Functional analysis of the apical polar ring and its role in secretion and motility of Toxoplasma parasites

Submitted in total fulfilment of the requirements of the degree of

Doctor of Philosophy (PhD) 2016

School of BioSciences, Faculty of Science

The University of Melbourne

Nicholas Jeremy Katris Student no. 327539 December 2016, Revised July 2017

i

Abstract

Human parasites Toxoplasma and Plasmodium species belong to the phylum Apicomplexa and are some of the most successful groups of human parasites on the planet. Part of this success can be attributed to the cytoskeletal components that afford them structural stability and flexibility required to efficiently attach to and invade host cells. As members of the superfamily Alveolata, they possess a pellicle comprised of a set of flattened vacuoles pressed up against the plasma membrane, with proteinaceous support network and actin actin-based motility system. In addition to this, Toxoplasma also possesses an apical complex which is a tubulin based structure comprised of a set of apical polar rings and a conoid, which is a tight-knit tubulin based structure that is evolutionarily derived from ancestral flagella components. The apical complex is biologically significant because it is the entry point the parasite uses to enter a host cell in order to parasitize it, and this process is conserved in Plasmodium species. However, unlike other organelles, the proteins of the apical complex have no known conserved targeting signals so identification of proteins that target here has been slow to progress. A Toxoplasma protein homologous to a predicted cytoskeletal Tetrahymena thermophila protein was identified and localized to the apical complex, which we call RNG2. RNG2 was functionally characterized by inducible knock down and found that RNG2 played a role in the cGMP signalling pathway upstream of calcium dependent activation of CDPKs, which severely impacted microneme secretion, conoid extrusion and even other downstream processes, particularly internal calcium release. In addition to this, I used various calcium and cyclic di- nucleotide signalling agonists and inhibitors to investigate novel regulation patterns of micronemes and dense granules. RNG2 and other cGMP and calcium signalling proteins, PKG, CDPK1 and CDPK3 all show altered secretion of dense granules showing for the first time a regulatory mechanism of dense granules based on calcium.

ii

Declaration

This is to certify that: i) The thesis comprises only my original work towards the PhD except where indicated in the Preface, ii) Due acknowledgement has been made in the text to all other material used, iii) The thesis is fewer than 100 000 words in length, exclusive of tables, maps, bibliographies and appendices.

______

Nicholas J Katris

iii

Preface

The majority of work presented here is my own and was undertaken during the period of my PhD candidature. Certain analyses and experiments presented in Chapter two and three of this thesis were extended from preliminary findings made during my undergraduate research project. These findings include rough localizations of the RNG2 protein, the generation of the inducible RNG2 mutant cell line and the preliminary observation of an invasion defect in this cell line.

I acknowledge the following people for assistance during the course of my PhD as follows;

Establishment of the GCaMP6 technology in Toxoplasma, introduction of the construct into the iΔHA-RNG2 mutant cell line, and subsequent FACS analysis which was performed by Dr. Rebecca Stewart, and Dr. Chris Tonkin at WEHI as part of a collaborative effort. My contribution was to assist in optimization of drug dosage of BIPPO for FACS analysis of the RNG2 mutant.

I would like to thank Dr. Paul McMIlllan and Dr. Eric Hanssen for assistance with the OMX 3D-SIM microscopy from Bio21 Institute, Melbourne, Australia, and Dr. Nicola Lawrence for her assistance with the OMX 3D-SIM in Gurdon Institute, Cambridge, United Kingdom.

