Biotechnology & Biomedical Engineering

JSM Central Biotechnology & Biomedical Engineering

Special Issue on Industrial Biotechnology-Made in Germany: The path from policies to sustainable energy, commodity and specialty products Edited by: Dr. Thomas Brück Professor of Industrial Biocatalysis, Dept. of Chemistry, Technische Universität München (TUM), Germany Table of Contents

Title Page No

Editorial Introduction 03

Industrial Biotechnology-Made in Germany: The Path from policies to sustainable 04 energy, Commodity and specialty products by Brück, T.

Policy Opinion 05

The Role of Government Research Funding in the German Industrial 06-12 Biotechnology Sector by Müller, W. Networks – Bridges between Academy, Industry and Politics. The Paradigm of Network IBB and its Management Organization by Zorbas, H., Völker, S., Härtling, 13-24 K.

Scientiic Contributions 25

Lignocellulose to Biogas and other Products by Streffer, F. 26-32

Cellulosic Ethanol from Agricultural Residues – An Advanced Biofuel and Biobased Chemical Platform by Koltermann, A., Kraus, M., Rarbach, M., Reisinger, C., 33-37 Zavrel, M., Söltl, Y. Shaping the Future with Industrial Biotechnology–New and Eficient Production 38-45 Processes for Biopolymers by Bendig, C., Kraxenberger, T., Römer, L.

The Psychrophile Shewanella arctica sp. Nov: A New Source of Industrially 46-54 Important Enzyme Systems by Qoura, F., Brück, T., Antranikian, G. Biochemical Characterization of a Recombinant Xylanase from Thermus brockianus, Suitable for Biofuel Production by Blank, S., Schröder, C., 55-63 Schirrmacher, G., Reisinger, C., Antranikian, G. A Novel Natural NADH and NADPH Dependent Glutathione Reductase as Tool in Biotechnological Applications by Reiter, J., Pick, A., Wiemann, L.O., Schieder, D., 64-70 Sieber, V. Lipases as Sustainable Biocatalysts for the Sustainable Industrial Production of 71-81 Fine Chemicals and Cosmetics by Kourist, R., Hollmann, F., Nguyen, G.S.

Downscale Upscale by Elasticity of Scales-An Approach to Forecast Future 82-86 Requirements in Biotechnology by Kurzrock, T., Kress, K. Establishment and Characterization of three New Embryonic Spodoptera littoralis Cell Lines and Testing their Susceptibility to SpliMNPV by Ahmed, I., Huebner, H., 87-94 Buchholz, R. Microalgae- A Promising Source of Novel Therapeutics by Mundt, S., Bui, H.T., Preisitsch, M., Kreitlow, S., Bui, H.T., Pham, H.T., Zainuddin, E., Le, T.T., Lukowski, 95-105 G., Jülich, W.D. Biosynthesis of Ginsenosides in Field-Grown Panax Ginseng by Schramek, N., Huber, C., Schmidt, S., Dvorski, S.E., Knispel, N., Ostrozhenkova, E., Pena-Rodriguez, 106-121 L.M., LM., Cusido, R.M., Wischmann, G., Eisenreich, W. Novel Antibody Format Provides Eficient Tools for Research and Drug Discovery 122-129 by Yurlova, L., Buchfellner, A., Zolghadr, K. Editorial Introduction Editorial *Corresponding author Prof.Dr. Thomas Brück, Industrial Biocatalysis, Department of Chemistry, Technische Universität Industrial Biotechnology-Made München (TUM), Germany, Tel: 49-89-289-13253; Email Id: Submitted: 16 May 2014 in Germany: The Path from Accepted: 16 May 2014 Published: 16 May 2014 policies to sustainable energy, ISSN: 2333-7117 Copyright Commodity and specialty © 2014 Brück products OPEN ACCESS Brück, T.* Industrial Biocatalysis, Department of Chemistry, Technische Universität München (TUM), Germany

Globally, Germany is the irst nation dedicated to change of sustainable bioprocesses. In this issue we present two its entire energy supply from fossil to renewable resources in industrial contributions that describe commercially ready the next decades. A clear political roadmap to accomplish this process options, which enable conversion of lignocellulose changeover fosters a climate for innovation and technology containing biomass residues streams into bioenergy (biogas) development leading to new sustainable energy and fuel and biofuels (bioethanol). In an additional contribution, the solutions. These trends now radiate into other industrial sectors. industrial contributors describe the conversion of biomass based Particularly, climate change, limited petroleum resources feedstock into various high performance polymeric materials and strict legislative frameworks drive the development of with application in the textile, cosmetics and pharmaceutical sustainable process development for commodity, material and sector. Since, complex biomass residues such as straw and wood specialty products. The latter include cosmetics, pharmaceutical are primarily made up of lignocellulose consisting of cellulose, and agrochemical products, such as biological insecticides. These hemicellulose and lignin polymers, mass eficient conversion is specialty product lines address both sustainable population dificult. Indeed, the utilization of polymeric biomass residues in growth and increasingly aging populations in industrial biotechnological processes often requires primary deconstruction countries. A key factor for translating research innovation into into its constituent monomers (i.e. sugars) using speciic enzyme products is a inely tuned interaction between academia and systems. In this issue various academic groups report on the industry. This interaction is increasingly managed by focused discovery of new microbial enzyme producers as well as the technology clusters, which manage the dialog between policy characterization and optimization of individual enzyme system, makers, academia and industry. The resulting technology which are essential for deconstruction, functionalization and advance allows German industries a prime positioning in the valorization of biomass based raw materials. In addition to evolving market of renewable product lines. This special issue renewable bioenergy and chemicals process options, this special on German based Industrial Biotechnology developments will issue highlights renewable technologies focused on high value include contributions from policy makers, technology cluster products, such as virus based insecticides, characterization of managers, academics and industries involved in sustainable novel bioactive natural products and the application of custom technology development. tailored antibodies for clinical and biotechnological applications. In all reports modern tools of biological systems analysis and The irst two contributions report on speciic policies and engineering, such metabolomics and genomics are essential to actions to support basic and applied research that initiates the realize the potential of reported bio-manufacturing procedures. innovation cascade towards sustainable new product lines. A key factor for success is the formation of academic :industrial All of these detailed bioprocesses save CO2 emissions and expert groups that focus on speciic process sectors. Strategies actively contribute to reduction of greenhouse gases and climate for development of new bio-based processes primarily have change. The contributions demonstrate that biotechnology to consider economically and ecologically suitable biomass can provide economically and ecologically viable alternatives feedstock. With respect to a globally ever growing population, to established petroleum based processes. The reported new biotechnological process should not rely on edible biomass bioprocess examples demonstrate that the ongoing advance resources, such as grain to avoid competition with food in biotechnological methods has ushered in an era of change production. Hence, agricultural, forest and food processing towards a bio-based economy. Germany has internalized this residues, including cereal straw, wood chips and crab shell route towards a completly sustainable economy and can provide waste constitute preferred raw materials for development cutting edge technologies to catalyze a global transition.

Page 4 Policy Opinion

Page 5 Policy Opinion *Corresponding author Dr. Wiebke Müller, Ph.D., Geschäftsbereich Biologische Innovation und Ökonomie (BIO1), Project The Role of Government Management Jülich, Forschungszentrum Jülich GmbH, 52425 Jülich, Germany, Tel: 492461611987; Email:

Müller, W.* OPEN ACCESS Project Management Jülich, Germany Keywords Abstract • Bioeconomy • Sustainable economic growth Project funding – the targeted funding of selected research projects – is a versatile • Technological advance tool that allows governments to stimulate research into speciﬁ c topics, to encourage the • Industrial development formation of cooperative research networks or to accelerate the transfer of academic • Government policy results into application. The German government has long offered project funding for research into industrial biotechnology, and continues to do so today. This article offers an • Research funding initiatives overview of the history of funding in this ﬁ eld, the rationale behind it and the processes • Industrial biotechnology involved. The aims and concepts underlying the funding programs are discussed, including the recent shift towards the inclusion of sustainability as a major criterion. The article also outlines the administrative processes involved, including the role of advisory bodies, expert groups and strategy processes in the creation of new funding initiatives. Examples of current initiatives in industrial biotechnology illustrate the wide range of strategic aims that can be addressed with the instrument of project funding.

ABBREVIATIONS Biotechnology is a growing economic factor in Germany with over 560 dedicated biotechnology companies, generating nearly BMBF: Bundesministerium für Bildung und Forschung 3 billion euros revenue with more than 17,000 employees. More (Federal Ministry of Education and Research); BMEL: than 120 additional companies include some biotechnological Bundesministerium für Ernährung und Landwirtschaft (Federal activities in their portfolio, employing an additional 17,000 Ministry of Food and Agriculture); BMUB: Bundesministerium people in their biotechnology divisions (all numbers for 2012) für Umwelt, Naturschutz, Bau und Reaktorsicherheit (Federal [4]. While Germany is itself a rather biomass-poor nation, and Ministry for the Environment, Nature Conservation, Building and Nuclear Safety); BMWi: Bundesministerium für Wirtschaft und unlikely to produce many bio-based bulk materials in future, Energie (Federal Ministry for Economic Affairs and Energy); CBP: its history of highly specialized industry can well contribute Fraunhofer Center for Chemical-Biotechnological Processes; high-value products as well as processing technology for use NFS 2030: Nationale Forschungsstrategie BioÖkonomie 2030 elsewhere. (National Research Strategy Bioeconomy 2030). This article aims to provide an overview of biotechnology INTRODUCTION funding in Germany, highlighting some of the underlying principles and aims, explaining processes, and examining past, Most of Germany’s industries, including the chemical, current and future trends. Some of it is of necessity simpliied pharmaceutical and engineering sectors, are overwhelmingly and generalized – for example, some initiatives deviate from knowledge-driven and innovation-dependent. In view of the general model described below. The present article is Germany’s high production and labor costs, it is vital for meant to offer a general introduction, citing examples rather individual companies, and also for the German economy as a than attempting comprehensiveness, and taking a sweeping whole, to stay one step ahead of the international competition panoramic view. in technological terms. This is certainly true of the industrial biotechnology sector, which is both increasingly important in The German research funding system established industries and has become a sector in its own right. Research funding in Germany, as elsewhere, is a complex po- German investment in research and development is high litical and administrative process. Two types of public research and has increased steadily over the past decade [1]. In 2012, funding can be distinguished: institutional funding and project Germany invested 2.98% of its gross domestic product in funding. The irst entails substantial baseline funding of universi- research; consisting of roughly one third public funding and two ties and the four publicly funded research organisations (Fraun- thirds industrial investment. This rate is somewhat higher than hofer-Gesellschaft zur Förderung angewandter Forschung e. V., the 2.77% in the USA and certainly high compared to the 2.06% Helmholtz-Gemeinschaft deutscher Forschungszentren, Wissen- average in the European Union, although rates are higher in the schaftsgemeinschaft Gottfried Wilhelm Leibniz e. V., Max-Plank- Scandinavian countries (2.99 to 3.55%), and also, for example, in Gesellschaft zur Förderung der Wissenschaften e. V.). Specialized Israel (4.38%) and South Korea (4.03%) [2, 3 – inal report not research institutes serving public interests, such as the Robert yet published]. Koch Institute, which plays a role in public health protection, also Note: Throughout the article, the current names of the ministries appear receive institutional funding.

Page 6 Central

In contrast, most of this article will be concerned with which aimed to promote scientiic and technological excellence, support for speciied research projects. Such project funding improve conditions for innovation in industry, further research differs from research commissioned by the government in that it and development projects in certain areas of services for the offers support for the projects of others rather than deining its public, to assess chances and risks including ethical aspects own projects. Research can also be commissioned, but only if it is and to support young scientists in biotechnology. Under this directly relevant to government responsibilities. program, the BMBF funded four research centers for molecular biology called Genzentren (gene centers) from 1982 to 1995 in As a irst step in the process, a government research program Berlin, Heidelberg, Cologne and Munich [5]. is published. It details a scientiic ield, like biotechnology, and the overall aims, as well as specifying the funds set aside for the The following research program “Biotechnologie 2000” [8] program. This program needs to be notiied to the European had two strategic goals: facilitating access to the high innovation Union, which veriies that it does not include subsidies which are potential of biotechnology for various applications in industry, not compatible with the European idea. and strengthening preparatory research for public services such as health, environmental protection and energy supply [9]. In the During the typical ive to ten years that a research program BioRegio Competition, which was the irst competition to fund is in effect, the government ministries publish funding initiatives the formation of research clusters in Germany and had a budget within the framework it has set up. These initiatives are typically of 90 million euros, regions could apply with their ideas for narrower in focus than the program itself and take the form of strengthening biotechnological research and the translation of competitions. Besides scientiic criteria, there may be other research into industrial application. Effects visible today include conditions, such as, for example, whether universities, companies many companies founded at the time. From 1998, the initiative or consortia containing both are eligible to apply. Determining BioFuture enabled promising young academics to kick-start their what initiatives to set up and how to design them is obviously careers. BioChance, which started in 1999, was aimed at newly crucial. Experts from academia, industry and administration are founded biotechnology companies. usually consulted in speciically organized events (see below). Most of these initiatives continued under the “Framework Once project proposals have been received, the selection of the programme Biotechnology – using and shaping its opportunities” projects to be funded is usually based on the recommendations between 2001 and 2010 [10,11]. This program listed eleven of reviewers, who may be recruited from abroad to promote “guiding principles”, such as increasing investment in research impartiality. Selected projects are then funded for a speciied and education, promoting interdisciplinary research and period. Depending on the risks of the project as well as the internationalization, stimulating start-ups and using the inancial abilities of the grant recipient, all, or a proportion, of the opportunities of globalization. “Preventive research” focused on costs will be funded. Large companies typically receive less than biological safety, animal protection and biodiversity. Under this half of the total costs, while universities may receive full funding. program, BioChance was developed into BioChance Plus and During the funding period, progress reports must be submitted then became the model for KMU-innovative (KMU = SME) which on a regular basis. was launched in 2007. KMU-innovative was aimed at small and medium-sized enterprises (SME) – a sector of great importance to Most of the administrative processes entailed in the entire the German economy – who were eager to apply biotechnological process are usually handled by project funding agencies, such methods but were unable to shoulder the risk using their own as Project Management Jülich (Projektträger Jülich), in close capital alone. This funding initiative for small and medium-sized collaboration with the ministry in question. enterprises is ongoing, with biannual application deadlines. A short history of biotechnology funding in Germany The GO-Bio initiative has enabled entrepreneurs to realize their dream of a biotechnology start-up since 2005. As early as 1974, the Federal Ministry of Education and Re- search (BMBF) commissioned a study from the DECHEMA (Ges- Two research programs followed in 2010: one for health ellschaft für chemische Technik und Biotechnologie e. V. / Soci- [12,13] and one for bioeconomy [14,15]. The latter includes ety for Chemical Engineering and Biotechnology) to evaluate the industrial biotechnology and will be introduced below. potential of biotechnology [5]. This study detailed the state of Patterns and observations pertaining to funding knowledge and recommended many possible areas of funding on history more than 150 pages [6]. This document proved popular and by 1976, three updated editions had been published. Despite this, Funding steadily increased over these three programs, no speciic funding program for biotechnology was established relecting the increasing number of research groups, companies at the time. A few years later, concern grew that Germany lacked and techniques. The 1985-1988 program earmarked about know-how in modern biotechnology, and it was a strong signal 406 million euros* of its total funds of over 560 million euros* when a German chemical company, Hoechst AG, invested 70 mil- for project funding [7]. In Biotechnologie 2000 this igure lion dollars in a research cooperation with Massachusetts Gen- subsequently increased to over 510 million euros* for project eral Hospital in Boston, USA, in the early 1980s. The aim of this funding out of a total of over 1 billion euros* [8]. Ultimately, in cooperation was to gain access to technology in the burgeoning the third program, over 800 million euros were allocated for research project funding in the years 2001 to 2005 [10,11]. ield of genetics [5]. The initiatives named above are only a small fraction of those As a reaction, the German government published its irst that ran during the three programs listed. biotechnology program “Biotechnologie 1985 – 1988” [7]

Page 7 Central

Project funding can be a versatile tool: Funding has been Promoting interdisciplinary research, speeding up technology used to establish entire research centers, to fund single projects transfer, promoting international cooperation and intensifying in academia or industry as well as cooperative projects between the dialogue with society were deined as cross-section activities. any number of partners, to fund the establishment of networks, Industry and sustainability in the NFS 2030: Creating to aid promising young academics in establishing their own research groups, to fund start-ups at the critical early stages and an alliance to encourage international collaborations. Conventionally, keeping industries competitive has been the main focus of funding, in Germany as elsewhere. Increasingly, Considering that biotechnology had been identiied as an the policies of the German government, relecting the opinions of important ield for economic development, it may be surprising that no speciic research program was published earlier. its populace, take into account global challenges such as threats However, it is not the task of funding to inance every important to the environment and climate, resource depletion or social emerging ield. Many will develop excellently without such inequalities arising from population growth and poverty. The help; funding them is a waste of limited funds. Government National Research Strategy Bioeconomy 2030 (NFS 2030) is no ministries and funding agencies, besides working under inancial, exception. The previous research program mentioned ethical administrative and political constraints, therefore have to predict aspects and environmental protection, including the idea of the development of emerging scientiic ields in order to judge environmentally friendly bioprocesses, but they were clearly whether government support will be necessary. not the focus. In contrast, the possibility and even necessity of creating more sustainable ways of production while at the same This history suggests that project funding has had a signiicant time making industries more competitive is central to the NFS impact. Germany lacked relevant know-how, but caught up once 2030. Industrial biotechnology in particular is seen to elegantly government guided funding was initiated. Generally, being risk combine these two aims, which have more commonly been averse can make perfect sense for an individual company or considered as being opposed to each other. institute, but not necessarily for the national economy. Some research is undertaken more readily if companies and institutes This concept is not entirely new, nor is it without its critics. do not have to deal with the risk alone. The aim of project funding Critics have feared that the ideas of a bioeconomy and “green” is to provide a percentage of the cost, and thus bear a part of the industrial processes are nothing but promises of a technological risk. ix which detract attention from reducing consumption. They have also voiced concerns about the possibility of associated The National Research Strategy Bioeconomy 2030 biosafety issues, biodiversity loss, increasing monocultures, The National Research Strategy Bioeconomy 2030 (NFS land grab, and the fact that alternative uses of biomass may 2030) [14,15] was launched by the German government in reduce food availability. Such dangers certainly exist. Few new November 2010 with funds of 2.4 billion euros for six years. Of processes, if any, are without risks and major transitions may these funds, 1.5 billion euros were earmarked for project funding, produce unwanted side effects. This, however, cannot be a reason the rest for institutional funding and other commitments. This is not to engage in them at all. Instead, it demands an appropriate nearly double the funding available for the previous program, amount of realism and vigilance to complement the hopes and a remarkable fact particularly since health research, included enthusiasm. in the previous program, now has its own funding. Industrial It is partly an awareness of such possible conlicts that biotechnology plays a signiicant role in this strategy, more makes the NFS 2030 more than just a vision. A recent analysis prominently than it did in the earlier ones. comparing national strategies and policies for the bioeconomy Bioeconomy is described in the strategy as “a natural cycle- of various countries worldwide found that “[i]n contrast to the oriented, sustainable bio-based economy that carries the promise other country policies and strategies, the German document has of global food supplies that are both ample and healthy and of high a clear and quiet straightforward approach with outlined visions, quality products from renewable resources”. The two objectives goals and tools to reach them. The measures are quite precise are (1) to make Germany a dynamic research and innovation hub and concrete” [16]. By thinking out the approach in some detail, for bio-based products, energy, processes and services and (2) the NFS 2030 aims to avoid the worse pitfalls through early to meet the responsibilities for global nutrition, as well as for the identiication and correction of the set course if necessary. protection of the climate, resources and the environment. Conlicts have already been encountered, in ields such as To meet these goals ive key ields of action have been deined: biosecurity or prioritization of biomass (including fuel versus food). More are undoubtedly to come. It is vital to involve the • securing global nutrition, public in solving them; in fact, such involvement has been deemed • ensuring sustainable agricultural production, invaluable for the success of the bioeconomy [17]. The German population has reservations about some biotechnological • producing healthy and safe foods, methods, in particular the genetic engineering of crops, the • using renewable resources for industry and use of embryonic stem cells and the cloning of animals, while there are few such reservations about the medical or industrial • developing biomass-based energy carriers. use of biotechnology. Public discussion is encouraged, and the Note: All currency values in Deutschmark have been converted into euros and results are taken into account to keep improving policies and are approximate; these converted values are marked * initiatives. A central role in this process can be undertaken by

Page 8 Central advisory bodies like the Bioeconomy Council (see below). This 2030: “A bioreinery is characterized by an explicitly integrative, process can be helpful in identifying conlicts early on and inding multifunctional overall concept that uses biomass as a diverse solutions that strike a balance between interests. For example, source of raw materials for the sustainable generation of a the NFS 2030 unmistakably prioritizes food production over any spectrum of different intermediates and products (chemicals, other use of biomass, and in consequence research using biomass materials, bioenergy/biofuels), allowing the fullest possible use from waste or by-products for industrial applications was given of all raw material components. The co-products can also be food priority from the start. and/or feed. These objectives necessitate the integration of a range of different methods and technologies.” Inspiring, shaping and prioritizing initiatives A long chain of funding initiatives has leshed out Germany’s Strategy processes: “Next generation of biotechnology research programs, each initiative with its biotechnological processes: Biotechnology 2020+” speciic target – be it a research topic or a structural task such Strategy processes are long term, and serve to increase inter- as, for example, encouraging start-ups. Many initiatives and disciplinary cooperation and thinking out of the box, in order to other activities focused or focus on industrial biotechnology. extend what is thought to be possible and attainable. They are not Some of these are, in rough chronological order: Biokatalyse only valuable for their results, but also have a wider knock-on ef- (Biocatalysis), mikrobielle Genomforschung (genetics of fect through the scientiic community and society as a whole. The microorganisms), Bioverfahrenstechnik (biological process strategy process “Biotechnology 2020+”was started in 2010 by engineering), Aufreinigungstechnik (down-stream processing), the BMBF together with all four research organizations (Fraun- Nachhaltige Bioproduktion (Sustainable Bioproduction), hofer-Gesellschaft zur Förderung angewandter Forschung e. V., Cluster-Wettbewerb BioIndustrie2021 (Cluster Competition Helmholtz-Gemeinschaft deutscher Forschungszentren, Wis- BioIndustry2021), ERA-Net Industrial Biotechnology, senschaftsgemeinschaft Gottfried Wilhelm Leibniz e. V., Max- Biotechnologie2020+ (Biotechnology2020+), Strategische Plank-Gesellschaft zur Förderung der Wissenschaften e. V.) and Allianzen (Strategic Alliances). As mentioned previously, creating a number of universities to encourage the development of con- initiatives is one of the most crucial steps in the entire system. ceptually new biotechnological production processes, such as for Besides their own expertise, government ministries and funding example cell-free processes. The irst phase, completed in 2013, agencies gather input from experts. Such consultations can take a served to bring together a very wide ield of scientists, including variety of forms, a few examples of which will follow. biologists, engineers, chemists, computer scientists, and material Advisory bodies: The Bioeconomy Council scientists, develop visionary concepts, assess the research and (Bioökonomierat) development necessary to reach these, and start implementing corresponding projects [36,37]. A research and development In preparation for the NFS 2030, the German government roadmap was written that will be revised every ive years. In set up the Bioeconomy Council in 2009. This advisory group was phase two, the four German research organizations will continue appointed by the BMBF and the Federal Ministry of Food and to implement research outlined in the roadmap. Additionally, Agriculture (BMEL) to serve as an independent advisory board, projects will be funded through a dedicated funding initiative and and has entered into a second working period in 2012. The a research award (see below). members were selected in order to represent industry, academia and society as well as all relevant scientiic ields. It is their Selected current initiatives in industrial biotechno- task to think ahead, anticipate problems and suggest solutions. logy They have, so far, published about twenty documents, most of Promoting early concepts: Initiatives accompanying the which focus on recommendations [18-32]. One of them deals strategy process “Biotechnology 2020+”: Projects developed exclusively with the “Contribution of industrial biotechnology to in the strategy process detailed above are being funded in the the economic change in Germany” [31] and primarily contains initiative “Enabling technologies for the next generation of bio- recommendations for public funding. They have also started a technological processes” (Basistechnologien für eine nächste formal dialogue with the public (Bürgerdialog), the irst results Generation biotechnologischer Verfahren). To date, there are 35 of which have also been published [33]. projects with a total of 42 million euros in funding. The “Research Specialist groups: Bioreineries Roadmap award next generation of biotechnological processes” (Forsc- hungspreis Nächste Generation biotechnologischer Verfahren) For certain topics, temporary specialist advisory groups is awarded every two years. It highlights revolutionary research may be established. An example of this was the working group falling within the scope of the strategy process and inances a re- “Bioreineries Roadmap” set up by the BMBF, BMEL, BMUB search group to work on the winning idea. Through the award, (Federal Ministry for the Environment, Nature Conservation, good ideas in the spirit of the strategy process but which arose Building and Nuclear Safety) and BMWi (Federal Ministry for outside of it can still be included. Both these initiatives fund high- Economic Affairs and Energy). The 29 members combined many ly innovative projects at the beginning of the value chain. The areas of expertise relevant to bioreineries and represented task of project funding in this context is to give cutting-edge ideas a wide range of institutions and companies. The document, a chance even before their potential can be known. Such ideas are published in 2012, contained detailed descriptions of different highly speculative and many may never make it to market, but types of bioreineries and of the state of knowledge in bioreinery others may prove revolutionary and lay the foundation for future technology [34,35]. Besides that, it provided a lengthy but processes and products. precise deinition of bioreineries for the purposes of the NFS

Page 9 Central

Research infrastructure: Fraunhofer Center for Chemical- from several of the 13 participating countries. The European Biotechnological Processes: In October 2012, German commission will fund the network until 2016 at least. Several chancellor Angela Merkel oficially opened the Fraunhofer calls have been published so far, with the fourth scheduled for Center for Chemical-Biotechnological Processes (CBP) in Leuna, early 2014. This fourth call is a unique joint initiative with the a facility for bioreinery research. Besides laboratories it also ERA-Net EuroTransBio, which funds cooperative biological provides several process plants. The lexible set-up allows a research in small and medium-sized enterprises. Under the new wide range of techniques and methods to be applied. It includes European Framework Programme Horizon2020, which started apparatus suficient to trial upscaling of processes to pilot at the beginning of this year, substantial funding in industrial scale. Researchers from the Fraunhofer-Gesellschaft and from biotechnology will be organized as a public-private partnership. industry can run trials there, making experimentation less cost- The Joint Technology Initiative Bio-based Industries (BBI JTI) is prohibitive. The 50 million euros in public funding came from a partnership of the Bio-based Industries Consortium (BIC) and the BMBF, the state government of Saxony-Anhalt, the BMEL und the European Union. Together, they will set the research agenda the BMUB. The CBP is also involved in the cluster BioEconomy, and take all funding decisions as equal partners. This new model which is part of the “Leading-Edge Cluster Competition” will hopefully lead to high inancial contributions by industry – (Spitzencluster-Wettbewerb) of the government, an initiative almost double the sum contributed by the EU –, a clear focus on open to all technologies. Funding agencies cooperate on projects areas of need from an industry point of view, and a comparatively if the costs are high and the beneits are considered to be low administrative effort. manifold. Facilitating research into bioreineries was a priority, Establishing networks: “Innovation-Initiative Industrial and by making adequate facilities available such research was Biotechnology”: The “Innovation-Inititive Industrial Biotech- made more affordable. Research funding can be used to create nology” (Innovationsinitiative Industrielle Biotechnologie) is the right conditions or infrastructure in order to level the playing based on “BioIndustrie2021”, but while the earlier initiative ield and enable more researchers and companies to examine encouraged networks of stakeholders working in related ields, their ideas and concepts thoroughly. the new one funds strategic alliances of dissimilar players that Transfer to application: “Competition for ideas: New would not previously have considered working together. These products for the bioeconomy”: The “Competition for ideas: New alliances must be led by industry and aim to replace mineral oil products for the bioeconomy” (Ideenwettbewerb Neue Produkte based products with biotechnologically produced ones in order für die Bioökonomie) invites short, informal pre-proposals to switch to renewable resources and reduce energy consump- detailing innovative ideas for new bio-based products. Up to tion. Up to 100 million euros are available overall, but alliances 50,000 euros may be granted for an initial nine months, in which have to contribute substantially. Five alliances are currently se- a more detailed project proposal is prepared. Beside scientiic lected to receive funding: “Zero Carbon Footprint – functional and technical detail, it must also name at least one expert with biomass from carbon-rich wastes” (Funktionale Biomasse aus experience of commercialization in the relevant ield who will act kohlenstoffreichen Abfallströmen), “Making polymers function- as an advisor. In a second phase, the project may then be funded al” (Funktionalisierung von Polymeren), “Natural Life Excellence up to the proof of concept with a maximum of 250,000 euros. Network”, “Techno functional proteins” (Technofunktionelle The highly innovative projects are risky both technologically Proteine) and “Knowledge-based process intelligence – new and commercially, and might have been conceived by a single routes towards stable bioprocesses” (Wissensbasierte Prozess- researcher with no experience in commercialization. Such intelligenz – Neue Wege zu stabilen Bioprozessen). Applications ideas often perish without being put to the test, take very long are accepted until 2015, so more alliances may well follow. Alli- to make it to the application stage or fail because of insuficient ances serve to increase cooperation between different actors in understanding of market processes and administrative hurdles. the same ields and establish structures that will make it easier to Encouraging transfer to application is therefore another classic ind cooperation partners, in order to speed up and make more area of research project funding, in order to improve the chances eficient both the exchange of knowledge and the transfer of that good ideas fulill their potential. ideas into application. These network structures are to remain in place once funding ceases. Previous initiatives, such as BioRegio, Fostering international cooperation: ERA-Net Industrial have shown this to be possible and proitable for all involved. De- Biotechnology: The present article concentrates on federal spite this, extensive cooperation networks, particularly between initiatives, which are for the most part national in scope, but dissimilar partners, rarely form without a seed event, such as a international initiatives are also of great importance despite funding initiative. As a consequence, encouraging cooperation the higher complexity they entail. There are a number of and the establishment of networks is a recurrent theme of gov- international initiatives of relevance to industrial biotechnology, ernment funding. many of which have a European focus. However, some, such as “BioEconomy International” fund cooperative projects of FUTURE OUTLOOK German partners with others from a large number of countries The new focus of combining sustainability with economic all over the world. The European Union has a long history of progress will continue to be expressed in further funding biotechnology funding [38]. Several European initiatives are initiatives. On 5 June 2014, a conference in Berlin will celebrate relevant to industrial biotechnology, such as the ERA-Nets the half-way point of the NFS 2030. As part of this conference, SUSFOOD, EuroTransBio and of course Industrial Biotechnology. several new funding initiatives are scheduled to be announced. The ERA-Net Industrial Biotechnology was started in 2006 This event will also mark the point in time at which irst thoughts in order to promote cooperative projects involving partners will be given to a possible subsequent research program. One

Page 10 Central measure to aid this undertaking is an evaluation of the NFS BEO, Aufgaben Aktivitäten Organisation. Forschungszentrum 2030 planned for 2015. The presentation of the new program is Jülich GmbH, Projektträger Biologie, Energie, Ökologie (BEO) des scheduled for 2016, and it is planned to start in 2017. Industrial Bundesministeriums für Bildung, Wissenschaft, Forschung und Technologie. 1997 (3rd edition). biotechnology is very likely to play a signiicant role again. 10. Rahmenprogramm Biotechnologie – Chancen nutzen und gestalten. Concluding remarks: Beyond research Bundesministerium für Bildung und Forschung (BMBF). 2001. Research opens up opportunities. In this particular case, 11. Framework Programme “Biotechnology – using and shaping its research may offer opportunities to decrease dependence opportunities”. Bundesministerium für Bildung und Forschung on fossil resources, reduce pollution, lower greenhouse gas (BMBF). 2002. emissions, improve quality of life, and at the same time, it may 12. Rahmenprogramm Gesundheitsforschung der Bundesregierung. offer opportunities for businesses in the form of more eficient Bundesministerium für Bildung und Forschung (BMBF). Bonn/Berlin processes or entirely new products. However, whether these 2010. opportunities will be utilized to the full is not a scientiic question; 13. Health Research Framework Program of the Federal Government. instead it is up to the public and political consensus as well as Bundesministerium für Bildung und Forschung (BMBF). Bonn/Berlin economic factors. Public discussion about the new opportunities 2010. is essential. Approaches may have to be prioritized; any undesired 14. Nationale Forschungsstrategie BioÖkonomie 2030, Unser Weg zu side effects need to be identiied and discussed; chances and einer bio-basierten Wirtschaft. Bundesministerium für Bildung und risks need to be weighed up. The results of these discussions Forschung (BMBF). Bonn/Berlin 2012. then feed into the policies pertaining to applications. For the 15. National Research Strategy BioEconomy 2030, Our route towards a bioeconomy in Germany, discussions have begun and a irst biobased economy. Bundesministerium für Bildung und Forschung policy document delineates how the results from bioeconomy (BMBF). Bonn/Berlin 2011. research are to be used for the beneit of society as a wider 16. Staffas L, Gustavsson M, McCormick K. Strategies and policies for the whole. It should be no surprise that industrial biotechnology is a bioeconomy and bio-based economy: An analysis of oficial national central component of the Politikstrategie Bioökonomie (Political approaches. Sustainability. 2013; 5: 2751-2769. Strategy for Bioeconomy) [39], being seen as a promising growth 17. McCormick K, Kautto N. The bioeconomy in Europe: An overview. market in a green economy, coupling economic prospects with Sustainability. 2013; 5: 2589-2608. a high potential for making production more sustainable. Thus, while industrial biotechnology and sustainability might at 18. Bio-economy Council Report 2010, Bio-economy innovation. Bio- times seem to be an uneasy alliance, it can, if used judiciously, economy Research and Technology Council (BÖR). Berlin 2011. deliver substantial beneits for all. Targeted research funding 19. Combine disciplines, improve parameters, seek out international can help ensure that research will continue to open up ever new partnerships, First recommendations for research into the opportunities so we can realize that potential. bioeconomy in Germany. Bio-economy research and Technology Council (Forschungs- und TechnologieratBioökonomie) BÖR. Berlin REFERENCES 2009. 1. FuE Datenreport 2013. Analysen und Vergleiche. Wissenschaftsstatistik 20. Priorities in bio-economic research, Recommendations of the Bio- GmbH im Stifterverband für die deutsche Wirtschaft. Essen 2013. economyCouncil. Bio-economy research and Technology Council (Forschungs- und TechnologieratBioökonomie) BÖR. Berlin 2011. 2. Press release Stifterverband für die deutsche Wirtschaft of 10.12.2013. 21. Sustainable use of bioenergy, Recommendations of the 3. Press release BMBF: “Germany is investing 3% of GDP in R&D - target BioEconomyCouncil. Forschungs- und TechnologieratBioökonomie achieved!” of 10.12.2013. (BÖR). Berlin 2012. 4. Ding S, Mannhardt B, Wirsching S, Graf P, Kaltwaßer B, Laqua M, 22. Future development of mechanisms for the support of public et al. Die deutsche Biotechnologe-Branche 2013 / The German and private research in regard to the needs of the bio-economy, Biotechnology Sector 2013. BIOCOM AG. Berlin 2014. Recommendations of the BioEconomy Council. Forschungs- und TechnologieratBioökonomie (BÖR). Berlin 2012. 5. http://www.bmbf.de/de/biooekonomie.php 23. Internationalisation of bio-economy research in Germany, First 6. Biotechnologie Eine Studie über Forschung und Entwicklung recommendations by the BioEconomyCouncil. Forschungs- und – Möglichkeiten, Aufgaben und Schwerpunkte der Förderung – Technologierat Bioökonomie (BÖR). Berlin 2012. ausgearbeitet im Auftrag des Bundesministeriums für Forschung und Technologie von Mitgliedern des Arbeitsausschusses technische 24. Requirements for a bioinformatics infrastructure in Germany for Biochemie der DECHEMA, Deutsche Gesellschaft für chemisches future research with bio-economic relevance, Recommendations of the Apparatewesen e.V., Frankfurt/Main, und weiteren Fachleuten aus BioEconomyCouncil. Forschungs- und TechnologieratBioökonomie Industrie und Wissenschaft. 1976 (3rd edition). (BÖR). Berlin 2012. 7. Angewandte Biologie und Biotechnologie Programm der 25. The future of the food, nutrition and health sector, Recommendations Bundesregierung 1985 – 1988. Der Bundesminister für Forschung of the BioEconomy Council. Forschungs- und Technologierat Bioökonomie (BÖR). Berlin 2012. und Technologie. Bonn 1986. 26. Eckpunktepapier des Bioökonomierates: Auf dem Weg zur 8. Biotechnologie 2000, Programm der Bundesregierung. Der biobasierten Wirtschaft“ (Politische und wissenschaftliche Bundesminister für Forschung und Technologie. Bonn 1990. 3rd Schwerpunkte 2013-2016). Adopted by the Bioeconomy Council on revised edition, December 1992. 30.04.2013. 9. Frankenstein H (editor). Informationen über den Projektträger 27. Bioökonomie-Politikempfehlungen für die 18. Legislaturperiode.

Page 11 Central

Adopted by the Bioeconomy Council on 26.11.2013. 33. Dieckhoff P. Auswertung Dialog zur Bioökonomie. Geschäftsstelle des Bioökonomierates. BIOCOM AG. 2013. 28. Hüttl RF, Born H, Eckelmann W, Frede HG, Fritz R, Hülsbergen KJ, et al. Empfehlungen zum Forschungsfeld Bioökonomie: Boden, Wasser und 34. Roadmap Biorafinerien im Rahmen der Aktionspläne der Landnutzung – Herausforderungen, Forschungs-, Technologie-, und Bundesregierung zur stoflichen und energetischen Nutzung Handlungsbedarf. BioÖkonomieRat. Berlin 2010. nachwachsender Rohstoffe. BMELV, BMBF, BMU, BMWi. Text/ Redaktion: Fachagentur Nachwachsende Rohstoffe e. V. (FNR). Berlin 29. Müller-Röber B, Bartmer C-A, Büchting AJ, Daniel H, Kast H, Metzlaff 2012. M, et al. Planzenforschung für eine nachhaltige Bioökonomie, Forschungs-, Technologie- und Handlungsbedarf. BioÖkonomieRat. 35. Bioreieneries Roadmap as part of the German Federal Government Berlin 2010. action plans for the material and energetic utilisation of renewable raw materials. BMELV, BMBF, BMU, BMWi. Text/editors: Agency for 30. Schwerin M, Balmann A, Baum M, Born H, Mettenleiter TC, Patermann Renewable Resources e. V. (FNR). Berlin 2012. C, et al. Herausforderungen für eine zukunftsfähige Erzeugung von Lebensmitteln tierischer Herkunft, Positionspapier der Arbeitsgruppe 36. Wirsching S, Graf P, Ninkovic D (editors). Nächste Generation Tier des BioÖkonomieRats. BioÖkonomieRat. Berlin 2010. biotechnologischer Verfahren, Bilanz und Ausblick der Initiative Biotechnologie 2020+, 27 June 2013. BIOCOM AG. Berlin 2013. 31. Treffenfeldt W, Fischer R, Heiden S, Hirth T, Maurer K-H, Patermann C, et al. Empfehlungen zum Aubau einer wettbewerbsfähigen und 37. Graf P, Wirsching S, Stolzenberg B (editors). Nächste Generation nachhaltigen Bioökonomie – Beitrag der Industriellen Biotechnologie biotechnologischer Verfahren, 4. Jahreskongress der Initiative zum wirtschaftlichen Wandel in Deutschland, Positionspapier Biotechnologie2020+, 27 June 2013. BIOCOM AG. Berlin 2013. der Arbeitsgruppe Biotechnologie des BioÖkonomieRats. 38. Aguilar A, Magnien E, Thomas D. Thirty years of European BioÖkonomieRat. Berlin 2010. biotechnology programs: from biomolecular engineering to the 32. George A, Wurl HN. Welchen Beitrag kann die Aquakultur bioeconomy. New Biotechnol. 2013; 30: 410 – 425. in Deutschland zur Bioökonomie leisten? Fachgespräch zur 39. Politikstrategie Bioökonomie. Bundesministerium für Ernährung, Identiizierung des Forschungs- und Handlungsbedarfs. Landwirtschaft und Verbraucherschutz (BMELV). Berlin. Geschäftsstelle des Forschungs- und Technologierats Bioökonomie (BÖR) and Deutsche Bundesstiftung Umwelt (DBU), Berlin 2011.

Cite this article Müller W (2014) The Role of Government Research Funding in the German Industrial Biotechnology Sector. JSM Biotechnol Bioeng 2(1): 1021.

Page 12 Policy Opinion *Corresponding author Prof.Dr. Haralabos Zorbas, Industrielle Biotechnologie Bayern Netzwerk GmbH, Am Networks – Bridges between Klopferspitz 19, 82152 Martinsried, Germany, Tel: +49-89-5404547-0; Fax: +49-89-5404547-15; Email:

Academy, Industry and Politics. Submitted: 23 March 2013 Accepted: 12 May 2014 The Paradigm of Network Published: 14 May 2014 ISSN: 2333-7117 Copyright IBB and its Management © 2014 Zorbas et al. Organization OPEN ACCESS Keywords Zorbas, H., Völker, S., Härtling, K. • Industrial biotechnology Industrielle Biotechnologie Bayern Netzwerk GmbH, Germany • Cluster • Network Abstract • Germany • Cluster policy The company Industrielle Biotechnologie Bayern Netzwerk GmbH (abbreviated: IBB Netzwerk GmbH) is a network organization in service of Industrial Biotechnology and sustainable economic growth. IBB Netzwerk GmbH manages the Network IBB. In this article, we clarify and defi ne the relationship of Industrial Biotechnology to related areas and its relation to the goals of the bioeconomy. Second, we rationalize our commitment to Industrial Biotechnology by listing explicitly fi elds, for which Industrial Biotechnology is highly relevant. On this rationale, we then describe the company IBB Netzwerk GmbH and the Network IBB, their tasks, goals, mode of action and achievements so far and suggest explanations for some drawbacks of technology transfer. Finally, we attempt a bird’s eye view on cluster benefi ts in general, on the cluster policy of Germany as well as on an important requirement for cluster maintenance.

ABBREVIATIONS technical or industrial processes. The applied processes may involve the synthesis, conversion or the degradation of industrially ABV: Advanced Biomass Value; BayStMELF: Bavarian relevant compounds, encompassing monomers, polymers, food State Ministry of Food, Agriculture and Forestry; BayStMWi: ingredients, drug intermediates, fuels and many other agents. Bavarian State Ministry for Economic Affairs and Media, Energy The attribute “industrial” confers a speciic framework upon the and Technology; BBI: Bio-based Industries; BIC: Bio-based biotechnology applied: The ultimate development targets the Industries Consortium; BMBF: Federal Ministry of Education production of commodity, which will be sold for proit. Therefore, and Research; BMEL: Federal Ministry of Food and Agriculture, process engineering, mechanical engineering and plant facilities BMWi: Federal Ministry of Economic Affairs and Energy; cf.: play a central role in IB to achieve cost-eficient production and confer; e.g.: exempli gratia; GM: Genetically Modiied; GMOs: an industrially relevant proit margin. Genetically Modiied Organisms; IB: Industrial Biotechnology; IBP: Industrial Processes with Biogenic Building Blocks and Placement of IB in the Biotechnology Sector Performance Proteins; i.e.: id est; iLUC: indirect Land Use Reasonably, the counterpart of this IB notion should be Change; INRO: Initiative on Sustainable Provision of Raw “Laboratory” or “Small Scale” Biotechnology, which focuses on Materials for the Material Use of Biomass; OECD: Organisation small product volume without rigorous cost-beneit calculations. for Economic Co-operation and Development; p.a.: per annum; R&D: Research And Development; SME: Small and Medium- However, just traditionally, there is this unfortunate, because Sized Enterprise; TeFuProt: Technofunctional proteins; TUM: inconsistent and artiicial, differentiation of biotechnologies into Technical University of Munich; VC: Venture Capital; ZIM: Central different “colors”. Therefore, we attempt here an assessment of Innovation Program SME the relationship of IB to the main colors of biotechnology. There are only two kinds of science: Applied and not yet White Biotechnology: White Biotechnology is supposed to applied. designate the Biotechnology deployed in the chemical industry or for the production of chemicals. “White” denotes the color (Based on Michael Porter, Institute for Strategy and of chemical “powders”, often just white. “White Biotechnology” Competitiveness, Harvard Business School) used to be or still is synonymous to IB, particularly in Germany. A.INDUSTRIAL BIOTECHNOLOGY However, IB may encompass more industries and by far more products than “only” chemicals. De inition, Relevant to this Article Red Biotechnology: Red Biotechnology indicates the branch Industrial Biotechnology (IB) utilizes biocomponents, of drug manufacturing by biological means or based on biological including microorganisms, cell cultures or enzymes, as tools for intelligence. Basically, this means the production of therapeutic

Page 13 Central

(as well as diagnostic) macromolecules like proteins and Relevance of IB for Enterprises (Big Industry, Small nucleic acids (“biologicals”) and other so-called “smart drugs”, and Medium-sized Enterprises [SMEs]) all designed and supposed to act selectively against a cellular target. However, when it comes to the production of rather small There are already several enterprises which apply exclusively molecules like antibiotics or statins, the borders to the White or partially IB in their production routes2. These enterprises may Biotechnology blur. An example: Demand for ethyl (R)-4-cyano- appreciate the following advantages [7]: 3-hydroxybutyrate, the key chiral building block used to make 1) In contrast to traditional conversion methods, methods the world’s top-selling drug atorvastatin (Lipitor®; over 125 using enzymes or microorganisms usually take place at ambient billion US$ sales volume in 14.5 years [1]), is about 200 tons p.a. conditions: they require low pressure of 1 atm (101,325 kPa) and and it is being made by several ine chemicals producers. This a temperature that is 37 °C or less. An immediate consequence intermediate is also produced through biocatalysis [2,3] and thus is a smaller amount of energy consumption and relaxed safety clearly belongs to White Biotechnology. measures. These factors, in turn, help enterprises to save capital Green Biotechnology: Green Biotechnology is reserved resources. for genetically modiied plants, which are used either as such (“optimized” for certain purposes) or as production factories 2) Enzymes, when used as tools for conversions of for other substances, e.g. therapeutic proteins. While IB could substances, are one main cost factor in IB. However, due to use genetically modiied plants as favorable feedstock for their unequaled speciicity as compared to chemical catalysts, biotechnological conversions, it does not depend on them. In enzymatic reactions may result in puriied product streams addition, due to many factors, Green Biotechnology is refused containing less or no byproducts. This feature allows for by the great majority of Germans, and has no “robust societal technically simpliied, cost-eficient downstream processing. This acceptance” [4]. effect may compensate for high upstream process investments in biotechnology unit operations that utilize biocatalysts. Differentiation: IB versus Bioeconomy 3) By using renewable biomass resources, enterprises IB is often considered in the same context as the term become progressively independent of fossil feedstock. Fossil bioeconomy. However, bioeconomy only mirrors the use of resources are not only inite but they are also linked to both renewable resources (like agricultural or forest-based material) supply and price volatility, which prevents solid business as feedstock for the industrial production phasing out fossil planning. By contrast, the sourcing of local renewable resources resources (like natural gas and mineral oil) from industrial processes [5,6]. A direct consequence of the bioeconomy concept provides for stable feedstock supply and enables enterprises to is supposed to be a reduced carbon footprint with its apparent reduce transport cost. climate and socioeconomic beneits. Thus, the “bioeconomy” 4) The utilization of renewable plant resources provides is a visionary concept following economical-environmental exploitation of nature’s unsurpassed synthetic versatility. and political targets. In contrast, IB is “merely” a technology, Hence, materials and products with novel chemical and physical process or method with no political goals. The bioeconomy does properties can be manufactured. Consequently, companies have not preclude a priori the application of conversion methods the opportunity for genuine innovations rather than “drop-in” other than biocatalysis, like conventional chemical and physical solutions. This may open up new markets and enhance their techniques. Likewise, IB may be combined with such methods, global competitiveness. but it still remains a cohesive approach. In addition, IB does not necessarily demand the use of renewable and/or organic At present, chemical companies apply IB to various extends. materials, but also allows for inorganic substances, like carbon However, we think that the application of IB can be extended dioxide, carbon monoxide or hydrogen, or even mineral oil as to other trade sectors of e.g. base materials and industrial, possible feedstock for biochemical reactions. Consequently, IB capital and consumer goods, food and feed production (that is, overlaps and complements the bioeconomy. This may be one all subsections of the “Processing Industry”). Additionally, the reason why they are – conceivably – used interchangeably by energy, water and the building industry could also beneit from some authors and, particularly, why IB is considered a stimulus biotechnological applications to keep pace with a post-petroleum or impetus1 for the bioeconomy. Indeed, the two approaches era and society [8]. This is why the IBB Netzwerk GmbH commits may develop their maximal beneit for the economy when they to promote this shift in resource and technology paradigm. are combined, i.e. by initiating both product versatility and environmental protection as well as improving regional self- Relevance of IB for Environment and Climate suficiency (= independence from imports and transports). This IB in combination with the bioeconomy strategy exerts beneit is exposed when domestic renewable resources are a positive impact on environment based on the following converted by cost-eficient biocatalytic processes to value adding arguments: products. To promote and catalyze just these synergies through dialog between academic, industrial and political partners is the 1) Biotechnological reactions occur mainly in aqueous focus of the Network IBB. solutions, not in organic solvents3. In addition, the enzymes pose IMPORTANCE OF IB 2 See a representative list on http://www.ibbnetzwerk-gmbh.com/en/industrielle- What exactly is the potential of IB in combination with biotechnologie/anwender-der-industriellen-biotechnologie/. bioeconomy? 3 Researchers also try to ﬁ nd “extremophile” enzymes e.g. surviving exposure to very high temperatures, or enzymes that are able to work in organic solvents 1 German: “Impulsgeber” metabolizing otherwise water-insoluble substances, like e.g. intermediates of ﬁ ne

Page 14 Central no hazard for the environment as opposed to often toxic, metal on today’s agriculture: The demand for agricultural crop land, containing chemical catalysts. Certainly, all biotechnological pesticides, energy, fertilizer, food and feed – and generally for processes must be subject to separate and thorough analysis natural resources – will increase enormously. The solution to regarding their environmental footprint according to several these challenges are innovations, like those offered by the IB parameters4. With some exceptions, however, most IB processes, including e.g. valorization of agricultural products manufacturing is in general environmentally friendly (“Green as well as the almost complete material and energy processing Chemistry”, “Green Economy”, [9]). of renewable raw materials in bioreineries. Similarly, the production of second and third-generation biofuels, such as bio- 2) IB works with foresight to prevent aftercare, that is, butanol, can sustainably relieve the global hunger for energy. production should ideally yield no waste, which would have to Thus, modern technologies such as IB pave the way to a more be disposed. Currently, the integrated bioreineries represent the eficient, more economical and at the same time sustainable best model for this concept: Constituents that are not converted agriculture and rural development. to the intended material and that would accumulate as waste (e.g. IB and the “food or fuel” debate: An issue of the bioeconomy lignin) are used for the necessary process heat. that affects IB is the discussion, whether industry is permitted 3) In case waste is produced, IB may provide methods for to consume edibles to produce engine or jet fuels. Apparently, safe removal or remediation, again by use of enzymes or other the obvious answer is ‘no’. However, one should be also aware biologic material. One topical example is the environmental of a recent study about whether food crops should be used for pollution by plastic waste. Moreover, a possible solution for bio-based applications other than food and feed. The quite avoiding this problem beforehand is the use of biopolymers for heretic though well-founded proclaimed view is that “all kinds of the manufacturing of bioplastics [10]. One noteworthy example biomass should be accepted for industrial uses; the choice should are the polyhydroxyalkanoates (like PHB [11]), which naturally be dependent on how sustainably and eficiently these biomass occur as storage compounds in certain microbial systems like recourses can be produced” [14]. Anyway, efforts in our Network Pseudomonas sp. As these biopolymers are rapidly biodegradable, IBB concentrate on the development of cost-eficient procedures they cause no harm for the environment. to use plant residues and other “waste” streams in industrial processes like the sunliquid® process of Clariant. This formidable 4) In summary, the smart combination of IB-based value process converts straw into cellulosic ethanol, a key biofuel and chains provides for optimized use of both renewable as well as chemical building block5. Further, the “Advanced Biomass Value” non-renewable resources. IB methods therefore promise a more (ABV) process converts algae biomass in an integrated bioreinery eficient use of the biomass potential compared to conventional concept aimed at the production of renewable aviation fuels, 6 methods of material and energy use. In the context of a circular high value bio-lubricants and CO2-adsorbing building materials . low economy, the cascade and coupled use of biomass contributes The particularly energy eficient ABV process, which does not to a complete and high-quality reutilization of raw materials. This produce any waste streams, is further discussed in this article. sustainment of natural resources improves economic viability With respect to other issues regarding agriculture and and preserves environment and climate [12]. bioeconomy, e.g. the feared rise in prices for foodstuff due to 5) In contrast to the consumption of fossil resources, use of increasing demand of bioenergy or the ongoing so-called indirect renewable resources, particularly plant material for production Land Use Change (iLUC) debate, we refer to the “News” section 7 of bio-fuels and other bio-based products, does not raise of our website . atmospheric CO2 content in toto, because as much CO2 is released Relevance of IB for National Economy as has been assimilated by the plants prior to combustion. Hence, these production processes are carbon neutral. IB is a key enabling technology delivering important impulses for the political and societal structural change from an oil- to a bio- 6) Finally, it is apparent, that the bioeconomy, combined based economy. In Germany, IB product sales totaled 143 million with the environmentally compatible methods of IB, is a principal Euros in 2010 and rose to 177.5 million Euros in 2011 (24 % methodology to decouple economic growth from atmospheric increase). For comparison: the entire biotechnological industry

CO2 increase. (including the medical biotechnology) generated in Germany a turnover of 2.4 billion Euros in 2010 and 2.6 billion Euros Relevance of IB for Agriculture and Rural Develop- in 2011 [16]. In fact, a study of the Organization for Economic ment Co-operation and Development (OECD) of 2009 predicted that Until 2050, the world population will grow from seven billion by 2030 IB will add up to 39 % of the total gross added value to nine billion people [13]. This development puts pressure of the output of chemicals and other industrial products that can be manufactured using biotechnology. Interestingly, the chemicals and drugs. As a matter of fact, this has been investigated and employed in numerous academic and industrial laboratories. Enzymes in organic 5 For a complete and authentic description of this powerful process, cf. the article solvents may display novel, interesting properties, like increased stability or by Rarbach & Söltl in this issue. See [15] for a comprehensive overview about altered speciﬁ city depending on the solvent. The latter phenomenon has been bioethanol and other biofuels, covering aspects from enabling technologies to dubbed “medium engineering” and may be used as an alternative to protein en- different technology and processes options,as well as economical and policy per- gineering. While such features may be quite valuable for the process in question, spectives. the aforementioned advantages of mild conditions and aqueous reaction medium using enzymes is, hereby, compromised. 6 Cf.: http://www.ibbnetzwerk-gmbh.com/en/sub-networks/advanced-biomass- value/ 4 Cf. http://www.ibbnetzwerk-gmbh.com/en/industrielle-biotechnologie/fragen- stellungnahme/oekobilanz-analysen/. 7 Cf.:http://www.ibbnetzwerk-gmbh.com/en/news/alle-nachrichten/

Page 15 Central study forecasted only a 25 % share for the health sector. Thus, non-genetically modiied food supply, effects of GMOs on the the economic potential of IB is immense and steadily growing. environment and nature, the rigor of the regulatory process, and However, in 2009 only about 2 % of the total R&D investment consolidation of control of the food supply in companies that of the OECD biotech companies were invested in the ield of IB, make and sell GMOs8. In the area of IB, there are three different whereas the lion’s share of 87 % of investments lew into the levels, at which GMOs might come across in daily live: health sector [17]. In Germany itself, this imbalance is even more 1) Substrate level. As mentioned above, IB does not extreme. need genetically modiied plant material as starting material. IB can contribute substantially to job retention and/or Conventional breeding outcomes are suficient for IB’s purposes. creation in high qualiication as well as in rural sectors, can 2) Level of conversion tools (microorganisms, enzymes). spur investments in European Economy and can strengthen the Biocatalysts may be developed and optimized (“evolved”) by European competitiveness. However, IB still needs support and a directed or random mutagenesis and selection. In fact, several mindset change to unfold its potentials. companies, mainly outside Germany, apply “Synthetic Biology”, EXAMPLES OF IB CONSUMER PRODUCTS a sort of advanced genetic engineering, for the production IB products can be found in every household and are an of valuable biochemicals, biopolymers, therapeutics, and inseparable part of our lives. Examples are: performance materials [18]. However, evolution of biocatalysts may also succeed without deliberate construction or introduction • Washing and cleaning agents: Biotechnologically of foreign genetic material into a microorganism, so that such produced enzymes are mixed with the detergent and treatment does not result in genuine recombinant organisms. decompose fats, proteins and carbohydrates at low Moreover, these “evolved” tools, recombinant or not, are not used temperatures. in outdoor tests but in closed containers; hence, there is virtually • Textiles: the stonewashed effect on denim is achieved no risk for consumers or for nature through their accidental using cellulases. spreading. • Odor stopper sprays for carpets, shoes or sofa covers 3) Level of products. If enzymes are the manufactured contain cyclodextrins, which absorb odors and thus item to be sold, e.g. as additives in washing powders, these may neutralize them. have been genetically modiied; yet they cannot proliferate. Other chemicals and food/feed additives should be free of GMOs. • Cosmetics often contain biotechnologically produced hyaluronic acid for moisture regulation. EMBEDDING IB IN SCIENCE AND RESEARCH • Many food and feed additives are now produced Innovation often commences with results of research biotechnologically, such as citric acid as an acidiier in originating from scientists’ curiosity and imagination. However, beverages, natural lavors such as vanilla or strawberry a technical problem or commercial question may also initiate lavor or phytase as a feed additive in pig breeding. research activity. In fact, given the huge challenges posed by the intended transition towards a sustainable, post-petroleum • Vitamins, such as vitamin C and vitamin B2, are produced economy, such research is urgently required. Obviously, research biotechnologically. does not only take place in academic institutions but just as well • Bioplastics can be found in yoghurt cups and carrier bags. in companies themselves. On the “News”9 area of our website, Recently, a toothbrush and an airbag were made from a plethora of examples demonstrates how IB/bioeconomy bioplastics. may inspire research in this instance – and thus illustrates the reciprocal positive interplay of science with the economic sector. Thus, consumer needs promote the advancement of IB. However, as IB production processes may involve genetically B.IBB NETZWERK GMBH modiied organisms (GMOs), there are rising concerns in the German population that these may affect health or environment. The Motive and the Genesis of IBB Netzwerk GmbH In general, there is controversy over GMOs, especially with regard The German Federal Ministry of Education and Research to their use in producing food or additives for food and feed via (BMBF, Bundesministerium für Bildung und Forschung) is the IB processes. The key areas of controversy related to GM food main governmental institution for funding of R&D. In 2006, the are whether GM food should be labeled, the role of government BMBF announced the supportive measure “BioIndustry 2021 regulators, the effect of GM crops on health and the environment, – Development of new products and processes in IB” aimed to the effect on pesticide resistance, the impact of GM crops for awaken the interest of German enterprises and researchers farmers, and the role of GM crops in feeding the world population. in IB. This competition was supposed to selectively support On one side, there is broad scientiic consensus that food on strategic clusters or networks of industry and academy. Twenty- the market derived from GM crops poses no greater risk than one consortia applied for a grant and the following ive won a conventional food. Nevertheless, opponents of GM food claim, risks have not been adequately identiied and managed, and they 8 Cf.: Genetically modiﬁ ed organism. (2014, May 9). In Wikipedia, The Free En- have questioned the objectivity of regulatory authorities. Some cyclopedia. Retrieved 09:23, May 9, 2014, from http://en.wikipedia.org/w/index. health groups say there are unanswered questions regarding php?title=Genetically_modiﬁ ed_organism&oldid=607730536,see sub-section the potential long-term impact on human health from food “Controversies” derived from GMOs. Concerns include contamination of the 9 Cf.: http://www.ibbnetzwerk-gmbh.com/en/news/alle-nachrichten/

Page 16 Central prize money for a ive years-funding of R&D projects starting in Alexandria in the 1st century AD. However, mankind had to wait 2007/2008 (Figure 1): for about seventeen centuries until this invention was deployed in industrial applications. The commodity “wheeled suitcase” • Biocatalysis2021 in Hamburg is an even more incredible example: Although the wheel was • Biopolymers/Biomaterials in Stuttgart invented six thousand years ago, suitcases only carry casters since perhaps twenty-ive years. And nobody would argue that • CIB Frankfurt there has been no unmet need in the market the years earlier. • CLIB2021 in Düsseldorf Therefore, beside systematic, rigorous and diligent screening and scanning (academic) ideas as well as looking at the market • Cluster Industrial Processes with Biogenic Building needs and doing match-making of our members, we also train Blocks and Performance Proteins (IBP) in Munich (now our imagination to run wild though creatively. This is a great deal IBB Netzwerk GmbH) of the added value we provide to the members of the Network IBB, and this is why most of the approached persons enter and Concerning the Bavarian cluster, by that time called “Cluster stay in the network. IBP”, it was reasoned by the Free State of Bavaria and the Bavarian chemical industry to create a dedicated management Core Technology Transfer Tools organization for IB as distinct company. This was considered Coordinated and orchestrated technology transfer can be necessary due to novel and speciic duties coming up as well as realized utilizing the following tools: a symbolic act of the recognition of the relevance and weight of IB. Accordingly, the Bavarian State Ministry for Economic Affairs R&D projects: The apparently most straight forward way and Media, Energy and Technology (BayStMWi) as well as several to transfer technology is to draft and execute an R&D project. companies, among them the globally active specialty chemical Starting from an idea that may lead to a new innovation in IB companies Clariant AG and Wacker Chemie AG supported the or bioeconomy, IBB Netzwerk GmbH teams suitable partners, usually from both industry and academy. Then, IBB Netzwerk establishment of such a company. As a result, the “IBB Netzwerk GmbH organizes meetings, in which, together with all partners, GmbH” was founded. Thus, the IBB Netzwerk GmbH is the a project with deined goal, time frame and costs is drafted. product of a successful and strong public-private partnership In September 2013, ive years after foundation, almost 400 initiated on 4 June 2008. such meetings and negotiations have been recorded by the ASSIGNMENTS, MODE OF OPERATION IBB Netzwerk GmbH. The outcomes of these meetings will be described in combination with the network chapter below. IBB Netzwerk GmbH’s objective is the transformation of valuable scientiic knowledge and inventions to innovative marketable products and processes, i.e. the mediation and facilitation of the technology transfer in the area of IB. Prerequisite: Building, Fostering and Expansion of the Network The irst requirement for technology transfer is to bring together the two ends between which the transfer takes place, i.e. scientists and businessmen. This process leads to formation of a target orientated network, at present consisting of nearly 100 members. We further expand and strengthen our network, seeking even more expertise and original ideas. The members are recruited by different ways and can see and get to know each other e.g. in frequent meetings, expert conferences and other events we organize for our network (or selected sub- groups), where the “technology push” encounters the “market pull” to inseminate each other. Accordingly, within this network, we bundle the competences and the potentials of industry and academia to realize technology transfer nation- and Europe- wide. Membership in the Network IBB is free of charge. The Power of Intuition Although the results of technology transfer may seem self- evident in hindsight, they do not materialize instantaneously or automatically. The lapse from an idea, even from a (patented) invention, to innovation, i.e. successful market introduction of a consumer good (or process) may be cumbersome. An extreme example is the steam engine. The power of steam to move devices was actually known and applied (as a toy turbine, called aeolipile) Figure 1 Location of the ive winners of the BMBF-competition “BioIndustry 2021”. already by the Greek mathematician and engineer Heron of

Page 17 Central

If the R&D project is linked with technical and/or commercial and efforts, start-ups and spin-offs of IB are a long time coming. risks or if the targeted products have no existing market, public To our knowledge, other “BioIndustry 2021” clusters suffer the grant support is sought. The IBB Netzwerk GmbH daily screens same setback. We can spot several reasons, general ones as well incoming information and is, thus, up-dated concerning national as speciic for IB: and European funding programs and measures with relevance for IB and bioeconomy. They are stored systematically in an own • Still unfavorable political frame conditions (e.g. taxation), data base and are freely accessible for members of the association especially for young, innovative companies and for VCs as (see section Shareholder: The “Förderverein Industrielle compared to other countries [20]. Biotechnologie Bayern e.V.”). As a matter of fact, IBB Netzwerk • IBB Netzwerk GmbH has not got an own seed fund to be GmbH is actively involved in the coordination and the preparing able to support promising start-ups at its own judgment. of grant proposals of its network members. • Most SMEs in IB tend to become service provider (e.g. Plant facilities: R&D projects may pave the way but are enzyme producers) due to the very high costs, if industrial not suficient for the success of IB. For many products of IB/ manufacturing of a bulk chemical is sighted. Others target bioeconomy, especially bulk chemicals, market entry is feasible the optimization of a process. Yet service providers and only after the demonstration of the cost-eficient fabrication in process developers are in general not attractive business industrial scale, i.e. several thousand tons or more. This means cases for VCs who, for example, pin their hopes on the that, after completion of an R&D project aiming at a new product, later selling of a blockbuster. the large scale production of the latter in a costly (pilot) plant facility is the next compulsory step. Understandably, only big • By and large, the German chemical industry is itself industry or a strong SME can tackle and lead this endeavor. The innovative. IB projects are often internally pursued. Thus, arrangement of such big projects may also be included in the aspiring founders may imagine altogether a better life as scope of IBB Netzwerk GmbH’s tasks. employees in the industry than as entrepreneurs. This leads directly to the last entry. Company settlement: The easiest way for technology transfer is to attract a company with an interesting product • The “German attitude” at present: After the turbulences or process from abroad to settle down in the own region. In of the 20th century, German society sought (and largely consequence, the value creation must occur in the new location. found) the political “middle”, in which privacy, wealth, IBB Netzwerk GmbH has had some success in this instance. peace and freedom prevail. At the same time, however, Start-ups and spin-offs: The most laborious process in this middle the “statistical normal” is raised to a “good for technology transfer is the foundation of a new company, a standard” to go for. Nowadays, almost everybody strives start-up (“spin-off” out of an academic institution), based on a to reach this standard [21]. Therefore, people who do not (ideally: proprietary) business idea. Perhaps the main reason quail in front of the entrepreneurial risk, not only are rare is that typically equity is needed (debt capital is usually out of in the “middle”, they are also despised when they fail. Yet reach due to absence of securities), and this means that a venture the aspired “normality” is delusive and in fact jeopardized capital (VC) partner and/or a “business angel” must be convinced by the steady threat of economic ruin. Therefore, we of the company’s commercial potential. Equity is lost, if the start- consider it essential to continue and boost every effort to up fails. In fact, technology transfer via start-ups and spin-offs promote innovative actions, also and in particular by the has been and still is a “sore spot” in Germany, inter alia due to a tool of foundation of companies. culture that does not accept risks as opportunities. According to a Supporting Measures for Implementation of study published in 2007, in six leading European countries 5.1 % Technology Transfer of the patents gave rise to a new company. This share was larger in the UK (9.7 %) and Spain (9.3 %). It was smaller in Germany Beside the core activities for technology transfer, IBB (2.7 %) and France (1.6 %). In Chemicals and Pharmaceuticals Netzwerk GmbH does a lot of accompanying work to enable the only 3.1 % of the patents are used to create a new irm [19]. success of IB. The activities not only serve the purpose to abolish Today, concerning all biotechnologies this situation stays the or alleviate hurdles of market entry of products or procedures of same or similar [16]. IB but also to inform and sensitize as much as possible industry Accordingly, and in spite of existent pre-seed and early branches about their economic and sustainability opportunities stage federal supporting instruments (e.g. GO-Bio, Exist- within the growing family of enterprises applying IB. Forschungstransfer, HTGF10) as well as despite intensive scouting Information gathering, processing and dissemination : IBB Netzwerk GmbH ilters and processes 10 “GO-Bio” (www.bmbf.de/de/go-bio.php) and “Exist-Forschungstransfer“ incoming information for the network, the public, stakeholders (www.exist.de/exist-forschungstransfer/) are funding measures of the German government to encourage and support the foundation of spin-offs in Life-Science and political decision makers. This information includes and other technical areas. Successful applicants receive, after a highly-demand- permanent documents, news from business areas and society, ing selection procedure and between three to seven years, ample fi nancial re- from science, research and education, and relevant political sources from the ministries BMBF or BMWi, accordingly, with the aim to develop their business ideas to a stage, at which they may become mature and attractive measures as well as announcements of events. Media of for equity fi nancing. During this period, the prospective company team may stay dissemination of such information comprise a monthly electronic at the academic institution and use the existing infrastructure. So far, out of 46 funded GO-Bio projects 22 spin-offs came out. Since 2005, “HTGF” (www.hightech-gruenderfonds.de/) provides VC for young technology enterprises and sup- Within the fi rst six years, HTGF fi nanced successfully and got off the ground ports the management team by a strong network and entrepreneurial know-how. about 250 high-tech companies.

