Heterogeneous Phenotype in a Family with Compound Heterozygous Parkin Gene Mutations

ORIGINAL CONTRIBUTION Heterogeneous Phenotype in a Family With Compound Heterozygous Parkin Gene Mutations

Hao Deng, PhD; Wei-Dong Le, MD, PhD; Christine B. Hunter, RN; William G. Ondo, MD; Yi Guo, MS; Wen-Jie Xie, MD; Joseph Jankovic, MD

Background: Mutations in the parkin gene (PRKN) cause mutations in compound heterozygotes. The phenotype autosomal recessive early-onset Parkinson disease (EOPD). of patients was that of classic autosomal recessive EOPD characterized by beneficial response to levodopa, rela- Objective: To investigate the presence of mutations in tively slow progression, and motor complications. All het- the PRKN gene in a white family with EOPD and the geno- erozygous mutation carriers (T240M or EX 5_6 del) and type-phenotype correlations. a 56-year-old woman who was a compound heterozygous mutation carrier (T240M and EX 5_6 del) were free Design: Twenty members belonging to 3 generations of of any neurological symptoms. the EOPD family with 4 affected subjects underwent genetic analysis. Direct genomic DNA sequencing, semi- Conclusions: Compound heterozygous mutations quantitative polymerase chain reaction, real-time quan- (T240M and EX 5_6 del) in the PRKN gene were found titative polymerase chain reaction, and reverse- to cause autosomal recessive EOPD in 4 members of a transcriptase polymerase chain reaction analyses were large white family. One additional member with the same performed to identify the PRKN mutation. mutation, who is more than 10 years older than the mean age at onset of the 4 affected individuals, had no clinical Results: Compound heterozygous mutations (T240M manifestation of the disease. This incomplete pen- and EX 5_6 del) in the PRKN gene were identified in 4 etrance has implications for genetic counseling, and it patients with early onset (at ages 30-38 years). Al- suggests that complex gene-environment interactions may though heterozygous T240M and homozygous EX 5_6 play a role in the pathogenesis of PRKN EOPD. del mutations in the PRKN gene have been previously described, this is, to our knowledge, the first report of these Arch Neurol. 2006;63:273-277

ARLY-ONSET PARKINSON the PRKN gene: a missense mutation disease (EOPD), beginning (T240M) and a gross deletion (EX 5_6 del; before 50 years of age, is deletion of exons 5 and 6). This family clinically and genetically draws attention to the broad spectrum of heterogeneous.1 At least 5 phenotypes in the PRKN group of EOPD. genes have been identified as causal genes E 2 for EOPD, including α-synuclein (PARK1), METHODS parkin (PRKN, PARK2),3 DJ-1(PARK7),4 5 PTEN-induced kinase 1 (PINK1, PARK6), PEDIGREE, PATIENTS, AND and leucine-rich repeat kinase 2 (LRRK2, HEALTHY CONTROL SUBJECTS PARK8).6,7 Homozygous and compound heterozygous mutations in the PRKN gene A 3-generation, 20-member family in which 4 are responsible for 49% of familial EOPD members had EOPD (the mother is Irish Ameri- and 18% of sporadic EOPD,8 and at least can and the father is Dutch and American In- Author Affiliations: 109 different mutations have been iden- dian) underwent screening for PRKN muta- Department of Neurology, tified in the Human Gene Mutation Da- tions. They were compared with 208 patients Baylor College of Medicine, tabase, including 38 nonsense/missense with PD, including 106 with EOPD (male- Houston, Tex (Drs Deng, Le, mutations and 38 gross deletions (avail- female ratio, 55:51; mean±SD onset age, Ondo, Xie, and Jankovic and 40.2±7.2 years) and 102 with late-onset PD Ms Hunter); and School of able at: http://archive.uwcm.ac.uk/uwcm (male-female ratio, 52:50; mean±SD onset age, Medical Technology and /mg/hgmd0.html), whereas mutations in 63.2±8.7 years), and 134 healthy control sub- Information, Central South late-onset cases are rare. We describe jects (male-female ratio, 69:65; mean±SD age, University, Changsha, China herein a large family with EOPD caused 57.2±11.2 years). Patients were diagnosed as (Ms Guo). by compound heterozygous mutations in having PD according to common diagnostic cri-

(REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 273

Forward Primer Reverse Primer Product Size, Exon (5؅→3؅) (5؅→3؅) bp 1 GCCCCGTCATTGACAGTT GAGGCCTGGAGGATTTAACC 227 2 TAAGGGCTTCGAGTGATGCT GCATGAGCAATGGAGCTG 273 3 CTCGCATTTCATGTTTGACA TAAATATGCACCCGGTGAGG 394 4 GAGTTTCTTGTCTCAATTTAGATGC TTTCTTTTCAAAGACGGGTGA 290 5 GTGGAAACATGTCTTAAGGAGTACA TTCCTGGCAAACAGTGAAGA 225 6 GTCCAAAGAGATTGTTTACTGTGG GGGGGAGTGATGCTATTTTT 278 7 GCCTTTCCACACTGACAGGTA AAATTCTTCTGCTAGGGTTTACG 296 8 GGCAACACTGGCAGTTGATA GGAGCCCAAACTGTCTCATT 230 9 AAGCAAGAAATCCCATGCAC TGTGCAAAAGCAAACAAGGA 299 10 TTGCCAAATGCAACCTAATG GGAACTCTCCATGACCTCCA 223 11 CCGACGTACAGGGAACATAAA ATGATTCTCCCCCAAAGAGC 253 12 GTTTGGGAATGCGTGTTTT AGAATTAGAAAATGAAGGTAGACA 255

Abbreviations: bp, base pair; PRKN, parkin gene.

