DEXKETOPROFEN):INFRESHWATER MODEL BIOASSAYS ECOTOXICOLOGICAL PROPERTIES S(+)- OFKETOPROFENTHE and Toxicology Environmental NTORRE Accepted Preprint LVIRA M

Home , Dexketoprofen

View metadata,citationandsimilarpapersatcore.ac.uk This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved pertain. et and journal disclaimers the legal manuscripts. in these contained information of the use from arising consequences to all and apply the content, to that affect changes introduce could guidelines may which editing graphics that Note and/or article. text View manuscript Early an as published and site Web ed is manuscript the After (DOI). acceptance since authors the by altered way any in peer are Articles" "Accepted AcceptedArticle Chem. Toxicol Environ I E SPECIES ANDPLHC-1 BIOMARKERSFISH IN ENANTIOMER (DEXKETOPROFEN):INFRESHWATER MODEL BIOASSAYS ECOTOXICOLOGICAL PROPERTIES S(+)- OFKETOPROFENTHE AND Toxicology Environmental NTORRE Accepted Preprint LVIRA M

and C and ENNILLO ARLO ,

, A Accepted ArticleAccepted P UGUSTINE UGUSTINE RETTI -

reviewed, accepted manuscripts that have not been edited, formatted, or or formatted, edited, been not have that manuscripts accepted reviewed,

ited and formatted, it will be removed from the “Accepted Articles” Articles” “Accepted the from removed be will it formatted, and ited A RUKWE • DOI: 10.1002/etc. DOI: ,

G SETAC IANFRANCA IANFRANCA . They are citable by the Digital Object Identifier Identifier Object Digital the by citable are They .

ant e ed epnil fr ros or errors for responsible held be cannot CELL-LINE CELL-LINE 3 9 43 M

ONNI ,

V ALENTINA ALENTINA

provided byArchiviodellaRicerca-UniversitàdiPisa M EUCCI , hical hical

L UIGI brought toyouby

CORE This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved SubmittedFebruary 21April2017;Accepted2017; 2 Returned Revision 2017 for 8August Thisarticle is protected byAllcopyright. rights reserved article Supplemental This online-only contains Data Ecotoxicological E. Mennillo etal. DOI 10.1002/etc.3943 EnvironmentalToxicology * b Department Science (NTNU),Norwegian ofBiology, andUniversity of Technology Trondheim,

E Address correspondence to [email protected] to correspondence LVIRA LVIRA Accepted PreprintENANTIOMER (DEXKETOPROFEN):INFRESHWATER MODEL BIOASSAYS ECOTOXICOLOGICAL PROPERTIES S(+)- OFKETOPROFENTHE AND a c Department SanPieroa ofVeterinaryPisa, Sciences, University Grado,Italy of Interuniversitaryof MarineBiologyItaly (CIBM)Bacci”, “G. Center Leghorn, M ENNILLO SPECIESPLHC-1 AND BIOMARKERSFISH IN effects of ketoprofen and dexketoprofen of ketoprofeneffectsand dexketoprofen , a, * A * UGUSTINE UGUSTINE L UIGI

I NTORRE A RUKWE

EnvironmentalToxicology Chemis and , Norway Norway a

and C and , b

G IANFRANCA IANFRANCA ARLO

P RETTI M ONNI a,c

CELL-LINE CELL-LINE

, a

V ALENTINA ALENTINA M EUCCI

try

, a

representative ( model organisms (dexketoprofen prescribedNSAIDs, namely their presence ubiquitous inthe environment.toxicological these properties The twowidely of This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Biomarkers, cells, Keywords: Ecotoxicology PLHC-1 NSAIDs, Pharmaceuticals, Bioassays, copyright.All rights reserved sensitivity thetime, interactionsNSAIDskey between systems, theseand anddifferent detoxification andexposure time concentration of theindividual drug.for revealed present study The thefirst mRNA andmodulated MRP2 MRP1 rac concentration cytotoxic exert DKP didnot effects PLHC in different for EC values compared torac ofbioluminescenceinhibition throughandgrowth algaland increased Toxicityfrom and data acute both chronicDKP exposure indicated sensitivity higher through multidrug using resistance associated proteinsthePLHC (MRP1/MRP2) Ceriodaphnia dubia Abstract: - AcceptedKP andDKPat differed transcriptionalcatalytic torac and Exposure level. Preprint

The increased use ofnonThe increased to the racemic mixtureenantiomer. comparedto the racemic toits - specificdifferential theeffects effectsCYP1A, andCYP1A onGSTlevels. of For , DKP) wereFirstly,acute evaluated. chronic byand threetests using toxicity - KP exposure. T KP exposure. ). Secondly,evaluating responses systems the of by and biotransformation 50

(240.2 µg/L and respectively). 65.6µg/L, -

racemic(rac ketoprofen he growth inhibition test showedgrowth thatrac inhibition he Vibrio fischeriVibrio - ste levels andthese effectsalso dependentoncompound, were roidal anti roidal - 1 cells, andproducedcells, compound , Pseudokirchneriella subcapitata - inflammatoryresulted (NSAIDs) has in drugs - KP) and enantiomerS(+) its This article is protectThis article is Furthermore, rac mortality/immobilization - - 1 fish hepaticfish cell 1 KP and DKP exhibited KP andDKP exhibited - - , time KP andDKP

and - ed by ketoprofen ketoprofen - - KP and

and - line.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved while expressed incellsphysiological under conditions, isconstitutively drugs ofisoforms. act(COX) COX-1 cyclooxygenase inhibitors asnon-selective mainly antipyreticanalgesic, anti-inflammatory due properties totheirand waters [5 ng/L-µg/Lof medicinal surface range,measurable bothin drugsconcentrations in and sewage have[6 environment different inthe fates compartments, these pharmaceuticals [5 STPs contributor theenvironment totheemissions ofmedicinal into products animal phase andsubsequentconsumption consumption The represents excretion. thebiggest substances reach can aquaticenvironments primarily viasewagefarm effluentshuman after or degraded in Theremanufacturingevidenceis thatmany [2,3]. these residues substancesare of neither fromandlandfill domesticleachates sewage effluents, treatmentand plant (STP) also but metabolites havedetected been to non-targetpharmaceutical theenvironment.Parent and their organisms compounds in effects there but information abouttheimpact ofpharmaceuticals, islimited ofthese compounds Thereecosystems isaamountlarge ofdata[1]. adverse andhuman onthe health beneficial and poses assurfaceemerginga isan that (SW) water environmentalissue INTRODUCTION Accepted ]. Preprint can Depending andchemical onthephysical ofeither properties orthe the host compounds The presence pharmaceuticaland (WTP) wastewater compoundsin of treatment plants ]. Non-steroidal anti-inflammatory (NSAIDs) Non-steroidal pharmaceuticals,arewidely drugs ]. used

partly eliminate or remove medicinal product residues, but some tracesarepartlyeliminate or removemedicinal residues, product butsome

STPs nor inthe environmentSTPs [2,3 in surface, drinking and ground water, from not only in surface,from ground hospitals water, drinkingand can

]. Recent have]. studies demonstratedthepresence of be biotransformed and the resulting metabolites maybe theresulting biotransformedand metabolites ]. Due totheir]. widespread these application, COX-2 is induced byCOX-2 isinduced cytokines, potential riskfor aquaticpotential [4 ]. Once]. inwastewater, [7 ]. Most ]. ofthese detectable detectable This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved studies generallylow acute that demonstrated NSAIDson calculated toxicitybased have short- has been organisms belonging tested onnon-target toxicity NSAIDs,acetylsalicylic ofthe common most including and diclofenac ibuprofen, acid, (dexketoprofen: efficacy marketing isdue tothedextroro S(+)-enantiomer, the of and thepreferential biodegradation of S-enantiomer dep biological [13 action rapidlygastrointestinalfrom tract,consequentlycharacterizedis by the and a produced resided withtheenantiomerconfiguration, possessing S(+) the comparing theirthe COXThis comparisonthattheactivity effectson binding showed site. inflammatory obtained ofathe individual enantiomers activity chiralNSAID was of since theR(-)- - KP andS(+) NSAIDsa and racemic(rac-KP), is foundas mixture concentrations excretion, metabolism andlowremoval several efficiencySTPs), can NSAIDs reach detectable [9 annualclass of productiontop-selling drugs ofworldwide NSAIDs several are kilotons, thesixth COX-2 undermitogens and endotoxins

5.7 µg ]. ]. ends on the extent of both the chiral inversion of R-enantiomers during human metabolism both the chiralof R-enantiomersends during of onthe inversion extent

Accepted PreprintDue tothe rising usageand pharmacokinetics associated urinaryand (half-life, faecal The /L are involvedinflammatory inthe synthesis mediators ofdifferent no interaction with theCOX bindingwith site[12 no interaction ) and at conc ) low therapeutic effect - KP [1] en in aquatic environmentsin aquatic [10 DKP antiomer antiomer . Rac ]. )

The of NSAIDs enantiomeric inthe aquaticenvironment distribution has becomehas - KP lacks such activity [11]. A useful index oftheA useful relative index anti- lacks suchactivity [11]. entrations theenvironment in has been detected at low concentrationshas beenat detected of the rac- of pathological conditions, suchasCOX-1pathological and inflammation.Both conditions, a major scientific and scientific economica major KP ]. Ketoprofen]. (KP)

resides almost exclusivelyresides inthe S(+)-enantiomer to different trophic levels [16 to different trophic levels during wastewater treatment [14]. Since the treatmentduring wastewater [14].