Page 18 Central newsletter with possibility to subscribe to, targeted mailings and enjoy special beneits, like discount on all events organized by IBB not least our highly instructive website. Netzwerk GmbH and free access to the list of funding measures and other useful functionalities of our website. Every legal or PR, organization of events: IBB Netzwerk GmbH natural person who is or plans to be active in the ield of IB can organizes expert or public events (i.e. meetings, workshops, become member of the Association. The annual membership fees lectures, booths in fairs and speciic press conferences) single differ between companies, universities and institutes and are handedly or in collaboration with other partners. The goal is graded according to company size and annual turn-over. to demonstrate the relevance of IB and to raise its visibility and acceptance. Furthermore, we also increase the awareness C. NETWORK IBB: A SUCCESS STORY level for our network members and their companies by either Members presenting their achievements on our website, in articles we write or in talks we give, or by placing them in conferences as Growth over time: By the course of actions described above, 14 speakers. Within ive years, IBB Netzwerk GmbH has organized, the Network IBB grew over time to almost 100 members to date arranged or prepared 120 events, contributions in media or (Figure 2). press releases. The result is that the Network IBB is known and The Network includes large industry, SMEs, universities, acknowledged way beyond the borders of Bavaria. research institutions and others. It is noticeable, that the number Promotion of the dialogue enterprises-politics: of the enterprises (large industry and SMEs) more than tripled over 5.5 years, and that the number of SMEs therein quintupled. IB is an innovative and „disruptive” technology. Therefore, in order to prosper, it is indispensable that the appropriate political Groups of enterprises: Under the umbrella of the Network conditions and regulatory framework be set11. For that, IBB IBB, there exist several sectors of industry members with the Netzwerk GmbH arranges opportunities for dialogue of industry corresponding expertise (Figure 3). and politicians, either by organizing parliamentary evenings, SUB NETWORKS AND SPECIALIZED ACTIVITIES workshops or other speciic meeting occasions on national or European level. In ive years, this exchange has been supported IBB Netzwerk GmbH initiated or played a major role in the by more than 80 recorded meetings and discussion forums. formation of a number of R&D project consortia with specialized content and speciic objective (cf. above). Thus, the Network Educational measures: The early contact with, and IBB now represents a kind of superstructure, composed of engagement of scholars and students in IB is imperative, if it is to partners who are working on one or several projects in the be sustained and carried further. However, operation possibilities ield of IB/bioeconomy, or have the intention to do so. From of IBB Netzwerk GmbH on that level, e.g. co-design of academic about ive partners upwards involved in a project, especially if curricula, are limited. Nevertheless, through seminars, other there is a common thematic focus manifesting in several related related events, as well as by instigating ideas and initiatives, we but separate projects, we speak of “sub-networks”, which are attempt to acquaint and familiarize this circle of persons with managed and/or administrated by IBB Netzwerk GmbH. Here, this fascinating ield. we summarize some examples of sub-networks and of other COMMISSIONING IBB NETZWERK GMBH activities to illustrate our and the network’s accomplishments and performance. IBB Netzwerk GmbH’s service palette12 can be hired. IBB Netzwerk GmbH supports the implementation of every sort Finalized: Cluster “Industrial Processes with Biogenic Building Blocks and Performance Proteins” (IBP) of innovative idea on the area of IB by experience, networking, expertise and professional competence. Upon request, IBB As explicated above, the present Network IBB based originally Netzwerk GmbH elaborates a working concept together with the on the cluster competition “BioIndustry 2021” of BMBF. At client and offers a deal. Orders are always carried out in close that time, the Bavarian network, one of the ive winners of this collaboration with the client. competition, bore the name “Cluster IBP – Industrial processes with biogenic Building Blocks and Performance Proteins”. SHAREHOLDER: THE “FÖRDERVEREIN INDUS The current Managing Director of IBB Netzwerk GmbH, Prof. TRIELLE BIOTECHNOLOGIE BAYERN E.V.“ Haralabos Zorbas, had initiated and coordinated the Cluster The sole shareholder of IBB Netzwerk GmbH is the IBP in his former function as project leader of the Bavarian Förderverein Industrielle Biotechnologie Bayern e.V.13. Its Biotechnology Cluster. members include industry as well as academic institutions. Under the coordination of the IBB Netzwerk GmbH, a total of Besides instructing and steering the operative work and nine R&D projects were approved and funded within “BioIndustry assignments of IBB Netzwerk GmbH, members of the Association 2021” by public money of the BMBF and the BayStMWi. The total project volume was 21.2 million Euros, with a total funding rate 11 Interested readers may have a look on http://www.ibbnetzwerk-gmbh.com/ en/industrielle-biotechnologie/industrielle-biotechnologie-und-politik/whats-nec- of 48 %. essary-need-for-further-measures/. 14 We prefer the designation „network“ rather than „cluster“ to indicate that, 12 Cf.: http://www.ibbnetzwerk-gmbh.com/en/ibb-netzwerk-gmbh/dienstleistung- although Bavaria-based, the members and partners are spread all over Germany sangebot/ as well as over neighboring countries, like Austria, Belgium, France, Switzerland 13 “Registered Supporting Association Industrial Biotechnology Bavaria”. Cf.: and the Netherlands. The common thematic focus and broad expertise weighs http://www.ibbnetzwerk-gmbh.com/en/association/ more than the localized concentration.

Page 19 Central From today’s perspective the “Cluster IBP” was the irst sub- network in the current Network IBB. “Advanced Biomass Value” (ABV): Sustainable Production by Energetic and Material Use of Algae Biomass The focus of the academic and industrial consortium “ABV” is the complete valorization of algae biomass components in a waste free and energy eficient integrated bioreinery concept. Algae biomass represents a new, “third generation” biogenic feedstock, with hallmarks such as high biomass yields, low lignin content, and improved land use eficiency. Hence this biomass feedstock does not compete with food and feed production or agricultural activities in general. The absences of lignin allows simpliied biomass processing and seemless integration of all biomass Figure 2 Development of the Network IBB (state end 2013). components in a value adding bioreinery concept for production of aviation fuels, high performance lubricants and new, CO - 2 adsorbing building materials, which ultimately improve the CO2- footprint of the entire process chain. The aim of the nine project partners under the leadership of the Department of Industrial Biocatalysis at the Technical University of Munich (TUM) is the energy-eficient production of algae biomass, its subsequent components fractionation and processing to a complementary product portfolio. Primarily, algae lipids are converted into high- performance lubricants. Then, the remaining algae biomass is further processed to bio-kerosene via a fermentative procedure employing oleaginous microbial biocatalysts. The side products accumulated in the chemical biomass conversion to renewable aviation fuels is utilized in the production in CO2-adsorbing building materials. As a result, all resources are converted to value adding products in non-competing, synergistic commercialization strategy. ABV is funded with 4 million Euros by the BMBF and runs until 2016.

IBB Netzwerk GmbH supported the project consortium in Figure 3 Sectors of industry members. Note that allocation to a certain sector identifying partners and in the submission of the grant application. is approximate and that some enterprises were assigned twice due to more than During the project phase, the company is responsible for the one focus of activities. acquisition of new partners and the external representation. IBB Netzwerk GmbH supported the partners in planning and Strategic Alliance “Technofunctional Proteins” structuring the alliance and the proposal and will take over the (TeFuProt) administrative project management on sub-contractual basis. In The strategic alliance TeFuProt is one of hitherto ive suc- addition, IBB Netzwerk GmbH is the designated contractor for cessful applicant consortia to the supportive measure “Innova- implementation-enhancing measures. After the inal revision of tionsinitiative Industrielle Biotechnologie” of the BMBF. In May the application and last arrangements, the alliance is expected to 2013, the alliance was oficially presented by the State Secretary start this year. Dr. Georg Schütte. 14 project partners plan to work together to ZIM Cooperation Network “BioPlastics” gain protein isolates and modiicates from agricultural plant resi- At the beginning of 2014, the Federal Ministry of Economic dues. Then, the proteinaceous material shall be optimized in such Affairs and Energy (BMWi) approved the cooperation network a way, that it can be used as base or additive for paints, cleansing “BioPlastics”. The interdisciplinary cooperation network wants agents, building materials, lubricants, plastics etc. The partners to signiicantly increase the market share of bio-based polymers. want to launch protein derivatives on the market with properties At present, the focus of the 20 partners lies on technical projects that cannot be achieved so far by conventional materials. for the development of innovative and low-priced biopolymers. The industrial partners cover the entire value chain for These shall be used in bulk production of goods such as packaging optimized protein products: from the supply of raw materials material. over puriication and modiication up to the technical use in IBB Netzwerk GmbH was commissioned by the participating numerous industrial applications. The activities of the companies partners for the network management. This includes expansion are supported by research institutes. of the network, promotion of the network interactions and

Page 20 Central designing R&D projects. In addition, the IBB Netzwerk GmbH will inform the public and develop concepts to facilitate market on Sustainable Provision of Raw Materials for the entry. For this, the company receives a total of 150,000 Euros Material Use of Biomass” (INRO) from BMWi and the network partners, initially for one year. After Another activity of IBB Netzwerk GmbH is the contribution a successful irst year, further funding over two to three years to INRO15, a network for voluntary sustainability certiication of is possible. Funding is provided within the program “Central material use of biomass by the industry, supported by the Federal Innovation Program SME” (Zentrales Innovationsprogramm Ministry of Food and Agriculture (BMEL) of Germany since Mittelstand - ZIM). 2011. The objective of INRO is reaching a voluntary certiication The biopolymer base elaborated in the upcoming R&D agreement with companies, which are using renewable raw projects must have the same or even better properties than materials in their production process. This certiication should conventional petrochemical plastics. In addition, the production include the dealing with biomass from the cultivation through of biopolymers and the materials themselves have to fulill strict to the primary processing. This means that the current amount sustainability criteria. Thus, by this activity IBB Netzwerk GmbH of almost 3 million tons of agricultural raw materials, which the is working in a ield with enormous environmental relevance, German industry processes into products at present, should be since products made from petrochemical plastic are hardly certiied by INRO soon. degradable and pollute the environment. Until now, a catalogue of sustainability measures has been Upcoming Projects established, covering social, economic and environmental criteria, e.g. no forced/child labor, anti-corruption measures or Besides the ongoing projects, there are also some more ideas protection of wetlands. in our network’s pipeline. E.g., based on the indings of a feasibility study about converting agricultural residues into platform Specialized Activity: Efforts in the Educational Sector chemicals (like n-butanol) and bioenergy, a new large R&D project Until now, several goals in research and education were is planned. In addition, within the sub-network BioPlastics, R&D realized. For example, a new master’s program in IB at the projects on several areas like packaging articles, glues, ibers etc. Munich School of Engineering of the TUM was established [22]. are being prepared. Furthermore, the sunliquid® demonstration This program was launched in the 2010/2011 winter semester. plant of Clariant for converting agricultural residues into climate- Additionally, a Research Center for IB with a screening laboratory friendly cellulosic ethanol in Straubing, Bavaria, with an annual and a pilot station with a fermentation module of up to 1,000 capacity of up to 1,000 tons of advanced biofuel, conirmed the liters were brought on stream [23]. IBB Netzwerk GmbH helped maturity of this new and innovative technology and shows that it inding the inancing of the latter. is, in a next step, ready for commercial deployment. MOBILIZED CAPITAL Specialized Activity: Member of “Bio-based Industries Consortium” (BIC) By the end of 2013, the Network IBB has mobilized more than 100 million euros for R&D projects, plant facilities and In 2013, ten organizations/SMEs of the Network IBB structural measures in the ield of IB (Figure 4): authorized IBB Netzwerk GmbH to represent them in the international non-proit association BIC. It is the private part of • The total volume of 17 R&D projects of the Network IBB the European public-private partnership Bio-based Industries was about 47 million euros. (BBI). BBI will be established soon in 2014 within HORIZON 2020, • 43.5 million Euros lew into the (re)construction of three the next framework program for research and innovation of the different industrial plants (incl. accompanying research) European Commission. It was initiated to realize the transition and one plant of the TUM. towards a post-petroleum society, while decoupling economic growth from resource depletion and environmental impact. As • 10 million Euros have been spent for technical-structural a regular member of BIC with voting right, IBB Netzwerk GmbH measures, such as the master’s program “Industrial will, in accordance with the represented organizations, support Biotechnology” at the TUM or the ZIM cooperation the ambitions of BBI. network “BioPlastics”. These ambitions are to use and exploit the potential of For these achievements, partners from different industries Europe’s bio-based industries through research, innovation and such as biochemistry, microbiology, chemistry, biochemical demonstration along the whole value chain in order to build a engineering and process engineering, mechanical engineering more competitive, eficient and sustainable Europe by 2020. BIC and plant construction worked and are still working together. has the objective to prepare, set-up and assist in the execution of Of the mobilized money, 53 %were private equity and 47 % BBI. Until 2020, about 3.7 billion Euros shall be invested in new were public funds from the BMBF, from the BMWi and the and sustainable ways to organize a new, bio-based economy. BayStMWi as well as from the BayStMELF for a feasibility study. As mentioned, further projects are already in the pipeline. In favor of the ten organizations/SMEs, IBB Netzwerk GmbH takes part in the relevant meetings and events of BBI and D.CLUSTERS AND NETWORKS processes the gathered information for regular reports to the After this excursion in the activities of our company and our authorizing partners. network, let us have a view on an aspect of the economic policy: Specialized Activity: Participation in the “Initiative 15 Cf.: http://www.inro-biomasse.de/

Page 21 Central

The public support of clusters and networks. Why Innovation Clusters/Networks? Germany needs inventions and developments which must be successfully converted into marketable products and services to secure its present and future economic power and wealth. Only when new developments from research are taken up by the industry and ind their way into the market, jobs and growth are created. However, much technology is tacit knowledge and cannot be easily transferred. Innovation cannot be purchased. That is where clusters or networks come into play: They are not an end in itself, but their purpose is to enable and make technology transfer veriiably more eficient. The importance of “networks of innovators” for conducting product and process development was early recognized and questions on how network content, governance, and social structure emerge over time within the ield of entrepreneurship were studied systematically several years ago [24,25]. Within networks, there are some undoubted advantages, which promote Figure 4 Illustration of total money mobilized of all projects carried out at the Network IBB, broken down by federal funds (BMBF and BMWi) and funds from the above goal of technology transfer [26]: the BayStMWi (including limited funding from the Bavarian State Ministry of • Rapid low of information, fast access to new technologies. Food, Agriculture and Forestry[BayStMELF] for a feasibility study) as well as own resources of the project partners. (Date: February 2014). • Access to external knowledge is less expensive than buying the expertise, e.g. via merger. members can manifest at the end. • Access to market- and industry-related trends. Cluster Policy in Germany • A particular opportunity for companies in clusters is that The connection of science and industry in research and they can focus on their own strengths (specialization) development is part of the traditional strength of the German and can additionally expand their limited resources by innovation system. But the federal government wanted to the integration into an overall system. That is, they may combine the already existing strengths in science and industry overcome insuficiency of resources and inancing: one to accelerate the way from an idea to marketable products and irm is dependent on the resources of another, and it is to services. In 1996, the federal government of Germany announced, both’s beneit to pool resources. that in order to better use the existing excellent research potential • Consolidation of existing and initiating new contacts with in Germany, an early coupling of science and industry is essential. partners along a value chain. From then on, the promotion of co-operative networks in order to improve an innovation-friendly environment should play a • Increase in lexibility, fast reaction times. Networks are key role in research policy [27]. Accordingly, in Germany cluster more “twinkle-toed” than large organizations. policy measures exist on Laender and on federal level for almost • Rise in output (innovation capability, production). 20 years now and have worked as pioneer actions of cluster promotion in Europe (Figure 5). • Improved image and reputation of the members’ own institution and products. The involvement of SMEs is clearly in focus of this High- Tech Strategy. And all programs have in common a focus on the These features eventually lead to decrease “time to market” development of clusters/networks. These are industrially driven and increase of market power and competitiveness. Surely, consortia of companies and research institutions, centrally in order to enjoy these beneits, threads that lurk must be managed by a cluster organization [29]. Their aim is to reinforce surmounted. These threads include “lock-in” effects, separation, cooperation between science and industry. The resulting hidden agendas, mistrust, internal rivalry, inequity, opportunism; strengthened knowledge transfer between science and industry they all lead to instability and incoherence. Therefore, cluster on the one hand leads to a signiicant commercial success managing organizations must evolve rules and conidence- of innovations and on the other hand to a greater scientiic building measures, but also dodges, to anticipate and appease knowledge. This creates an added value for both sides [30]. such developments. The initiative “BioIndustry 2021” of BMBF16 in 2006 Conclusively, clusters are an important tool for the has been the irst cluster policy measure directly devoted development of speciic technologies and hence for modern to the IB in Germany. Within “BioIndustry 2021”, about 60 economic development. They offer special services to support million Euros public money was invested to let work together technology transfer and are a major link between academy, enterprises and institutions with expertise in disciplines like industry and politics. Companies and research institutions can easily tap the knowledge bundled in these clusters. However, 16 Cf.: http://www.ibbnetzwerk-gmbh.com/en/ibb-netzwerk-gmbh/geschichte/ whether a cluster strategy has been successful, only the cluster bmbf-competition-bioindustrie-2021/

Page 22 Central

Figure 5 Chronological illustration of the nationwide cluster measures in Germany 1995-2012 (modiied from [28]).

Figure 6 Life cycle of a network. Optimistic view (black continuous line) and realistic view (red dashed line) of public funding of the management organization [34]. life sciences, chemistry, physics, informatics and engineering in In an empiric study [33], a team led by Carola Jungwirth at interdisciplinary R&D projects [31]. With slightly different foci, the University Passau, analyzed, as an example, the temporary the ive established “policy-driven” winner clusters [32] have publicly funded Bavarian “Cluster Offensive”, which is expected been working together for the overall aim: support of IB. Indeed, to inance itself privately within a certain time-frame. Based on “BioIndustry 2021” contributed to bring ideas and research in-depth interviews with the cluster managers of the Bavarian results in the ield of IB to the market. Since that time, further Cluster Offensive, the authors found there is interference between supporting measures have also been released, particularly the the implementation of public and private goals, i.e. either to “Innovationsinitiative Industrielle Biotechnologie” addressing promote private enterprises and networks or to perform public bioeconomy in general. duties such as infrastructure development. Hence, the planned transformation from a publicly subsidized cluster initiative into a You may ind a selection of examples of national and privately inanced one is dificult to succeed under the prevalent international political measures and initiatives that directly or circumstances. As long as a cluster management organization indirectly support IB on http://www.ibbnetzwerk-gmbh.com/ is expected to perform public duties, it should still be publicly en/industrielle-biotechnologie/industrielle-biotechnologie-und- funded. politik/. In a workshop of the cluster management organizations of Financing of Cluster Management Organizations “BioIndustry 2021” on 15 September 2010 in Frankfurt, Gerrit A cluster organization performs the cluster management. Its Stratmann presented the supposed life cycle of a network [34] central role is the coordination and administration of the cluster (Figure 6). In an optimistic view, public funding of a management as well as providing goods and services. At the beginning of a organization should markedly decline after about four to ive clusters’ life, the cluster organization is usually inanced largely years. From experience, however, one can say that the trajectory by public money, because cluster members will not pay upfront. will rather follow the course of the red dashed line, i.e. public However, it is supposed to become gradually independent funding persists a lot longer than ive years. Besides, from the age thereof in the midterm (to become a “private club” inanced by of about 5 to 8 years of the initiative, it seems public funding of the enterprise members themselves), or to close down upon approx. 30-50 % is justiied and necessary to stabilize a cluster completion of the clusters’ goal. initiative as an innovation-political partner and to compensate for the provision of public goods.

Page 23 Central

In fact, after ive and a half years, IBB Netzwerk GmbH was 15. Scheper T. Advances in Biochemical Engineering/Biotechnology. able to substantially reduce its initial rate of public support, with Olssen L, Editor. In Biofuels Series. Springer-Verlag Berlin Heidelberg more anticipated decrease in the next years. According to the 108: 2007. remarks above, it seems we are on the right way. 16. biotechnologie.de: Die deutsche Biotechnologie-Branche 2012. Berlin 2012 ACKNOWLEDGEMENTS 17. OECD. The Bioeconomy to 2030, Designing a Policy Agenda. 2009; We express our gratitude to Wilfried Peters, Christine 201. Hasenauer and Thomas Brück for carefully reading and editing 18. Singh R. Facts, Growth, and Opportunities in Industrial Biotechnology. the manuscript. Org Process Res Dev. 2011; 15: 175–179. REFERENCES 19. Giuri P, Mariani M, Brusoni S, Crespi G, Francoz D, Gambardella A, et al. Inventors and invention processes in Europe: Results from the PatVal- 1. Lipitor becomes world’s top-selling drug. EU survey. Research Policy. 2007; 36: 1107-1127. 2. Ritter SK. Going Green Keeps Getting Easier – Presidential honors 20. Consult the reports of the “Expertenkommision für Forschung und reward advances in chemistry that promote pollution prevention and Innovation” from 2008 onwards. sustainability. Chemical & Engineering News. 2006; 84: 24-27. 21. Münkler H. Mitte und Maß. Rowohlt. 2012. 3. Bornscheuer UT, Huisman GW, Kazlauskas RJ, Lutz S, Moore JC, Robins K, . Engineering the third wave of biocatalysis. Nature. 2012; 485: 185- 22. Industrial Biotechnology (IBT) at the Munich School of Engineering 194. (MSE). 4. Acatech. Deutsche Akademie der Technikwissenschaften. 23. Research Center for Industrial Biotechnology at Technical University Perspektiven der Biotechnologie-Kommunikation -acatech Position, of Munich. Dezember 2012. 24. Freeman C. Networks of innovators: A synthesis of research issues. 5. Jordan N, Boody G, Broussard W, Glover JD, Keeney D, McCown BH, Research Policy. 1991; 20: 499-514. McIsaac G . Environment. Sustainable development of the agricultural 25. Hoang H, Antoncic B. Network-based research in entrepreneurship - bio-economy. Science. 2007; 316: 1570-1571. A critical review. Journal of Business Venturing. 2003; 18: 165–187. 6. Federal Ministry of Education and Research (BMBF). Nationale 26. Powell WW. Neither market nor hierarchy: network forms ForschungsstrategieBioÖkonomie 2030 – Unser Weg zu einer bio- of organization. Staw BM, Cummints LL, eds. In Research in basierten Wirtschaft. Berlin 2010 Organizational Behavior. 1990; 12: 295-336 7. Wohlgemuth R . The locks and keys to industrial biotechnology. N 27. Deutscher Bundestag 13. Wahlperiode. Bundesbericht Forschung Biotechnol. 2009; 25: 204-213. 1996. 1996, Drucksache 13/4554: 29 8. Schuurbiers D, Osseweijer P, Kinderlerer J . Future societal issues in 28. Lämmer-Gamp T. Leistungsfähige Cluster als Instrument der industrial biotechnology. Biotechnol J. 2007; 2: 1112-1120. Wirtschaftspolitik – worin unterscheiden sich deutsche Cluster von 9. Philp JC, Ritchie RJ, Allan JE. Biobased chemicals: the convergence of anderen? Ein Blick nach Frankreich und Norwegen. Cluster: Zwischen green chemistry with industrial biotechnology. Trends Biotechnol. hardfacts und soft factors - iit Jahresbericht 2012. 2013; 14-19. 2013; 31: 219-222. 29. Federal Ministry of Economic Affairs and Energy. 10. Philp JC, Ritchie RJ, Guy K . Biobased plastics in a bioeconomy. Trends 30. Deutscher Bundestag 17. Wahlperiode. Hightech-Strategie 2020 für Biotechnol. 2013; 31: 65-67. Deutschland – Bilanz und Perspektiven. Drucksache 17/13075 from 11. Lenz RW, Marchessault RH. Bacterial polyesters: biosynthesis, 2013-4-12: 21 biodegradable plastics and biotechnology. Biomacromolecules. 2005; 31. Federal Ministry of Education and Research.Weiße Biotechnologie, 6: 1-8. Chancen für eine bio-basierte Wirtschaft. 2012: 42 12. Zhang W, Bai FW, Zhong JJ . Industrial biotechnology: Current status 32. Chiaroni D, Chiesa V. Forms of creation of industrial clusters in and future development for the sustainability of human society. J biotechnology. Technovation. 2006; 26: 1064–1076. Biotechnol. 2009; 144: 1-2. 33. Jungwirth C, Grundgreif D, Mueller E. How to Turn Public Networks 13. United Nations Population Fund. Das Recht auf Entscheidung - into Clubs? The Challenge of Being a Cluster Manager. Social Science Weltbevölkerungsbericht 2012 Kurzfassung. Hannover 2012: 9. Research Network. 2009 14. Carus M, Dammer L. Food or non-food: Which agricultural feedstocks 34. Stratmann G. Leader of TTN-Hessen at Hessen Agentur GmbH. 2010. are best for industrial uses? Nova paper #2 on bio-based economy. 2013.

Cite this article Zorbas H, Völker S, Härtling K (2014) Networks – Bridges between Academy, Industry and Politics. The Paradigm of Network IBB and its Management Organiza- tion. JSM Biotechnol Bioeng 2(1): 1022.

Page 24 Scientiic Contributions

Page 25 Short Communication *Corresponding author Dr. Friedrich Streffer, maxbiogas GmbH, Alte Dorfstr. 14A, 16348 Marienwerder, Germany, Tel: Lignocellulose to Biogas and +49 3337 3774140 ; Fax: +49 3337 3774189; E-mail:

Great efforts are made to realize concepts for replacing oil and using renewable OPEN ACCESS resources as starting material in biorefi neries. Currently, biorefi neries produce chemical Keywords base materials on an industrial scale from readily available sugar-or starch-containing • Pretreatment process plant components. However, thesefeedstocks only account for about 1% of the available • Lignocellulose plant biomass. The majority of available plant biomass, constitutes lignocellulose, which • Biogas is currently inaccessible to conventional biorefi neries and biogas processes.However, • Effi ciency in future generating higher economic effi ciency for biorefi neries and biogas plants is important to ensure these operations can compete with the effi ciency of oil refi neries even in the absence of government subsidies. Further, it is desirable to increase the ecological effi ciency of these operations in order to reduce the required agricultural land use and to improve the CO2 balance. All these claims could be achieved if hitherto waste products such as digestates, agricultural, food and municipal wastestreams could be used as feedstock. Physico-chemical and biotechnological pretreatment technologies, such as the LX process are being established, which would allow utilization of these feedstocks particularly for biogas plants. This review summarized the technical and economic framework to establish these enabling technologies with a particular focus on development of second generation biogas process.

ABBREVIATIONS eficient and cost effective solutions in all three unit operations will secure the economic energy and raw material production. atm: atmosphere; CBP: Combined Bio Processing; CO : 2 This is possible using raw materials which are hitherto waste Carbon dioxide; C5 sugar: Pentoses; C6 sugar: hexoses; °C: products. In bioreineries these are e.g. plant residues that Degree Celsius; KTBL: Kuratorium für Technik und Bauwesen can only be of commercial use after pretreatment. Therefore, in der Landwirtschaft e.V.; min: minute(s); SHF: Sacchariication pretreatment processes are key enabling technologies, which followed by Fermentation; SSF: Simultaneous Sacchariication and Fermentation allow utilization of a cheap and available feedstock base for design of mass- and economically eficient, second generation INTRODUCTION biomanufacturing processes [5]. The focus of these efforts is to Oil is the basis of modern life, ranging from energy production achieve the process more cost- and energy-eficient [6]. to packaging material, from synthetic ibre to the production of Eficiency of bioreineries basic chemicals [1]. Highly eficient processes for extracting and reining crude oil, which have been optimized over the last 100 Plants used as a carbon source for industrial purposes in years allows its economical use today. However, our oil reserves bioreineries are a reality today in different markets of renewable are inite. Therefore, great efforts are made to realize concepts for materials and renewable energy. Examples include production replacing oil by renewable biomass based resources as feedstock of lactic acid, 1,3-propandiol, ethanol etc. (see Table 1) [7]. All in bioreineries. these processes have in common that their production is based on the utilization of energy-rich and easily accessible plant Currently, irst generation bioreineries produce chemical parts (the sugar or starch based depot substances). This in turn base materials on an industrial scale from readily available sugar- requires the cultivation of specialized plants for these systems or starch-containing plant components. However, sugar and/or such as sugar beet or wheat grains for bioethanol production or starch based feedstocks are also the basis for food production and account only for about 1% of the available plant biomass [2]. so-called energy crops like corn for biogas production [8]. For By contrast the majority of available plant biomass constitutes these production processes to be economical plant sizes of more lignocellulose, which is not accessible by irst generation than 10.000 tons are required [8,9]. As consequence investment bioprocesses such as biogas production. In the future, energy costs of such systems as well as their operation costs are high, and raw material production in bioreineries can preserve this limits the number economic project realizations. However in our current standard of living only if the eficiency and cost of the biogas market the situation is different due to government production can compete with today’s eficiency and economy of subsidies. Due to these subsidies biogas plants already operate petroleum reineries [3,4]. eficiently in this market with a throughput in the lower four digit range of tons per year [10] Signiicant cost determining factors of a bioreinery are commodity prices, costs and expenses of the fermentation Now the market is expected to mature. Among other things process and for product workup in the downstream process. Only the objectives include:

Page 26 Central

• economic utilization of plants as a carbon supplier A representative diagrammatic framework of lignocellulosic without subsidies. biomass is illustrated in igure 1. The cellulose chains are organized as bundles which are stabilized by hydrogen bonds. • ensuring sustainable production processes, Embedded in hemicellulose and covered by lignin these bundles Reduction of substrate costs important are called microibrils and have diameters in the range of 10 to 20 nm [15]. These micro ibrils are tightly packed. Neither One of the largest cost positions in the operation of enzymes nor small molecules like water can enter the complex bioreineries are substrate costs [11]. Thus it is one of the framework [14]. The microibrils are usually associated to major tasks to reduce these costs to ensure the world-wide macroibrils and also higher structure (see igure 1). success of sustainable production of materials and energy in an economically viable way. But how can this be achieved? Only The major impediment towards development of an economic approximately only 1 % of the available plant biomass represents viable technology for degradation of cellulose is its association the depot substances starch and sugar. If the “energy crops” used with lignin, its crystallinity and the small surface area for an attack today could be replaced by plant parts which accumulate as waste [14]. However, the eficient utilization of the three components in agriculture, food production or in communities, the amount of cellulose, hemicellulose and lignin will be the key to economic cheaply available input material would increase immensely. In viability of lignocellulose bioreineries. the current processes however, it is not possible to use the waste The bioreinery marktet as substrate, mainly because of the contained lignocellulose that cannot be fermented in bioreineries eficiently due to the The German chemical industry already covers more than 10% chemical structure. of their raw material requirements from renewable raw materials [16]. This proportion will increase in the coming years and the Lignocellulose – hard to crack utilization of lignocellulose for microbiological processes will be There are several excellent reviews on the structure of a prerequisite for the economic success of such bioreineries. lignocellulose [12,13]. Therefore we keep the description As described above pretreatment processes should ensure brief. Lignocellulose is the most abundant source of unutilized a separation of lignocellulose at the molecular level into the biomass and its availability does not necessarily impact land use. individual components.This ideally takes place under mild Lignocellulose in general consists of three biopolymers: conditions to ensure that no toxins arise. Such protocols are • Cellulose (40%-50%) currently under development. For their success in the market, the economic viability of this process will play a very crucial role. • Hemicellulose (25%-30%) Typical processing in bioreineries • Lignin(10%-30%) Bioreining is described as the transfer of the eficiency and Additionally it contains other extractable components [6]. logic of fossil-based chemistry and substantial converting indus- The relative content of each polymer depends on the origin, try as well as the production of energy onto the biomass industry but in general the lignin content will increase with the age of [16]. Usually the microorganisms of a bioreinery utilize either the plant. In nature cellulose ibers are embedded in a matrix of carbohydrates like starch, cellulose, or hemicellulose. Crop resi- other structural biopolymers, mainly hemicellulose and lignin dues often consist of lignocellulose, the tight composite of cel- with cotton balls being the only exception. Lignin is composed lulose, hemicellulose and lignin. Great efforts are necessary to of the three major phenolic components p-coumaryl alcohol, convert lignocellulose in bioreineries to enable their recovery. coniferyl alcohol and sinapyl alcohol. Lignin is synthesized by Currently, the following steps are applied to gain accessibility to polymerization of these three components and their ratio varies the components for downstream microbial conversion processes between different plants wood tissues and cell wall layers. [17]: Lignin is a complex hydrophobic, cross-linked aromatic polymer that interferes with the carbohydrate hydrolysis process [14]. • Step 1: Separating lignincellulose into hemicellulose,

Table 1: White biotechnology products [7]. Product Markets Volume p.a. Companies Resources Fuels Solvay 65.000.000 tons Ethanol Solvents Dow Starch, sugar (biobased) Polyethylene Braskem Energy 4.300.000 tons Starch, sugar Methane Many Fuels (biobased, Germany) cellulose, others Polylacticacid (PLA) Dow Lactic acid 400.000 tons (biobased) Starch Food additiv Cargill Polyurethane 50.000 tons 1,3-Propandiol (PDO) Personal care DuPont Starch (biobased) PTT 1,4 Butanediol 50.000 tons Succinic acid Pharmaceuticals DSM Starch (biobased) Fibers

Page 27 Central

cellulose and lignin (often referred to as a pretreatment of These methods aim to make the lignocellulose components the substrate) to make the (hemi-)cellulose accessible for accessible by mechanical treatment or by high pressure and/or microorganisms and thus to make the (hemi-)cellulose high temperature. This approach is usually very energy-intensive degradable. but does not lead to a separation of cellulose, hemicellulose and lignin, on a molecular level. • Step 2: Hydrolysis of the hemicellulose and cellulose, in order to divide them into oligomeric or monomeric • Chemical pretreatment processes [6] sugars molecules (C5 and C6 sugar). Using solvents cellulose, hemicellulose and lignin can be • Step 3: Product generation, to prepare the desired separated in the molecular components. Subsequently, the product from the monomeric sugars by microorganisms, individual components have to be recovered by separate for example, ethanol, butanol, lactic acid, biogas, etc. chemical processes from the solution. The chemical pretreatment nevertheless has some disadvantages as the process itself is • Step 4: Product recovery. energy-intensive, much water is necessary and undesirable Step 1: Pretreatment methods [6] degradation products of biopolymers occur at the required high temperatures, which are toxic to microorganisms. To be able to utilize crop residues eficiently it is imperative Steps 2 and 3: Hydrolysis and product formation [6] to break down the lignocellulosic structure. This is implemented in so-called pretreatment processes, which differ substantially in The fermentation of the hemicellulose and cellulose their type of treatment [14]. Among them are: carbohydrate polymers requires the hydrolysis of the polymer into oligomers, or even monomers. Currently, three approaches • Biological pretreatment processes [6] are implemented mainly [14,19]: These methods use microorganisms like fungi which are • Sacchariication followed by fermentation (SHF) able to degrade lignin. The lignin degradation always requires oxygen, and the pure lignin degradation process cannot serve as Initially oligomers and/or monomers will be produced with the sole energy and carbon source for the microorganism [18]. It the help of additionally employed enzymes. Then these oligomers is important to note that most of white biotechnology processes or monomers are subjected to a fermentation process. are anaerobic fermentation processes and therefore inhibited by • Simultaneous sacchariication and fermentation (SSF) oxygen. Furthermore, the microorganisms mainly destroy the lignin in order to use the cellulose or hemicellulose as carbon In this method oligomers and/or monomers are produced and/or energy source [18]. with the help of additionally employed enzymes and these oligomers and/or monomers are simultaneously subjected to a • Physical / mechanicalpretreatment processes [6] fermentation process.

Figure 1 Schmatic structure of lignocellulose. The hexagons denote the lignin subunits p-coumaryl alcohol (H), coniferyl alcohol (G) and sinapyl alcohol (S).

Page 28 Central • Combined bio processing (CBP) DISCUSSION A microorganism (or consortium of microorganisms) is The Lignin extraction process (LX-process) responsible for the formation of the oligomers and/or monomers and their fermentation at the same time. The newly developed LX-process is a chemical pretreatment process to break up lignocellulose in its components. In a irst From an economic perspective CBP is preferable, among step, the biomass is dissolved. In the second step the cellulose, other things, because there are no additional enzymes used and hemicellulose and lignin are precipitated as solids. The consumed in this process. For an application of this method, it precipitation is optionally carried out in a fractionated fashion, is imperative that no toxins (e.g. furfural) are contained in the so that the individual components cellulose, hemicellulose and pretreated cellulose or hemicellulose which inhibit the growth of lignin can be obtained separately (see Figure 2). the organisms [15]. In the special case of the biogas market a fractionated Step 4: The products generated in step 3 are initially in precipitation is not absolutely necessary. The microorganisms aqueous fermentation media. Before they can be sold or used for of a biogas plant convert cellulose and hemicellulose even in the further applications they need to be cleaned and/or isolated from presence of lignin. The prerequisite is that the structure of the unwanted by-products. molecular composite between the individual components has Production of biogas been broken up beforehand. Among the most commonly used fermentation processes A irst implementation of the LX-process in a pilot-LX plant and thus one of the largest markets for fermentation in Germany will reveal that the method is very interesting for the biogas is the production of biogas. As a consequence of missing or market. But the LX-process also offers other advantages that insuficient pretreatment processes [17] the depot substances make its use attractive. These beneits include, in particular: of plants are well decomposed, while lignocellulose is, however, 1. The LX system is highly compatible. scarcely degraded at all in current biogas digesters [20].Hence, lignocellulose remains practically unused as ibrous content in The process conditions are that mild that toxic degradation the digestate, which has hardly any economic value. products of cellulose and hemicellulose are avoided and thus the obtained cellulose and hemicellulose can be degraded directly by The biogas market is currently considered to consist of about microorganisms into biogas. 7.600 plants that do not have good eficiency for the utilization of lignocellulosic residues. Government policies however, are in 2. The available waste heat of biogas plants can be used. favor of support the usage of residues. In addition, the pressure The LX-process conditions can be selected in a form that on plant operators to improve the eficiency of their investments the available waste heat of a biogas plant is suficient with its is steadily increasing because of rising feedstock prizes. temperature range to operate the LX-process. How to improve biogas plant eficiency 3. Nutrient and carbon cycles are closed. The economic upgrading of conventional biogas plants can After the fermentation processes the digestate still containing be achieved with a pretreatment process implemented that lignin and minerals may be supplied to the soil again. can be integrated into the existing biogas process, recovering the huge biogas potential of lignocellulosic materials [21]. 4. The Greenhouse Gas Balances (GHG-balance) However, current bioreinery pretreatment process concepts of a standard biogas plant can be signiicantly improved are not compatible with the biogas market. A successful biogas Enhancing the biogas yield signiicantly reduces in consequence pretreatment process must be able to be operated economically the CO2 emission. Furthermore, the emission contribution to at processing approximately 1000 ton dry matter a year. In this the GHG-balance can be signiicantly reduced, as drying of scenario it is mandatory to use the waste heat of a biogas plant to the solid digestate and the associated pasteurization of the satisfy the energy demand. However, a pretreatment processes digestate brings the nitriication process to a halt. Thus, the that meets this particular technical framework the biogas market particularly harmful nitrous oxide (N2O) emissions are almost offers excellent conditions for market entry. completely suppressed. The extensive discussion on (indirect) land use change [4,23,24,25] can be mitigated switching from a Typical dificulties in large bioreinery projects, such as the 1. Generation to a 2. Generation production of biogas employing lack of logistics for the substrate provision [22], would shrink if residues [4,25] and the (partial) return of carbon to the soil [4]. the waste material of the biogas plant, namely the solid digestate, is used as substrate. This lignocellulosic waste would go through Special features of the LX-process the pretreatment process as input material and subsequently be fed back to the microbiological process of biogas fermenter. LX-process is operated at temperaturesbelow 100 °C, both A process that can also use in addition to the solid constituents the process it self as well as the work-up of the operating sup- of the digestate other residues from agriculture, food production plies. This allows suppressing the degradation reactions mainly or the municipalities such as bedding after using them in the of hemicellulose, an important prerequisite for subsequent utilization by microorganisms. Most pretreatment processes have barn, leaves, green waste, landscaping grass, builders from fruit still a considerable energy demand even after heat integration. and vegetables solves the problem of substrate costs, needed This can be signiicantly reduced, by keeping water away from agricultural land and disposal of solid digestate. the process and thus also heating or evaporating as little water

Page 29 Central as possible.The integration of this knowledgeinto the LX-process lignin. First results show that the properties for LX-cellulose from means that the LX-process without heat integration according to the batch LX-process and from the continuous LX-process of the present estimates can gain the required amount of heat energy mini plant are comparable, e.g. in their biogas yield indicating from the processed residues in the LX-plant. the near total conversion of the carbohydrate stream. Currently maxbiogas GmbH scales up the LX-process, expanding from its 10 With the successful launch and the implementation of the kg per day mini plant line to a pilot facility capable of converting recovery of the individual components cellulose, hemicellulose about three dry tons of plant residues to LX-cellulose per day. and lignin LX-plants are becoming increasingly interesting for other markets where, for example, chemical raw materials In addition the combination of the LX-process with other obtained with the help of microbiological processes (see Table fermentation processes is investigated in the laboratory. Current 1). Furthermore, the process can also be transferred to the results in the process and product development of the LX-process production of other products than biogas from the rich palette of show the great potential of using LX-plants not only for eficiency white biotechnology. improvements in the biogas sector but also to increase the eficiency of other production processes in bioreineries. Increasing product yield CONCLUSION In all these processes that operate successfully on the basis of starch or sugar today, the eficiency of these processes can be It is obvious and the political will that bioreining will play an increased by utilizing the residual materials with the LX-process important role for energy production as well as the production of as additional input for the particular process. This is the potential numerous products in the future. In order to become economically of the LX-process. viable which means to be able to operate without subsidies and to improve sustainability in the production processes the The LX-celluloses are successfully converted by commercially eficiency of bioreineries has to improve signiicantly. In recent available cellulase preparations into monomeric sugars and by years, great efforts have been made in the ield of bioreinery microorganisms into biogas without inhibiting the growth of the and irst successes are achieved (see for example Table 1). microorganisms. In addition to the carbohydrate stream (the Bioreinery plants focused in particular on developments in steps LX-celluloses) also the lignin can be recovered. Initial results 2 and 3 of product generation For example, certain methods have show that the lignin of the LX process is similarly well soluble been developed, as well as enzyme preparations or genetically in various solvents, such as in DMSO, ethanol or acetone as modiied microorganisms that can produce a variety of products organosolv lignins, while the carbohydrate content is very low from carbohydrate-based substances. with substantially less than 1%. New developments improve the system In the past two years, maxbiogas GmbH realized the LX- process in a mini plant capable of converting up to 10 dry However, there is still huge potential within the system, kilograms of plant residues per day to LX-celluloses and/or LX- especially in the increased use of residues. Therefore, a number

Figure 2 Scheme of the lignin extraction process (LX-process).

Page 30 Central of companies in different parts of the world are currently Technol. 2010; 101: 8915-8922. working on an economic realization of step 1, the break-down 6. Menon V, Rao M. Trends in bioconversion of lignocellulose: Biofuels, of lignocellulose [26-30]. One promising approach is the LX- platform chemicals & bioreinery concept. Prog Energy Combust Sci. process. The focus of the process lies especially on the application 2012; 38: 522-550. of mild process conditions, so that toxic degradation products of 7. Riesmeier, J Bioeconomy beyond biofuels. Going Public. 2013; 3: 18- the cellulose are avoided and microorganisms will degrade the 21. celluloses obtained from the LX-process directly. In addition, the use of water in the LX-process has been limited to a minimum. 8. Himmel ME, Ding SY, Johnson DK, Adney WS, Nimlos MR . Biomass recalcitrance: engineering plants and enzymes for biofuels production. The relevance of this particular point in the development of Science. 2007; 315: 804-807. economic bioreinery plants was, inter alia, described in the inal report of the cluster BIOREFINERY2021 [26]. The authors of the 9. Stephen J, Mabee W, Saddler J. Biomass logistics as a determinant module “Development and evaluation of integrated bioreinery of second generation biofuel facility scale, location and technology selection. Biofuels Bioprod Bioref. 2010; 4: 503–518. ‘New Concepts’” summarize their indings as follows: “The combination of the pre-treatment process and the subsequent 10. Biogasmessprogramm II process steps, however, turned out to be extremely important. 11. Becker C et al. Faustzahlen Biogas; Publisher Kuratorium für Technik Especially the low water loading in all stages of the process und Bauwesen in der Landwirtschaft. 2007. ISBN: 978-3-939371-46- should be a top priority. Otherwise laborious processes (e.g. 5. evaporation) are necessary in order to subsequently separate the 12. van Wyk JP . Biotechnology and the utilization of biowaste as a desired products.” [26]. resource for bioproduct development. Trends Biotechnol. 2001; 19: Entering a new era 172-177. 13. Knauf N, Moniruzzaman M. Lignocellulosic biomass processing: a Furthermore the method has the potential to lift bioreining to perspective. Int Sugar J. 2004; 106: 147-150. a new level since more or less all disadvantages of the processing today will be reduced. The digestate which is today treated 14. Olofsson K, Bertilsson M, Lidén G . A short review on SSF - an as end of the process still contains large amounts of substrate interesting process option for ethanol production from lignocellulosic feedstocks. Biotechnol Biofuels. 2008; 1: 7. bound within the lignocellulose. This potential can be used by the LX-process. Even the carbon- and mineral-cycle is closed, 15. Rubin EM . Genomics of cellulosic biofuels. Nature. 2008; 454: 841- since the granular LX-digestate can still be used for treatment of 845. soil afterwards. As a consequence the need for freshly produced 16. Kamm B, Gruber PR, Kamm M. Bioreineries- Industrial Processes substrates decreases and agricultural land can be used for and Products. Ullmann’s Encyclopedia of Industrial Chemistry. 7th ed. the production of food instead of substrate for bioreineries. WILEY-VCH. 2011. ISBN: 978-3-527-32943-4. Additionally the possibility to ferment also other waste products 17. Taherzadeh MJ, Karimi K . Pretreatment of lignocellulosic wastes to from agricultural or food production further reduces the amount improve ethanol and biogas production: a review. Int J Mol Sci. 2008; of especially grown substrates. These factors help to save natural 9: 1621-1651. resources on the one side and to reduce substrate costs, an 18. Munk K. Taschenlehrbuch Biologie: Mikrobiologie. Thieme Stuttgart. important factor for eficiency on the other side. This increases 2008; ISBN 978-3-13-144861-3: 507–508. the land eficiency of bioreinieries and economic viability of the 19. Gírio FM, Fonseca C, Carvalheiro F, Duarte LC, Marques S . process will increase automatically. Hemicelluloses for fuel ethanol: A review. Bioresour Technol. 2010; ACKNOWLEDGEMENTS 101: 4775-4800. 20. Liew L, Shi J, Li Y. Methane production from solid-state anaerobic Kind support by the “Europäischer Fonds für regionale digestion of lignocellulosic biomass biomass and bioenergy. 2012; 46: Entwicklung” is acknowledged. 125 – 132. REFERENCES 21. Chandra R, Takeuchi H, Hasegawa T. Methane production from lignocellulosic agricultural crop wastes: A review in context to second 1. Matar S, Hatch L. Chemistry of petrochemical processes. Elsevier Inc generation of biofuel production. Renewable and Sustainable Energy 2001. ISBN: 978-0-88415-315-3. Reviews. 2012; 16: 1462– 1476. 2. Biobased products and bioreineries Proceedings and Lectures (engl). 22. Pöschl M, Ward S, Owende P. Evaluation of energy eficiency of various Eds: Kamm, B; Hempel, M; Erb R, Publisher: FI biopos eV, 2009; ISBN: biogas production and utilization Pathways. Applied Energy. 2010; 978-3-00-027243-1. 87: 3305–3321. 3. Sims RE, Mabee W, Saddler JN, Taylor M . An overview of second generation biofuel technologies. Bioresour Technol. 2010; 101: 1570- 23. Mathews J, Tan H. Biofuels and indirect land use change effects: the 1580. debate continues. Biofuels Bioprod Bioref. 2009; 3: 305–317. 4. Cherubini F and Ulgiati S. Crop residues as raw materials for 24. Laser M, Larson E, Dale B, Wang M, Greene N, Lynd L. Comparative bioreinery systems – A LCA case study. Applied Energy. 2010; 87: analysis of eficiency, environmental impact, and process economics 47–57. for mature biomass reining scenarios. Biofuels Bioprod Bioref. 2009; 3:247–270. 5. FitzPatrick M, Champagne P, Cunningham MF, Whitney RA . A bioreinery processing perspective: treatment of lignocellulosic 25. Warner E, Zhang Y, Inman D, Heath G, Challenges in the estimation materials for the production of value-added products. Bioresour of greenhouse gas emissionsfrom biofuel-induced global land-use

Page 31 Central

change. Biofuels Bioprod Bioref. 2014; 8:114–125. 28. Grueling B. Straw reinery - still lacks the alternative to oil eficiency. TUHH spectrum. 2013; 10: 48-51. 26. Cluster BIOREFINERY 2021; Final report “Energy from Biomass - New approaches to integrated bioreinery - BIOREFINERY 2021” Phase 1 29. Puky-Heinrich D. Leschinsky M. Unkelbach G. New Strategies - wood of the BMBF research project in Forderprogramm “BioEnergy 2021 - as a raw material for the chemical industry. Chemistry & more. 2012; Research for the use of biomass”, 2013. 10-13. ISSN: 2191-3803. 27. Hamburg University of Technology, Institute of Chemical Engineering, 30. Colakyan M. The role of supercritical hydrolysis. Bioenergy Insight. Final Report “value for bioethanol reinery 2nd generation: 2012; 10: 51-52. optimization and conversion to glucans and xylans from lignocellulose to valuable raw materials and energy sources,” 2011 project funded by the German Federal Environmental Foundation, AZ 13226th

Cite this article Streffer F (2014) Lignocellulose to Biogas and other Products. JSM Biotechnol Bioeng 2(1): 1023.

Page 32 Review Article *Corresponding author Yvonne Söltl, Group Biotechnology, Clariant (Produkte) Deutschland GmbH, Staffelseestraße 6, 81477 Munich, Cellulosic Ethanol from Germany, Tel: 4989710661180; Fax: 4989710661122; Email: Submitted: 23 March 2014 Agricultural Residues – An Accepted: 12 May 2014 Published: 14 May 2014 Advanced Biofuel and Biobased ISSN: 2333-7117 Copyright Chemical Platform © 2014 Söltl et al. OPEN ACCESS Koltermann, A., Kettling, U., Kraus, M., Rarbach, R., Reisinger, C., Zavrel, M., Söltl, Y. Keywords Cellulosic ethanol; Agricultural residues; Advanced Group Biotechnology, Clariant (Produkte) Deutschland GmbH, Germany biofuels; Biobased chemicals; Enzymatic hydrolysis, Biocatalysis.

Abstract Cellulosic ethanol made from agricultural residues has been a scientifi c and commercial interest for decades however the development and commercial deployment of technologies have been limited. It constitutes an almost carbon neutral new energy source using an already existing renewable feedstock that doesn’t compete with food or feed production and land use. The fi eld of application is wide, from second generation biofuel to the chemical industry. A key controversial issue regarding technological developments aimed at the production of cellulosic ethanol is the commercial economic viability of the process. The challenges facing process development include optimization of the ethanol yield while lowering operational and capital costs such as the reduction in enzyme costs and energy effi ciency improvements. Recent years have seen great success in the development and deployment of cellulosic ethanol technologies. Now policy makers are asked to facilitate the market entry of such innovative processes by setting a long-term stable framework. Clariant’s sunliquid® technology overcomes the main challenges of competitive conversion of lignocellulosic feedstock into cellulosic sugars for fermentation to cellulosic ethanol. In July 2012 a demonstration plant with an annual output of 1000 tons of ethanol started operation. This is the last step on the way to commercializing a technology platform for second generation biofuels and biobased chemicals. The plant represents the complete production chain, including pretreatment, process-integrated production of feedstock and process specifi c enzymes, hydrolysis, simultaneous C5 and C6 fermentation and energy saving ethanol separation. The process itself is

energy neutral, yielding cellulosic ethanol with about 95% of CO2 emission reductions.

ABBREVIATIONS The structural, so called lognocellulosic part of the plants also contains a substantial amount of sugars, bound in long chain a: Year; t:Metric Tons; USD: US Dollars sugar polymers cellulose and hemicellulose, glued together INTRODUCTION by lignin. One hectare of wheat for example yields about 3-3.5 tonnes of sugars bound in lignocellulosic biomass in addition Today the chemical industry is facing the situation that most of its products are based on fossil resources. Over the last to the 4-4.5 tonnes of sugars from the grain. Hence straw is an couple of decades the price for oil and fossil derived energy has extremely attractive additional source of sugars from the non- risen drastically. While a barrel of crude oil was sold at about edible parts of agricultural crops. 20 USD at the end of the last century today the price is stable These cellulosic sugars are harder but not impossible to over 100 USD/barrel (with a peak of almost 140 USD/barrel in access. By using speciic enzymes, the stable structure can 2008) [1,2]. Thus, the fuels and chemical industry is looking for eficiently be broken down into the corresponding monomeric innovations to increase energy and process eficiency as well as sugars which can then be fermented into the desired product. to foster the substitution of fossil resources with renewable ones Recently, signiicant advances have been made in research to remain competitive in the long term. Along with this comes an and process development, with cellulosic ethanol being the increased demand for more sustainability from the market side. irst product currently on the brink of commercial deployment The transition from an entirely fossil based industry to a more (Figure 1). and more bio-based one is one of the mega trends seen in the chemical sector today. The technology Industrial biotechnology is the key enabling technology for A key controversial issue regarding technological the shift towards a sustainable bioeconomy. Today, biobased developments aimed at the production of cellulosic ethanol is chemicals and biofuels available in the market are ultimately the economic viability of the process. In order to be competitive derived from sugars by means of biotechnological processes. on the fuel market, the production costs achieved in the medium This imposes a new dilemma: Using food or feed for the large term must be comparable with the costs of manufacturing scale production of for example fuels and converting land for the conventional bioethanol from plants containing sugar or starch. production of such feedstock has to be seen controversial, as the The challenges facing process development therefore include priority of agriculture is and should be to feed an ever growing optimization of the ethanol yield, the lowest possible energy population. input and a reduction in the cost of enzymes – as yet one of the However, sugars can not only be derived from foodstuff. major cost factors (Figure 2).

Page 33 Central

whenever and wherever needed, with no costs being incurred for transport, storage or processing and without being dependent on enzyme suppliers. Following hydrolysis, any remaining solid matter (mainly lignin) is separated out and incinerated to generate energy, leaving a sugar solution containing C5 sugars in addition to glucose, a C6 sugar. The sunliquid process uses a special fermentation organism which simultaneously converts both C6 and C5 sugars into ethanol by way of a one-pot reaction, consequently producing around 50% more ethanol than comparable processes, which are only able to convert C6 sugars. The inal unit process consists of purifying the ethanol produced. This is usually carried out by means of classic

Figure 1 Global distribution of structural biomass. distillation which, however, calls for high energy input. Clariant has developed an energy-eficient, adsorption-based separation process which, by comparison, offers energy savings of up to 50%. As a result of optimising this and other process design features, it is possible to generate the energy needed for the entire process from accumulated residue (mostly lignin). No additional fossil energy sources are required. The products One of the main features of cellulosic ethanol is its particularly high potential for greenhouse gas emission savings, which can reach up to 100% compared with fossil fuel (Figure 5). If agricultural waste is used as feedstock, cellulosic ethanol does not entail any additional land use, nor does it compete with food and feed production [3-5]. As a result, cellulosic ethanol opens up a new domestic source of energy based on renewable feedstock which can be produced on a regional basis without having to cultivate new land. By utilizing residue, additional value is Figure 2 Challenges in process development and sunliquid solutions. generated for this waste as it helps to diversify farm income. The concept of decentralised plants generates new green jobs, In recent years, Clariant, a global leader in the ield of specialty especially in rural areas. chemicals headquartered in Switzerland, has been developing Cellulosic ethanol used as biofuel is the irst product derived the sunliquid process for the production of cellulosic ethanol from lignocellulosic biomass entering the market. Ethanol from agricultural residues, which is now ready to market (Figure itself has however many other applications and serves as an 3). The biofuel obtained using this process is manufactured on an important feedstock for the chemical industry. For example energy-neutral basis and boasts greenhouse gas savings of some ethylene is currently the most important chemical worldwide 95%. The remaining 5% being attributable to the use of transport for conversion into polyethylene. Today’s production is mainly energy in logistics chain which is calculated as fossil-based. The based on cracking of naphtha, but an alternative route would be production costs can compete with those of irst-generation the conversion of bioethanol via dehydration. In addition, the bioethanol. sunliquid technology generates access to cellulosic sugars and Firstly, the feedstock, i.e. wheat straw, undergoes mechanical hence creates a platform for a wide range of biobased chemicals and thermal pre-treatment. This results in the lignin separating such as organic acids, higher alcohols or other specialty and bulk from the cellulose and hemicellulose chains, allowing the enzymes chemicals [6,7] to split into sugar monomers during the next step (Figure 4). The feedstock potential The enzymes used have been optimised to a high degree by Many new developments in the ield of liquid energy resources the company and speciically modiied for each type of feedstock focus on the use of so-called second-generation feedstocks, i.e. and the relevant process conditions. This ensures particularly feedstocks which consist of lignocellulose and are therefore eficient hydrolysis, giving rise to high sugar yields. not suitable for use in food production. Above all, agricultural As a result of process-integrated enzyme production, enzyme residues such as cereal straw, maize straw and sugarcane bagasse costs can be reduced to a minimum. To this end, a small portion are of particular interest, but also certain energy crops, such as of the pre-treated feedstock is channelled off from the main mass miscanthus and switch grass, are possible candidates [8-10]. to serve as a basic source of nutrients for special microorganisms Especially agricultural residues already pose a high potential– which produce the enzymes. These are therefore created they are readily available globally in substantial amounts without

Page 34 Central

Figure 3 The sunliquid process creates sustainable and eficient cellulosic ethanol from agricultural residues.

Figure 4 The optimized enzyme mixture splits polymeric sugars into monomers.

Figure 5 Greenhouse gas emissions from various biofuels compared with gasoline.

Page 35 Central interfering with current agricultural practice (Figure 6) [11]. The most important type of agricultural waste in the EU is cereal straw, of which some 240 million tons accumulate across the EU´s 27 member states each year [12]. Several long-term studies have shown that depending on the region and prevailing local conditions, up to 60% of the residual straw can be collected from the ields and made available for recycling [13-15]. Using the sunliquid process, 27 million tons of cellulosic ethanol could be produced from this volume of straw, which is equivalent to the energy content of almost 18 million tons of fossil-based petrol. This means that around 25% of the EU´s demand for gasoline predicted for 2020 could be met by cellulosic ethanol. A study conducted by Bloomberg New Energy Finance includes other types of residue and various scenarios in its calculations and forecasts fossil gasoline substitution potential of up to 62% [16].

In the US, corn Stover is the main residue available for Figure 7 The sunliquid demonstration plant has been producing cellulosic conversion into cellulosic ethanol, the second most important ethanol from agricultural residues since July 2012. feedstock being cereal straw. The Billion Ton study released by the Department of Energy estimates the volumes of corn stover blend ratios, adapting vehicle leets, a petrol-ethanol pricing and cereal straw available in a sustainable way at 190-290 policy and low-interest loans. In 2011, the percentage of new million tons [17]. In Brazil, where sugar cane has already been purchases attributable to lex-fuel vehicles amounted to 83.1% used to produce bioethanol for many years, some 545 million and today, fuel supplied by Brazilian petrol stations contains at tons of sugar cane are forecast for the 2011-2012 harvest, which least 20% ethanol. will in turn give rise to approx. 73 million tons of bagasse [18]. Even after deduction of the amounts used to generate energy in Future developments in each fuel market are therefore existing plants, around 11 million additional tons of cellulosic largely dependent on the measures instituted by the relevant ethanol could be produced. This is equivalent to about 50% of governments. Today many governments have fuel strategies in Brazil´s current ethanol production. place that include ambitious targets for the use of biofuels to The political framework secure energy supply or reduce greenhouse gas emissions. In the European Union, the Renewable Energy Directive is the The nature of future changes in fuel supplies ultimately legislative instrument in place. By 2020 20% of the overall energy depends on the political environment. A striking example has consumption and 10% of energy consumed in the transport been set by Brazil where, in 1975, the ProAlcool programme sector is required to come from renewable resources. Currently, was initiated as an answer to the oil crisis. Over the following European Parliament and Council are discussing an amendment fourteen years, the government promoted the development of an of the Directive proposed by the European Commission to cap ethanol industry based on a series of measures which included the use of conventional biofuels and to introduce a dedicated blending mandate for advanced biofuels. As a result of ongoing discussions a stable long-term framework needs to be agreed on to facilitate market entry for innovative technologies like cellulosic ethanol production and foster private investments in the sector. In the US, the Renewable Fuels Standard requires obligated parties to blend increasing volumes of various types of renewable fuel over time. When RFS2 was passed in 2007, Congress divided the 36 billion gallon per year (by 2022) blending standard into two primary categories: conventional biofuels (15 billion gallons per year) and advanced biofuel (21 billion gallons per year). The conventional biofuel requirement increases to 15 billion gallons per year by 2015, then “lat lines” at this level through 2022. The advanced biofuel requirement started with 600 million gallons in 2009 and increases to 21 billion gallons annually in 2022. The RFS is working and must maintain pressure on the marketplace to realize its full potential through 2022 and onwards [19]. To reduce the dependency on fossil imports while at the same time reducing pollution, the Indian government has initiated a biofuels program. In September 2002 the Ministry of Petroleum Figure 6 Lignocellulosic feedstock of different regions worldwide. and Natural Gas has issued a 5% mandatory blending quota for

Page 36 Central ethanol in nine major states and 4 union territories from 2003 on. ACKNOWLEDGEMENT Due to a supply shortage of ethanol in 2004/2005, the blending was made optional and only resumed mandatory in 20 states We thank the Bavarian government and the Federal Ministry in October 2006. Then in 2008, the Government announced for Education and Research for the support of accompanying its National Biofuels Policy which was approved by the Union research regarding the sun liquid demonstration plant. Cabinet in December 2009. The program constitutes a three- REFERENCES phase implementation of ethanol blending in petrol across the country, starting at 5% in 2010, increasing it to 10% by 2012 and 1. U.S. Energy Information Administration’s (EIA) Annual Energy Outlook. 2011. inally reaching 20% in 2017. 2. OPEC World Oil Outlook 2012, OECD/IEA Energy Balances of OECD/ One thing is certain - innovative technology, such as that used non-OECD countries. 2011. to produce cellulosic ethanol, cannot be successfully introduced 3. Dunn JB, Mueller S, Kwon HY, Wang MQ. Land-use change and onto the market unless the prevailing political environment is greenhouse gas emissions from corn and cellulosic ethanol. Biotechnol reliable, thereby providing security for investors. This includes Biofuels. 2013; 6: 51. blend ratios, as well as investment support for initial production 4. María Blanco Fonseca, Alison Burrell, Hubertus Gay, Martin Henseler, facilities in order to bridge the speciic technical challenges of Aikaterini Kavallari, Robert M’Barek, et al. Impacts of the EU biofuel commissioning the irst plants. target on agricultural markets and land use: a comparative modelling assessment. 2010. DISCUSSION AND CONCLUSION 5. Croezen et al. Biofuels: indirect land use change and climate impact. The use of lignocellulosic feedstock for cellulosic biofuels or 2010. biobased chemicals production has a lot to offer: the exploitation 6. Vennestrøm PN, Osmundsen CM, Christensen CH, Taarning E. Beyond of a new and renewable resource, high greenhouse gas savings, petrochemicals: the renewable chemicals industry. Angew Chem Int reduced dependence on fossil imports, economic growth just to Ed Engl. 2011; 50: 10502-10509. name a few. Realization on an industrial scale is no longer merely 7. Joseph J Bozell, Gene R Petersenb. Technology development for the a dream. The irst production plants for cellulosic ethanol are production of biobased products from bioreinery carbohydrates— already under construction in the US, one started operation in the US Department of Energy’s “Top 10” revisited, 2010; 12: 539-554. Italy in 2013, and four demonstration plants are currently located 8. W.E. Mabeea, McFarlaneb PN, Saddlerb JN. Biomass availability for in Europe – one of which is operated by Clariant. lignocellulosic ethanol production. 2011; 35: 4519-4529. On 20 July, the sunliquid demonstration plant was oficially 9. Seungdo Kim, Bruce E Dale. Global potential bioethanol production commissioned in the Lower Bavarian town of Straubing (Figure from wasted crops and crop residues, 2004; 26: 361-375. 7). The plant replicates the entire process chain on an industrial 10. Simmons BA, Loque D, Blanch HW . Next-generation biomass scale, from pre-treatment to ethanol puriication, serving to feedstocks for biofuel production. Genome Biol. 2008; 9: 242. verify the viability of the sunliquid technology on an industrial 11. UN Food & Agriculture Organization, FAOstat. 2012. scale. On an annual basis, up to 1,000 tons of cellulosic ethanol 12. EuroStat. 2013. can be produced at this plant, using approximately 4,500 tons of wheat straw. Since May 2013 irst runs on corn Stover from North 13. Förderverband Humus e.V. Getreidestroh zur Humusreproduktion. America and bagasse from Brazil have been successful. The plant 2010. is certiied under the European ISCC scheme to prove that the 14. Münch, Nachhaltig nutzbares Getreidestroh in Deutschland. 2008. cellulosic ethanol produced here is truly sustainable according to 15. Körschens M, Rogasik J, Schulz E. Bilanzierung und Richtwerte European legislation. organischer Bodensubstanz. 2005. However, to effectively enter the market, a supportive, 16. Bloomberg New Energy Finance, Next-generation ethanol and reliable framework needs to be in place to foster investment and biochemicals: what’s in it for Europe? 2010. ensure investors’ conidence. In an economy where resource 17. U.S. Billion-Ton Update: Biomass Supply for a Bioenergy and eficiency and sustainability become more and more important, Bioproducts Industry. 2011. we need to use all available resources in the most rational way. 18. UNICA, Brasilianische Zuckerrohr Industrievereinigung–Statistiken. By using agricultural byproducts for the production of bio-based 2011. products, both plate and tank can be illed, while at the same 19. Coleman B. United States Senate Committee on Environment and time protecting climate and the environment and drive economic Public Works, Oversight Hearing on Domestic Renewable Fuels, growth. December 2013.