teria.9 This study was approved by the Baylor College of Medi- ation of our assay, we used samples with LRRK2 R1441G and cine Institutional Review Board, Houston, Tex, and all partici- G2019S mutations as negative controls.7 All experiments were pants gave signed informed consent. performed and were accepted only when the standard deviation was less than 10% of the calculated mean concentra- GENETIC ANALYSIS tions. Gene dosage alternations were confirmed after triple analysis.13 The sequences of the primers are Genomic DNA was isolated from lymphocytes using standard 5Ј-AACATCAGTAGCTTTGCACCTG-3Ј for PRKN6F; methods. Polymerase chain reaction (PCR) amplification of the 5Ј-GGGGGAGTGATGCTATTTTT-3Ј for PRKN6R; PRKN gene was performed with the use of a thermocycler sys- 5Ј-CAAATAGTCGGAACATCACTTGC-3Ј for PRKN probe; tem (MyCycle; Bio-Rad Laboratories, Hercules, Calif) for 32 5Ј-ATTCCACCCATGGCAAATT-3Ј for GAPDH-F; cycles at 95°C for 45 seconds, 58°C for 45 seconds, and 72°C 5Ј-AGCCACACCATCCTAGTT-3Ј for GAPDH-R; and for 45 seconds, for 100 ng of genomic DNA, and 10-pmol prim- 5Ј-CAAGCTTCCCGTTCTCAGCC-3Ј for GAPDH probe. ers were used in a 25-µL reaction volume (HotStar Master Mix To determine the deletion of the PRKN gene changes per kit; Qiagen, Amsterdam, the Netherlands). The primers used messenger RNA (mRNA) splice, lymphocytes from periph- for PCR amplification cover all coding regions and intron/ eral blood were isolated from the patients and total RNA was exon boundaries of the PRKN gene (Table 1). The PCR prod- extracted with TRIZOL reagent (Invitrogen, Carlsbad, ucts were sequenced bidirectionally using a genetic analyzer Calif). The complementary DNA (cDNA) synthesis was (ABI3700; Applied Biosystems, Foster City, Calif). completed as per the instructions of the cDNA synthesis kit To determine the frequency of T240M or T240R mutations (Iscript; Bio-Rad Laboratories) using 1 µg of total RNA. in patients with PD and in healthy controls, PCR-restriction Polymerase chain reaction amplification from exon 1 to fragment length polymorphism was conducted using the primer exon 11 was conducted using paired primers pair 5Ј-TAGAGGAAAAATGAGCAGCCGGGATC-3Ј and 5Ј-CACCTACCCAGTGACCATGA-3Ј for forward primer 5Ј-CTATTTTTAGATCCTTACCTGACCTCTGTGC-3Ј. The cPRKN1-11F and 5Ј-ACAGGGCTTGGTGGTTTTCT-3Ј for base mismatch is underlined. reverse primer cPRKN1-11R. The thermocycling profile was The 2-µL PCR products were digested with HpyCH4 IV re- a 3-step PCR (94°C for 1.5 minutes, 58°C for 1.5 minutes, striction enzyme at 37°C overnight and resolved on 6% poly- and 72°C for 2.5 minutes) for 32 cycles. We used 1 µL of the acrylamide gel. The T240M or T240R cannot be digested by first reverse-transcriptase PCR products as a template for HpyCH4 IV, resulting in an uncut fragment of 192 base pairs, second amplification with paired primers whereas the wild-type allele can be digested into 159- and 33- (5Ј-TGACCAGTTGCGTGTGATTT-3Ј for cPRKN2-11F and base pair fragments. 5Ј-GGTTTCTTTGGAGGCTGCTT-3Ј for cPRKN2-11R) and Semiquantitative PCR was used for quantification of the 12 denatured the PCR products initially at 95°C followed by 28 exon regions of the PRKN genomic DNA using primers (Table 1); thermocycles of 1.5 minutes at 94°C, 1.5 minutes at 60°C, exon 6 was also detected by real-time quantitative PCR.10,11 The 2 minutes at 72°C, and a final elongation of 5 minutes at glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH)was 72°C. The PCR products were analyzed by gel purification amplified as a reference for quantification of the PRKN genomic and sequencing. DNA. The dose of the PRKN exons relative to GAPDH and nor- To determine the T240M change at the mRNA level, the malized to control DNA was determined using the 2−⌬⌬Ct method12: transcribed PRKN fragment from exon 6 to exon 11 was amplified using paired primers (for cPRKN6F, Ct= Ј Ј [CtPRKN (unknown sample)−CtGAPDH (unknown sample)] 5 -CCCACCTCTGACAAGGAAAC-3 , and cPRKN1-11R) −[CtPRKN (calibrator sample)−CtGAPDH (calibrator sample)], and a second amplification with paired primers (for PRKN6F and cPRKN2-11R) and sequencing. where Ct indicates the threshold cycle. The PRKN and GAPDH real-time PCR probes were labeled with fluorescent dyes 6-FAM and 5-TexRed, respectively, at the RESULTS 5Ј end and with MGB (nonfluorescent quencher dye) at the 3Ј end. In brief, 10 ng of genomic DNA was amplified in a total volume of 15 µL containing 5 pmol of each primer using a real- The 4 patients from this white pedigree had typical EOPD, time PCR machine (iCycler IQ; Bio-Rad Laboratories). For evalu- with age at onset of 30 to 38 years (mean age, 34.5 years).

(REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 274

©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 The patients had a beneficial response to levodopa, rela- healthy family members were heterozygous for the T240M tively slow progression of the disease, and marked mo- mutation (age, 22-77 years; mean age, 38.8 years). tor and nonmotor fluctuations, all of which are typi- Semiquantitative and quantitative PCR showed the de- cally present in patients with the PRKN mutations. Direct letion of exons 5 and 6 in the PRKN gene in this pedigree sequencing of the PRKN gene identified a CϾT (Figure 2). To evaluate the change of the mRNA splice, (NT_007422, nt 754455) substitution in exon 6 we conducted nest reverse-transcriptase PCR to obtain the (Figure 1A), changing a threonine codon (ACG) to a abnormal splice and identified the EX 5_6 del mutation methionine codon (ATG) at amino acid position 240 in complementary RNA (Figure 1B). All 4 patients har- (T240M), rather than changing the mRNA splice site (pre- bored the compound heterozygous mutations (T240M and dicted by http://hgsc.bcm.tmc.edu). The mRNA se- EX 5_6 del) (Table 2), but a 56-year-old woman (II:1 in quence was also changed by the reverse-transcriptase PCR Figure 2) with the compound heterozygous mutations had and sequencing assay. This mutation was absent in 208 no parkinsonian features. The heterozygous EX 5_6 del unrelated patients with PD and 134 healthy controls. Five mutation was present in 10 healthy family members (age range, 13-75 years; mean age, 34.1 years).