I have published much of the work presented in Chapter 2 and Chapter 3 regarding localization and functional analysis of RNG2 in the journal PLoS pathogens (Katris, N.J., van Dooren, G.G., McMillan, P.J., Hanssen, E., Tilley, L., and Waller, R.F. (2014). The apical complex provides a regulated gateway for secretion of invasion factors in Toxoplasma. PLoS pathogens 10, e1004074.). The PLoS Pathogens publication was written by myself, together with my supervisor Dr. Ross F. Waller and Dr. Giel van Dooren.

iv

Acknowledgements

I would like to thank Dr. Ross Waller for ongoing supervisory support. Prof. Geoff McFadden for use of shared laboratory consumables and lab space. Dr. Giel van Dooren for Toxoplasma training and provision of the base plasmids to generate these cell lines. Dr. Chris Tonkin and Dr. Sebastian Lourido for gifting mutant Toxoplasma cell lines. Also thanks to Dr. Oliver Billker for provision of the Compound 2 drug, and Dr. Phillip Campbell for providing the BIPPO drug. A big thanks to everyone in the McFadden lab for hosting me during the transition from Melbourne. Thanks to everyone in the Carrington Lab at Cambridge for their patience and support during the move to Cambridge, and thanks to everyone in the Waller lab for creating such a cool atmosphere that made it fun to go to work. I will miss you guys the most. Lastly thanks to everyone in Melbourne, Cambridge, France and everywhere in between for being there during this very chaotic, turbulent, and thrilling adventure that became my PhD.

v

List of Abbreviations:

ATC: Anhydrotetracycline

AKMT: Toxoplasma apical complex lysine methyl transferase

A23187: Calcium Ionophore A23187

BLE: Phleomycin resistance gene

BIPPO: Abbreviated from 5-benzyl-3-isopropyl-1H-pyrazolo[4,3-d]-pyrimidin-7(6H)-one. (See Howard et al. 2016)

CAT: Chloramphenicol acyltransferase resistance gene.

CDPK1: Calcium Dependent Protein Kinase 1

CDPK3: Calcium Dependent Protein Kinase 3

CytD: Cytochalasin D actin inhibitor

DHFR: Dihydrofolate Reductase resistance gene in Toxoplasma

GA: Glutaraldehyde used for fixing cells for microscopy.

GFP: green fluorescent protein.

GRA1: Dense Granule Protein 1 in Toxoplasma, no homologue in Plasmodium species.

HA: haemaglutinin epitope tag

HX: Mycophenolic acid resistance gene in Toxoplasma

IFA: Immunofluorescence assay

IMC: Inner Membrane Complex iΔ: inducible knockdown

Δ: knock-out

Ku80: DNA repair enzyme preventing homologous recombination.

MIC2: Microneme protein 2, homologue of TRAP protein in Plasmodium species.

Myc: c-Myc epitope tag.

MyoH: Acronym for describing Myosins, in this case Myosin H protein.

PFA: Paraformeldehyde fixative used for fixing cells for microscopy.

PKG: Protein Kinase G pPR2: plasmid containing T7S4 promoter for promoter replacement of target genes. pPR2-HA3: plasmid containing T7S4 promoter for promoter replacement of target genes and addition of an N-terminal Haemaglutinin tag

RNG1: Toxoplasma Apical Polar Ring protein 1 vi

RNG2: Toxoplasma Apical Polar Ring protein 2

TEM: Transmission Electron Microscopy

ToxoDB: Toxoplasma genome online database

vii

Table of Contents

Abstract pg iii

Declaration pg iv

Preface pg v

Acknowledgements pg vi

List of abbreviations pg vii

List of Figures and tables pg. xii

Chapter 1, Literature review: The Toxoplasma cytoskeleton and its role in invasion.

