ORIGINAL CONTRIBUTION Heterogeneous Phenotype in a Family With Compound Heterozygous Parkin Gene Mutations Hao Deng, PhD; Wei-Dong Le, MD, PhD; Christine B. Hunter, RN; William G. Ondo, MD; Yi Guo, MS; Wen-Jie Xie, MD; Joseph Jankovic, MD Background: Mutations in the parkin gene (PRKN) cause mutations in compound heterozygotes. The phenotype autosomal recessive early-onset Parkinson disease (EOPD). of patients was that of classic autosomal recessive EOPD characterized by beneficial response to levodopa, rela- Objective: To investigate the presence of mutations in tively slow progression, and motor complications. All het- the PRKN gene in a white family with EOPD and the geno- erozygous mutation carriers (T240M or EX 5_6 del) and type-phenotype correlations. a 56-year-old woman who was a compound heterozy- gous mutation carrier (T240M and EX 5_6 del) were free Design: Twenty members belonging to 3 generations of of any neurological symptoms. the EOPD family with 4 affected subjects underwent ge- netic analysis. Direct genomic DNA sequencing, semi- Conclusions: Compound heterozygous mutations quantitative polymerase chain reaction, real-time quan- (T240M and EX 5_6 del) in the PRKN gene were found titative polymerase chain reaction, and reverse- to cause autosomal recessive EOPD in 4 members of a transcriptase polymerase chain reaction analyses were large white family. One additional member with the same performed to identify the PRKN mutation. mutation, who is more than 10 years older than the mean age at onset of the 4 affected individuals, had no clinical Results: Compound heterozygous mutations (T240M manifestation of the disease. This incomplete pen- and EX 5_6 del) in the PRKN gene were identified in 4 etrance has implications for genetic counseling, and it patients with early onset (at ages 30-38 years). Al- suggests that complex gene-environment interactions may though heterozygous T240M and homozygous EX 5_6 play a role in the pathogenesis of PRKN EOPD. del mutations in the PRKN gene have been previously de- scribed, this is, to our knowledge, the first report of these Arch Neurol. 2006;63:273-277 ARLY-ONSET PARKINSON the PRKN gene: a missense mutation disease (EOPD), beginning (T240M) and a gross deletion (EX 5_6 del; before 50 years of age, is deletion of exons 5 and 6). This family clinically and genetically draws attention to the broad spectrum of heterogeneous.1 At least 5 phenotypes in the PRKN group of EOPD. genes have been identified as causal genes E 2 for EOPD, including α-synuclein (PARK1), METHODS parkin (PRKN, PARK2),3 DJ-1(PARK7),4 5 PTEN-induced kinase 1 (PINK1, PARK6), PEDIGREE, PATIENTS, AND and leucine-rich repeat kinase 2 (LRRK2, HEALTHY CONTROL SUBJECTS PARK8).6,7 Homozygous and compound heterozygous mutations in the PRKN gene A 3-generation, 20-member family in which 4 are responsible for 49% of familial EOPD members had EOPD (the mother is Irish Ameri- and 18% of sporadic EOPD,8 and at least can and the father is Dutch and American In- Author Affiliations: 109 different mutations have been iden- dian) underwent screening for PRKN muta- Department of Neurology, tified in the Human Gene Mutation Da- tions. They were compared with 208 patients Baylor College of Medicine, tabase, including 38 nonsense/missense with PD, including 106 with EOPD (male- Houston, Tex (Drs Deng, Le, mutations and 38 gross deletions (avail- female ratio, 55:51; mean±SD onset age, Ondo, Xie, and Jankovic and 40.2±7.2 years) and 102 with late-onset PD Ms Hunter); and School of able at: http://archive.uwcm.ac.uk/uwcm (male-female ratio, 52:50; mean±SD onset age, Medical Technology and /mg/hgmd0.html), whereas mutations in 63.2±8.7 years), and 134 healthy control sub- Information, Central South late-onset cases are rare. We describe jects (male-female ratio, 69:65; mean±SD age, University, Changsha, China herein a large family with EOPD caused 57.2±11.2 years). Patients were diagnosed as (Ms Guo). by compound heterozygous mutations in having PD according to common diagnostic cri- (REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 273 ©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 Table 1. Primers for PRKN Forward Primer Reverse Primer Product Size, Exon (5؅→3؅) (5؅→3؅) bp 1 GCCCCGTCATTGACAGTT GAGGCCTGGAGGATTTAACC 227 2 TAAGGGCTTCGAGTGATGCT GCATGAGCAATGGAGCTG 273 3 CTCGCATTTCATGTTTGACA TAAATATGCACCCGGTGAGG 394 4 GAGTTTCTTGTCTCAATTTAGATGC TTTCTTTTCAAAGACGGGTGA 290 5 GTGGAAACATGTCTTAAGGAGTACA TTCCTGGCAAACAGTGAAGA 225 6 GTCCAAAGAGATTGTTTACTGTGG GGGGGAGTGATGCTATTTTT 278 7 GCCTTTCCACACTGACAGGTA AAATTCTTCTGCTAGGGTTTACG 296 8 GGCAACACTGGCAGTTGATA GGAGCCCAAACTGTCTCATT 230 9 AAGCAAGAAATCCCATGCAC TGTGCAAAAGCAAACAAGGA 299 10 TTGCCAAATGCAACCTAATG GGAACTCTCCATGACCTCCA 223 11 CCGACGTACAGGGAACATAAA ATGATTCTCCCCCAAAGAGC 253 12 GTTTGGGAATGCGTGTTTT AGAATTAGAAAATGAAGGTAGACA 255 Abbreviations: bp, base pair; PRKN, parkin gene. teria.9 This study was approved by the