COMMENT A T/T T T G C A T T A T G T G C A C A G The PRKN gene (PARK2) was mapped to chromosome 6q34 and encodes an E3 ubiquitin-proteasome system. It contains 12 exons spanning about 1.4 centimorgans and encodes a 466–amino acid protein. Parkin protein appears to have 6 phosphorylation sites (3 sites in exon 3, 1 in exon 5, and 2 in exon 6) for casein kinase II, a serine or threonine kinase that is found in the nucleus and cytoplasm of eukaryotic cells and has been impli- cated to play roles in regulating various cellular func- tions.14 Mutations in this gene account for half of famil- B Exon 4 Exon 7 ial cases of EOPD. We identified compound heterozygous mutations T T G A C C C A G G A G C C C C G T (T240M and EX 5_6 del) in the PRKN gene in a large white EOPD pedigree. Patients in this family began to have symptoms in their fourth decade of life, typical of PRKN EOPD. Our cases also share similar clinical features to other PRKN cases, including symptoms at disease onset, beneficial response to levodopa, and the occurrence of levodopa-related motor complications. The T240M mutation, which presumably eliminates a phosphorylation site for casein kinase II, was found in a patient with late-onset onset PD from North America, and Ͼ Figure 1. Sequencing analysis of the parkin gene (PRKN ). A, C T a homozygous T240R mutation in PRKN was previously (NT_007422, nt 754455; T240M) substitution in exon 6 in the PRKN gene 15,16 (genomic DNA). The arrow shows the nucleotide mutation. B, Abnormal reported in a Turkish family with EOPD, indicating that splice (EX 5_6 del) in the PRKN gene (complementary DNA). this gene site contains an important functional domain of

I 1 2 W/M W/D 77 y 75 y

II 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M/D M/D M/D M/D M/D M/W W/D W/D W/D 56 y 54 y 50 y 47 y 45 y 44 y 42 y 41 y 39 y

III 1 2 3 4 5 6 7 8 9 W/D M/W W/D W/D W/D M/W M/W W/D W/D 30 y 27 y 33 y 29 y 13 y 24 y 22 y 21 y 18 y

Figure 2. The early-onset Parkinson disease (EOPD) pedigree with the compound heterozygous mutations of the parkin gene (PRKN ) (T240M and EX 5_6 del). The sex of some family members has been masked for confidentiality reasons. Years indicate present age. D indicates the allele for the EX 5_6 del mutation; M, the allele for the T240M mutation; W, wild-type allele; arrow, the proband; circles, women; filled symbols, individuals manifesting PD; and squares, men.

(REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 275

Subjects

Characteristics II:2 II:7 II:11 II:12 Age at onset, y 36 38 34 30 Present age, y 54 50 47 45 Tremor Present Present Present Present Rigidity Present Present Present Present Bradykinesia Present Present Present Present Upper motor neuron signs Absent Absent Absent Absent Cognitive status MMSE 27/30 NE Normal NE Response therapy Levodopa Levodopa Agonists only Levodopa Fluctuations Yes No No No

Abbreviations: MMSE, Mini-Mental State Examination; NE, not examined; PRKN, parkin gene.

