2DM) and hepato- Hepatocellular carcinoma cellular carcinoma (HCC), but the underlying pathophysiology is still elusive. We aimed to identify unrecognized Diabetes but important genes and pathways related to T2DM and HCC by bioinformatic analysis. The GSE64998 and TCGA GSE15653 datasets (for T2DM), the GSE121248 dataset and the Cancer Genome Atlas-Liver Hepatocellular GEO Carcinoma (TCGA-LIHC) dataset (for HCC) were downloaded. Differential expression analysis, functional and Bioinformatic pathway enrichment analysis, protein–protein interaction (PPI) network construction, survival analysis, tran- scription factor (TF) prediction, and correlation of gene expression with methylation and tumour-infiltrating immune cells were conducted. Nine genes, namely, CDNF, CRELD2, DNAJB11, DTL, GINS2, MANF, PDIA4, PDIA6, and VCP, were recognized as hub genes. Enrichment analysis revealed several enriched terms and pathways. Transcription factors such as Kruppel-like factor 6, abnormal methylation and immune dysregulation might help explain the dysregulation of hub genes. Our study identified nine hub genes that might play a critical role in both T2DM and HCC. However, more studies are warranted to clarify the mechanisms of these genes. 1. Introduction 2. Materials and methods Hepatocellular carcinoma (HCC) remains a great challenge in public 2.1.
    [Show full text]
  • Mouse Cfap206 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Cfap206 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Cfap206 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Cfap206 gene (NCBI Reference Sequence: NM_027041 ; Ensembl: ENSMUSG00000028294 ) is located on Mouse chromosome 4. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000108136). Exon 4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Cfap206 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-98N9 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 4 starts from about 12.76% of the coding region. The knockout of Exon 4 will result in frameshift of the gene. The size of intron 3 for 5'-loxP site insertion: 2999 bp, and the size of intron 4 for 3'-loxP site insertion: 2018 bp. The size of effective cKO region: ~591 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 4 5 11 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cfap206 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Examining the Effects of Endogenous Sex Steroids and the Xenoestrogen Contaminant 17-Ethinylestradiol on Previtellogenic Coho Salmon Ovarian Growth and Function
    Examining the effects of endogenous sex steroids and the xenoestrogen contaminant 17-ethinylestradiol on previtellogenic coho salmon ovarian growth and function Christopher A. Monson A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2018 Reading committee: Dr. Graham Young, Chair Dr. Penny Swanson Dr. Steven Roberts Program authorized to offer degree: Aquatic and Fishery Sciences ©Copyright 2018 Christopher A. Monson University of Washington Abstract Examining the effects of endogenous sex steroids and the xenoestrogen contaminant 17α- ethinylestradiol on previtellogenic coho salmon ovarian growth and function. Christopher A. Monson Chair of Supervisory Committee: Professor Graham Young School of Aquatic and Fishery Sciences In teleost fish, as in other oviparous vertebrates, the production of a fertilizable egg is a complex process driven by the specific spatiotemporal coordination of endocrine and paracrine factors in multiple tissues. Across the brain-pituitary-ovary-liver (BPOL) axis, this includes the synthesis and release of pituitary gonadrotopins, the ovarian production and release of sex steroids, and the hepatic synthesis and release of egg yolk protein precursors, as well as numerous factors that mediate these processes. The factors controlling the earliest stages of oogenesis, the loading of yolk proteins (vitellogenesis), and the final maturational stage are fairly well understood, but the control of the intermediate growth stages (primary and early secondary growth) and the developmental point analogous to the onset of mammalian puberty, the transition from primary to secondary growth, are less clear. The research described in this dissertation addresses the regulation of the ovarian transcriptome by sex steroids during the primary and early secondary growth stages in coho salmon (Oncorhynchus kisutch), and the potential disruption of normal ovarian processes during early secondary growth by a potent synthetic steroidal xenoestrogen.
    [Show full text]