Baylor College of Medi- ation of our assay, we used samples with LRRK2 R1441G and cine Institutional Review Board, Houston, Tex, and all partici- G2019S mutations as negative controls.7 All experiments were pants gave signed informed consent. performed and were accepted only when the standard deviation was less than 10% of the calculated mean concentra- GENETIC ANALYSIS tions. Gene dosage alternations were confirmed after triple analysis.13 The sequences of the primers are Genomic DNA was isolated from lymphocytes using standard 5Ј-AACATCAGTAGCTTTGCACCTG-3Ј for PRKN6F; methods. Polymerase chain reaction (PCR) amplification of the 5Ј-GGGGGAGTGATGCTATTTTT-3Ј for PRKN6R; PRKN gene was performed with the use of a thermocycler sys- 5Ј-CAAATAGTCGGAACATCACTTGC-3Ј for PRKN probe; tem (MyCycle; Bio-Rad Laboratories, Hercules, Calif) for 32 5Ј-ATTCCACCCATGGCAAATT-3Ј for GAPDH-F; cycles at 95°C for 45 seconds, 58°C for 45 seconds, and 72°C 5Ј-AGCCACACCATCCTAGTT-3Ј for GAPDH-R; and for 45 seconds, for 100 ng of genomic DNA, and 10-pmol prim- 5Ј-CAAGCTTCCCGTTCTCAGCC-3Ј for GAPDH probe. ers were used in a 25-µL reaction volume (HotStar Master Mix To determine the deletion of the PRKN gene changes per kit; Qiagen, Amsterdam, the Netherlands). The primers used messenger RNA (mRNA) splice, lymphocytes from periph- for PCR amplification cover all coding regions and intron/ eral blood were isolated from the patients and total RNA was exon boundaries of the PRKN gene (Table 1). The PCR prod- extracted with TRIZOL reagent (Invitrogen, Carlsbad, ucts were sequenced bidirectionally using a genetic analyzer Calif). The complementary DNA (cDNA) synthesis was (ABI3700; Applied Biosystems, Foster City, Calif). completed as per the instructions of the cDNA synthesis kit To determine the frequency of T240M or T240R mutations (Iscript; Bio-Rad Laboratories) using 1 µg of total RNA. in patients with PD and in healthy controls, PCR-restriction Polymerase chain reaction amplification from exon 1 to fragment length polymorphism was conducted using the primer exon 11 was conducted using paired primers pair 5Ј-TAGAGGAAAAATGAGCAGCCGGGATC-3Ј and 5Ј-CACCTACCCAGTGACCATGA-3Ј for forward primer 5Ј-CTATTTTTAGATCCTTACCTGACCTCTGTGC-3Ј. The cPRKN1-11F and 5Ј-ACAGGGCTTGGTGGTTTTCT-3Ј for base mismatch is underlined. reverse primer cPRKN1-11R. The thermocycling profile was The 2-µL PCR products were digested with HpyCH4 IV re- a 3-step PCR (94°C for 1.5 minutes, 58°C for 1.5 minutes, striction enzyme at 37°C overnight and resolved on 6% poly- and 72°C for 2.5 minutes) for 32 cycles. We used 1 µL of the acrylamide gel. The T240M or T240R cannot be digested by first reverse-transcriptase PCR products as a template for HpyCH4 IV, resulting in an uncut fragment of 192 base pairs, second amplification with paired primers whereas the wild-type allele can be digested into 159- and 33- (5Ј-TGACCAGTTGCGTGTGATTT-3Ј for cPRKN2-11F and base pair fragments. 5Ј-GGTTTCTTTGGAGGCTGCTT-3Ј for cPRKN2-11R) and Semiquantitative PCR was used for quantification of the 12 denatured the PCR products initially at 95°C followed by 28 exon regions of the PRKN genomic DNA using primers (Table 1); thermocycles of 1.5 minutes at 94°C, 1.5 minutes at 60°C, exon 6 was also detected by real-time quantitative PCR.10,11 The 2 minutes at 72°C, and a final elongation of 5 minutes at glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH)was 72°C. The PCR products were analyzed by gel purification amplified as a reference for quantification of the PRKN genomic and sequencing. DNA. The dose of the PRKN exons relative to GAPDH and nor- To determine the T240M change at the mRNA level, the malized to control DNA was determined using the 2−⌬⌬Ct method12: transcribed PRKN fragment from exon 6 to exon 11 was amplified using paired primers (for cPRKN6F, Ct= Ј Ј [CtPRKN (unknown sample)−CtGAPDH (unknown sample)] 5 -CCCACCTCTGACAAGGAAAC-3 , and cPRKN1-11R) −[CtPRKN (calibrator sample)−CtGAPDH (calibrator sample)], and a second amplification with paired primers (for PRKN6F and cPRKN2-11R) and sequencing. where Ct indicates the threshold cycle. The PRKN and GAPDH real-time PCR probes were labeled with fluorescent dyes 6-FAM and 5-TexRed, respectively, at the RESULTS 5Ј end and with MGB (nonfluorescent quencher dye) at the 3Ј end. In brief, 10 ng of genomic DNA was amplified in a total volume of 15 µL containing 5 pmol of each primer using a real- The 4 patients from this white pedigree had typical EOPD, time PCR machine (iCycler IQ; Bio-Rad Laboratories). For evalu- with age at onset of 30 to 38 years (mean age, 34.5 years). (REPRINTED) ARCH NEUROL / VOL 63, FEB 2006 WWW.ARCHNEUROL.COM 274 ©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 The patients had a beneficial response to levodopa, rela- healthy family members were heterozygous for the T240M tively slow progression of the disease, and marked mo- mutation (age, 22-77 years; mean age, 38.8 years).