1.1.1 The life cycle of Toxoplasma pg. 2

1.1.2 Origin from algal ancestors: not just the apicoplast. pg. 3

1.1.3 Introduction to the Apicomplexan pellicle structures. pg. 4

1.1.4 The apical complex in the cell division process of Toxoplasma tachyzoites. pg. 6

1.1.5 Cell replication in Toxoplasma; Mitotic assembly, nuclear division and formation of nascent daughter buds. pg. 6

1.2.1 Invasion components of Toxoplasma; the molecular composition of the apical complex. pg. 8

1.2.2 Functional studies of apical complex proteins. pg. 9

1.2.3 The Apical Complex in Plasmodium. pg. 12

1.2.4 The IMC. pg. 16

1.2.5 The glideosome. pg. 17

1.2.6 Cytoskeletal Morphology and TgPhil1/TgSIP. pg. 19

1.2.7 Sub-pellicular Microtubules (SPMs). pg. 20

1.3.1 Secretion factors in Toxoplasma and the tight junction. pg. 20

1.3.2 Micronemes. pg. 21

1.3.3 Rhoptries. pg. 22

1.3.4 Dense Granule Proteins. pg. 23

1.4.1 Signalling in Toxoplasma invasion. pg. 25

1.4.2 Calcium and Calcium-dependent protein kinases (CDPKs). pg. 26

1.4.3 The role of cyclic-guanosine-monophosphate (cGMP) and Protein Kinase G. pg. 28

1.4.4 Cyclic Adenosine monophosphate (cAMP) signalling. pg. 29

1.4.5 Conclusion and perspectives pg. 31 viii

Chapter 2- Identification and localization of Apical Complex Proteins:

2.1 Introduction pg. 33

2.2 Results pg. 37

2.2.1 Bioinformatic analysis of the RNG2 protein. pg. 35

2.2.2 RNG2 localization in daughter cell formation. pg. 35

2.2.3 Constructing a 3D model of the apical complex: pg. 39

2.3 Discussion pg. 43

2.3.1 RNG2 is the earliest known protein to appear at the apical complex. pg. 43

2.3.2 RNG2 and the centrosome. pg. 43

2.3.3 RNG2 connects the apical polar ring and the conoid at the apical complex. pg. 44

2.3.4 The apical complex as a tube of rings? pg. 45

2.3.5 Apical complex and conoid loss in Plasmodium. pg. 45

Chapter 3-Functional Characterization of apical polar ring proteins

3.1 Introduction pg. 48

3.2 Results pg. 50

3.2.1 Generation of RNG2 mutant. pg. 50

3.2.2 RNG2 knockdown has a severe growth defect. pg. 50

3.2.3 Toxoplasma tachyzoites are morphologically intact following RNG2 knockdown. pg. 52

3.2.4 RNG2 knockdown cells have an invasion defect. pg. 55

3.2.5 RNG2 knockdown cells are impaired in motility and tight junction formation. pg. 55

3.2.6 RNG2 has a role in regulated secretion of micronemes. pg. 58

3.2.7 RNG2 has an additional defect in conoid extrusion. pg. 60

3.2.8 RNG2 controls downstream calcium flux in a cGMP dependent manner. pg. 63

3.2.9 Generation of inducible Knockdown of RNG1 and phenotype assessment. pg. 64

3.2.10 RNG1 knockdown displays normal growth pg. 66

3.3 Discussion pg. 70

3.3.1 RNG1 and functional redundancy in the apical complex. pg. 70

3.3.2 Comparison of RNG2 with other apical complex protein mutants. pg. 71

3.3.3 A role for RNG2 in conoid extrusion. pg. 72

3.3.4 Comparison of RNG2 with other proteins in the cGMP and calcium network. pg. 72 ix

3.3.5 The apical complex as a sensory organelle? pg. 74

Chapter 4- Investigations of cGMP, cAMP and calcium in regulated secretion.

4.1 Introduction pg. 76

4.2 Results pg. 81

4.2.1 Observations on dense granule secretion in Toxoplasma. pg. 80

4.2.2 PKG inhibition prevents cGMP dependent inhibition of dense granule secretion. pg. 82

4.2.3 RNG2 and CDPK mutants are unresponsive to agonists that inhibit dense granule release. pg. 84

4.2.4 cAMP and cGMP have antagonistic effects on microneme secretion. pg. 88

4.3 Discussion pg. 91

4.3.1 Dense granule secretion is inhibited by increased calcium flux. pg. 91

4.3.2 Inhibition of dense granule secretion is regulated by CDPKs and is not a pleiotropic effect. pg. 92

4.3.3 Consolidating secretion with invasion in the Δcdpk3. pg. 93

4.3.4 PKG and cGMP as the major determinant for microneme secretion? pg. 94

4.3.5 Proteomic studies suggest possible phosphorylation targets involved in regulation of dense granule secretion. pg. 94