comprising ]. Additionally, ]. S(+)-KP absorbed is the

[1].

is one of the most widelymost is oneof the used since the R (-)R since enantiomer the of the interest [15]. The acute [15]. interest ta in STPs tory enantiomer two enantiomers:two R( [8]. [8]. quick onset of quick Based onestimated

( rangingfrom 0.41 ]. Overall,]. these in vitro in vitro - by ) - This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved r hepatocellular PLHCcarcinoma, subcapitata chronic freshwater bioassayson model organisms DKP toxicity [2 hasconsequences pumps efflux been infishcellcell their lines tostudy potential used intermsof functions when correlating theEC assays [21 Fish cell lines from[1]. different for and organs species different used cytotoxicity been have actions ofeach pharmaceutical andknown humansare side effectsin consideration into nottaken Moreover, howeverstudies of there isalack are of ecologicalAcute risk inthe aquaticenvironment. or chronic onstandard bioassays approach test asignificant organismsinthe represents definition related to fish cnidariansNSAIDs [17 as onnon-target organisms, such detected chronic intheenvironment, certainly effectsare environmental more concentrations forthanthoseconsidering testsaremuchhigher currently these thattheeffective termconcentration 50% effect (EC egulation of CYP1a, GST and efflux pumps (MRP1 and and (MRP1 MRP2). pumps egulation efflux ofCYP1a, GST commonly used for assessing the potential impact of pharmaceuticals on theenvironment, assessing ofpharmaceuticalsused commonly for thepotential impact

Accepted Preprint[2

in freshwater organisms usingin freshwater twodifferent organisms approaches. acute Firstly,applied we and 0 An increasingstudies have of evaluated number ],

hi and regulation of cytochrome P450 1A (CYP1A), glutathione S-transferase (GST) andandof cytochrome glutathione regulation(CYP1A), 1AS-transferase P450 oxidative stress, reproduction,oxidative and The survival. cyto-genotoxicity 0 and shownto] providetomammalian thecells comparable basal information, toxicity the traditional toxicity testsaregenerally the traditional notdesigned specific for modesof the ,2 , ghlighting that Ceriodaphnia dubia 3 ,2 4 ].

Thus, theaims 50

values [2 these compounds - ). Secondly,we used 1) to evaluate the toxicological 1) toevaluate responses the on 50 of thisstudy w 2

), ranging between 10and 100mg ]. chronic and toxicity

The interactions The interactions alone or in combination or in alone

ere ere ( Vibrio fischeriVibrio b to evaluate the ecotoxicity of rac-KPto evaluate theecotoxicityand of ioassaysalgae, usingcrustaceanfish and in vitro

between several sub-lethal effectsseveral by sub-lethal induced ], cladocerans], [16 in vitro

fish

several pharmaceuticals on theseveral pharmaceuticals

biotransformation biotransformation

cell model Pseudokichneriella can /L

produce produce [1 ], mussels [18 on function and 6 use acute of either Nevertheless,].

ly ( Poeciliopsis lucida

relevant. relevant. toxic effectstoxic effects. , 19] and

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved operating TheM500 luminometer. the instrument Microtox® was interfaced withaPC with (pHtests were 6 at performed 15°C wasemission determinedafter 15 minutes Bacteriaeach3.90 µg/L 10 dilutions). to2000µg/L, were to exposed ecotoxicological such parameters as EC [2 (V. ofbioluminescenceInhibition fischeri) evaluation, effect order for in todefine pharmaceuticals. concentrations Ecotoxicological Bioassays acidSigma-Aldrich.from were obtained dichromate,IsopropylEthoxyresorufin, Potassium Phenol, Hexane (IPA), and alcohol Formic yl)-2,5-diphenyl-tetrazolium bromide Dimethyl (DMSO), EDTA tetra sulfoxide ethylenediamine acetic 3-(4,5-dimethylthiazol-2 acid, streptomycinU/mL (5000 light degradation serum of (FBS) pharmaceuticals.Fetal (heat inactivated), penicillin bovine prepared water atglassware indeionized and atAmber 10mg/L was stored 4°C. usedtoprevent Italy).purchased (Milan, frompharmaceuticals Stock Sigma-Aldrich standard of solutions were 22071-15 Chemicals reagents and ANDMATERIALS METHODS 5 AcceptedBacteria ]. LSD werefromItaly). For obtained Ecotox (Pregnana of identification Milanese, Preprint The inhibition ofbioluminescenceThe according inhibition testwas performed to An ecotoxicologicalbattery was toxicity for (bacteria,algae,adopted test daphnids) Racemic of(RS)-k mixture -4) and its enantiomer dexketoprofen,-4) and (S)-(+) enantiomer its ), trypsin (2.5%), Eagle’s Minimum Essential Medium Minimum (2.5%), Eagle’s (MEM),), trypsin etoprofen, 2- – 8) intriplicate. All measurements were performed the using (MTT), 20/50 20/50 incubation and comparedincubation toanaqueous control. The a fulltest was performed with

1 -chloro-2,4 (3 -Benzoylphenyl) propionic acid No. -Benzoylphenyl) propionic (CAS -ketoprofen (CAS No. 22161-81 -ketoprofen (CASNo. -dinitrobenzene dilution and light their dilution a (CDNB), the ISO proceduresthe dilution seriesdilution (from -5) were – - This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved order Rac-KP andDKP toassesseffects. lethal andrangingconcentrations 1560 DKP ofrac-KP from increased Assaysthe numbercontrolcellsaftervalid of were when considered 96 hof incubation. inhibition dichromateof growth was (cells/mL) asThe wasthe endpoint reference toxicant. used to concentration (LOEC NOEC), and (EC andgrowth 50% inhibition of (Olympus CH-2). counted with a Bürker Chamber Cell Counting (HBG, for 96h growncool atlight under white fluorescent 20±2°C of7000lu continuous were25 in inoculated Late NitrogenBasal 3-fold modified). (BoldVitamins; and logarithmic phase Mediumwith algae MarineLtd). Research Science/SAMS Services the reference(Culture center CCAP procedures [26 (P. inibithion Growth subcapitata) determinations. Phenolwas usedastoxicant. thereference EC acquisition,Omni 1.16software,data handling for and EC Acute andchronic(C. assays dubia)

2000 µg/L).rac- Experiments on Accepted Preprint50

values are as meansand expressed The inhibition of growth was evaluated according to the protocol described in ISO ofgrowthThe describedin was inhibition to the protocol evaluated according For the toxicityassay,acute of incubation. Thegrowth cellsof incubation. algalcells/mLnumber andwer measured asof was by

at least ] with slight modifications. For the determination the For of theeffective concentration causing 20% 5%, 10%, 16

mL fresh medium to an initial concentration of 10000 mL concentration freshtoaninitial medium of 10000 -fold -fold over 96 h. over 96 h. 5/10/20/50

a full test was performeda (from fulltest 1.95µg/L was dilutions by serial KP C. dubia C. Collection of Algae and Protozoa-Scottish Association forCollection of Algae and Protozoa-Scottish

and confidence limits (95 %)replicateconfidence of (95 three limits ) and P. subcapitata DKP

(neonates < 24 h old) were exposed to high were to 24 hold) exposed (neonates < the lowest- stock solutions of 100 of g/Lwerestock solutions preparedin P. subcapitata P.

were intriplicate. Potassium performed Germany), using an opticalGermany), using anmicroscope µg/L to100000

strain CCAP 278/4strain CCAP was purchased from 50 and effect noeffect-observed

calculation (Least Square Method).

was in3N-BBM+V cultured

µg/L µg/L x with slow shaking withslow x cells/mLwere and in 48 h static tests, tests, in 48hstatic

e in This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved measured method.Samples werean enantioselective via detection HPLC-UV filteredand experimental media solutions Analytical chemistry of survivingcontrol produced females characterized as mg/L CaCO by alkalinity120-138 thendiscardedeverymedia were and renewed.Neonates the solutions were day. Test before The start ineach number ofthe the test. ofneonates was and beaker counted recorded All testsuspension. solutionsprepared werestarting thestock daily renewed solutions from yeastassignedeach Organisms dailya werewith fed to treatment. and once 5.7 µg/L) [1]. concentrations were similar of rac-KPat andDKP different concentrations 2002aEPA [27 dichromate wasPotassium usedas The testwas referenceinaccording toxicant. performed toUS in theexceed control group(German 10%. numbernot The ofdead organisms did Company). LeicaAfterthe immobilization/mortality evaluated 48h,we M80 a using stereo-microscope DKP), replicatesexperimentaleach groupscontaining(rac-KP and were assigned ten organisms tothe LSDItaly)obtained (Pregnana from Ecotox Milanese, asThree(ephippia). dormant eggs acetonein cultureand mediumto thendiluted neonates per surviving female. The test was performed in according to US EPA 2002b inaccording2002b EPA neonates surviving female. per The toUS testwas performed 8.22

AcceptedAt-10.13, atsurvived, least and and 25°C. 80%of 60% pH7.52-8.60 all control organisms Preprint the control group (culture medium) and the solvent(acetone:group control the control(culturegroup medium)and the Concentrationsrac- of For the Ten replicatesglass withone 30mLof organism ina per beaker 100mLwere chronic toxicity assay,broodchronic toxicity third ]. ]. to concentrationsto environment detectedinthe from (ranging 0.41to KP forEnantiomers (algae thechronicassays and crustacean).