Cite this article Koltermann A, Kraus M, Rarbach M, Reisinger C, Zavrel M, et al. (2014) Cellulosic Ethanol from Agricultural Residues – An Advanced Biofuel and Biobased Chemical Platform. JSM Biotechnol Bioeng 2(1): 1024.

Page 37 Review Article *Corresponding author Dr. Lin Römer, AMSilk GmbH, Am Klopferspitz 19 im IZB, 82152 Planegg/Martinsried, Germany, Tel: Shaping the Future with 004989381564430; Fax: 004989381563859; Email:

Submitted: 15 April 2014 Industrial Biotechnology– Accepted: 12 May 2014 Published: 14 May 2014 New and Efﬁ cient Production ISSN: 2333-7117 Copyright Processes for Biopolymers © 2014 Bendig et al OPEN ACCESS Bendig, C., Kraxenberger, T., Römer, L.* AMSilk GmbH, Planegg/Martinsried, Germany Keywords • Industrial biotechnology • White biotechnology • Recombinant Abstract • Biopolymer • Biocompatibility The large-scale production of biopolymers has been an emerging branch of industry for decades. Besides mere substitution of oil-based polymers, biopolymers with innovative features are in the focus of research and industry. This review highlights modern high-impact biopolymers, their respective industrial production processes and relevant applications. The vast majority of prominent commercial biopolymers are either made from sugars (such as cellulose derivatives), acids (such as poly lactic acid) or proteins (such as silk). Some of the more simple biopolymers such as -polyglutamic acid and bacterial cellulose are mainly produced in their native microorganisms. A more challenging trend in biopolymer production is the switch from traditional extraction or conversion of natural products to recombinant/heterologous production techniques in microorganisms. This is analyzed in detail for collagen, hyaluronic acid and silk. Despite the complexity of these biopolymers in structure and production, all share important features such as biocompatibility, adjustable shapes and slow biodegradation. The combination of properties renders these polymers ideal materials for biomedical scaffolding, surgery and wound care as well as related pharmaceutical applications and drug delivery.

ABBREVIATIONS Beside established (artiicial) polymers with green footprint, a variety of new and old (natural) biopolymers exists. The CG: Collagen; HA: Hyaluronic Acid; PGA: γ-Polyglutamic Acid; difference between bio-based materials and biopolymers is BC: Bacterial Cellulose generally spoken its origin. Biopolymers have their origin in INTRODUCTION (micro-)organisms and/or plants [5]. Biopolymers are often characterized by the chemical background of their monomers: Nowadays, green products and green chemicals gain more Polypeptides, polysaccharides and nucleic acids, among others and more importance–not only in public discussion but also (igure 1). The unique properties of these monomers and, even in industry’s practice. At the same time traditional chemistry more, of the resulting polymers enable unique and innovative is facing another challenge manifested in the rising need for products and applications. substitution of oil-based polymers. This for instance becomes Most available biopolymers are either isolated from nature evident as big brands such as Coca-Cola, Ford, Nike and others or produced by native existing organisms such as silk, xanthan founded the Plant PET Technology Collaborative (PTC)- starting and polyhydroxylbutyrate [2]. These polymers serve as cocoons, to shift their focus on bio-based materials [1]. capsule or storage material, respectively, in their corresponding The term bio-based material is used for almost any organisms. Since scientists elucidated the molecular and genetic material synthesized from renewable resources. Prominent basis of biosynthesis pathways, a rising number of these polymers representatives are plastics (i.e. polyethylene (PE), Polyethylene were understood and after years of research some of them terephthalate (PET), polylacticacid (PLA)) which are based on produced recombinant by genetically modiied microorganisms. ethanol or lactic acid [2]. These bulk chemicals are in this case Productions utilizing microorganisms do not only enable the output from microorganisms utilizing natural resources industry to produce signiicant quantities within relatively short production times in a compact volume. It also ensures production such as starch or sugar whereby this regime represents the irst independently of sometimes only locally available, costly generation of biomaterials. The second generation is ethically and – most important – limited natural precursors. Further, more accepted, because it is based on non-food resources. Here, recombinant biopolymers can be produced animal-free, lowering the carbon sources for fermentation processes are obtained risks of contaminations such as viruses. from cellulose and hemicelluloses gained from agricultural residues (straw) [3]. These techniques start to enter commercial In this review important biopolymers which were introduced scale; however, for most companies bringing this technology to to the marked in recent years are highlighted. The focus lies on industrial scale is a signiicant challenge [4]. multi-billion dollar markets such as esthetic and reconstructive

Page 38 Central

Figure 1 Composition of biopolymers. Biopolymers are composed of sugars, acids or proteins, respectively. Typical sugar monomers are a) glucose, b) N-acteylglucoseamine, c) glucoronic acid. Popular acid based polymers are composed of d) lactic acid, e) butyric acid and f) glutamic acid. Proteins represent a special species as they are themselves biopolymers of monomeric amino acids. A schematic drawing of a polypeptide g) indicates the main features: Secondary structures such as β-sheet (arrows) and helices, dictate the tertiary structure (not shown) and the speciic properties of proteins. Three representative polymers from this review are outlined in the lower section. Sugar and acid based polymers (hyaluronic acid and γ-PGA) are linear polymers. Hyaluronic acid is composed of an N-acteylglucoseamine and a glucoronic disaccharide repeat; γ-PGA is composed of glutamic acid. Spider silk polymeric structure is outlined as a iber. Spider silk exhibits crystalline regions of different dimensions embedded in an amorphous matrix. surgery as well as related biomedical and pharmaceutical sources is necessary to achieve high productivity. Yields up applications including topical wound treatment and drug to 101.1 g/L [8,9] were described in the literature. The issue delivery. All these applications have overlapping needs for their known for most fermentative extracellular polymer productions, material of choice: biocompatibility, scaffold forming capabilities namely the increasing viscosity to approximately 4 Pa·s and the and slow biodegradation. correlated mass-transfer problems especially for oxygen, is also the biggest challenge to produce PGA [8]. BIOPOLYMERS PGA is utilized in many different ields of application. A major Poly- γ-glutamic acid (γ-PGA) application is the use as locculent in waste-water treatment Polyglutamic acid (PGA) is a polymer of the amino acid [10,11]. An outstanding property of PGA is its ability to bind glutamic acid (igure 1). In contrast to common proteins, the heavy metals which is an advantage in the water treatment [12]. peptide bonds are in this case between the amino group and The food safety and its metal binding feature can be exploited the carboxyl group at the end of the side chain (γ-linkage of the to increase bioavailability of essential but not readily soluble molecules). Three different types of γ-PGA are known, which of metals in functional food [13]. Additionally the use of PGA as consist of D-glutamic acid (D-PGA), L-glutamic acid (L-PGA) or protectant for nutritional probiotic bacteria during freeze-drying a mixture of both (DL-PGA). DL- and L-PGA can be produced is discussed on this background [14]. by several different microorganisms, mainly Bacillus species, in Another application is based on its hygroscopic effect. The use different chain lengths up to 10,000 kDa. In contrast, D-PGA is only of PGA in cosmetics as moisturizer is more and more accepted produced by Bacillus anthracis [6]. Furthermore, a chemically [15]. Furthermore the use in drug-delivery is promoted by the synthesized α-PGA with α-linked glutamic acid is available which humidity of PGA and especially the use for anti-cancer drugs is can also be obtained by enzyme catalysis [7]. under research [16,17]. Production of PGA by Bacillusis performed in classic stirred In contrast to other biopolymers discussed here, the tank reactors. A steady supply of L-glutamic acid and/or ammonia optimization of the PGA production focuses on already

Page 39 Central established Bacillus strains [18,19]. Additionally, new strains is similar to cellulose. It is produced by chemical treatment of from natural sources are permanently identiied (e.g. natto, a natural occurring material, in this case the chitin of crustaceans. traditional Japanese fermented food) also by high-throughput Nevertheless, chitosan is suited for more applications with screenings [19]. unique features, making it a versatile polymer for technical and medical applications. Chitosan is a β(1-4)-glycosidic poly amino Cellulose sugar. It is constructed from the monomer N-acetylglucosamine. In contrast to PGA, cellulose is directly produced from The mass lies between 10 and 10,000 kDa [29]. In Chitosan less natural resources. Cellulose is a polysaccharide composed of than 40 % of the monomers are acetylated [30]. In contrast to β(1-4)-linked D-glucose molecules. As cell-walls of plants contain chitin, chitosan has a cationic nature in its protonated state approx. 50 % cellulose, it is the most abundant organic compound rendering it water soluble. available on earth. The β-linkage of the glucose molecules forms Chitosan can be produced from Chitin by deacetylation with a strand, which is more robust then the α-linkages in storage alkali or with enzymes [31]. Chitin is a major waste-product in polysaccharides such as in starch. Cellulose is used in the the production of crustaceans and today mainly used for the energy sector, the pulp and paper production as well as in food production of Chitosan. Nevertheless, the chemical modiication and pharmaceutical applications. Furthermore, sugar derived is not environmentally friendly [32] and has strong inluence on from lignocelluloses is thought to play a rising role in microbial the molecular weight and the amount of deacetylated residues production processes of for instance ethanol or lactic acid. [33]. To overcome these problems a biotechnological approach Traditionally, cellulose is extracted from plants. Derivatives like has been developed in which the crustacean residues are methylcellulose, cellulose acetate or nitrocellulose are enhanced fermented by lactic acid bacteria and/or treated by proteolytic by chemical modiications to obtain new properties. enzymes. This process dramatically reduces the use of acids and Besides plant cellulose, bacteria, fungi and algae also produce alkali and produces chitosan with a higher nutritional value, due cellulose. Bacterial cellulose (BC) is mostly produced with to a higher content of protein residues in the inal product [34]. Acetobacter (or Gluconacetobacter) xylinum and its microibrils Chitin can also be isolated from fungi. Even though the chitin are approx. 100x smaller than plant cellulose [20,21]. Secreted contain in fungi is less than in crustaceans the production can be BC single-strains assemble to highly crystalline structures – done in stirred tank reactors under controlled conditions and is according to speciic culture methods [22]. This crystallinity is thought to be economical feasible [35]. characterized by inely structured high density layers. The properties of chitosan are typical for modern biopolymers BC has numerous applications and thereby a high potential as and they directly imply its industrial use: it is biocompatible, industrial relevant material. The main disadvantage is, however, biodegradable, an adsorption enhancer, antioxidant and the relatively slow growth of the BC on the interface between antimicrobial among other features [29]. Its high capacity to bind substrate and the required oxygen enriched medium. A cellulose heavy metals and the usability as a locculation agent makes it a ilm of proper size requires 2-15 days (summarized in [21,23]. good material for waste water treatment comparable to PGA as Even though different kinds of reactors (stirred tank reactors, mentioned above [36]. The ability to form aggregates can also be rotating disk reactors, airlift reactors and belt-reactors (HoLiR, used for paper production [37]. The properties of chitosan to be [24]) are available for production, all have severe disadvantages an anion exchanger cannot only be used in waste water cleaning, [21]. Especially the formation of non-producing mutants in but also as illing material for chromatography. Especially aerated reactors has to be overcome [25], which can be achieved fungal chitosan has advantages due to the uniformity of particle for example by optimization of production conditions. In addition, size [38]. Its antimicrobial effect is exploited in water cleaning production strains were improved towards a homogenous BC procedures [39] the beer-brewing process [40], wound coverage producing phenotype [26] with better yield by reducing the [41] and textile production [42]. In pharmaceutical applications a production of metabolic side-products [27]. Further improvement big potential in the drug delivery is claimed. Here the possibility of productivity can be achieved by using genetic approaches to make chemical modiications on the material and the different (reviewed in [21]). The use of BC for medical devices is believed solubility with changing pH has a big potential to work as a to have a big potential as it is biocompatible and stable. Today, reservoir and a speciic carrier [29,43]. BC is already used for the coverage of heavy wounds which is a Hyaluronic acid (HA) straightforward application [20]. The use as vascular grafts is a more ambitious aim which is still under research [28]. Although Besides processed biocompatible material such as cellulose the main sources of cellulose are plants, the biotechnological and chitosan, materials already present in the human body production of cellulose has distinct advantages, especially for should be per se compatible, offering even more sophisticated biomedical applications. For example the MW of the polymer, the applications. Hyaluronic acid (HA), also called hyaluronan is a density of aggregates and also the shape can be varied, either by simple, linear polymer of the glycosaminoglycan family (igure production process optimization or by genetic manipulation of 1). HA is produced by all vertebrates and Streptococci group the producing organism. On the long run, this can also facilitate A and C [44,45]. As HA from all known sources is chemically new products and applications. identical, the HA from animal or microbial resources is always directly biocompatible to humans. It consists of disaccharide Chitosan repeats of D-glucuronic acid (GlcUA) and N-acetylglucosamine At a irst glance, the production and application of Chitosan (GlcNAc) joined alternately by β-1,3 and β-1,4 glycosidic bond with a MW from 104 to 107 Da. The synthesis via HA synthases is

Page 40 Central well studied and understood [46-48]. Various states of HA such N- and C-termini and hydroxylation of prolyl- and lysyl-residues, as hydrogels, ibers meshes or sponges have been described [49]. N-linked oligosaccharides, glycosylation of hydroxylysyl residues The most prominent applications are currently dermal iller and and disulphide bond formation, which takes place in deined regenerative medicine applications such as scaffolds for tissue cell compartments. Mature CG inally assembles to ibers with engineering [50]. The world market doubled in the pastyears to diameters ranging from 0.5–3 microns [65]. approx. 1 billion USD [51,52]. Pure CG is suited for various sophisticated applications. It The main commercial sources of HA are animal tissues, can be used for medical and cosmetic tissue engineering, drug particularly rooster combs, and bacteria (Streptococci). These delivery and wound care [66,67]. CG isolation from various source simply contamination risks of proteins, DNA, viruses and animal tissues has been developed for years and includes endotoxins of animal or bacterial origin, respectively and require harsh chemical and enzymatically extraction methods [68]. As extensive and harsh puriication strategies [53]. Improvement discussed above for hyaluronic acid, recombinant production of Streptococci strains, optimized fermentation media and of CG improves yield, purity and productivity in comparison to conditions lead to yields of 6-7 g HA per liter fermentation broth animal sourced CG. Plants, insect cells, yeast and bacteria are used (reviewed in [52]) to produce recombinant CG or CG like proteins. Recombinant human collagen type I has been successfully expressed in tobacco A new trend in HA production is the optimization towards a [69]. By co-expression of a special set of human enzymes, post deined molecular weight. Low MW-HA for instance stimulates translational modiications are also possible. The properties of the immune response [54]. Bacillus subtilis lacking HA degrading such a material are comparable to natural derived CG, yielding an enzymes mitigates this problem. It has also been reported optimal alternative to natural sources [70]. recently, that metabolic engineering and induction strategy lead to more uniform HA products [55]. Additionally, “generally Pichia pastoris was engineered to produce recombinant recognized as save” (GRAS) organisms such as Bacillus subtilis human collagen intracellularly, featuring a hydroxylated triple minimize risks of contamination with toxines. helical molecule at levels up to 1.5 g/L. Hydroxylated collagen was produced by coexpression of recombinant collagen with Engineered B. subtilis is propagated to be the major player in recombinant prolyl-hydroxylase [71]. Further engineering of recombinant HA production (reviewed in [52], [56-59]. Patents, the yeast lead to collagen fragments with deined length and publications and journal articles indicate, that HA produced in composition and high expression levels (3 to 14 g/L) [72]. The B. subtilis is available in suficient yields and purity [58,60, 61]. performance of the material can be seen by a cornea derived “Hyasis”, a hyaluronic acid with improved properties produced in from recombinant CG which was stably integrated into human B. subtilis was put on the market by Novozymes and is propagated without rejection for four years [73]. to be the new generation HA (www.hyasis.com). Although bacteria commonly do not have the machinery for New HA derivatives with deined rigidity can only be achieved posttranslational modiications, short and cheap cultivation and by crosslinking due to the invariable core structure of HA. The production times together with easy strain/product engineering challenge lies in identifying non-toxic or irradiant cross linkers. make it favorable to explore this strategy [74]. In order to form highly stable scaffolds for tissue regeneration, cross linking via di-glycidyl ether was reported. Lyophilized The main function und thus the main applications of CG are sponges were chemically derivatized and showed high stability determined by its unique triple-helical structure, making it a against enzymatic degradation [62]. versatile scaffold. Leaving the world of vertebrates, even more specialized structural proteins with extraordinary properties HA is an important component of e.g. the extracellular suited for multiple applications can be found. matrix in vertebrates, but it is exceeded in mass by collagen, the predominant structural polypeptide. Silk Collagen Silk is a natural protein iber traditionally obtained from insect cocoons and commonly associated with Bombyx mori ibers. Silk Collagen (CG) and HA show similar properties and occurrence and its fabrics are characterized by low weight, decent tensile but a very different chemical background. Collagen is a strength, isolating properties, among others. In hydrolyzed form polypeptide, thereby intrinsically exhibiting more variability due silk is used in cosmetics. However, Hymenoptera (e. g. bees, to its individual amino acid composition. The sequence deines the wasps, ants) and especially Arthropods (e. g. spiders) produce biochemical properties, leading to more complex and graduated even superior silks, which display higher toughness and ductility functions in both, native as well as artiicial applications. It is the as well as better mechanical and chemical resilience (igure 1). predominant structural protein in various connective tissues Thus, spider silk is the most outstanding non-bombyx silk and in and extracellular matrices in humans and animals and makes up the focus of research in academia and industry for decades. Silks 5% to 35% of their entire protein. It is the main component of of the genera Araneus (European garden cross spider), Nephila fascia, cartilage, ligaments, tendons, bone and skin [63]. The CG (golden silk orb-weaver) and others were identiied and are still super family comprises 28 different types of collagen proteins studied extensively. Spiders produce different types of silk for to date. Although this family is highly diverse, most - if not all different functions in their webs and cocoons such as scaffolding - share a unique repeated amino acid motif Gly-Pro-X or Gly-X- silks, capturing lines or dragline silk. The latter is used for the Hydroxyproline, where X may be any amino acid [64,65]. CG is webs outer rim and is characterized by high tensile strength and synthesized in a well understood procedure including cleavage of

Page 41 Central

Figure 2 Shapes of recombinant spider silk. Possible shapes of biopolymers are presented on the example of recombinant spider silk. Other biopolymers discussed in this review are able to adapt at least one or more of these shapes. Similar to natural spider silk, recombinant silk can be converted into ibers. It is also possible to transform silk proteins in other two- or three-dimensional shapes such as ilms, hydrogels, foams, capsules and spheres (pictures with courtesy from AMSilk GmbH, 2014).

Table 1: Summary of biopolymers, their origin, potential production organisms and features. Natural Production Biopolymer Monomer GMO Biodegradable Biocompatible Hydrogel Fiber Commercialized origin Microorganism Plants, Micro- Cellulose glucose A. xylinum No Yes Yes Yes Wound covering organism Hyaluronic N-acetyl- Vertebrats, Streptococci, B. Dermalillers, Vis- Yes Yes Yes Yes No acid glucosamin Streptococci subtilis cosupplementation Bacillus spp., Glutamic Cosmetics, fertil- γ-PGA Microorgan- Bacillus spp. No Yes Yes No acid izer, locculant ism Bombyxmorii, Cosmetics, cell ad- Silk protein E. coli, Yes Yes Yes Yes Yes spider, bee hesion scaffolds Scaffolds, Cosmet- Collagen protein Vertebrates Yeasts Yes Yes Yes Yes Yes ics N-acetyl- Flocculant, Filter glucosamin membranes, Cos- Chitosan (partly fungi Yeast , bacteria No Yes Yes Yes Yes metics, wound deacyl- covering ated) ductility [75]. As spiders are territorial, they cannot be farmed easily and silk ibers would have to be prepared manually from each single The dragline of Nephila clavipes consists of two predominant spider. Since the publishing of a (partial) spider silk amino acid proteins MaSp1 and MaSp2, each with a molecular size of more sequence the work on its recombinant production in engineered than 300 kDa. These proteins are comprised of highly repetitive host organisms began [77]. motifs with an unusual high alanine, glycine and proline content (MaSp2). The dragline of Nephilaclavipes contains approx. 80% Spider silk can be produced in goats [78], plants [79], yeast MaSp1 and approx. 20% MaSp2, leading to a high tensile strength [80], silkworms [81] and many more systems. None of these exceeding 1500 MPa [76]. platforms ever reached industrial scale. The breakthrough

Page 42 Central for industrial scale production was achieved by Scheibel and Kytozyme (Belgium) - the irst company which started to produce coworkers [82]. Engineered domains of the dragline proteins Chitosan from fungi in 2007 - also originates from academical ADF3 and ADF4 from Araneus diadematus can now be produced research. The same is true for the production of spider silk. in established E. coli production processes. Recombinant spider silk is an ideal material for various industrial sectors such as The proprietary silk platform technology of AMSilk cosmetics, pharmaceutics or technical products. It is available (Germany) was also developed in a university lab. Five years after in form of coatings, particles, ilms, nonwovens, hydrogels and its formation, AMSilk is the irst company offering commercial silk threads (igure 2). Together with its biocompatibility the products made from spider silk [87]. These products include proteins offers ideal prerequisites for implant coatings. A recent for example cosmetical bulk ingredients such as Silkbeads and study demonstrated that spider silk coated silicone implants are Silkgel. In parallel, a new and unique medical product, the SanaSilk signiicantly better accepted than common, non-coated implants skin protection spray, has been developed and is scheduled to hit [83]. the market in 2014. More sophisticated medical devices such as spider silk covered silicone implants show signiicantly reduced As silk monomers can be specially engineered and extended post-operative inlammation as well as reduced capsule formation with other protein domains, nearly any functional protein in comparison to untreated silicone implants [83]. Here, further entity can be fused to spider silk proteins, thereby adding a new development is ongoing. The irst artiicial spider iber (Biosteel) functionality to the spider silk properties. Wohlrab and colleges was presented early 2013. Currently the production process for [84] showed, that a ilm with a spider silk derivative comprising this iber is evaluated on pilot-scale. the integrin recognition sequence (RGD-motif) signiicantly improved adherence of for instance BALB/3T3 mouse cells. The presented examples demonstrate that innovative These indings can be assigned to applications, where speciic biopolymers are in many cases not developed by multinational cell lines are directed to scaffolds or tissues in reconstruction corporations, but by specialized research laboratories and/or medicine. Spider silk based materials can additionally also dedicated small companies. As is true for most breakthrough be functionalized with covalently or non-covalently bound inventions, money and time are critical parameters. (Federal) compounds. Recent studies indicate, that enzymes and drugs can Investment in research and universities is thus a prerequisite be imbedded in silk, which are later released linearly [85,86]. for commercial success in industrial biotechnology, accelerating new and sophisticated products without further exploiting our CONCLUSIONS environment. All presented biopolymers show similar properties even REFERENCES though they sometimes arise from totally different origins. They are biodegradable, even though they are very stable under 1. Coca-Cola, Ford Motor Company, H.J. Heinz Company, NIKE, Inc. and most conditions. Furthermore, they all are biocompatible and Procter & Gamble today announced the formation of the Plant PET Technology Collaborative (PTC), Atlanta 2005. applications in form of medical devices or in pharmaceutical products already exist or are under development. Most of them 2. Babu RP, O’Connor K, Seeram K, Current progress on bio-based can be used as hydrogel or as a iber independently of their polymers and their future trends, Progress in Biomaterials. 2013; 2: 8. original, natural appearance (table 1). 3. Naika SN, Goudb VV, Routb PK, Dalaib AK. Production of irst and The main difference between the described biopolymers second generation biofuels: A comprehensive review, Renewable and Sustainable Energy Reviews. 2010; 14: 578–597. is their respective industrial production process. Bacterial cellulose, hyaluronic acid, γ-PGA and chitosan are in nature 4. Advanced Ethanol Council, Industry Progress Report. 2012-2013, already produced by microorganisms. Their production under 2012. controlled conditions in bioreactors is thus possible without 5. Vert M, Doi Y, Hellwich KH, Hess M, Hodge P, Kubisa P, et al. demanding changes within the production organism. Silk Terminology for biorelated polymers and applications (IUPAC and collagen can in principle be directly produced from their Recommendations 2012), Pure Appl. Chem. 2012; 84: 377–410. originating animals/insects, too. Nevertheless, production from 6. Ashiuchi M. Microbial production and chemical transformation of animals always holds the risk of diseases and impurities due to poly--glutamate. Microb Biotechnol. 2013; 6: 664-674. the nature of living higher order organisms. In the near future, technological improvements achieved by applying genetically 7. Kino K, Arai T, Arimura Y. Poly-alpha-glutamic acid synthesis using a novel catalytic activity of RimK from Escherichia coli K-12. Appl modiied organisms and/or newly designed production systems Environ Microbiol. 2011; 77: 2019-2025. (as for instance in the case of cellulose) will further improve the availability of materials with high purity and quality. 8. Huang J, Du Y, Xu G, Zhang H, Zhu F, Huang L, et al. High yield and cost- effective production of poly(-glutamic acid) with Bacillus subtilis. The complexity of these production processes becomes Eng. Life Sci. 2011; 11: 291–297. evident after taking a closer look into the structure of the 9. Moraes LP, Brito PN, Alegre RM. The Existing Studies on Biosynthesis companies producing such materials. Bacterial cellulose is of Poly(-glutamic acid) by Fermentation, Food and Public Health. classically produced in simple production systems, but academia 2013; 3: 28-36. has developed a special production reactor which eventually led to the founding of Jenacell (Germany). The production of 10. Bhunia B, Mukhopadhy D, Goswami S, Mandal T, Dey A. Improved production, characterization and locculation properties of poly ()- hyaluronic acid in B. subtilis has been developed by Novozymes glutamic acid produced from Bacillus subtilis, J Biochem Tech. 2012; (Denmark) one of the biggest biotech companies in the world. 3: 389-394.

Page 43 Central

11. Wu JY, Ye HF. Characterization and locculating properties of an Enzymatic Method and Applications in Plant Tissue Culture and Tissue extracellular biopolymer produced from a Bacillus subtilis DYU1 Engineering: 11 Years of Our Progress, Present Situation and Future isolate, Process Biochem. 2007; 42: 1114–1123. Prospects, Biopolymers, In Tech 2010; ISBN: 978-953-307-109-1. 12. Shih IL, Van YT. The production of poly-(gamma-glutamic acid) from 31. Kaur K, Dattajirao V, Shrivastava V, Bhardwaj U. Isolation and microorganisms and its various applications. Bioresour Technol. characterization of chitosan-producing bacteria from beaches of 2001; 79: 207-225. chennai, India. Enzyme Res. 2012; 2012: 421683. 13. Tanimoto H, Mori M, Motoki M, Torii K, Kadowaki M. Natto mucilage 32. Healy M, Green A, Healy A. Bioprocessing of Marine Crustacean Shell containing poly-gamma-glutamic acid increases soluble calcium in the Waste. ActaBiotechnol. 2003; 23: 151–160. rat small intestine. Biosci Biotechnol Biochem. 2001; 65: 516-521. 33. Vázquez JA, Rodríguez-Amado I, Montemayor MI, Fraguas J, González 14. Bhat A, Irorere V, Bartlett T, Hill D, Kedia G, Morris M, et al. Bacillus Mdel P, Murado MA. Chondroitin sulfate, hyaluronic acid and chitin/ subtilisnatto: a non-toxic source of poly-gamma-glutamic acid that chitosan production using marine waste sources: characteristics, could be used as a cryoprotectant for probiotic bacteria, AMB Express. applications and eco-friendly processes: a review. Mar Drugs. 2013; 2013; 3: 36. 11: 747-74. 15. Poo H, Park C, Kwak MS, Choi DY, Hong SP. New biological functions 34. Synowiecki J, Al-Khateeb NAAQ. The recovery of protein hydrolysate and applications of high-molecular-mass poly-gamma-glutamic acid. during enzymatic isolation of chitin from shrimp Crangoncrangon Chem Biodivers. 2010; 7: 1555-1562. processing discards. Food Chem. 2000; 68: 147–152. 16. Richard A, Margaritis A. Poly(glutamic acid) for biomedical 35. Peter MG, Chitin and Chitosan in Fungi. Biopolymers Online. 2005. applications. Crit Rev Biotechnol. 2001; 21: 219-232. 36. Da Sacco L, Masotti A. Chitin and chitosan as multipurpose natural 17. Yuan H, Luo K, Lai Y, Pu Y, He B. A novel poly(l-glutamic acid) polymers for groundwater arsenic removal and AS2O3 delivery in dendrimer based drug delivery system with both pH-sensitive and tumor therapy. Mar Drugs. 2010; 8: 1518-1525. targeting functions. Mol Pharm. 2010; 7: 953-962. 37. Nicu R, Bobu E, Miranda R, Blanco A. Flocculation Eficiency of Chitosan 18. Yao J, Xu H, Shi N, Cao X, Feng X. Analysis of carbon metabolism and for Papermaking Applications, Bioresources, 2013; 8: 768-784. improvement of gamma-polyglutamic acid production from Bacillus subtilis NX-2. Appl Biochem Biotechnol. 2010; 160: 2332-2341. 38. Kucera J. Fungal mycelium--the source of chitosan for chromatography. J Chromatogr B Analyt Technol Biomed Life Sci. 2004; 808: 69-73. 19. Zeng W, Lin Y, Qi Z, He Y, Wang D. An integrated high-throughput strategy for rapid screening of poly(-glutamic acid)-producing 39. Cooper A, Oldinski R, Ma H, Bryers JD, Zhang M. Chitosan-based bacteria. Appl Microbiol Biotechnol. 2013; 97: 2163-2172. nanoibrous membranes for antibacterial ilter applications. Carbohydr Polym. 2013; 92: 254-259. 20. Czaja W, Krystynowicz A, Bielecki S, Brown RM Jr. Microbial cellulose- -the natural power to heal wounds. Biomaterials. 2006; 27: 145-151. 40. Pan C, Rezaei H, Soor A. Chitosan Disrupts Membrane Permeability of Lactic Acid Bacteria, J. Exp. Microbiol. Immunol. 2011; 15: 7-14 21. Chawla PR, Bajaj IB, Survase SA, Singhal RS. Microbial Cellulose: Fermentative Production and Applications, Food Technol. Biotechnol. 41. Hurler J, Škalko-Basnet N. Potentials of Chitosan-Based Delivery 2009; 47: 107–124. Systems in Wound Therapy: Bioadhesion Study. Journal of Functional Biomaterials. 2012; 3: 37-48. 22. Watanabe K, Tabuchi M, Morinaga Y, Yoshinaga F. Structural Features and Properties of Bacterial Cellulose Produced in Agitated Culture, 42. Pillai CKS, Paul W, Sharma CP. Chitin and chitosan polymers: Kluwer Academic Publishers: Cellulose. 1998; 5: 187-200. Chemistry, solubility and iber formation, Prog Polym Sci 2009; 34: 641–678. 23. Verschuren PG, Cardona TD, Nout MJ, De Gooijer KD, Van den Heuvel JC. Location and limitation of cellulose production by Acetobacter 43. Zhang J, Xia W, Liu P, Cheng Q, Tahirou T. Chitosan modiication and xylinum established from oxygen proiles. J Biosci Bioeng. 2000; 89: pharmaceutical/biomedical applications. Mar Drugs. 2010; 8: 1962- 414-419. 1987. 24. Kralisch D, Hessler N, Klemm D, Erdmann R, Schmidt W. White 44. Laurent TC, Fraser JR. Hyaluronan. FASEB J. 1992; 6: 2397-2404. biotechnology for cellulose manufacturing--the HoLiR concept. 45. Fraser JR, Laurent TC, Laurent UB. Hyaluronan: its nature, distribution, Biotechnol Bioeng. 2010; 105: 740-747. functions and turnover. J Intern Med. 1997; 242: 27-33. 25. schramm M, Hestrin S. Factors affecting production of cellulose at 46. Hubbard C, McNamara JT, Azumaya C, Patel MS, Zimmer J. The the air/liquid interface of a culture of Acetobacter xylinum. J Gen hyaluronan synthase catalyzes the synthesis and membrane Microbiol. 1954; 11: 123-129. translocation of hyaluronan. J Mol Biol. 2012; 418: 21-31. 26. Tsuchida T, Yoshinaga F. Production of bacterial cellulose by agitation 47. Heldermon C, DeAngelis PL, Weigel PH. Topological organization of culture systems, Pure Appl. Chem. 1997; 69: 2453-2458. the hyaluronan synthase from Streptococcus pyogenes. J Biol Chem. 27. Dewulf P, Joris K, Vandamme E. Improved cellulose formation by an 2001; 276: 2037-2046. Acetobacterxylinum mutant limited in (keto)gluconate synthesis. J 48. DeAngelis PL, Papaconstantinou J, Weigel PH. Molecular cloning, Chem. Technol. Biotechnol. 1996; 67: 376–380. identiication, and sequence of the hyaluronan synthase gene from 28. Zahedmanesh H, Mackle JN, Sellborn A, Drotz K, Bodin A, Gatenholm group A Streptococcus pyogenes. J Biol Chem. 1993; 268: 19181- P, et al. Bacterial cellulose as a potential vascular graft: Mechanical 19184. characterization and constitutive model development. J. Biomed. Mater. Res. 2011; 97: 105–113. 49. Burdick JA, Prestwich GD. Hyaluronic acid hydrogels for biomedical applications. Adv Mater. 2011; 23: H41-56. 29. Sonia TA, Sharma CP. Chitosan and Its Derivatives for Drug Delivery Perspective. AdvPolym Sci. 2011; 243: 23–54 50. Fakhari A, Phan Q, Berkland C. Hyaluronic acid colloidal gels as self- assembling elastic biomaterials. J Biomed Mater Res B Appl Biomater. 30. New N, Furuike T, Tamura H. Production of Fungal Chitosan by 2014; 102: 612-618.

Page 44 Central

51. Chong BF, Blank LM, Mclaughlin R, Nielsen LK. Microbial hyaluronic More than just another molecule. Bioengineered. 2014; 5: 49-52. acid production. Appl Microbiol Biotechnol. 2005; 66: 341-351. 71. Rutschmann C, Baumann S, Cabalzar J, Luther KB, Hennet T. 52. Liu L, Liu Y, Li J, Du G, Chen J. Microbial production of hyaluronic acid: Recombinant expression of hydroxylated human collagen in current state, challenges, and perspectives. Microb Cell Fact. 2011; 10: Escherichia coli. Appl Microbiol Biotechnol. 2014; 98: 4445-4455. 99. 72. Báez J, Olsen D, Polarek JW. Recombinant microbial systems for the 53. Balazs EA, “Ultrapure hyaluronic acid and the use thereof,” U.S. Patent, production of human collagen and gelatin. Appl Microbiol Biotechnol. US4141973. 1979. 2005; 69: 245-252. 54. Baeva LF, Lyle DB, Rios M, Langone JJ, Lightfoote MM. Different 73. Fagerholm P, Lagali NS, Ong JA, Merrett K, Jackson WB. Stable corneal molecular weight hyaluronic acid effects on human macrophage regeneration four years after implantation of a cell-free recombinant interleukin 1Î² production. J Biomed Mater Res A. 2014; 102: 305-314. human collagen scaffold. Biomaterials. 2014; 35: 2420-2427. 55. Jia Y, Zhu J, Chen X, Tang D, Su D. Metabolic engineering of Bacillus 74. Yu Z, An B, Ramshaw JA, Brodsky B. Bacterial collagen-like proteins subtilis for the eficient biosynthesis of uniform hyaluronic acid with that form triple-helical structures. J Struct Biol. 2014;. controlled molecular weights. Bioresour Technol. 2013; 132: 427-431. 75. Cranford SW, Tarakanova A, Pugno NM, Buehler MJ. Nonlinear 56. Mao Z, Shin HD, Chen R. A recombinant E. coli bioprocess for material behaviour of spider silk yields robust webs. Nature. 2012; hyaluronan synthesis. Appl Microbiol Biotechnol. 2009; 84: 63-69. 482: 72-76. 57. Yu H, Stephanopoulos G. Metabolic engineering of Escherichia coli for 76. Rising A, Widhe M, Johansson J, Hedhammar M. Spider silk proteins: biosynthesis of hyaluronic acid. Metab Eng. 2008; 10: 24-32. recent advances in recombinant production, structure-function relationships and biomedical applications. Cell Mol Life Sci. 2011; 68: 58. Widner B, Behr R, Von Dollen S, Tang M, Heu T. Hyaluronic acid 169-184. production in Bacillus subtilis. Appl Environ Microbiol. 2005; 71: 3747-3752. 77. Prince JT, McGrath KP, DiGirolamo CM, Kaplan DL. Construction, cloning, and expression of synthetic genes encoding spider dragline 59. Chien LJ, Lee CK. Hyaluronic acid production by recombinant silk. Biochemistry. 1995; 34: 10879-10885. Lactococcus lactis. Appl Microbiol Biotechnol. 2007; 77: 339-346. 78. Service RF. Materials science. Mammalian cells spin a spidery new 60. Brown SH, Pummill PE. Recombinant production of hyaluronic acid. yarn. Science. 2002; 295: 419-421. Curr Pharm Biotechnol. 2008; 9: 239-241. 79. Scheller J, Gührs KH, Grosse F, Conrad U. Production of spider silk 61. Sloma A, Behr R, Widner W, Tang M, Sternberg D, Brown S. Novozymes proteins in tobacco and potato. Nat Biotechnol. 2001; 19: 573-577. AS (Denmark), Methods for producing hyaluronan in a recombinant host cell. US8093036 B2. 2012. 80. Fahnestock SR, Bedzyk LA. Production of synthetic spider dragline silk protein in Pichia pastoris. Appl Microbiol Biotechnol. 1997; 47: 33-39. 62. La Gatta A, Schiraldi C, Papa A, D’Agostino A, Cammarota M. Hyaluronan scaffolds via diglycidyl ether crosslinking: toward improvements in 81. Teulé F, Miao YG, Sohn BH, Kim YS, Hull JJ. Silkworms transformed composition and performance. Carbohydr Polym. 2013; 96: 536-544. with chimeric silkworm/spider silk genes spin composite silk ibers with improved mechanical properties. Proc Natl Acad Sci U S A. 2012; 63. Shoulders MD, Raines RT. Collagen structure and stability. Annu Rev 109: 923-928. Biochem. 2009; 78: 929-958. 82. Huemmerich D, Helsen CW, Quedzuweit S, Oschmann J, Rudolph 64. Ricard-Blum S, Ruggiero F. The collagen superfamily: from the R. Primary structure elements of spider dragline silks and their extracellular matrix to the cell membrane. Pathol Biol (Paris). 2005; contribution to protein solubility. Biochemistry. 2004; 43: 13604- 53: 430-442. 13612.

65. Ricard-Blum S. The Collagen Family. Cold Spring Harb Perspect Biol 83. Zeplin PH, Maksimovikj NC, Jordan MC, Nickel J, Lang G, Leimer AH, et 2011; 3. al. Spider silk coatings as a bioshield to reduce periprosthetic ibrous 66. Lee CH, Singla A, Lee Y. Biomedical applications of collagen. Int J capsule formation. Adv. Funct. Mater. 2014; 24: 2658-2666. Pharm. 2001; 221: 1-22. 84. Wohlrab S, Müller S, Schmidt A, Neubauer S, Kessler H. Cell adhesion 67. Cen L, Liu W, Cui L, Zhang W, Cao Y. Collagen tissue engineering: and proliferation on RGD-modiied recombinant spider silk proteins. development of novel biomaterials and applications. Pediatr Res. Biomaterials. 2012; 33: 6650-6659. 2008; 63: 492-496. 85. Bluem C, Nichtl A, Scheibel T. Spider silk capsules as protective 68. Pacak CA, Powers JM, Cowan DB. Ultrarapid puriication of collagen reaction containers for enzymes, Adv. Funct. Mater. 2014; 24: 763- type I for tissue engineering applications. Tissue Eng Part C Methods. 768. 2011; 17: 879-885. 86. Hardy JG, Leal-Egaña A, Scheibel TR. Engineered spider silk protein- 69. Stein H, Wilensky M, Tsafrir Y, Rosenthal M, Amir R. Production based composites for drug delivery. Macromol Biosci. 2013; 13: 1431- of bioactive, post-translationally modiied, heterotrimeric, human 1437. recombinant type-I collagen in transgenic tobacco. Biomacromolecules. 2009; 10: 2640-2645. 87. Scott A, Spider Silk Poised For Commercial Entry. C&EN. 2014; 92: 24- 27. 70. Shoseyov O, Posen Y, Grynspan F. Human collagen produced in plants:

Cite this article Bendig C, Kraxenberger T, Römer L (2014) Shaping the Future with Industrial Biotechnology–New and Efﬁ cient Production Processes for Biopolymers. JSM Biotechnol Bioeng 2(1): 1025.

Page 45 Research Article *Corresponding authors Prof. Dr. Garabed Antranikian, Institute of Technical Microbiology, Hamburg University of technology, The Psychrophile Shewanella Kasernenstr, 12, 21073 Hamburg, Germany, Tel: 4904042878311; Fax: 49040428782582; Email: arctica sp. Nov: A New Source Prof. Dr. Thomas Brück, Department of Chemistry, Industrial Biocatalysis, Technical University of Munich, Lichtenbergstr, 4, 85748 Garching, Germany, Tel: of Industrially Important 4908928913253; Fax: 4908928913255; Email:

Submitted: 19 March 2014 Enzyme Systems Accepted: 12 May 2014 Qoura, F.1, Brück, T.2* and Antranikian, G.3* Published: 14 May 2014 1Department of Chemistry, Industrial Biocatalysis, Technical University of Munich, Germany ISSN: 2333-7117 2Department of Chemistry, Industrial Biocatalysis, Technical University of Munich, Germany Copyright 3 Institute of Technical Microbiology, Hamburg University of technology, Germany © 2014 Qoura et al.

Keywords OPEN ACCESS Spitsbergen; Psychrophile; Shewanella arctica; Industrial enzymes

Abstract A new psychrophilic, strictly aerobic bacterium, strain 40-3, was isolated from seawater samples collected at Spitsbergen in the Arctic. The cells are gram negative, straight or curved rod shaped and non-spore forming (2-3 μm long and 0.4-0.6 μm wide). Colonies on agar medium are slightly orange, circular, smooth and convex. 40-3 strain grows optimally over the temperature range of 10-15 °C and a pH range of 7-8 in media containing 8 to 9 % NaCl (w/v). Growth occurs with  cyclo-dextrin, dextrin, tween 80, N-acetyl-D-glucosamine, -D-glucose, maltose, sucrose, methyl pyruvate, D,L-lactitate, succiniate , bromo succinic acid, inosine, esculin ferric citrate, L-arabinose, potassium gluconate, malic acid and trisodium citrate. In the presence of

glucose H2S was produced and nitrates are reduced to nitrites. The fatty acid methyl ester (FAME) are composed of 17.89 % straight chain saturated FAMEs, 14,85 % terminally branched saturated FAMEs and 17.73 % monounsaturated FAMEs. The DNA base ratio is 48 mol % G + C. Phylogenetic analysis reveals as close relationship to Shewanella putrefaciens with 99 % 16S rDNA composition identity and 50 % DNA- DNA similarity. The phylogenetic evidence, together with phenotypic characteristics, show that this psychrophilic strain constitute a novel species of the genus Shewanella. The name Shewanella arctica is proposed. Interestingly, when grown on glucose as a carbon source Shewanella arctica produced numerous industrially important enzyme systems including amylase, pullulanase, protease, ornithine decarboxylase, alkaline phospatase, esterase (C4), lipase (C8), leucine arylamidase, valine arylamidase, naphthol-AS-BI-phosphohydrolase and N-acetyl-– glucosaminidase. Due to the functional new physochrophilic Shewanella strainresource for the isolation of new enzyme system, which may operate at low reaction thereby increasing the energy efﬁ ciency of industrial processes.

ABBREVIATION Recently, a comprehensive study of the phylogenetic relationships and taxonomy of the genus provided an improved FAME: Fatty Acid Methyl Ester approach for identiication of newly isolated wild strains [6]. In INTRODUCTION this study a novel psychrophilic bacterium was isolated from seawater samples obtained from the area of Spitsbergen, in the Recently, increasing attention has been directed to cold- Arctic. The novel isolate was found to be similar to, but distinct adapted microorganisms able to grow at/or close to the from in a number of characteristics, a previously described genus, freezing point of water, namely psychrophiles [1]. Cold adapted Shewanella. Taxonomic and physiological analysis of the newly microorganisms are found in both permanently and temporarily isolated strain demonstrated that the represent is a novel specie cold habitats, which comprise more than 80 % of the Earth’s of the genus Shewanella, and we propose the name Shewanella biosphere. The genus Shewanella MacDonell and Colwell 1985 arctica sp. nov. For the species represented by the strain 40- comprises a ubiquitous group of gram negative, aerobic and 3. Further, the isolated Shewanella strain secreted numerous facultatively anaerobic δ-Proteobacteria. This genus comprises industrially relevant enzyme systems including hydrolyases more than 25 species inhabiting a wide range of environments such, as amylase, protease and, esterases and lipases. Enzymes including spoiled food, oil ield wastes, redox interfaces in marine derived from physchiphilic organism have the potential to and freshwater, cold water and sediments of the deep sea [2-6]. operate at low temperatures thereby improving the energy During the last decade, the bacteria of this genus have received a eficiency of biotechnological process [10-12]. Further, many signiicant amount of attention due to their important roles in co- physochophilic enzymes have shown the propensity to operate metabolic bioremediation of halogenated organic pollutants [7], destructive souring of crude petroleum [8] and the dissimilatory over a wider temperature proile than those derived from reduction of magnesium and iron oxides [9]. mesophilic organism [13,14]. More recently, various Shewanella

Page 46 Central sp. have been lagged as excellent sources for novel industrially were inoculated with the new strain cells suspension (cells were relevant enzyme systems [15-17]. Therefore, the enzymes resuspended in NaCl 0.85 % (w/v) medium to a inal OD of 0.5 systems that can be produced using the current bacterial strain nm) and incubated at 15 °C overnight. have potential use in the biofuels and food (amylase, lipase) as A large number of carbon source were tested: α cyclo- well as the chemical industry (pullulanase, alkaline phospatase, dextrin, dextrin, Tween 80, Tween 40, N-acetyl-D-glucosamine, leucine arylamidase, valine arylamidase). α-D-glucose, maltose, sucrose, methylpyruvate, D,L-lactic MATERIALS AND METHODS acid, succinic acid, bromo succinic acid, inosine, esculin ferric Sample collection, media and culturing conditions citrate, L-arabinose, potassium gluconate, malic acid, trisodium citrate, glycogen, N-acetyl-D-galacto-samine, adonitol, capric Seawater samples were collected in 1998 during an acid, D-arabitol, cellobiose, L-erythol, D-fructose, L-fructose, expedition at Spitsbergen, Norway. Samples were transported D-galactose, gentiobiose, m-inositol, α-D-lactose, lactulose, to the laboratory at temperature between 2 to 10 °C. A 1 ml D-mannitol, D-mannose, D-mellobiose, β-methyl-D-glucose, volume of liquid sample was incubated in a complex marine D-psicose, D-rafinose, L-rhamnose, D-sorbitol, D-trehalose, liquid medium. The complex marine medium consisted of a turanose, Xylitol, mono-methyl succinate, acetic acid, cis- basal medium supplemented with a solution of different carbon aconitic acid, citric acid, formic acid, D-galactonic acid sources. The basal medium contained (volume g l-1): NaCl 28.13 lactone, D-galacturonic acid, D-gluconic acid, D-glucosaminic g; KCl 0.77 g; CaCl2 x2H2O 0.02 g; MgSO4 x7H2O 0.5 g; NH4Cl 1.0 acid, D-glucuronic acid, α-hydroxy-butyric acid, β-hydroxy- g; iron-ammonium-citrate 0.02 g; yeast extract 0.5 g; 10-fold butyric acid, γ-hydroxy-butyric acid, p-hydroxyphenylacetic concentration trace element solution (DSM 141) 1 ml; 10-fold acid, itaconic acid, α-keto butyric acid, α-keto glutaric acid, concentration vitamin solution (DSM 141) 1 ml; KH2PO4 2.3 α-keto valeric acid, malonic acid, propionic acid, quinic acid, g; Na2HPO4 x2H2O 2.9 g. The carbon source mixture solution D-saccharic acid, seabacic acid, succinamic acid, glucuronamide, -1 (volume g l ): NA-acetate 0.5 g; Na2-succinate 0.5 g; Na-pyruvate alaninamide, D-alanine, L-alanine, L-alanyl-glycine, L-asparagine, 0.5 g; DL-malate 0.5 g; D-mannitol 0.5 g and glucose 2 g. The L-aspartic acid, L-glutamic acid, glycyl-L-aspartic acid, glycyl- inal pH of the complex medium was 7. Incubation was carried L-glutamic acid, L-histidine, hydroxy L-proline, L-leucine, out at 4 °C for about 4-7 days, before growth and colonies on L-ornithine, L-phenyl-alanine, L-proline, L-pyroglutamic acid, agar plates were observed. Colonies were selected on the basis D-serine, L-serine, L-threonine, D,L-carnitine, γ-amino butyric of morphological differences. For the isolation of a pure culture, acid, urocanic acid, uridine, thymidine, phenylthylamine, serial dilution and plating techniques were applied. The pure putrescine, 2-aminoethanol, 2,3-butanediol, glycerol, D,L isolates were routinely cultivated on complex marine medium α-glycerol phosphate, glucose 1-phosphate, glucose 6-phosphate, agar plates at 15 °C for 4 days. phenylacetic acid. Cellular characterization Screening for enzyme production Gram staining test was performed by staining cells using the The ability of the new strain to produce: alkaline phospatase, Hucker method [18]. For the sporulation test cells were grown arginine dihydrolase, esterase (C4), esterase lipase (C8), for up to 6 days in medium containing no carbon source other lipase, leucine arylamidase, valine arylamidase, cystine then 0.1 % (w/v) yeast extract. The presence of spores and cell arylamidase, trypsin, α chymotrpsin, acid phosphatase, omithine morphology were determined by phase-contrast microscope decarboxylase, lysine decarboxylase, urease, tryptophane (Zeiss/Axioskop). deaminase, naphthol-AS-BI-phosphohydrolase, α and β – galactosidase, β – glucoronidase, α and β – glucosidase, N-acetyl-β Optimal temperature, pH and salt requirement for – glucosaminidase, α – mannosidase and α – fucosidase was tested growth on api zym (25 200) strips (bio Merieux, Inc) by inoculation the The optimum growth temperature was tested between 4-37 strips wells with cell suspension of the new strain (cells were °C and pH 7. The pH optimum for growth was tested between pH resuspended in water to a inal OD of 5 nm). The strips were 2-10 at 15 °C. The salt requirement was determined on different incubated at 15 °C for 6 hours. NaCl concentration between 0 and 10 % (w/v), with no change Amylase, arabinase, arabinoxylanase, protease, HE-cellulase, of the other salts concentrations at pH 7 and 15 °C. Growth was glucanase, dextranase, galactanase, galactomannanase, β- measured by determining the optical density at 600 nm (1 – cm glucanase, pullulanase, curdlanase xylanase and xyloglucanase path length) using Schimadzu UV spectrophotometer. production from the new strain was tested on diffusion agar Substrate spectrum plates containing the base medium and 0.1 % (w/v) of one of the following substrates: red pullulan (pullulanase), azo-casien Substrates utilization from the new strain was tested on (protease) , AZCL – pullulan (pullulanase), AZCL – HE – cellulose api 20 NE strips (20050) (Bio Merieux. Inc), api 20 E strips (20 (HE – celulase), AZCL – arabinan (arabinase), AZCL – arabinoxylan 100/20 160) (Bio Merieux. Inc) and Biolog GN2 micro-plates. (arabinoxylanase), AZCL – curdlan (curdlanase), AZCL – amylose api 20 NE strips (20050) (Bio Merieux. Inc) and api 20 E strips (amylase), AZCL – dextran (dextranase), AZCL – galactan (20 100/20 160) were also used for testing the ability of the new (galactanase), AZCL – galactomannan (galactomannanase), AZCL strain to produce indol (tryptoPhane), acetoin and H S (from 2 – β - glucan (β – glucanase) AZCL – xylan (xylanase) and AZCL – sodium thiosalfate) and the ability of the strain to reduce nitrates xyloglucan (xyloglucanase). Substrate degradation was detected to nitrites and nitrites to nitrogen. The strips and micro-plates by clearing zone/color diffusion halo around the colonies after

Page 47 Central the new stain was grown on these substrates agar plates at 10 °C Shewanella colwelliana (AY653177.1), Shewanella decolorationis for 2-4 days. AZCL – polymers were purchased from Megazume, (AJ609571.1), Shewanella idelia (AF420313.1), Shewanella Bray, Ireland. frigidimarina (AJ300833.1), Shewanella gaetbuli (AY190533.1) Shewanella gelidimarina (U85907.1), Shewanella hanedai Fatty acids analysis (X82132.1), Shewanella japonica (AF500079.1), Shewanella Cells of the new strain were harvested from a 2 l culture kaireiae (AB094598.1), Shewanella livingstonis (AJ300834.1), sample by centrifugation and were used for fatty acids analysis. Shewanella marinintestina (AB081759.1), Shewanella marislavi Fatty acids methyl ester (FAME) was performed according to the (AY485224.1), Shewanella massilia (AJ006084.1) Shewanella modiied method of Lepage and Roy (1984) [19]. Total lipids were paciica (AY366086.1), Shewanella pealeana (AF011335.1), extracted according to Bligh and Dyer (1959) [20]. The FAMEs Shewanella saccharophilus (AF033028.1), Shewanella sairae were analyzed by capillary gas chrompack [21]. A fused silica (AB081762.1), Shewanella schlegeliana (AB081761.1), capillary column D23, 40 m (Fisons) was used for the separation Shewanella surugaensis (AB094597.1), Shewanella violacea of fatty acid species.The chromatographic conditions were as (D21225.1), Shewanella waksmanii (AY170366.1), Shewanella follows: injector (PTV): 65 °C – 270 °C split ratio 15:1; carrier gas: woodyi (AF003548.1) and Shewanella olleyana (AF295592.1). helium at a 40 cm s-1 low. Column oven: initial temperature : 60 G + C content of genomic DNA °C for 0.1 min; from 60 °C to 180 °C at 40 °C min-1; 180 °C for 2 min; from 180 °C to 210 °C for 3min; from 210 °C to 240 °C at 3 Cells of the new strain were harvested from a 2 l culture sample °C min-1; 240 °C for 10 min. The spectra were recorded by a lame by centrifugation and were used for the determination of G + C ionization detector at 280 °C. content of the genomic DNA. The cells were disrupted with a cell French presser and puriied by chromatography hydroxyapatit 16S rDNA ampliication and sequencing [26]. The mol % G + C of genomic DNA was determined by high performance liquid chromatography (HPLC) (Shimadzu corp, Cells of the new strain were harvested from 500 μl a cell culture sample by centrifugation and resuspended in 100 μl of water. A Japan) [27]. The analytical column was a VYDAC 201 SP 54, C18 sub-sample of 1 μl was used as template for the ampliication of 5 μm (250 x 4.6 mm) equipped with a guard column 201 GD 54H the 16S rDNA. PCR-mediated ampliication of the 16S rDNA was (Vydac, Hesperia, USA). carried out according to Stakebrandt & Gloebel (1994) [22]. PCR DNA – DNA hybridization products were puriied using the QIA quick PCR puriication kit (Qiagen). Puriied PCR products were directly sequenced using DNA – DNA hybridization of the new strain with the strain the Tag Dye Deoxy Terminator Cycle sequencing kit (Applied Shewanella putrefaciens (DSM 6067 = ATCC 8071) was carried Biosystems). Sequence reactions were electrophoresed using out from 3 g cell mass of each strain. DNA was isolated using a Applied Bio systems model 373S DNA sequence. Both strands of French pressure cell (Thermo spectroic) and was puriied by ampliication product were sequenced using primers 8F, 518F chromatography on hydroxyapatite as described by Cashion. and 1504R [23]. The complete 16S rDNA sequence of the new DNA – DNA hybridization was carried out as described by De strain was discovered by the assembly of all sequence products Ley [28], with the modiication described by Huss [29], using using Pregap4 version 1.4bl and Gap4 version 4.8bl software. a model 2600 spectrophotometer equipped with a model 2527-R thermopropgrammer and plotter (Gilford Instrument Phylogenetic analysis Laboratories). Renaturation rates were computed with the BLAST analysis was performed by NBCI online database on TRANSFER. BAS program of Jahnke [30]. the new strain 16S rDNA sequence to determine the phylogenetic RESULTS AND DISCUSSION grouping to which the new strain was most closely related. Reference sequences utilized in phylogenetic analysis were Physiological and morphological characteristics retrieved from NCBI database and aligned with the newly Enrichment cultures (pH 7) containing glucose inoculated determined sequence of the new strain by using CLUSTAL W with seawater sample from Spitsbergen showed bacterial growth (1.83) software. The phylogenetic and molecular evolutionary after one week of incubation at 4 °C. Microscopy revealed the analyses was performed with neighbour joining method by presence of straight rod cells. After a number of transfers on using software from PHYLIP, version 3.57c [24]; the DNADIST marine medium agar plates at 15 °C, one culture was shown to program with Kimura-2 factor was used to compute the pairwise exhibit the same characteristics and was selected as the culture evolutionary distances for the above aligned sequences [25], the for the strain 40-3. topology of the phylogenetic tree was evaluated by performing a bootstrap (algorithm version 3.6 b) with 1000 bootstrapped Cells of the strain 40-3 were found to be gram negative. They trials. The phylogenetic tree was drawn using Tree View 32 were straight or curved rod - shaped (0.4-0.6 μm wide and 2-3 software. As out group the 16S rDNA of Bacillus subtilis was used. μm long). They occurred singly. Spores could never be detected. The strain 40–3 showed high similarity in morphological The 16S rDNA sequence data was compared with all characterization to the strains belonging to the genus Shewanella currently available sequences of organisms belonging to identiied as: straight or curved rod–shaped, 2-3 μm length, 0.4- the genus Shewanella: Shewanella putrefaciens (U91552.1), 0.7 wide, gram negative and non–spore forming [5,6,31-45]. The Shewanella afinis (AF500080.1), Shewanella alga (U91544.1) morphological characteristics of the strain 40-3 and the related Shewanella denitriicans (AJ457093.1), Shewanella amazonensis (AF005248.1), Shewanella aquimarina (AY485225.1), Shewanella strains are listed in Table 1. baltica (AJ000214.1), Shewanella benthica (X82131.1) No growth was observed under anaerobic condition with

Page 48 Central

Table 1: Comparative characteristics of the isolated strain 40-3 with related Shewanella sp. strains. 1. Strain 40-3, 2. Shewanella putrefaciens [date reproduced from Venkateswaran]; 3. Shewanella baltica [date reproduced from Ziemke]; 4. Shewanella frigidimarina [date reproduced from Bowman]; 5. Shewanella paciica [date reproduced from Ivanova]; 6. Shewanella gaetbuli [date reproduced from Yoon et al (2004)]; 7. Shewanella waksmanii [date reproduced from Ivanova]. +, positive; -, negative; ND, not determined. Character 1234567 Cell shape Straight rod Straight rod Straight rod Straight rod Straight rod Straight rod Straight rod Gram stain ------Spore formation ------Optimum growth temperature (°C) 10 -15 25 - 33 Growth at 4 20 - 22 20 - 25 30 20 - 22 Optimum pH for growth 7 - 8 7 - 8 ND ND ND 7 - 8 7,5 Optimum NaCl conscetration for growth (%, 8 - 9 0 - 6 ND 0 - 6 0.5 - 6 3 - 6 1 - 6 w/v) DNA G + C content (mol %) 48 47 46 40 - 43 40 42 43 Reduction of: NO3- to NO2- + + + + + - ND NO2- to N - - ND ND ND - ND Production of: Amylase + - ND - + + - Protease + ND ND ND + ND ND Pullulanase + ND ND ND ND ND ND Lipase - - + + + + + H2S from sodium thiosulfate + + + + ND - + Indole (tryptophane) - - - ND - ND ND Acetion - - - ND - ND ND Utilization of: α cyclo-dextrin + ND ND ND ND ND ND Dextrin + ND ND ND + ND ND Tween 80 + ND ND ND ND ND ND N-acetyl-D-glucosamine + ND ND ND + ND - α-D-glucose + ND ND ND ND ND + Maltose + + + - + - ND Sucrose + + + - ND - - Methyl pyruvate + ND ND ND ND ND ND D,L-lactic acid + ND ND ND ND ND ND Succiniate + + ND + + - - Bromo succiniate + ND ND ND ND ND ND Inosine + ND ND ND ND ND ND Esculin ferric citrate + ND ND ND ND ND ND L-arabinose + ND ND ND + ND ND Potassium gluconate + ND ND ND ND ND ND Malic acid + ND + ND ND ND ND Trisodium citrate + ND ND ND ND ND ND D-galactose - + ND - + - - D-fructose - - ND ---- Fumarate ND + ND + - - - Lactose - + ND ND - - - Citrate - - + ND - - ND

Page 49 Central glucose. Growth occurred only under aerobic conditions between citrate. No growth was observed on glycogen, tween 40, N-acetyl- 4 and 25°C. Optimal growth was optioned at 10-15°C where the D-galacto-samine, adonitol, capric acid, D-arabitol, cellobiose, growth rate reached its maximum. No growth was observed L-erythol, D-fructose, L-fructose, D-galactose, gentiobiose, above 25°C (Data not shown). The strain 40-3 required seawater m-inositol, α-D-lactose, lactulose, D-mannitol, D-mannose, and grew well at salt (NaCl) concentration of 0–10 % (w/v) with D-mellobiose, β-methyl D-glucose, D-psicose, D-rafinose, optimum at 8-9 % NaCl (w/v) (Data not shown). The pH range for L-rhamnose, D-sorbitol, D-trehalose, turanose, xylitol, mono- growth was 6–9, with an optimum at pH 7–8 (Data not shown). methyl succinate, acetic acid, cis-aconitic acid, citric acid, formic Under the optimum conditions using 2 g-1glucose, the growth acid, D-galactonic acid lactone, D-galacturonic acid, D-gluconic rate was 0.48 h-1. The optimal growth temperature and pH of acid, D-glucosaminic acid, D-glucuronic acid, α-hydroxy-butyric the strain 40–3 (10–15 °C and pH 7–8) were similar to the most acid, β-hydroxy-butyric acid, g-hydroxy-butyric acid, β-hydroxy related Shewanella species: Shewanella putrefaciens (25–35 °C phenylacetic acid, itaconic acid, α-keto butyric acid, α-keto and pH 7-8), Shewanella frigidimarina (20–22 °C), Shewanella glutaric acid, α-keto valeric acid, malonic acid, propionic acid, paciica (20–25 °C), Shewanella gaetbuli (30 °C and pH 7-8) and quinic acid, D-saccharic acid, seabacic acid, succinamic acid, Shewanella waksmanii (20–22 °C and pH 7.5) [6,31,34,36,45]. glucuronamide, alaninamide, D-alanine, L-alanine, L-alanyl- However, Shewanella baltica grew at 4 °C [46]. The strain 40–3 glycine, L-asparagine, L-aspartic acid, L-glutamic acid, glycyl- grew in the presence of a wide range of NaCl concentration from L-aspartic acid, glycyl-L-glutamic acid, L-histidine, hydroxy 0 to 10 % (w/v) (optimum 8 to 9 % (w/v)) unlike the related L-proline, L-leucine, L-ornithine, L-phenyl-alanine, L-proline, Shewanella species: S. putrefaciens, S. frigidimarina, S. paciica, S. L-pyroglutamic acid, D-serine, L-serine, L-threonine, D,L- gaetbuli and S. waksmanii, where no growth was observed above carnitine, g-amino butyric acid, urocanic acid, uridine, thymidine, 6 % NaCl (w/v) [6,31,34,36,45]. The growth conditions of the phenylthylamine, putrescine, 2-aminoethanol, 2,3-butanediol, strain 40-3 and the related strains are listed in Table 1 glycerol, D,L α-glycerol phosphate, glucose 1-phosphate, glucose 6-phosphate or phenylacetic acid. The strain 40–3 was able Substrate spectrum to produce H2S. Indole (Tryptophane) and aceton were not The strain 40-3 grew on a variety of substrates. Good growth produced. The strain was also able to reduce nitrates to nitrites was observed on: α-cyclodextrin, dextrin, tween 80, N-acetyl-D- but not nitrites to nitrogen. Shewanella putrefaciens and the strain glucosamine, α-D-glucose, maltose, sucrose, methylpyruvate, D,L- 40–3 shared the ability to utilize: maltose, sucrose, succiniate, lactic acid, succinic acid, bromo succinic acid, inosine, esculin ferric D–galactose, fumarate and lactose [6]. Shewanella baltica and citrate, L-arabinose, potassium gluconate, malic acid or trisodium the strain 40–3 on the other hand, shared the ability to utilize

Table 2: Comparative fatty acids composition (%) of the new isolated strain 40-3 and related Shewanella species. 1. Strain 40-3, 2. Shewanella putrefaciens [date reproduced from Venkateswaran]; 3. Shewanella baltica [date reproduced from Ziemke]; 4. Shewanella frigidimarina [date reproduced from Bowman]; 5. Shewanella gaetbuli [date reproduced from Yoon]; 6. Shewanella waksmanii [date reproduced from Ivanova]. Both the strain 40 – 3 and Shewanella frigidimarina produce eicosapentaenoic acid, 20:5ω3. ND, not determined. Fatty acids 123 456 Straight-chain fatty acids 12:00 3,64 ND ND ND 3,1 2 13:00 0,07 ND ND ND ND ND 14:00 1,8 2,3 2,2 3,7 ND 1,7 15:00 0,31 3,2 7,8 2,5 3,8 5,3 16:00 11,24 19,1 4,3 11.8 8,4 6,2 17:00 0,31 1,5 0,6 1.2 ND ND 18:00 0.52 2.1 ND 0.1 ND 0.3 Terminally branched saturated fatty acids 13:0-iso 4.13 2.5 12.4 6.3 9.4 10 14:0-iso 0.18 0.3 1.6 0.6 2 ND 15:0-iso 9.4 21.1 14.3 9 ND 32.5 17:0-iso 1.03 1.7 0.5 0.3 ND ND 18:0-iso 0.11 ND ND ND ND ND Monounsaturated fatty acids 15:1 ω6c 0.1 0.2 2.2 1.2 ND ND 16:1 ω5c 0.28 ND ND ND ND ND 16:1 ω7c 29.6 24.1 51.1 21.1 9.8 16:1 ω9c 2.09 3.5 1.6 2.2 ND ND 17:1 ω8c 0.89 6.7 11 3 6.4 ND 17:1 ω6c 0.24 0.9 1.4 ND ND ND 18:1 ω9c 4.5 3.8 0.3 1.7 ND ND 18:1 ω7c 9.21 6.6 0.8 5.3 2.5 2 18:1 ω5c 0.35 ND ND ND ND ND

Page 50 Central

0.02 Shewanella baltica (AJ000214.1) Shewanella massilia (AJ006084.1) 68 95 97 Shewanella arctica sp. nov. (40-3)(AJ877256) 68 Shewanella putrefaciens (U91552.1) 45 63 Shewanella saccharophilus (AF033028.1) Shewanella decolorationis (AJ609571.1) Shewanella gaetbuli (AY190533.1) 60 Shewanella denitrificans (AJ457093.1) 64 100 Shewanella livingstonis (AJ300834.1) Shewanella frigidimarina (AJ300833.1)

99 Shewanella pacifica (AY366086.1) Shewanella olleyana (AF295592.1)

90 Shewanella alga (U91544.1) 52 Shewanella amazonensis (AF005248.1) Shewanella waksmanii (AY170366.1) 68 90 Shewanella marisflavi (AY485224.1) 77 100 Shewanella colwelliana (AY653177.1) Shewanella affinis (AF500080.1) 63 Shewanella aquimarina (AY485225.1) Shewanella surugaensis (AB094597.1) 55 79 99 Shewanella benthica (X82131.1) 72 Shewanella violacea (D21225.1)

98 Shewanella woodyi (AF003548.1) 72 Shewanella hanedai (X82132.1) Shewanella gelidimarina (U85907.1) Shewanella kaireiae (AB094598.1) 89 56 Shewanella schlegeliana (AB081761.1) 86 Shewanella pealeana (AF011335.1) 83 77 Shewanella marinintestina (AB081759.1) 43 Shewanella sairae (AB081762.1)

99 Shewanella fidelia (AF420313.1) Shewanella japonica (AF500079.1)

Figure 1 Phylogenetic dendrogram based on 16S rDNA gene sequence comparison indicating the position of the new strain Shewanella arctica sp. nov. 40-3 within the genes Shewanella. performed by the neighbor-joining method using software from PHYLIP, version 3.57c; the DNADIST program with Kimura-2 factor was used to compute the pair wise evolutionary distances for the above aligned sequences , the topology of the phylogenetic tree was evaluated by performing a bootstrap (algorithm version 3.6 b) with 1000 bootstrapped trials. The tree was draw using Tree View 32 software. Bar correspond to 2 nucleotide substitutions per 100 nucleotides. maltose, sucrose, malic acid and citrate [46]. The strain 40–3 and Fatty acid analysis the related strains Shewanella putrefaciens, Shewanella baltica, The FAMEs proiles display only those fatty acids comprising Shewanella frigidimarina and Shewanella waksmanii were able ≥ 0.05 % of the total. Straight chain saturated FAMEs were 17.89 to produce H2S (from sodium thiosulfate) and reduce nitrates to nitrites [6,31,36,46]. And inally the strain 40-3 and all previous % total, terminally branched saturated FAMEs were 14.85 % Shewanella species were unable to produce indole or acetoin total and monounsaturated FAMEs were 17.73 % total. 16:0 [6,31,36,45]. The ability of the strain 40–3 and related strains to straight chain saturated FAME was the most abundant FAME grow on various substrates is listed in Table1. found in the strain 40-3 (11.24 %) as well as, in the related

Page 51 Central strains: Shewanella putrefaciens (19.1 %), Shewanella baltica (4.3 leucine arylamidase, valine arylamidase, naphthol-AS-BI- %), Shewanella frigidimarina (11.8 %), Shewanella gaetbuli (8.4 phosphohydrolase and N-acetyl-β–glucosaminidase. No %) and Shewanella waksmanii (6.2 %) [6, 31, 36, 45, 46]. 15:0- activities for arabinase, arabinoxylanase, HE-cellulase, glucanase, iso terminally branched saturated FAME was the most abundant dextranase, galactanase, galactomannanase, β-glucanase, FAME found in the strain 40-3 (9.4 %) and in the related strains: curdlanase xylanase, xyloglucanase, α- and β–galactosidase, Shewanella putrefaciens (21.1%), Shewanella baltica (14.3 %), β–glucoronidase, α and β–glucosidase, α–mannosidase, α– Shewanella frigidimarina (9 %), and Shewanella waksmanii (32.5 fucosidase, acid phosphatase, cystine arylamidase, arginine %) [6, 31, 36, 45, 46]. However, 16:1 ω7c was the most abundant dihydrolase, lysine decarboxylase, urease and tryptophane FAME in all Shewanella species mentioned above, but not in deaminase were detected. Amylase activities have also been the strain 40–3 where, 18:1 ω7c was the most abundant FAME reported for Shewanella paciica and Shewanella gaetbuli, (Table 2). while protease activities are reported for Shewanella paciica [34,45] (Table 1). This is the irst time that a phsychrophilic DNA base composition and DNA - DNA hybridization Shewanella strain is reported to secrete hydrolyases with speciic The G + C content of the DNA from the strain 40-3 was 48 mol pullulanase (E.C. 3.2.1.XX), esterase (C4, E.C. 3.1.1.1), lipase (C8, %. High similarity was shown between the G + C content of strain E.C.3.1.1.3), phosphohydrolase (E.C. 3.1.3.XX) and arylamidase 40-3 (48 mol %) and related strains: Shewanella putrefaciens (E.C. 3.4.14.XX) activities. These speciic enzyme activates are (47 mol %), Shewanella baltica (46 mol %), Shewanella of industrial interest for the conversion of biomass to biofuels, frigidimarina (40-43 mol %), Shewanella paciica (40 mol %), food additives and platform chemicals [47-49]. Therefore, the Shewanella gaetbuli (42 mol %) and Shewanella waksmanii (42 new Shewanella strain represents an excellent resource to isolate mol %) [6,31,34-36,45,46]. The 16S rDNA sequence of the strain new enzyme activities with potential industrial relevance. Since 40-3 (1.447 kb) was analyzed and compared to all currently enzymes derived from phychrophilic organisms often operate at available 16S rDNA sequences of organisms belonging to the low temperatures, they can contribute sigicantly to enhynce the genus Shewanella (Figure 1). The closest relationship was to energy eficiency of an industrial process. The most prominent Shewanella putrefaciens (U91552.1) with an identity on 16S example is the use of phychrophilic protease in laundry powder rDNA level of 99 %. However, Shewanella massilia (AJ006084.1) formulation, which enable textile cleaning at temprastures and Shewanella baltica (AJ000214.1), showed 98% identity, as low as 15°C therby signiicantly contributing to household Shewanella decolorationis (AJ609571.1) and Shewanella energy saving measures [50]. The same features will contribute frigidimarina (AJ300833.1) showed 97 % identity, Shewanella to energy eficiency in starch based bioethanol production or the paciica (AY366086.1) and Shewanella gaetbuli (AY190533.1) lipase catalysed transesterication of plant oil derived fatty acids showed 96% identity and Shewanella marislavi (AY485224.1) [13]. We have recently isolated and characterised the genetic and Shewanella waksmanii (AY170366.1) showed 95 % identity, elements encoding Shewanella arctica pullulanase and protease on the 16S rDNA level. activities. Additionally we have puriied and characterized the recombinant protein products, expressed in an E. coli system. The Phylogenetic treeing placed the strain 40-3 (according to detailed description of these enzyme systems will be published its 16S rDNA composition) among the species of the genus elsewhere. Shewanella. The strain 40-3 showed a stable relative branching order with Shewanella putrefaciens and was placed in between Description of Shewanella arctica sp. nov. and Shewanella putrefaciens and Shewanella massilia (Figure 1). conclusion DNA-DNA hybridization of the strain 40-3 and the most identical Shewanella arctica (arc’ ti.ca. L. fem. adj. arctica from the strain Shewanella putrefaciens (DSM 6067) showed only 50 % Arctic, referring to the site were the type strain was isolated). DNA–DNA similarity despite the fact that the 16S rDNA identity Cells are straight or curved rod- shaped, gram negative, 2-3 between both, the new strain and Shewanella putrefaciens was μm long and 0.4–0.6 μm wide, occur singly, non spore forming very high (99 %). This strongly indicates that the newly isolated and strictly aerobic. Colonies on agar medium are slightly strain (40-3) is a new species within the genus Shewanella. orange, circular, smooth and convex. Temperature range for All data mentioned previously demonstrate clearly that the growth is 4–25 °C, with an optimum between 10 and 15 °C. new isolate 40-3 is a new species within the genus Shewanella. No growth above 25 °C was detected. Range of pH for growth This fact was also supported by the DNA-DNA hybridization, 6–9, with an optimum at pH 7–8. Growth from 0-10 % NaCl phylogenetic, G+C content, morphological and fatty acid (w/v) concentrations with an optimum between 8 and 9 % analysis data. Based on the phylogenetic analysis by 16S rDNA (w/v). Growth is observed with α-cyclo-dextrin, dextrin, tween and DNA-DNA hybridization homology, the new isolated strain 80, N-acetyl-D-glucosamine, α-D-glucose, maltose, sucrose, 40-3 was found to be closely related to Shewanella putrefaciens, methylpyruvate, D,L-lactitate, succiniate , bromo succinic acid, but represents a new species within the genus Shewanella. we inosine, esculin ferric citrate, L-arabinose, potassium gluconate, propose to assign the newly isolate to the genus Shewanella as malic acid and trisodium citrate. In the presence of glucose, H2S Shewanella arctica sp. nov. is produced and nitrates are reduced to nitrites. The fatty acid methyl esters (FAME) are composed of 17.89 % straight chain Screening for enzymes production saturated FAMEs, 14,85 % terminally branched saturated FAMEs The strain 40–3 was able to produce several enzymes and 17.73 % monounsaturated FAMEs. Phylogenetic analysis including amylase, pullulanase, protease, esterase (C4), esterase/ reveals as close relationship to Shewanella putrefaciens with 99 lipase (C8), omithine decarboxylase, alkaline phospatase, , % 16S rDNA composition identity and 50 % DNA-DNA similarty.