4.3.6 Contributions to the signal network to invasion from proteomic studies. pg. 95

4.3.7 Effects of cAMP suggest a role for shutting down invasion processes. pg. 95

4.3.8 Is PKA and cAMP in P. falciparum a good model for Toxoplasma? pg. 96

4.3.9 Model for signalling events related to secretion in Toxoplasma. pg. 97

Materials and Methods

5.1 Materials and methods pg. 101

5.1.1 Parasites cultures. pg. 101

5.1.2 Parasite transfection. pg. 101

5.1.3 Western Blotting. pg. 102

5.1.4 Immunofluorescence assays. pg. 102

5.1.5 Red/Green Invasion Assay. pg. 103

5.1.6 Egress Assay. pg. 103 x

5.1.7 Conoid Assay. pg. 103

5.1.9 Rhoptry/Evacuole Assay. pg. 104

5.1.10 Secretion Assay. pg. 104

5.1.11 Detergent extraction assays. pg. 104

5.1.12 Electron Microscopy. pg. 105

5.1.13 GCaMP6 FACS experiments. pg. 105

5.1.14 Bioinformatics Software analysis. pg. 105

5.1.15 Plasmid and Cell line construction details. pg. 105

5.1.16 Cell lines, chemicals, pg. 106

Table 1: Primers used to synthesize plasmids used in this study. Pg. 107

Table 2: Primers used for screening integration of knockdown cell lines. pg. 107

Table 3: Cell lines used in this study pg. 108

Table 4: Antibodies used in this study. Pg. 109

References

6.1 References pg. 111

xi

Figure List

Figure 1.1, Schematic of some of the known apical complex proteins and connected

sub-pellicular microtubules. pg. 11

Figure 1.2, Summary of known Apical complex proteins. pg. 13

Figure 1.3, Schematic of different myosin motors in different compartments of the

Toxoplasma cell body. pg. 18

Figure 2.1, Bioinformatics analysis of RNG2 protein and observation of behaviour

in the tachyzoite cell cycle. pg. 36

Figure 2.2, Co-staining of apical complex proteins. pg. 38

Figure 2.3, Localization of the N and C termini of RNG2 protein by 3D-SIM microscopy. pg. 39

Figure 2.4, Super-resolution 3D-SIM microscopy of apical ring proteins RNG1, pg. 41

RNG2 and CAM1.

Figure 2.5. 3D schematic of RNG2 protein at the apical complex.

Figure 3.1. Generation of inducible knockdown of RNG2 protein by promoter replacement. pg. 51

Figure 3.2, Examination of structural integrity of iΔHA-RNG2 knockdown cell line. pg. 53

Figure 3.3, Transmission electron microscopy of iΔHA-RNG2 knockdown cell line. pg. 54

Figure 3.4, Functional characterization of iΔHA-RNG2 cell line show a defect in invasion, but not replication or A23187-stimulated egress. pg. 56

Figure 3.5, iΔHA-RNG2 is defective in motility and rhoptry secretion. pg. 57

Figure 3.6, RNG2 has a role in regulation of microneme secretion. pg. 59

Figure 3.7, iΔHA-RNG2 cell line is unable to respond to cGMP stimulus, but micronemes develop normally. pg. 61

Figure 3.8, iΔHA-RNG2 is defective in conoid extrusion. pg. 62

Figure 3.9, RNG2 controls downstream calcium release in a cGMP dependent manner pg. 63

Figure 3.10, Generation of inducible RNG1 knockdown cell line ( iΔHA-RNG1) by promoter replacement. pg. 65

Figure 3.11. iΔHA-RNG1 has no defect in invasion or replication. pg. 67

Figure 3.12, iΔHA-RNG1 displayes normal microneme secretion and motility. pg. 68

Figure 4.1, Secretion assay of tachyzoites treated with calcium ionophore A23187 or Ionomycin. pg. 80 xii

Figure 4.2, Effects of zaprinast and BIPPO on secretion in extracellular parasites. pg. 81

Figure 4.3, Secretion assay of tachyzoites in response to Compound 2. pg. 82

Figure 4.4, Secretion assays of RNG2 iHA in response to A23187 and BIPPO treatment. pg. 83