(R(-)/S( at least broods, an three with average of15 ormore +) - KP obtain the concentrations tested. obtain theconcentrations tested. ranging from 1 to 1000 µg/L. The lowest µg/L. fromranging 1000 1to ) and DKP ) and DKP neonates (< 24hold)wereneonates for exposed 7days 3 , hardness 150-184as mg/L CaCO (S(+)- KP ) were measured in were measured ) P. subcapitata Organisms were 0.1% v:v). 3 [28 , DO were ]. ].

algal This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Acceptedμg/L). Plates we which were incultureat concentrations dissolved medium different 10, 100and 1000 (0.1,1, in 96-well plate and toattach24h. allowed for wereat 30000 rate seeded of diphenyltetrazolium bromide) toformazan aswas cell a used measure viability of assay viability Cell were at confluency. 75%monolayer used (PBS)(EDTA) and(0.53 3 mM)inphosphate-buffered diluted solution saline every 3 a 5% CO supplemented bovineserum with5%fetal U/mL) (FBS) 1% (5000 and penicillin-streptomycin in Theygrownwere at inEagle’s routinelyEssential 30°C Medium(MEM) Minimum Preprint2406), isderivedthehepatocellular from of carcinoma theTopminnow cell-linePLHC-1 ratio 3:1,was 0.05µg/L. calculatedisopropyl asnoise % limit, offormicacid.signal-to detection alcohol 0.1 The with processing. A 20 USA). The columnwas wasatroomTurbochrome® temperature. usedfor kept data software Lux®phase Amylosea column was coupled toadetector, Series variableUV Thewas 254nm. 200PerkinElmer normal- which setat with achromatographicSeriesgradienta system200PerkinElmer thatconsisted ofPump (Strata™extracted with SPE – Mitochondrial capacity reduce (3-(4,5-dimethylthiazol-2 to MTT The PLHC-1cell from Type line, obtained the American (ATTC CRL Culture Collection 4 d 2

humidified atmosphere. The cells were grown in 75 humidified atmosphere. growncells in75 The were ays after harvesting andtetraaceticays withtrypsin (0.05%) ethylenediamine acid reand for incubated 72h. 48 μL injection was The phase inhexane usedeachmobile injection μL time. consisted -XL 100 µm Polymeric Reversed Phase) followed byanalysis-XL HPLC PolymericReversed 100µm followed Phase) or 50000 cells per well (dependingor 50000 cellswell of per ontheduration exposure - 1, LC 250x (5μm, 1, Column The experiments were The intriplicates. performed Cells were then exposed to rac-KP andDKP, wereCells to exposed then cm

4.60 mm) (Phenomenex, CA, 2

culture flasksculture and Poeciliopsis lucida Poeciliopsis -yl)-2,5- – 4 times. Cells Cells 4 times. [3 0 ]. Cells Cells ]. subcultured -

[29]. [29].

) This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved x centrifugationwere frozen were three and collectedafter then thawed Celllysates times. Tris were intriplicates. performed differentconcentrations (0.1,1,10, 100and ofthe andDKP 1000µg/L). rac-KP 300000 or plate ina 6-well well 500000cellsexposed for per and (1974)spectrophotometric described [3 et by Habig al. assay with 7-hydroxyresorufin. The activitiesas were expressed albumin (BSA)of the Quantificationwas asthe activity standard. made wasTotalwith the methodof amountofprotein determinedBradford, bovineserum using 535nm; em: 590nm)[3 fluorescence inamicroplatereaderfor (ex: 20min measured was started thesubstrate by adding ethoxyresorufin 1μLDMSO) and(180 in (EROD)μM of 100 After wasperformedand removed themedium exposure, intriplicates. andDKPconcentrations ofthe rac-KP inablackexposed fluorometric biotransformation activity. responses Phase Iand II biotransformation viabilitygiven wasrelative survival as formazan crystals, platereada wasspectrophotometric andthe plate at inreader Cell 570nm. medium. The MTT After0.5 mg/mL weregrowth incomplete exposure,incubated cells dissolved 4h with for MTT g for atGSTassay 30min 4°C. reaction KH 100mM contained µL (dissolved inPBS) of0.3NADPH mM

Acceptedbuffer Preprint Glutathione-S-transferaseon cell (GST)followingthe lysates activity was measured Ethoxyresorufin-O-deethylase(EROD)activityI usedas phase was for markers pH 7.4, 100 mM NaCl, 1 mM EDTA mM NaCl, 1 mM 7.4, 100 pH solution wassolution thenreplacedwith200μL the dissolve insoluble DMSOto Cells were seeded at the rate of 30000 or 50000 cells per well cells wereCells rate30000 seededper or at well 50000 of the Afterexposure, 9 6 -well (0.1, 1, 10, 100 and 1000µg/L).(0.1, 1, 10, (% viability) plate for 72 and forplate72

cells were cells and resuspended harvested in for at The 10minutes 37°C. reaction was then 1x PIC1x (proteasecocktail). Samples inhibitor of exposed cells compared to control cells. exposed cells comparedof tocontrol 48 a h percentage of the control. the control. percentage of 2

respectively, ].

Cells wereCells seededat the rate of 2 72 and 48 hrespectively,and 48 to 72 PO 4

pH GSH,1 6.5,1mM cells cells

using a calibrationa using curve The experiments wereThe

to various were in incubated The experiments The 20 m at 10000 and 1 ]. ]. M This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Accepted(Ct) values obtainedconverted mRNAcopy were versus into plotsofCt using standard number templatedetermineof target was included thespecificity to amplification. cDNA fluorescence increasing between with temperature detection 65 s) (30 65°C followed byfor aanalysisat 95°C melting 1min, (10 min)and 40cyclesgene of95°C(30s), depending s),and 60°C (15s), (15 72°C ontarget CA,USA).real-timeprogram includedJolla, an The PCR step enzyme at 3step activation 95°C mrp2 analysis(qRT-PCR) Quantitative real-time PCR atand at 30min 42°C, 5min 25°C, 85°C. inthethe reaction at mixture under5min followingconditions: Thermal (Biothe Rad), Cycler described The was by themanufacturer transcription (Bio-Rad). reverse by conducted incubating from samplestreated Synthesis usingprimers iScriptcDNA all as totalRNApoly-T Kit from Preprint260/280 ratio. reactions TotalcDNAfor thePCR generate real-time were was(NanoDrop assessed DE,USA)Technologies, Wilmington, andby thequality RNA of USA). UV Theusing ND-1000 quantified RNA was NanoDrop® cells (Zymo were kit isolatedusingDirect-zol RNAMiniPrepisolation Irvine, Research, CA, and 1000µg/L). experimen The DKP (0.1, 1,10,100 plate and forrespectively, 72andtodifferent 48h concentrations ofrac-KP andcDNARNA isolation synthesis calculatedextinction coefficient usingthe of 9.6mM conjugation of glutathione toCDNB mM CDNBoftotalcell and dissolved (1-chloro-2,4-dinitrobenzene) lysate. inDMSO 20µLThe , asshown Quantitative (real-time) PCR was performed gene-specific(cyp1QuantitativePCR (real-time) primers with wereCells cellsrate seeded perand 300000 atina24-well well exposed of the 150000or

Table 1) using the Mx3000P REAL-TIME1) using (Stratagene,Table SYSTEM the LaMx3000P PCR ts were performed in triplicates. intriplicates. ts were performed was measured at The 340nm. specific measured activitywas was -1 cm -1 . – and thereafterdecreasing 95 °C. Controls lacking Controls 95 °C. cDNA Afterexposur – vis Spectrophotometer d from 0.1μgd from DNase e RNAsfrom total

Cycle threshold a, mrp1 and mrp1 - This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Acceptedof bacteria (datanotshown). expressed as (relative RBUbioluminescence at was 490nm), units bioluminescence of Inhibition onV.fischeri RESULTS dependency. Pearson’s was performed correlation onall test betweenand control, related time treated aswellamong concentration. as The at time the same ANOVA followed was byTukey exposure (48 using time-effect possible fordose-effect time thebiomarkerendpoints and relationships using Comparison Multiple Test.Two theDunnett’s crustaceans differences evaluate statistical to ( Preprintand variance performed was ANOVA experiment chronic for homogeneity.with the One-way Inc.GraphPad 6.01(GraphPad version Data Prism, tested Software 2012).were for normality calculated analysesStatistical method. wereusing byinterpolation performed thelinear Analysis Statistical control. obtained from forthe triplicateas were runs cDNA targetamplification percentageexpressed of containingplasmid of interest, theamplicon following standard were curve.plots generated Standard each for amounts of target sequence known using samplestothe efficiency samples and toextrapolating checked withunknown prior unknown logwas amplification onequal criterionbased Thefor curve copy thestandard using number. In our preliminary analysis with rac-KP weIn observed preliminarywith andDKP, thatbioluminescence,analysis our EC 5/10/20/50 h and 72 values of growth for algal inhibition were their 95% confidence and limits

h) and rac-KP andDKPh) concentrations as The with the reference performed assay (phenol) toxicant confirmed post-hoc

test to evaluate differences( test tosignificant p

the measuredthe variablestoinvestigate dose- < 0.05) between control and exposure0.05) groups between < control and -way performed ANOVA was toinvestigate an already method[3 an validated variables not detectable inthe absence . The Two-way p