Page 52 Central

The DNA base ratio is 48mol % G + C. Habitat: artic seawater. 13. Cavicchioli R, Charlton T, Ertan H, Mohd Omar S, Siddiqui KS, Williams The strain 40-3 (DSM 16509) is isolated from seawater samples TJ. Biotechnological uses of enzymes from psychrophiles. Microb taken from Spitsbergen. The Shewanella arctica strain was Biotechnol. 2011; 4: 449-460. capable of secreting numerous industrially relevant enzyme 14. Georlette D, Blaise V, Collins T, D’Amico S, Gratia E, Hoyoux A, et al. systems when grown on glucose as the sole carbon source. The Some like it cold: biocatalysis at low temperatures. FEMS Microbiol applied enzyme screening procedure could detect amylase, Rev. 2004; 28: 25-42. pullulanase, protease, esterase (C4), lipase (C8), ornithine 15. Kulakova L, Galkin A, Kurihara T, Yoshimura T, Esaki N. Cold- decarboxylase, alkaline phospatase, leucine arylamidase, valine active serine alkaline protease from the psychrotrophic bacterium arylamidase, naphthol-AS-BI-phosphohydrolase and N-acetyl-β– Shewanella strain ac10: gene cloning and enzyme puriication and glucosaminidase activities. This is the irst time that a Shewanella characterization. Applied and environmental microbiology. 1999; 65: strain is been reported to secrete hydrolases with speciic 611-617. pullulanase, alkaline phospatase, esterase (C4), lipase (C8), 16. Nichols D, Bowman J, Sanderson K, Nichols CM, Lewis T, McMeekin T, et arylamidase, phosphohydrolase and glucosaminidase activities. al. Developments with antarctic microorganisms: culture collections, The extreme functional diversity of the secreted enzyme systems bioactivity screening, taxonomy, PUFA production and cold-adapted provides a rich resource for the isolation industrially relevant enzymes. Current opinion in biotechnology. 1999; 10: 240-246. biocatalysts, which can potentially optimize the energy eficiency 17. Fredrickson JK, Romine MF, Beliaev AS, Auchtung JM, Driscoll of biotechnological processes producing biofuel, food additives ME, Gardner TS, et al. Towards environmental systems biology of and/or platform chemicals. Shewanella. Nat Rev Microbiol. 2008; 6: 592-603. REFERENCES 18. Gerhardt P, Murray RGE, Wood WA, Krieg NR. Method of General and Molecular Microbiology. Gerhardt P, Murray RGE, Wood WA, Krieg 1. Groudieva T, Grote R, Antranikian G. Psychromonas arctica sp. nov., NR, editors. Washington DC: American Society for Microbiology. 1994. a novel psychrotolerant, bioilm-forming bacterium isolated from Spitzbergen. Int J Syst Evol Microbiol. 2003; 53: 539-545. 19. Lepage G, Roy CC. Improved recovery of fatty acid through direct transesteriication without prior extraction or puriication. J Lipid 2. MacDonell MT, Colwell RR. Pylogeny of the Vibrionaceae, and Res. 1984; 25: 1391-1396. recommendation for two new genera, Listonella and Shewanella. Syst Appl Microbiol. 1985; 6: 171-182. 20. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and puriication. Can J Biochem Physiol. 1959; 37: 911-917. 3. Garrity GM, Holt JG. The road map to the Manual. In Berger’s Manual of Systematic Bacteriology. 2nd edn. Boone DR, Castenholz RW, editors. 21. Kohn G, van der Ploeg P, Möbius M, Sawatzki G. Inluence of the derivatization procedure on the results of the gaschromatographic New York: Springer. 2001; 1: 119-166. fatty acid analysis of human milk and infant formulae. Z 4. Gauthier G, Gauthier M, Christen R. Phylogenetic analysis of the genera Ernahrungswiss. 1996; 35: 226-234. Alteromonas, Shewanella, and Moritella using genes coding for small- 22. Stackebrandt E, Goebel BM. Taxonomic note: a place of DNA-DNA subunit rRNA sequences and division of the genus Alteromonas into reassociation and 16S rRNA sequence analysis in the present species two genera, Alteromonas (emended) and Pseudoalteromonas gen. deinition in bacteriology. Int J Syst Bacteriol. 1994; 44: 846-849. nov., and proposal of twelve new species combinations. Int J Syst Bacteriol. 1995; 45: 755-761. 23. Buchholz-Cleven BEE, Rattunde B, Staub KL. Screening forgenetic diversity of anaerobic Fe(II)- oxidizing bacteria using DGGE and 5. Satomi M, Oikawa H, Yano Y. Shewanella marinintestina sp. nov., whole-cell hybridization. Syst Appl Microbiol. 1997; 20: 301-309. Shewanella schlegeliana sp. nov. and Shewanella sairae sp. nov., novel eicosapentaenoic-acid-producing marine bacteria isolated from sea- 24. Felsenstien J. PHYLIP (Phylogeny Inference Package), version 3.57c: animal intestines. Int J Syst Evol Microbiol. 2003; 53: 491-499. Department of Genetics, University of Washington, Seattle, WA, USA; 1995. 6. Venkateswaran K, Moser DP, Dollhopf ME, Lies DP, Saffarini DA, MacGregor BJ, et al. Polyphasic taxonomy of the genus Shewanella 25. Kimura M. A simple method for estimating evolutionary rates of base and description of Shewanella oneidensis sp. nov. Int J Syst Bacteriol. substitutions through comparative studies of nucleotide sequences. J 1999; 49 Pt 2: 705-724. Mol Evol. 1980; 16: 111-120. 7. Petrovskis EA, Vogel TM, Adriaens P. Effects of electron acceptors 26. Cashion P, Holder-Franklin MA, McCully J, Franklin M. A rapid method and donors on transformation of tetrachloromethane by Shewanella for the base ratio determination of bacterial DNA. Anal Biochem. putrefaciens MR-1. FEMS Microbiol Lett. 1994; 121: 357-363. 1977; 81: 461-466. 8. Semple KM, Westlake DWS. Characterization of iron reducing 27. Mesbah M, Whitman WB. Measurement of deoxyguanosine/ thymidine ratios in complex mixtures by high-performance liquid Alteromonas putrefaciens from oil ield luids. Canadian journal of chromatography for determination of the mole percentage guanine + microbiology. 1987; 35: 925-931. cytosine of DNA. J Chromatogr. 1989; 479: 297-306. 9. Myers CR, Nealson KH. Bacterial manganese reduction and growth 28. De Ley J, Cattoir H, Reynaerts A. The quantitative measurement of with manganese oxide as the sole electron acceptor. Science. 1988; DNA hybridization from renaturation rates. Eur J Biochem. 1970; 12: 240: 1319-1321. 133-142. 10. Feller G, Gerday C. Psychrophilic enzymes: hot topics in cold 29. Huss VA, Festl H, Schleifer KH. Studies on the spectrophotometric adaptation. Nat Rev Microbiol. 2003; 1: 200-208. determination of DNA hybridization from renaturation rates. Syst 11. Feller G. Psychrophilic enzymes: from folding to function and Appl Microbiol. 1983; 4: 184-192. biotechnology. Scientiica (Cairo). 2013; 2013: 512840. 30. Jahnke KD. Basic computer for evaluation of spectoscopic DNA 12. Struvay C, Feller G. Optimization to low temperature activity in renaturation data from GILFORD System 2600 spectrometer on a PC/ psychrophilic enzymes. Int J Mol Sci. 2012; 13: 11643-11665. XT/AT type personal computer. J Microbiol Methods. 1992; 15: 61-73.

Page 53 Central

31. Bowman JP, McCammon SA, Nichols DS, Skerratt JH, Rea SM, EA, et al. Shewanella woodyi sp. nov., an exclusively respiratory Nichols PD, et al. Shewanella gelidimarina sp. nov. and Shewanella luminous bacterium isolated from the Alboran Sea. Int J Syst Bacteriol. frigidimarina sp. nov., novel Antarctic species with the ability to 1997; 47: 1034-1039. produce eicosapentaenoic acid (20:5 omega 3) and grow anaerobically by dissimilatory Fe(III) reduction. Int J Syst Bacteriol. 1997; 47: 1040- 41. Nogi Y, Kato C, Horikoshi K. Taxonomic studies of deep-sea barophilic 1047. Shewanella strains and description of Shewanella violacea sp. nov. Arch Microbiol. 1998; 170: 331-338. 32. Bozal N, Montes MJ, Tudela E, Jiménez F, Guinea J. Shewanella frigidimarina and Shewanella livingstonensis sp. nov. isolated from 42. Reid GA, Gordon EH. Phylogeny of marine and freshwater Shewanella: Antarctic coastal areas. Int J Syst Evol Microbiol. 2002; 52: 195-205. reclassiication of Shewanella putrefaciens NCIMB 400 as Shewanella frigidimarina. Int J Syst Bacteriol. 1999; 49 Pt 1: 189-191. 33. Brettar I, Christen R, Höle MG. Shewanella denitriicans sp. nov., a vigorously denitrifying bacterium isolated from the oxic-anoxic 43. Skerratt JH, Bowman JP, Nichols PD. Shewanella olleyana sp. nov., a interface of the Gotland Deep in the central Baltic Sea. Int J Syst Evol marine species isolated from a temperate estuary which produces Microbiol. 2002; 52: 2211-2217. high levels of polyunsaturated fatty acids. Int J Syst Evol Microbiol. 2002; 52: 2101-2106. 34. Ivanova EP, Gorshkova NM, Bowman JP, Lysenko AM, Zhukova NV, Sergeev AF, et al. Shewanella paciica sp. nov., a polyunsaturated fatty 44. Venkateswaran K, Dollhopf ME, Aller R, Stackebrandt E, Nealson KH. acid-producing bacterium isolated from sea water. Int J Syst Evol Shewanella amazonensis sp. nov., a novel metal-reducing facultative Microbiol. 2004; 54: 1083-1087. anaerobe from Amazonian shelf muds. Int J Syst Bacteriol. 1998; 48 Pt 3: 965-972. 35. Ivanova EP, Nedashkovskaya OI, Sawabe T, Zhukova NV, Frolova GM, Nicolau DV, et al. Shewanella afinis sp. nov., isolated from marine 45. Yoon JH, Kang KH, Oh TK, Park YH. Shewanella gaetbuli sp. nov., invertebrates. Int J Syst Evol Microbiol. 2004; 54: 1089-1093. a slight halophile isolated from a tidal lat in Korea. Int J Syst Evol Microbiol. 2004; 54: 487-491. 36. Ivanova EP, Nedashkovskaya OI, Zhukova NV, Nicolau DV, Christen R, Mikhailov VV. Shewanella waksmanii sp. nov., isolated from a 46. Ziemke F, Höle MG, Lalucat J, Rosselló-Mora R. Reclassiication of sipuncula (Phascolosoma japonicum). Int J Syst Evol Microbiol. 2003; Shewanella putrefaciens Owen’s genomic group II as Shewanella 53: 1471-1477. baltica sp. nov. Int J Syst Bacteriol. 1998; 48 Pt 1: 179-186. 37. Ivanova EP, Sawabe T, Gorshkova NM, Svetashev VI, Mikhailov VV, 47. Hii SL, Tan JS, Ling TC, Ariff AB. Pullulanase: role in starch hydrolysis Nicolau DV, et al. Shewanella japonica sp. nov. Int J Syst Evol Microbiol. and potential industrial applications. Enzyme Res. 2012; 2012: 2001; 51: 1027-1033. 921362. 38. Ivanova EP, Sawabe T, Hayashi K, Gorshkova NM, Zhukova NV, 48. Kirk O, Borchert TV, Fuglsang CC. Industrial enzyme applications. Curr Nedashkovskaya OI, et al. Shewanella idelis sp. nov., isolated from Opin Biotechnol. 2002; 13: 345-351. sediments and sea water. Int J Syst Evol Microbiol. 2003; 53: 577-582. 49. Lorenz P, Eck J. Metagenomics and industrial applications. Nat Rev 39. Leonardo MR, Moser DP, Barbieri E, Brantner CA, MacGregor BJ, Paster Microbiol. 2005; 3: 510-516. BJ, et al. Shewanella pealeana sp. nov., a member of the microbial 50. Kuddus M, Ramteke PW. Cold-active extracellular alkaline protease community associated with the accessory nidamental gland of the from an alkaliphilic Stenotrophomonas maltophilia: production squid Loligo pealei. Int J Syst Bacteriol. 1999; 49 Pt 4: 1341-1351. of enzyme and its industrial applications. Canadian journal of 40. Makemson JC, Fulayil NR, Landry W, Van Ert LM, Wimpee CF, Widder microbiology. 2009; 55: 1294-1301.

Cite this article Qoura F, Brueck T, Antranikian G (2014) The Psychrophile Shewanella arctica sp. Nov: A New Source of Industrially Important Enzyme Systems. JSM Biotechnol Bioeng 2(1): 1026.

Page 54 Research Article *Corresponding author Prof.Dr. Garabed Antranikian, Institute of Technical Microbiology, Hamburg University of Technology, Biochemical Characterization of 21073 Hamburg, Germany, Tel: 4940428783117; Email:

Submitted: 23 March 2014 a Recombinant Xylanase from Accepted: 12 May 2014 Published: 14 May 2014 Thermus brockianus, Suitable ISSN: 2333-7117 Copyright for Biofuel Production © 2014 Antranikian et al. OPEN ACCESS Blank, S.1, Schröder, C.1, Schirrmacher, G.2, Reisinger, C.2 and Antranikian, G.1* Keywords Endoxylanase; Thermostable; Thermus brockianus; 1Institute of Technical Microbiology, Hamburg University of Technology, Germany Bioethanol; Hemicellulose 2Group Biotechnology, Clariant Produkte (Deutschland) GmbH, Germany

Abstract To discover new industrially relevant, thermoactive xylanases a gene library from Thermus brockianus was constructed. Function-based screening revealed a novel xylanase- encoding gene (xyn10) which was successfully expressed in E. coli BL21 (DE3). The resulting protein (38.7 kDa), a member of glycoside hydrolase family 10 was purifi ed to homogeneity and biochemically characterized. Catalytic activity was detected up to 115 °C and highest activity was measured at 95 °C and pH 6.0. The protein was extremely thermostable and showed 80 % remaining activity after incubation at 50-70 °C for 24 h. HPLC analysis showed that Xyn10 hydrolyzes insoluble and soluble substrates, such as oat spelt xylan, xylan from beech- and birchwood forming xylobiose and xylose. Specifi c activity of the enzyme was 1119.5 U/mg for oat spelt xylan and 994.0 U/mg for beechwood xylan, respectively. The xylanase exhibited remarkable stability in the presence of various detergents and chaotropic agents, such as CHAPS, guanidine hydrochloride and urea. This is the fi rst report of the heterologous production, purifi cation and characterization of a xylanase from Thermus sp.

ABBREVIATIONS are frequently employed [5]. The availability of eficient enzymes is necessary when bioethanol has to be produced on an industrial CHAPS: 3-[(3-cholamidopropyl)dimethylammonio]-1-pro- scale e. g. in bioreineries of the 2nd generation [6]. For this panesulfonate purpose more eficient yeast strains that are able to utilize both, INTRODUCTION glucose and xylose as carbon source also have to be developed [7]. Recent progress in metabolic engineering has resulted in Lignocellulose which is the major component of the plant cell xylose-fermenting yeast strains. This offers great opportunities wall consists of 40-50 % cellulose, 20-30 % hemicelluloses and to improve economic eficiency of existing bioreinery plants [8]. 20 % lignin. It represents one of the most abundant sustainable Therefore, the inding of novel, thermoactive xylanases is crucial feed stocks which can be used as a resource for the production since heat-stable enzymes can be directly added to the complex of high value chemicals and alcohols [1,2]. The hydrolysis of the substrate during the hydrothermal treatment step [9]. Thermo- β-1,4-glycosidic linkages of cellulose by endo-1,4-β-D-glucanases stable enzymes offer many advantages for industrial applications (EC 3.2.1.4), exo-1,4-β-D-glucanases (EC 3.2.1.91) and 1,4-β-D- as they are active at high temperatures and resistant against glucosidases (EC 3.2.1.21) releases glucose [3]. Hemicellulose, different reagents. Furthermore, the substrate accessibility at the second abundant polymer of lignocellulose, shows a more elevated temperatures is enhanced and the risk of contaminations complex structure that is composed of different pentoses, hexoses, is reduced [10]. uronic acids and acetyl residues. Xylan is the major component of hemicellulose and comprises a β-1,4-linked backbone of Bacteria of the genus Thermus are promising sources for D-xylose. Due to the complex structure of xylan synergistic action thermostable enzymes since most of the species have been of endo-1,4-β-D-xylanases (EC 3.2.1.8), 1,4-β-D-xylosidases (EC isolated from hydrothermal habitats with optimal growth 3.2.1.37), esterases (EC 3.1.1-) and glucuronidases (EC 3.2.1.31) temperatures between 53 and 86 °C [11-13]. During the last is required [4]. Traditional industrial applications for xylanases two decades several enzymes, such as proteases, catalases or include biobleaching of pulp, enhancement of digestibility of feed DNA processing enzymes, have been characterized from these or processing of food. Especially for the clariication of juices and microorganisms [14]. the improvement of dough properties during baking xylanases Although xylanolytic Thermus thermophilus strains

Page 55 Central were discovered, so far no recombinant xylanase has been the GeneJET Plasmid Miniprep Kit (Thermo Scientiic, Schwerte, characterized [15]. Germany). Sequencing of inserted DNA was done by Euroins MWG Operon (Ebersberg, Germany). Open reading frames In this study we report on the identiication of the irst (ORFs) were identiied with frameplot 4.0beta (http://nocardia. xylanase-encoding gene from Thermus sp. and the production, nih.go.jp/fp4/). BLAST (Basic Local Alignment Search Tool) puriication and biochemical characterization of the recombinant was used for sequence identity analysis [17]. SignalP 4.0 was enzyme. employed for potential signal peptide prediction [18]. Multiple MATERIALS AND METHODS sequence alignments were done using ClustalX 2.0 [19]. SWISS- Bacterial strains, plasmids and cultivation MODEL was used for hypothetical protein modeling [20]. Escherichia coli EPI300 (Epicentre, Hessisch Oldendorf, Cloning of the xylanase-encoding gene Germany) and the bifunctional shuttle vector pCT3FK were used The xylanase-encoding gene xyn10 was ampliied by PCR for the construction of a fosmid library [16]. E. coli strains Top10 without signal peptide-encoding sequence using the following and DH5α and the vector pCR-XL-TOPO (Invitrogen, Karlsruhe, primers: Germany) were employed to construct a shotgun library. For cloning and expression the E. coli strains Nova Blue Single xyn10_f_BamHI: GGATCCCAGGTGGACTCGGTAACCCAG (Bam- (Novagen, Darmstadt, Germany), BL21 StarTM (DE3) (Invitrogen, HI recognition site underlined) and xyn10_r_SalI: GTCGACCTAC- Karlsruhe, Germany) and the plasmids pJET (Thermo Scientiic, CTCCCTTTGGCGGCTAC (SalI recognition site underlined). Schwerte, Germany) and pQE-80L (Qiagen, Hilden, Germany) PCR was carried out with the Phusion High-Fidelity DNA- were used. polymerase (Thermo Scientiic, Schwerte, Germany) according All E. coli strains were cultivated in LB medium at 37 °C and to the manufacturer’s instruction. The resulting PCR product 160 rpm for 12-18 h. Thermus brockianus GE-1 was grown in was ligated into the vector pJET (Thermo Scientiic, Schwerte, Thermus 162 medium (DSMZ medium 878) at 70 °C and 160 rpm Germany) prior to transformation of competent E. coli Nova Blue. for 12-24 h. After the identiication of a recombinant clone by colony PCR the plasmid was isolated and double digested with BamHI and SalI. To Genomic library construction and screening recover and purify the gene xyn10 gel electrophoresis with further Genomic DNA from T. brockianus GE-1 was isolated using the gel extraction (GeneJET Gel Extraction Kit, Thermo Scientiic, DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). Isolated Schwerte, Germany) was conducted. The xylanase-encoding gene genomic DNA was directly ligated into the vector pCT3FK [16]. was then ligated into the BamHI and SalI double digested vector Further steps for fosmid library construction were carried pQE-80L and subsequently used for the transformation of E. coli out according to the manufacturer’s instructions of the Copy BL21 StarTM (DE3) (Invitrogen, Karlsruhe, Germany). TM Control Fosmid Library Production Kit (Epicentre, Hessisch Heterologous expression and puriication of the Oldendorf, Germany). recombinant xylanase To screen the fosmid library for clones with xylanase The recombinant clone E. coli BL21 StarTM (DE3)/pQE- activity the cells were cultivated on LB agar plates (12.5 μg/mL 80L::xyn10 was cultivated in 700 mL LB (100 μg/mL ampicillin) chloramphenicol), overlayed with top agarose (50 mM sodium until OD of 0.5-0.7 and subsequently induced for 12 h at 30 °C acetate, 2.5 mM calcium chloride x 2 H O, 170 mM sodium 600 2 with 0.5 mM IPTG. The cells were harvested by centrifugation at chloride, 25 mM AZCL-xylan, 1 % agarose) and incubated at 70 7000 rpm for 20 min at 4 °C, resuspended in lysis buffer (50 mM °C for 10-18 h. NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8) and disrupted A shotgun library was constructed from isolated fosmid DNA using a French press (FrenchR Pressure Cell Press, SLM-Aminco, of a xylanase-positive clone resulting from the fosmid library Maryland, USA). The crude extract was obtained by subsequent screening. Isolated fosmid DNA was cut to 1-6 kb using SmaI and centrifugation at 13,000 rpm for 20 min at 4 °C. further puriied from an agarose gel with the help of the GeneJET The crude extract was heat precipitated for 15 min at 70 °C Gel Extraction Kit (Thermo Scientiic, Schwerte, Germany). After and again centrifuged at 13,000 rpm for 20 min at 4°C. The the addition of a single 3`-desoxyadenosine the ligation into the resulting supernatant was further puriied through Ni2+-nitrilic pCR-XL-TOPO vector and the transformation of E. coli Top 10 acid (Ni-NTA) afinity chromatography using a 1.5 mL Ni-NTA cells was carried out according to the manufacturer’s instructions superlow column (Qiagen, Hilden, Germany) according to the (TOPO XL PCR Cloning Kit, Invitrogen, Karlsruhe, Germany). manufacturer’s instructions. Eluted fractions containing the Accordingly, isolated plasmid DNA was used to transform E. coli DH5α puriied xylanase were pooled, dialyzed against 50 mM maleate (Qiagen Plasmid Plus Midi Kit, Hilden, Germany). Subsequent buffer pH 6.0 (50 mM maleic acid, 50 mM NaOH) and stored at screening was carried out as described above using AZCL-xylan 4 °C. containing top agarose. The purity of the recombinant xylanase was analyzed by SDS- DNA sequencing and bioinformatic analysis PAGE (12%) according to Laemmli [21]. Hydrolytic activity of the Plasmids from xylanase-positive clones were isolated using puriied xylanase was veriied with a zymogram. After SDS-PAGE

Page 56 Central the gel was incubated for 1 h in 1 % Triton X-100 (v/v).Then it pH-stability the enzyme was preincubated for 24 h at 4 °C and 70 was incubated in a solution of 1 % beechwood xylan (w/v) for °C in Britton-Robinson buffer pH 3.0-10.0 in presence of 0.5 mg/ 1 h at 70 °C, stained with Congo red (2 %, w/v) for 30 min and mL bovine serum albumin. Subsequently, relative activity against destained in 1 M NaCl. oat spelt xylan was measured for 15 min at 70 °C. Protein concentration was determined by using bovine serum The effect of metal ions was studied by measuring relative albumin as standard according to Bradford [22]. activity towards oat spelt xylan in presence of 1 and 5 mM, and 10 mM AgNO , AlCl , CaCl , CoCl , CrCl , CuCl , FeCl , FeCl , The molecular mass was determined by gel iltration 3 3 2 2 3 2 2 3 KCl, MgCl , MnCl , NaCl, NiCl , RbCl, SrCl and ZnCl in 50 mM applying the ÄKTATM Fast Protein Liquid Chromatography 2 2 2 2 2 system (GE Healthcare, München) with a HiLoad 16/60 Superdex maleate buffer, pH 6.0 at 95°C. Furthermore, the inluence of 200 prep grade column (GE Healthcare, München) following the 3-[(3-cholamidopropyl)dimethyl-ammonio]-1-propanesulfonate manufacturer’s instructions. (CHAPS), cetyltrimethyl-ammonium bromide (CTAB), Triton X-100, Tween 20, Tween 80, guanidine hydrochloride, urea, Enzyme activity assays dithiotreitol (DTT), β-mercaptoethanol, EDTA, iodacetic acid, Enzymatic activity was determined by measuring the amount sodium azide and Pefabloc was monitored. Relative activity was of reducing sugars released from xylan and cellulose employing measured in presence of 5 mM additive in 50 mM maleate buffer, the 3,5-dinitrosalicylic acid (DNS) assay according to Miller pH 6 at 95 °C against oat spelt xylan. [23]. The standard reaction mixture of 500 μL contained 0.5 % To determine substrate speciicity of the xylanase enzymatic substrate (w/v) in 50 mM maleate buffer, pH 6.0 (50 mM maleic hydrolysis was performed for 15 min at 95 °C in 50 mM maleate acid, 50 mM NaOH) and 50 μL of the enzyme solution. The buffer, pH 6.0 using 0.5 % beechwood-, birchwood-, oat spelt hydrolysis was conducted at 95 °C for 15 min. To stop enzymatic xylan, cellulose, carboxymethyl cellulose and 2 mM 4-nitrophenol- hydrolysis 500 μL of DNS reagent were added and the reaction β-D-xylopyranoside as substrates. Kinetic parameters were was transferred on ice. After 5 min of incubation at 99 °C and determined with oat spelt xylan. subsequent centrifugation for 5 min at 4 °C the absorption was determined at 546 nm. Calibration curves were prepared To investigate hydrolysis products of beechwood-, for xylose and glucose (supplementary material, Figure S1). birchwood- and oat spelt xylan (2 %, w/v) HPLC analysis was Mixtures for calibration contained 500 μL of DNS reagent and performed using a LaChrom system (Merck-Hitachi, Tokio, Japan) 500 μL of xylose or glucose, respectively (0-2.5 mM in 50 mM with following components: sampler L-7200, pump L-7100, oven maleate buffer). After incubation for 5 min at 99 °C absorptions L 7350, (RI)-detector L-7490. For sample preparation enzymatic were measured at 546 nm. A time dependant activity proile hydrolysis was conducted for 1 h at 80 °C. After centrifugation was measured to conirm that the time of 15 min for enzymatic of the reaction mixtures for 20 min at 4 °C the supernatant was hydrolysis is suitable (supplementary material, Figure S2). iltered (0.2 μm, Pall, Darmstadt, Germany). A volume of 20 μL All measurements were done in triplicates in 3 independent of the iltered supernatant was applied to a HPX42A column measurements. One unit of enzymatic activity was deined as the (Bio-Rad, München, Germany). Filtered and helium lushed high amount of enzyme required for the release of 1 μmol of reducing purity water was used as solvent with a low rate of 0.6 mL/min. sugars per minute. Retention times in minutes were determined for the following standards (Megazyme, Ireland): xylose: 18.05, xylobiose: 16.33, To determine β-xylosidase activity the release of xylotriose: 14.95, xylotetraose: 13.79, xylopentaose: 12.82. 4-nitrophenol from 4-nitrophenol-β-D-xylopyranoside was measured. The standard reaction mixture of 1 mL contained 2 Nucleotide sequence accession number mM 4-nitrophenol-β-D-xylopyranoside in 50 mM maleate buffer, The nucleotide sequence of the xylanase-encoding gene from pH 6.0 and 10 μL of enzyme solution. The reaction was carried Thermus brockianus GE-1 has been deposited in GenBank under out for 10 min at 95 °C before 0.1 mL of 0.1 M Na CO was added 2 3 the accession number HG931726. to stop hydrolysis. The absorption was monitored at 410 nm. One unit of enzymatic activity was deined as the amount of enzyme RESULTS AND DISCUSSION required for the release of 1 μmol of 4-nitrophenol per minute. Identi ication of the xylanase-encoding gene and Determination of enzyme characteristics and sequence analysis. hydrolysis products Function-based screening of a fosmid library constructed To investigate the inluence of temperature on the enzyme from genomic DNA of T. brockianus resulted in two clones with relative activities against oat spelt xylan were measured in the xylanase activity. The respective fosmids were isolated and used range of 10-115 °C in 50 mM maleate buffer, pH 6.0. To study to construct a shotgun library. Based on a functional screening temperature stability the enzyme was preincubated in 50 mM using azurine-crosslinked xylan a positive clone was identiied, maleate buffer, pH 6.0 for 3 and 24 h at 50-90 °C in presence of carrying a plasmid with a 1.9 kb insert. Sequencing of the insert 0.5 mg/mL bovine serum albumin. revealed two ORFs within the same reading frame. The sequent The inluence of pH was examined by determining relative arrangement of both ORFs and putative ribosomal binding site activity towards oat spelt xylan in 50 mM Britton-Robinson 12 nucleotides upstream of the start codon for ORF2 indicated an buffer in a range of pH 3.0-10.0 at 95 °C [24]. To examine operon-like structure.

Page 57 Central

The association of genes with similar functions in operons Biochemical properties of Xyn10 permits their simultaneous regulation allowing organisms to Xyn10 exhibited catalytic activity in the range of 70-115 °C adapt faster to environmental changes [25]. Especially hydrolysis with the highest value at 95 °C (Figure 2A). The protein exhibited of complex substrates like hemicellulose requires synergistic high thermal stability retaining 80-100 % activity after incuba- action of different enzymes [26,27]. tion for 24 h at 50-70 °C (supplementary material, Figure S3). At The deduced amino acid sequence of ORF1 exhibited 80 °C the half life time was approximately 150 min (Figure 2B). 51 % identity to a characterized xylanase from Streptomyces Sequence analysis of Xyn10 showed some possible features for thermocarboxydus HY-15 (ACJ64840.1) [28]. ORF2 comprises thermal stability described for other thermoactive proteins, such 752 bp and the respective protein showed identity of 43 % to a as elevated percentage of charged amino acids, higher arginine/ putative family 5 glycoside hydrolase from Kribbella lavida DSM lysine ratio and no cysteine residues [35-38]. Xyn10 showed 17836 (YP_003379978.1). higher thermal stability as well as optimal temperature compared to characterized glycoside hydrolases derived from Ther- The xylanase-encoding gene xyn10 consists of 1077 bp and mus species and recently characterized xylanases from Geobacil- showed a GC-content of 51.2 %. Within the resulting 358 amino lus sp. and Bacillus halodurans [39-42]. Operation temperature acids (aa) long sequence an N-terminal signal peptide of 25 aa of several enzymatic processes in industry is limited to 50-60 °C was detected, indicating that the protein is secreted. Xylanases because most commercially available xylanases are produced by are often synthesized with signal peptides because hydrolysis Aspergillus and Trichoderma and are heat-labile. The extraordi- of the heteropolymer xylan occurs extracellularly. Proteins nary temperature range between 70 and 115 °C as well as the showing sequence identity to Xyn10 also have signal peptides stability for more than 24 h at 70 °C makes Xyn10 a powerful [29-31]. The conserved catalytic domain for family 10 glycoside candidate for pretreatment of lignocellulose at the elevated tem- hydrolases extends from aa 41 to 346 suggesting that the protein perature of 70 °C in second generation bioreineries or paper in- belongs to this family. Glycoside hydrolases are grouped in dustry. families according to amino acid sequence homologies [32]. Xyn10 displayed highest hydrolytic activity at pH 6.0 (Figure Multiple sequence alignments resulted in the identiication of 3A), similar to other characterized glycoside hydrolases from two putative catalytic glutamate residues within the frequently Thermus spp. [39,40]. However, the enzyme showed high stability found conserved motifs VVNEA (aa 159-163) and TEVD (aa 270- at a broad range of pH 4.0-10.0 with more than 80 % residual 273). Hypothetical protein modelling indicated a characteristic activity after incubation for 24 h at 4 °C at the mentioned pH TIM-barrel fold for Xyn10 as it is typical for members of glycoside values. Residual activities of more than 80 % were detected after hydrolase family 10 [33]. incubation of 24 h at pH 6.0-8.0 and 70 °C. After 24 h of incubation at 70 °C in the range of pH 4.0-5.0 and 8.0-10.0 Xyn10 exhibited Production and puriication of Xyn10 30-50 % residual activity (Figure 3B). The decrease of stability The gene xyn10 was ampliied without signal peptide, cloned of Xyn10 at acidic and alkaline pH was probably caused through into pQE-80L and successfully overexpressed in E. coli BL21 the additional denaturing effect of the elevated temperature. The (DE3). The expression of functional xylanase-encoding genes characterized xylanase fromThermotoga maritima showed lower from thermophiles in E. coli BL21 (DE3) was reported recently stability because after incubation for 8 h at pH 5.1-10.1 residual activities of 10-40 % were detected [43]. [34,35]. E. coli was also shown to be a suitable host in this study. The recombinant thermostable xylanase Xyn10 could be detected The effect of metal ions on the catalytic activity of Xyn10 is and puriied from the soluble fraction of the crude extract. shown in Table 2. The protein showed no detectable activity in presence of Cu2+ and was strongly inhibited in presence of 1 mM Xyn10 was puriied to homogeneity by heat precipitation and Al3+,Fe2+, Fe3+ and Zn2+. High sensitivity towards these cations has subsequent Ni-NTA afinity chromatography with a puriication been described for other xylanases [28,30,41]. Especially for the factor of 2.7 (Table 1). Zymogram analysis conirmed hydrolytic inhibitory effect of Cu2+on GH 10 xylanases numerous examples activity of the protein (Figure 1). The calculated molecular mass have been reported [35,44,45]. No metal ion caused enhance- of the heterologously produced Xyn10 was 38.7 kDa which was in ment of catalytic activity. Therefore, Xyn10 seemed to belong to accordance to the value determined by gel iltration. A molecular the 61 % of hydrolases that do not require metal ions for cata- mass above 30 kDa is typical for family 10 glycoside hydrolases lytic action [46]. Enzymes from thermophilic microorganisms and was also found for xylanases with sequence identity to often display high stability in presence of several detergents and Xyn10 [4,29, 30]. reagents which is advantageous for many industrial applications

Table 1: Puriication of Xyn10.

Activity Spec. activity Yield Step Protein conc. [mg/mL] Total activity [U] PF [U/mL] [ U/mg] [%] CE 24.9 157,035.0 10,469.0 420.0 100.0 1.0 HP 13.0 111,468.0 9289.0 714.0 71.0 1.7 Ni-NTA 4.7 26,470.0 5294.0 1126.0 17.0 2.7 Abbreviations: conc: concentration; spec: Speciic; PF: Puriication factor; CE: Crude extract; HP: Heat precipitation; Ni-NTA: Ni-NTA Afinity chromatography

Page 58 Central

[47]. Therefore, the inluence of different reagents on the activ- kDa MCCE HP N Zym ity of Xyn10 was examined. Remarkably high tolerance (relative activities of 80-100 %) was detected for several reagents, but hy- 116.0 drolytic activity decreased in the presence of Pefabloc and CTAB

66.0 (Table 3). The inhibitory effect of the cationic surfactant CTAB could be due to its interaction with negatively charged (catalytic) 45.0 residues of Xyn10. Slight increase of activity was observed in 35.0 Xyn10 presence of DTT as described for several xylanases [28,45].

25.0 Xyn10 was able to hydrolyze oat spelt xylan (1119.5 ± 20.2 U/ mg), beech- and birchwood xylan (944.1 ± 35.0 U/mg, 854.7 ± 27.1

18.4 U/mg) as well as 4-NP-β-D-xylopyranoside (6.4 ± 0.6 U/mg) but did not show side activity towards cellulose (Table 4). Xylanases 14.4 from glycoside hydrolase family 10 often exhibit activity against a variety of branched substrates as it can be observed for the Figure 1 Puriication process of Xyn10 and zymogram analysis. enzyme of T. brockianus [48]. Thexylanase described here Proteins were separated via SDS-PAGE (gel 12 %) and stained with Coomassie brilliant blue. For zymogram analysis the gel was incubated demonstrates enormous potential for application in second for 1 h at 70 °C in a solution of beechwood xylan (1 %, w/v), stained generation bioreineries due to higher speciic activities towards with Congo red and decolorized in 1 M NaCl. kDa: kilo Dalton, M: soluble and insoluble xylan from different sources compared to Unstained Protein Molecular Weight Marker (Fermentas), C: control commercially available enzymes (sigmaaldrich.com) or recently (crude extract of E. coli BL21 (DE3)/pQE-80L), CE: crude extract of characterized proteins from thermophiles [34,35]. E. coli BL21 (DE3)/pQE-80L::xyn10, HP: heat precipitation, N: Ni-NTA afinity chromatography, Zym: zymogram. The kinetic parameters, such as Vmax, Km,kcat and the catalytic

A A

100 100 90 90 80 80 70 70 60 60 50 50 40 30 30 relative activity [%] relative activity [%] 20 20 10 1040 0 0 50 60 70 80 90 100 110 120 45678910 temperature [°C] pH

B B

100 100 90 90 80 80 70 70 60 60 50 50 40 40 30 30 relative activity [%] relative activity[%] 24 h, 4 °C 20 80 °C 20 10 10 24 h, 70 °C 0 0 0 20406080100120140160180 45678910 time [min] pH

Figure 2 Inluence of temperature on the activity and stability of Figure 3 Inluence of pH on the activity and stability of Xyn10. (A) Xyn10. (A) Determination of relative activities in the range of 50-115 °C Relative activity was measured at 95 °C in the range of pH 4.0-10.0 was performed in 50 mM maleate buffer pH 6.0 using 0.5 % oat spelt (50 mM Britton-Robinson buffer) for 15 min using 0.5 % oat spelt xy- xylan (w/v) as substrate. Time for hydrolysis was set to 15 min. Rela- lan (w/v) as substrate. The value at pH 6.0 was considered as 100 %. (B) pH stability was investigated by determining residual activity after tive activity at 95 °C was considered as 100 %. 24 h of incubation at pH 4.0-10.0 (50 mM Britton-Robinson buffer) at (B) Thermal stability was examined by incubation of Xyn10 for 0-180 4 °C and 70 °C. Subsequently, the activity assay was conducted at pH 6 min at 80°C. Subsequently residual activityagainst 0.5 % oat spelt xylan using 0.5 % oat spelt xylan (w/v) as substrate, the hydrolysis-assay was (w/v) was measured at 95 °C in 50 mM maleate buffer, pH 6.0. Detected done for 15 min at 70 °C. The measured values without incubation were relative activity without preceding incubation was set to 100 %. considered as 100 %.

Page 59 Central

Table 2: Inluence of metal ions on the activity of Xyn10. xylobiose and xylose are the main hydrolysis products generated Metal Relative activity [%] by Xyn10 ((supplementary material, Figure S4). Due to often existing β-xylosidase side activity xylose is a common hydrolysis 1 mM 5 mM product of family 10 xylanases [49]. Especially for the application Al3+ 24 ± 4 20 ± 2 in bioreineries the direct production of xylose from xylan is an Ca2+ 96 ± 2 78 ± 3 important advantage. Co2+ 87 ± 5 35 ± 5 CONCLUSION Cr3+ 84 ± 5 42 ± 1 The utilization of lignocellulose for biofuel production Cu2+ 00offers chances to satisfy the growing demand for energy in a Fe2+ 28 ± 5 11 ± 4 sustainable way. Moreover, food vs. fuel conlicts which are st Fe3+ 18 ± 3 18 ± 5 the most controversial aspects of 1 generation bioethanol are avoided [50]. However, for the competitive production of biofuel K+ 88 ± 1 101 ± 2 from lignocellulose highly eficient, thermostable enzymes are 2+ Mg 85 ± 1 88 ± 3 required. Especially xylanases play an essential role because Mn2+ 98 ± 2 95 ± 3 additional fermentation of hemicellulose-derived xylose will Na+ 87 ± 3 95 ± 2 contribute to higher yields and therefore improve eficiency of bioreineries [7,8]. Ni2+ 70 ± 2 35 ± 4 Rb+ 83 ± 3 99 ± 2 The irst xylanase-encoding gene from the genus Thermus was identiied. The xylanolytic enzyme Xyn10 was successfully Sr2+ 82 ± 4 83 ± 3 produced, puriied and characterized. In comparison to 2+ Zn 17 ± 1 0 commercially available xylanases the protein exhibits higher speciic activities, reaction temperatures and better thermal Table 3: Inluence of additives on the activity of Xyn10. stability. Compound [5 mM] Relative activity [%] ACKNOWLEDGEMENT CHAPS 84± 4 This work was inancially supported by the German Federal Triton X-100 88 ± 1 Ministry of Education and Research (BMBF, funding code Tween 20 87 ± 4 0315559A) within the Cluster “Bioreinery2021”. We thank Tween 80 97 ± 4 Angel Angelov (Technical University Munich, TUM, Germany) Guanidine hydrochloride 90 ± 2 and Vera Haye for support. Urea 93 ± 1 REFERENCES DTT 110 ± 1 1. Kamm B, Kamm M. Principles of bioreineries. Appl Microbiol β-mercaptoethanol 101 ± 4 Biotechnol. 2004; 64: 137-145. EDTA 90 ± 2 2. Kamm B, Gruber PR, Kamm M. Bioreineries - Industrial Processes and Iodacetic acid 96 ± 2 Products: Status Quo and Future Directions: Wiley-VCH Verlag GmbH & Co. KGaA; 2005. Sodium azide 96 ± 2 3. Rubin EM. Genomics of cellulosic biofuels. Nature. 2008; 454: 841- Pefabloc 68 ± 1 845. CTAB 16 ± 3 4. Collins T, Gerday C, Feller G. Xylanases, xylanase families and Abbreviations: CHAPS: 3-[(3-cholamidopropyl)dimethylammonio]-1- extremophilic xylanases. FEMS Microbiol Rev. 2005; 29: 3-23. propanesulfonate DTT: Dithiotreitol; EDTA: Ethylenediaminetetraacetic Acid; CTAB: Cetyltrimethyl-Ammonium Bromide 5. Subramaniyan S, Prema P. Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Crit Rev Biotechnol. Table 4: Substrate speciicity of Xyn10. 2002; 22: 33-64. Substrate Speciic activity [U/mg] 6. Zhang J, Moilanen U, Tang M, Viikari L. The carbohydrate-binding Oat spelt xylan 1119.5 ± 20.2 module of xylanase from Nonomuraea lexuosa decreases its non- productive adsorption on lignin. Biotechnol Biofuels. 2013; 6: 18. Beechwood xylan 944.1 ± 35.0 7. Dodd D, Cann IK. Enzymatic deconstruction of xylan for biofuel Birchwood xylan 854.7 ± 27.1 production. Glob Change Biol Bioenergy. 2009; 1: 2-17. 4-NP-β-D-xylopyranoside 6.4 ± 0.6 8. Zhang W, Geng A. Improved ethanol production by a xylose-fermenting Carboxymethyl cellulose 0 recombinant yeast strain constructed through a modiied genome Cellulose 0 shufling method. Biotechnol Biofuels. 2012; 5: 35-46. 9. Turner P, Mamo G, Karlsson EN. Potential and utilization of eficiency for oat spelt xylan of 1324 μmol * min-1 * mg-1, 3.0 thermophiles and thermostable enzymes in bioreining. Microb Cell mg/mL, 868.1 * s-1 and 284.9 mL * mg-1 * s-1 are comparable Fact. 2007; 6: 9. to xylanases from other sources. HPLC analysis showed that 10. Yeoman CJ, Han Y, Dodd D, Schroeder CM, Mackie RI, Cann IK,.

Page 60 Central

Thermostable enzymes as biocatalysts in the biofuel industry. Adv Thermal Asymmetric Interlaced-PCR Speciic for GC-Rich Genes and Appl Microbiol. 2010; 70: 1-55. Biochemical Characterization. Appl Biochem Biotechnol. 2010; 160: 1277-1292. 11. Oshima TI, K. Description of Thermus thermophilus (Yoshida and Oshima) comb. nov., a Nonsporulating Thermophilic Bacterium from 30. Oh HW, Heo SY, Kim do Y, Park DS, Bae KS, Park HY. Biochemical a Japanese Thermal Spa. Int J Syst Bacteriol 1974; 24: 102-112. characterization and sequence analysis of a xylanase produced by an exo-symbiotic bacterium of Gryllotalpa orientalis, Cellulosimicrobium 12. Williams RA, Smith KE, Welch SG, Micallef J, Sharp RJ. DNA relatedness sp. HY-12. A Van Leeuw J Microb 2008; 93: 437-442. of Thermus strains, description of Thermus brockianus sp. nov., and proposal to reestablish Thermus thermophilus (Oshima and Imahori) 31. Blanco JC, J. J. R.; Velasco, J.; Martin, J. F. Cloning, expression in Int J Syst Bacteriol. 1995; 45: 495-499. Streptomyces lividans and biochemical characterization of a thermostable endo-beta-1,4-xylanase of Thermomonospora alba UL 13. Brock TD, Freeze H. Thermus aquaticus gen. n. and sp. n., a JB1 with cellulose-binding ability. Appl Microbiol Biotechnol. 1997; nonsporulating extreme thermophile. J Bacteriol. 1969; 98: 289-297. 48: 208-217. 14. Pantazaki AA, Pritsa AA, Kyriakidis DA. Biotechnologically relevant 32. Henrissat B. A classiication of glycosyl hydrolases based on amino enzymes from Thermus thermophilus. Appl Microbiol Biotechnol. acid sequence similarities. Biochem J. 1991; 280 : 309-316. 2002; 58: 1-12. 33. Henrissat B, Callebaut I, Fabrega S, Lehn P, Mornon JP, Davies G. 15. Lyon PF, Beffa T, Blanc M, Auling G, Aragno M. Isolation and Conserved catalytic machinery and the prediction of a common fold characterization of highly thermophilic xylanolytic Thermus for several families of glycosyl hydrolases. P Natl Acad Sci USA. 1995; thermophilus strains from hot composts. Can J Microbiol. 2000; 46: 92: 7090-7094. 1029-1035. 34. Verma D, Kawarabayasi Y, Miyazaki K, Satyanarayana T. Cloning, 16. Angelov A, Mientus M, Liebl S, Liebl W. A two-host fosmid system expression and characteristics of a novel alkalistable and for functional screening of (meta)genomic libraries from extreme thermostable xylanase encoding gene (Mxyl) retrieved from compost- thermophiles. Syst Appl Microbiol. 2009; 32: 177-185. soil metagenome. PLoS One. 2013; 8: e52459. 17. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, 35. Shi H, Zhang Y, Li X, Huang Y, Wang L, Wang Y, Ding H. A novel Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of highly thermostable xylanase stimulated by Ca2+ from Thermotoga protein database search programs. Nucleic Acids Res. 1997; 25: thermarum: cloning, expression and characterization. Biotechnol 3389-3402. Biofuels. 2013; 6: 26. 18. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction 36. Hickey DA, Singer GA. Genomic and proteomic adaptations to growth of signal peptides: SignalP 3.0. J Mol Biol. 2004; 340: 783-795. at high temperature. Genome Biol. 2004; 5: 117. 19. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, 37. Wang X, He X, Yang S, An X, Chang W, Liang D. Structural Basis McWilliam H, Valentin F. Clustal W and Clustal X version 2.0. for Thermostability of beta-Glycosidase from the Thermophilic Bioinformatics. 2007; 23: 2947-2948. Eubacterium Thermus nonproteolyticus HG102. J Bacteriol 2003; 185: 4248-4255. 20. Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. 38. Vieille C, Zeikus GJ. Hyperthermophilic enzymes: sources, uses, and Bioinformatics. 2006; 22: 195-201. molecular mechanisms for thermostability. Microbiol Mol Biol Rev. 2001; 65: 1-43. 21. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680-685. 39. Gezgin Y, Tanyolac B, Eltem R. Some Characteristics and isolation of Novel Thermostable ß-Galactosidase from Thermus oshimai DSM 22. Bradford MM. A rapid and sensitive method for the quantitation of 12092. Food Sci. Biotechnol. 2013; 22: 63-70. microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72: 248-254. 40. Fridjonsson O, Watzlawick H, Gehweiler A, Rohrhirsch T, Mattes R. Cloning of the gene encoding a novel thermostable alpha- 23. Miller GL. Use of Dinitrosalicylic Acid Reagent for Determination of galactosidase from Thermus brockianus ITI360. Appl Environ Reducing Sugar. Anal Chem 1959; 31: 426–428. Microbiol. 1999; 65: 3955-3963. 24. Britton HTS, Robinson RA. Universal buffer solutions and the 41. Liu B, Zhang N, Zhao C, Lin B, Xie L, Huang Y,. Characterization of a dissociation constant of veronal. J Chem Soc. 1931: 1456-1473. recombinant thermostable xylanase from hot spring thermophilic 25. Kozak M. Regulation of translation via mRNA structure in prokaryotes Geobacillus sp. TC-W7. J Microbiol Biotechnol. 2012; 22: 1388-1394. and eukaryotes. Gene. 2005; 361: 13-37. 42. Kumar V, Satyanarayana T. Production of thermo-alkali-stable 26. Newcomb M, Chen CY, Wu JH. Induction of the celC operon of xylanase by a novel polyextremophilic Bacillus halodurans TSEV1 in Clostridium thermocellum by laminaribiose. Proc Natl Acad Sci U S A. cane molasses medium and its applicability in making whole wheat 2007; 104: 3747-3752. bread. Bioprocess Biosyst Eng. 2013. 27. Takeda Y, Takase K, Yamato I, Abe K. Sequencing and characterization 43. Jiang ZQ, Li XT, Yang SQ, Li LT, Li Y, Feng WY,. Biobleach boosting effect of the xyl operon of a gram-positive bacterium, Tetragenococcus of recombinant xylanase B from the hyperthermophilic Thermotoga halophila. Appl Environ Microbiol. 1998; 64: 2513-2519. maritima on wheat straw pulp. Appl Microbiol Biotechnol. 2006; 70: 65-71. 28. Kim DY, Han MK, Oh H-W, Park D-S, Kim S-J, Lee S-G, et al. Catalytic properties of a GH10 endo-ß-1,4-xylanase from Streptomyces 44. Park DJ, Lee YS, Chang J, Fang SJ, Choi YL. An -1,4-xylanase with exo- thermocarboxydus HY-15 isolated from the gut of Eisenia fetida. J Mol enzyme activity produced by Paenibacillus xylanilyticus KJ-03 and its Catal B-Enzym 2010; 62: 32-39. cloning and characterization. J Microbiol Biotechnol. 2013; 23: 397- 404. 29. Zhou J, Huang H, Meng K, Shi P, Wang Y, Luo H, et al. Cloning of a New Xylanase Gene from Streptomyces sp. TN119 Using a Modiied 45. Liu B, Zhang N, Zhao C, Lin B, Xie L, Huang Y,. Characterization of a

Page 61 Central

recombinant thermostable xylanase from hot spring thermophilic 48. Pell G, Taylor EJ, Gloster TM, Turkenburg JP, Fontes CM, Ferreira LM, Geobacillus sp. TC-W7. J Microbiol Biotechnol. 2012; 22: 1388-1394. Nagy T. The mechanisms by which family 10 glycoside hydrolases bind decorated substrates. J Biol Chem. 2004; 279: 9597-9605. 46. Andreini C, Bertini I, Cavallaro G, Holliday GL, Thornton JM. Metal ions in biological catalysis: from enzyme databases to general principles. J 49. Biely P, Vrsanská M, Tenkanen M, Kluepfel D. Endo-beta-1,4-xylanase Biol Inorg Chem. 2008; 13: 1205-1218. families: differences in catalytic properties. J Biotechnol. 1997; 57: 151-166. 47. Bruins ME, Janssen AE, Boom RM. Thermozymes and their applications: a review of recent literature and patents. Appl Biochem 50. Grayson M, Graham-Rowe D, Sanderson K, Martin M, Lynd LR, Woods Biotechnol. 2001; 90: 155-186. J, et al. Biofuels. Nature. 2011; 474: 1-24.

SUPPLEMENTARY FIGURES

1,2 1,0

1,0 0,8

0,8 0,6 0,6

A 546nm 0,4 0,4 nm 546 A

0,2 0,2

0,0 0,0 0 0,5 1 1,5 2 2,5 3 00,511,52 xylose [mM] glucose [mM]

Figure S1 Calibration curves. (A) Calibration curve for xylose, (B) Calibration curve for glucose. 500 μL of xylose or glucose, respectively (0-2.5 mM in 50 mM maleate buffer, pH 6.0) were mixed with 500 μL of DNS reagent. After incubation for 5 min at 99 °C absorptions were measured at 546 nm.

100 90 80 70 60 50 40 30 relative activity [%] 20 10 0 0 5 10 15 20 25 30 35 time [min]

Figure S2 Time dependant activity proile. Hydrolysis of 0.5 % oat spelt xylan (w/v) in 50 mM maleate buffer (pH 6.0)was conducted at 95 °C for 0-35 min. After the addition of 500 μL DNS reagent the reaction was transferred on ice and subsequently incubated at 99 °C for 5 min.Absorption was determined at 546 nm.

Page 62 Central

100 90 80 70 60 50 3 h 40 24 h 30 relative activity [%] activity relative 20 10 0 50 60 70 temperature [°C]

Figure S3 Thermal stability of Xyn10. After incubation of the protein at 50-70 °C for 3-24 h the residual activity was determined using 0.5 % oat spelt xylan (w/v) as substrate. Hydrolysis was conducted at 95 °C for 15 min in 50 mM maleate buffer, pH 6.0. Detected relative activity without preceding incubation was set to 100 %.

Figure S4 HPLC analysis of hydrolysis products. Hydrolysis of 2 % xylan (w/v) by Xyn10 was carried out for 1 h at 80 °C. Hydrolysis products were monitored by HPLC (LaChrom, RI-detector: L-7490, Merck-Hitachi, Tokio, Japan) using a HPX42A column and high purity water as solvent with a low rate of 0.6 mL/min. The following retention times in minutes were determined: xylobiose: 16.23, xylose: 18.02.

Cite this article Blank S, Schröder C, Schirrmacher G, Reisinger C, Antranikian G (2014) Biochemical Characterization of a Recombinant xylanase from Thermus brockianus, Suitable for Biofuel Production. JSM Biotechnol Bioeng 2(1): 1027.

Page 63 Research Article *Corresponding author Prof.Dr. Volker Sieber, Chair of Chemistry of Biogenic Resources, Technische Universität München, A Novel Natural NADH and Schulgasse 16, 94315 Straubing, Germany, Tel: 4909421187301; Email: Submitted: 16 April 2014 NADPH Dependent Glutathione Accepted: 12 May 2014 Published: 14 May 2014 Reductase as Tool in ISSN: 2333-7117 Copyright Biotechnological Applications © 2014 Sieber et al. OPEN ACCESS Reiter, J.1,2, Pick, A.1, Wiemann, L.O.2, Schieder, D.1 and Sieber, V.1,2* Keywords • Glutathione reductase 1 Chair of Chemistry of Biogenic Resources, Technische Universität München, Germany • NADH 2 Fraunhofer IGB, Projektgruppe BioCat, Germany • Allochromatium vinosum

Abstract The antioxidant glutathione (GSH) is an important reducing agent in cell physiology. Glutathione reductases (GR) of humans and higher organisms convert oxidized glutathione (GSSG) to two reduced GSH molecules under consumption of the co-factor NADPH. GSH acts as an antioxidant eliminating reactive oxygen species in the cell. We found a novel GR being able to accept both NADPH and much cheaper NADH for GSSG reduction. For the ﬁ rst time we produced it in E. coli and puriﬁ ed

active GR from Allochromatium vinosum, determined its Km-values for NADH (0.026 mM) and NADPH (0.309 mM), as well as its temperature optimum (20 °C) and pH optimum (pH 8). Since numerous bio-diagnostic assays and enzymatic processes are dependent on GRs the possibility to use a cheaper co-substrate could help to overcome cost limitations in future.