Figure 4.5, Secretion assays of Δcdpk3 in response to A23187 and BIPPO treatment. pg. 85

Figure 4.6, Secretion assays of CDPK1 iHA KD in response to A23187 and

BIPPO treatment. pg. 87

Figure 4.7, Secretion assays of wild type extracellular parasites in response to treatment with stable analogues of cGMP or cAMP. pg. 89

Figure 4.8, Schematic of signalling pathway of cGMP and calcium signalling components in Toxoplasma tachyzoites, leading to microneme secretion and dense granule inhibition. pg. 97

xiii

1

Chapter 1, Literature review: The Toxoplasma cytoskeleton and its role in invasion.

1.1.1 The life cycle of Toxoplasma. Toxoplasma gondii is an obligate intracellular parasite that parasitizes humans and other vertebrates. Toxoplasma gondii is grouped in the phylum Apicomplexa together with parasites of the Plasmodium species. These parasites parasitize hosts with differing host specificity and transmission routes. For example, Plasmodium spp. parasitize vertebrate hosts through a mosquito vector, and these parasites are usually highly specific for particular hosts with only certain Plasmodium species being able to infect humans and other apes or mice (Frech and Chen, 2011; Janse et al., 1989). P. falciparum is an obligate human parasite which is incapable of infecting rodent species, although this can be achieved through the use of humanized mice (Soulard et al., 2015). In contrast, Toxoplasma is able to infect a wide variety of transient intermediate hosts including humans, rodents and other vertebrates (Hill et al., 2005) but the definitive hosts are members of the Felidae family, through which the sexual cycle takes place (Janitschke and Werner, 1972; Miller et al., 1972). Most human infections are asymptomatic with mild flu like symptoms upon infection, before immunity is achieved (Pappas et al., 2009). However, infection can cause serious problems in immune- compromised individuals such as newborn babies, the elderly and HIV/AIDS patients in whom it is a common cause of death behind influenza (Cook, 1990; Hofflin and Remington, 1985). Toxoplasmosis is also still a leading cause of neurological birth defects, a pathology described as congenital Toxoplasmosis, even after the discovery and implementation of antimicrobial drugs such as pyrimethamine for treatment (Aspock et al., 1994; Fleck, 1975). Transmission to humans as intermediate hosts typically occurs after eating undercooked meat infected with bradyzoite cysts (Bobic et al., 2007). Infection can also occur by ingestion of sporozoite containing oocysts (Dubey and Frenkel, 1973; Sugi et al., 2016) which are shed through the faeces of the definitive feline host (Miller et al., 1972). The complete life cycle was fully described in 1970 including the sexual stages in the cat intestines (Dubey et al., 1970).

It is possible for the definitive feline or intermediate hosts to be infected by one of three parasitic stages; the tachyzoite or bradyzoites from consumed meat or sporozoite filled oocysts from faecal contamination. The tachyzoite is a highly virulent, invasive stage, the bradyzoite is a slower growing stage that forms cysts in muscle and brain tissue, and the sporozoite filled oocysts are shed from the cat gut which are the result of gametocyte fusion from the sexual cycle (Dubey et al., 1970). Sporozoite filled oocysts are shed in feline faeces where the sexual cycle takes place and then can potentially re-infect a feline after ingestion of oocysts from contaminated faeces or with bradyzoite tissue cysts from meat tissue (Dubey et al., 1970). Typically, feline hosts become reinfected after consuming infected prey with bradyzoite tissue cysts (Dubey et al., 1970), because although tachyzoites are highly invasive in muscle tissue they are destroyed by gastric secretions (Jacobs et al., 1960). Desipte this,infection with tachyzoites is still possible through direct blood contactas laboratory mice are commonly infected with tachyzoites by needle injection (Arroyo-Olarte et al., 2015; Graindorge et al., 2016). When infecting an intermediate host, an oocyst is ingested after consuming contaminated food and the sporozoites are released and invade gut epithelial cells. Once

2 the parasite is within the host tissue, the sporozoite develops into a tachyzoite and the lytic cycle takes effect.