< 0.05) 3 ]. Data ]. This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved re exposure. the range theobtained assay. data ofthe However, Table in the DKPacceptability isshown The5. data tobe experimental control isshown within acute on (mortality/immobilization) toxicity an EC Acute andchronic effects toxicity dubia C. on and S2 percentages pharmaceutical compounds S(+) fraction of rac- rac-KP.The EC EC onP.subcapitata inhibition Growth 1046 µg/Lconfidence (C.L.): (95 %- limit 373 and above, detectedatrac-KP contrary, of the concentration. highest DKP500µg/L Onthe concentration concentrationbetween presence of sensitivity ofacceptabilitymg/L) thelimit within with (13-26 spectively. The effect of 7-dayspectively.effect chronic toxicityThe of on 5/10/20/50 50 Acceptedabsence of Preprint

value of 0.4 mg/L within the limit ofacceptabilityvalue of thelimit within 0.4mg/L (0.18 50 ) The showing dichromate) anThe withthe reference algal tested (potassium strain was toxicant . value of 1.1

The maximum The40 mortality maximum percentage observed was

values an are EC exhibited summarizedinTable DKP 3. inhibited inhibited crustaceans werecrustaceans V. fischeri, (%) (%) reported a dose-response trend. Thus, no EC values have trend. Thus,noEC dose-response for each exposu eachfor KP

mg/L(0. ofacceptability thelimit within bioluminescence andbioluminescence therefore theEC in 3.9 - 3.9

we did not observe acute toxicity after 15 min incubation at rac-KP observe not at did we toxicity acute after15minincubation hi is shown inFigureis shown 1. bition (%)bition ofgrowth in in algalare inTablemean presented 4.The media 2000 µg/LHowever, a 2). (Table effect (I% hormeticwas = 17.9) tested with thereference dichromate)tested (potassium showing toxicant re condition were99. C. dubiaC.

Measured concentrations of individual concentrationsMeasured ofindividual were unsuitable for the regression modelduewere to unsuitable regression for the 2935 µg/L, Table2935 2). P. subcapitata C. dubia C. 1 exposed toserialexposed rac-KP dilutions of and

± 4.6% 50 value of DKP was calculated tobe -1.8 mg/L). The NOEC, LOECThe NOEC,-1.8 mg/L).and 18 exposed toenvironmentalexposed relevant an EC been calculated intheacute calculated been -

-1.8 mg/L). -1.8 mg/L). (Supplemental data, Table(Supplemental S1 by and 60 % for rac-KP% andDKP,for and 60

plotting rac-KP, DKPandthe plotting rac-KP, 50 50 value of3.7-foldthan lower

value of 18.4mg/L. The effect48 h of

recovery In the

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Interestingly,(Fig.no 10, 100and 1000µg/L 2B). rac-KP cyp1a levels, 48 hat 1000µg/L, 72h andfor dependent increase Effectsbiotransformationin PLHC-1 on responses viability µg/L. at 10,100and1000 ~65% ofviability observed. was for 48hproduced survival high all ratesthetested at1000µg/L, concentrations, at except where S4) percentages ea for pharmaceutical incrustaceanare presented compound media mean 8.The inTable in Table 6and 7. 1000 µg/L for DKP. in KP andDKP,dramatic themost a effectobserved onfecundity, significant decrease showing was and 40%rate mortalityrac- observedforand was 1000µg/L, DKP at 100 respectively. both For concentrationµg/L,rac-KPmortality atthehighest of whilea 1000 tested for ratewas 20- 20% the acceptability within 6 Table andconcentrations in DKP isshown ofrac-KP KP exposed cellswasKP exposed significantly decreased, functional The (Fig. (ERODcyp1a activity) 2). levels Effects cellPLHC-1 on line

the number of offspring/female of . Accepted Preprint TheI phase response measured and was at biotransformation (mRNA) transcript MTT cell viabilityshowed assay thatcells toserial exposed dilutions

compared to control cells (Fig. 2A). On the other hand, the EROD activity of rac- On theactivityof control other(Fig. EROD cells hand,compared 2A). the to

For the chronic theFor assay, toxicity ch exposure condition were 98.6 ±10.6 ch exposure condition were 98.6 at 48 h (Pearson r at 48 The percentage of reproduction inhibition relative percentage Thereproduction inhibition of

range of the assay. After 7-day exposure time period, thecumulative period, assay. exposure time range ofthe 7-day After at 10, 100 and 1000 µg/L at10, 100and 1000 Cells exposed for 72 h to rac-KP and DKP exhibited rac-KPto andDKP 72h for exposed Cells C. dubia C. =0.93; R

compared to control cells after compared tocontrol cells exposed to 1000 µg/L (rac-KP) and at 100- to1000µg/Lexposed (rac-KP) 2 =0.86;

the measured concentrations ofindividual measured concentrations the

transcript arac-KPshowed concentration- p

and <0.05). Exposure of cells to rac-KP cells<0.05). for to of Exposure

resulted insignificantly increased % significant changes in EROD activityEROD significantin changes 7

(Supplemental data,(Supplemental Table S3a , respectively to the controlis reported . Control valuesControl are of rac-KP andDKP 48 h exposureto 48 h

recovery ~70% cell and nd p This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved wereevaluated(Fig. Themrp mRNAabundance 4). for Effectson exposures showed significant activity decreaseinGST DKP producedµg/Lexposure to produced adecrease (Fig.Interestingly, significant 72h 3B). significanth exposure to100µg/L, atwhilethe increase 48highest testedconcentration of 1000 R (Fig. 3A).At groupscontrol were andexcept treated asignificant observed, decrease observed at 0.1µg/L in alltested concentrations at 48 produced(Fig.rac-KP 3).Exposure to DKP activity (Fig.II 2D).usedas GST was phase The a measure biotransformationresponse of µg/LEROD activityin to were (Fig. and observed after48h changes exposure 2D) nosignificant significantly controltoDKPfor decreased exposed level,72hto10,100and1000 below cells in cyp1a 72h( mRNAat 48hand exposure (Fig. Furthermore, 2C). DKP, for significant of cyp1a increase between However,both 48and72h(Fig.µg/L,µg/L at DKP atproduced 0.1-100 2C). 1000 belowmRNA expression, controlcells level, when were toconcentrations wasexposed observed rac-KP concentrations differentcyp1a rac-KP2B). exposurewere to after (Fig. h observed 72

2 < 0.05,respectively). Accepted=0.98; Preprint Changes in p Multidrug resistant protein resistant Multidrug

< 0.05). 48 h mRNA levels and EROD activities between 48 and 72 h exposure exposure between andERODmRNA levels activities 72h 48 ,

significant time differences in GST activity. differences activity. significanttime inGST the increase in GST activity was concentration-dependent ( activity the increaseinGST was transcript level of the multidrug resistant protein 1 and 2 (mrp1 and 1and of the 2(mrp1 multidrug level transcript protein resistant On the other hand, GST activity in DKP-treated PLHC-1cellsaOn the other GST activityshowed hand,inDKP-treated (10, 100and 1000µg/L(10, ).

The functional activityThe responsemeasured as CYP1A EROD was mRNA expression, abovemRNA expression, 48and control 72hof level, atboth Pearson r h, whileafter h 72 at alltested concentrations (Fig. 3B). a significant increase in GST activity above increaseGST activity control in levels, significant =0.97; R

a concentration-dependent For DKP, 2 =0.95; exposure nodifferences inactivity between Additionally, cells showed significantly cellsshowed Additionally, exhibited time- exhibited p a

< 0.05and significant decrease of cyp1a decrease of significant trend was observed fortrend Pearson r Pearson and concentration- R ac Pearson r -KP andDKP =0.98, R to

the same mrp2 =0.99; 2 =0.96; ) a a This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved bioluminescence using bacteria,or chronically exposed algaeNSAIDsand crustaceansthese to other hand, between circumstances, and species, insome conversion of R( two enantiomers in occur differentactivity biological [3 compound often may same have and physical abiotic degradation the have they properties rates, (PLHC-1). Although through approach bioassay DISCUSSION  significant at 0.1 respectively ( exposure toDKP was dependencymrp2 mRNA expression andin mrp1 On the µgincreasedrac-KP/L other (Fig. hand after 72h to1000 4B). mrp2 was mRNAexpression rac-KP 100µg/L The with significantlyand (Fig.4A). at10,100 72 hincellsat treatedspecific increased 48and ofmrp1weresignificantly levels changes. The Ecotoxicological assessment Ecotoxicological assessment Accepted Preprintg/Land observed nochanges were -

We have evaluated the acute and chronic effects of rac-KP haveWe anditsenantiomer and evaluated thechroniceffectsDKP acute of In order 100

increase increase the  ). Particularly, g/L for 48 h (Fig.g/L 48h 4C for conversion ofS(+) conversion to define the ecotoxicological hazard assessment of rac-KP and DKP, rac-KPecotoxicological andDKP, hazard assessment of the to define - ) - Pearson r KP to S(+) KP to in the racemic mixture and corresponding enantiomers aracemic particular of corresponding and mixture the mrp V. fischeri V. mammals 1 mRNAafterexposure tothe highest of 1000 DKPconcentration es a =0.99; R significant decrease wascells observedwhen decrease were significant with DKP treated

with freshwaterwith organisms and model 4 - KP occurs in many species, inmany KP occurs ].