the parkin protein. Expression of parkin, but not its T240R action of PRKN with other genes (epistasis), that certain mutant, significantly alleviated detrimental effects of the environmental effects somehow protect this woman from misfolded dopamine transporter, indicating that the developing PD, or both. 240–amino acid position is very important for the main- tenance of normal parkin protein function.17 Among 38 Accepted for Publication: September 14, 2005. known nonsense/missense mutations in the PRKN gene, Correspondence: Joseph Jankovic, MD, Department of 3 nucleotides may be substituted by at least 2 different Neurology, Baylor College of Medicine, 6550 Fannin St, nucleotides, resulting in 2 mutated amino acids, includ- Suite 1801, Houston, TX 77030 ([email protected] ing T240, which indicates that this position is highly li- .edu). able to produce mutations. The T240M and T240R mu- Author Contributions: Drs Deng and Le contributed tations were not present in 208 unrelated patients with PD equally to this work. Study concept and design: Deng, Le, or 134 healthy controls, suggesting that they are indeed Hunter, Ondo, Guo, Xie, and Jankovic. Acquisition of data: mutations rather than polymorphisms, as they seem to be Deng, Le, Hunter, Ondo, Guo, Xie, and Jankovic. Analy- rare in general population. Three alternative splicing vari- sis and interpretation of data: Deng, Le, Hunter, Guo, Xie, ants (NM_004562, NM_013987, and NM_013988) of the and Jankovic. Drafting of the manuscript: Deng, Le, Hunter, PRKN gene were described in the literature, and each of Guo, Xie, and Jankovic. Critical revision of the manu- them contains exon 6. script for important intellectual content: Deng, Le, Hunter, To explore the possibility of deletions or multiplica- Ondo, Xie, and Jankovic. Statistical analysis: Deng, Le, tions of 1 or more exons, we conducted gene dose stud- Guo, and Xie. Obtained funding: Le. Administrative, tech- ies and found the deletion of exons 5 and 6 of the PRKN nical, and material support: Deng, Le, Hunter, Ondo, Guo, gene in this pedigree. Homozygous deletion of exons 5 and Xie. Study supervision: Le and Jankovic. and 6 was previously found in 2 non–North American Funding/Support: This study was supported by grants patients with EOPD by genome DNA analysis, but the NS 043567 and NS 40370 from the National Institute of status of the transcripts was unknown.13 We found that Neurological Disorders and Stroke, Bethesda, Md. EX 5_6 del carriers in our pedigree can change the mRNA Acknowledgment: We thank the participating individu- splice by reverse-transcriptase PCR and sequencing. als for their cooperation. The PRKN mutations vary from point mutations to complex rearrangements, including deletions and/or mul- REFRENCES tiplications of complete exons. Previous studies sug- gested that a single mutation may cause EOPD or rep- 1. Deng H, Le WD, Xie WJ, Pan TH, Zhang X, Jankovic J. Genetic analysis of parkin 15,18,19 resent a risk factor for late-onset PD. In a few patients, co-regulated gene (PACRG) in patients with early-onset parkinsonism. Neuro- only heterozygous mutations have been detected, sug- sci Lett. 2005;382:297-299. gesting that a second mutation has escaped detection by 2. Polymeropoulos MH, Lavedan C, Leroy E, et al. Mutation in the ␣-synuclein gene identified in families with Parkinson’s disease. Science. 1997;276: the methods used or that some mutations in heterozy- 2045-2047. 20 gous forms are sufficient to cause this disorder. Our study 3. Kitada T, Asakawa S, Hattori N, et al. Mutations in the parkin gene cause auto- suggests that the heterozygous T240M or EX 5_6 del mu- somal recessive juvenile parkinsonism. Nature. 1998;392:605-608. tation is of minor importance in EOPD because 5 het- 4. Bonifati V, Rizzu P, van Baren MJ, et al. Mutations in the DJ-1 gene associated erozygous T240M and 10 heterozygous EX 5_6 del car- with autosomal recessive early-onset parkinsonism. Science. 2003;299: 256-259. riers were all exempted from this disorder (the oldest ages 5. Valente EM, Abou-Sleiman PM, Caputo V, et al. Hereditary early-onset Parkin- of neurologically healthy family members with hetero- son’s disease caused by mutations in PINK1. Science. 2004;304:1158-1160. zygous T240M and heterozygous EX 5_6 del were 77 and 6. Di Fonzo A, Rohe CF, Ferreira J, et al. A frequent LRRK2 gene mutation associ- 75 years, respectively), consistent with loss of function ated with autosomal dominant Parkinson’s disease. Lancet. 2005;365: 412-415. of the PRKN gene. The observation that a 56-year-old com- 7. Deng H, Le WD, Guo YI, Hunter CB, Xie WJ, Jankovic J. Genetic and clinical iden- pound heterozygous female carrier does not at present tification of Parkinson’s disease patients with LRRK2 G2019S mutation. Ann Neurol. manifest any clinical features of PD suggests some inter- 2005;57:933-934.

(REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 276

©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 8. Lucking CB, Durr A, Bonifati V, et al; French Parkinson’s Disease Genetics Study 15. Foroud T, Uniacke SK, Liu L, et al. Heterozygosity for a mutation in the parkin Group. Association between early-onset Parkinson’s disease and mutations in gene leads to later onset Parkinson disease. Neurology. 2003;60:796-801. the parkin gene. N Engl J Med. 2000;342:1560-1567. 16. Hattori N, Matsumine H, Asakawa S, et al. Point mutations (Thr240Arg and 9. Gelb DJ, Oliver E, Gilman S. Diagnostic criteria for Parkinson’s disease. Arch Neurol. Gln311Stop) in the parkin gene. Biochem Biophys Res Commun. 1998;249: 1999;56:33-39. 754-758. 10. Tenan M, Benedetti S, Finocchiaro G. Deletion and transfection analysis of the 17. Jiang H, Jiang Q, Feng J. Parkin increases dopamine uptake by enhancing the p15/MTS2 gene in malignant gliomas. Biochem Biophys Res Commun. 1995; cell surface expression of dopamine transporter. J Biol Chem. 2004;279:54380- 217:195-202. 54386. 11. Hedrich K, Kann M, Lanthaler AJ, et al. The importance of gene dosage studies: 18. Maruyama M, Ikeuchi T, Saito M, et al. Novel mutations, pseudo-dominant in- mutational analysis of the parkin gene in early-onset parkinsonism. Hum Mol heritance, and possible familial affects in patients with autosomal recessive ju- Genet. 2001;10:1649-1656. 12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real- venile parkinsonism. Ann Neurol. 2000;48:245-250. time quantitative PCR and the 2(−⌬⌬C(T)) method. Methods. 2001;25:402-408. 19. Poorkaj P, Moses L, Montimurro JS, Nutt JG, Schellenberg GD, Payami H. 13. Djarmati A, Hedrich K, Svetel M, et al. Detection of Parkin (PARK2) and DJ1 (PARK7) Parkin mutation dosage and the phenomenon of anticipation: a molecular ge- mutations in early-onset Parkinson disease: parkin mutation frequency de- netic study of familial parkinsonism. BMC Neurol. 2005;5:4. pends on ethnic origin of patients. Hum Mutat. 2004;23:525. 20. Bertoli-Avella AM, Giroud-Benitez JL, Akyol A, et al; Italian Parkinson Genetics 14. Pinna LA. Casein kinase 2: an “eminence grise” in cellular regulation? Biochim Network. Novel parkin mutations detected in patients with early-onset Parkin- Biophys Acta. 1990;1054:267-284. son’s disease. Mov Disord. 2005;20:424-431.

Call for Papers

ARCHIVES Express

The ARCHIVES launched a new ARCHIVES Express section in the September 2000 issue. This section will enable the editors to publish highly selected papers within approxi- mately 2 months of acceptance. We will consider only the most significant research, the top 1% of accepted papers, on new important insights into the pathogenesis of disease, brain function, and therapy. We encourage authors to send their most exceptional clinical or basic research, designating in the cover letter a request for ex- pedited ARCHIVES Express review. We look forward to pub- lishing your important new research in this accelerated manner. Roger N. Rosenberg, MD

(REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 277