ABBREVIATIONS Moreover, several novel and highly sensitive detection methods for analyzing in vivo levels of glutathione and glutathione GR: Glutathione Reductase; GSH: Reduced Glutathione; GSSG: disulide have been developed [10,11]. These methods are Oxidized Glutathione important for pharmacology as they allow the monitoring of INTRODUCTION oxidative stress, or to study cellular responses towards drugs and toxic compounds. Rahman setup a high throughput detection All organisms have developed certain mechanisms to cope method for the GSH level by reducing GSH with 5,5’-dithio-bis with cellular stress caused by reactive oxygen species, pathogens, (2-nitrobenzoic acid) (i.e. Ellman’s reagent) yielding highly unfavorable temperature and environmental conditions or heavy chromophoric 5-thio-2-nitrobenzoic acid [10] while Noh applied metal–contaminations to name only a few [1-5]. Detoxiication an electrochemical detection method for glutathione [11]. Both of reactive oxygen species or degradation of xenobiotics in living assays are based on the reduction of GSSG by a eukaryotic GR that cells, for example, often involves reduced glutathione (GSH). For only accepts NADPH. However, commercially available reduced instance the ascorbate-glutathione cycle is part of the peroxide β-Nicotinamide adenine dinucleotide is approximately ten times degradation process [5-8]. The GSH (γ-L-Glutamyl-L-cysteinyl- cheaper than reduced β-Nicotinamide adenine dinucleotide glycin tripeptide) has a mid-point redox potential of -318 mV. 2′-phosphate. Therefore, switching to NADH dependent assays In addition, glutathione plays important roles in the cells’ iron could signiicantly decrease costs. metabolism, DNA and protein synthesis as well as enzyme activation. Glutathione reeducates [NAD(P)H: glutathione disulide oxidoreductase, EC 1.8.1.7.] have been described in various plants, Furthermore, reduced glutathione is the substrate for various animals, fungi, yeasts and bacteria [12-17]. However, until now cellular metabolic pathways that inally oxidize glutathione, most GR’s have been described as being strictly NADPH dependent. where two GSH molecules are linked by a disulide bond. Though GRs from human erythrocyte and from Spinach were found However, the most critical process in living cells is to maintain to also utilize NADH, but the maximal reaction rates achieved here the balance between reduced and oxidized glutathione (GSSG) were only ca. 20 % of those obtained with NADPH [18-19]. So even and that is permanently adjusted by glutathione reductases (GR) though both enzymes are able to use NADH their main their main [5]. activity still lies with NADPH [20]. Glutathione reductases have found important applications About 40 years ago a glutathione reductase from in industrial as well as medical biotechnology. For example, Allochromatium vinosum (reclassiied, formerly known glutathione reductase was recently used in an enzymatic as Chromatium vinosum) had been puriied and partially multistep cascade for the deoxygenation of vicinal diol characterized and shown to be highly speciic for NADH [21]. derivatives, by a hydrogen borrowing mechanism (Figure 1) [9]. Chromatiaceae represent a very rudimentary bacterial group and This cascade has high potential for the defunctionalization of it is assumed that this group developed its NADPH dependency polyhydroxy compounds. later than its NADH-dependency [22]. Till date, there has been

Page 64 Central no report about other natural glutathione reductases exhibiting of elution fractions were tested by SDS-PAGE and Coomassie a preference for NADH. Since just recently the genome of staining and protein concentrations were measured by Bradford Allochromatium vinosum has been sequenced we now for the irst (Roti Nanoquant, Carl Roth, Germany) [23]. The enzyme was time were able to clone and express an E. coli codon-optimized stored in batch samples in the elution buffer (20% glycine, avGR gene and to purify and characterize the corresponding 500 mM imidazole, pH 6.5) at -20°C, single fractions of 3700 μg/mL protein to make it available for potential applications in protein concentration were gently thawed directly before starting diagnostics and biotechnology where reduced cofactor costs are an activity assay, diluted 1:20,000. A slight activity loss of 10 to 20 % of advantage. occurred on refreezing. Else, the enzyme was stable at 20°C. MATERIALS AND METHODS Assay conditions Chemicals, strains and gene synthesis Activity of the enzyme was measured photometrically at 340 nm in 96 well plates. The assay was started by adding All chemicals in this paper were purchased from Sigma- 7 mM GSSG (Sigma Aldrich, Germany) and 0.5 mM NADH or Aldrich (Germany). The Allochromatium vinosum DSM 180 NADPH (Carl Roth, Germany) in a citrate-borate-phosphate glutathione reductase YP_003443292 was synthesized with (CBP) universal pH buffer (Carl Roth, Germany) to a solution of codon optimization for Escherichia coli by Life Technologies avGR in the same buffer. Temperature and pH dependence were GmbH (Germany) in a pUC18 derivative. The open reading frame measured in a universal pH 4-12 CBP buffer system. of the avGR gene fragment was cut out of this plasmid with For determining K and k for NADH and NADPH activity BsaI and PsiI and cloned with a C-terminal His-tag in a pET28b m cat measurements at optimal conditions (pH 8, 20 °C) and constant derivative (pCBR-C-His with a BsaI and BfuAI restriction site. GSSG (7 mM) were performed. The concentration of NADH and Predigested with BsaI, 3´sticky ends were illed with klenow NADPH was varied between 0.3 μM and 1 mM. Km and kcat for fragment. In the next step the 5´ end was cut with BfuAI, creating GSSG was determined in the presence of 1 mM NADH. Calculation a BsaI cloning site) (Novagen, Germany; NEB, U.S.). This plasmid of the kinetic constants was performed with Sigma Plot 11.0. was sequenced and used to transform Escherichia coli BL21 Samples which contained NADH/NADPH concentrations above (DE3) (Merck KGaA, Germany). The protein was expressed in 1 mM were diluted before measurement. Escherichia coli BL21 (DE3). NADH and NADPH were purchased by Carl Roth (Germany). Inhibition tests Expression and puriication Tests with lavin adenine dinucleotide (FAD) or GSSG pre- incubation prior to the assay were conducted with 0.5 mM FAD After expression in LB medium with 50 μg/mL kanamycin (Carl Roth, Germany) or 7 mM GSSG (Sigma Aldrich, Germany) induced at OD600 = 0.8 by 1 mM IPTG at 37°C for 4 h the cells were following the above standard assay protocol with CBP-buffer pH harvested (4500 g, 4°C, 30 min) and applied to a cell disruptor 8 at 20 °C. Different ion concentrations on GR were tested with (Constant Systems Ltd., U.S.) in binding buffer (Tris/HCl pH 5 mM and 10 mM NaCl, Na2SO4 and Na3PO4 following the above 7.2, 10% (v/v) glycerol, 20 mM imidazole). The cell extract was standard protocol under optimum conditions. centrifuged (25,000 g, 4°C, 20 min), applied to a Ni2+-NTA column (4 mL, GE, U.S.) and then fractionated in elution buffer (Tris/ Structure modeling HCl pH 7.2, 10% (v/v) glycerol, 500 mM imidazole). The purity A structure model for avGR was created using Phyre2 [24].

Figure 1 Enzymatic multistep cascade for the enzymatic deoxygenation of vicinal diol derivatives by a hydrogen borrowing mechanism [9].

Page 65 Central

40 avGR Activity A

20 U/mg

0 3456789101112 pH

Figure 2 Reaction of avGR at 340 nm with 0.5 mM NADH and 7 mM glutathione in CBP-buffer pH 4-11. (n=3). B

avGR Activity 40

20 U/mg

0 20 30 40 50 60 70 80 90 Figure 4 (A) avGR kinetic under variation of NADH concentrations, T [°C] and (B) oxidized glutathione concentrations in CBP-buffer pH 8, 20 °C as triplicates. Figure 3 Temperature-related avGR activity with 0.5 mM NADH and 7 mM glutathione in CBP-buffer pH8 at 340 nm, measured between 20 °C and 90 °C (n=3).

Table 1: Activity of avGR towards different substrates compared to control experiment (%). (n=3). K = 100% 5 mM 10 mM NaCl 40.4 ± 1.9 63.3 ± 16.8

Na2SO4 106.7 ± 13.3 111.1 ± 10.2

Na3PO4 97.8 ± 10.2 117.8 ± 7.7 Abbreviations: avGR Allochromatium vinosum glutathione reductase;

NaCl Sodium chloride; Na2SO4 Sodium sulfate; Na3PO4 Sodium phosphate Table 2: Activity of avGR with 0.5 mM NADH, 0.5 mM oxidized glutathione in CBP-buffer pH 8 after pre-incubation of the enzyme with FAD or GSSG. (n=3). avGR avGR +FAD avGR + GSSG % 100 194.2 ± 14.2 105.4 ± 8.1 Abbreviations: avGR Allochromatium vinosum glutathione reductase; FAD Figure 5 avGR kinetic under variation of NADPH in CBP-buffer pH 8, Flavin adenine dinucleotide; GSSG oxidized glutathione; NADH Nicotine 20 °C (n=3). adenine dinucleotide; CBP Citrate borate phosphate buffer.

Page 66 Central

Subsequently, the derived model was used for 3DLigandSite to avGR was determined to be 35.8 ± 0.3 U/mg at pH 8, thus being integrate FAD and NADH into the structure [25]. Out of a set of above the published pH of 7 for the native enzyme (Figure 2). different FAD and NADH/NADPH molecules respectively one This is important as earlier described applications [9,10,11] candidate was chosen and the remaining removed from the model. all use slightly alkaline conditions. The temperature optimum for In a inal step the model was compared to crystal structures of avGR was investigated in the range from 20 °C to 90 °C at pH 8 glutathione reductase from E. coli (PDB: 1 GER and 1 GEU) as well as and was determined to be 34.3 ± 1.5 U/mg at 20 °C (Figure 3). a variant thereof with improved acceptance of NADH. Previous studies showed an inhibition or activation of native RESULTS AND DISCUSSION avGR by salts like phosphate [21]. We tested the inhibition of We were able to annotate the gene function to a glutathione recombinant avGR activity at its optimal conditions by addition of reductase in Allochromatium vinosum DSM 180. We postulated different concentrations of NaCl, Na2SO4, and Na3PO4. The activity the gene YP_003443292 coding for a 458aa predicted glutathione was measured photometrically at 340 nm. Whereas 5 mM NaCl reductase of the sequenced genome of Allochromatium vinosum decreased activity of avGR by ca. 60 %, activity in phosphate

DSM 180 to be responsible for the GR activity described 40 years increased 17.8 ± 7.7 % at 10 mM Na3PO4. This result stands in ago in this organism [21]. The gene was codon optimized for E. contrast to those obtained previously for the native enzyme and coli and cloned with a His-tag. Soluble protein was expressed by it is important when considering its potential applications in E. coli BL21 (DE3) in LB-media and puriied via a metal-chelate commonly used phosphate buffers (Table 1). column (GE, U.S.). Protein content of the elution peak fractions Chung observed an inhibition of the Allochromatium vinosum varied between 3700 μg/mL and 4700 μg/mL and the SDS-PAGE reductase by pre-bound GSSG and proposed to alleviate this by showed clear single bands at 48.8 kDa (data not shown). pre-incubation of avGR with FAD. We found almost no difference We were able to express the soluble avGR enzyme with codon by GSSG pre-incubation, but an almost-twofold increase of optimization in E.coli and were able to purify the His-tagged activity with FAD pre-incubation to about 194.2 ± 14.2 % (Table protein in an active form as well. In all assays avGR was pre- 2) [21]. incubated for 5 min with FAD. The external addition of FAD is Km and kcat were determined photometrically following the supposed to replenish potentially lost lavin adenine dinucleotide decline of NADH at different concentrations. The concentrations from the enzymes active center during the puriication process. of avGR and GSSG (7 mM) were kept constant and reactions The reaction was started with 0.5 mM NADH and 7 mM GSSG. were run at pH 8 and 20 °C. The Km for NADH and NADPH were The pH dependence of avGR activity was tested in citrate-borate- identiied as 0.026 ± 0.004 mM (Figure 4A) and 0.309 ± 0.030 mM phosphate buffer (CBP) ranging from pH 4-12. The optimum for -1 respectively. (Figure 5) The kcat values were 33.23 ± 1.23 s and

Figure 6 Alignment of avGR and ecGR with glycine 178 and glutamate 198 (red boxes) of the NADH binding sites of pyridine dinucleotide oxidoreductases (Basic Logarithmic Alignment Search Tool, BLAST).

Page 67 Central

-1 40.02 ± 1.46 s respectively. Km and kcat for GSSG with constant well as the amino acid sequence was compared to characterized NADH at 0.5 mM were 0.033 ± 0.007 mM and 5.34 ± 1.47 s-1 glutathione reductases. The characteristic glycine residue (AS (Figure 4B). 178) found for enzymes preferring NADH as well as a negatively charged residue at the end of the β-strand (AS 198) can be found Intensive research of glutathione reductases has been in avGR. Glutamate at position 198 is the main factor inluencing conducted not only to elucidate its role in cell physiology but the binding of NADPH by decreasing the space for the 2’phosphate also to understand the mechanism of cofactor acceptance. A and preventing stabilization. (Figure 7) comparison of Homo sapiens GR and Plasmodium falciparum GR (pfGR) showed up to 5 % activity of pfGR and hsGR towards These structural features correspond to the measured kinetic

NADH and a lower Km value of pfGR for NADPH compared to hsGR parameters and the observed preference for NADH. Glutathione [26]. Moreover, wild type Escherichia coli GR (ecGR) shows a reductase from Allochromatium vinosum is still superior against strongly decreased activity of around 5 % with NADH. As a result the variant of ecGR in context of Km (three times lower) and also -1 -1 of the crystal structure for hsGR and the high homology towards for kcat/Km which is with 76.6 min μM three times higher. The ecGR irst mutagenesis studies were carried out. Scrutton were NADH attachment site is within a larger FAD binding domain. successful in the redesign of the coenzyme speciicity of ecGR Huber and Brandt (1980) calculated glutathione reduction in [27]. As a member of the lavoprotein disulphide oxidoreductase human glutathione reductase with the following three steps, (1) family glutathione reductase shares some typical features NADPH binding (>300 s-1) (2) hydride transfer to FAD (153 s-1) and found in enzymes interacting with pyrophosphate moieties (3) disulide reduction by FAD (68 s-1) [31]. In a binding study for (Figure 6) [26]. NADH, Y197 played an important role in the catalytic mechanism by opening and blocking the binding pocket of NADH/NADPH and The unique βαβ-fold responsible for the ADP binding of it is also conserved in avGR. K66 and E201 of hsGR transfer the the cofactor carries a GxGxxG/A motif [28]. Scrutton suspected hydride by forming an ion pair whereas oxygen atoms of E201 that the differentiation between glycine and alanine in the third are closer to NADH than K66 nitrogen atoms, implicating that position is correlated with the preference towards NADH or the carboxyl group seems to be more important. Both sites are NADPH [27]. But a more intense study by Carugo and Argos on conserved in the NADH/NADPH binding pockets of glutathione basis of crystal structures of different enzymes did not reveal any and mercury reductases or liponamide dehydrogenases [31-36]. signiicant correlation for this feature [29]. A clear characteristic However, only crystallization and detailed binding studies could to distinguish between the two pyridine nucleotide cofactors is clearly elucidate the exact mechanism of avGR as NADH and the residue at the C-terminal end of the second β-strand. It is NADPH dependent glutathione reductase. negatively charged when a hydrogen bond to the 2’-hydroxyl group of NADH is required and in most cases hydrophobic for CONCLUSION the 2’-phosphate of NADPH [30]. Within the study of Scrutton et The availability of enzymes that are using the cheapest possible al. for ecGR a change in these characteristic residues allowed a cofactor is essential for cost effective biocatalysis. In making this complete switch towards NADH by lowering the K from 2 mM m rare NADH-dependent GR available as recombinant enzyme in to 0.086 mM. The catalytic eficiency k /K was increased by cat m E.coli we provided a new tool for GR dependent diagnostic assays a factor of 72 (24.4 min-1 μM-1) compared to the wild type with or for GSH dependent biotransformation reactions. avGR has a 0.34 min-1 μM-1. Based on this information the homology model as

Figure 7 Structure model of avGR with FAD and NAD+. Residues leucine 197 and glutamate 198 are shown in the stick mode and the distances to the 2’ and 3’-hydroxy groups of the ribose ring are speciied.

Page 68 Central superior catalytic eficiency than previously engineered GR from 14. Backos DS, Franklin CC, Reigan P. The role of glutathione in brain E. coli. The enzyme can be produced in soluble form in good yield. tumor drug resistance. Biochem Pharmacol. 2012; 83: 1005-1012. Storage stability is high. At temperature above 20 °C the enzyme 15. Krauth-Siegel RL, Leroux AE. Low-molecular-mass antioxidants in has reduced activity. However, even at 70 °C signiicant activity parasites. Antioxid Redox Signal. 2012; 17: 583-607. was still available showing that the enzyme can be used at higher 16. Mendoza-Cózatl D, Loza-Tavera H, Hernández-Navarro A, Moreno- temperature. Recently we demonstrated the application of this Sánchez R. Sulfur assimilation and glutathione metabolism under enzyme in a redox-neutral synthetic enzymatic pathway for cadmium stress in yeast, protists and plants. FEMS Microbiol Rev. the degradation of lignin [9]. In future it could even be feasible 2005; 29: 653-671. to couple this NADH-dependent GR with important toxic or 17. López-Mirabal HR, Winther JR. Redox characteristics of the eukaryotic environmentally problematic industrial waste degradation cytosol. Biochim Biophys Acta. 2008; 1783: 629-640. approaches. 18. Scott EM, Duncan IW, Ekstrand V. Puriication and Properties of ACKNOWLE DGEMENT Glutathione Reductase of Human Erythrocytes. J Biol Chem. 1963; 238: 3928-3933. We would like to thank Kerstin Stadler and Benjamin Kick for 19. Vanoni MA, Wong KK, Ballou DP, Blanchard JS. Glutathione reductase: experimental support. We also thank the Bavarian government comparison of steady-state and rapid reaction primary kinetic isotope for funding this project within the BayernFit program. effects exhibited by the yeast, spinach, and Escherichia coli enzymes. Biochemistry. 1990; 29: 5790-5796. REFERENCES 20. Perham RN, Scrutton NS, Berry A. New enzymes for old: redesigning 1. Foyer CH, Noctor G. Ascorbate and glutathione: the heart of the redox the coenzyme and substrate speciicities of glutathione reductase. hub. Plant Physiol. 2011; 155: 2-18. Bioessays. 1991; 13: 515-525. 2. Noctor G, Mhamdi A, Chaouch S, Han Y, Neukermans J, Marquez- 21. Chung YC, Hurlbert RE. Puriication and properties of the glutathione Garcia B, et al. Glutathione in plants: an integrated overview. Plant Cell reductase of Chromatium vinosum. J Bacteriol. 1975; 123: 203-211. Environ. 2012; 35: 454-484. 22. Horocker BL. [Alternate pathways of carbohydrate metabolism and 3. Meyer AJ, Hell R. Glutathione homeostasis and redox-regulation by their physiological signiicance]. Seikagaku. 1965; 37: 313-324. sulhydryl groups. Photosynth Res. 2005; 86: 435-457. 23. Bradford MM. A rapid and sensitive method for the quantitation of 4. Parisy V, Poinssot B, Owsianowski L, Buchala A, Glazebrook J, Mauch microgram quantities of protein utilizing the principle of protein-dye F. Identiication of PAD2 as a gamma-glutamylcysteine synthetase binding. Anal Biochem. 1976; 72: 248-254. highlights the importance of glutathione in disease resistance of 24. Kelley LA, Sternberg MJ. Protein structure prediction on the Web: a Arabidopsis. Plant J. 2007; 49: 159-172. case study using the Phyre server. Nat Protoc. 2009; 4: 363-371. 5. Hicks LM, Cahoon RE, Bonner ER, Rivard RS, Shefield J, Jez JM. Thiol- 25. Wass MN, Kelley LA, Sternberg MJ. 3DLigandSite: predicting ligand- based regulation of redox-active glutamate-cysteine ligase from binding sites using similar structures. Nucleic Acids Res. 2010; 38: Arabidopsis thaliana. Plant Cell. 2007; 19: 2653-2661. W469-473. 6. May MJ, Leaver CJ. Oxidative Stimulation of Glutathione Synthesis in 26. Krauth-Siegel RL, Müller JG, Lottspeich F, Schirmer RH. Glutathione Arabidopsis thaliana Suspension Cultures. Plant Physiol. 1993; 103: reductase and glutamate dehydrogenase of Plasmodium falciparum, 621-627. the causative agent of tropical malaria. Eur J Biochem. 1996; 235: 345- 7. Xiang C, Werner BL, Christensen EM, Oliver DJ. The biological functions 350. of glutathione revisited in arabidopsis transgenic plants with altered 27. Scrutton NS, Berry A, Perham RN. Redesign of the coenzyme speciicity glutathione levels. Plant Physiol. 2001; 126: 564-574. of a dehydrogenase by protein engineering. Nature. 1990; 343: 38-43. 8. Mullineaux PM, Rausch T. Glutathione, photosynthesis and the redox 28. Wierenga RK, Terpstra P, Hol WG. Prediction of the occurrence of the regulation of stress-responsive gene expression. Photosynth Res. ADP-binding beta alpha beta-fold in proteins, using an amino acid 2005; 86: 459-474. sequence ingerprint. J Mol Biol. 1986; 187: 101-107. 9. Reiter J, Strittmatter H, Wiemann LO, Schieder D, Sieber V. Enzymatic 29. Carugo O, Argos P. NADP-dependent enzymes. I: Conserved cleavage of lignin ß-O-4 aryl ether bonds via net internal hydrogen stereochemistry of cofactor binding. Proteins. 1997; 28: 10-28. transfer. Green Chem. 2013; 15: 1373- 1381. 30. Schierbeek AJ, Swarte MB, Dijkstra BW, Vriend G, Read RJ, Hol WG, 10. Rahman I, Kode A, Biswas SK. Assay for quantitative determination of et al. X-ray structure of lipoamide dehydrogenase from Azotobacter glutathione and glutathione disulide levels using enzymatic recycling vinelandii determined by a combination of molecular and isomorphous method. Nat Protoc. 2006; 1: 3159-3165. replacement techniques. J Mol Biol. 1989; 206: 365-379. 11. Noh HB, Chandra P, Moon JO, Shim YB. In vivo detection of glutathione 31. Wierenga RK, De Maeyer MH, Hol WJ. Interaction of pyrophosphate disulide and oxidative stress monitoring using a biosensor. moieties with alpha-helixes in dinucleotide-binding proteins. Biomaterials. 2012; 33: 2600-2607. Biochemistry. 1985; 24: 1346-1357. 12. Prast-Nielsen S, Huang HH, Williams DL. Thioredoxin glutathione 32. Sarma GN, Savvides SN, Becker K, Schirmer M, Schirmer RH, Karplus reductase: its role in redox biology and potential as a target for drugs PA. Glutathione reductase of the malarial parasite Plasmodium against neglected diseases. Biochim Biophys Acta. 2011; 1810: 1262- falciparum: crystal structure and inhibitor development. J Mol Biol. 1271. 2003; 328: 893-907. 13. Johann L, Lanfranchi DA, Davioud-Charvet E, Elhabiri M. A physico- 33. Karplus PA, Schulz GE. Substrate binding and catalysis by glutathione biochemical study on potential redox-cyclers as antimalarial and anti- reductase as derived from reined enzyme: substrate crystal structures schistosomal drugs. Curr Pharm Des. 2012; 18: 3539-3566. at 2 A resolution. J Mol Biol. 1989; 210: 163-180.

Page 69 Central

34. Bump EA, Taylor YC, Brown JM. Role of glutathione in the hypoxic cell 36. Huber PW, Brandt KG. Kinetic studies of the mechanism of pyridine cytotoxicity of misonidazole. Cancer Res. 1983; 43: 997-1002. nucleotide dependent reduction of yeast glutathione reductase. Biochemistry. 1980; 19: 4569-4575. 35. Rice DW, Schulz GE, Guest JR. Structural relationship between glutathione reductase and lipoamide dehydrogenase. J Mol Biol. 1984; 174: 483-496.

Cite this article Reiter J, Pick A, Wiemann LO, Schieder D, Sieber V (2014) A Novel Natural NADH and NADPH Dependent Glutathione Reductase as Tool in Biotechnological Applications. JSM Biotechnol Bioeng 2(1): 1028.

Page 70 Research Article *Corresponding author Prof.Dr. Robert Kourist, Junior Research Group for Microbial Biotechnology, Ruhr-University Bochum, Lipases as Sustainable 44780 Bochum, Germany, Tel: 492343225059, Email:

Submitted: 14 April 2013 Biocatalysts for the Sustainable Accepted: 12 May 2014 Published: 14 May 2014 Industrial Production of Fine ISSN: 2333-7117 Copyright Chemicals and Cosmetics © 2014 Kourist et al. OPEN ACCESS Kourist, R.1*, Hollmann, F.2, Nguyen, G.S.2,3 1Junior Research Group for Microbial Biotechnology, Ruhr-University Bochum, Germany Keywords • Biotechnology 2Department of Biotechnology, Delft University of Technology, The Netherlands • Lipase 3 Barentzymes AS, Sykehusveien 23, Postboks 6431, 9294 Tromsø, Norway • Chiral amines • Protein engineering • Pseudozyma antarctica • CAL-A Abstract • CAL-B Lipases A and B from the psychrophilic basidiomyceteous yeast Pseudozyma antarctica (formerly known as Candida antarctica) belong to the most important industrial biocatalysts with numerous applications in the oleochemical, polymer, textile, biodiesel, and detergent industry. Both lipases have been intensively studied for decades. Nevertheless, several important achievements were made in the last few years. This highlight presents three recent trends that signiﬁ cantly widen the application of lipases. Firstly, improvements in enzyme formulation and reactor setups have improved the performance of lipase in solvent-free reactions systems, which have signiﬁ cantly broadened the scope of lipases for the environmentally friendly synthesis of cosmetic products. Secondly, combination with chemical reactions has a tremendous potential to widen the scope of lipases. For instance, metal-free racemization reactions proved to be a successful approach to increase the yield in the industrially established kinetic resolution of amines. Thirdly, the impressive process in the engineering of lipases shortened time horizons for catalyst development and led to series of novel biocatalysts with engineered selectivity. Successful examples include lipase variants with improved activity towards amines, increased substrate scope, increased or even inverted enantioselectivity and increased ability to discriminate cis and trans fatty acids.

ABBREVIATIONS (formerly known as Candida antarctica) play a particularly prominent role. CAL-A shows unique catalytic properties such Pseudozyma (formerly: Candida) antarctica lipase A CAL-A: as a preference for trans-fatty acids [8] and high activity and (formerly: ) lipase B CAL-B: Pseudozyma Candida antarctica enantioselectivity towards tertiary alcohols [11]. The excellent INTRODUCTION enantioselectivity of CAL-B towards a wide range of chiral compounds makes it one of the most-applied enantioselective Lipases (triacylglycerol hydrolases, EC 3.1.1.3) belong to biocatalysts [12]. Furthermore, the enzyme shows a striking the superfamily of α/β-hydrolases. They have been best known stability at elevated reaction temperatures. In its immobilized for their activities of hydrolysis or synthesis of carboxylic ester form (Novozyme 435), it has been applied in various industrial bonds, but also show several promiscuous activities, among them and pharmaceutical processes [13-15]. Both lipases have been the hydrolysis of amides [1]. The enzymes are distinguished by intensively studied for decades. Nevertheless, several important a broad substrate scope and excellent stability in various media achievements were made in the last few years. and have participated in a wide range of industrial applications in the oleochemical, polymer, textile, biodiesel, detergent industry This article uses the example of CAL-A and CAL-B to highlight and others [1-3]. With their excellent enantioselectivity, they three recent trends that signi�icantly widen the application of belong to the most important biocatalysts for the synthesis of enzymes. Firstly, the use of lipases in the cosmetic industry will be �ine chemicals. Over the last years, screening efforts for new discussed. Here, especially the mild reaction conditions and the lipases, mostly from bacterial and fungal origin, have provided high selectivity of lipase catalyzed esteri�ications and amidations lipases with interesting properties such as high activity at low are valued. Also, in recent years, improvements in enzyme temperatures [4-6] or with interesting substrate selectivity [7,8] formulation and reactor setup have signi�icantly broadened the for the biocatalytic toolbox. Nevertheless, the vast majority of scope of lipases for the synthesis of cosmetic products. Secondly, applications use only a handful of lipases, due to their commercial combination with chemical reactions has a tremendous potential availability and excellent selectivity, wide substrate spectra and to widen the scope of biocatalytic reactions. An interesting operational stability. Lipases [9] (CAL-A) and B (CAL-B [10]) from example is the lipase-catalyzed enantioselective acylation of the psychrophilic basidiomyceteous yeast Pseudozyma antarctica amines. Here, development of reactions for the sustainable in situ

Page 71 Central

O O R O O O O R' R=C6,C8,C10,C12,C14,C16 R'=Me, Et, Pr, iPr, Bu HO OH myristyl myristate OH (emollient ester) glycoside esters (mild surfactants)

OH R OH O O O O O O R=H, fatty acids from soibean oil C15H31 R OCH3 HO OH O O

6-O-ascorbyl palmitate feroylated glycerides (hydrophobized antioxidant) (UV filters)

O O OH O

retinyl adipate (hydrophilic Vitamin A)

O OH

N OH H OH HN O (2E, 4Z)-Pellitorine (flavor compound) Ceramide III (active ingregient)

Figure 1 Mutated sites of Candida antarctica lipase A described in the review. Representative examples of esters useful for the cosmetic industry, Emollient esters such as myristyl myristate, glycoside esters [16,17], ascorbic acid esters [18,19], feroylated glycerols [20], retinyl adipates [21,22]; (2E, 4Z)-Pellitorine [23] and Ceramide III (N-stearoly sphingosine) [24, 25]. racemization of amines allowed overcoming the intrinsic yield- of enzymes is beneicial especially if multi-functional starting limitation of kinetic resolutions. Thirdly, improved expression materials are used. For example, selective lipase-catalyzed systems paved the way for the optimization of CAL-A and CAL-B esteriication of carbohydrates often leads to only one whereas by directed evolution. This greatly expanded the toolbox of lipase traditional chemical technologies usually yield very complex variants and led to new synthetic applications of CAL-A and product mixtures (comprising various isomers as well as multiple CAL-B. esteriication products). Secondly, enzymatic esteriication reactions generally proceed at much lower temperatures RESULTS AND DISCUSSION (ambient temperature to 80oC) than in ‘chemical’ reactions Lipase-catalysis in the cosmetic industry (usually above 180oC) resulting in far less thermal side reactions. Overall, higher product qualities resulting from higher selectivity Esters represent an important class of products in the and milder reaction conditions enable signiicantly simpliied cosmetic industry. Therefore, it is not astonishing that especially downstream processing of the inal products. this chemical sector has an ongoing interest in lipases as Also the environmental potential of biocatalysts is worth production catalysts. Lipase-derived products are used for emphasizing here. Thum and co-workers from Evonik have diverse applications such as emollients, surfactants, thickeners, performed a comparative life cycle assessment of the industrial UV-ilters and active ingredients. Figure 1 gives a representative scale synthesis of myristyl myristate comparing the traditional overview over the versatility of lipase-derived esters and amides (tin oxalate-catalyzed) esteriication reaction with the newer and their (possible) applications. enzymatic variant [26]. It turned out that the biocatalytic process Compared to ‘standard’ esteriication protocols utilizing is superior in all environmental impact classes considered. Lewis- or Brønsted acids as esteriication catalysts, lipases For example, the greenhouse-gas emission was reduced by 1 offer a range of advantages making them attractive tools for the more than 60% and overall energy savings of more than 60 % cosmetic industry. Firstly, the frequently observed selectivity 1 W104C/L144Y/V149I/V154I/A281C/A282F

Page 72 Central

Scheme 1 The lipase-catalyzed kinetic resolution belongs to the most important industrial routes for the manufacture of chiral amines [43].

Scheme 2 DKR of amino acid amides using Pd-nanoparticles for racemization.

Scheme 3 The dynamic kinetic resolution of amines using CAL-B and ruthenium catalysts produces chiral amines with excellent yields and enantiomeric purity [50].

Scheme 4 Dynamic-kinetic resolution of amines with a racemization procedure using sulfanyl radicals [49]. The possibility to perform the DKR at 38-40°C allows the synthesis of amines that are unstable or undergo side-reactions at higher temperatures.

Page 73 Central were reached. These investigations impressively underline the this reaction [42]. CAL-A shows excellent selectivity to several potential of biocatalysis not only for more economical synthesis amino-functionalized products, including β-amino acid esters but also for more sustainable chemical processes. [45] (Scheme 1). Economic and regulatory constraints in the cosmetic The kinetic resolution produces both enantiomers in high industry largely forbid the use of solvents. Therefore, neat optical purity. In cases where only one enantiomer is required, reaction systems are mandatory for most processes. In case the limitation to 50% maximal yield constitutes a disadvantage of simple emollient esters, this does not represent a major because the non-desired enantiomer must be either discarded or challenge as all reagents are liquid with low viscosity under the recycled by racemization. Recently, several successful examples reaction conditions allowing for simple plugged-low reactor of dynamic-kinetic resolutions showed the usefulness of this setups with immobilized enzymes. However, in case of more strategy to increase the maximal yield of lipase-catalyzed amine viscous reaction mixtures, such simple reactor setups are not synthesis. Generally, the racemization of amines is more dificult feasible due to the high pressures built up. Stirred tank reactors, to achieve than that of secondary alcohols step and requires however, are not always suitable for immobilized enzymes due harsher reaction conditions [46]. While the racemizing catalysts to mechanical erosion of the carrier material leading to enzyme are mostly palladium metals dispersed in porous supports and inactivation and problems in product isolation. Recently, Thum, Shvo’s complex [47], recent studies also propose metal-free Liese and coworkers have demonstrated that such limitations dynamic kinetic resolutions [48,49] (Scheme 2). may easily be addressed by (equally) simple bubble-column technology exerting signiicantly lower mechanical stress on the Already in 1996, the Reetz group presented a irst DKR immobilized enzymes [27,28]. Another possibility to stabilize using Pd on charcoal and CAL-B. The racemization proceeds via immobilized enzymes may be the coating with silicones [29-33]. the reversible deprotonation of a primary or secondary amine Here, the commercial preparation of Novo435 had been illed and reprotonation. Since then, the approach has been much up and covered with silicone yielding a signiicantly increased developed. Incorporation of Pd into nanoparticles provides a mechanical stability. A further beneit of this technology lies in means for the regeneration of the catalyst. the increased leaching stability of the biocatalyst. In Novo435, the Scheme 3 shows the versatility of the DKR using ruthenium lipase is simply absorbed to the carrier material. Hence, under complexes as racemising catalysts. By variation of the phenyl aqueous conditions or in the presence of surface-active reactants substituents of the phenyl ring, Bäckvall. Identiied several Ru- (as frequently the case in cosmetic products) the enzyme can complexes that catalyze amine racemization at 90°C and are thus dissolve in the reaction medium leading to contamination of the compatible with lipase catalysis [50]. The high thermostability products and reduction of the (immobilized) biocatalyst activity. of CAL-B combined with excellent enantioselectivity makes this A silicon layer was demonstrated to eficiently surpress this lipase particularly useful for this reaction. Combining these undesired leaching. catalysts with CAL-B, they achieved the synthesis of acetylated Combination of biocatalytic transformations with amines with high yield and excellent enantiopurity. The chemical reactions – the example of lipase-catalyzed practicability of the approach was further demonstrated in the amine synthesis synthesis of a precursor of the the drug candidate norsertraline, which is currently under investigation for the treatment of The excellent enantioselectivity of lipases made them central nervous system (CNS) disorders. This method generally widely-applied catalysts for ine chemical synthesis. The kinetic requires reaction temperatures well above 80°C. Because resolution of carboxylic acids [34-36], primary [37], secondary CAL-A shows a lower thermostability than CAL-B, Bäckvall. [9,12] and, to some degree, of tertiary alcohols [11,38] are immobilized the lipase on mesocellar foam, which increased the established reactions. However, the intrinsic limitation of 50% stability and the selectivity in the DKR of β-amino acid esters maximal yield makes other methods such as dehydrogenase- [45]. An alternative approach to the stabilization of the enzyme is catalyzed asymmetric synthesis the preferred route. Elegant lowering the reaction temperature, which was achieved by using approaches for the dynamic kinetic resolution of secondary Pd nanocatalysts for racemization. The CAL-catalyzed DKR of [39,40] and also some primary [37] alcohols can overcome the yield limitation. However, their complexity compared to well- β-amino acid esters proceeded smoothly at 50°C with excellent established reductive biotransformation with eficient cofactor yield and enantiopurity (96-99%) [51] (Scheme 4). regeneration systems and the disadvantages associated to the use Despite excellent optical purities and yields of these of transition metal catalysts have prevented their wide industrial examples, regulatory and environmental considerations make it use so far. The hydrolase-catalyzed enantioselective conversion often desirable to avoid metal catalysis. Acid/base catalysis is a of carboxylesters is therefore mainly limited to asymmetric sustainable alternative. Poulhes developed a generally applicable syntheses [41] and to the kinetic resolution of carboxylic acids method for amine racemization at moderate temperatures [49]. [34-36], where alternative reactions are scarce. They used a racemization procedure based on the use of sulfanyl Interestingly, several lipases show excellent enantioselectivity radicals. Irradiation at 350 nm in glassware allowed initiation the also in the acylation of chiral amines [42]. Here, fewer alternative formation of sulfanyl radicals from octanethiol at 38-40°C. While reactions are available. BASF and other companies use lipases to ethyl α-methoxyacetate was incompatible with the racemizing produce a wide diversity of optically pure amines up to multi-ton- conditions, methyl-β-methoxypropionate proved to be an scale [43,44]. Its high stability and excellent selectivity towards a eficient acyl donor, being 11 times faster than ethyl butyrate. In wide range of amines makes CAL-B a widely used biocatalyst for addition, the volatility of methyl-β-methoxypropionate makes

Page 74 Central

Scheme 5 Dynamic-kinetic resolution of cis-vicinal diamines using acid/base catalyed simultaneous racemization of two stereocenters (TBME:tert-butylmethyether) [52]. it easy to remove it from the reaction solution. A limitation of was quite challenging as the dificult expression made high- the radical approach was that the racemization reaction may throughput screens virtually impossible. Recent progress in the not exceed 3-5 h. The reaction control was therefore adapted functional expression of CAL-A and CAL-B in yeast [35,36] and taking into account the reaction time of the kinetic resolution, E. coli [8,54,55] greatly facilitated the cultivation and screening which varied between 2.5 and 24 h. A good solution to this in microtiter plates and thus paved the way for directed problem was to perform an initial KR, then continue with a phase evolution using randomization of genes (i.e. by error-prone PCR) under racemising conditions (DKR) and add another KR. This or combining rational design and randomization of selected combination of different reaction modes worked excellent and sites (i.e. by iterative saturation mutagenesis. Two interesting made the synthesis of several amines with excellent yield and examples regard the increase of the activity of lipases towards enantiopurity possible. The synthetic value of the method was amines and the generation of enzyme variants with improved further demonstrated by the synthesis of thermolabile products stereoselectivity. that would not withstand reaction conditions at 90°C (Scheme 5). Although the hydrolysis of carboxyl esters and carboxyl amides Recently, Rebolledo and co-workers developed a dynamic seems to be rather similar on irst side, the chemoselectivities kinetic resolution of the diastereomeric cis-cyclopentane-1,2- of proteases and carboxyl esterases (including lipases) show diamine, a molecule with two stereocenters. They found that considerable differences. While proteases hydrolyse esters and CAL-B shows excellent enantioselectivity in the catalyzed kinetic amides alike, most esterases and lipases show much reduced activity towards amides or do not convert them at all. Several resolution N-Boc-protected (±)-cis-cyclopentane-1,2-diamine. studies using molecular modeling and protein engineering shed The kinetic resolution of other monocarbamates yielded the some light on the catalytic promiscuity of lipases in amide cleavage. product in high optical purity, whereas the ee of the substrate Cammenberg and co-workers provided a irst explanation when was much lower than it would be expected. This indicated they pointed out the necessity to accommodate the additional a spontaneous racemization. Interestingly, the formation of hydrogen atom of the amide group. They followed the lead that trans-diamine derivatives was not observed. Rebolledo et al methoxyacetate esters (in comparison to butyrates) accelerate attributed the fascinating racemization of two stereocenters to lipase-catalyzed conversion of amines, but not of alcohols [56]. an intramolecular migration of the alkoxycarbonyl protection By molecular modeling of the tetrahedral intermediate formed group. Both triethylamine and acetic acid released from the in the acylation of 1-phenyl ethanol, Cammenberg. identiied an acyl donor can catalyze the migration. The great advantages of interaction a hydrogen bond between the β-oxygen atom and this new DKR lie in the possibility to racemise diastereomeric the nitrogen atom of the amine. This nitrogen atom can invert substrates along with simplicity of the approach. and orient its hydrogen atom in two directions. According to the These examples outline the synthetic value of the combination authors, the hydrogen bond with the β-oxygen atom arrests the of enzymatic reactions with chemical transformations. The hydrogen atom in a productive coniguration. Cammenberg. thus development of metal-free, sustainable racemization reactions directed the attention to the role of the nitrogen atom lone pair in for amines is thus a promising strategy for the development of amide cleavage reactions. enantioselective DKR reactions under the “green chemistry” The role of the nitrogen atom was conirmed when Hiratake. philosophy. increased the amidase activity of a lipase from Pseudomonas aeruginosa by directed evolution [57]. Mutant libraries were Protein engineering for synthetic applications of created by using epPCR with a mutation rate of approximately lipases one amino acid exchange per gene. Three residues were identiied Advances in DNA sequencing and gene synthesis paved whose substitution led to a slightly higher activity towards the way for a tremendous progress in the generation of tailor- amides and retained their activity towards esters. Interestingly, made catalyst variants with improved activity, selectivity and they were located near to a calcium-binding site and rather stability [53]. Until recently, the engineering of fungal lipases distant from the amino acids of the catalytic machinery. This

Page 75 Central

Figure 2 Mutated sites of Candida antarctica lipase B described in the review. Residues of Candida antarctica lipase B with high relevance for catalytic properties identiied by directed evolution experiments: T221 and I301: increased preference towards trans and saturated fatty acids; L225, F233, F431, G237, I150: combined effects leading to increase enantioselectivities towards different esters (more details in Table 1). calcium ion is involved in the structural stabilization of the loop several variants with increased amidase activity, the best variant bearing the catalytic histidine. It was proposed that the mutations I270F/F314Y showing a 7fold increased relative activity. They in the Ca2+-binding site might have an effect on the orientation of explained the effect of this mutant with the stabilization of a loop this histidine and inluence the ability of this residue to abstract/ in the active site by a π-π-interaction. donate protons. The effect of the mutations was therefore Hediger. used a computer-based approach to improve the attributed to an increased leaving group protonation. In a later amidase activity of CAL-B [62,63]. They generated a set of 22 study Hiratake and co-workers identiied a key residue for variants following different rationales including a change of the amidase activity by saturation mutagenesis of all amino acid the binding site properties of the active site, creatin of space for residues at the substrate-binding site of the lipase. Substitution substrate accomodation, the introduction of dipolar interaction of the C-terminal neighbor (orange in Figure 2) of the catalytic and the reduction of polartiy. After careful characterization in histidine increased the relative activity towards amides 28-fold vitro, they performed a computational screening, in which they [58]. The effect of this residue was explained by an inluence identiied 12 improved variants, the highest G39A/T103G/ on the histidine-mediated leaving group protonation. Syrén W104F/L278A having an 11.2-fold increased amidase activity. summarized several different explanations in an excellent review, in which he emphasized the importance of nitrogen The intensive research on the amidase activity of inversion [59]. Several groups attempted to increase the relative carboxylesterases is driven by the high applicability of amidase activity in CAL-B and other hydrolyses. The successes enantioselective amine synthesis. The last years show an and failures of different strategies such as epPCR, iterative impressive progress in the understanding of the molecular basis saturation mutagenesis and rational design give a good overview of amine conversion, and several groups achieved moderate to which extend a catalytic property can be controlled with state- improvements of the enzymatic activity. However, strictly of-the-art protein engineering. rational approaches do not guarantee success, and epPCR is still By assisting the formation of a hydrogen bond, Syrén identiied a viable alternative. The example of the promiscuitive amidase the CAL-B variant L140Q/I189Q with a 5fold increased amidase activity underlines the importance of protein engineering as a activity while the ratio between amidase and esterase activity tool to make lipases it for industrial applications [64]. Further was 50fold increased [60]. While they argued that the increase progress in this exciting area can be expected soon. was lower than expected by an additional H-bond (103), this A particularly interesting case is the engineering of enzymatic nevertheless is the highest increase achieved so far. Bornscheuer. selectivity [65]. An interesting example is the inversion of the used directed evolution to increase the amidase activity of an enantiopreference of the lipase from Burkholderia cepacia by esterase from Bacillus [61]. Variation of residues directly in the Koga. They reasoned that the site of interest in lipases for the active site (and hence possible hydrogen bond acceptors) lead enantioselectivity towards chiral carboxylic acids should be the to a reduction of the relative amidase activity [38]. This shows fatty acid binding tunnel. Consequently, they varied four residues that iterative mutagenesis, though often successful, does not in the tunnel. By using simultaneous saturation mutagenesis, guarantee success. By classical epPCR, they were able to identify they reduced the screening effort by using codons that limited

Page 76 Central the variation to hydrophobic amino acids. After a screening of (ketoprofen ester), after two rounds of mutagenesis, a variant4 more than 10,000 variants, two (R)-selective, highly selective with excellent enantioselectivity, E> 200, was identiied. A larger variants were identiied. This study clearly showed that focused pocket binding site formed by the mutations could be a main directed evolution is a very successful for lipases, and that contribution to the drastic increase of enantioselectivity. particularly the simultaneous variation of several residues allows While CAL-B is one of the most-used biocatalysts CAL-A signiicant modiications of enzyme selectivity. To achieve the has been used to a much lesser degree. However, its unique soluble expression of the lipase, developed a new expression catalytic properties and the recently resolved crystal structure and screening system called single-molecule-PCR-linked in (and thus the possibility to optimize this catalyst by enzyme vitro expression (SIMPLEX) to overcome the dificulties in the engineering) have considerably increased the attention for expression of the lipase. The bottleneck for directed evolution had this interesting biocatalyst [73]. The group around Jan-Erling been the poor expression of most lipases in bacterial expression Bäckvall developed the expression of this lipase in microtiter hosts, which makes directed evolution unpractical. While the plates, which greatly facilitated directed evolution experiments. SIMPLEX approach was very effective, cell-free expression is The crystal structure of CAL-A (pdb-entry 2veo) represents costly and dificult to establish. In the absence of practicable a closed coniguration, which makes molecular modeling and systems for microtiter-plate expression, most researchers relied rational design dificult. This increases the experimental value on rational design of lipases, which requires the screening of a of directed evolution for this lipase. Engström, successfully much lower number of variants (usually <50). created with the CASTing approach a variant with three amino The group of Karl Hult studied intensively the catalytic acid substitutions5 with E values up to 200. They used a series of properties of lipase CAL-A by molecular modeling and protein α–substituted p-nitrophenyl esters as substrates in comparison engineering [66,67]. They successfully predicted a variant with with low enantioselectivity of the wild-type (up to 20) [35]. inverted enantioselectivity. The substitution of a large tryptophan Moreover, one variant displayed an inverted enantiopreference in the active site by alanine created space for the phenyl substituent (R-selective) compared with the S-selective wild-type. Two of the slower reacting (S)-phenylethanols, which subsequently libraries, FI (F149 and I150) in the binding region of the α-methyl was converted faster than the (R)-enantiomer. Variant W104A group of the substrate, and FG (F233 and G237) in the acyl pocket displayed (S)-selectivity toward a variety of alcohols [68]. Very were subjected to mutagenesis based on molecular modelling recently, the group of Bäckvall applied the new mutant W104A analysis and knowledge from previous studies. The rational for the dynamic kinetic resolution (DKR) of (S) 1-phenylheptanol explanation of the change in stereoselectivity of the variant is and later for the resolution of diarylmethanols. Excellent yield the modiied active site with an enlarged binding pocket favoring (84%) and enantioselectivity (96.5%) were obtained with the the R-enantiomers of substrates with large aryl side chains. DKR of 1-phenylheptanol under optimized reaction conditions Sandström. Improved the enantioselectivity of CAL-A toward a [69]. This example clearly underlines the value of protein sterically demanding substrate 2-(4-isobutylphenyl) propanoate engineering for the creation of synthetically successful catalysts. ester with an E-value of 100 [36]. The potential residues were Wu. have applied the iterative CASTing approach (CAST = chosen based on the analysis of docking experiments of the combinatorial active-site saturation test) to greatly improve substrate in the active site of CAL-A. Interestingly, they increased the enantioselectivity of CAL-B toward p-nitrophenyl the number of simultaneously varied residues to nine and 2-phenylpropanoate (from 1.2 to 72) for the (S)-enantiomer reduced the variability at the individual positions. While the and even invert the enatiopreference of the enzyme with E = wild-type enzyme showed a modest E-value of 5.1 towards the 42 (R) [71]. Combining structural knowledge on CAL-B and the model substrate, the best obtained enzyme variants had E-values substrate binding modes, the group focused on the residues in of 52 (S) and 27 (R), proving the success of this very consequent the active site region (W104, S105, A281, A282, L144, V149, approach. I189, V190, V154, Q157) as the starting point for the saturation mutagenesis. After several rounds of mutagenesis towards Nine residues in the binding region were chosen and two directions, two variants have been identiied, (R)-selective subjected to saturation mutagenesis. Directed evolution  2 3 mutant RG401 and (S)-selective mutant SG301 . The increase generated two variants, SV1CV2 and SV1CAV2 , with signiicant of enantioselectivity was explained by the combinatorial effects increases in enantioselectivity with E values of 53 and 100, of a newly formed hydrogen bond between C190 and A132 respectively. Further single point mutagenesis to verify the together with an enlargement of binding pocket created by I189V contribution of each mutation in the variants for the increased mutation in SG301. For the variant RG401, a larger active site was enantioselectivity showed that the two substitutions T221S and accounted for the better binding of the (R)-enantiomer in which L225V were essential for the changes of enantioselectivities. the mutation of the residue W104 also played an important role The effect appeared to stem from a wider space in the binding as observed in other studies. pocket of the variants in which a bulky substrate could be more easily accommodated in the active site leading to higher You et al. achieved a signiicant increase in enantioselectivity enantioselectivity. In directed evolution, practical considerations of CAL-B towards profen esters, using the semi-rational CASTing approach [72]. From a very poor activity of wild-type often limit the possible library-size to a few thousand variants. CAL-B towards 4-nitrophenyl 2-(3-benzoylphenyl)propanoate 4 F233Y/I150G/F233G 2 L144Q/I189V/V190C/A281G/A282V 5 SV1CV2 :T221S/L225V/F233S/F431V and SV1CAV2:T221S/L225V/F233S/ 3 I189F/V190L/V154G/Q157S F431V/G237A

Page 77 Central

Figure 3 Residues of Candida antarctica lipase B with high relevance for catalytic properties. W104: Enantioselecitivty, substrate spectrum; L144, V149, V154, A281, A282, I189, V190, Q157: combined effects leading to increased enantioselectivities towards different secondary alcohols and profen esters (more details in Table 1).

Table 1: Overview on different approaches for the engineering of CAL-A and CAL-B. Original Variants Approach Changes in properties Reference enzymes Candida Inverted and improved W104A antarctica lipase Rational design enantioselectivity towards variety of Vallin [68] B (CAL-B) secondary alcohols Candida New activity with excellent W104A antarctica lipase Rational design enantioselectivity towards (S)-1- Engström [70] B (CAL-B) phenylheptanol and diarylmethanols W104C/L144Y/V149I/ V154I/A281C/A282F ((R)-selective) Candida Access to both enantiomers of antarctica lipase Iterative CASTing p-nitrophenyl 2-phenylpropanoate with Wu [71] L144Q/I189V/V190C/ A281G/A282V ((S)- B (CAL-B) good enantioselectivities selective) Candida Excellent enantioselectivity toward Semi-rational I189F/V190L/V154G/Q157S antarctica lipase 4-nitrophenyl 2-(3-benzoylphenyl) Qin [72] CASTing B (CAL-B) propanoate Molecular T221S/L225V/F233S/F431V Candida modelling-oriented Increased enantioselectivity toward antarctica lipase Sandström [36] saturation 2-(4-isobutylphenyl)propanoate ester T221S/L225V/F233S /F431V/G237A A (CAL-A) mutagenesis Candida Increased and inverted CASTing in the F233Y/I150G/F233G antarctica lipase enantioselectivity towards α– Engström [35] active site region A (CAL-A) substituted p-nitrophenyl esters T221H Candida Engineering of Increased preference toward trans and antarctica lipase Brundiek [8] binding tunnel saturated fatty acids I301H A (CAL-A)

In these cases, iterative saturation mutagenesis is an eficient of positions can achieve very striking effects. More of this very strategy to increase the quality of libraries [74]. However, not promising approach can be expected soon (Figure 3). more than 3-4 residues can be varied simultaneously with good coverage. This is a dilemma, because synergistic effets can only The early study of Koga already indicated the importance of been achieved by simultaneous substitution of several amino the fatty acid binding tunnel as a determinant of lipase selectivity acids [75]. The example from Sandström et al. demonstrates towards the acyl moiety of esters. Recently, Brundiek. have that consequent reduction of variety at individual positions (to succeeded in engineering the binding tunnel of lipase A from 1-3 amino acids) and simultaneous variation of a large number Candida antarctica (CAL-A) to increase the speciicity towards

Page 78 Central trans fatty acids (TFA), which have been shown to involve in novel biocatalysts from metagenomes. J Mol Microbiol Biotechnol. heart-related diseases [8]. Aim was the development of a catalyst 2009; 16: 25-37. for the selective removal of trans-fatty acids from hardened fats. 7. Bertram M, Hildebrandt P, Weiner DP, Patel JS, Bartnek F, Hitchman Variation of several residues in the fatty acid binding tunnel and TS, et al. Characterization of lipases and esterases from metagenomes screening with the para-nitrophenol esters of oleic acid (cis) for lipid modiication. J Am Oil Chem Soc. 2008; 85: 47-53. and elaidic acid (trans) led to the identiication of two variants 8. Brundiek HB, Evitt AS, Kourist R, Bornscheuer UT. Creation of a lipase with a strong preference towards trans. T221H and I301H had highly selective for trans fatty acids by protein engineering. Angew also a high selectivity for trans in the hydrolysis of partially Chem Int Ed Engl. 2012; 51: 412-414. hydrogenated soybean oil. The work proved the possibility of 9. Dominguez de Maria P, Carboni-Oerlemans C, Tuin B, Bargeman G, van selective removal of trans-fatty acids and thus underlines the der Meer A, van Gemert R. Biotechnological applications of Candida usefulness of protein engineering for the creation of synthetically antarctica lipase A: State-of-the-art. J Mol Catal B: Enzym. 2005; 37: useful catalysts. 36-46. CONCLUSION 10. Lutz S. Engineering lipase B from Candida antarctica. Tetrahedron: Asymmetry. 2004; 15: 2743-2748. Lipases belong to the most important industrial biocatalysts with a plethora of applications. The synthetic usefulness can be 11. Kourist R, Bornscheuer UT. Biocatalytic synthesis of optically active tertiary alcohols. Appl Microbiol Biotechnol. 2011; 91: 505-517. substantially increased by the integration of reaction engineering and chemical engineering. Methods for the increase of lipase 12. Magnusson AO, Takwa M, Hamberg A, Hult K. An S-selective lipase was stability and reactor design facilitated the application for the created by rational redesign and the enantioselectivity increased with environmentally-friendly solvent-free synthesis of cosmetics. In temperature. Angew Chem Int Ed Engl. 2005; 44: 4582-4585. the enantioselective synthesis of amines, sustainable methods for 13. Chen B, Hu J, Miller EM, Xie W, Cai M, Gross RA. Candida antarctica the in situ racemization of amines allowed the development of lipase B chemically immobilized on epoxy-activated micro- and metal-free dynamic-kinetic resolution processes, while protein nanobeads: catalysts for polyester synthesis. Biomacromolecules. engineering succeeded in the generation of lipases with increased 2008; 9: 463-471. activity towards amines. Both methods are therefore highly 14. Stefan L. Engineering lipase B from Candida antarctica. Tetrahedron: useful to increase yield and catalyst productivity, two important Asymmetry. 2004; 15. parameters for the sustainability of a reaction. Finally, protein engineering is a mature and successful method for the generation 15. Jochens H, Hesseler M, Stiba K, Padhi SK, Kazlauskas RJ, Bornscheuer of tailor-made lipase variants. Traditionally, application of this UT,. Protein engineering of Î±/Î²-hydrolase fold enzymes. Chembiochem. 2011; 12: 1508-1517. approach was hampered by dificulties in the microtiter-plate expression of lipases. Progress in lipase expression in P. pastoris 16. Adelhorst K, Bjorkling F, Godtfredsen SE, Kirk O. Enzyme catalyzed and E. coli greatly facilitated the directed evolution of lipases. preparation of 6-o-acylglucopyranosides. Synthesis. 1990: 112-115. Recent examples such as the increase in amidase activity and the 17. Bjorkling F, Godtfredsen SE, Kirk O. A highly selective enzyme- generation of variants with improved enantioselectivity and cis/ catalyzed esteriication of simple glucosides. J Chem Soc, Chem trans-selectivity show the value of protein engineering of lipases Commun. 1989: 934-935. for commercial applications. 18. Karmee SK. Biocatalytic synthesis of ascorbyl esters and their ACKNOWLEDGEMENT biotechnological applications. Appl Microbiol Biotechnol. 2009; 81: 1013-1022. R.K. is grateful to the Mercator foundation (Mercur Research 19. Song Q, Zhao Y, Xu W, Zhou W, Wei D. Enzymatic synthesis of L-ascorbyl centre grant Nr. Pr-2013-0010) for inancial support. linoleate in organic media. Bioprocess Biosyst Eng. 2006; 28: 211-215. REFERENCES 20. Laszlo JA, Compton DL, Eller FJ, Taylor SL, Isbell TA. Packed-bed bioreactor synthesis of feruloylated monoacyl- and diacylglycerols: 1. Houde A, Kademi A, Leblanc D. Lipases and their industrial Clean production of a “green” sunscreen. Green Chem. 2003; 5: 382- applications: an overview. Appl Biochem Biotechnol. 2004; 118: 155- 386. 170. 21. Maugard T, Rejasse B, Legoy MD. Synthesis of water-soluble retinol 2. Reetz MT. Lipases as practical biocatalysts. Curr Opin Chem Biol. derivatives by enzymatic method. Biotechnol Prog. 2002; 18: 424-428. 2002; 6: 145-150. 22. Rejasse B, Maugard T, Legoy MD. Enzymatic procedures for the synthesis of water-soluble retinol derivatives in organic media. 3. Jaeger KE, Eggert T. Lipases for biotechnology. Curr Opin Biotechnol. Enzyme Microb Technol. 2003; 32: 312-320. 2002; 13: 390-397. 23. Ley JP, Hilmer JM, Weber B, Krammer G, Gatield IL, Bertram HJ. 4. Elend C, Schmeisser C, Hoebenreich H, Steele HL, Streit WR. Isolation Stereoselective enzymatic synthesis of cis-pellitorine, a taste active and characterization of a metagenome-derived and cold-active lipase alkamide naturally occurring in tarragon. Eur J Org Chem. 2004; 5135- with high stereospeciicity for (R)-ibuprofen esters. J Biotechnol. 5140. 2007; 130: 370-377. 24. Hollmann F, Grzebyk P, Thum O, Toelle C, inventors; Evonik Goldschmidt 5. Kourist R, Brundiek H, Bornscheuer U. Protein engineering and Gmbh (Evon), assignee. Preparing sphingolipid compounds, useful e.G. In cosmetic or pharmaceutical formulation, comprises discovery of lipases. Eur J Lipid Sci Technol. 2010; 112: 64-67. reacting lysosphingolipid compounds with carboxylic acid ester 6. Steele HL, Jaeger KE, Daniel R, Streit WR. Advances in recovery of compounds in the presence of a biocatalyst comprising carboxylester-

Page 79 Central

hydrolase patent DE102008002410-A1; WO2009150023-A2. 2010 Bornscheuer UT. Isoenzymes of pig-liver esterase reveal striking DE102008002410-A1 17 Dec 2009 C12P-013/02 201001. differences in enantioselectivities. Angew Chem Int Ed Engl. 2007; 46: 8492-8494. 25. Hollmann F, Korevaar CGN, Provinzano A, Thum O, Toelle C, inventors; Evonik Goldschmidt Gmbh (Evon), assignee. Biocatalytic preparation 42. Gotor-Fernández V, Busto E, Gotor V. Candida antarctica lipase B: of sphingolipid compound, useful in e.G. Dermatological formulation, An ideal biocatalyst for the preparation of nitrogenated organic comprises reacting lysosphingolipid compound with carboxylic compounds. Adv Synth Catal. 2006; 348: 797-812. acid ester compound using biocatalyst comprising carboxylester- 43. Ditrich K. Optically active amines by enzyme-catalyzed kinetic hydrolase patent DE102008002409-A1; WO2009150022-A2. 2010 resolution. Synthesis. 2008; 2008: 2283-2287. DE102008002409-A1 17 Dec 2009 C12P-013/02 201001. 44. Breuer M, Ditrich K, Habicher T, Hauer B, Kesseler M, Stürmer 26. Thum O, Oxenbøll KM. Biocatalysis: A sustainable process for R, et al. Industrial methods for the production of optically active production of cosmetic ingredients. IFSCC Congress 2006; Osaka, intermediates. Angew Chem Int Ed Engl. 2004; 43: 788-824. Japan 2006. 45. Shakeri M, Engström K, Sandström AG, Bäckvall J-E. Highly 27. Liese A, Hilterhaus L. Evaluation of immobilized enzymes for industrial enantioselective resolution of ß-amino esters by Candida antarctica applications. Chem Soc Rev. 2013; 42: 6236-6249. lipase A immobilized in mesocellular foam: Application to dynamic 28. Hilterhaus L, Thum O, Liese A. Reactor concept for lipase-catalyzed kinetic resolution. ChemCatChem. 2010; 2: 534-538. solvent-free conversion of highly viscous reactants forming two- 46. Ahn Y, Ko SB, Kim MJ, Park J. Racemization catalysts for the dynamic phase systems. Org Process Res Dev. 2008; 12: 618-625. kinetic resolution of alcohols and amines. Coord Chem Rev. 2008; 252: 29. Scholz A, Eckstein M, Ansorge-Schumacher MB. Hydrophilized silicone 647-658. matrix for the preparation of stable carbonyl reductase immobilizates. 47. Reetz MT, Schimossek K. Lipase-catalyzed dynamic kinetic resolution ChemCatChem. 2013; 5: 815-821. of chiral amines: Use of palladium as the racemization catalyst. Chimia. 30. Ansorge-Schumacher MB, Thum O. Immobilised lipases in the 1996; 50: 668-669. cosmetics industry. Chem Soc Rev. 2013; 42: 6475-6490. 48. Poulhes F, Mouysset D, Gil G, Bertrand MP, Gastaldi S. Speeding-up 31. Bhattacharya S, Drews A, Lyagin E, Kraume M. Ansorge-Schumacher enzyme-catalyzed synthesis of polyamides using omega-amino-alpha- MB. Eficient Chemo-Enzymatic Epoxidation Using silcoat-Novozym alkoxy-acetate as monomer. Polymer. 2013; 54: 3467-3471. (R) 435: Characterizing the Multiphase System. Chem Eng Technol. 2012; 35: 1448-1455. 49. Poulhès F, Vanthuyne N, Bertrand MP, Gastaldi S, Gil G. Chemoenzymatic dynamic kinetic resolution of primary amines catalyzed by CAL-B at 32. Nieguth R, Eckstein M, Wiemann LO, Thum O, Ansorge-Schumacher 38-40 °C. J Org Chem. 2011; 76: 7281-7286. MB. Ansorge-Schumacher MB. Enabling industrial biocatalytic processes by application of silicone-coated enzyme preparations. Adv. 50. Thalén LK, Zhao D, Sortais JB, Paetzold J, Hoben C, Bäckvall JE,. Synth. Catal. 2011; 353: 2522–2528. A chemoenzymatic approach to enantiomerically pure amines using dynamic kinetic resolution: application to the synthesis of 33. Wiemann LO, Nieguth R, Eckstein M, Naumann M, Thum O, Ansorge- norsertraline. Chemistry. 2009; 15: 3403-3410. Schumacher MB. Composite Particles of Novozyme 435 and Silicone: 51. Engström K, Shakeri M, Bäckvall JE. Dynamic kinetic resolution of Advancing Technical Applicability of Macroporous Enzyme Carriers. ß-amino esters by a heterogeneous system of a palladium nanocatalyst ChemCatChem. 2009; 1: 455-462. and Candida antarctica lipase A. Eur J Org Chem. 2011; 2011: 1827- 34. Kourist R, Domínguez de María P, Miyamoto K. Biocatalytic strategies 1830. for the asymmetric synthesis of profens – recent trends and 52. Quijada FJ, González-Sabín J, Rebolledo F, Gotor V. An eficient developments. Green Chem. 2011; 11: 2607-2618. chemoenzymatic method to prepare optically active primary-tertiary 35. Engström K, Nyhlén J, Sandström AG, Bäckvall JE. Directed evolution trans-cycloalkane-,2-diamines. Tetrahedron. 2009; 65: 8028-8034. of an enantioselective lipase with broad substrate scope for hydrolysis 53. Bornscheuer UT, Huisman GW, Kazlauskas RJ, Lutz S, Moore JC, Robins of alpha-substituted esters. J Am Chem Soc. 2010; 132: 7038-7042. K. Engineering the third wave of biocatalysis. Nature. 2012; 485: 185- 36. Sandström AG, Wikmark Y, Engström K, Nyhlén J, Bäckvall JE. 194. Combinatorial reshaping of the Candida antarctica lipase A substrate 54. Pfeffer J, Rusnak M, Hansen CE, Rhlid RB, Schmid RD, Maurer pocket for enantioselectivity using an extremely condensed library. SC. Functional expression of lipase A from Candida antarctica in Proc Natl Acad Sci U S A. 2012; 109: 78-83. Escherichia coli - A prerequisite for high-throughput screening and 37. Strübing D, Krumlinde P, Piera J, Bäckvall JE. Dynamic kinetic directed evolution. J Mol Catal B: Enzym. 2007; 45: 62-67. resolution of primary alcohols with an unfunctionalized stereogenic 55. Liu D, Schmid RD, Rusnak M. Functional expression of Candida center in the beta-position. Adv Synth Catal. 2007; 349: 1577-1581. antarctica lipase B in the Escherichia coli cytoplasm--a screening 38. Kourist R, Bartsch S, Fransson L, Hult K, Bornscheuer UT. system for a frequently used biocatalyst. Appl Microbiol Biotechnol. Understanding promiscuous amidase activity of an esterase from 2006; 72: 1024-1032. Bacillus subtilis. Chembiochem. 2008; 9: 67-69. 56. Cammenberg M, Hult K, Park S. Molecular basis for the enhanced lipase- 39. Martín-Matute B, Bäckvall JE. Dynamic kinetic resolution catalyzed by catalyzed N-acylation of 1-phenylethanamine with methoxyacetate. enzymes and metals. Curr Opin Chem Biol. 2007; 11: 226-232. Chembiochem. 2006; 7: 1745-1749. 40. Martín-Matute B, Edin M, Bogár K, Bäckvall JE. Highly compatible 57. Fujii R, Nakagawa Y, Hiratake J, Sogabe A, Sakata K. Directed evolution metal and enzyme catalysts for eficient dynamic kinetic resolution of of Pseudomonas aeruginosa lipase for improved amide-hydrolyzing alcohols at ambient temperature. Angew Chem Int Ed Engl. 2004; 43: activity. Protein Eng Des Sel. 2005; 18: 93-101. 6535-6539. 58. Nakagawa Y, Hasegawa A, Hiratake J, Sakata K. Engineering of 41. Hummel A, Brüsehaber E, Böttcher D, Trauthwein H, Doderer K, Pseudomonas aeruginosa lipase by directed evolution for enhanced

Page 80 Central

amidase activity: mechanistic implication for amide hydrolysis by lipase B: a molecular dynamics study. Protein Sci. 2001; 10: 329-338. serine hydrolases. Prot Eng Des Sel. 2007; 20: 339-346. 68. Vallin M, Syrén PO, Hult K. Mutant lipase-catalyzed kinetic resolution 59. Syrén PO. The solution of nitrogen inversion in amidases. FEBS J. of bulky phenyl alkyl sec-alcohols: a thermodynamic analysis of 2013; 280: 3069-3083. enantioselectivity. Chembiochem. 2010; 11: 411-416. 60. Syrén PO, Hendil-Forssell P, Aumailley L, Besenmatter W, Gounine F, 69. Engström K, Vallin M, Syrén PO, Hult K, Bäckvall JE. Mutated variant of Svendsen A, et al. Esterases with an introduced amidase-like hydrogen Candida antarctica lipase B in (S)-selective dynamic kinetic resolution bond in the transition state have increased amidase speciicity. of secondary alcohols. Org Biomol Chem. 2011; 9: 81-82. Chembiochem. 2012; 13: 645-648. 70. Engström K, Vallin M, Hult K, Bäckvall JE. Kinetic resolution of 61. Hackenschmidt S, Moldenhauer EJ, Behrens GA, Gand M, Pavlidis diarylmethanols using a mutated variant of lipase CALB. Tetrahedron. IV, Bornscheuer UT. Enhancement of promiscuous amidase activity 2012; 68: 7613-7618. of a Bacillus subtilis esterase by formation of a p–p network. 71. Wu Q, Soni P, Reetz MT. Laboratory evolution of enantiocomplementary ChemCatChem. 2013. Candida antarctica lipase B mutants with broad substrate scope. J Am 62. Hediger MR, De Vico L, Rannes JB, Jäckel C, Besenmatter W, Svendsen A, Chem Soc. 2013; 135: 1872-1881. et al. In silico screening of 393 mutants facilitates enzyme engineering 72. Qin B, Liang P, Jia X, Zhang X, Mu M, Wang X-Y, et al. Directed evolution of amidase activity in CalB. PeerJ. 2013; 1: e145. of Candida antarctica lipase B for kinetic resolution of profen esters. 63. Suplatov DA, Besenmatter W, Svedas VK, Svendsen A. Bioinformatic Catal Commun. 2013; 38: 1-5. analysis of Î±/Î²-hydrolase fold enzymes reveals subfamily-speciic 73. Widmann M, Juhl PB, Pleiss J. Structural classiication by the Lipase positions responsible for discrimination of amidase and lipase Engineering Database: a case study of Candida antarctica lipase A. activities. Protein Eng Des Sel. 2012; 25: 689-697. BMC Genomics. 2010; 11: 123. 64. Fariha H, Aamer Ali S, Abdul H. Industrial applications of microbial 74. Reetz MT, Prasad S, Carballeira JD, Gumulya Y, Bocola M. Iterative lipases. Enzyme Microb Technol. 2006; 39: 235-251. saturation mutagenesis accelerates laboratory evolution of enzyme 65. Robert K, Henrike B, Uwe TB. Protein engineering and discovery of stereoselectivity: rigorous comparison with traditional methods. J Am lipases. Eur J Lipid Sci Technol. 2010; 112: 64-67. Chem Soc. 2010; 132: 9144-9152. 66. Ottosson J, Fransson L, Hult K. Substrate entropy in enzyme 75. Bartsch S, Kourist R, Bornscheuer UT. Complete inversion of enantioselectivity: an experimental and molecular modeling study of enantioselectivity towards acetylated tertiary alcohols by a double a lipase. Protein Sci. 2002; 11: 1462-1471. mutant of a Bacillus subtilis esterase. Angew Chem Int Ed Engl. 2008; 47: 1508-1511. 67. Raza S, Fransson L, Hult K. Enantioselectivity in Candida antarctica

Cite this article Kourist R, Hollmann F, Nguyen GS (2014) Lipases as Sustainable Biocatalysts for the Sustainable Industrial Production of Fine Chemicals and Cosmetics. JSM Biotechnol Bioeng 2(1): 1029.