Differencesand pharmacodynamics inpharmacokinetics ofthe

- test producedtest and KP to R( KP to

and sign in 2 =0

mrp D, respectively). .98; 2 -

ificantly vary among varyificantly [ species ) mRNA levels mRNA p between - KP, KP,

< 0.05and

a hormetica effect tested atthehighest has

individual observed in PLHC-1 cells observedin PLHC-1 only

While atWhile 72 Pearson r

but the (Fig. 4C been been s demonstrated inmicedemonstrated [3

within awithin species [ rate

=0.99; R =0.99; and h exposure, , a of conversion varies . Inhibition ofInhibition .

D, respectively).D, ﬁ concentration- sh hepatocytesh model 35 2 ] =0.99; . Additionally therewas a af ter 48h 35 p ]. we ra

< 0.05

On the c-KP c-KP

6 acutely

]. ,

, This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved chlorophyllor numbercells/volume unit fluorescence of methods for evaluatingendpoint, suchelectronic density, as parti the optical growththe photo conditions, may revea have to rac reported [4 49.3mg/L few studies intheliterature reportingexposure of the for there boththe pharmaceuticals. While are noecotoxicologicalusing studies DKP, thereare calculated EC was (EC more toDKP sensitive pr lower than theEC in their study.I any ho However, knowledge,available thereare noreport Thereare a only showed toDKP exposed may a have beneficial harmful, or low concentrations oftoxicchemicals [37 is aphenomenonconcentration. that Hormesisdefineda is stimulatory aseffect beneficial atvery reported EC different Accepted oducegrowththe algal effectsonusing Preprint - KP that is 16.7 KP that is r We have We metic effect after exposure to metic effect after a recent study showed anrecent EC study 10 nterestingly, severely with DKPan inourstudy, was EC toxic

led lower EC lower led value both for also evaluated whetheralso evaluated few 50

value reported by Wieczerza studies on studies - 50 1 fold lower than reportedfold thelowest inliterature. Specifically, value our test

,4 values an inhibition of bioluminescence of an inhibition 2 ] . O - 50 degradation compounds, of testduration thetested and different , ur study showedEC an

rac value comparedthose reported to algal inthe literature, due tothe with the lowest repor

50 exposure to =65.6 µg/L) compared to - indifferent effect in biota [38 biota effect in indifferent KP and DKP were tothe observed comparable KP and rac 50 s chronic exposure (96h) toeitherchronic exposure -

KP of t ]. P. subcapitata hat

However, at higher concentrations this phenomenonHowever,this atconcentrations higher rac 118 , which , which have have - KP using KP

mg/L k

an used DKP inecotoxicological ted is likely concentration tothe high due d colleaguesusing (2016) 50 P. subcapitata

for value in 4 mg/L [4

[43 as model organism, showing thatalgae V. fischeri rac with anEC rac ] . -

KP - Overall KP (EC ]. On the contrary,]. P. subcapitata

[ 0 39 ] to24.6mg/L] and thehighest

to and onour based ] , thealgae testdata suggest 50 . The authors report didnot 50 rac value of1046 µg/L. =240.2 µg/L). The rac - KP cle counter, - 50 KP or DKP w KP .

exposed forexposed 96h T rac value 100 hese studies NOEC values NOEC assays V. fischeri - KP [ 39 . – s ]. fold

ould used

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved racemate. F relation. The highest sensitiv observedexposure torac after DKP than than 1mg/L. concentrations ofthesewe testconcentrations didnot compounds, ofrac concentration. Since thetopicof thestudywas toinvestigate relevant environmental rac of 22.6 mg/L [4 mortality study of40%. Aprevious in performed. dubia C. at pH7.5 cladoceransimilar ( species acute toxicitynot exhibit on or [1 concentrations orders are ofconcentrations than magnitude several lower the represent a for both study. inthis on thealgal species tested that these pharmaceuticals mayat effects producers, notproducesignificant primary on igure 1 ] . - KP (≤1000 µg/L), we observed a 24.9 % inhibition in reproduction observedKP (≤1000µg/L),in % inhibition we aat 24.9the highest Accepted PreprintThis inaccordance is withprevious studiesshowing that Subsequently, , rac

suggest a enantioselective possible suggest partially toxicity, due tothe S(+) [44

to negligible - KP and DKP at 100 KP andDKP

rac ] D . Finally,a ata ata 1 - KP. ]. Interestingly, ]. tested significantly which inourstudy, lower of concentrations on bioassays exposed to10 exposed Despite Despite

acute assaysacute using environment environment

chronic lowrac(7 d) assay using D. magna ity that - g KP andDKP

anisms when tested atanisms when 1mg tested of DKP compared to rac compared of DKP showed that mg the 00 µg DKP/L showed a 45.4% of reproduction inhibition with with inhibition 00 µg reproduction a DKP/L showed 45.4% of and biota /L. Thus,theacute risk posed by ) reported a) reported comparable EC racemic C. dubia C. C. dubia C. in bacteria and algae V. fischeri, effect mixture rac tested ractested (48 h) revealed(48 h) thehighest onmortality effect , since the reported environment

P. subcapitata - - KP (containing 50% DKP) observedKP (containing in 50% - KP fecundity found a and NOEC value - KP KP andDKPalso concentrations was /L [ rac containing 24 - 50 KP, diclofenacand atenolol did ] did n .

value (>100mg/L) rac for Moreover, rac

ot were - -

KP and DKP mayKP parallel KP andDKP higher 50%

more to sensitive used in -

enantiomer inthe DKP, theeffects a study

this this al this ratio

using using least

study not

- KP functional example, levels. whilea For concentration responses, signallingmodifications)the P450functionpathways. involvingor AhR toxicandpossible regulatory translational and (transcriptional, post-translational mechanisms andDKPbetter observedconsider must effects understanding thefull our range of ofrac-KP of This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved physiol exogenous interactions between (including substances drugs), foreignchemicals and given inmind, this that biotransformation the CYP system endogenous both metabolizes and these play compounds may not in significant roles [48 effect onERODat activity ofNSAIDs 1μM liver incarp subcellular fractions (3 regulationCYP1A by NSAID response. There a This couldsuggest theCYP mechanism thatnormalize apossible ateffects the mRNAlevels,E theon whichconsequently is important from and drugsxenobiotics their alterations and markedlyaffectsthe findings absence of Toxicological responses return level. tothe normal - MC) inducedin ratactivityMC) has liver reported [4 ERODbeen ]

Accepted. Due tothe high solubility ofboth Preprint o Biotransformation play enzymes theactivation of and roles integral in deactivation T gical processesare[ possible are consistent with previous report andare consistent with by Thibaut he c rac significant including atalltested effects concentrations, ytotoxicity rac of - KP and DKP producedtranscriptionaleffectsDKP differentialthe CYP1AatKP andon is no available information onnon no available Interestingly, a notexhibit cellssimilar toDKPdid exposed s - . KP KP However and ROD activity levelsROD were activity either orindifferent. decreased 49

a DKP w rac ]. Thus,the]. toxicological and pharmacological standpoint andpharmacological standpoint toxicological , theability of - KP and DKP, it could DKP, it bereasonablyKP and that inferred as

assessed in PLHCassessed phase Ithe phase bi - target about the mechanisms organisms of relationships between inductionof -

and time rac - Porte [4 KP to decrease 3 decrease KP to - ir 7 dependent increase wasdependent increase observed otransformation pathway.otransformation With

]. - potential risksand benefits, dependent function

Elsewhere, - 1000 µg/L (~ Our 4µM). 5 1 cells ] .

For toxicologicalFor

by MTT - methylcolanthrene

no was observed

signi , showing , indicating [4 ficant 6]. A the This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved and while cells toDKPshowedmrp1 exposed different body [5 systems- modifyglutathionemediated proteintransport conjugatesand by ATP-dependent sulphateand is solubility affectsrapidglucuronide excretion of the [5 metabolite with orwithout conjugation [5 be eliminated as (probablyrac-KP,glucuronide), freeas eitherconjugated a poorlyrac-KPour tested is In mammals,can pharmaceuticals hasbeen understood. it shownthat IIAlthoughenzymes arecrucial phase eliminating in theinteraction between NSAIDs, and GST decreasedexcept at48hwith100 activity, GST rac-KPconjugation withGSH.Onthe metabolites significantly of rac-KP contrary, orDKP that [5 of drugsimportancecompoundsendogenous and and subsequent inthe conjugation elimination large The by molecules. endogenous endogenous production ofmajor GSTis large molecules metabolism andexcretion of investigations tobetter involvement areunderstand needed possible oftheCYPsystem the in rac-KP leadingexcretion.metabolize DKP, subsequent totheir and effects,adaptivebioavailability may optimal sinceCYP1A control functional for ofdrug rac-KPmay andDKPEROD producedreduction activity an inCYP1A-mediated represent biotransformation enzymesandalteration of possible drugmore efficacy deserve attention. The 0 ]. Herein,]. orDKP, showing GSTactivityafterexposure werac-KP toeither measured levels

Accepted Preprint rac-KP for producedelevated GSTexposed activity48 cells in Protein transportersa compounds fundamentalrole from have ineliminating the toxic 4 GST is anIIGST is important phase enzyme thatuses ]. In increase resulteda in significant ofMRP1, rac-KP ]. study, thepresentexposure to namely P-glycoprotein or MRPs [5 namely orMRPs P-glycoprotein rac-KP and DKP. rac-KP andDKP. 1 ]. In this regard, the high degree of ionization andIn of ionization regard,]. the this degree high 2 ,

53  g/L,effects. time-specific suggesting possible ].