The lytic cycle consists of a fast growing tachyzoite stage which invades host tissue at a rapid rate (Sheffield and Melton, 1968). This stage can infect nearly any nucleated cell type of any vertebrate organism, which contrasts with the highly specific nature of Plasmodium parasites which can only invade particular cell types of specific life stages within particular vertebrate species. The tachyzoites can transition into the bradyzoite stage which is slow growing and form cysts in muscle and brain tissue (Sugi et al., 2016; Uboldi et al., 2015). Tachyzoites and bradyzoites can transition back and forth and this comprises the lytic cycle of Toxoplasma which is the part of the life cycle that takes place in the intermediate host. It is also possible for an intermediate host to be consumed by another intermediate host and the bradyzoite cysts if, still active, can propagate an infection in the new intermediate host. In this way, the Toxoplasma parasite can continue to live indefinitely without ever having to go through the sexual cycle. Only once a bradyzoite cyst is ingested by consumption of the host by a feline predator will the sexual cycle re-commence. The complex sexual cycle occurs in the cat gut where the bradyzoites ultimately produce gametocytes. These gametocytes generate gametes that fuse to form a zygote and eventually sporozoite containing oocysts (Dubey and Frenkel, 1972, 1973, 1976).

In comparison to the broad host range of T. gondii, the life cycle of Plasmodium species has a narrow host range and many Plasmodium species can only infect one or a handful of vertebrate hosts (Frech and Chen, 2011). Plasmodium sp. Parasites are mosquito borne pathogen and spreads through a particular set of mosquito definitive hosts of the Anopheles genus, usually Anopheles gambiae in the case of P. falciparum (Gnanguenon et al., 2014; Taylor et al., 1990). The sexual stage begins with gametocyte production in the blood stage, and taken up by mosquitoes upon blood feeding. The resultant zygote develops into a bulky, motile ookinete which traverses the mosquito midgut and embeds itself on the outer wall of the midgut. There it forms an oocyst which produces sporozoites which migrate to the salivary glands (Choumet et al., 2007). From there, they re-enter the blood stream of a host and migrate to the liver. Having colonized the liverthe sporozoites form a merosome from which emerge invasive, blood stage merozoites (Box et al., 1953; Garnham et al., 1958; Soulard et al., 2015). These merozoites undergo replication within the host erythrocyte until the blood stage form decides to form gametocytes and the cycle repeats itself. (Wall et al., 2016). From here the cycle continues through to the mosquito. Despite their close relation within the Apicomplexa phylum, Toxoplasma parasites exhibit a much higher intermediate host range than Plasmodium and have more flexible routes of transmission, as opposed to the linear chain of cell cycle progression in the Plasmodium species (Boothroyd, 2009). Plasmodium motile stages are limited to invading a handful of cell types while Toxoplasma can invade almost any nucleated cell type. In order to understand this we have to take a closer look at the biology of Toxoplasma invasion machinery and what makes it unique.

1.1.2 Origin from algal ancestors: not just the apicoplast.

The phylum Apicomplexa have evolved from algal ancestors (Janouskovec et al., 2010; Striepen, 2011; van Dooren and Striepen, 2013). This is evidenced most famously by the discovery of the apicoplast, a plastid organelle that is evolutionary derived from a photosynthetic bacteria (McFadden et al., 1996; Palmer, 1992; Roos et al., 1999; Wilson, 1993). The evolutionary phenomenon known as endosymbiosis is responsible for this in which primitive cells phagocytosed a smaller cell which in some cases was photosynthetic. This organelle was seen in TEM images and was a mysterious organelle for a long time (Rudzinska and Trager, 1959a, b; Sheffield and Melton, 1968). Plastid acquisition from an endosymbiont is very common among parasites and basal

3 eukaryotes and there are many basal eukaryotes whose possession of a plastid is in question (Fernandez Robledo et al., 2011). However, gene sequencing evidence proved that these parasites were in possession of plant-like genes and subsequent studies showed that it was indeed the Apicomplexan plastid or ‘apicoplast’ that was housing many of these proteins (McFadden et al., 1996; Waller et al., 1998). Since then, we now know that the apicoplast is responsible for isoprenoid synthesis, fatty acid metabolism, and haem synthesis (Waller et al., 2003) (Ke et al., 2014; Nair et al., 2011).The study of the apicoplast has been very productive in shedding light onto the evolutionary history of these parasites. However, this evolutionary relationship often overshadows other links to algal ancestors, in particular to the common cytoskeletal arrangement known as the pellicle.