Page 81 Review Article *Corresponding author Dr. Tanja Kurzrock, 2mag AG, Schragenhofstrasse 35 I-K, 80992 Muenchen, Germany, Tel: 4989381531120; Downscale Upscale - Elasticity Fax: 498941334369; Email: Submitted: 17 April 2014 of Scales-An Approach to Accepted: 12 May 2014 Published: 14 May 2014 ISSN: 2333-7117 Forecast Future Requirements Copyright © 2014 Kurzrock et al. in Biotechnology OPEN ACCESS

Kurzrock, T.* and Kress, K. Keywords 2mag, Munich, Germany • Parallelization • Miniaturization Abstract • Minifermenter • Bioreactor Imagine a future world with a signifi cantly grown infl uence of biotechnology into • Screening all parts of society. Let us assume that the majority of products in a consumer’s world, including food & beverage, furniture and clothes, plastics, buildings, streets and fuel are produced with the help of modern biotechnology. Meaning that at least parts of fi nished products are produced in an industrial environment with outcome from a biotechnological procedure. There might be many reasons for a biotechnological revolution like exhaustible raw materials, minimizing ecological pollution, the consumer’s political will or just quality improvements. Whatever the fi nal drivers are, a transformation like this will open new fi elds in laboratory work and create new requirements for laboratory devices. Without predicting the future world in details, it will be essential that biotechnological production processes are competitive to industrial productions. Main industrial challenges are 1st optimal economic parameter defi nitions in laboratory scale, 2nd a quick and reliable scale-up to minimize time to market and 3rd a maximal yield assurance in production. To overcome all these requirements for a successful biotechnological process development, a highly effi cient screening tool, as the 2mag bioREACTOR, is urgently needed.

INTRODUCTION cost-effective raw materials, the most eficient production strain which is able to metabolize different sugars with high yields, the The industrial landscape is no longer imaginable without optimal process parameters to reach high production rates and to biotechnological processes (Figure 1). Whether at the creation ensure the reconditioning of the product out of the fermentation of new transgene plants e.g. resistant corn (green biotechnology) broth [7]. [1] for the food and feed industry, the development of new drugs in the pharmaceutical industry (red biotechnology) [2,3], Identiication of the most eficient production strain and development of such new biotechnological processes is time the use of aquatic resources e.g. deep sea bacteria or other and cost intensive, due to the high amount and combination marine organisms (blue biotechnology) [4], the protection of possibilities of parameters. As a result, mass screening for the the environment (brown biotechnology) or the waste industry identiication of optimal parameters and therewith an eficient (bacteria for treatment of waste water, grey biotechnology), screening tool is urgently needed for biotechnological process biotechnological processes displace more and more the classical development to have a shorter time to market and therewith to processes or bring off some new production methods for become competitive to already existing petrol based production dificultly accessible substances. processes [8]. Also in other classical industrial branches, as the production Requirements of minibioreactors/minibioreactor of washing or cleaning agents, cosmetics or plastics (white systems biotechnology) [5], biotechnological production methods Minibioreactors and minibioreactor systems have to are already permanent features, because they are more fulill some requirements to be useful screening tools for environmentally friendly and more resource saving than biotechnological processes: These systems should be highly comparable industrial chemical processes. parallelized to generate a lot of data with only one run. In many of the industrial sectors relying on petroleum based Moreover the working volume of the reactors/reaction resources, such as the chemical industry, biotechnology is still in vessels has to be in a useful range: as small as possible to minimize its infancy. It is suggested that fossil oil and gas reserves will run costs for media components, antibiotic or inducing agents but dry in the next decades resulting in price luctuations for fossil big enough to allow multiple taking of samples for other more resources, which urgently calls for alternative action [6]. detailed characterizing experiments. To develop a competitive biotechnological production, some Parameters like pH, dissolved oxygen, and temperature critical points have to be addressed: the selection of the most should be precisely adjustable to represent a real fermentation

Page 82 Central

On-line measurement of respiration activities (oxygen transfer rate, carbon dioxide transfer rate and respiratory quotient) is possible by using special devices (RAMO S-Respiratory Activity Monitoring System) but this is rarely applied [12]. Temperature can be adjusted easily by using incubators. pH is mostly kept in an acceptable range due to use of buffers. Only a few systems allow pH control in shake lasks [17,18]. Altogether shake lasks are easy systems for basic studies of microorganisms and eukaryotic cells but they are not easy to control or automate. Minibioreactor systems based on microtiter plates (Applicon Biotechnology, m2p-labs GmbH, Pall GmbH) rely on a strong minimization (a few μl up to a few ml) and a very high parallelization of up to 96. The high parallelization is an optimal way to obtain much data with only one run. Due to their simple construction, these systems are easy to handle and therewith cost and time saving, as well as space saving. Moreover automation with laboratory robots (e.g. the BioLector, m2p-labs GmbH) is easily possible, which allows the realization of feeding processes and pH control [9]. A disadvantage is the small working volume which allows only a very small number of samples. Usually only an end-point measurement is realized Figure 1 Fields of Biotechnology. [19]. Moreover, stopping of the shaking is needed for taking samples, which disturbs the respiration proile. Last but not least, process in laboratory fermenters and should be monitored over control of pH, dissolved oxygen or oxygen transfer rate is dificult the whole run. Therefore precise measuring methods must [12] and the oxygen capacity is lower than in stirred miniature be implemented for the small volumes and concentrations in bioreactors [20]. minibioreactors. Stirred minibioreactors systems Moreover the microbial metabolism, growth and production Sequential mass screening can be realized with classical kinetics drastically change depending on the cultivation strategy. laboratory fermenters (e.g. Infors AG, Switzerland) or with This demonstrates the importance of an automated feeding (with parallelized stirred tank reactor systems in 60-250 milliliter scale glucose or another carbon source) and titration of acid or base (e.g. DASbox, DASGIP, Germany) which are based on multiple for pH control to realize meaningful screening experiments also reactors (usually 4, parallelization up to 24 is possible by using in parallelized minibioreactors [9,10]. more units). Another signiicant requirement is, that new identiied or optimized production processes developed with minibioreactors The identical geometry and function of these reactors should be easily scaled up into laboratory scale stirred tank compared to industrial scale fermenters allow an easy down- and reactors [11]. up-scaling of production processes. pH, temperature and dissolved oxygen can be controlled and therewith stirred minibioreactors Minibioreactors combine all of these prerequisites and can offer the lexibility and controllability of conventional bench- therefore have the potential to become the analytical time and scale reactors [19]. The higher working volume enables multiple cost saving screening tool for the identiication of robust strains sampling and therewith a good characterization of the cultivation and process conditions. process. Meanwhile, there are some approaches to achieve a highly A disadvantage is that not all of these systems can be used parallelized and miniaturized work low with minibioreactors or fully automated with pipetting robots. Moreover they have a minibioreactor systems. higher space and material demand compared to microtiter plate COMPARISON OF MINIBIOREACTORS/MINIBIO systems and parallelization is limited due to the more complex REACTOR SYSTEMS setup (cables, tubes, peripheral units). As summarized from Kumar et al. 2003 [12], three types of There is only one stirred minibioreactor system, which minibioreactors for microbial cultivations can be differentiated: allows a simple and detailed miniaturization of biotechnological shaken bioreactors, stirred systems and other special devices. production processes into the milliliter scale and a high Shaken minibioreactors parallelization at the same time – the 2mag bioREACTOR 48 (see Figure 2). This minibioreactor system is the modern and simple Shake lasks [13-16] are very easy to handle and have a low answer to the existing demand for a screening tool for eficient price, which makes them an often used tool in all ields of basic biotechnological process development. biotechnological fermentation studies with bacteria, yeast, fungi, animal, insect or plant cells. The bioREACTOR 48 is a space-saving and user-friendly

Page 83 Central

based microreactors [29] or bubble-column minibioreactors [30]. Their construction is simple but the mass transfer is limited -1 to KLa-values up to 0.15 s due to the restricted power input. Advantages of minibioreactors/minibioreactors systems Minibioreactors allow mass screening experiments for the development of new biotechnological production processes or the optimization of already known production processes. Due to their high parallelization and miniaturization, they are cost, material and time saving and can reduce time to market. This allows the fast and economic development of new biotechnological processes as the production of 2-hydroxyisbutyric acid as Figure 2 2mag bioREACTOR 48 – 1) gassing unit for aeration precursor of polymethyl methylacrylate (Plexiglas®) [5] or the 2) stirring elements for mixing of medium and oxygen input 3) production and esteriication of biosuccinic acid as building cooling unit for minimization of evaporation effects 4) block unit for temperature control and inductive drive for stirring elements 5) block chemical for chemical, pharmaceutical, food and cosmetic single-use reaction vessels with pH and DO spots. industry branches [31]. Moreover the optimization of already known biotechnological fermentation system with 48 miniaturized reaction vessels, which production processes leads to more eficient and therewith is especially designed for the scaling down of biotechnological also more competitive processes compared to the fossil based processes (aerobic and anaerobic) [21,22]. High material and productions, as shown on a ribolavin production process with cost savings in process development can be achieved due to the Bacillus subtilis [28]. miniaturization (8-15 ml). Minibioreactors are time and cost saving analytical screening Experiments in the miniaturized reaction vessels can displace tools for the identiication of robust strains and process approaches in shake lasks and microtiter plates due to the high conditions and provide the possibility to evaluate how a process parallelization of up to 48 units. Moreover, the bioREACTOR will behave in the inal laboratory and production scale [32]. generates more detailed experimental data comparable to Moreover, there is a second point regarding the behavior laboratory stirred tank reactors especially due to the non-invasive of biotechnological production processes. Biotechnological pH and dissolved oxygen measurement at all 48 positions via processes are always subject to natural variances, because special sensor systems from PreSens GmbH, Germany. the basis is a living microorganism which reacts sensitively on any inluence, e.g. small variations in the raw material or other pH can be measured in a range from 6.0 to 8.0 with a maximal process parameters. To avoid the loss of a whole batch, it is standard deviation of pH 0.2 and with a complex medium at also important to have a precise process monitoring. With a pH values around the threshold of the measurement. Lower miniaturized parallel fermentation system, as the bioREACTOR, deviations of maximal pH 0.1 are standard for pH 7.0 and a it is possible to model the production process in a small approach deined medium. Standard deviation of dissolved oxygen is about and therefore quicker response time. Unwanted inluences can 5% air saturation independent of the medium components [23]. be shown earlier than in the parallel mass production and quality The power input is comparable to conventional stirred can be assured. This allows a greater range for correcting the real -1 process or for stopping it in an early stage to reduce the costs and tank reactors and also analogous KLa-values up to 0.3 s can be achieved [17]. Based on different production processes, e.g. maximize the yield. cultivation of mycelium forming Streptomyces tendae or parallel CONCLUSION studies of enzymatic biomass hydrolysis, the reliable scale-up of experimental data from the bioREACTOR into the liter-scale Comparing the different types of minibioreactors, microtiter could be demonstrated [24-26]. plate based systems are the screening systems of choice to overcome the huge amount of parameters of biotechnological Moreover, the bioREACTOR can be used as stand-alone unit strain (wild-types and molecular developed new strains) and for batch-processes or fully integrable into pipetting robots media optimization. An intense parallelization of up to 96 [21,27]. This automation allows pH control, taking samples, or positions and automation is feasible. However, due to the small realization of fed-batch processes. working volume and the limited oxygen transfer into the media the generated data is not suficient to guarantee an easy upscaling Therewith the development of new biotechnological into laboratory stirred tank reactors. processes can be sped up or already existing processes, e.g. production of ribolavin, can be optimized [28]. Stirred mini bioreactors/mini bioreactor systems, such as the 2mag bioREACTOR, are certainly more suitable to provide Other special devices subsequent process up-scaling. The identical parameters (high

Other special devices for screening experiments are cuvette- KLa-values, power input) compared to conventional stirred-tank

Page 84 Central reactors allow an easy down- and up-scaling of biotechnological 8. Funke M, Buchenauer A, Mokwa W, Kluge S, Hein L, Müller C, et al. processes. Moreover, high parallelization up to 48 is possible. pH Bioprocess control in microscale: scalable fermentations in disposable and dissolved oxygen can be monitored by using the bioREACTOR and user-friendly microluidic systems. Microb Cell Fact. 2010; 9: 86. as a stand-alone unit with the PreSens sensor systems. Integration 9. Funke M, Buchenauer A, Schnakenberg U, Mokwa W, Diederichs S, into a pipetting robot enables control of pH, realization of fed- Mertens A, et al. Microluidic biolector-microluidic bioprocess control batch experiments and automated taking of samples. in microtiter plates. Biotechnol Bioeng. 2010; 107: 497-505. In summary, microtiter plates are a irst good step for the 10. Klein T, Schneider K, Heinzle E. A system of miniaturized stirred bioreactors for parallel continuous cultivation of yeast with online pre-selection of the parameters (strains, media compositions) of measurement of dissolved oxygen and off-gas. Biotechnol Bioeng. a biotechnological production process. 2013; 110: 535-542. For detailed strain characterization and process optimization 11. Weuster-Botz D, Puskeiler R, Kusterer A, Kaufmann K, John GT, (feeding, inducing…) a more instrumentally equipped screening Arnold M. Methods and milliliter scale devices for high-throughput tool, as the 2mag bioREACTOR, is required, that provides pH bioprocess design. Bioprocess Biosyst Eng. 2005; 28: 109-119. control, automation, sample taking and an easy up-scaling into 12. Kumar S, Wittmann C, Heinzle E. Minibioreactors. Biotechnol Lett. the laboratory liter-scale of stirred tank-reactors. 2004; 26: 1-10. OUTLOOK 13. Buechs J, Maier U, Milbradt C, Zoels B. Power consumption in shaking lasks on rotary shaking machines: I. power consumption Minibioreactors and minibioreactor systems are eficient measurement in unbafled lasks at low liquid viscosity. Biotechnol tools for the identiication of new production strains and the Bioeng. 2000; 68: 589-593. optimization of media and process conditions. Nevertheless, in 14. Maier U, Büchs J. Characterisation of the gas-liquid mass transfer in order to demonstrate a complete biotechnological production shaking bioreactors. Biochem Eng J. 2001; 7: 99-106. process, the product has to be extracted from the fermentation 15. Mrotzek C, Anderlei T, Henzler H, Büchs J. Mass transfer resistance of broth after the fermentation and puriied from other components sterile plugs in shaking bioreactors. Biochem Eng J. 2001; 7: 107-112. in the next steps (downstream processing). Downstream processing technologies, as for example a prototype miniature 16. Wittmann C, Kim HM, John G, Heinzle E. Characterization and microiltration, are rarely available [33]. There is an urgent application of an optical sensor for quantiication of dissolved O2 in shake-lasks. Biotechnol Lett. 2003; 25: 377-380. requirement for the down-sizing of common downstream procedures into the milliliter scale. 17. Weuster-Botz D. Parallele Reaktorsysteme zur Bioprozessentwicklung. Chem Ing Tech. 2002; 12: 1762-1766. Moreover, additional analytical features for these small volumes would be desirable to characterize strains and 18. Weuster-Botz D, Altenbach-Rehm J, Arnold M. Parallel substrate feeding and pH-control in shaking-lasks. Biochem Eng J. 2001; 7: conditions in more detail. In this respect exhaust gas analysis 163-170. to close nitrogen and carbon balances would be a great beneit. Further, on-line GC (gas chromatography) or HPLC (high pressure 19. Schäpper D, Alam MN, Szita N, Eliasson Lantz A, Gernaey KV. Application liquid chromatography) measurement methods would provide of microbioreactors in fermentation process development: a review. Anal Bioanal Chem. 2009; 395: 679-695. detection of special metabolites and target products. 20. Betts JI, Baganz F. Miniature bioreactors: current practices and future REFERENCES opportunities. Microb Cell Fact. 2006; 5: 21. 1. Alizadhe H, Behboudi K, Ahmadzadeh M, Javan-Nikkah M, Zamioudis 21. Puskeiler R, Kusterer A, John GT, Weuster-Botz D. Miniature C, Pieterse CMJ, et al. Induced systemic resistance in cucumber and bioreactors for automated high-throughput bioprocess design Arabidopsis thaliana by the combination of Trichoderma harzianum (HTBD): reproducibility of parallel fed-batch cultivations with Tr6 and Pseudomonas sp. Ps14. Biological Control. 2013; 65:14-23. Escherichia coli. Biotechnol Appl Biochem. 2005; 42: 227-235. 2. Gosse ME, Manocchia M. The irst biopharmaceuticals approved in 22. Schmidt M, Weuster-Botz D. Reaction engineering studies of acetone- United States. Drug Inf J. 1996; 30: 991-1001. butanol-ethanol fermentation with Clostridium acetobutylicum. Biotechnol J. 2012; 7: 656-661. 3. Pavlou AK, Reichert JM. Recombinant protein therapeutics--success rates, market trends and values to 2010. Nat Biotechnol. 2004; 22: 23. Kusterer A, Krause C, Kaufmann K, Arnold M, Weuster-Botz D. Fully 1513-1519. automated single-use stirred-tank bioreactors for parallel microbial cultivations. Bioprocess Biosyst Eng. 2008; 31: 207-215. 4. Aiello A, D’Esposito M, Fattorusso E, Menna M, Mueller WEG, Perovic- Ottstadt S, et al. Novel bioactive bromopyrrole alkaloids from the 24. Hortsch R, Stratmann A, Weuster-Botz D. New milliliter-scale mediterranean sponge Axinella verrucosa. Bioorg Med Chem. 2006; stirred tank bioreactors for the cultivation of mycelium forming 14: 17-24. microorganisms. Biotechnol Bioeng. 2010; 106: 443-451. 5. Hoefel T, Wittmann E, Reinecke L, Weuster-Botz D. Reaction 25. Hortsch R, Weuster-Botz D. Growth and recombinant protein engineering studies for the production of 2-hydroxyisobutyric expression with Escherichia coli in different batch cultivation media. acid with recombinant Cupriavidus necator H 16. Appl Microbiol Appl Microbiol Biotechnol. 2011; 90: 69-76. Biotechnol. 2010; 88: 477-484. 26. Riedlberger P, Weuster-Botz D. New miniature stirred-tank 6. Vogel GH. Change in raw material base in the chemical industry. Chem bioreactors for parallel study of enzymatic biomass hydrolysis. Eng Technol. 2008; 31: 730–735. Bioresour Technol. 2012; 106: 138-146. 7. Tokiwa Y, Calabia BP. Biological production of functional chemicals 27. Puskeiler R, Kaufmann K, Weuster-Botz D. Development, from renewable resources. Can J Chem. 2008; 86: 548-555. parallelization, and automation of a gas-inducing milliliter-scale

Page 85 Central

bioreactor for high-throughput bioprocess design (HTBD). Biotechnol engineering characterization of small-scale bubble columns for Bioeng. 2005; 89: 512-523. microbial process development. Bioproc Biosys Eng. 2001; 24: 3–11. 28. Vester A, Hans M, Hohmann HP, Weuster-Botz D. Discrimination of 31. Delhomme C, Goh SLM, Kuehn FE, Weuster-Botz D. Esteriication of ribolavin producing Bacillus subtilis strains based on their fed-batch bio-based succinic acid in biphasic systems: Comparison of chemical process performances on a millilitre scale. Appl Microbiol Biotechnol. and biological catalysts. J Mol Cat B Enz. 2012; 80: 39-47. 2009; 84: 71-76. 32. Neubauer P, Junne S. Scale-down simulators for metabolic analysis of 29. Kostov Y, Harms P, Randers-Eichhorn L, Rao G. Low-cost large-scale bioprocesses. Curr Opin Biotechnol. 2010; 21: 114-121. microbioreactor for high-throughput bioprocessing. Biotechnol 33. Jackson NB, Liddell JM, Lye GJ. An automated microscale technique for Bioeng. 2001; 72: 346-352. the quantitative and parallel analysis of microiltration operations. J 30. Weuster-Botz D, Altenbach-Rehm J, Hawrylenko A. Process- Memb Sci. 2006; 276: 31-41.

Cite this article Kurzrock T, Kress K (2014) Downscale Upscale - Elasticity of Scales-An Approach to Forecast Future Requirements in Biotechnology. JSM Biotechnol Bioeng 2(1): 1030.

Page 86 Research Article *Corresponding author Ibrahim Ahmed, Institute of Bioprocess Engineering, Department of Chemical and Biological Engineering, Establishment and Friedrich Alexander Universitat, Erlangen Nüremberg, Paul-Gordan Str.3, 91052 Erlangen, Germany, Characterization of three New Tel:4991318523055; Email: Submitted: 10 March 2013 Embryonic Spodoptera littoralis Accepted: 12 May 2014 Published: 14 May 2014 ISSN: 2333-7117 Cell Lines and Testing their Copyright © 2014 Ahmed et al. Susceptibility to SpliMNPV OPEN ACCESS 1,2 1 1 Ahmed, I. *, Huebner, H. , Buchholz, R. Keywords 1Department of Chemical and Biological Engineering, Friedrich Alexander Universitӓt, • Spodoptera littoralis Germany • Occlusion bodies (OBs) 2Department of Biotechnology, AL-Nahrain University, Iraq • Insect cell culture • SpliMNPV • Immobilization Abstract Baculoviruses have a signifi cant potential as biological pesticides. Spodoptera littoralis multicapsid nucleopolyhedrovirus (SpliMNPV) could thus fi nd an application to protect plants against the African Cotton Leafworm. For the in vitro production of SpliMNPV a cellular system has to be established. For this purpose three new continuous cell lines were established from the embryonic tissue of the cotton leaf worm S. littoralis.The three cell lines were designated Spli-C, Spli-S and Spli-B. They consisted mostly of spherical cells, but also contained spindle and giant cells. The population doubling time for the three cell lines Spli-C, Spli-S and Spli-B were 30.5, 31 and 44.5 hrs, respectively, at passage 19, while at passage 120 it decreased to 26, 27 and 32 hrs, respectively. RAPD and DAF DNA fi ngerprint confi rmed that the cell lines originated from S. littoralis tissues. The lactate dehydrogenase (LDH) isozyme analysis demonstrated a distinguishable difference between the three new S. littoralis cell lines and the other insect cell lines which we use in our laboratory.All three new cell lines were susceptible to SpliMNPV and thus are suitable for virus multipication. Cells were immobilized using sodium cellulose sulfate (NaCS) and poly diallyl dimethyl ammoniumchloride (PDADMAC) capsules to protect cells from shear stress. This is caused during cultivation by agitation and gas sparging during supply of suffi cient oxygen in order to reach high cell densities. The cell densities increased from 4-5x106 cells/ml in suspension cultureto1.3x107 cells/ml in capsules. Our results suggest that large-scale production of SpliMNPV as a biopesticide is possible with these cell lines.

INTRODUCTION be susceptible to the virus, support viral replication and produce high yield of budded virus and occlusion bodies. The cell lines Insect cell culture is becoming an important tool in different also should be able to grow in suspension culture and in low cost ields of study, such as cell physiology, genetics, immunology, serum free medium [14]. For commercial application, high cell developmental biology and microbial pathology [1-3]. But also densities offer advantages, e.g. in the production of viral pesticides for biotechnological applications. Recently, insect cell cultures in compact bioreactors with high volumetric production rates, have been widely used in the production of viral insecticides [4, but there are factors that may prevent the cells from reaching 5], recombinant proteins and vaccines [6-8]. The irst continuous suficient high densities. The most important factors are oxygen insect cell line was established by Grace in 1962 [9]. Since then many cell lines have been developed, but only very few of them limitation and cell damage as a result of agitation and gas are used in the industrial ield. sparging [15,16]. Cell culturing in capsules can overcome these problems since a high shaking rate can be applied to supply a S. littoralis is considered to be one of the most destructive suficient amount of oxygen without damaging the cells. The cell agricultural insect pests, attacking more than 40 plant families, encapsulation technique provides many advantages beyond, including about 87 economically important species such as increasing oxygen supply as, protecting cells from shaking stress, apples, corn, cotton, tomatoes and potatoes. It undergoes many making the medium exchange process easy without losing cells, generations per year, and a signiicant part of the pest population and facilitating product puriication [17,15]. Euroferm (Erlangen, has become resistant to chemical pesticides [10,11]. S. littoralis Germany) is one of the companies that use the cell encapsulation has been classiied by the European and Mediterranean Plant technique for the production of insect-pathogenic viruses as Protection Organization (EPPO) as an A2 quarantine pest. In biopesticides. The aim of this study was to establish new cell the US, it is considered an exotic organism with a high risk of lines from S. littoralis embryonic tissue and to test their ability becoming invasive [12,13]. to support SpliMNPV replication for in vitro production of a viral The insect cell lines used for viral pesticide production have to insecticide using the cell encapsulation technique. Three cell

Page 87 Central lines were successfully established, which are to our knowledge cells for each cell line harvested 24 and 120 hrs post-seeding. the irst cell lines established from S. littoralis embryonic tissue. Five different measurements of cell densities were carried out for MATERIALS AND METHODS each cell line. The activity of the mitochondrial dehydrogenase enzymes was assessed by monitoring the conversion of MTT [19]. Insect cell lines and virus Isozyme analysis The following insect cell lines Sf21 (Spodoptera frugiperda), Tni (Trichoplusia ni) and Cp (Cydia pomonella) were used in this In this experiment, lactate dehydrogenase (LDH) was used study. Additionally, SpliMNPV andfertilized Spodoptera littoralis for isozyme analysis. The three new S. littoralis cell lines were eggs were used to establish the new cell lines. compared to the three insect cell lines Sf21, Tni and Cp. The cells were harvested at the logarithmic phase and washed Primary cultures twice with phosphate buffer (pH 6.3) by centrifugation at 180g Primary cultures of cells were prepared from S. littoralis for 8 min. The cell pellet (5-6x106cells) was suspended in lysis eggs (Syngenta, Switzerland). The eggs were placed in a mesh buffer (20 mM phosphate buffer pH 7.4, 500mM NaCl and 2% strainer and washed with 1% Triton X-100 in order to disinfect Nonidet P40) and sonicated for 15 min at 4oC. Cell extracts were the surface of the eggs; eggs were immersed three times in 5% centrifuged at 13,000 g for 30 min at 4oC, and the supernatant sodium hypochlorite solution for 5 min each. Then, they were transferred to a new tube. Extracted proteins were separated on placed in 70% ethanol for 20 min. Afterwards, eggs were washed 8% polyacrylamide gel electrophoresis at constant voltage, 70 V, with PBS buffer (pH 6.3). Disinfected eggs were crushed in the for 15 min, then 120 V for 80-120 min, and inally the gels were Hink’s TNM-FH medium (Sigma), which was supplemented with stained to detect LDH enzymes [20]. The migration distance of 20% FBS, by using a spatula. This forced the cells to go through each isoenzyme band was recorded. The relative mobility (Rm) the mesh strainer. Finally, the cell suspension was dispensed in was estimated by measuring the ratio of the migration distance 24-multiwell plates and incubated at 27oC. No antibiotics were used in this experiment. of isoenzyme bands to the migration distance of the standard cell line [21,22,23], i.e. the Cp cell line with a LDH is23,058 Da Cell maintenance and subculture (UniProtKB databases). Cells were maintained by replacing half of the old medium DNA ingerprinting with the same volume of fresh medium every 7-10 days. The cells were subcultured when they had covered 90% of the growth The three S. littoralis cell lines were genetically characterized area. The subculturing was achieved by lushing the medium by DNA ampliication ingerprint (DAF) using three pairs of DAF over the cell monolayer, and then the cell suspension was split primers which were originally designed for PCR ampliication at a ratio of 1:2 with fresh medium. The cells were adapted for of mammalian aldolase 5’ CCGGAGCAGAAGGAG-3’, 5’-CACAT- growth in suspension culture after passage ten and grown in EX- ACTGGCAGCGCTTCA-3’, interleukin-1β 5’-ATGAGGATGACTTGT- cell 420 medium instead of Hink’s TNM-FH medium, which was TCTTT-3’, 5’-GAGGTGCTGATGTACCAGTT-3’ and prolactin recep- used in the initiation of the primary culture. The concentration of tor 5’-CTG GGA CAG ATG GAG GAC TT-3’ , 5’-CTC AGG TTT TAA FBS was decreased gradually from 20% to 15%, 10% and 5% at TCG AAT TT-3’as described by McIntosh. (1996) [24]. DNA was passages 5, 11 and 31 until passage 65, respectively. From then extracted by using the Tissue DNA Mini Kit (Peqlab, Germany), on the cells were subcultured every 2-3 days. and the DNA concentration and purity were measured using a Cell morphology NanoDrop 1000 spectrophotometer. The PCR products were analyzed on a 1.6 % agarose gel containing propidium iodide. The morphology of the obtained cells was observed and photographed by using a Nikon inverted microscope with phase Random ampliication polymorphic DNA (RAPD) was also contrast. The cell size histogram of the three S. littoralis cell used to characterize the cell lines. Two different RAPD 10 lines, in addition to the Sf21 cell line, were analyzed using a Moxi nucleotide primers (5’-AACGCGCAAC-3’, 5’-CCCGTCAGCA-3’) automated cell counter. were used under the following conditions: 95°C for 3 min; 35 Cell line growth curve, population doubling time and cycles at 95°C for 40 sec, 27°C for 30 sec, 72°C for 1min; and 72°C for 7 min. MTT calibration curve Cryopreservation The growth curves of the three cell lines (designated as Spli-B, Spli-C and Spli-S) were determined at passages 19 and The cells with high viability (~98%) were stored by harvesting 120. The cells were seeded at a density of 4-6x105cells/ml in the cells at 180 g for 8 min. The cell pellet was resuspended in an Erlenmeyer lask containing EX-Cell 420 medium (Sigma) freezing medium and cell numbers were adjusted to 5x106 cells/ supplemented with 10% FBS at passage 19 and 5% at passage ml. Two freezing media were used to store the cells. The irst 120. The growth culture was incubated at 27oC, 50 rpm. The cell comprised 90% EX-Cell 420 medium plus 20% FBS and 10% density was determined each day by using a hemocytometer. DMSO. The second comprised 90% EX-Cell 420 medium plus The population doubling time was calculated by plotting the cell 20% FBS and 10% glycerol. The cell suspension was dispensed density against the growth time. An exponential regression was into sterile cryotubes. The cryotubes were frozen at -20oC for 0.5- used to estimate cell doubling time during the logarithmic phase o of growth [18]. An MTT calibration test was done with 2-3x106 2 hours and transferred to -80 C for permanent storage.

Page 88 Central

Testing the susceptibility of the S. littoralis cell lines cell debris and obtained only the OBs in the samples. After that, to SpliMNPV the puriied OBs were washed and resuspended in ultrapure water and stored at -20oC. The OBs were counted under phase The virus stock was prepared from SpliMNPV occlusion contrast microscope using a haemocytometer and OB amount bodies, according to Reid and Lua, 2005 [25] with some was estimated using the following formula: modiication.The occlusion bodies were solubilized by incubation in alkaline solution (pH 11) at 27oC until they lysed and then the Occlusion bodies (OBs) = counted OBs x dilution factor. solution was neutralized by insect medium to a inal pH 6.0- 6.4. S. littoralis cell encapsulation Finally, the virus solution was sterilized by iltration (0.22 μm) and stored at 4oC. The newly established S. littoralis cell lines The cell encapsulation was done by mixing sodium cellulose were seeded at a density of 4x105cells/ml in a 6-well plate and sulfate (NaCS; Euroferm/Germany) with poly diallyl dimethyl inoculated with the virus before incubation at 27oC. The cells ammonium chloride (low molecular weight pDADMAC; Sigma) were checked each day under a microscope to follow the infection to produce hollow spheres. The NaCS solution was prepared at a progress. The cells were seeded in a shaker lask, infected with concentration of 1.9 % (W/W) in PBS (pH 6.3) in a small beaker. the virus (culture supernatant), incubated at 27oC, 50 rpm, and The beaker was covered with parafin and aluminum foil, and left the cell number and viability were checked each day. The virus at RT overnight. The solution was strongly agitated by stirring for was harvested by centrifugation at 180 g for 8 min before the at least 2 hrs until it was homogenized completely. Then it was cell viability dropped to 80%. Virus stock was stored at 4oC for sterilized in an autoclave at 121oC for 5 min. The solution was experiments. taken out immediately at the end of sterilization and cooled down with agitation at RT for at least 2 hrs. Viral occlusion bodies puriication and quantiication The pDADMAC solution was prepared at a concentration SpliMNPV was quantiied by counting the viral occlusion of 1.2 % (W/W) in PBS (pH 6.3) and one drop of Tween-20 bodies (OBs) under a microscope. Infected cells were harvested was added to each beaker. The solution was then agitated with by centrifugation at 13,000 rpm for 30 min, the pellet was a magnetic stirrer until it was homogenized. The beaker was resuspended in polyhedralysis buffer (10Mm Tris, 1mM EDTA, covered with aluminum foil and the solution was sterilized, 0.072% SDS), and sonicated for 15 min. Then, the samples were including the magnetic stirring bar, by autoclave using the same centrifuged again at 13,000 rpm for 30 min. The supernantant conditions used to sterilize the NaCS solution. that contains cell debris was removed and the pellet was resuspended again in the polyhedralysis buffer and sonicated A sterile syringe (5 ml) was ixed on a stand, a small sterile again. This process was repeated several times to remove all the tube was joined to one end and passed through a peristaltic pump, and a sterile needle was ixed to the other end of the tube. Cells with a viability of 95-98% were harvested, the cell pellet (5x106 cells) resuspended gently in 0.25 ml FBS, and 4.75 ml NaCS solution was added and mixed gently. The cell suspension was transferred to the syringe and dripped into the PADMAC solution beaker placed on a magnetic stirrer so that each drop formed a capsule. Afterwards, capsules were washed three times with PBS (pH 6.3). Finally, EX-Cell 420 medium was added to the capsules, which then were transferred into a bafled lask, and placed in an incubator at 27oC, 70 rpm. The medium was changed 2 hrs after encapsulation to remove remaining traces of pDADMAC. Culture medium was changed each 3 days during the irst 10 days, and every day thereafter. The cell density within the capsules was estimated by weighting 3-4 capsules. To dissolve the capsules 5-10 fold cellulase were added, and incubated at 27oC for about 2 hrs. Finally, the cell number was determined using a hemocytometer. RESULTS AND DISCUSSION Primary cultures The primary cell cultures were prepared by crushing disinfected eggs in insect medium. The suspensions of embryonic tissue fragments were dispensed in 24-multiwell plates and incubated at 27oC. The tissue fragments started to attach to the Figure 1 Phase contrast micrographs of S. littoralis primary cell bottom of the multiwell plates after 1-2 days. Thirty days later, culture. (A, B) ibroblast-like cells, (C) immigration of suspension a network of nerve-like structures was observed. Many vesicles cells from tissue explants (D) suspension cells reached conluence (E) appeared in the early stages of primary culture initiation. immigration of adherent cells from tissue explants and (F) adherent Thereafter, cells started to migrate from the embryonic tissue cells reached conluence. segments. The culture included adherent and suspended cells

Page 89 Central (Figure 1). Spli-S Spli-B Spli-C Sf21 Tni Cp Various tissues of lepidopteran insects were used to establish many continuous cell lines [26]. The embryonic, fat and ovarian tissues are the most commonly used source [27]. The immature 23,058 Da embryonic tissue is the most successful source for development of cell lines [28]. The opportunity to obtain a continuous cell line from immature tissue is higher than from mature tissues, because the embryonic tissues consist of many undifferentiated actively proliferating cells [26]. Therefore, in this study, we used embryonic tissues to get the irst cell lines established from S. littoralis.

Cell subculture Figure 3 Lactate dehydrogenase (LDH) isozyme analysis, for three S. littoralis cell lines and three other insect cell lines, on 8% a The irst successful subculture was achieved two months polyacrylamide gel. after establishing the primary culture. At the beginning, the cells were attached strongly to the bottom of the well. However, cells started to loose adherence and became easy to remove from the beginning they were composed of different shapes and sizes, well bottom after six passages. Two weeks after establishing the such as ibroblast-like cells, spherical cells, spindle-like cells irst subculture, the second subculture was obtained, while the and trapezoid-like cells. After several subcultures, the dominant third subculture was established ten days later. Furthermore, shapes were spherical but some spindle and giant cells were still after a few passages the cells started to grow quickly, which detectable. The mean diameter of the Spli-C, Spli-S, and Spli-B further shortened the period between the subcultures. At cells are 16.65, 14.2 and 18.46 μm, respectively. The existence of present, cells are subcultured every 2-3 days. Since the cells various forms of cells during establishing cell lines was reported became well-adapted to the growth conditions, in EX-Cell 420 by other authors [29]. This was foreseeable since embryos medium supplemented with 5% FBS, the split ratio was gradually differentiate into different tissues and thus will contain different increased from 1:2 at the beginning to 1:10. To prolong cell life, types of cells [26]. Embryonic fragments will therefore lead to cells should be subcultured regularly when the cell density gets heterogeneous cell populations as has been demonstrated in this too high by transferring some of cells from the old culture to project. The cell size of the Spli-C, Spli-S, and Spli-B cell lines was fresh medium. The required period from an established primary within the assumed range size (5-20.11 μm) for insect cells [30]. culture to the irst successful subculture can be diverse. It can Cell line growth curve, population doubling time and take weeks, months or even more than a year, relying on insect species and tissue origins [27]. The S. littoralis cells were frozen MTT calibration curve at -80oC using two different freezing media. The stored cells in The growth curves of the three cell lines were determined these two freezing media grew well again after thawing. in suspension culture. The maximum population density of the Spli-C and Spli-S cells were 4-5x106cells/ml, while for Spli-B it Cell morphology was 6x106cells/ml. The growth rate of the Spli-C cell line was The results showed that the populations of the Spli-B, 0.582 (d-1) , which was higher than the other two cell lines, while Spli-C and Spli-S cell lines are heterogeneous. Moreover, at the the Spli-B cell line showed the slowest growth rate about 0.373 (d-1). The population doubling time for Spli-B, Spli-C and Spli-S at passage 19 was 44.5, 30.5 and 31hrs, respectively; while at

3.E+07 Spli-S cell line passage 120 it changed to 32, 26 and 27 hrs, respectively. The Spli-B cell line three cell lines did not undergo a lag phase and the saturated Spli-C cell line phase occurred ive days post cell seeding for Spli-C and seven days for Spli-S and Spli-B. The MTT calibration curve show stable slopes for all three cell lines when compared both at 24 and at 120 hrs. The cell growth curves are shown in Figure 2. 3.E+06 The maximum population density of the Spli-C, Spli-S and Spli-B cell lines was higher than other cell lines established from S. littoralis by other researchers. According to Knudson et al.

Cell density (cells/ml) density Cell 1980 [29], the maximum cell density of the S. littoralis UIV-SL573 cell line, which was established from the pupal ovary tissue, was 3x106cells/ml 6-7 days post-seeding. This increment in cell 3.E+05 density in this project could be because different tissues were 012345678910 used in establishing the corresponding cell lines. Days Isozyme analysis Figure 2 Growth curve of the three new S. littoralis cell lines in EX-Cell In order to distinguish between different insect cell lines, 420 medium supplemented with 10% FBS, at 27oC and 50 rpm. isozyme analysis was used as a protein ingerprint using

Page 90 Central polyacrylamide gel electrophoresis. It is well known that isoenzyme analysis using polyacrylamide gel is suficiently sensitive to obtain clear isoenzyme patterns and distinguish between different cell lines (20). The lactate dehydrogenase (LDH) isozyme analysis revealed one clear and sharp band for each cell line. The particularly fast S. littoralis enzyme bands indicate that the S. littoralis LDH has a molecular weight less than the other Lepidoptera cell lines tested. The LDH enzyme bands of the three S. littoralis cell lines are identical. The relative mobility (Rm) of the Spli-C, Spli-S and Spli-B cell lines was 1.6, conirming that these three cell lines belong to the same species. The Sf21 Figure 6 Light microscopic observations of Spli-C cells (magniication enzyme band is very close to the S. littoralis bands, with an Rm 400x1.5). (A) uninfected cells, and (B) cells infected with SpliMNPV. of 1.47, which could be because they belong to the same genus Many viral occlusion bodies (OBs) appeared inside the cells. Spodoptera. On the other hand, the isozyme proile of the Tni cell line, with an Rm 0.67, differed signiicantly from the S. littoralis cell lines, proving that there was no cross-contamination with the each species is genetically unique and a speciic DNA ingerprint other insect cell lines used in our laboratory (Figure 3). exists for each one [32]. DNA ingerprinting The results of RAPD and DAF were different from one species to the other and from one primer to the other. Different DNA ingerprinting was also used to conirm the identity of the DNA band numbers and sizes, ranging between 0.15 and 3 Kb, new cell lines. Because cross-contamination is quite common in were observed. The three S. littoralis cell lines showed similar laboratories, it is necessary to use the DNA ingerprint to conirm DAF proile patterns with the aldolase primers. Six bands at the identity of cell lines and to detect any contamination. The DAF approximately 340, 400, 500, 650, 700 and 920bp were seen in and RAPD are important DNA ingerprinting techniques that both the Spli-S and Spli-C. In the host ive bands were recorded, are widely used to identify cell lines and both can successfully which were equal in size to the bands obtained from Spli-S distinguish between different cell lines [24,31]. This is because andSpli-C DNA preparations. Spli-B gave six bands and ive of these bands were also similar to the host. Spli-B had one band at approximitly 450 bp not found in the host, Spli-C orSpli-S.On the other hand, the Sf21 showed ive bands while seven and six bands were produced from Cp and Tnicell lines, respectively (Figure 4). With the interleukin-1β primers,Spli-C and Spli-S showed six bands at approximately 200, 500, 600, 765, 1500 and 2400 bp and ive of these bands were shared with the host, which also had ive bands. Five bands were generated from Spli-B cells, with four bands being similar to the host and band ive a different size at approximately 680 bp. The other insect cell lines Sf21, Cp and Tniclearly showed different patterns, where six bands were observed in Sf21 and three and four bands were recorded Figure 4 DAF ampliications pattern of the three S. littoralis cell lines, in Cp and Tni respectively (Figure 4). The prolactin receptor host tissue and three other insect cell lines. (A) aldolase primers and primers failed to amplify in any caseand thus there were no (B) interleukin-1β primers. Samples were analyzed on 1.6% agarose bands observed on the agarose gel. This could be due to the lack gel electrophoresis and stained with propidium iodide (PI). of complementary sequences for this set of primersin the insect cells’ genome [33]. The RAPD results with primer 2 showed ive bands (310, 400, 600, 700 and 1250 bp) that were identical in the Spli-C, Spli-S andSpli-B as well as in the host. While with primer 1, the Spli-B showed a slightly different pattern from the other two. Three bands (2000, 2250 and 3000 bp) identical to those in the host were observed in the Spli-C and Spli-S cell lines, while the Spli-B cell line showed only two bands identical to the host. The third band, at about 2000 bp, missing from the proile (Figure 5). The DNA proile of the three S. littoralis cell lines were identical to the host (eggs) DNA proile conirming that the new Figure 5 Random ampliied polymorphic DNA (RAPD) ampliication cell lines originated from the S. littoralis species. The new cell pattern of insect cell lines and S. littoralis eggs (A) primer 1 lines clearly showed proile patterns different from the Sf21, Tni (5’-AACGCGCAAC-3’) and (B) primer 2 (5’-CCCGTCAGCA-3’). Samples and Cp cell lines, which are used in our laboratory as well. were analyzed on 1.6% agarose gel electrophoresis and stained with propidium iodide (PI). The two DNA ingerprint techniques, DAF and RAPD,

Page 91 Central successfully conirmed again that the three S. littoralis cell lines infected and replicated in all three cell lines. Cytopathic effects, are nearly identical and belong to the same species and that such as hypertrophy of nuclei slow cell growth and large cell they differ from the other insect cell lines that are used in our size, were observed after 1-2 days post-infection. Viral occlusion laboratory, even though they are closely related. The Spli-B cell bodies (OBs) were observed inside the cell nuclei after 2-3 days line showed a slightly different pattern than Spli-C and Spli-S and after 4-5 days many OBs were produced in the cells. A few with the interleukin-1β primers and RAPD primer 1. This could days post-infection, some of the infected cells were lysed and OBs be due to DNA methylation or mutation that may have prevented were released into the culture medium (Figure 6). primers from annealing to this site in Spli-B genomic DNA. A These observations indicate that the new S. littoralis cell comparable observation was recorded by McIntosh and his lines were susceptible to SpliMNPV and they supported viral group in 1996 [24]. replication. The same observation was noticed by Shih [34]. The Testing the susceptibility of the S. littoralis cell lines to Viral occlusion bodies are highly detectable during the late stage SpliMNPV of the viral infection, accumulated inside the infected cells, and After establishing and characterizing the new cell lines, their were later released into the culture medium after cell death. The susceptibility to SpliMNPV was tested to observe, if these cell NPV OBs can be easily identiied under a microscope due to their lines are susceptible to the virus infection and also to determine large size range from 0.15 to 15 μm [35,36]. the highest virus producer cell line. SpliMNPV successfully In suspension culture, the cell density of infected cells

3.E+07 100

Spli-C uninfected cells Spli-C infected cells Viability of uninfected cells 80 Viability of infected cells

60 3.E+06

40 % Viability Cell density (cells/ml) density Cell 20

3.E+05 0 012345 Days

Figure 7 The growth curve of Spli-C cells for both uninfected and infected with SpliMNPV. Cells were cultured in EX-Cell 420 medium supplemented with 5% FBS at 27oC, 50 rpm.

A B 1 9 14 days

Spli-C uninfected cells in capsules

Spli-C infected cells with SpliMNPV in capsules

Figure 8 (A) The growth curve of the Spli-C cells in capsules and in suspension culture. (B) Spli-C cell growth in capsules after 1, 9, and 14 days (for both, uninfected and infected cells with SpliMNPV).

Page 92 Central dramatically decreased compared to uninfected cells, and the In this study, we developed biotechnological system for Spli growth rate of the infected cells was lower than noninfected cells. MNPV production applying cell culture, where the viral pesticide The cell viability also decreased after two days post infection as produced using in vitro methods is of good quality and free of shown in Figure 7. microbial contamination. But the main advantages of it are easy, cheap and space saving production conditions. Three new cell The Spli-C cells showed high susceptibility to the virus and lines were developed and characterized and found to be able to high production of OBs (data not shown). The slow growth rate support SpliMNPV replication. Immobilization led to particularly of the infected cells was expected since cell division of permissive good growth in a bafled shaker lasks under suboptimal culture insect cells undergoes arrestment when the cells are infected conditions. However, optimization is still required to obtain high with baculovirus [37]. cell densities and high viral OBs yield in a bioreactor system as S. littoralis cell encapsulation necessary for an industrial product. Furthermore, the isolation of pure clones from the heterogeneous cell population of the best The Spli-C cell line that showed higher susceptible to Spli producer cell line, i.e. is needed, in order to develop a high virus MNPV and higher viral occlusion bodies production (1x107 producing cell colony. But our results already clearly demonstrate OBs/ml) than the other two cell lines (data not shown) was the feasibility of large scale production of SpliMNPV to be used as immobilized using NaCS and PDADMAC. The resulting capsules biopesticide using the cell encapsulation system. were 3 mm in diameter. The Spli-C cells grew well aggregated The biopesticide market is rapidly growing by around 16% inside the capsules, the cell growth rate in capsules was 0.553 each year and the demand for the biopesticides is expected to (d-1) and the cells illed the capsules after about two weeks. The rise steadily [41]. Since the market is predictable to reach $3.2 maximum cell density of the Spli-C cells in capsules reached billion by 2017 and $4.5 billion by 2023 according to Global 7 6 1.3x10 cells/ml while it was only 4-5x10 cells/ml in suspension Industry Analysis, Inc. and Lux Research, the SpliMNPV pesticide culture (Figure 8). The Spli-C cell encapsulation led to a roughly market is expected to increase as well. with the biotechnological 3-fold increase in cell density. The Spli-C cells in the capsule were production system described above this need can be served infected with SpliMNPV at MOI 1 to analyse the infection process easily and with good quality to secure important sectors of in capsules, where the infected cells showed, as expected, lower agricultural production. With the SpliMNPV agent a potent and cell densities compared to uninfected cells (Figure 8). urgently needed biopesticide with particularly friendly ecological The cell encapsulation technique provides many advantages, properties will become available for such important agricultural such as increasing oxygen supply and protecting cells from products like corn, cotton, tamatoes and potatoes. shaking stress, which is an important requirement for increasing ACKNOWLEDGEMENT the cell densities and the product yield [15]. Therefore, increasing The authors would like to thank Roland Reist and Oliver in Spli-C cell density was obtained due to cell culture in capsules. Kindler (Syngenta Crop Protection, Switzerland) for providing This is in good accordance with the literature [38,15]. As a S. littoralis eggs and David Grzywacz (University of Greenwich, result of increasing cell densities per ml by using this cell culture UK) for providing S. littoralis NPV isolates. The authors would system, an increase viral particle production could be achieved. also like to thank Anette Amtmann for technical assistance. Son et al. 2006 [38] recorded that the production of polyhedral We would also like to thank the German Academic Exchange inclusion bodies (PIBs) in encapsulated cells increased 58 fold Service (DAAD) and the Ministry of Higher Education in Iraq compared to cultivation in suspension culture. Insect cells need for the scholarship to Ibrahim Ahmed that helped make this more oxygen compared to mammalian cells, and virally infected project possible. Special thanks are attributed to Cynthia L. insect cells consume even more oxygen than uninfected cells [39]. Goodman (USDA/ARS/BCIRL, USA). Our thanks to Andreas Therefore, cell encapsulation is a good way to provide enough Perlick (Institute of Bioprocess Engineering, Friedrich Alexander quantities of oxygen to the cells. Cell encapsulation is attractive Universitӓt, Erlangen-Nürnberg, Germany) for reviewing and for continuous large-scale production of baculovirus [40]. correction of the manuscript. CONCLUSION REFERENCES Due to the harmful effects of chemical pesticides on the 1. Bhatia R, Jesionowski G, Ferrance J, Ataai MM. Insect cell physiology. environment and human health, in addition to pest resistance Cytotechnology. 1997; 24: 1-9. against these agents, alternatives in general and ecological 2. Lynn DE. Methods for maintaining insect cell cultures. J Insect Sci. alternatives in particular are urgently needed. Biopesticides are 2002; 2: 9. considered as such viable alternatives since they speciically target 3. Taniai K, Lee JH, Lee IH. Bombyx mori cell line as a model of immune- the pest and lack harmful effects to humans and the environment. system organs. Insect Mol Biol. 2006; 15: 269-279. SpliMNPV, as a biopesticide, is used actively to control the cotton leaf worm S. littorali spest, which is considered the major pest on 4. Goodman CL, McIntosh AH, El Sayed GN, Grasela JJ, Stiles B. Production cotton and other economically important plants. Currently, the in of selected baculoviruses in newly established lepidopteran cell lines. In Vitro Cell Dev Biol Anim. 2001; 37: 374-379. vivo production, i.e. the controlled multiplication of the virus in the living pest organism, is the only method used for production 5. Szewczyk B, Rabalski L, Krol E, Sihler W, Lobo de Souza M. of SpliMNPV as a commercial biopesticide product, despite the Baculovirusbiopesticides-a safe alternative to chemical protection of fact that it has several disadvantages such as the requirement for plants, Journal of Biopesticides. 2009; 2: 209-216. intensive labor and the poor quality of its product. 6. Ikonomou L, Schneider YJ, Agathos SN. Insect cell culture for industrial

Page 93 Central

production of recombinant proteins. Appl Microbiol Biotechnol. 2003; by DNA ampliication ingerprinting (DAF). Insect Mol Biol. 1996; 5: 62: 1-20. 187-195. 7. McCarroll L, King LA. Stable insect cell cultures for recombinant 25. Reid S, Lua L. Method of producing baculovirus. Patent WO protein production. Curr Opin Biotechnol. 1997; 8: 590-594. 2005045014 A1; 2005. 8. Cox MM. Recombinant protein vaccines produced in insect cells. 26. Mitsuhashi J. Invertebrate Tissue Culture Methods. Springer Lab Vaccine. 2012; 30: 1759-1766. Manual. 2002; 791-812. 9. GRACE TD. Establishment of four strains of cells from insect tissues 27. Belloncik S, Petcharawan O, Couillard M, Charpentier G, Larue B, grown in vitro. Nature. 1962; 195: 788-789. Guardado H, et al. Development and characterization of a continuous cell line, AFKM-On-H, from hemocytes of the European corn borer 10. Abo-El-Ghar MR, Nassar ME, Riskalla MR, Abd-El-Ghafar SF. Rate Ostrinia nubilalis (Hübner) (Lepidoptera, Pyralidae). In Vitro Cell Dev of development of resistance and pattern of cross-resistance Biol Anim. 2007; 43: 245-254. in fenvalerate and decamethrin resistant strains of S. littoralis. Agricultural Research Review. 1986; 61: 141-145. 28. Lynn DE. Development and characterization of insect cell lines. Cytotechnology. 1996; 20: 3-11. 11. Mosallanejad H, Smagghe G. Biochemical mechanisms of methoxyfenozide resistance in the cotton leafworm Spodoptera 29. Kndudson DL, Lescott T, Tinsleg TW. Establishment of a continuous littoralis. Pest Manag Sci. 2009; 65: 732-736. cell line of Spodoptera littoralis (Lepidoptera; Noctuidae). In vitro. 1980; 16: 369-370. 12. European and Mediterranean Plant Protection. 30. Zeiser A, Elias CB, Voyer R, Jardin B, Kamen AA. On-line monitoring of 13. Venette RC, Davis EE, Zaspel J, Heisler H, Larson M. Mini Risk physiological parameters of insect cell cultures during the growth and Assessment Egyptian cotton leafworm, Spodoptera littoralisBiosduval infection process. Biotechnol Prog. 2000; 16: 803-808. [Lepidoptera: Noctuidae]. 2003. 31. Léry X, LaRue B, Cossette J, Charpentier G. Characterization and 14. Claus JD, Gioria VV, Micheloud GA, Visnovsky G. Production of authentication of insect cell lines using RAPD markers. Insect Biochem insecticidal Baculoviruses in insect cell cultures: potential and Mol Biol. 2003; 33: 1035-1041. limitations. Soloneski S, Larramendy M, editors. In: Inscticides- Basic 32. Stacey G, Bolton B, Doyle A, Grifiths B. DNA ingerprinting--a valuable and other Applications. InTech. 2012; 127-152. new technique for the characterisation of cell lines. Cytotechnology. 15. Wu JY, Goosen MF. Immobilization of insect cells. Cytotechnology. 1992; 9: 211-216. 1996; 20: 199-208. 33. McPherson MJ, Moller SG. PCR: The basics from background to bench. 16. Archambault J, Robert J, Tom, L. Culture of immobilized insect cells. 1st edn. BIOS Scientiic Publishers Ltd. Oxford. 2000. Bioprocess Engineering. 1994; 11: 189-197. 34. Shih CJ, Lin RW, Wang CH. Establishment of a cell line from Spodoptera 17. Yamaji H, Manabe T, Kitaura A, Izumoto E, Fukuda H. Eficient litura (Lepidoptera: Noctuidae) and replication of S. litura nuclear production of recombinant protein in immobilized insect cell culture polyhedrosis virus in vitro. J Invertebr Pathol. 1997; 69: 1-6. using serum-free basal media after baculovirus infection. Biochemical Engineering Journal. 2006; 28: 67-72. 35. Ferrelli ML, Berretta MF, Belaich MN, Ghiringhelli PD, Sciocco-Cap A, RomanowskiV. The Baculoviral Genome. Garcia ML and Romanowski 18. Nair AJ. Introduction to Biotechnology and Genetic Engineering. V, editors. In: Viral Genomes-Molecular Structure, Diversity, Gene INFINITY SCIENCE PRESS LLC, Hingham, Massachusetts. 2008; 666- Expression Mechanisms and Host-Virus. In Tech. 2012; 1-31. 668. 36. Hunter-Fujita FR, Entwistle PF, Evans HF, Crook NE. Insect Viruses 19. Mosmann T. Rapid colorimetric assay for cellular growth and survival: and Pest Management. John Wiley and Sons Ltd, England. 1998. application to proliferation and cytotoxicity assays. J Immunol Methods. 1983; 65: 55-63. 37. McIntosh AH, Grasela JJ, Popham HJ. AcMNPV in permissive, semipermissive, and nonpermissive cell lines from Arthropoda. In 20. Manchenko GP. Handbook of detection of enzymes on electrophoretic Vitro Cell Dev Biol Anim. 2005; 41: 298-304. gels. 2nd edn. CRC press; 2003. 38. Son JH, Buchholz R, Park J, Kim SK. Production of baculoviruses and 21. Tabachnick WJ, Knudson DL. Characterization of invertebrate cell expression of green luorescent protein in immobilized Sf21 insect cell lines: II. Isozyme Analyses Employing Starch Gel Electrophoresis. In cultivation. Biochemical Engineering Journal. 2006; 29: 55-61. Vitro. 1980; 16: 392-398. 39. Wang MY, Kwong S, Bentley WE. Effects of oxygen/glucose/glutamine 22. Shilpashree K, Patil MS, UMa MS. Estimation of total phenols and feeding on insect cell baculovirus protein expression: a study on peroxidase isozyme in plants infected with blackeye cowpea mosaic disease. 2013; 26: 318-319. epoxide hydrolase production. Biotechnol Prog. 1993; 9: 355-361. 23. Bello FJ, Brochero H, Boshell J, Olano V, Rey G. Establishment and 40. Muralidhar RV, Jayachandran G, Singh P. Development of high-density characterization of a cell line from the mosquito Anopheles albimanus cultivation systems by bioencapsulation. CURRENT SCIENCE. 2001; (Diptera: Culicidae). Mem Inst Oswaldo Cruz. 1997; 92: 123-128. 81: 263-268. 24. McIntosh AH, Grasela JJ, Matteri RL. Identiication of insect cell lines 41. Jose S. Biopesticide: AGlobalStratgic Business Report.

Cite this article Ahmed I, Huebner H, Buchholz R (2014) Establishment and Characterization of three New Embryonic Spodoptera littoralis Cell Lines and Testing their Susceptibil- ity to SpliMNPV. JSM Biotechnol Bioeng 2(1): 1031.

Page 94 Research Article *Corresponding author PD.Dr. Sabine Mundt, Institute of Pharmacy, Ernst- Moritz-Arndt-University, Jahnstr.17, 17487 Greifswald, Microalgae - A Promising Germany, Tel: +493834864869; Fax: 493834864885; Email: Submitted: 15 April 2013 Source of Novel Therapeutics Accepted: 12 May 2014 Mundt, S.1*, Bui, H.T.1, Preisitsch, M.1, Kreitlow, S.1, Bui, H.T.1, Published: 14 May 2014 Pham, H.T.1, Zainuddin, E.1, Le, T.T.1, Lukowski, G.2 and Jülich, ISSN: 2333-7117 W.D. 1 Copyright © 2014 Mundt et al. 1Institute of Pharmacy, Ernst-Moritz-Arndt-University, Germany 2Institute of Marine Biotechnology, Rathenaustr, Germany OPEN ACCESS

Keywords Abstract Microalgae; Antimicrobial screening; Fatty Due to the growing resistance of pathogenic bacteria and fungi against acids; Lyngbyazothrins; Carbamidocyclophanes; commercially available therapeutics, the search for new antimicrobial substances is Microparticles of increasing importance. Based on the hypothesis that microorganisms living in an aquatic environment produce secondary metabolites as chemical weapons to survive in their daily fi ght against cohabitants of the biotope, a screening of 133 microalgae (121 cyanobacteria, 12 eukaryotic microalgae) was started. Biomass extracts and cultivation media were tested for activity against the Gram-positive bacteria Bacillus subtilis and Staphylococcus aureus, the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa as well as the yeast Candida maltosa. Our data indicates that 56 cyanobacterial strains and 5 eukaryotic algae exhibited antimicrobial activity. Interestingly, 19 of the screened cyanobacteria inhibited the growth of MRSA. Further, screening experiments revealed activity against Helicobacter pylori as well as fi sh pathogenic bacteria and plant pathogenic fungi. Strains exhibiting signifi cant antimicrobial activity were cultivated at 40L scale in order to conduct a bioassay-guided isolation and structure elucidation of the bioactive components. This procedure allowed identifi cation of bioactive secondary metabolites encompassing the hydroxylated fatty acids coriolic and dimorphecolic acid, lyngbyazothrins, cyclic depsispeptides and carbamidocyclophanes, belonging to the class of polyketides, which are responsible for the observed antimicrobial activity. In addition to tests of purifi ed bioactive compounds, whole biomass of selected microalgae was used to prepare microparticles by high pressure homogenization. Subsequent, in-vitro tests have shown that microparticles from biomass of the microalgal strain Bio 33, named Maresome®, inhibit dermal colonization of different MRSA strains. Since preliminary, clinical tests confi rm the in-vitro data, the anti-pathogenic potential of microalgae might be utilized in form of a prophylactic skin care product to prevent nosocomial infections.

ABBREVIATIONS 50,000 and 60,000 species, cyanobacterial species amount to only approximately 2000 species. Nonetheless, far more bioactive AA: Arachidonic Acid; ADC: Antibody Drug Conjugate; ALCL: compounds acting in micromolar to nanomolar range have been Anaplastic Large Cell Lymphoma; Aound: 3-amino-2,5,7,8- isolated from cyanobacteria. Examples of bioactive compounds tetrahydroxy-10-methylundecanoic acid; DCM: Dichloromethane; derived from cyanobacteria include hepato- and neurotoxins DHA: Docosahexaenoic Acid; EPA: Eicosapentaenoic Acid; EtOAc: isolated from genera such as Microcystis, Anabaena, Nodularia, Ethyl Acetate; GCMS: Gas Chromatography Mass Spectrometry; GLA: Gamma Linolenic Acid; MMA: Monomethylauristatin; Aphanizomenon, Cylindrospermopsis and Oscillatoria. In addition MRSA: Methicillin-Resistant Staphylococcus aureus; MSSA: to these toxins a variety of bioactive secondary metabolites with Methicillin-Sensitive Staphylococcus aureus; NES: North German cytotoxic/antitumoral, antibiotic, antiviral, anti-inlammatory MRSA Epidemic Strain; PSP: Paralytic Shellish Poisoning; and antiparasitic activity have been published [1-10]. PUFA: Polyunsaturated Fatty Acid; VRSA: Vancomycin Resistant An array of pharmaceutically relevant substances constitutes Staphylococcus aureus linear or cyclic peptides containing unusual amino acids, INTRODUCTION which are often connected to aliphatic residues, forming lipopeptides. Additional pharmacologically relevant peptides Microalgae are photoautotrophic microorganisms containing comprise depsipeptides. The majority of bioactive peptides chlorophyll a and other accessory pigments to convert sunlight, are derived from polyketide synthase/nonribosomal peptide carbon dioxide and water to carbohydrates, proteins and lipids synthetase activity. By contrast, ribosomally synthesized and in the process of photosynthesis. These organisms are found in both aquatic and terrestrial environments. The term microalgae posttranslational modiied peptides with pharmaceutical activity does not describe a distinct taxonomic group, because it includes have rarely been described [1-5,11,12]. In addition to microalgae eukaryotes such as diatoms, dinolagellates, green, red, brown derived bioactive peptides, pharmaceutically relevant natural and golden algae as well as prokaryotic cyanobacteria (blue-green products belonging to the class of alkaloids, carbohydrates and algae). While identiied eukaryotic microalgae number between terpenes have also been described [1-12].