1 the products of phase I products form to the ofphase reactions ]. Thistransformation]. also to is known mrp2 mRNAs expression levels, mRNAs expression h, suggesting a possible Ultimately, further

or as hydroxyl (OH) This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved fis differentmodel organisms effectson and toxicity different mechanism response in toxicological it by rac-KP pump interacted levels,expression with the efflux increasing while the increaseGST activityand treated decrease incellsin In addition, through within mechanism different cytotoxic cells. effects Nevertheless PLHC-1 in DKP commonlypharmaceuticals are that approach at transcriptionalbioassays offunctional studies keywith systemsand levels. detoxification CONCLUSIONS pharmacological processes behind these effects. rac-KP andDKP,suchtounderstand theserequirefurther andasstudies,inorder findings the bymRNA to theofMRP best infishshowing ofour knowledge, thefirstan is increase study this on theregulation proteins, at ofthese level which are the normallyprotein [56 regulated hasexpression been inseveral fishspecies demonstrated [55 Althoughperiod ofonly and MRP time eliminatedhighest at could be the concentration. III process. biotransformation asunconjugated, rac-KP excreted ispossible is DKP. Thus,it shorterrac-KP, that cellularof retention compared to comparedrac- to , except atthehighest concentration. andDKP have results These suggest tested thatrac-KP Acceptedh cell model. Preprint

showed This presentThis study provides a better overview and understanding on a overviewand better understanding provides the phase II biotransformation pathway showed different responses responses biotransformationpathwaythe phaseII differentshowed higher toxicity than KP conjugated byenzyme, conjugated GST .

The effects of rac-KP on mrp1 and effectsThe rac-KPmrp1 ofon ha s s

demonstrated On

those exposed to to exposed those DKP couldthecell hand,a remain forthe other longer within detected in the environment. Bacteriadetectedthe in environment.and al the cells. Both NSAIDs differently interacted withCYP1A.

the importance chronic ofcombiningacuteand

or as glucuronide, as or ,

rac-KP and DKP were observed to possibly actpossiblyDKP were rac-KP observed to and rac-KP. These with with mrp2 levelsexpression couldsuggesta rac-KP and DKP, respectively.Lastly,rac-KP andDKP, the toxicological propertiesthe toxicological of ], only], reports are available limited priordeliveryfor to NSAIDs did not exert exert did not NSAIDs with significant ga DKPreduced e exposed to to exposed e the phase ]. Thus, ]. This This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Accepted PreprintData Availability exposure, sampling and analysesand Å Acknowledgment 10.1002/etc.xxxx. Supplemental Data — — — We would like tothankR like would We Data are available on request to E. Mennillo ([email protected]). DataMennillo ([email protected]). E. are availableonrequest to The Supplemental DataThe areLibrary availableonthe Wiley Online at DOI: .

Krøkje for Krøkje .

Røsbak for technical during her assistance

PHLC - 1 cell line. 1

11. 10. 8. 6. 4. 3. 1. 9. 7. 5. 2.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved and duodenum. 20:3 32:3245 Ternes rivers. T.1998.Occurrence ofdrugs sewage inGerman treatment plants and agents change? ofsubtle 1999. Daughton Ternes CG, TA. Toxicol FentAA, D.2006. K,Weston Caminada REFERENCES Pharmacokinet AntonijoanI.Barbanoj Gich RM, MJ, dexketoprofen. 2001.Clinical pharmacokinetics of naproxen, and acetylsalicylic acid. Cleuvers M.2004.Mixture the toxicity diclofenac, anti-inflammatory drugs of ibuprofen, 1999.EpidemiologyLangman MJS. ofnon-steroidal BottingVane 1998.Mechanism JR, RM. of ofaction antiinflammatory drugs. inflammatory drugs. byBray theeffect GordonProstaglandinand macrophages D.1978. production ofanti- MA, to Green Chemistry. 2007. HumanKhetan TJ. Pharmaceuticals SK,Collins theAquatic AChallenge in Environment: Hazard Mater Ecotoxicological aspectsrelated toth LHMLM,Santos AN, FachiniDelerue A,Pena Araújo A, Report prepared Executive Agency for Health and Consumers. for IntelligenceBIO Service

Accepted– Preprint 15. 76:122 – 3260.

175:45 - 40(4):245 159. Ital J Gastroenterol HepatolItal J Gastroenterol

Chem Chem Br - 95.

J PharmacolJ . Environ –

2013. Study ofmedicinalproducts, environmentalrisks Final onthe 62. Rev

107(6):2319 Pharmaceuticals andPharmaceuticals care theenvironment: personal in products Health Perspect Ecotoxicol Environ Saf Ecotoxicol Environ

e presence of pharmaceuticalse presenceof theaquatic envir in 63(4):635-642. 63(4):635-642. Ecotoxicology of humanpharmaceuticals.Ecotoxicology of -2364. -2364.

31(S1):2 107:907 anti-inflammatory drug damage tostomach – 5.

Matos C, Montenegro MCBSM. Montenegro Matos C, – 59:309-315. 938.

Int J Tissue Water Res Aquat onment. Clin Clin

2010. React

21. 20. 19. 14. 13. 12. 18. 17. 16. 15.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved chiral chromatography liquid inflammatoryfish based infreshwater withasupramolecular drugs and onmicroextraction liquid MD,RubioCaballo Sicilia 2015. C, S. for acute postoperative adults. in pain DerryBarden Moore 2008.Single J, McQuayRA. HJ, S, dose ketoprofen and oral dexketoprofen steroidal anti-inflammatory drugs. andEvans pharmacokineticsAM. Enantioselective 1992.of pharmacodynamics chiral non- Acceptedsamples. cytochrome potentialand estrogenic activity andenvironmental induction of chemicals P4501A FentFish cell inecotoxicology: lines K.2001.astools versatile ofcytotoxicity, Assessment Japanese latipes) medaka(Oryzias using real LeeHong KS, Kim HN,Park Gu SK, HN, MB. 2007. bivalve Dreissena polymorpha M,BinelliParolini A.2011b. A,Provini polymorpha). nonsteroidal anti M,BinelliParolini A.2011a. A,Provini studyHydra withthe cnidarian vulgaris. Pascoe Muller 2003. D,KarntanutCT. W, Preprintcombination effects. Cleuvers ecotoxicity M.2003.Aquatic of pharmaceuticals of includingassessment the RevNat DrugDiscov chiralAgranat 2002.PuttingI, theof strategy switches. J. H,chirality Caner Caldwell towork: Toxicol In Vitro Water Pollut Soil Air - inflammatory (NSAID) diclofenacon drug Toxicol Lett

1:753-768.

15:477 - tandem mass spectrometry.tandem . Ecotoxicol Environ Saf . EcotoxicolEnviron –

142, 185 488. Eur J Clin PharmacolEur J Clin

21 The Cochrane Library.

7: Enantioselective analysis of non

589 Chemosphere Assessment ofthepotential cyto Chronic effects induced byonthefreshwater ibuprofen – Do pharmaceutic 194. – - 601. time PCR. PCR. time

Analysis diclofenac effects ofthe on has

51:521 74(6): Chemosphere

42:237-256. 42:237-256. Anal Bioanal Chem Anal Bioanal als affect freshwater invertebrates? A als affect freshwaterinvertebrates? the zebra mussel (Dreissenathe zebra mussel Issue 4. 1586 – 528. –

1594.

67:2115 - ster –

genotoxicity ofthe oidal anti

407:4721 – 2121. -

- 4731.

29. 25. 24. 23. 22. 30. 28. 27. 26.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved 02/013.Washington, DC. ( Ecotoxicity diclofenac, their atenolol photolysiszebrafish and byproductsin ofketoprofen, 2015. JP. MS, A, Noronha ReisSalgado MAM, Diniz Oehmen Carvalho Pereira R, VJ, G, hepatocellular PLHC-1carcinoma, cell and onkey and other mechanisms cytoskeleton xenobiotics detoxification in B,InteractionWassmur NorströmM,Celander Gräns E,Wallin MC.2013. of J, pharmaceuticals mammalian andlines: aliterature fishcell survey Castano A, Gomez 89(2): 271-277. the tetrazolium dyereliability.giving and procedure sensitivity improved Lang F,Denizot 1986.Rapid R. colorimetric forgrowth Modifications assay celland to survival: combined stress cytotoxicity proteinand assay. cellsRyan HightowerLE. using1994. Evaluation toxicity ion in fish ofheavy-metal a JA, toxicity ofeffluents and receiving tofreshwater waters 4 organisms. US Environmentalestimating Protection for methods Agency. thechronic 2002b.Short-term effluents marine and freshwater to organisms. 5 US Environmental Protection for Agency. measuring 2002a.theacute toxicity Methods of green algae. FreshwaterISO.growth algalISO unicellular testwith quality. 2012. 8692:Water inhibition dried bacteria. on thelight Vibrio of emission fischerimethod using (luminescent bacteria test).Part freeze- 3: ISO.ISO Water quality. of 2007. theinhibitory 11348-3: Determination effectofwatersamples Accepted PreprintDanio rerio ). Sci Total EnvironSci Total

- Lechon MJ. 2005. Lechon MJ. 505(1): Comparison basal of between cytotoxicity data line. 282 -289. -289. Toxicol In Vitro th Environ. Toxicol. Chem Environ.