Alveolates possess a set of flattened vesicles pushed against their plasma membranes, interconnected with proteinaceous structures, which together provide structural support and rigidity. This is a conserved feature of Apicomplexa, but also of free living cilitates such as Tetrahymena and, dinoflagellate algae such as Perkinus, and Karlodinium. As a result, these organisms were grouped in to the superfamily, Alveolata. These relationships based on common cytoskeletal arrangement between dinoflagellates and ciliates were first proposed as far back as the 1970’s (Taylor, 1976). Dinoflagellates and Apicomplexans were grouped together in the Miozoa group by Cavalier-Smith et al. 1987(Cavalier-Smith, 1987). This was later confirmed using rRNA phylogenies and further adapted to include the Ciliates (Gajadhar et al., 1991; Wolters, 1991). Since then, the dinoflagellates, apicomplexans, and ciliates have been cemented into the Alveolata super- group (Adl et al., 2007; Adl et al., 2005; Gould et al., 2008). Subsequent studies identified classes of such alveolar proteins termed alveolins as part of a broad suite of proteins that unified this structure (Gould et al., 2011). Each species in this superfamily have in common this set of flattened vesicles pressed against the plasma membrane, and interconnected with proteinaceous structures specific to each species’ mode of living. For example, Tetrahymena possesses spikes embedded in their pellicles called trichocysts which can be ejected upon sensing danger to aid in defence (Plattner and Kissmehl, 2003). These adaptations are specific to a free living aquatic mode of living. Apicomplexa however, have adaptations specifically geared towards a parasitic mode of living.

1.1.3 Introduction to the Apicomplexan pellicle structures.

The two aforementioned apicomplexan species, Plasmodium and Toxoplasma, are some of the most highly researched parasites given their blight as chronic infectious diseases. A large part of their success is due to their alveolate-derived cytoskeleton. This cytoskeleton is integral to the cell pellicle and is split into three broad structures; the apical complex, the inner membrane complex, and the basal complex. The apical complex, is the uniting feature of all of Apicomplexa, and the namesake of the group. Proteomic studies of the ciliate cytoskeleton showed that homologues in Toxoplasma localized to the apical complex supporting their place within their Alveolate superfamily (Gould et al., 2011). This structure is present in all invasive stages of Plasmodium (Wall et al., 2016), but is disassembled and re-assembled in some stages such as gametocytes (Wall et al., 2016; Yusuf et al., 2015). In Plasmodium invasive stages, and also in Toxoplasma tachzoites, these parasites are always highly polarized with an apical and basal end, and they move in a forward direction (Hakansson et al., 1999; Yusuf et al., 2015). The forward motion is facilitated via the secretion of micronemes that enable attachment to host cell surfaces and tissues. It has been hypothesized that this might be an evolutionary related strategy to the adhesive functions of ciliate trichocysts, whereby the parasite secretes micronemes to attach to a host cell substrate, then moves along using its IMC-anchored glideosome machinery to propel forward (Gubbels and Duraisingh, 2012; Hakansson et al., 1999). The glideosome is a complex of motor proteins and cytoskeletal elements that drives the parasites forward after attachment to a substrate via the microneme proteins (Herm-Gotz et al., 2002;

4 Meissner et al., 2002). The basal complex is the structure that closes and supports the base of the parasite (Heaslip et al., 2010; Hu, 2008), . There are many studies in molecular biology of Apicomplexan invasion which focus on the highly invasive stage of Toxoplasma, the tachyzoite, largely owing to the ease with which this stage can be genetically manipulated and cultures in vitro (Limenitakis and Soldati-Favre, 2011). Consequently the biology of the parasites and in particular, motility apparatus of the tachyzoite is well studied (Frenal et al., 2010), and is the main focus of this review and this study.