Page 95 Central

Cyanobacteria belonging to the orders Nostocales and Karenia brevis and maitotoxin from Gambierdiscus toxicus Oscillatoriales with the genera Nostoc, Anabaena and Lyngbya are activators of sodium and calcium channels respectively, are important producers of bioactive secondary metabolites. resulting in strong neurotoxicity. The diatoms Nitzschia and The ilamentous cyanobacterium Lyngbya majuscula has been Pseudonitzschia are producers of the excitatory amino acid identiied as a “high-natural product production strain” because domoic acid, acting at the cerebral glutamate receptor [3]. in excess of 25% of all cyanobacterial natural products have been In this paper we present an antimicrobial natural product isolated from this species [1,4,13]. Prominent example of these screen of 121 cyanobacteria and 12 eukaryotic algae belonging natural products are the dolastatins, which display antineoplastic to the genera chlorophyta, heterokontophyta, charophyta, activities [1-4,12-14]. Monomethyl auristatin E (MMAE), a haptophyta and rhodophyta. Our screening procedure aims to synthetic dolastatin 10 derivative was coupled to a monoclonal identify compounds displaying activity against bacteria and antibody that can be targeted to speciic surface antigen such yeast/fungi, which are pathogenic in humans, ish and plants. as CD30, Nectin-4 or glycoprotein NMB, which are expressed by Subsequently, strains showing target activity were chosen different types of cancers. The Antibody-Drug-Conjugate (ADC) is for bioassay-guided isolation and structure elucidation of the internalized and cleaved only in cancer cells expressing the typical active compounds. In this context we focus on three classes of surface antigen,where the cytotoxic dolastatin analog is released. structures, which we could identify structurally. Finally, we tested The ADC targets CD 30 has been approved by the FDA in 2011 microparticles prepared from algae biomass by Maresome® [15] and in 2012 in Europe as Brentuximab vedotin (Adcetris®) technology for its ability to inhibit dermal colonization of MRSA. [16] for treatment of patients with Hodgkins lymphoma and patients with systemic anaplastic large cell lymphoma (ALCL), MATERIALS AND METHODS respectively [17,18]. Brentuximab vedotin is the irst approved Cultivation of microalgae drug derived from a cyanobacterial secondary metabolite. Further, CDX-011, an ADC with MMA E targets glycoprotein NMB 121 cyanobacterial strains and 12 strains of microalgae is in phase II of clinical trials [19]. deposited in the Culture collection of the Institute of Pharmacy, Department of Pharmaceutical Biology, Ernst-Moritz-Arndt- Eukaryotic microalgae containing considerable amounts University Greifswald were used for screening. The microalgae of polyunsaturated fatty acids (PUFA) such as DHA, EPA, AA were cultivated batchwise in 2 L Fehrnbach lasks with 1000 mL and GLA, polysaccharides, pigments and essential amino acids BG 11 medium [26] at 25°C under continuous illumination with are used commercially as foodstuff and animal feed. PUFAs 20 μmol m-2 s-1 with cool white luorescent lamps over 35 d. may reduce the risk of coronary heart disease and prevent Large scale cultivation was carried out in a 50 L cylindrical development of atherosclerosis [7]. DHA derived from the air-lift bioreactor [27]. Biomass and cultivation medium were microalgae Crypthecodinium, Schizochytrium and Ulkenia sp. is harvested after 35 d by centrifugation. The biomass was washed used as supplement for baby food to promote development of with distilled water, lyophilized and kept at -20°C until use. The the infant’s eyes and brain [6]. Recently, DHA, EPA and higher cultivation medium was iltrated and frozen at -20°C. unsaturated fatty acids were shown to have antimicrobial activities against Propionibacterium acnes and Staphylococcus Extract preparation aureus [20,21]. The irst antibacterial compound isolated 1 g dried biomass was extracted with 3x150 mL n-hexane, from microalgae was Chlorellin from Chlorella spp., which was methanol and water successively. The supernatants of each identiied as a mixture of fatty acids [7,22]. Furthermore, a extraction were combined; the organic solvents were removed glycoprotein isolated from Chlorella vulgaris culture supernatant in vacuum at 40°C and the water by lyophilization. A volume of has shown protective activity against tumor metastasis and 3000 mL culture medium was reduced to 300 mL in vacuum at chemotherapy-induced immune suppression in mice [23]. 40°C. 300 mL ethyl acetate (EtOAc) was added and the mixture Another prominent example is the polysaccharide β-1,3-glucan was shaken for 24 h. The EtOAc layer was separated and the can, which is accumulated in several microalgae such as Chlorella, aqueous layer was shaken again with 300 mL EtOAc. The EtOAc Skeletonema, Nannochloropsis, Euglena and linked with antiviral, layers were combined, dried over sodium sulphate and the EtOAc antitumor and immune stimulating effects. More recently, β-1,3- was removed in vacuum. For isolation of the pure compounds, glucans were linked to regulation of blood glucose and insulin extractions were carried out according to [28-30]. response in humans [6,24]. Sulfated polysaccharides of the red microalgae Porphyridium cruentum displayed antiviral activity In vitro screening test system against Herpex simplex and Varicella zoster viruses, and may The antibacterial and antifungal activity of the n-hexane, prevent colon cancer [6]. Carotenoids with antioxidant effects methanol, water and EtOAc extracts were evaluated in agar such as α- and β-caroten, lutein, zeaxanthin, astaxanthin seem diffusion assay according to the methods of the European to be responsible for prevention of neurodegenerative and Pharmacopoeia [31]. Extracts (2 mg/6 mm paper disc) were tested cardiovascular diseases, diabetes, osteoporoses and cancer [25]. against the ATCC strains Bacillus subtilis 6051, Staphylococcus In contrast to cyanobacteria, which produce numerous aureus 6538, Escherichia coli 11229, Pseudomonas aeruginosa bioactive natural products with activities in the low micromolar 27853. The yeast Candida maltosa SBUG 700 was provided by the or nanomolar range, such compounds are rarely isolated from Institute of Microbiology of the Ernst-Moritz-Arndt-University, eukaryotic algae. An exception are dinolagellates which produce Greifswald. The following antibiotics were tested as reference: highly active sodium channel blockers such as saxitoxin and Ampicillin 10μg B. subtilis (inhibition zone 33 mm) and S. aureus neosaxitoxin. Polyether compounds such as brevetoxin A from (inhibition zone 35 mm), 50μg E. coli (inhibition zone 26 mm);

Page 96 Central

Table 1: Antimicrobial activity of cyanobacterial and microalgal extracts obtained from different solvents. Antimicrobial activity Strains tested Active strains Extracts tested Active extracts Cyanobacteria 121 56 410 97 n-hexane 102 16 (4) activity* ≤10mm >10 mm to ≤ 16mm >16mm to ≥ 31 mm 12 3 1 methanol 121 48 (17) activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 16 28 4 water 121 8 (3) activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 43 1 EtOAc (medium) 66 25 (6) activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 10 9 6 Eukaryotic algae 12 5 96 18 n-hexane 23 7 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 52 0 dichloromethane 20 1 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 10 0 methanol 23 2 (1) activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 20 0 water 23 2 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 20 0 EtOAc (medium) 7 6 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 24 0 MRSA activity Strains tested Active strains Extracts tested Active extracts Cyanobacteria 47 19 144 20 n-hexane 26 0 methanol 50 18 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 49 2 water 50 0 dichloromethane 6 0 EtOAc (medium) 12 2 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 01 1 Eukaryotic algae 11 0 60 0 n-hexane 14 0 dichloromethane 14 0 methanol 14 0 water 14 0 EtOAc) medium 4 0

Page 97 Central

Activity to ishpathogenic Strains Active strains Extracts tested Active extracts bacteria tested Cyanobacteria 42 11 106 21 n-hexane 22 9 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 09 0 methanol 42 11 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 35 3 water 42 1 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 00 1 Eukaryotic algae 7 3 19 5 n-hexane 5 2 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 02 0 methanol 7 3 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 12 0 water 7 0 Activity to Helicobacter pylori Strains tested Active strains Extracts tested Active extracts Cyanobacteria 15 6 56 17 n-hexane 14 5 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 23 0 dichloromethane 5 3 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 20 1 methanol 15 6 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 41 1 water 11 1 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 10 0 EtOAc (medium) 11 2 activity* ≤10mm >10 mm to ≤ 16mm >16 mm to ≥ 31 mm 20 0 Eukaryotic algae n.t. n.t. n.t. n.t. Abbreviations: n.t. not tested; ( ) extracts with antifungal activity; n=3 with two parallels in agar diffusion assay, 2 mg extract/6mm paper disk;*inhibition zone including diameter of paper disc; inhibition zone ≤ 10mm – low activity; inhibition zone >10 mm to ≤ 16mm – moderate activity; inhibition zone >16mm to ≥ 31 mm – good activity [32].

Gentamicin 20μg P. aeruginosa (inhibition zone 26 mm); Nystatin aeruginosa 595 (Institute of hygiene Greifwald). Selected extracts 10μg C. maltosa (inhibition zone 22 mm). Tests for antibacterial were tested for activity against Helicobacter pylori in cooperation effects against multiresistant strains of human pathogenic with Institute of hygiene Greifwald. bacteria were carried out in cooperation with the Institute To investigate activity against ish pathogenic bacteria, of hygiene, Greifswald. The following multiresistant strains the strains Pseudomonas anguilliseptica DSMZ 12111, Vibrio were used: North German MRSA epidemic strain (NES), MRSA 34289 (Friedrich Loefler Institute of Medical Microbiology, anguillarum DSMZ 11323, Aeromononas salmonicida ssp. Ernst-Moritz-Arndt-University, Greifswald); Staphylococcus salmonicida ATCC 51413, Aeromonas hydrophila ssp. hydrophila epidermidis 847, Staphylococcus haemolyticus 535, Pseudomonas DSMZ 6173, Flexibacter maritimus DSMZ 17995 and Yersinia

Page 98 Central

Table 2: Activity of cyanobacteria against phytopathogenic fungi. Activity phytopathogenic fungi Strains tested Active strains Extracts tested Active extracts Cyanobacteria 34 3 152 3 n-hexane 13 0 methanol 68 3 water 68 0 EtOAc (medium) 30 Eukaryotic algae n.t. n.t. n.t. n.t. Abbreviations: n.t. not tested n=3 with two parallels, agar diffusion assay, 2 mg extract/6mm paper disk; inhibition zone including diameter of paper disc. ruckeri ATCC 29493 were investigated. As reference, 10μg of GC/MS oxytetracylcline was used. Depending on the bacterial strain N-hexane and EtOAc extracts were analyzed after hydrolysis inhibition zones between 27 and 55 mm were measured. The (5 mg biomass + 0.5 mL NaOH in 50% aqueous MeOH, 45 min phytopathogenic fungi Alternaria sp., Botrytis cinerea, Drechslera 80°C), extraction of the fatty acids with ether and derivatization sp. and Microdochium nivale were obtained from the DSMZ with diazomethane by a GC 80007 MD 800 (Fisons instruments). Braunschweig. A DB5 MS column (J &W Scientiic] was used and the temperature Diameters of the inhibition zones were measured over the was increased from 80°C to 280°C (8°C per min). whole zone including the paper disc (6 mm). The evaluation of RESULTS AND DISCUSSION the antibacterial and antifungal activity, respectively, was carried out according to the following schema: 1. Inhibition zone ≤ 10mm General antimicrobial screening of algae extracts – low activity; 2. inhibition zone >10 mm to ≤ 16mm – moderate In a basic screening for antimicrobial activity 506 extracts of activity; 3. inhibition zone >16mm to ≤ 31 mm – good activity; 4. different polarity prepared from biomass and cultivation medium inhibition zone >31mm – excellent activity [32]. of 121 cyanobacteria and 12 strains of eukaryotic microalgae Preparation of Maresome® have been tested in agar diffusion test. The activity screen encompassed two Gram-positive bacteria (Bacillus subtilis, The microparticles were produced using a special Staphylococcus aureus), two Gram-negative bacteria (Escherichia microencapsulation technique [33]. Biomass and n-hexane were coli, Pseudomonas aeruginosa) and the yeast Candida maltosa mixed (1:10 v/v) and the organic solvent was evaporated in a (Table 1). rotatory evaporator. The remaining dried biomass was dispersed Of the evaluated extracts derived from cyanobacteria, 56 in a surfactant-water mixture and homogenized by a high strains exhibited antimicrobial activities and a total of 97 extracts pressure homogenizer. The zeta potential was estimated with a inhibited at least one of the test organisms. Methanol extracts zetasizer 4 (Malvern Instruments, UK). The particle mixture was showed the highest bioactivity score with 40% of the tested incorporated into an ointment (Heitland & Petre International extracts showing activity. The lowest bioactivity score with GmbH, Celle, Germany). In the same manner ointments based 7% was observed with water extracts. Tests with the lipophilic on biomasses of Chlorella, Arthrospira (formerly Spirulina) and n-hexane extracts derived from cyanobacterial biomass Spirogyra were produced. indicated that overall 16% showed antimicrobial activity. By Test of Maresome® contrast 38% of the EtOAc extracts derived from the cultivation medium inhibited the growth of the test organisms. Yields for The Maresome® were tested in the animal models mouse EtOAc and hexane extracts were only 0.2 and 1.5 %, respectively, ear (direct contamination) and cow udder teat (skin to skin therefore limiting further tests. GCMS analyses of the n-hexane ® transmission) [34]. Mouse ears were prepared with Maresome and EtOAc extracts revealed the presence of saturated and ® ointment and Maresome free ointment as control in the direct unsaturated fatty acids may be responsible for the antimicrobial contamination test. The prepared mouse ears were contaminated activity [21,35,36]. The tested extracts inhibited the growth of with MRSA strain NES. Thereafter the mouse ears were streaked Gram-positive bacteria. Additionally, methanol extracts of the on Mueller-Hinton II-agar plates and the agar plates were biomass of the freshwater Lyngbya sp. SAG 36.91 as well as of two o incubated for 48 h at 30 C, checked for bacterial growth and the Vietnamese cyanobacteria Westiellopsis sp. and Calothrixelenkinii colonies were enumerated. For skin to skin transmission test showed low to moderate activity with inhibition zones of 8 the “donor”- cow udder teat skin was contaminated also with and 12 mm against the Gram-negative bacteria Pseudomonas MRSA strain NES. The “acceptor”- cow udder teats were treated aeruginosa and Escherichia coli. Of the assayed extracts listed with Maresome® ointment. Maresome® - free ointment was used in table 1, 30 extracts displayed antifungal activity. From these as control. The “acceptor skin” was brought into contact to the extracts 3 methanol extracts derived from the biomass of two “donor skin” for 10 s. Subsequently the cow udder teats were Aphanizomenon spp. and one Anabaena sp. speciically inhibited streaked on the agar plates. The agar plates were incubated for the growth of the yeast Candida maltosa, while not showing any 48 h at 30°C and the MRSA colony number was determined. antibacterial activity.

Page 99 Central

COOH COOH

CH3 CH3 HO OH 9-HODE dimorphecolic acid 13-HODE coriolic acid

Carbamidocyclophans A - E

R5 R1 R1 R2 R3 R4 R5 R6

A Cl Cl Cl Cl OCONH2 OCONH2 HO OH R2 B Cl Cl Cl H OCONH2 OCONH2

R3 HO OH C Cl Cl H H OCONH2 OCONH2

D Cl H H H OCONH2 OCONH2 R4 R6 E H H H H OCONH2 OCONH2

F Cl Cl Cl Cl OH OCONH2 G Cl Cl Cl Cl OCOCH3 OCONH2

Arom-9 R2 L-Pro-10 O OH

Lynbyazothrins A - D OH OH N HN R R L-Thr-8 HN 1 2 O O O NH D-Gln-1 A OCH3 H HO O O O B H H HN O C OCH3 C12H14NO3 HN NH2 D H C12H14NO3 DeH-Thr-7 NH OH Gly-2 N O O L-Ser-6 HN O L-Pro-3 OH O O O N N O N D-aIlo-Ile-5 H

L-Pro-4 R2=C12H14NO3

Figure 1 Antimicrobial active compounds from cyanobacteria.

Screening of 96 extracts of 12 eukaryotic microalgae belonging reviews have estimated the prevalence of nosocomial infections to the chlorophyta, haptophyta, charophyta, heterokontophyta in high-income countries at 7.6 % and in low and middle-income and rhodophyta resulted in identiication of 5 active strains. Of the countries at 10.1 % [37]. Commonly, infections with multidrug 43 tested lipophilic (n-hexane and DCM) biomass derived extracts resistant strains result in high mortality rates. Based on this 8 displayed activity to Gram-positive bacteria. Additionally, two background, the search for novel reserve antibiotics is an ongoing aqueous extracts caused inhibition activity against E. coli and research challenge. Therefore we have extended our screening Pseudomonas aeruginosa; and 1 methanol extract inhibited the to four multiresistent Staphylococcus strains and Pseudomonas growth of the yeast with inhibition zones ≤ 10mm. Although 6 aeruginosa. Initially we tested 144 extracts from 47 cyanobacteria of 7 medium extracts exhibited antibacterial activity, inhibition (Table 1) using the agar-diffusion assay. Interestingly, 19 zones between 8 and 15 mm indicated low to moderate activity cyanobacterialstrains and 20 extracts, demonstrated inhibitory and mixtures of fatty acids seem to be responsible for the effect. activity against MRSA. No activity was observed with n-hexane, dichloromethane and water extracts. Also, no growth inhibition Targeting screening of algae extracts against MRSA of Pseudomonas aeruginosa was observed. Extracts of the tested and Helicobacter pylori eukaryotic microalgae displayed no activity to multiresistant test Today worldwide nosocomial infections are caused by organisms. multiresistant bacteria such as MRSA but also VRSA and multi drug Further screening of cyanobacteria for activity towards resistant Streptococcus and Enterococcus strains, Mycobacterium Helicobacter pylori, a Gram-negative, microaerophilic bacterium tuberculosis, Pseudomonas aeruginosa, E. coli and Klebsiella known as cause for developing chronic gastritis, ulcer and gastric sp. Generally, multidrug resistance of various bacterial strains cancer, disclosed that 6 of 15 tested strains (Table 1) exhibited represents an increasing clinical problem. Recent systematic activity.

Page 100 Central

Screening of algae extracts against ish pathogens [38] showed that eukaryotic algae also produce active secondary and plant pathogenic fungi metabolites inhibiting proliferation of plant pathogens. Although bacterial diseases of ish such as saddleback disease, Based on the results of the screening the three extracts were erythrodermatitis, red spot disease, in rot, furunculosis and selected for bioassay-guided isolation and structural elucidation vibriosis are caused by Gram-negative bacteria, a screening of of the active compounds: 1. the n-hexane biomass extract of the 106 extracts from 42 cyanobacteria resulted in 11 active strains freshwater cyanobacterium Limnothrix redekei HUB 051 with and 21 active extracts (Table 1). The main activity was found in inhibition zones between 18 and 20 mm against Gram-positive methanol extracts, 11 of 42 extracts displayed activity. From the bacteria the most active n-hexane extract; 2. the biomass derived tested eukaryotic microalgae 3 of 7 strains and 5 of 19 extracts methanol extract of the freshwater Lyngbya sp. with bioactivity caused growth inhibition of the pathogens with inhibition zones against Gram-positive and Gram-negative bacteria and 3. the between 7 and 15 mm in agar-diffusion assay. methanol extract prepared from the biomass of the Vietnamese cyanobacterium Nostoc sp. inhibiting growth of MRSA. The Furthermore, selected cyanobacterial strains were tested structures of the compounds discussed are shown in (Figure 1). for activity to plant pathogenic fungi (Table 2). From 34 strains and 152 extracts, the biomass derived methanol extracts of Fatty acids from Limnothrix redekei HUB 051 Cylindrospermum majus, Calothrix gracilis and Oscillatoria sp. From the n-hexane biomass extract of Limnothrix redekei revealed activity to Microdochium nivale, the pathogen causes HUB 051, (formerly Oscillatoria redekei ) α-linolenic acid and two snow mould, a cereal diseaseof great economic importance. The hydroxylated derivatives of α-linoleic acid, α-dimorphecolic acid described activity of Scenedesmus extracts against Alternaria sp. (19-HODE) and coriolic acid (13-HODE) (Figure 1) were isolated.

1200

1000

800

600

400

200 colony forming colony units

0 control Arthrospira Spirogyra Chlorella Bio 33

Figure 2 Inluence of Maresome®prepared from biomass of Bio 33 (n=50) Arthrospira, Spirogyra and Chlorella (n = 6) on the colonization of MRSA strain NES in the model “Mouse ear”(direct contamination).

2000

1800

1600

1400

1200

1000

800

600 colony forming colony units

400

200

0 donator(NES) acceptor(NES) control(NES) donator(ATCC) acceptor(ATCC) control(ATCC)

Figure 3 Inluence of Bio 33 Maresome® (n = 18) on the colonization of MRSA Strain NES and MSSA strain ATCC 6835 in the model “Cow udder teat” (skin to skin transmission).

Page 101 Central

In agar diffusion tests, these acids and also the non-hydroxylated compounds lyngbyzothrin C and D proteasome-inhibiting α-linoleic acid exhibited activity towards Staphylococcus aureus activity, but no cytotoxic effects to human colon cancer cells HT29 strains. Yet only α-linoleic and α-linolenic acid were able to was described [42].Therefore, the antimicrobial activity seems to limit growth of MRSA [27,28]. Fatty acids and their derivates be not associated with cytotoxic effects. Overall, antimicrobial are known as antimicrobial active substances. Already the irst activity of the lyngbyazothrins is rather moderate with MICs in antimicrobial substance Chlorellin, isolated from microalgae micromolar range and no MRSA activity was detected. The yield of the genus Chlorella [22] was identiied as a mixture of C18 of the binary mixtures A/B was 0.1% and C/D 0.2% of dry weight fatty acids. Apart from antibacterial effects, the release of fatty but separation of the mixtures to obtain pure compounds was acids into the cultivation medium resulted in allelopathic effects, hindered by rearrangement of structural isomers. A method for a mechanism to improve the survival of the producers in their total synthesis of the compounds has not been described. environment [39]. Mixtures of polyunsaturated and saturated fatty acids, such as eicosapentaenoic acid and α-linolenic Carbamidocyclophanes from Nostoc sp. CAVN 10 acid produced by microalgae are identiied as antimicrobial Cyanobacteria also employ the polyketide pathway to agents especially towards Gram-positive bacteria or even synthesize natural products. Cylindro- and nostocyclophanes MRSA [20]. Recently, long-chain unsaturated fatty acids and from Nostoc linkia and Cylindrospermum licheniforme were hydroxylated derivatives such as 15-hydroxyeicosapentaenoic isolated by the group of Moore in the 1990 as the irst natural acid and 15-hydroxyeicosatrienoic acid with inhibitor activity paracyclophanes belonging to polyketides exhibited cytotoxic to Staphylococcus aureus and Propionobacterium acnes were effects to several tumor cell lines [43-45]. Nostocyclyne, a triple discussed as potential agents in treatment of skin infections [21]. bond containing paracyclophane from a ield-collected Nostoc Even though the exact mechanism of action for the antimicrobial sp. caused growth inhibition of Gram-positive bacteria such as activity of fatty acids is not fully clariied, the most probable Bacillus subtilis and Staphylococcus aureus [46]. The methanol target seems to be the cell membrane. Damage to the membrane extract prepared from the biomass of the Vietnamese Nostoc will lead to cell leakage and eventually lysis of bacterial cells. strain CAVN 10, exhibited activity against Bacillus subtilis, A peroxidative mechanism involving hydrogen peroxide is Staphylococcus aureus and Candida maltosa in the basic screening proposed by Dubois [40]. with inhibition zones between 13 and 18 mm in agar diffusion Cyclic depsipeptides from Lyngbya sp. SAG 36.91 assay. Furthermore, the growth of MRSA strains 535 and 847 was inhibited by the extract. Bioassay-guided fragmentation From the structural point of view, linear and cyclic of the extract resulted in ive novel carbamidocyclophanes A-E peptides often with lipophilic side chains are the main group (Figure 1), characterized by two carbamidogroups in contrast of cyanobacterial secondary metabolites. Most peptides are of to the known cylindrocyclophanes. Compounds A-D differ in mixed polyketide synthase/nonribosomal peptide synthetase their degree of chlorination at the end of the butyl side chains. origin and biosynthetic pathways are more and more elucidated Carbamidocyclophane A contains 4 chlorine atoms whereas in [11]. Cyanobacteria belonging to the genus Lyngbya are compounds B-E, the chlorine groups are successively replaced important producers of bioactive peptides and have potential for by hydrogen atoms so that carbamidocyclophane E is the therapeutically use [13]. Especially marine strains of Lyngbya, only non-chlorinated compound. The antibacterial activity to present worldwide in tropical and subtropical regions, have Staphylococcus aureus was moderate in the milli molar range. In been investigated. Surprisingly, methanol/water extracts of contrast to that, ampicillin, a well-known antibiotic, exhibited an Lyngbya sp. SAG 36.91, a freshwater strain from the temperate MIC of 2.2 μmol in our test system. The carbamidocyclophanes climate, inhibited growth of Bacillus subtilis, E. coli, Pseudomonas also displayed cytotoxic effects to different tumor cell lines in aeruginosa as well as all ish pathogenic bacteria employed in our micromolar concentrations, so that cytotoxic effects may be screening. Fractionation of the 50% water methanol extract by responsible for antibacterial activity [30]. Meanwhile, new column chromatography including HPLC lead to identiication cylindrocyclophanes from a Nostoc sp. with protease inhibiting of four cyclic undecapeptides, lyngbyazothrins A-D (Figure 1) and cytotoxic activity to different tumor cell lines have been as binary mixtures A/B and C/D, respectively. Only the mixture published [47]. Merocyclophanes A and B, also isolated from C/D, structurally characterized by an N-acetyl-N-methyltyrosine residue at the free hydroxyl group at C5 of Aound (3-amino- Nostoc, consist of a novel carbon skeleton, which is characterized 2,5,7,8-tetrahydroxy-10-methylundecanoic acid) showed activity by the presence of α-branched methyl residues [48].The towards Bacillus subtilis with MIC of 16μM and to E. coli with MIC compounds display cytotoxic activity against human colon cancer of 65μM. It seems that the antimicrobial activity depends on the cell line HT-29. Most recently, isolation of carbamidocyclophanes linkage of the acyl group at the C-5 position of the Aound unit, F and G (Figure 1) from a freshwater Nostoc strain together as only the binary mixture C/D showed antibacterial activity. No with the already known carbamidocyclophanes A, B, C [49] activity towards MSSA and MRSA was observed [29]. Identical was described. All compounds were evaluated for antibacterial structures have been published as portoamides A and B [41,42], activity and inhibited growth of Staphylococcus aureus and which reportedly are released into the cultivation medium by the Enterococcus faecalis in micromolar range. In the new compounds cyanobacterium Oscillatoria sp. and responsible for allelopathic F and G, one carbamido group is replaced by a hydroxyl group effects to the green alga Chlorella vulgaris. Portoamides C and D, (F) and by acetate (G), respectively (Figure 1). The loss of one identical to lyngbyazothrins A and B, are discussed as hydrolysis carbamido group seems to be responsible for activity against artefacts generated during natural detoxiication of the active Mycobacterium tuberculosis, especially the free hydroxyl group metabolites in aqueous medium [41]. For the separated causes strong activity of carbamidocyclophane F with MIC of 0.8

Page 102 Central

μM in comparison to MICs >10 μM of carbamidocyclophanes A-C Similar strong inhibition effects of a palmitoleic acid isomer (Figure 1) [49]. against S. aureus were found also in human skin sebum [53]. Dermal treatment with cis-6-hexadecenoic acid also leads to a Microparticle as novel application form to prevent reduction of S. aureus colonization [54]. Since preliminary clinical MRSA colonization on the skin tests conirm the in-vitro data, the anti-pathogenic potential of Apart from low molecular secondary metabolites, microalgae microalgae might be utilized in form of a prophylactic skin care contain polysaccharides, pigments, lipids and proteins and product to prevent nosocomial infections. the use of the whole biomass as foodstuff and animal feed is in CONCLUSION development. Microparticles named Maresome® of the whole biomass as dermal application form is a novel approach [33] Screening microalgae for antimicrobial activity, we have to prevent colonization of MRSA on the skin, which constitutes identiied several prokaryotic cyanobacterial strains with distinct the irst step in the development of an infection. Biomass of and speciic effects in-vitro. Through bioassay guided isolation 3 cyanobacteria and 3 eukaryotic microalgae, including the secondary metabolites, structurally belonging to fatty acids, well-known Arthrospira, formely Spirulina and Chlorella, was peptides and polyketides were obtained. Due to low activity formed into Maresome® by high-pressure homogenization and and stability under physiological conditions, the therapeutically Maresome® containing ointments were prepared. It was shown potential of fatty acids appears low at this point. However, the with the mouse ear assay, a direct contamination model, that only remarkable ability of microparticles prepared from the biomass Maresome® prepared from the biomass of the cyanobacterial of the cyanobacterium Bio 33 to prevent colonization of MRSA strain Bio 33 was able to prevent colonization of NES strain on the skin seems to be caused by a special composition of fatty completely (Figure 2). acids. Especially high amounts of unsaturated fatty acids and their unusual isomers seem to be responsible for this phenomenon. Maresome® prepared from Chlorella and Arthrospira biomass exhibited also activity but to a lower degree. In the cow udder From the small molecular secondary metabolites, teat model, the transmission of MRSA from the donor skin to an paracyclophanes seem to have potential as lead structures for acceptor skin was evaluated. Pretreatment of the acceptor with development of new antibiotics. They are produced by different Bio 33 Maresome® inhibited the colonization of attached NES on cyanobacterial strains and can be isolated as pure compounds the acceptor completely (Figure 3). The colonization of MSSA was in yields between 0.1 to 0.2%. They also show biological also fully inhibited. The reason of this protecting effect may be activities against multidrug resistant bacteria and irst insights that lipid containing Maresome® form an anti-adhesion ilm on in the biosynthetic pathways reveal opportunities to modify the the outer layer of the skin, the stratum corneum, and interact in biosynthesis of highly active substances [48,55,56]. To ensure this way with MRSA. The Bio 33 Maresome® have a high negative supply of the compounds, large scale cultivation strategies zeta potential (-38.8 mV) leading to electrical repulsion forces. and development of heterologous expressions systems using Due to the negatively charged surface of Staphylococcus aureus, heterotrophic bacteria are promising strategies. [50] it can be speculated that the attachment of the bacteria ACKNOWLEDGEMENT is inhibited by that repulsion forces between the negatively charged bacteria and the negatively charged Maresome®. The We thank the BMBF, the DAAD and the government of question why Maresome® prepared from different biomasses of Mecklenburg-Vorpommern for inancial support. Further, we microalgae show remarkable differences in their effectiveness thank the Humboldt-University-Berlin, Institute for Ecology for in inhibiting colonization of MRSA on the skin is not resolved. providing the laboratory culture of HUB 051 and Dr. N. V. Tran, A reason for the differences in activity could be found in the IBT Hanoi for providing the laboratory culture of Nostoc sp. CAVN different lipid composition of the biomass used for preparation 10. Beate Cuypers, Institute of Marine Biotechnology, Greifswald, of Maresome®. Gas chromatographic analyses revealed that is thanked for isolating strain Bio 33 and Hannelore Bartrow for there were differences in fatty acid composition of Bio 33 in her skillful technical assistance. comparison to Arthrospira, Chlorella and Spirogyra. The main fatty acids in Arthrospira biomass are palmitic acid, linoleic acid REFERENCES and γ-linolenic acid [51]. Main fatty acids in Spirogyra biomass 1. Burja AM, Banaigs B, Abou-Mansour E, Burgess JG, Wright PC. Marine are palmitic and linolenic acid [52]. In the used Chlorella strain cyanobacteria – a proliic source of natural products. Tetrahedron. the main fatty acid was palmitic acid (27%), followed by oleic 2001; 57: 9347–9377 acid (17%) and linoleic acid (8%); small amounts of palmitoleic 2. Nunnery JK, Mevers E, Gerwick WH. Biologically active secondary acid and stearic acid also have been detected. Analysis of the metabolites from marine cyanobacteria. Curr Opin Biotechnol. 2010; fatty acids of the cyanobacterium Bio 33 showed that the 21: 787-793. quantitative dominating fatty acids are palmitic acid (49%), 3. Niedermeyer T, Brönstrup M. Natural product drug discovery from linolenic (32%) and linoleic acid (8%). In contrast to the other microalgae. Posten C, Walter C, editors. Microalgal biotechnology: microalgae, Bio 33 contains palmitoleic acid isomer C16:1 Δ7 integration and economy. Berlin: De Gruyter. 2012; 169-202. and higher unsaturated derivatives such as 7,10 hexadecadienoic and 7,10,13 hexadecatrienoic acid. We conclude that the high 4. Tan LT. Bioactive natural products from marine cyanobacteria for drug discovery. Phytochemistry. 2007; 68: 954-979. amount of unsaturated fatty acids, especially linolenic acid, but also C16 derivatives released from the Maresome® on the skin 5. Tarman K, Lindequist U, Mundt S. Metabolites of Marine are responsible for the prevention of colonization with MRSA. microorganisms and their pharmacological activities. Kim SK, editor.

Page 103 Central

Marine Microbiology: bioactive compounds and biotechnological Environ Health. 2001; 203: 327-334. applications. Weinheim: Wiley-VCH; 2013; 393-416. 28. Mundt S, Kreitlow S, Jansen R. Fatty acids with antibacterial activity 6. Rosello Sastre R. Products from microalgae: an overview. Posten C, from the cyanobacterium Oscillatoria redekei HUB 051. J Appl Phycol. Walter C, editors. Microalgal biotechnology: integration and economy. 2003; 15: 263–267. Berlin: De Gruyter; 2012; 13–50. 29. Zainuddin EN, Jansen R, Nimtz M, Wray V, Preisitsch M, Lalk M, et al. 7. Mostafa SSM. Microalgal biotechnology. Prospects and applications. Lyngbyazothrins A-D, antimicrobial cyclic undecapeptides from the Dhal NK, Sahu SC, editors. Plant Science. In Tech; 2012; 275–314. cultured Cyanobacterium lyngbya sp. J Nat Prod. 2009; 72: 1373-1378.

8. Blunt JW, Copp BR, Keyzers RA, Munro MHG, Prinsep M. Marine 30. Bui HT, Jansen R, Pham HT, Mundt S. Carbamidocyclophanes A-E, natural products. Nat Prod Rep 2012; 29: 144–222. chlorinated paracyclophanes with cytotoxic and antibiotic activity from the Vietnamese cyanobacterium Nostoc sp. J Nat Prod. 2007; 70: 9. Blunt JW, Copp BR, Keyzers RA, Munro MH, Prinsep MR. Marine 499-503. natural products. Nat Prod Rep. 2013; 30: 237-323. 31. European Pharmacopoeia. Microbial assay of antibiotics, 5th edn. 10. Blunt JW, Copp BR, Keyzers RA, Munro MH, Prinsep MR. Marine Council of Europe (COE), European Directorate for the Quality of natural products. Nat Prod Rep. 2014; 31: 160-258. Medicines (EDQM). 2005; 5.3: 188.

11. Sivonen K, Börner T. Bioactive compounds produced by cyanobacteria. 32. Bansemir A, Phytochemische und biologische Untersuchungen Herrero A, Flores E, editors. The cyanobacteria: molecular biology, ausgewählter Makroalgen unter besonderer Berücksichtigung genomics and evolution. Norfolk: Caister Academic Press. 2008; 159- ihrer Wirksamkeit gegen die Erreger bakterieller Fischkrankheiten 198. [dissertation]. Greifswald: Ernst-Moritz-Arndt-University, 2004. 12. Singh RK, Tiwari SP, Rai AK, Mohapatra TM. Cyanobacteria: an 33. Lukowski G, Lindequist U, Jülich WD, Mundt S. Pharmazeutisch oder emerging source for drug discovery. J Antibiot (Tokyo). 2011; 64: kosmetisch wirksame Mittel aus lipidhaltigen marinen Organismen. 401-412. EP 2 255 821 A1. 2010. 13. Liu L, Rein KS. New peptides isolated from Lyngbya species: a review. 34. Lukowski G, Lindequist U, Mundt S, Kramer A, Julich WD. Inhibition Mar Drugs. 2010; 8: 1817-1837. of dermal MRSA colonization by microalgal micro- and nanoparticles. Skin Pharmacol Physiol. 2008; 21: 98-105. 14. Tan LT. Filamentous tropical marine cyanobacteria: A rich source of natural products for anticancer drug discovery. J Appl Phycol. 2010; 35. Wu JT, Chiang YR, Huang WY, Jane WN. Cytotoxic effects of free fatty 22: 659–676. acids on phytoplankton algae and cyanobacteria. Aquat Toxicol. 2006; 80: 338-345. 15. U.S. Food and Drug Administration 36. Pham HTL. Bioassay-guided isolation of cytotoxic and antifungal 16. European Medicines Agency compounds from cyanobacteria [dissertation]. Greifswald: Ernst- Moritz-Arndt-University. 2007. 17. Younes A, Yasothan U, Kirkpatrick P. Brentuximab vedotin. Nat Rev Drug Discov. 2012; 11: 19-20. 37. Report on the burden of endemic health care associated infection word wide. 2011. 18. Katz J, Janik JE, Younes A. Brentuximab Vedotin (SGN-35). Clin Cancer Res. 2011; 17: 6428-6436. 38. Ördög VO, Stirk WA, Lenobel R, Bancirova M, Strnad M, van Staden J, et al. Screening microalgae for some potentially useful agricultural 19. Marine Pharmaceuticals: The Clinical Pipeline and pharmaceutical secondary metabolites. J Appl Phycol. 2004; 16: 20. Amaro HM, Guedes AC, Malcata FX. Antimicrobial activities of 309–314. microalgae: an invited review. 3rd edn. Mendez-Villas A, editor. Science 39. DellaGreca M, Zarrelli A, Fergola P, Cerasuolo M, Pollio A, Pinto G. Fatty against microbial pathogens: communicating current research and acids released by Chlorella vulgaris and their role in interference with technological advances. Badajoz: Formatex; 2011; 12721–12280. Pseudokirchneriella subcapitata: experiments and modelling. J Chem 21. Desbois AP, Lawlor KC. Antibacterial activity of long-chain Ecol. 2010; 36: 339-349. polyunsaturated fatty acids against Propionibacterium acnes and 40. Desbois AP, Mearns-Spragg A, Smith VJ. A fatty acid from the diatom Staphylococcus aureus. Mar Drugs. 2013; 11: 4544-4557. Phaeodactylum tricornutum is antibacterial against diverse bacteria 22. Pratt R, Daniels TC, Eiler JJ, Gunnison JB, Kumler WD, Oneto JF, including multi-resistant Staphylococcus aureus (MRSA). Mar Strait LA. CHLORELLIN, AN ANTIBACTERIAL SUBSTANCE FROM Biotechnol (NY). 2009; 11: 45-52. CHLORELLA. Science. 1944; 99: 351-352. 41. Leão PN, Pereira AR, Liu WT, Ng J, Pevzner PA, Dorrestein PC, et al. 23. Barsanti L, Gualtieri P. editors. Algae. Anatomy, biochemistry and Synergistic allelochemicals from a freshwater cyanobacterium. Proc biotechnology. Boca Raton: CRC press. 2006. Natl Acad Sci U S A. 2010; 107: 11183-11188. 24. Santek B, Felski M, Fries K, Lotz M, Flaschel E. Production of paramylon, 42. Zi J, Lantvit DD, Swanson SM, Orjala J. Lyngbyaureidamides A and B, a ß- 1,3-glucan, by heterotrophic cultivation of Euglena gracilis. Eng two anabaenopeptins from the cultured freshwater cyanobacterium Life Sci. 2009; 9: 23–28. Lyngbya sp. (SAG 36.91). Phytochemistry. 2012; 74: 173-177. 25. Zhang J, Sun Z, Sun P, Chen T, Chen F. Microalgal carotenoids: beneicial 43. Moore BS, Chen JL, Patterson GML, Moore RE, Brinen L, Kazo Y, et al. effects and potential in human health. Food Funct. 2014; 5: 413-425. [7.7] paracyclophanes from blue-green algae. J Am ChemSoc. 1990; 112: 4016–4063. 26. Rippka R, Herdman H. editors. Pasteur Culture Collection of cyanobacteria: Catalogue and taxonomic handbook. I. Catalogue of 44. Chen JL, Moore RE, Patterson GML. Structures of nostocyclophanes strains. Paris: Institut Pasteur. 1992. A–D. J Org Chem. 1991; 56: 4360–4364. 27. Mundt S, Kreitlow S, Nowotny A, Effmert U. Biochemical and 45. Moore BS, Chen JL, Patterson GML, Moore RE. Structures of pharmacological investigations of selected cyanobacteria. Int J Hyg cylindrocyclophanes A–F. Tetrahedron. 1992; 48: 3001–3006.

Page 104 Central

46. Ploutno A, Carmeli S. Nostocyclyne A, a novel antimicrobial cyclophane 52. Ivanova A, Khotimchenko S, Toneva A, Marinova E, Dimitrova- from the cyanobacterium Nostoc sp. J Nat Prod. 2000; 63: 1524-1526. Konaklieva S, Stefanov K. Lipid composition and antioxidative effects of different Spirogyra species. DokladBulgAkademNauk. 2002; 55: 47. Chlipala GE, Sturdy M, Krunic A, Lantvit DD, Shen Q, Porter K, et al. 47–50. Cylindrocyclophanes with proteasome inhibitory activity from the Cyanobacterium Nostoc sp. J Nat Prod. 2010; 73: 1529-1537. 53. Wille JJ, Kydonieus A. Palmitoleic acid isomer (C16:1delta6) in human skin sebum is effective against gram-positive bacteria. Skin Pharmacol 48. Kang HS, Santarsiero BD, Kim H, Krunic A, Shen Q, Swanson SM, et Appl Skin Physiol. 2003; 16: 176-187. al. Merocyclophanes A and B, antiproliferative cyclophanes from the cultured terrestrial Cyanobacterium Nostoc sp. Phytochemistry. 54. Clarke SR, Mohamed R, Bian L, Routh AF, Kokai-Kun JF, Mond JJ, et al. 2012; 79: 109-115. The Staphylococcus aureus surface protein IsdA mediates resistance to innate defenses of human skin. Cell Host Microbe. 2007; 1: 199-212. 49. Luo S, Kang HS, Krunic A, Chlipala GE, Cai G, Chen WL, et al. Carbamidocyclophanes F and G with anti-mycobacterium tuberculosis 55. Bobzin SC, Moore RE. Biosynthetic origin of [7.7] paracyclophanes activity from the cultured freshwater cyanobacteriumNostocsp. from cyanobacteria. Tetrahedron. 1993; 49: 7615–7626. TetrahedronLett. 2014; 55: 686–689. 56. Nakamura H, Hamer HA, Sirasani G, Balskus EP. Cylindrocyclophane 50. Gross M, Cramton SE, Götz F, Peschel A. Key role of teichoic acid net biosynthesis involves functionalization of an unactivated carbon charge in Staphylococcus aureus colonization of artiicial surfaces. center. J Am Chem Soc. 2012; 134: 18518-18521. Infect Immun. 2001; 69: 3423-3426. 51. Shabana KA, Saleh AM. Spirulina-An overview. Int J Pharm Pharmaceut Sci. 2012; 4: 9-15.

Cite this article Mundt S, Bui HT, Preisitsch M, Kreitlow S, Bui HTN, et al. (2014) Microalgae - A Promising Source of Novel Therapeutics. JSM Biotechnol Bioeng 2(1): 1032.

Page 105 Research Article *Corresponding author Prof.Dr. Wolfgang Eisenreich, Lehrstuhl für Biochemie, Technische Universität München, Lichtenbergstr. 4, Biosynthesis of Ginsenosides in 85747 Garching, Germany, Tel: +49-89-289-13336; Fax: +49-89-289-13363; E-Mail:

Field-Grown Panax Ginseng Submitted: 14 April 2013 Schramek, N.1, Huber, C.1, Schmidt, S.1, Dvorski, S.E.1, Kmispel, Accepted: 12 May 2014 Published: 14 May 2014 N.1, Ostrozhenkova, E.1, Pena-Rodriguez, L.M.1,2, Cusido, R.M.3, ISSN: 2333-7117 Wischmann, G.4 and Eisenreich, W.1* Copyright 1Lehrstuhl für Biochemie, Technische Universität München, Germany © 2014 Eisenreich et al. 2Laboratorio de Química Orgánica, Centro de Investigación Científi ca de Yucatán, México OPEN ACCESS 3Laboratorio de Fisiología Vegetal, Facultad de Farmacia, Universidad de Barcelona, Spain 4FloraFarm GmbH, Walsrode-Bockhorn, Germany Keywords • Araliaceae • Triterpene Abstract • Mevalonate The biosynthesis of the triterpenoid ginsenosides Rg and Rb was studied by • Isotopologue Profi ling 1 1 13 • 13 CO2 CO2 pulse-chase experiments in six-year-old Panax ginseng growing in the fi eld. A pulse period of 7 hours followed by a chase period of 8 days was shown to generate 13 signifi cant C-enrichments in both ginsenosides (Rg1> Rb1), as well as in free sugars 13 and amino acids. More specifi cally, CO2-labeled Rg1 and Rb1 were characterized 13 by specifi c NMR couplings due to C2-units indicating the mevalonate origin of the 13 triterpenes. C3-Labeled motifs in Rg1 or Rg1 that should be generated by the 13 alternative methylerythritol phosphate pathway from a C3-triose phosphate precursor 13 were apparently absent, whereas C3-isotopologues were detected in free sugars, amino acids and the sugar moieties of the ginsensosides from the same experiment. It can be concluded that ginsenosides are predominantly or entirely biosynthesized in P. ginseng via the mevalonate route, under the physiological conditions of the fi eld experiment. The observed labeling patterns were also in perfect agreement with a chair-chair-chair-boat conformation of the (S)-2,3-oxidosqualene precursor entering the cyclization process with the dammarenyl intermediate. The higher 13 enrichments of C2-isotopologues in the protopanaxatriol-type Rg1 in comparison to

the protopanaxadiol-type Rb1 indicated higher rates of Rg1 biosynthesis during the pulse/chase experiment with the six-year-old plant of P. ginseng. In summary, the study reveals the nature and dynamics of the ginsenoside biosynthetic pathway as a welcome basis for future biotechnological means.

INTRODUCTION roots of four to seven year-old Panax plants grown in the ield, e.g. in South Korea, China, Canada, and the US. These cultivations Medicinal plants are important sources of therapeutics aimed produce about 80,000 tons of fresh Ginseng roots per year. The at alleviating human disease. With increasing awareness of the world Ginseng market has been estimated to be around US$ health hazards and toxicity associated with the indiscriminate 2,000 million [7]. use of synthetic drugs and antibiotics, interest in plant-based The multiple effects of Ginseng on human health are drugs has revived throughout the world [1]. The World Health intensely studied but still not completely understood [5,11-25]. Organization has estimated that more than 75 % of the population Its bioactivity is mainly assigned to ginsenosides, a group of in developing countries depends primarily on traditional herbal triterpene saponins that are unique to Panax plants and especially medicine for basic healthcare needs and the worldwide annual abundant in the roots of P. ginseng. In the meantime, more than market for these products approached about US $ 60 billion [2- 150 different ginsenosides are known [13,24,26-28]. Most of 3]. Based on the current research, world-wide strategies and them belong to the dammarane or the oleanane-type, respectively inancial investments, it can be assumed that medicinal plants (Figure 1). According to their glycone moieties, dammarane- will continue to play an important role in health care [4]. type ginsenosides are further classiied into protopanaxadiol- type ginsenosides (for example, Rb ) and protopanaxatriol-type Ginseng (Panax ginseng C.A. Meyer), belonging to the 1 ginsenosides (for example, Rg ) (Figure 1). Recently, suppressive Araliaceae family, is one of the most important plants in traditional 1 effects of Rg1 on liver glucose production could be determined and modern East Asian Medicine. Since centuries, Ginseng in HepG2 human hepatoma cells via the LKB1-AMPK-FoxO1 extracts are used for anti-aging, anti-oxidative, adaptogenic and pathway [29]. Moreover, Rg1 and especially Rb1 showed beneicial other health-beneitting effects [5,6]. Not surprisingly, Ginseng cell-protective effects in models for ischemic disease [30-31], has now also been established in the phytotherapy of Western oxidative cellular stress [32], and hyper permeability-related Medicine [7]. diseases induced by bacterial pathogens [33]. Although some advances in the production of ginsenosides Despite the enormous pharmacological importance of these by tissue culture and biotransformation have been made recently compounds, the biosynthesis of ginsenosides is not completely [8-10], Ginseng drugs are mostly based on extracts from the understood [9,24,34-38]. Generally, triterpenoid saponins are

Page 106 Central

Figure 1 Formation and isoprenoid dissection of β-amyrin and ginsenosides Rb1 and Rg1. Carbon atoms derived from DMAPP and IPP are indicated

in green and red, respectively. The used carbon numbering of Rb1 and Rg1 is also indicated.

believed to be derived from the linear C30 compound, squalene, elimination, mevalonate is inally converted into IPP which can made by the head-to-head condensation of two molecules of be isomerized to DMAPP [49-52]. farnesyl diphosphate (FPP), each of them assembled from However, in the plastidic compartment of plant cells, also a dimethylallyl diphosphate (DMAPP) and two molecules of mevalonate-independent pathway (methylerythritol phosphate isopentenyl diphosphate (IPP) [8]. In an O -dependent process, 2 pathway, MEP pathway) exists for the biosynthesis of IPP and squalene is converted into (S)-2,3-oxidosqualene [39] which DMAPP (Figure 2B). This pathway starts with the condensation reacts to dammarane [40-43] or oleanane (β-amyrin) [44- of glyceraldehyde 3-phosphate (GAP) and a C2-unit from pyruvate 45] triterpenes. These intermediates are then converted into affording 1-deoxy-D-xylulose 5-phosphate (DXP). DXP is then ginsenosides by multiple oxidations (e.g. catalyzed by cytochrome rearranged and reduced to 2-C-methyl-D-erythritol 4-phosphate

P450-dependent monooxygenases) [46-48] and glycosylations (MEP), which leads via four steps to (E)-4-hydroxy-3-methyl- [34,36] which are largely unknown (Figure 1). but-2-enyl diphosphate (HMBPP). In the inal reaction, HMBPP is reduced to a mixture of IPP and DMAPP [53-56]. Also less understood is the generation of the early precursors IPP and DMAPP used in the biosynthesis of triterpenes including Due to the assignment of the mevalonate and MEP pathway ginsenosides. Generally, these early precursors are formed in the to the cytosolic or plastidic compartments, respectively, plant cytosolic compartment of plant cells by the classical mevalonate terpenes made in the cytosol (e.g. phytosterols) are thought to pathway (Figure 2A). Three molecules of acetyl-CoA produce be derived from the mevalonate pathway, whereas terpenes 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) which is reduced formed in the plastids (e.g. monoterpenes, diterpenes and to mevalonate. By phosphorylation and decarboxylation/ carotenoids) are believed to be made from the MEP route.

Page 107 Central

Figure 2 Biosynthetic origin of IPP and DMAPP via the mevalonate pathway (A) and the alternative MEP pathway (B).

Indeed, this classiication has now been approved experimentally [64]. The same conclusion was made from recent experiments for many terpenes, mainly on the basis of labeling experiments with hairy root cultures of P. ginseng exposed to mevinolin or with plant cell cultures (reviewed in [56]). On the other hand, fosmidomycin, speciic inhibitors of the mevalonate or the MEP exchange of mevalonate or MEP-derived precursors between the pathway, respectively [65]. However, it became not clear from compartments has been observed affording plant terpenes with the later study whether this mixed contribution is also valid for mixed biosynthetic origin [57-62]. ginsenoside formation in whole plants of Panax. The biosynthesis of ginsenosides occurs in the cytosolic In the present work, we have labeled full-grown plants of P. 13 compartment, and, on this basis, a cytoplasm-located mevalonate ginseng under ield conditions using CO2 as a tracer. Indeed, origin of the precursors can be assumed. However, direct this method allows the maintenance of physiological conditions experimental evidence for the biosynthetic assignment of during the labeling experiment with a minimum of stress factors 13 triterpenes is scarce. Recently, the lupeol moiety in lupeol-3- for the plant [66]. During the incubation period with CO2 for (3’-R-hydroxy)-stearate has been shown to exclusively originate several hours (pulse phase), the photosynthetic generation of from the mevalonate pathway in the Yucatan plant, Pentalinon completely 13C-labeled metabolic intermediates (e.g. triose and and rieuxii [63]. On the other hand, the biosynthesis of the pentose phosphates) takes place. During a subsequent chase dinortriterpenoid withanolides from Withania somnifera has phase where the plants are further cultivated under standard been reported to involve both the mevalonate and the MEP route conditions for several days (i.e. in a natural atmosphere

Page 108 Central

12 13 containing CO2), unlabeled photosynthetic intermediates are CO2 dosage unit was controlled by a pressure reduction valve 13 12 13 generated. The combination of these C- and C-intermediates reducing the CO2 pressure coming from the cylinder to about as precursor units for downstream biosynthetic processes then 300 to 500 mbar. An electronic valve then controlled the inlux of yields a speciic mixture of 13C-labeled and unlabeled fragments 13 CO2 into the incubation chamber according to the target value in the product [57,67-69]. Recent improvements in GC/MS 13 12 inside the chamber (i.e. 700 ppm CO2). To reduce the CO2 and NMR technology have allowed the deconvolution of these content during incubation, the chamber was eventually lushed complex isotopologue patterns aimed at the elucidation of with synthetic air. Inlow of synthetic air was electronically biosynthetic pathways and luxes. 12 controlled depending on the target value for the CO2 content We here show that the experimental approach can also be used (typically < 70 ppm). to study the biosynthesis of ginsenosides in full-grown plants of Using this setting, the P. ginseng plant was kept under the 13 13 13 P. ginseng. A relatively short CO2 pulse (i.e. 7 hours) followed by CO atmosphere (700 ppm CO ) for 7 h from 10 a.m. until 5 13 2 2 a chase period of 8 days resulted in speciic C-labeling patterns p.m. (13CO throughput, about 20 L). After this pulse period, the in the major ginsenosides Rg and Rb from the roots. High- 2 1 1 plant was left for 8 days (chase period) under the natural ield 13 resolution NMR spectroscopy revealed C-coupling proiles that conditions. Then, the plant was harvested including the roots documented the mevalonate origin of these compounds. (Figure 3B). The leaves and roots were washed, cut in pieces, MATERIALS AND METHODS frozen (liquid nitrogen) and lyophilized. The dry root pieces were subsequently ground using a mortar and a Retsch ZM 1 mill Chemicals (Haan, Germany).

13 13 CO2 (99 % C-abundance) and other chemicals were Analytical HPLC of ginsenosides obtained from Sigma-Aldrich (Steinheim, Germany). Reference Analysis of ginsenosides was carried out according to the samples for Rb1 and Rg1 were obtained from Roth (Karlsruhe, Germany). monograph on Ginseng in the European Pharmacopoeia [70]. Approximately 100 mg of dry root powder was extracted two 13 Plants and CO2 experiment times by boiling with each 7 mL of 50 % methanol. The combined 13 methanol fractions were evaporated to dryness and the residue Labeling experiments with CO2 were carried out in August 2011 using six-year-old plants of Panax ginseng C.A. Meyer was dissolved in 20 mL of 20 % aqueous acetonitrile. HPLC growing in the commercial ield of FloraFarm GmbH (Walsrode- analysis was performed using a Symmetry C18 150 x 3.9 mm Bockhorn, Germany). The labeling unit [66] was based on a column (Waters, Eschborn, Germany) with a low rate of 1 mL/min. chamber consisting of a clear-transparent plastic sheet around The injection volume was 20 μL. Within 40 min, a gradient from a wire-mesh cylinder that can be lushed with synthetic air 20 % to 40 % aqueous acetonitrile was applied, followed by 13 an increase to 100 % acetonitrile within 7 min. The eluate was and/or CO2 from reservoir gas containers (Figure 3A). The chamber was tightened around the bottom stem of the plant. The monitored at 203 nm using a UV detector. concentrations of 12CO and 13CO were monitored online using a 2 2 Large-scale extraction of ginsenosides gas analyzer (Advance Optima, ABB, Mannheim, Germany). The

A) B)

13 13 Figure 3 (A) – Portable unit used for CO2-labeling of P. ginseng under ield conditions (B) – Roots of CO2-labeled P. ginseng that yielded the

ginsenosides Rg1 and Rb1 described in this study.

Page 109 Central

The dry root powder (10 g) was extracted with 100 mL of GC/MS analysis of amino acids methanol for 2 h in a Soxhlet extractor. The extract was concentrated 5 mg of the freeze dried root sample was suspended in 0.5 to 5 ml under vacuum and centrifuged (14.000 rpm, 3 min). The ml of 6 M HCl and incubated for 24 h at 105 °C. Afterwards, HCl supernatant was subjected to preparative HPLC chromatography. was removed under nitrogen supply, and 200 μl of glacial acetic Puri ication of ginsenosides by preparative HPLC acid was added to the dried sample. The hydrolysate was transferred onto a mini-column of Dowex 50WX8 (H+ form; 200 to 400 The major ginsenosides Rb and Rg were puriied by preparative 1 1 mesh; 0.5 x 1 cm). The column was washed twice with water and HPLC (Merck Hitachi) on a reversed phase column (Luna® 5 μm developed with 1 ml of 4 M ammonium hydroxide. An aliquot of C (2) 100 Å AX; 150 x 21.2 mm; Phenomenex, Aschaffenburg, 18 the eluate was dried under a stream of nitrogen, and the residue Germany) with a low rate of 8 ml/min. Within 40 min, a gradient was dissolved in 50 μl of dry acetonitrile. A total of 50 μl of N- from 15 % to 40 % aqueous acetonitrile was applied, followed by (tert-butyldimethylsilyl)-N-methyltriluoracetamide containing an increase to 100 % acetonitrile within 5 min. The eluate was 1 % N-(tert-butyldimethylsilyl chloride (TBDMS; Sigma-Aldrich, monitored at 206 nm using an UV detector. The retention volumes of Steinheim, Germany) was added. The mixture was kept at 70 °C Rg and Rb were 200 and 305 ml, respectively. Fractions containing 1 1 for 30 min. The resulting mixture of TBDMS amino acids was Rg and Rb were concentrated to dryness under reduced pressure 1 1 used for GC/MS analysis that was performed on a GC-QP 2010 and subjected to NMR analysis. plus (Shimadzu, Duisburg, Germany) equipped with a fused silica NMR spectroscopy of ginsenosides capillary column (equity TM-5; 30 m by 0.25 mm, 0.25 μm ilm thickness; Supelco, Bellafonte, PA). The mass detector worked in 100 mg of Rg or 50 mg of Rb were dissolved in 600 μL of 1 1 electron ionization (EI) mode at 70 eV. An aliquot of the solution methanol-D and subjected to one- and two-dimensional NMR 4 was injected in split mode (1:10) at an injector and interface tem- 13 analysis. C NMR spectra were measured with a Bruker Avance- perature of 260 °C. The column was held at 150 °C for 3 min and III 500 MHz spectrometer equipped with a cryo probe (5 mm then developed with a temperature gradient of 7 °C/min to a inal 1 13 31 19 29 1 CPQNP, H/ C/ P/ F/ Si; Z-gradient). H NMR spectra were temperature of 280 °C. The retention time of alanine-TBDMS un- registered with an Avance-I 500 MHz system and an inverse der these conditions was 6.2 min. Samples were analyzed in SIM 1 13 probe head (5 mm SEI, H/ C; Z-gradient). The temperature was mode at least three times. Data were collected with Lab Solution 300 K. Data processing and analysis was done with TOPSPIN 3.0 software (Shimadzu, Duisburg, Germany). The overall 13C excess 13 or MestreNova. The one-dimensional C NMR spectrum as well values and the isotopologue compositions were calculated by an as COSY, TOCSY, HSQC, HMBC, INADEQUATE and 1,1-ADEQUATE Excel-based in-house software package. spectra were measured with standard Bruker parameter sets. 13C abundances were determined via the 13C-coupled satellites in 1H GC/MS analysis of sugars NMR spectra. Multiple-labeled isotopologues displaying 13C13C- Sugars were analyzed as diisopropylidene-acetate derivatives. couplings were quantiied from the corresponding satellite 10 mg of the freeze dried root or leaf sample were incubated for 1 signals in the 13C NMR spectra. The integral of each respective h at room temperature with 1 ml of acetone containing 20 μl H SO . satellite pair was referenced to the total signal integral of a given 2 4 2 ml of saturated NaCl and 2 ml of saturated Na CO solution were carbon atom. 2 3 added afterwards. The solution was extracted two times with 3

13 Figure 4 Isotopomer contribution for protein bound alanine and free sugars from the roots and leaves of C2-labeled P. ginseng, respectively, as measured by GC/MS analysis. Isotopomers are shown as M+1 up to M+6 indicating molecules with one up to six 13C-atoms, respectively. Error bars indicate standard deviations from three independent measurements.

Page 110 Central ml ethyl acetate. The organic phase was dried under a constant a gas bottle reservoir. After a chase period of 8 days, where stream of nitrogen. 200 μl of a 1:1 mixture of ethyl acetate and acetic the plant was further cultivated in the ield under standard 13 anhydride was added to the dry residue and incubated over night conditions (i.e. without a CO2-enriched atmosphere), the roots at 60 °C in a sealed GC/MS vial. GC/MS analysis was done in split were harvested (Figure 3B). mode (1:5) with a temperature gradient from 150 ° (3 min) - 280 °C At the onset of the experiment, it was not clear whether the (10 °C/min). Other conditions were the same as described for amino experimental approach using the relatively short 7 h 13CO -pulse acids. Under these conditions sucrose is hydrolysed, and analysed 2 to the six-year-old P. ginseng plant was suficient to provide as glucose and fructose. The retention times for the glucose and detectable and speciic 13C-enrichments in the root metabolites. fructose derivatives are 8.4 min and 7.9 min, respectively. As mentioned above, the approach crucially depends on the GC/MS analysis of ginsenosides presence of multiple 13C-labeled biosynthetic precursors in dilution with corresponding unlabeled building units at the site For hydrolysis of the ginsenosides, 50 mg of the freeze dried of biosynthesis. In the present project, this implied transport of root sample were extracted with 1 ml of methanol. After drying, suficient amounts of 13C-photosynthates (e.g. multiply 13C-labeled the residue was incubated at 90 °C for 3 h in 2.5 ml n-butanol sugars and related compounds formed during the relatively short containing 70 mg of sodium methoxide. After centrifugation, the pulse period of 7 h) from the leaves via the phloem into the roots butanolic phase was washed with 1.4 ml water. Afterwards, the where, during the chase period of 8 days, suficient amounts of the organic layer was dried under a constant stream of nitrogen. target compounds (i.e. ginsenosides) must be biosynthesized in The resulting aglycones were derivatized with a mixture of 30 13C-labeled form. Notably, it can be assumed that the roots of the μl BSTFA, 30 μl TMS and 20 μl TMS-Cl at 70 °C for 20 min. GC/ six-year-old plant already contained huge amounts of unlabeled MS analysis started with an oven temperature of 200 °C which ginsenosides that dilute the presumably tiny amounts of newly was ramped at 30 °C/min to 300 °C which was then held for made metabolites during the experimental period of 8 days. further 20 min other conditions were the same as described for On this basis, it was completely unknown whether a multiple amino acids. The retention times for the silylated panaxadiol and 13C-labeled ginsenoside could be detected at all with this setting. panaxatriol were 17.8 and 19.5 min, respectively. Characteristic 13 13 m/z values, which were used for SIM analysis were 199 To irst provide information about C-incorporation of CO2 (C20-C27) and 593 (C1-C21) for panaxadiol, and 199 and 681 for and the transfer of its photosynthates from the leaves into the panaxatriol. roots, protein-derived amino acids from the roots were analyzed by GC/MS in the form of silylated derivatives. With the chosen RESULTS AND DISCUSSION 13 setting (i.e. CO2 pulse period of 7 h followed by a chase period of 13 To study the biosynthetic origin of the ginsenosides Rg1 8 days), C-enrichments were fortunately detected for protein- 13 and Rb1 in full plants of P. ginseng under quasi-physiological bound amino acids. Particularly, 0.9 % C-excess over the natu- conditions, we exposed a six-year-old plant in the ield for 7 h ral 13C-abundance was detected for alanine from the roots, which 13 13 (pulse period) to an atmosphere containing 700 ppm CO2 was only slightly lower than C-enrichment in alanine from the 13 (Figure 3A). During this period, the CO2 concentration was leaves (Figure 4). In both samples, about 50 % of labeled alanine 13 13 13 monitored and held constant by continuously adding CO2 from was due to [U- C3]-alanine. Completely C-labeled alanine may

1 13 Figure 5 H- NMR spectrum of Rg1 from CO2-labeled P. ginseng measured in deuterated methanol.

Page 111 Central

1 13 Table 1: H and C NMR signal assignments of the ginsenosides Rg1 and Rb1.

Rg1 Rb1 Aglycon C-Atom 1H (δ) [ppm] 13C (δ) [ppm] 1H (δ) [ppm] 13C (δ) [ppm] 1 1.06 1.74 40.31 1.03 1.74 40.31 2 1.59 27.38 1.74 2.02 27.38 3 3.11 79.98 3.21 79.98 4 40.5 40.5 5 1.12 61.9 0.79 61.9 6 4.1 81 1.58 81.00 7 1.64 2.04 45.4.0 1.31 1.56 45.40 8 42.00 42.00 9 1.48 50.73 1.44 50.73 10 40.64 40.64 11 1.19 1.85 31.08 1.25 1.80 31.08 12 3.68 72.01 3.74 72.01 13 1.74 49.78 1.75 49.78 14 52.58 52.58 15 1.13 1.60 31.67 1.05 1.59 31.67 16 1.40 1.93 27.72 1.35 1.91 27.72 17 2.29 53.26 2.30 53.26 18 1.10 17.78 1.01 17.78 19 0.99 17.97 0.87 17.97 20 85.06 85.06 21 1.35 22.97 1.38 22.97 22 1.62 1.81 36.77 1.56 1.81 36.77 23 2.07 24.39 2.05 2.15 24.39 24 5.11 125.98 5.16 125.98 25 132.43 132.43 26 1.68 26.04 1.71 26.04 27 1.63 18.11 1.65 18.11 28 (α-Me) 1.33 31.51 1.09 31.51 29 (β-Me) 1.02 16.25 0.87 16.25 30 0.95 17.22 0.93 17.22 Sugars Glucose´ 1´ 4.35 105.7 4.45 105.7 2´ 3.21 75.63 3.58 75.63 3´ 3.34 79.21 3.37 79.21 4´ 3.27 71.82 3.22 71.82 5´ 3.27 77.81 77.81 6´ 3.64 3.8 63.03 3.87 63.03 Glucose´´ 1´´ 4.61 98.43 4.61 98.23 2´´ 3.08 75.53 3.13 3´´ 3.36 78.34 4´´ 3.31 71.32 5´´ 3.21 78.07 3.44 6´´ 3.65 3.82 62.65 3.81 70.35 Glucose´´´ 1´´´ 4.69 104.57 2´´´ 3.24 76.44 3´´´ 3.58 78.64 4´´´ 3.36 71.61 5´´´ 3.28 78.02 6´´´ 3.65 63.26 Glucose´´´´ 1´´´´ 4.37 105.14 2´´´´ 3.23 6´´´´ 3.67 62.94

Page 112 Central be used as a positive control to document the formation of [U- of these satellites were typically about 8-17 % in the overall 13 13 13 C3]-phosphoglycerate from CO2 during the photosynthetic signal intensity of a given C NMR signal (Table 2), thus clearly 13 13 13 process which can be further converted via [U- C3]-GAP into exceeding the expected values due to statistical C- C couplings 13 13 13 [U- C3]-pyruvate serving as the precursor for [U- C3]-alanine (1 %) in natural C-abundance compounds. 13 13 13 and for [U- C2] acetyl-CoA. Notably, [U- C2] acetyl-CoA, [U- C3]- pyruvate and [U-13C ]-GAP provide the carbon units for terpenes Obviously, these couplings were due to de novo synthesis of the 3 ginsenosides via multiply 13C-labeled precursors from 13CO (see in the mevalonate and the MEP pathway, respectively (see be- 2 low). below). Remarkably, however, the intensities of the satellite pairs were higher in the 13C NMR signals of Rg (14.3 % ± 4.1 %) than in Additional evidence for the transfer of multiple 13C-labeled 1 the corresponding ones in Rb1 (8.9 % ± 2.6 %).This suggested that photosynthates into root metabolites was provided by the the protopanaxatriol-based Rg was more eficiently biosynthesized labeling proiles of free glucose and fructose, which may partly 1 during the pulse/chase experiment with the six-year-old plant. On derive from sucrose. As shown by GC/MS analysis, both sugars this basis, it can be speculated whether higher amounts of the diol- from the roots acquired signiicant 13C-labels with 13C-excess based ginsenoside including Rb were already present at the onset of values of 2.3 %. About 30 % of labeled glucose and fructose were 1 the labeling experiment and whether higher oxidized ginsenosides completely 13C-labeled (Figure 4), relecting their formation via including Rg are preferably made in the older state of the Panax 13C -carbon substrates. 1 3 roots (i.e. in the six-year-old plant). Taken together, these data showed that the 13C-label was 13 readily transported from the leaves to the roots of the Panax plant Some of satellites pairs in the C NMR spectra of both presumably also providing speciically 13C-labeled precursor ginsenosides were considerably lower (3-4 %) or even below the units for ginsenoside biosynthesis. With this positive result in detection limit of the NMR sensitivity (< 3 %) (Table 2). Obviously, mind, we have now extracted and isolated ginsenosides from carbon atoms with this 13C signature did not signiicantly acquire 13 13C-label by adjacent 13C -units. On the basis of the speciic the roots of the CO2-labeled plant. HPLC analysis showed that 2 coupling constants (Table 2) and on the basis of the speciic the protopanaxatriol-type Rg1 and the protopanaxadiol-type Rb1 were the most abundant ginsenosides in the methanolic extract correlations detected in two-dimensional INADEQUATE and 13 of the six-year-old P. ginseng roots with 32.1 and 15.3 mg/g of ADEQUATE spectra (Figures 8 and 9), twelve C2-isotopologues fresh root material, respectively. with adjacent 13C-atoms were identiied in the triterpene aglycons of Rg and Rb , respectively (Figure 10, Table 2). Fractionation of the crude methanolic root extract using 1 1 preparative reversed phase HPLC yielded the ginsenosides Rb 1 Some signals for the sugar moieties in Rg1 and Rb1 overlapped and Rg1 in good purity at amounts of about 10 mg and 5 mg, and the corresponding couplings could not be resolved. respectively, per g of root material. In total, about 100 mg of Rg1 However, the signals for the C-1 and C-2 sugar carbon atoms 13 and 50 mg of Rb1 were obtained in pure form. GC/MS analysis of were resolved showing C-couplings to the neighbored carbon the TMS derivatives of panaxadiol and panaxatriol from Rb and 1 atoms. Closer inspection of the coupling pairs for C-1 revealed Rg , respectively, as well as quantiication of 13C coupled satellites 1 evidence for long range 13C-coupling (i.e. coupling between C-1 1 13 for H-24 in the H NMR spectra showed less than 1 % C excess. and C-3 in the sugar moiety) due to the presence of [1,2,3-13C ]- Due to this low 13C-enrichment, a more concise analysis of the 3 sugars or isotopologues bearing more than three 13C-atoms. isotope distribution in the carbocycles of ginsenosides was only This was also conirmed by the coupling patterns of the C-2’ possible by NMR spectroscopy. and C-2’’ signals of the glucose moieties in Rg1 where doublet of 1 13 13 13 One-dimensional H and C NMR spectra of labeled Rg1 are doublets due to simultaneous C-coupling between C-2 and its shown in (Figures 5 and 6), respectively, documenting the purity respective neighbors 13C-1 and 13C-3 (Figures 10 and 11). Thus, 13 of the ginsenoside with sharp signals. Similarly, the spectra of Rb1 NMR analysis of the carbohydrate moieties in the C-enriched were of high quality. All 1H and 13C NMR signals were assigned by ginsenosides again documented, as an internal control, the two-dimensional COSY, TOCSY, HMQC and HMBC spectra (Table transfer of multiple 13C-labeled precursors (i.e. with three and 1). more 13C-atoms in a given molecule) to the roots and the site of Additional conirmation was provided by INADEQUATE and ginsenoside biosynthesis. 1,1-ADEQUATE experiments (see below). The signal assignments The observed 13C-13C coupling patterns were in perfect were in agreement with published values [71]. agreement with those predicted for a triterpene formed from 13 13 During NMR analysis, it became obvious that many of the C [U- C2] acetyl-CoA via the mevalonate pathway (Figure 12). NMR signals in Rg and Rb from the 13CO experiment displayed 1 1 2 More speciically, twelve isotopologues with adjacent 13C satellites due to couplings between adjacent 13C-atoms (for atoms, i.e. [2,3-13C ]-, [4,29-13C ]-, [5,6-13C ]-, [8,18-13C ]-, [9,11- examples, see Figure 7). 2 2 2 2 13 13 13 13 13 C2]-, [10,19- C2]-, [12,13- C2]-, [14,30- C2]-, [16,17- C2]-, These satellites were remarkably sharp and did not 13 13 13 [20,21- C2]-, [23,24- C2]-, and [25,27- C2]- isotopologues display any evidence for additional ine splittings due to long- can be predicted on the basis of the mevalonate route and the range couplings. This was especially important to exclude established mechanisms of ring formation starting from the biosynthetic contributions from [U-13C ]-GAP in the MEP route 3 chair-chair-chair-boat conformation of the (S)-2,3-oxidosqualene of terpene biosynthesis (see below). The relative intensities precursor and with the dammarenyl cation as an intermediate of

Page 113 Central

13 13 Figure 6 Overall C-NMR spectrum of Rg1 from CO2-labeled P. ginseng measured in deuterated methanol.