. ed. EPA/821/R-02/012. Washington, DC. Washington,ed. EPA/821/R-02/012. DC. Toxicol In Vitro 27(1): 111-120.

19:695 th

ed. EPA/821/R- 13:1231-1240. J ImmunolJ Methods – 705.

Poeciliopsis lucida

36. 35. 34. 33. 32. 31. 39. 38. 37.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved species. 40(1):16-23. 123. biotransformationxenobiotic system (Salmosalar). ofAtlantic salmon A. 2007.EffectsMortensen of17α AS, Arukwe mercapturic acid formation. JakobyfirstHabig enzymatic S-transferases:the stepPabst MJ, in WB. WH, 1974.Glutathione 2:583 dealkylationmethylcholanthrene. which ispreferentially inducibleby 3- Burke Mayer RT.1974.Ethoxyresorufin: MD, assaya directfluorometric microsomal of O- models. and2016. Modeling best-fitfunctions ratio toxicity ofpharmaceuticals withdeviation mixtures Wieczerzak M,Kudlak Simeonov YotovaM, Tsakovski B, S, G,Nedyalkova V,Namiesnik J. 141 bacterium deOrtiz Garcìa S,Garcìa inhomeostasis.disruption Calabrese represents response Evidence thathormesis anovercompensation EJ.1999a. toa Chirality 9(1): 29-31. Lovlin F, chiralJamali Abergmice. R, inversionBi-directional of ketoprofen inCD-1 G.1997. InversionAberg 1995. RG. of(R)- G,Ciofalo Pendleton VB, GarrisonProbing 2006. AW. theEnantioselectivity Pesticides. of Chiral -

Accepted162. Preprint –588. Chirality Chirality Sci Vibrio fischeriVibrio

Total EnvironTotal

7(5):383-387.

- exposed topharmaceuticalsexposed andpersonal care products. Encina PA, IrustaEncina PA, 571: 259-268. Ecotoxicol Environ Saf J Chem Biol

248:7130 - Mata R. 2015. R. Mata - ethynylestradiol- onhormonal responses and 42: 135-137. – 7139.

Dose to (S)-

– responsebehavior o ketoprofen ineight animal ketoprofen Aquat Toxicol Aquat Environ Sci Technol Drug Metab Dispos Drug Ecotoxicol

85:113 f the

–

25: 46. 44. 43. 41. 40. 48. 47. 45. 42.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved 5160. northwesternFrance. of48pharmacuticalsToxicities andtheir freshwaterand assessment environmental marine in L,Minguez Farcy Ballandonne PedelucqBudzenski J, E, H,Halm C, to three acquatic(alga, organisms daphnid, and Tatarazako N.2016. WatanabeI,Abe H,Tamura Takanobu T,Hirose R, Nakamura A,Nishimura A,Suzuki H, T, Environ removal by O L,Illés E, Wojnàrovits E,Takàcs E,Szabò DombiA,Gajda Accepted metabolizingxenobiotc enzymes an incarp liver: endogenous Porte SchnellThibaut S, R, and C.2006.The interference ofpharmaceuticals with of hepatic drug metabolism. Pappas StehanouVasiliou V,Marselos P, P, 1998. M. cytochrome and P450 carcinogenesis. DE,LechBuhlerWilliams and of JJ, xenoestrogens DR.1998.Xenobiotics fish:modulation in in Vitro fish hepatoma line PLHC cell Porte2008. Thibaut C. R, pharmaceuticals over environmentalrisk assessments pHranges. on InfluenceBoströmO. 2015. acquaticBerglund ML, ofpH-dependent ofionisable toxicity duckweed. Ecotoxicol Preprint tests inhibition I, ReuterEberius J.2002. G, M,Mennicken Vandenhirtz

22(5): 1128 472: 178 3

- and O just ajust question Theory of mathematical calculation? and practicealgae and for - 184. - 1135. Chronic toxicityChronic environmentally ofan relevant mixture ofpharmaceuticals 3 Environ Sci P Environ

\ 11(5):293 UV processes: Kinetics,ecotoxicity.UV transformationproducts and

Effectsfibrates,anti of

Eur J DrugMetab Ph - 1: cytotoxicity and interactions1: cytotoxicityand cytochrome P4501A. with - 297. ollut Resollut

Mutat Res

23: 4992 fish). fish).

399: 179 399: - in vitro in inflammatoryantidepressants and drugs i

23: 457 Environ Toxicol - Antiinflammatoryagents inducibility and 5001.

Sensitivitygrowth ofdifferent study. – – 192. 460. -

Schrantz K.2014. Schrantz

Environ Sci TechnolEnviron Sci Water Res - Lemeille MP.2016. Chem

(4): Ketoprofen 72: 154-161. 72: 154-161. 996

40: 5154 40: - 1006. Sci To Sci Toxicol n the -

tal tal 55. 51. 50. 49. 56. 54. 53. 52.

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved the calculated of rac fraction S(+) differentconcentration Figure 1. 204. associatedrelated(mrp)gene barbatus). (Mullus protein inred mullet 513. membrane intransport 127 after incamels. intravenous and administration intramuscular LambertIA,Alkatheeri A, Wasfi N M.1999. Metabolise Drugs andOther HayesSherratt J, 2001. P JD. environmental monitoring. L.Goksøyr systemA, Förlin The cytochrome fish,aquatic P-450 in 1992. toxicologyand Sauerborn transport activityfish cell line PLHC inthe CaminadaZaja D, T,Fent R,Smital K.2008. androstane recept Burk KA, O,A, Geick Tegude Arnold H,Eichelbaum M.2005. multidrug resistance- BaasBoF, Lankelma Zaman Dekker GJR, Van Beijnen TellingenJ, H, O, J, Elferink Paulusma C, RPJO, geneMRP Mayer BuchlerLeier M,Jedlitschky R,Kartenbeck J, G, I, D.Keppler 1996. -

Accepted Preprint135. Inhibition of

- R, Polanecec DS, Zaja PolanececR, T.2004. R,Smital rst P. 1995. rst P. encoded or intheregulation expression. MDR1 ofhuman intestinal

conjugate export pump in liver pumpin conjugate export and selectiveabsence its canalicular from the associated protein. - s growth in Role ofRole of glutathione cells compoundsexport from by inthe the deficient mutant hepatocytes.

rac Aquat Toxicol Xenobiotics Glutathione S - KP andDKP Pseudokirchneriella subcapitata - KP are plotted asare plotted

Proc ,

22: 287-312. 22: 287-312. John WileyLtd&John Sons - -

1. transferases. Intransferases. (expressed as Log as(expressed Nati Acad Sci Nati Pharmacokinetics and metabolism ofketoprofenand metabolism Pharmacokinetics Human pharmaceuticals P Human modulate Aquat Toxicol Aquat percentage of inhibition percentage inhibition of Identificationmultidrug of theresistance J Biol Cell

US Costas I, Costas ed,

90: 214 J

A concentration Vet Pharmacol

A roleconstitutive for 131: 137

92:

, NY, USA, NY, USA, , (96 h - 7690 222. Mar Environ Res Mar

incubation) exposed to Enzyme Systems t Enzyme Systems -

- 150. 7694. Biol ChemBiol of ) Expression of the Expression . pp 319

R Therapeut

control. ac

- - gp1(ABCB1) KP, DKPand - 352.

Data areData 386: 503 58: 199

22:

hat -

- - This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved ( same concentration exposure times at different controls the same within exposure ANOVA, Tukey mean percentage (n=3) h torac-KP ( forFigure and 48and inmrp1 72 exposed Changes mrp2transcriptlevels 4.PLHC-1cell-line in ### ( and concentration bycomparing at different thesame times exposure the samethe corresponding within exposure( time controls differences TukeyANOVA, (two-way Data (n=3) are percentage presented as mean Figure 3. ≤0.001) comparingconcentrationat the same different times exposure corresponding controls (two presentedaspercentage mean (n=3) 48 and 72htorac-KP ( Figurecyp1a in Changes 2. represented as lines. presentedas mean % p

≤0.001) Accepted Preprint-way ANOVA, Tukey .

GST activity in PLHC-1 cell-line exposed to to PLHC-1 exposed cell-line GST activity in .