13 13 13 13 Figure 7 Expanded view of some C- NMR signals of Rg1 from the CO2 experiment. Satellite pairs due to C- C couplings are indicated. Simultaneous couplings between three 13C-atoms were not observed as shown by the “empty” down-ield and up-ield regions of the coupling pairs. Long-range 13C-couplings indicative of the MEP-pathway were also not detected. The spectrum was calculated after zero-illing and multiplication of the FID with a Gaussian function to achieve sharp signals.

13 Figure 8 INADEQUATE spectrum of Rg1 from the CO2 experiment. Observed correlations (connected by horizontal lines in the two-dimensional 13 13 13 matrix) relect the biosynthetic history of the ginsenoside from CO2 and are due to magnetization transfer of a C-atom to a direct C-neighbour (see also bold dark-blue bars in Figure 11). The one-dimensional 13C-spectrum is shown as projections. Skip diagonals are also drawn as lines for the main part (upper part of the spectrum) and the folded region (lower part).

Page 114 Central

13 Table 2: NMR data of Rg1 and Rb1 from the CO2 experiment. n.d., not determined due to signal overlap. 13 13 Relative signal intensity of C C satellites [ %] JCC [Hz] Conirmed (+) with C-atom Correlation with Rg1 Rb1 Rg1 Rb1 ADEQUATE Rg1/Rb1 INADEQUATE Rg1/Rb1 1 < 3 < 3 < 3 < 3 2 12.6 3.0 32.6 36.5 3 +/+ +/+ 3 12.3 6.6 36.5 37.4 2 +/+ +/+ 4 13.3 10.4 36.0 35.5 29 +/+ 5 12.5 9.5 38.7 36.1 6 +/+ +/ 6 14.2 12.0 38.8 38.7 5 +/+ +/ 7 < 3 < 3 < 3 < 3 8 10.3 7.0 36.6 36.8 18 +/+ 9 12.0 5.9 34.5 36.8 11 +/+ +/+ 10 12.8 8.9 35.5 35.5 19 +/+ 11 17.1 8.9 34.9 36.5 9 +/+ +/+ 12 13.5 n.d. 37.2 n.d. 13 +/+ +/+ 13 7.5 n.d. 37.8 n.d. 12 +/ +/+ 14 10.5 8.3 36.6 36.5 30 +/+ +/ 15 < 3 < 3 16 16.6 7.6 36.4 39.0 17 +/+ +/ 17 9.5 4.4 32.5 33.5 16 +/+ +/ 18 16.8 10.4 38.7 36.7 8 +/+ 19 28.5 9.8 43.7 40.3 10 +/+ 20 13.1 10.1 39.9 39.6 21 +/+ +/+ 21 13.4 9.3 39.9 38.9 20 +/+ +/+ 22 3.1 < 3 38.6 23 13.4 7.3 44.3 44.1 24 +/+ +/ 24 18.0 10.2 44.2 44.0 23 +/+ +/ 25 17.8 14.1 42.4 42.3 27 +/+ +/ 26 < 3 < 3 27 13.6 12.2 42.4 42.5 25 +/+ +/ 28 (α-Me) 4.0 < 3 35.0 4 29 (β-Me) 16.5 11.7 36.2 39.2 4 +/+ 30 16.8 7.8 36.6 36.7 14 +/+ +/ Glucose 1´ 17.5 12.3 48.2 47.0 2´ +/+ +/ 2´ 8.0 47.7 1´ +/ +/ 3´ 3.1 42.1 4´ 18.2 41.4 5´ 8.1 42.1 6´ +/ +/ 6´ 27.9 43.1 5´ +/ +/ 1´´ 15.6 7.4 47.6 48.3 2´´ +/+ +/ 2´´ 6.1 46.9 1´´ +/ +/ 3´´ 4´´ 10.5 41.0 5´´ 6´´ +/ 6´´ 15.7 42.6 5´´ +/ 1´´´ 13.0 47.2 2´´´ /+ 1´´´´ 14.0 44.3 2´´´´ /+

Page 115 Central

13 Figure 9 1, 1-ADEQUATE spectrum of Rg1 from the CO2 experiment. Observed correlations relect the biosynthetic history of the ginsenoside from 13 13 13 CO2 and are due to magnetization transfer of a C-atom to a direct C-neighbour and its connected H-atom (see also green arrows in Figure 11). One-dimensional 1H- and 13C-spectra are shown as projections.

13 13 Figure 10 Labeling pattern of the ginsenoside Rg1 from the CO2 experiment; biosynthetically contributed C atom pairs are indicated by bold lines. Dark-blue lines display 13C-pairs observed in the INADEQUATE spectrum; green arrows indicate connections detected in the ADEQUATE spectrum. The weak signal observed between 13C-4 and H-28 is indicated by the dotted green arrow. Additional 13C-pairs or triples gleaned from the analysis of the coupling pattern in the one-dimensional 13C-NMR spectrum are displayed by bright-blue lines.

13 13 the ginsenosides under study (Figure 13). detect adjacent C2-units and an outlier C, as predicted for

13 the ginsenosides via the MEP route. Importantly, the labeling On the other hand, the MEP route involving a [U- C3]- GAP precursor would have generated, in addition to the above patterns of alanine, free sugars and the sugar moieties of the mentioned isotopologues, six 13C -units, namely [2,3,28-13C ]-, ginsensoides provided experimental proof for the formation 3 3 13 13 13 13 13 of [U- C3]-GAP during the pulse period and its transport to the [1,5,6- C3]-, [7,9,11- C3], [12,13,15- C3], [16,17,22- C3]- and 13 roots where ginsenosides are made, but not its use for Rg1 and [23,24,26- C3]-isotopologues (indicated in red in Figure 12). 13 Rb biosynthesis. Therefore, it appears safe to assume that IPP Whereas the twelve C2-pairs predicted by the mevalonate 1 and DMAPP used as precursors for the triterpene aglycons of route were detected in the NMR data of Rg1 and Rb1, none of 13 Rg and Rb are predominantly, if not exclusively, made from the the C3-isotopologues could be observed neither as long-range 1 1 couplings in the one-dimensional 13C NMR signals, even under mevalonate pathway in the full-grown six-year-old plants of P. extreme Gaussian processing of the FID, nor by two-dimensional ginseng. Capitalizing on the detection limits of the experiment, it n,1-ADEQUATE experiments (data not shown) optimized to can be estimated that contributions of IPP and DMAPP via the

Page 116 Central

13 13 13 13 Figure 11 Expanded view of some C-NMR sugar signals of Rg1 from the CO2 experiment. Satellite pairs due to C- C couplings are indicated. Note the simultaneous couplings between three 13C-atoms (see also bright-blue bars in Figure 10).

13 13 Figure 12 Predicted labeling patterns of the ginsenoside Rg1 from CO2-labeled plants of P. ginseng. The bold bonds indicate adjacent C-atoms via 13 13 the mevalonate pathway (a, from C2-acetyl-CoA and mevalonate, colored in blue) or the MEP pathway (b, from C3-pyruvate, colored in green, and 13 13 13 C3-GAP, colored in red; note that one of the C-atoms in C3-GAP becomes separated during the formation of MEP as indicated by illed red circles).

Page 117 Central

MEP pathway have to be far below 5 %, if at all. On this basis, the biosynthesized late in the root development of the plant in earlier observations [65] about signiicant contributions of the comparison to panaxadiol-based ginsenosides. MEP pathway to ginsenoside biosynthesis might have relected The understanding of the location, timing and the pathways the studied [65] situation and adaptation processes of Panax affording ginsenosides is important to optimize and modify hairy root cell cultures growing in an artiicial medium containing plant lines for cultivation as well as for developing eficient speciic inhibitors of the mevalonate and MEP pathway, biotechnological means to produce ginsenosidesn with cell respectively. Obviously, these factors are not relevant for the cultures or recombinant organisms. Notably, the highest yields undisturbed and physiological in planta condition examined in in the production of ginsenosides can still be found in planta our study. in the roots of 6 year-old P. ginseng. This long-term cultivation CONCLUSION period is a considerable cost factor in the commercial production of Ginseng drugs. Therefore, companies involved in the Ginseng Using 13CO pulse/chase experiments in the ield, we have 2 business [in Germany, e.g. Florafarm GmbH both cultivating P. shown that full grown six-year-old P. ginseng plants use the mevalonate pathway as the predominant, if not the exclusive route ginseng in plantations and producing Ginseng drugs/products which are directly distributed to the consumers (www.lorafarm. to synthesize the major ginsenosides Rg1 and Rb1. The labeling patterns conirm their formation via (S)-2,3-oxidosqualene and de)] are interested in a shortened cultivation period while the dammarenyl cation as intermediates. The enzymes involved maintaining or even improving the yield and quality of their in these reactions are promising targets in improving the yields products. Knowledge about the natural biosynthetic process is of ginsenosides by recombinant techniques. The labeling data therefore a crucial prerequisite to develop rational approaches also suggest that protopanaxatriol-based ginsenosides are in this optimization process.

13 Figure 13 Biosynthesis of the ginsenosides Rg1and Rb1in full-grown plants of P. ginseng. Bold green lines indicate the adjacent C-atom pairs that 13 13 13 13 were contributed from CO2 via [1,2- C2]acetyl-CoA and [1,2- C2]-, [3,5- C2]-IPP/DMAPP. The labeling patterns of Rb1 and Rg1 were detected by 13 NMR spectroscopy. Notably, the detected C2-pair in C-4 and C-29 (β-methyl group at C-4) is indicative for the stereospeciicity displayed in the igure.

Page 118 Central ACKNOWLEDGEMENTS 2007; 30: 2126-2134. We thank the Deutsche Forschungsgemeinschaft (EI 384/8- 17. Paul S, Shin HS, Kang SC. Inhibition of inlammations and macrophage 1) for inancial support. L. M. P.-R. and W. E. thank the German activation by ginsenoside-Re isolated from Korean ginseng (Panax Academic Exchange Service (DAAD, A/11/00471) and CONACYT- ginseng C.A. Meyer). Food Chem Toxicol. 2012; 50: 1354-1361. México (exp. No. 160813) for supporting the sabbatical stay of 18. Hong SY, Kim JY, Ahn HY, Shin JH, Kwon O. Panax ginseng extract rich L. M. P.-R. at TUM. Financial support from the FOMIX-Yucatán in ginsenoside protopanaxatriol attenuates blood pressure elevation Project No. 66262 and the Hans-Fischer Gesellschaft (München) in spontaneously hypertensive rats by affecting the Akt-dependent is also gratefully acknowledged. We cordially thank Henrike phosphorylation of endothelial nitric oxide synthase. J Agric Food Rodemeier and Dennis Koopmann from Florafarm GmbH for Chem. 2012; 60: 3086-3091. essential support when performing the ield experiments at the 19. Raghavendran HR, Sathyanath R, Shin J, Kim HK, Han JM, Cho J, et Ginseng farm. al. Panax ginseng modulates cytokines in bone marrow toxicity and myelopoiesis: ginsenoside Rg1 partially supports myelopoiesis. PLoS REFERENCES One. 2012; 7: e33733. 1. Tilburt JC, Kaptchuk TJ. Herbal medicine research and global health: 20. Jung ID, Kim HY, Park JW, Lee CM, Noh KT, Kang HK, et al. RG-II from an ethical analysis. Bull World Health Organ. 2008; 86: 594-599. Panax ginseng C.A. Meyer suppresses asthmatic reaction. BMB Rep. 2. WHO global strategy on traditional and alternative medicine. Public 2012; 45: 79-84. Health Rep. 2002; 117: 300-301. 21. Gum SI, Jo SJ, Ahn SH, Kim SG, Kim JT, Shin HM, et al. The potent 3. Willcox ML, Bodeker G. Traditional herbal medicines for malaria. BMJ. protective effect of wild ginseng (Panax ginseng C.A. Meyer) against 2004; 329: 1156-1159. benzo[alpha]pyrene-induced toxicity through metabolic regulation of CYP1A1 and GSTs. J Ethnopharmacol. 2007; 112: 568-576. 4. WHO traditional medicine strategy: 2014–2023. Geneva: World Health Organization; 2013. 22. Helms S. Cancer prevention and therapeutics: Panax ginseng. Altern Med Rev. 2004; 9: 259-274. 5. Choi J, Kim TH, Choi TY, Lee MS. Ginseng for health care: a systematic review of randomized controlled trials in Korean literature. PLoS One. 23. Yue PY, Mak NK, Cheng YK, Leung KW, Ng TB, Fan DT, et al. 2013; 8: e59978. Pharmacogenomics and the Yin/Yang actions of ginseng: anti-tumor, angiomodulating and steroid-like activities of ginsenosides. Chin Med. 6. Kiefer D, Pantuso T. Panax ginseng. Am Fam Physician. 2003; 68: 2007; 2: 6. 1539-1542. 24. Augustin JM, Kuzina V, Andersen SB, Bak S. Molecular activities, 7. Baeg IH, So SH. The world ginseng market and the ginseng (Korea). J biosynthesis and evolution of triterpenoid saponins. Phytochemistry. Ginseng Res. 2013; 37: 1-7. 2011; 72: 435-457. 8. Lee MH, Jeong JH, Seo JW, Shin CG, Kim YS, In JG, et al. Enhanced 25. Jia L, Zhao Y, Liang XJ. Current evaluation of the millennium triterpene and phytosterol biosynthesis in Panax ginseng phytomedicine- ginseng (II): Collected chemical entities, modern overexpressing squalene synthase gene. Plant Cell Physiol. 2004; 45: pharmacology, and clinical applications emanated from traditional 976-984. Chinese medicine. Curr Med Chem. 2009; 16: 2924-2942. 9. Liang Y, Zhao S. Progress in understanding of ginsenoside biosynthesis. 26. Liu J, Wang Y, Qiu L, Yu Y, Wang C. Saponins of Panax notoginseng: Plant Biol (Stuttg). 2008; 10: 415-421. chemistry, cellular targets and therapeutic opportunities in 10. Choi YE. Ginseng (Panax ginseng). Methods Mol Biol. 2006; 344: 361- cardiovascular diseases. Expert Opin Investig Drugs. 2014; 23: 523- 371. 539.

11. Leung KW, Wong AS. Pharmacology of ginsenosides: a literature 27. Dinda B, Debnath S, Mohanta BC, Harigaya Y. Naturally occurring review. Chin Med. 2010; 5: 20. triterpenoid saponins. Chem Biodivers. 2010; 7: 2327-2580.

12. Podolak I, Galanty A, Sobolewska D. Saponins as cytotoxic agents: a 28. Shibata S. Chemistry and cancer preventing activities of ginseng review. Phytochem Rev. 2010; 9: 425-474. saponins and some related triterpenoid compounds. J Korean Med Sci. 2001; 16 Suppl: S28-37. 13. Christensen LP. Ginsenosides chemistry, biosynthesis, analysis, and potential health effects. Adv Food Nutr Res. 2009; 55: 1-99. 29. Kim SJ, Yuan HD, Chung SH. Ginsenoside Rg1 suppresses hepatic glucose production via AMP-activated protein kinase in HepG2 cells. 14. Kim HG, Yoo SR, Park HJ, Lee NH, Shin JW, Sathyanath R, et al. Biol Pharm Bull. 2010; 33: 325-328. Antioxidant effects of Panax ginseng C.A. Meyer in healthy subjects: a randomized, placebo-controlled clinical trial. Food Chem Toxicol. 30. Liang J, Yu Y, Wang B, Lu B, Zhang J, Zhang H, Ge P. Ginsenoside Rb1 2011; 49: 2229-2235. attenuates oxygen-glucose deprivation-induced apoptosis in SH- 15. Shin HR, Kim JY, Yun TK, Morgan G, Vainio H. The cancer-preventive SY5Y cells via protection of mitochondria and inhibition of AIF and potential of Panax ginseng: a review of human and experimental cytochrome c release. Molecules. 2013; 18: 12777-12792. evidence. Cancer Causes Control. 2000; 11: 565-576. 31. Huang SL, He XJ, Li ZF, Lin L, Cheng B. Neuroprotective effects of 16. Lee JH, Choi SH, Kwon OS, Shin TJ, Lee JH, Lee BH, et al. Effects of ginsenoside Rg1 on oxygen-glucose deprivation reperfusion in PC12 ginsenosides, active ingredients of Panax ginseng, on development, cells. Pharmazie. 2014; 69: 208-211. growth, and life span of Caenorhabditis elegans. Biol Pharm Bull. 32. Ni N, Liu Q2, Ren H3, Wu D4, Luo C5, Li P6, Wan JB7. Ginsenoside

Page 119 Central

Rb1 protects rat neural progenitor cells against oxidative injury. mevalonic acid from acetyl-CoA. Cane DE, editor. In: Comprehensive Molecules. 2014; 19: 3012-3024. natural product chemistry. Oxford: Pergamon. 1999; 15-44.

33. Zhang Y, Sun K, Liu YY, Zhang YP, Hu BH, Chang X, et al. Ginsenoside 50. Bloch K. Sterol molecule: structure, biosynthesis, and function. Rb1 ameliorates lipopolysaccharide-induced albumin leakage from Steroids. 1992; 57: 378-383. rat mesenteric venules by intervening in both trans- and paracellular 51. Bach TJ. Some new aspects of isoprenoid biosynthesis in plants--a pathway. Am J Physiol - Gast Liver Physiol. 2014; 306: G289-G300. review. Lipids. 1995; 30: 191-202. 34. Haralampidis K, Trojanowska M, Osbourn AE. Biosynthesis of 52. Qureshi N, Porter JW. Conversion of acetyl-coenzyme A to isopentenyl triterpenoid saponins in plants. Adv Biochem Eng Biotechnol. 2002; pyrophosphate. Porter JW, Spurgeon SL, editors. In: Biosynthesis of 75: 31-49. isoprenoid compounds. New York: John Wiley. 1981; 47-94. 35. Thimmappa R, Geisler K, Louveau T, O’Maille P, Osbourn A. Triterpene 53. Kuzuyama T, Seto H. Two distinct pathways for essential metabolic biosynthesis in plants. Annu Rev Plant Biol. 2014; 65: 225-257. precursors for isoprenoid biosynthesis. Proc Jpn Acad Ser B Phys Biol 36. Jenner H, Townsend B, Osbourn A. Unravelling triterpene glycoside Sci. 2012; 88: 41-52. synthesis in plants: phytochemistry and functional genomics join 54. Gräwert T, Groll M, Rohdich F, Bacher A, Eisenreich W. Biochemistry forces. Planta. 2005; 220: 503-506. of the non-mevalonate isoprenoid pathway. Cell Mol Life Sci. 2011; 68: 37. Osbourn A, Goss RJ, Field RA. The saponins: polar isoprenoids with 3797-3814. important and diverse biological activities. Nat Prod Rep. 2011; 28: 55. Rohmer M. A mevalonate-independent rout to isopentenyl 1261-1268. diphosphate. Cane DE, editor. In: Comprehensive natural product 38. Sawai S, Saito K. Triterpenoid biosynthesis and engineering in plants. chemistry. Oxford: Pergamon. 1999; 45-68. Front Plant Sci. 2011; 2: 25. 56. Eisenreich W, Bacher A, Arigoni D, Rohdich F. Biosynthesis of 39. Han JY, In JG, Kwon YS, Choi YE. Regulation of ginsenoside and isoprenoids via the non-mevalonate pathway. Cell Mol Life Sci. 2004; phytosterol biosynthesis by RNA interferences of squalene epoxidase 61: 1401-1426. gene in Panax ginseng. Phytochemistry. 2010; 71: 36-46. 57. Schramek N, Wang H, Römisch-Margl W, Keil B, Radykewicz T, 40. Han JY, Kwon YS, Yang DC, Jung YR, Choi YE. Expression and RNA Winzenhörlein B, et al. Artemisinin biosynthesis in growing plants of interference-induced silencing of the dammarenediol synthase gene Artemisia annua. A 13CO2 study. Phytochemistry. 2010; 71: 179-187. in Panax ginseng. Plant Cell Physiol. 2006; 47: 1653-1662. 58. Hemmerlin A, Hoefler JF, Meyer O, Tritsch D, Kagan IA, Grosdemange- 41. Hu W, Liu N, Tian Y, Zhang L. Molecular cloning, expression, Billiard C, et al. Cross-talk between the cytosolic mevalonate and the puriication, and functional characterization of dammarenediol plastidial methylerythritol phosphate pathways in tobacco bright synthase from Panax ginseng. Biomed Res Int. 2013; 2013: 285740. yellow-2 cells. J Biol Chem. 2003; 278: 26666-26676.

42. Tansakul P, Shibuya M, Kushiro T, Ebizuka Y. Dammarenediol-II 59. Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH. synthase, the irst dedicated enzyme for ginsenoside biosynthesis, in Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants Panax ginseng. FEBS Lett. 2006; 580: 5143-5149. by intramolecular skeletal rearrangement. Proc Natl Acad Sci U S A. 1997; 94: 10600-10605. 43. Kushiro T, Ohno Y, Shibuya M, Ebizuka Y. In vitro conversion of 2,3-oxidosqualene into dammarenediol by Panax ginseng microsomes. 60. Hemmerlin A, Harwood JL, Bach TJ. A raison d’être for two distinct Biol Pharm Bull. 1997; 20: 292-294. pathways in the early steps of plant isoprenoid biosynthesis? Prog Lipid Res. 2012; 51: 95-148. 44. Kushiro T, Shibuya M, Ebizuka Y. Beta-amyrin synthase--cloning of oxidosqualene cyclase that catalyzes the formation of the most 61. Aharoni A, Jongsma MA, Bouwmeester HJ. Volatile science? Metabolic popular triterpene among higher plants. Eur J Biochem. 1998; 256: engineering of terpenoids in plants. Trends Plant Sci. 2005; 10: 594- 238-244. 602.

45. Xue Z, Duan L, Liu D, Guo J, Ge S, Dicks J, et al. Divergent evolution of 62. Flügge UI, Gao W. Transport of isoprenoid intermediates across oxidosqualene cyclases in plants. New Phytol. 2012; 193: 1022-1038. chloroplast envelope membranes. Plant Biol (Stuttg). 2005; 7: 91-97.

46. Han JY, Kim HJ, Kwon YS, Choi YE. The Cyt P450 enzyme CYP716A47 63. Peña-Rodríguez LM, Yam-Puc A, Knispel N, Schramek N, Huber C, catalyzes the formation of protopanaxadiol from dammarenediol-II Graßberger C, et al. Isotopologue proiling of triterpene formation during ginsenoside biosynthesis in Panax ginseng. Plant Cell Physiol. under physiological conditions. Biosynthesis of lupeol-3-(3’-R- 2011; 52: 2062-2073. hydroxy)-stearate in Pentalinon andrieuxii. J Org Chem. 2014; 79: 2864-2873. 47. Han JY, Hwang HS, Choi SW, Kim HJ, Choi YE. Cytochrome P450 CYP716A53v2 catalyzes the formation of protopanaxatriol from 64. Chaurasiya ND, Sangwan NS, Sabir F, Misra L, Sangwan RS. Withanolide protopanaxadiol during ginsenoside biosynthesis in Panax ginseng. biosynthesis recruits both mevalonate and DOXP pathways of Plant Cell Physiol. 2012; 53: 1535-1545. isoprenogenesis in Ashwagandha Withania somnifera L. (Dunal). Plant Cell Rep. 2012; 31: 1889-1897. 48. Han JY, Kim MJ, Ban YW, Hwang HS, Choi YE. The involvement of Î²- amyrin 28-oxidase (CYP716A52v2) in oleanane-type ginsenoside 65. Zhao S, Wang L, Liu L, Liang Y, Sun Y, Wu J. Both the mevalonate and the biosynthesis in Panax ginseng. Plant Cell Physiol. 2013; 54: 2034- non-mevalonate pathways are involved in ginsenoside biosynthesis. 2046. Plant Cell Rep. 2014; 33: 393-400.

49. Bochar DA, Friesen JA, Stauffacher CV, Rodwell VW. Biosynthesis of 66. Eisenreich W, Huber C, Kutzner E, Knispel N, Schramek N. Isotopologue

Page 120 Central

Proiling–Towards a better understanding of metabolic pathways. 69. Ostrozhenkova E, Eylert E, Schramek N, Golan-Goldhirsh A, Bacher Weckwerth W, Kahl G, editors. In: Handbook of Plant Metabolomics, A, Eisenreich W. Biosynthesis of the chromogen hermidin from New York: Wiley-Blackwell. 2013; 25–56. Mercurialis annua L. Phytochemistry. 2007; 68: 2816-2824.

67. Römisch-Margl W, Schramek N, Radykewicz T, Ettenhuber C, Eylert E, 70. Ginseng. In European Pharmacopeia 8.0, edqm, 2014; 1261. Huber C, et al. 13CO2 as a universal metabolic tracer in isotopologue 71. Lin MC, Wang KC, Lee SS. Transformation of ginsenosides Rg1 and Rb, perturbation experiments. Phytochemistry. 2007; 68: 2273-2289. and crude Sanchi saponins by human intestinal microlora. J. Chin. 68. Knispel N, Ostrozhenkova E, Schramek N, Huber C, Peña-Rodríguez Chem. Soc. 2001; 48: 113-120. LM, Bonill M, et al. Biosynthesis of panaxynol and panaxydol in Panax ginseng. Molecules. 2013; 18: 7686-7698.

Cite this article Schramek N, Huber C, Schmidt S, Dvorski SEM, Knispel N, et al. (2014) Biosynthesis of Ginsenosides in Field-Grown Panax Ginseng. JSM Biotechnol Bioeng 2(1): 1033.

Page 121 Review Article *Corresponding author Dr. Kourosh Zolghadr, ChromoTek GmbH, Am Klopferspitz 19, 82152 Planegg/Martinsried, Germany, Novel Antibody Format Provides Tel: +49-89-78797306; Fax: +49-89-78797311; E-mail: Efﬁ cient Tools for Research and Submitted: 06 May 2013 Accepted: 12 May 2014 Drug Discovery Published: 14 May 2014 ISSN: 2333-7117 Yurlova, L.1, Buchfellner, A.1,2, Zolghadr, K.* Copyright 1ChromoTek GmbH, IZB, Germany © 2014 Zolghadr et al. 2Natural and Medical Sciences Institute (NMI) at the University of Tuebingen, Germany OPEN ACCESS Keywords Heavy-chain antibody; Single domain antibody; VHH; Nano-Trap; Nano-Booster; Chromobody

Abstract Antibody-based reagents are indispensable for a broad range of biomedical sciences as well as for bioproduction. Here we highlight novel derivatives of heavy- chain antibodies and elaborate upon their beneﬁ cial application in proteomics, cell biological research and drug discovery. This special class of antibodies from Camelidae provides distinct advantages over conventional antibodies due to the naturally originating single-chain structure of their antigen-binding domains. At ChromoTek we have now developed new immunization and screening strategies to convert these advantages into superior tools for a broad range of applications. First, these extremely stable antigen-binding fragments of heavy chain antibodies

(VHHs, single domain antibodies, sdABs) can be easily produced as recombinant proteins in bacteria with constant quality criteria. When coupled to solid matrices, ® the highly specifi c VHHs can function as Nano-Traps , facilitating effi cient affi nity purifi cation of proteins for proteomic analyses.

Second, the tenfold smaller size of VHHs than that of the commonly used immunoglobulins offers a versatile substitute to traditional antibody staining as VHHs can also be ﬂ uorescently labeled. These Nano-Booster termed reagents are therefore especially useful for super-resolution microscopy and possess higher tissue penetrating ability.

The third exciting application of VHHs as live cell biomarkers opens new possibilities for cell biological and pharma research. When VHHs are genetically fused to fl uorescent proteins and expressed inside cells, these so-called Chromobodies® enable unique intracellular live cell antibody staining, unthinkable with conventional antibodies. These fl uorescent nanoprobes are of special interest for high content analysis (HCA) in drug discovery, since they permit real-time analyses of the effects of drug candidates at endogenous targets. Here we show examples for Chromobodies® highlighting important cellular biomarkers.Beyond visualization, Chromobodies® can be designed to specifi cally modulate (e.g. inhibit) their intracellular targets. Further possible implementations of these extremely small, stable and soluble single-chain camelid antibody fragments vary from co-crystallization assistance and neutralization of toxins, to crop protection and eventual therapeutics.

ABBREVIATIONS Structured illumination microscopy. BrdU: Bromodeoxyuridine; CCC: Cell Cycle INTRODUCTION Chromobody; ChIP: Chromatin immunoprecipitation; Co- The natural role of antibodies as blood plasma proteins is IP: Co-immunoprecipitation; DNMT1: DNA (cytosine-5)- to identify and bind other biomolecules, viruses and microbial methyltransferase 1; ELISA: Enzyme-linked immunosorbent toxins in this way defending us against infection [1]. This ability assay; FISH: Fluorescence in situ hybridization; GFP: Green of antibodies to recognize their particular targets (termed luorescent protein; GST: Glutathione S-transferase; HCA: High antigens) is broadly employed in biomedical research, enabling content analysis; IF: Immunoluorescence; IgG: Immunoglobulin speciic and quantitative detection of target molecules among G; IHC: Immunohistochemistry; IP: Immunoprecipitation; a myriad of others. Antibody-based tools are indispensable in MAPKAPK2, MK2: MAP kinase-activated protein kinase 2; basic experimental science, as well as in medicine for diagnostics NHS: N-hydroxysuccinimide; PALM: Photoactivated localization purposes and as of late even in therapeutics [2]. microscopy; PARP: Poly (ADP-ribose) polymerase; PBS: Phosphate buffered saline; PCNA: Proliferating cell nuclear The drawback of these powerful molecules is that antigen; PFA: Paraformaldehyde; RFP: Red luorescent conventional antibodies are large proteins consisting of several protein; RIP: RNA immunoprecipitation; sdAb: Single domain polypeptide chains which complicates their production and antibody; SDS-PAGE: Sodium dodecyl sulfate polyacrylamide some of the applications. However, a couple of decades ago, gel electrophoresis; STED: Stimulated emission depletion the accidental inding of some oddly small antibodies in camel (microscopy); STORM: Stochastic optical reconstruction blood serum triggered the uncovering of a whole new class microscopy; U2OS: Human osteosarcoma cell line; VHH: Variable of antibodies. These camelid antibodies (present in camels, domain of heavy chain of heavy chain antibody; 3D-SIM: dromedaries, llamas, guanacos, vicunas and alpacas) were named

Page 122 Central heavychain antibodies, as they are composed of heavy chains highly afine for a selected target must be obtained. For this, we only and are devoid of light chains ([3,4], recent review in [5]). follow an optimized process consisting of alpaca immunization,

In the absence of light chains, the antigen binding part of these generation of a VHH-library, selection by immunopanning and antibodies is reduced to a single domain (single domain antibody, veriication by ELISA. In brief, alpacas (Vicugna pacos) are sbAb), the so-called VHH domain (variable domain of heavy chain immunized with a puriied target protein in a suitable adjuvant (e.g. from Gerbu Biotechnik GmbH, Germany) for a 3 month of heavy chain antibody) or nanobody (Figure 1). These VHH domains are just 12-15 kDa in size, which is one-tenth the size period including a 1 week “boost”. Lymphocytes are isolated from a blood sample and further used for mRNA-extraction and cDNA of a conventional IgG antibody.VHHs are highly afine, extremely soluble and stable to temperature and chemicals [6-8]. synthesis. These are then used as a template for ampliication of V H sequences with speciic primers resulting in construction These exceptional properties of V Hs offer tangible advantages H H of a V H library of ~107 individual DNA sequences. Here we for various applications and even enable them to perform other H employ one of the most widely used library methodologies, functions for which no true alternative is available. At ChromoTek which is based on the use of ilamentous phage [10], a virus that GmbH (Planegg, Germany), we put these advantages on service lives on Escherichia coli. Phage display technology (reviewed in to basic science by converting V Hs into superior research tools. H [11,12]) has proven to be a powerful technique for presentation Furthermore, V Hs’ unique properties enable targeting and H and selection of antibodies in general and single-chain V Hs in tracing of antigens in living cells [9]. This patented Chromobody® H particular [13]. Technology is exclusively available to ChromoTek. The basic Depending on the downstream application of a V H (i.e. live- VHH patents have been developed at the Vlaams Instituut voor H Biotechnologie (VIB, Belgium) and the Vrije Universiteit Brussel cell or biochemical application) we subject a phage displayed (VUB, Belgium). Dependent on the application ield, ChromoTek library to one of the two different panning methods: an adapted and several other licensors have access to the VHH technology. immunopanning method, known as a solid phase panning [14], Other key patent holders are Ablynx, Belgium (healthcare or, alternatively, a “native” panning technique [15]. These two application of VHHs) and BAC BV, Netherlands (now part of Life methods differ by antigen presentation. In solid phase panning, Technologies recently integrated into Thermo Fisher Scientiic, the antigen is a puriied protein or peptide, which is passively

USA; application of VHHs in biopharmaceutical puriication). adsorbed on a solid support, e.g. on a microplate. Passive Since its launch in 2008, ChromoTek has developed adsorption, however, has been shown to be able to induce conformational changes in proteins, potentially rendering a large new immunization and screening strategies to convert VHH advantages into the irst-rate products for biomedical science, proportion of nonfunctional proteins [16]. In contrast to this, in appreciated by ~ 4500 customers all over the world. Below “native” panning the antigen is presented as tagged fusion protein we discuss several most important research applications of enriched from a mammalian cell lysate [15]. In comparison to the solid phase method, with the “native panning” we aim at VHHs: eficient immunoprecipitation with Nano-Traps, super- resolution microscopy with Nano-Boosters and visualization presentation of the antigen in its intracellular conformation with of endogenous proteins in live cells with Chromobodies®. An posttranslational modiications in order to thereby increase the overview comparison of these applications can be found in chance of inding antibodies for cell based applications. Three (Table 1). consecutive panning rounds are performed to enrich phages, carrying an antibody fragment, speciic for the presented antigen V HH-based reagents: from immunization to screening and production [9]. V Hs which were selected by immunopanning are further To develop a V H-based reagent, irst a speciic V H which is H H H tested for antigen recognition in ELISA [17], [18]. ELISA-positive binders are then characterized for their expression level, solubility, afinity and speciicity. For the bacterial production,

selected VHHs are cloned in appropriate bacterial expression vectors. Different expression methods have to be tested since

VHHs can be either produced in the bacterial cytoplasm [19] or in the periplasm, where the oxidating environment supports disulide bond formation [13]. Soluble antibody fragments produced in E. coli are puriied by afinity chromatography via the hexahistidine-peptide genetically fused to the C-terminus

of a VHH [20] followed by gel iltration chromatograpy [21]. In comparison to conventional production of monoclonal or polyclonal antibodies (e.g. isolation from serum, or puriication from culture media of hybridoma cells), bacterial production

of recombinant antibody fragments like VHHs is economic and sustainable, providing a protein of consistent quality with Figure 1 Comparison of conventional antibodies, consisting of four polypeptide negligible batch-to-batch variations [18]. Puriied VHHs are chains (e.g. mouse IgG, ~150 kDa) and much simpler camelid heavy-chain then modiied for appropriate functionality by coupling to solid antibodies. A binding domain of a heavy-chain antibody (in blue, VHH fragment matrices or luorescent dyes to create our biochemical reagents or sdAb) is formed by a single polypeptide chain and is just ~15 kDa in size. Nano-Traps and Nano-Boosters.

Page 123 Central

Table 1: Overview of application areas for VHH-based research tools.

Nano-Trap Nano-Booster Chromobody®

Format VHH-solid support VHH-chemical dye VHH-GFP/RFP (DNA) Pull-down (IP), co-IP + mass-spec, IF/IHC, Live-cell assays, co-IP + SDS-PAGE/Western blot, super-resolution microscopy, Application endogenous antigen visualization, co-IP + enzymatic assay, luorescence enhancement, endogenous target inhibition ChIP, RIP Conventional IP (e.g. IgGwith Conventional IF/IHC (primary + Overexpression of genetic fusions of Alternative Technologies Protein-A/G beads) secondary antibody) GFP/RFP with the target protein 2X faster IP, robust against t°C and chemicals (e.g. 2X faster IF, Detection of endogenous (not Advantages of V H H for mass-spec), close proximity of signal to the target overexpressed) proteins in live cells, Technology no interference from (for super-resolution microscopy) endogenous target inhibition immunoglobulin chains GFP-, RFP-, GST-, DNMT1-, p53*-, Cell Cycle Chromobody®, Lamin-, Actin-, GFP-, RFP-, PARP*-, p53*-, Mdm4*-, Examples Mdm4*-, MK2*-, β-Arrestin*-, PARP*- DNMT1-, PARP-, p53*-, Mdm4*-, MK2*- MK2*-, β-Arrestin*-Boosters Traps Chromobodies® References [22,25-34] [35-41] [9,42-45] *- in development Abbreviations: please refer to the full list of abbreviations at the beginning of the manuscript.

Product Line: Nano-Traps® (dissociation constant for our GFP-Trap® lies in the picomolar range) [22]. Additionally, a higher density can be expected from Nano-Trap reagents enable highly eficient one-step isolation the coupling of V Hs to the beads, than from coupling of the of the target proteins and their interaction partners from cell H full IgG molecules, due to the 10-times smaller size of the V H lysates or tissues [22]. These immunoprecipitation reagents H fragments. consist of target-speciic VHHs covalently coupled to agarose or magnetic particles (beads). Nano-Trap technology provides Finally, since Nano-Traps are manufactured with the binders notable improvements in speed, robustness and quality of already immobilized on the beads, the pull-down procedure is immunoprecipitation in comparison to the conventional signiicantly shorter then with conventional antibodies, which immunoprecipitation techniques employing IgGs coupled to require additional time for coupling to Protein-A/G beads [23]. Protein-A/G beads [23]. This results in aneficient immunoprecipitation with Nano-Traps within 30 minutes (Figure 2B). Firstly, to manufacture Nano-Traps, the NHS One example for an extremely popular Nano-Trap is our (N-hydroxysuccinimide) coupling is employed to immobilize VHHs on the beads, resulting in formation of amide bonds between the GFP-Trap® (over 400 references on PubMed, listed also at www. chromotek.com/references/publications/) which connects matrix and the primary amino groups of the VHH proteins. This covalent bonding allows Nano-Traps to overcome the commonly cell biology with biochemistry. Fluorescent proteins are the encountered problem of interference from immunoglobulin commonly used tags in cell biology, and GFP-Trap enables easy bands with analysis of immunoprecipitates (e.g. on SDS-PAGE) immunoprecipitation of luorescent fusion proteins and their [24]. Thus, in case of conventional immunoprecipitation with interacting factors from transfected cells or stable cell lines IgGs immobilized on Protein-A/G beads, elution in presence (Figure 2A, 2B). of detergents and reducing agents (e.g. boiling in SDS-sample GFP-Trap has been employed for a multitude of buffer, containing SDS and β-mercaptoethanol), results in biochemical analyses of the GFP-fusion proteins by means of contamination of the eluate (“bound” fraction) with heavy and immunoprecipitation (IP) / Co-IP followed by Western Blot light chains of conventional antibodies. In contrast, even under detection [26, 27], mass spectroscopy [28-30], enzyme activity these conditions, Nano-Traps ensure that the eluted protein is measurements (can be done directly on-beads) [31, 32], ChIP not contaminated with the antibodies, since V Hs stay “on the H [33] or RIP analyses [34]. For example, GFP-Trap was one of bead” during elution due to both covalent binding of V Hs to the H the tools the authors used in a recent study of the role of the matrices and monomeric nature of V Hs (Figure 2A). H post-translational modiication citrullination in regulation of pluripotency and histone H1 binding to chromatin [26]. For this, Secondly, extreme stability of VHHs themselves ensures their robust binding performance under a broad range of conditions GFP-tagged histone H1.2 (wild-type vs. its mutant form) was (up to 2M NaCl or 1% SDS or 8M Urea), which can be required for expressed in embryonic stem (ES) cells, pulled-down with GFP- some high-end downstream applications, such as ubiquitination Trap and then subjected to citrullination immunoblot. In another assay [25]. publication, the authors analyzed an interaction between the two disease- and RNA-associated proteins, FMRP (fragile X Next, immunoprecipitation with Nano-Traps is very eficient, protein) and Ataxin-2 in transgenic Drosophila using GFP-Trap in which stems from the high afinity of the VHH binding its target

Page 124 Central conjunction with Western blotting as one of the approaches [27]. available within the next months. In the most recent work, GFP-Trap was used to conduct in vivo Product Line: Nano-Booster high-throughput RNA-binding assays [34]. Nano-Booster reagents enable reactivation, enhancement and Besides GFP-Trap, we provide the following highly effective stabilization of the signals of luorescent proteins for microscopy Nano-Trap reagents: RFP-Trap, GST-Trap, DNMT1-Trap. A applications (Figure 3 and [35]). number of other Nano-Traps speciic against p53, Mdm4, MAPKAPK2, PARP and β-Arrestin is our pipeline and will become As mentioned in the previous chapter, luorescent proteins are commonly used in cell biology to facilitate studying protein localization and dynamics in living cells. However, ixation or other treatments (FISH, Click chemistry or BrdU detection) can dramatically decrease signal intensities. Our GFP- and RFP- Boosters are immunocyto/histochemical reagents, consisting of

small, highly afine VHHs coupled to bright luorescent ATTO-dyes from ATTO-TEC GmbH, Germany (www.atto-tec.com‎). ATTO

NHS-esters react with amino groups of VHHs typically resulting in

1:1 labeling eficiency (one dye molecule per one VHH molecule). Nano-Boosters can be easily applied in a one-step protocol: no incubation with secondary antibodies is required here. Already after a short 30-minute immunostaining of PFA-ixed cells with RFP-Booster, the luorescent signal intensities increase ~2.5 times (data not shown) and become signiicantly more stable against bleaching (Figure 3, bottom). Enhancement of the luorescent protein signals with our Nano-Boosters for conventional or confocal luorescence microscopy can be exempliied with recent publications on spindle assembly checkpoint [36], on membrane remodeling in Dictyostelium discoideum [37] and on traficking in mammalian ciliogenesis [38]. Another drawback of typical luorescent proteins is that their photostability and quantum eficiency are not suficient for super- resolution microscopy applications, such as 3D-SIM, STED or STORM/PALM. Although the signal properties of the luorescent proteins can be improved through immunostaining, the large size of conventional antibodies displaces the dye from the target in a “linkage error” of ~ 10 nm [35], which is undesirable for single- molecule imaging. In contrast, close proximity of a dye to the target Figure 2 (A) - Comparison of GFP-Trap with conventional mono- structure can be easily achieved with GFP- and RFP-Boosters due and polyclonal anti-GFP antibodies in pull-down experiments. to the small size (1.5 nm X 2.5 nm) of the alpaca antibody fragments Immunoprecipitation (IP) of GFP was carried out from cell lysates of [35], [39]. Thus, Nano-Boosters combine molecular speciicity of GFP-expressing human cells (GFP-transfected HEK293T). One 10-cm tissue culture dish with conluent cells (~5 X 106 cells) was used per genetic tagging with the minimal linkage error and a high photon IP. GFP-Trap, Protein-A beads and conventional antibodies were used yield of organic dyes. This labeling scheme has been successfully according to manufactures instructions. All immunoprecipitation applied for single-molecule nanoscopy of GFP-tagged proteins reactions were carried out for 1 h at 4°C, elution of the bound fractions in mammalian cell lines, in cultured hippocampal neurons, and was performed by boiling the beads in SDS-sample buffer (2 X in budding yeast Saccharomyces cerevisiae [35]. Also, in a recent Laemmli buffer with 4% SDS and 10% β-mercaptoethanol). Input (I), study of Drosophila patterning, the authors examined differential non-bound (FT) and bound (B) fractions were separated by SDS-PAGE association of mRNAs with processing bodies (P bodies) in ly followed by Coomassie staining (above) and Western blot detection with anti-GFP antibodies (3H9, ChromoTek GmbH, Germany) oocytes using structured illumination microscopy. To determine (below). Note the presence of heavy and light chains (hc and lc) of co-localization of bicoid (bcd) and gurken (grk) ribonucleoprotein conventional antibodies in the bound fractions, when monoclonal complexes with a P body marker protein, they detectedthe or polyclonal antibodies were used for immunoprecipitation. Note protein counterparts through genetic fusions to luorescent eficient immunoprecipitation with GFP-Trap® and the absence of proteins, which were immunostained with Nano-Booster and contaminating proteins in the bound fraction (adapted from [22]). imaged with 3D-SIM [40]. The group of A. Furstenberg also used (B) - Eficient immunoprecipitation with Nano-Traps in 30 minutes. HEK293T cells were transfected with GFP for 24 h, lysed and incubated Nano-Boosters in super-resolution microscopy to quantitatively with GFP-Trap beads for 1, 5, 10 and 30 min. Input (I), non-bound analyze dynamics of arrestin2 clustering in cultured mammalian (FT) and bound (B) fractions were separated by SDS-PAGE followed cells upon G protein-coupled receptor stimulation and its by Western blot detection with anti-GFP 3H9 antibodies. Note that the dependence on cytoskeletal components [41]. low-through (FT) lanes corresponding to 1, 5 and 10 minute-long IPs ® contain decreasing amounts of GFP, whereas no GFP signal is could be Product Line: Chromobodies detected in FT lanes after a 30 minute-IP. Chromobodies are unique molecular probes developed by

Page 125 Central

conventional antibodies lies in their ability to fold in the reducing

environment of cytoplasm of eukaryotic cells, making VHHs suitable for a role as intracellular antibodies. Chromobodies®are

generated by genetic fusion of a target-speciic VHH with a luorescent protein. To develop a Chromobody against a target of

interest, speciic VHHs which were selected in a “native” panning, are cloned in-frame with luorescent proteins, such as TagRFP or TagGFP2 under control of immediate early promoter of

cytomegalovirus (PCMVIE) in mammalian expression vectors from Evrogen, Russia (www.evrogen.com/products/TagFPs.shtml). These Chromobody plasmids can be introduced into living cells (cell lines, primary or stem cells) by means of transient transfection (e.g. with Lipofectamine®, Thermo Fisher Scientiic, MA, USA). Alternatively, Chromobodies are also available as stable cell lines for high-content analysis (HCA) and screening. In brief, stable HeLa and U2OS cell lines are generated by random integration of a Chromobody into cellular genome upon transfection followed by culturing under selection pressure (puromycin or G418) and single-cell sorting to gain individual clones. Transgene expression is validated by luorescence microscopy and Western blotting. Stability of the genetic modiication is conirmed after 1, 2 and Figure 3 RFP-Booster enables speciic labeling of RFP-fusion proteins 3 months in culture (respective paper describing the method is and increases signal stability. currently in preparation). Top: Confocal images of HeLa cells expressing mRFP-PCNA and stained with RFP-Booster. The cells were transiently transfected At ChromoTek we developed Chromobodies highlighting with mRFP-PCNA mammalian expression construct, ixed in 4% PFA, important cellular biomarker processes such as cell cycle permeabil ized with 0.5% triton-PBS, incubated with RFP-Booster_ (PCNA, Cell Cycle Chromobody), DNA methylation (DNMT1 ATTO594 for 30 min and stained with DAPI to highlight nuclei. Chromobody), PARylation (PARP Chromobody), nuclear and Imaging was performed with UltraVIEW VoX (PerkinElmer, MA, USA) cytoskeletal rearrangements (Lamin and Actin Chromobodies) spinning disc microscope. Left to right: DAPI signal is in blue, PCNA/ (see Figure 4). With the help of Chromobodies these processes RFP-Booster signal is in red, overlay image is on the right. Note that can for the irst time be resolved based on the signals from the the red signal is strong and speciic and clearly resolves the replication foci. Scale bar, 10 μm. endogenous proteins, which is essential for understanding Bottom: Quantiication of signal stability upon photobleaching. fundamental biological processes as well as for accurate RFP-expressing cells were ixed and stained with RFP-Booster and distinguishing of health and disease at a cellular level. For compared with unstained cells in bleaching experiments. Bleaching example, DNA replication could recently be for the irst time and imaging was performed with Leica SP5 confocal microscope (Leica observed in high detail at endogenous level by subjecting our Cell Microsystems GmbH, Germany) equipped with HeNe 2 mW 594 nm Cycle Chromobody cell line that speciically labels endogenous laser (60% laser intensity for bleaching, 15% for image acquisition). PCNA to high-resolution confocal time-lapse microscopy [43]. Signal intensities were quantiied, starting values normalized to 100% and plotted against the bleaching time, s. Bar chart shows that Since Chromobodies® permit real-time analyses of the RFP luorescence bleaches very quickly upon irradiation with high effects of drug candidates at endogenous targets, they are of laser intensity. In contrast, luorescent signals remain stable when special interest for high content analysis in drug discovery. enhanced with RFP-Booster_ATTO594 (in-house comparison tests, www.chromotek.com). Several in-house and external studies demonstrated suitability of Chromobodies® for automated HCA. For example, our Cell Cycle Chromobody (CCC) HeLa and U2OS stable cell lines enable ChromoTek to enable immunotracing of antigens in living cells in screening of compounds such as cancer drugs for inluencing real-time imaging applications [9]. cell cycle and cell viability in one experiment. (Figure 5) shows Commonly, live-cell microscopy is performed with the results of an automated evaluation of the effect of anticancer exogenously introduced chimeric proteins generated by a genetic drugs such as aphidicolin, nocodazole or staurosporine on the fusion of a target protein with a luorescent protein. However, cell cycle, analyzed with CCC cell line. In another case study we these exogenously expressed chimeras do not give information demonstrate a straight-forward visualization of apoptosis in about distribution or dynamics of the endogenous cellular real-time imaging using Lamin Chromobody cellline for high- proteins. Localization of endogenous proteins can be examined content analysis [44]. by means of immunostaining, which is however in the majority Beyond visualization, Chromobodies can be designed to of cases incompatible with live imaging and is restricted to ixed speciically modulate (e.g. inhibit) their intracellular targets samples. [39], [45]. Inhibitory Chromobodies provide a useful tool for At ChromoTek we found a unique way to overcome these basic research and for target validation in drug discovery. Chromobodies could even serve as a lead molecule for shortcomings by creating VHH-based nanoprobes termed investigation of targets considered undruggable. Chromobodies [42]. A hallmark advantage of VHHs over

Page 126 Central PERSPECTIVES AND VISIONS assist crystallization process and structural determination of dificult-to-crystallize proteins and complexes, such as Being extremely small, stable and soluble, the single-chain Ribonuclease A, components of bacterial secretion system, or camelid antibody fragments, V Hs, offer special advantages H archeal mechanosensitive channel [46]. These single-domain to biomedical sciences. At ChromoTek GmbH we develop binders restrain highly dynamic proteins, stabilize intrinsic superior V H-based tools for a broad range of applications in H lexible protein regions and mask counterproductive protein basic academic research: from immunoprecipitation to super- surfaces to facilitate eficient crystal formation. Furthermore, resolution microscopy. However, V Hs can serve basic science H V Hs can be engineered to assist speciic depletion of their also in a number of other ways. For example, V Hs proved to H H target by targeting it to the ubiquitin-proteasome pathway, as

Figure 4 Confocal images of human cells expressing Chromobodies that highlight important cellular markers. Image acquisition was performed with Leica SP5 confocal microscope (Leica Microsystems GmbH, Germany) either live or after ixation. Left to right: HeLa cells stably expressing Cell Cycle Chromobody (in green, different cell cycle stages are visualized: G phase, early, mid and late S phases), HeLa cells transiently transfected with DNMT1 Chromobody (in red), HeLa cells stably expressing Lamin Chromobody (green, visualizes nuclear morphology), HeLa cells transiently transfected with Actin Chromobody (in red). Cells were ixed and counterstained for DNA (in blue).Scale bar, 10 μm. (Unpublished in-house experiments).

Figure 5 Top: A time-series was acquired by live-cell confocal imaging of a stable U2OS cell line expressing Cell Cycle Chromobody (U2OS-CCC). Cells were imaged live for 10 h with UltraVIEW VoX (PerkinElmer, MA, USA) spinning disc microscope. A typical cell progressing through different stages of cell cycle is shown. Left to right: G2 phase, mitosis, G1 phase, early and mid S phases. Scale bar, 10 μm. Bottom: Results of automated cell cycle analysis of Cell Cycle Chromobody cells treated with three different cell cycle inhibitors. CCC cells were seeded into 96-well plates (Grenier μ-clear, Greiner bio one, Germany), incubated for 24 hours with several concentrations of reference substances, ixed and counterstained for DNA. Two independent experiments were performed in duplicates. Automated image acquisition and analyses were carried out with INCell Analyzer 1000 and INCell Workstation software (GE Healthcare, Germany) respectively. For cell classiication, a decision tree was generated based on nuclear size, shape and intensity and on the amount and size of nuclear granules. Note increased number of cells arrested in early S phase upon aphidicolin treatment, mitosis arrest upon treatment with higher concentrations of nocodazole and increased number of dead cells when subjected to increasing concentrations of staurosporine.

Page 127 Central elegantly shown in [47]. Therefore, to assist scientists in their 10. Smith GP. Filamentous fusion phage: novel expression vectors that speciic needs of single-domain afinity reagents, in addition to display cloned antigens on the virion surface. Science. 1985; 228: 1315-1317. our portfolio of VHH-products outlined above we offer isolation of VHHs for speciic customer targets. 11. Hoogenboom HR. Overview of antibody phage-display technology and its applications. Methods Mol Biol. 2002; 178: 1-37. Further implementations of single-chain antibody fragments outside of basic science include healthcare and diagnostics (in 12. Willats WG . Phage display: practicalities and prospects. Plant Mol vivo imaging, neutralization of toxins and eventual therapeutics), Biol. 2002; 50: 837-854. biotechnological puriication (former BAC BV, Netherlands), crop 13. Saerens DM. Single Domain Antibodies. Methods in Molecular Biology. protection (AgroSavfe, Belgium) and environmental/food safety ed JM Walker. Vol. 911. 2012: Humana Press. (AbCelex, Canada). 14. Ehrlich GK, Berthold W, Bailon P. Phage display technology. Afinity ACKNOWLEDGEMENTS selection by biopanning. Methods Mol Biol. 2000; 147: 195-208. 15. Schmidthals K. Generation and characterization of heavy chain We are grateful to our academic collaboration partner antibodies derived from Camelids. 2013. LMU Munich. Prof. Ulrich Rothbauer at the University of Tuebingen for his 16. Davies J, Dawkes AC, Haymes AG, Roberts CJ, Sunderland RF, Wilkins constant support and scientiic advising. We are indebted to MJ, et al. A scanning tunnelling microscopy comparison of passive Katrin Schmidthals and Tina Romer for the productive work antibody adsorption and biotinylated antibody linkage to streptavidin together throughout the years. We thank Marion Jung for the on microtiter wells. J Immunol Methods. 1994; 167: 263-269. helpful comments on the manuscript. We furthermore thank 17. Engvall E, Perlmann P . Enzyme-linked immunosorbent assay (ELISA). Jacqueline Gregor and Benjamin Ruff or their excellent technical Quantitative assay of immunoglobulin G. Immunochemistry. 1971; 8: assistance. This work was funded in part by the GoBio grant of 871-874. the German Federal Ministry of Education and Research (BMBF) to ChromoTek. 18. Baral TN, MacKenzie R, Arbabi Ghahroudi M. Single-domain antibodies and their utility. Curr Protoc Immunol. 2013; 103: Unit 2. Con lict of Interest 19. Veggiani G, de Marco A. Improved quantitative and qualitative The authors declare the following potential conlicts of production of single-domain intrabodies mediated by the coexpression of Erv1p sulhydryl oxidase. Protein Expr Purif. 2011; 79: interest with respect to the research, authorship, and/or 111-114. publication of this article: The author K.Z. declares competing inancial interests as co-inventor of the Chromobody technology 20. Hochuli E, Döbeli H, Schacher A. New metal chelate adsorbent selective for proteins and peptides containing neighbouring histidine residues. and as shareholder of ChromoTek. The Chromobody technology J Chromatogr. 1987; 411: 177-184. is covered by a patent application owned by the University of Munich and licensed to ChromoTek on an exclusive basis. 21. PORATH J, FLODIN P. Gel iltration: a method for desalting and group separation. Nature. 1959; 183: 1657-1659. REFERENCES 22. Rothbauer U, Zolghadr K, Muyldermans S, Schepers A, Cardoso MC, 1. Alberts B JA, Lewis J, et al. Molecular Biology of the Cell. 4th edition. Leonhardt H. A versatile nanotrap for biochemical and functional 2002: New York: Garland Science. studies with luorescent fusion proteins. Mol Cell Proteomics. 2008; 7: 282-289. 2. Williams SC. Small nanobody drugs win big backing from pharma. Nat Med. 2013; 19: 1355-1356. 23. Bonifacino JS, Dell’Angelica EC, Springer TA. Immunoprecipitation. Curr Protoc Mol Biol. 2001; Chapter 10: Unit 10. 3. Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, et al. Naturally occurring antibodies devoid of 24. Rosenberg IM. Protein Analysis and Puriication: Benchtop light chains. Nature. 1993; 363: 446-448. Techniques. 2 ed. 2004: Birkhäuser. 4. Flajnik MF, Deschacht N, Muyldermans S. A case of convergence: why 25. Lee SY, Ramirez J, Franco M, Lectez B, Gonzalez M, Barrio R, et al. did a simple alternative to canonical antibodies arise in sharks and Ube3a, the E3 ubiquitin ligase causing Angelman syndrome and linked camels? PLoS Biol. 2011; 9: e1001120. to autism, regulates protein homeostasis through the proteasomal shuttle Rpn10. Cell Mol Life Sci. 2013; . 5. Muyldermans S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 2013; 82: 775-797. 26. Christophorou MA, Castelo-Branco G, Halley-Stott RP, Oliveira CS, Loos R, Radzisheuskaya A, et al. Citrullination regulates pluripotency 6. van der Linden RH, Frenken LG, de Geus B, Harmsen MM, Ruuls RC, Stok W, et al. Comparison of physical chemical properties of llama and histone H1 binding to chromatin. Nature. 2014; 507: 104-108. VHH antibody fragments and mouse monoclonal antibodies. Biochim 27. Sudhakaran IP, Hillebrand J, Dervan A, Das S, Holohan EE, Hülsmeier Biophys Acta. 1999; 1431: 37-46. J, et al. FMRP and Ataxin-2 function together in long-term olfactory 7. Dumoulin M, Conrath K, Van Meirhaeghe A, Meersman F, Heremans habituation and neuronal translational control. Proc Natl Acad Sci U S K, Frenken LG, et al. Single-domain antibody fragments with high A. 2014; 111: E99-99E108. conformational stability. Protein Sci. 2002; 11: 500-515. 28. Parkinson K, Baines AE, Keller T, Gruenheit N, Bragg L, North RA, et al. 8. Harmsen MM, De Haard HJ. Properties, production, and applications Calcium-dependent regulation of Rab activation and vesicle fusion by of camelid single-domain antibody fragments. Appl Microbiol an intracellular P2X ion channel. Nat Cell Biol. 2014; 16: 87-98. Biotechnol. 2007; 77: 13-22. 29. Popichenko D, Hugosson F, Sjögren C, Dogru M, Yamazaki Y, 9. Rothbauer U, Zolghadr K, Tillib S, Nowak D, Schermelleh L, Gahl A, Wolfstetter G, et al. Jeb/Alk signalling regulates the Lame duck GLI et al. Targeting and tracing antigens in live cells with luorescent family transcription factor in the Drosophila visceral mesoderm. nanobodies. Nat Methods. 2006; 3: 887-889. Development. 2013; 140: 3156-3166.

Page 128 Central

30. Weinert BT, Iesmantavicius V, Moustafa T, Schölz C, Wagner 39. Kirchhofer A, Helma J, Schmidthals K, Frauer C, Cui S, Karcher A, et al. SA, Magnes C, et al. Acetylation dynamics and stoichiometry in Modulation of protein properties in living cells using nanobodies. Nat Saccharomyces cerevisiae. Mol Syst Biol. 2014; 10: 716. Struct Mol Biol. 2010; 17: 133-138. 31. Walte A, Rüben K, Birner-Gruenberger R, Preisinger C, Bamberg- 40. Weil TT, Parton RM, Herpers B, Soetaert J, Veenendaal T, Xanthakis D, Lemper S, Hilz N, et al. Mechanism of dual speciicity kinase activity of et al. Drosophila patterning is established by differential association DYRK1A. FEBS J. 2013; 280: 4495-4511. of mRNAs with P bodies. Nat Cell Biol. 2012; 14: 1305-1313. 32. Chen ZH, Schaap P. The prokaryote messenger c-di-GMP triggers stalk 41. Truan Z, Tarancón Díez L, Bönsch C, Malkusch S, Endesfelder U, cell differentiation in Dictyostelium. Nature. 2012; 488: 680-683. Munteanu M, et al. Quantitative morphological analysis of arrestin2 clustering upon G protein-coupled receptor stimulation by super- 33. Vidal SE, Pincus D, Stewart-Ornstein J, El-Samad H. Formation of resolution microscopy. J Struct Biol. 2013; 184: 329-334. subnuclear foci is a unique spatial behavior of mating MAPKs during hyperosmotic stress. Cell Rep. 2013; 3: 328-334. 42. Romer T, Leonhardt H, Rothbauer U. Engineering antibodies and proteins for molecular in vivo imaging. Curr Opin Biotechnol. 2011; 34. Strein C, Alleaume AM, Rothbauer U, Hentze MW, Castello A. A 22: 882-887. versatile assay for RNA-binding proteins in living cells. RNA. 2014; 20: 721-731. 43. Burgess A, Lorca T, Castro A. Quantitative live imaging of endogenous DNA replication in mammalian cells. PLoS One. 2012; 7: e45726. 35. Ries J, Kaplan C, Platonova E, Eghlidi H, Ewers H. A simple, versatile method for GFP-based super-resolution microscopy via nanobodies. 44. Zolghadr K, Gregor J, Leonhardt H, Rothbauer U. Case study on live cell Nat Methods. 2012; 9: 582-584. apoptosis-assay using lamin-chromobody cell-lines for high-content analysis. Methods Mol Biol. 2012; 911: 569-575. 36. Kruse T, Larsen MS, Sedgwick GG, Sigurdsson JO, Streicher W, Olsen JV, et al. A direct role of Mad1 in the spindle assembly checkpoint beyond 45. Paalanen MM, Ekokoski E, E Khattabi M, Tuominen RK, Verrips CT, Mad2 kinetochore recruitment. EMBO Rep. 2014; 15: 282-290. Boonstra J, et al. The development of activating and inhibiting camelid VHH domains against human protein kinase C epsilon. Eur J Pharm Sci. 37. Linkner J, Witte G, Zhao H, Junemann A, Nordholz B, Runge-Wollmann 2011; 42: 332-339. P, et al. The inverse BAR domain protein IBARa drives membrane remodeling to control osmoregulation, phagocytosis and cytokinesis. 46. Koide S. Engineering of recombinant crystallization chaperones. Curr J Cell Sci. 2014; 127: 1279-1292. Opin Struct Biol. 2009; 19: 449-457. 38. Hall EA, Keighren M, Ford MJ, Davey T, Jarman AP, Smith LB, et al. 47. Caussinus E, Kanca O, Affolter M. Fluorescent fusion protein knockout Acute versus chronic loss of mammalian Azi1/Cep131 results in mediated by anti-GFP nanobody. Nat Struct Mol Biol. 2011; 19: 117- distinct ciliary phenotypes. PLoS Genet. 2013; 9: e1003928. 121.

Cite this article Yurlova L, Buchfellner A, Zolghadr K (2014) Novel Antibody Format Provides Efﬁ cient Tools for Research and Drug Discovery. JSM Biotechnol Bioeng 2(1): 1034.

Page 129