A and and post-hoc post-hoc B, respectivelyB,

of inhibition (symbols; eachinhibition andfor condition are regression n=3)of curves A A within the same exposure within of control and of and B, respectivelyB, and test) werecomparing analyzed thecorresponding bytreatedcells to post-hoc post-hoc transcript and EROD activitytranscriptEROD and time ) and DKP ( ) and of control and control and of test) standard deviation. deviation. standard post-hoc post-hoc ( * p were analyzed were ≤0.05; of control and and control of ) and DKP ( ) and C and and C # test) were analyzedtest) by comparing cells to treated p time ( time **

≤0.05; standard deviation.Significant differences p ≤0.01 and D, respectively rac- * p by comparing by comparing ≤0.05; levels in PLHC-1 cell-line for exposed levelsin PLHC-1 Significant differences (two-way C ## KP * p standard deviation. Significant standard deviation. p and and ≤0.05;

≤0.01 and ( (A) # *** p **

D, respectively p ≤0.05;

p and

≤0.01 and ≤0.01 and ≤0.001) ** p # ). Data areas). Data presented

treated cells treated ≤0.01 and ≤0.01 p DKP

### ≤0.05; ## p p and bycomparing the

≤0.01 and ≤0.001). (B) ***

p ## ). areData for 48and 72 ***

p ≤0.001) to

p ≤0.01 and

the ≤0.001) ### p and by

h. This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Accepted Preprint mrp2 mrp1 cyp1a Gene amplified byreal-time PCR. 1.PrimerpairTable sequences,annealing ampliconsize, temperature

Reverse: TTGCAGATGTGCTCCTCCAACA Forward: GCATTTGGCGTGCTCGAAGAAA Primer pairs sequences (5’ Reverse: GCAAAGAGTCAACAGTCGGAGAAA Forward: TGCTGCTGGTGGCTCTTCTAC Reverse: GAGAGTGACCAGCGAGTA Forward: GCCGTTCTCCTATCTACAC - 3’)

Amplicon size (bp) 159 107 109

and G and Annealing en T T (°C) Bank IDgenesforBank 60 60 60

HM102360.1 HM102361.1 JX270831.1 GenBank ID

(µg/L) 2000 1000 62.5 31. 15.6 500 250 125 3.9 Accepted Preprint7.8 -

KP 3

Inhibition of

15 min - - - - - 17.9 0. 0.6 0.7 3. 3. I% 2.9 2. 0. 8.4

9 8 3 8 5

bioluminescence in

(µg/L) 2000 1000 DKP 62.5 31. 15.6 500 250 125 7.8 3.9

Vibrio fischeri Vibrio 15 min 72. 28. 18. - - - - 2.6 4.9 4.0 I% 5. 4.0 0. 0.

6 3 9 9 7 5

(expressed as I%) exposed todifferent(expressedI%) as

DKP Rac NSAIDs - KP KP

Accepted Preprint NOEC µg/L 3.9 7.8

LOEC µg/L Pseudokirchneriella subcapitata 15.6 7.8

3.1 2.9 (0.7 2.9 (0.7

(1.1 µg/L EC

- 5 -

10.5)

4.7)

5 , 10,20 9.0 4.5 (1.6 4.5 (1.6

exposed todifferentrac-KPexposed of concentrations 50 (1.4 µg/L EC

values withconfident limits(CL: in

10 - -

12.9)

6.6)

13.9 (4.8 7.4 (5.4 µg/L EC

- -

32.2 9.2)

)

240.2 65.6 (40.6

(201.8 µg/L EC

50 -

72.3)

280.7)

250 125 62.5 31.25 15.63 (µg/L) concentration Nominal 7.81 3.90 1.95

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved Dataalgal arestandard testsolutions. deviationas mean(n=3). expressed ± 4.NominalandDKP (S(+)KP) (R(-)/S(+) measuredKP)and Table rac-KP concentration in of 124.7

Accepted64.77 0.4 ± Preprint 32.10±0.36 16.1 ± 0.6 8.16 ± 0.29 4.03 ± 0.15 2.03 ± 0.06 0.99 ± 0.05 0 R (

± 5.03 ±

- )

0 0

64 32 15.93 0.12 ± 7.99 ± 7.99 ± 0.11 3.96 ± 0.06 1.96 ± 0.11 1.11 ± 0.11 .00 .00 S (+) Measured concentration

± 2.65 ± 1 ±

of of

.05 rac

- KP

* (µg/L) 112.3 62.67 ± 29.67 0.58 ± 14.9 7.5 3.83 ± 0.06 1.90 ± 0.1 0.9 0 0 R ( 0 0

± 0.5 ± 0.01 ± 0.17 ±

± 6.66 ± - ) 3.79

0 0

60 29.67 0.57 ± 15.17 0.76 ± 7.77 ± 7.77 ± 0.25 3.9 1.91 ± 0.03 0.99 ± 0.01 .02 S (+) 0

± 0.17 ± 1 ±

.05

251.7 117 64.77 0.4 ± 32.1 16.33 0.58 ± 8.06 ± 8.06 ± 0.12 3.97 ± 0.15 1.99 ± 0.2 Measured concentration .04 S (+) S (+) 0 0 2

± 0.36 ±

h ± 7.64 ± 2.65 ± of of

DKP 1 0

(µg/L) 241.30±16.29 113.3 62.67 3.79 ± 29.67 0.58 ± 14.9 ± 14.9 ± 0.1 7.79 ± 0.22 3.83 ± 0.06 1.92 ± 0.1

S (+) 96 1

± 8.39 ± h

2 0

2000 1000 500

± 11 ±

± 5 ± ± 16.92± .00 .03

992.3 488.7 120.7 252.3 0 0 0 0

± 16.26 ± 10.5 ±

± 2.08 ± ± 6.81 ± 0

986.7 476.7 242 .00 1 0

± 11.55 ± 25.17 ± 13.11 ±

933.3 220 448.7 111.7 7.64 ± .00 2 0

± 37.86 ± 10 ±

± 8.08 ± .01

2003 1007 501.3 .03 .04 0

± 15.72± 11.2 ± 4.93 ± 2

1987 990 483.00±11.27 .01 .00

± 10.01 ±

± 15.28±

Accepted PreprintSolvent Rac Control 100 (µ 50 25 12 6 3 1 25 13 56 g/L) 000 000 5 -

000 c 00 KP 0 0 0 ontrol

mortality/immobilization in mortality/immobilization Immobilization

Mortality/ rac-KP and DKP. rac-KP andDKP. 40 26. 23.3 23.3 23.3 20 13. (%) 3.3 0 .0 .0 .0 7 3

Solvent Ceriodaphnia dubia Control 100 (µ 50 25 12 DKP 3 1 6 13 560 25 g/L) 000 000 5

000 control 0 0 0 0

Immobilization Mortality/

after acute 48hexposure to 10 10 60 30 26. 23.3 23.3 (%) 3.3 0 .0 .0 .0 .0 .0 7

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved * Mortality (%) Inhibited r Total reproduction Offspring/female (days) Time first of reproduction differentconcentrations ofrac-KP. 6. Table p <0.05(one- Accepted Preprint

± SD ±

Reproduction and survival of eproduction (%)

way ANOVA, Dunnett’s test)

± SD

23.3 ± 23.3 ± 1.9 Control 4 ± 0 4 ±

233

0 -

.0 Ceriodaphnia dubia

18.7 ± 18.7 ± 7.4 4 ± 0 4 ± 19.7 187 1 0

21.2 ± 21.2 ± 2.5

following 4 ± 0 4 ± 212 9.1 10 Rac

0 (

µg/L)

chronic 7-daychronic

18.2 ± 18.2 ± 1.5 4 ± 4 ± 0 21.9 100 182 0

exposure to

17.5 ± 17.5 ± 4.4 4.3 ± 0.54.3 ± 1000 24.9 105 20

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved * Mortality (%) Inhibited reproduction (%) Total reproduction Offspring/female (days) Time first of reproduction differentconcentrations ofDKP. 7.ReproductionTable and survival of Acceptedp <0.05(one-way ANOVA, Preprint

± SD ±

± SD

Dunnett’s test) 20.5 ± 20.5 ± 1.7

Control 4 ± 0 4 ± 205 0 -

.0 Ceriodaphnia dubia

18.2 ± 18.2 ± 2.2 4 ± 0 4 ± 11.2 182 1 0

17.4 ± 17.4 ± 1.8

following 7-day chronic exposure to 4 ± 0 4 ± 15.1 174 10 ( 0

DKP µg/L)

14.6 ± 14.6 ± 2.6 4.4 ± 0.54.4 ± 28.8 100 117 20

11.2 ± 11.2 ± 1.6 4.6 ± 0.54.6 ± 1000 45.4 40 67

1000 100 10 1 (µg/L) concentration Nominal

This article is protected by copyright. All rights reserved This article isprotected rights All bycopyright. reserved * crustacean Dataas ±standard are testsolutions. (n=3). mean expresseddeviation 8.NominalandDKP (S(+)KP) (R(-)/S(+) measuredKP)and Table rac-KP concentration in of AcceptedSum R 50% andS of enantiomers. Preprint 489.7 47.33 3.79 ± 4.5 0.43 ± 0.06 0 0

± 0.5 R ( ± 10.02 ±

- )

d 486

49 4.53 ± 4.53 ± 0.5 0.6 .00 .00 0 S (+)

± 0.1 Measured concentration ± 6.25 ±

± 6.93 ±

f 0 0

rac

- KP

453.3 (µg/L) 45.67 3.06 ± 5 0.63 ± 0.2 .00 R ( 0

± 0.1

± 15.28 ±

- )

0 0

d 456.7

42.33 4.04 ± 4.53 ± 4.53 ± 0.5 0.6 S (+) 0 0

± 0.26 ± 37.86 ±

996.7 104 9.5 1.1 Measured concentration .02 S (+) 0 0 0 0

± 0.5 ± 0.1

± 25.17 ±

d ± 5.29 ±

of of

DKP 0 0

(µg/L) 993.3 95.67 5.86 ± 9.6 0.97 ± 0.15 2 S (+) 2 7

± 1.22

± 25.1 ±

This