Early investigation of the Toxoplasma cytoskeleton were done using electron microscopy and were critical in shaping the current understanding of modern parasite cell biology These studies identified core eukaryotic and specialized organelles (Gustafson et al., 1954; Rudzinska and Trager, 1959a; Sheffield and Melton, 1968), before modern sequencing tools were developed to identify the origin of many of these genes (Palmer, 1992; Wilson, 1993). In particular, studies in Toxoplasma were beneficial to the understanding of the broader Apicomplexan cytoskeleton arrangement owing to how well the bulky cytoskeleton is preserved by fixation. The flattened vesicles termed ‘alveolae’ in Toxoplasma tachyzoites are pressed up against the plasma membrane and on the cytosolic face of the alveolae run a series of 22 microtubules which run parallel to the parasite length, and are thought to provide structural rigidity and controlled growth of daughter cells (Bringmann and Holz, 1953, 1954; Tran et al., 2012b). Anchored to the alveoli and connected through the plasma membrane to the surface is the glideosome machinery which is an actin/myosin based complex which allows the parasite to move forward after connecting with the substrate (Frenal et al., 2010). This set of flattened vesicles is collectively called the Inner Membrane Complex (IMC) (Anderson- White et al., 2011). The parasite displays radial symmetry along its length and this glidesome structure allows it to move along host cell surfaces. The pellicle has also developed specialized cytoskeletal structures in many alveolates and the apical complex in Apicomplexa is such a structure (Gould et al., 2011). There is evidence that this apical complex has evolved from flagellar components (de Leon et al., 2013b; Francia et al., 2012) and indeed, it has been anticipated since early electron microscopy studies that it was composed of tubulin components (Bringmann and Holz, 1953). The apical complex is comprised of a polar ring, and appears as an electron dense structure ring in EM images. The apical polar ring nucleates a set of 22 sub-pellicular microtubules that cascade down the length of the plasma membrane until it gets to approximately two thirds of the parasite length (Bringmann and Holz, 1954; Sheffield and Melton, 1968; Tran et al., 2012b). It is proposed that they, together with the IMC, provide structural support for the plasma membrane and glideosome (Harding et al., 2016).

Within the lumen of the apical polar ring sits a structure termed the conoid. It is a tightly bound, detergent resistant structure (Hu et al., 2006) with a core composed of a novel tubulin polymer (Hu et al., 2002b). It is cylindrical in shape and at its tip is a set of preconoidal rings. The position of the conoid is dynamic and can be extruded forward and outside of the apical polar ring (Mondragon and Frixione, 1996). Its exact function is not fully clear but given its flagellar origins it could have multiple roles ranging from secretion, to motility to chemosensory roles. However, the evidence to date from the few genetic manipulation studies suggests a role in motility (Graindorge et al., 2016). Indeed, in intracellular parasites the conoid is always within the parasite, and extrudes upon egress and activation of motility (Del Carmen et al., 2009; Mondragon and Frixione, 1996).

The apical complex is also important because it is the site of secretion of numerous invasion factors via secretory organelles micronemes and rhoptries (Carruthers and Sibley, 1997). Rhoptries were first morphologically characterized by EM studies and appear as club shaped organelles which taper as they approach the apical complex (Gustafson et al., 1954). They are surrounded by a single

5 membrane bilayer appearing as a blackened line around the organelles (Sheffield and Melton, 1970). The number of rhoptries can vary from cell to cell and there are typically 8-10 rhoptries per Toxoplasma parasite (Kremer et al., 2013; Paredes-Santos et al., 2012). Micronemes are smaller in size and are shaped as small circles or ovals, and were first described much later than the rhoptries (Garnham et al., 1961). Rhoptry and micronemes are positioned toward the apical complex and indeed, their contents have been shown to be secreted from the apical complex and are required for invasion and motility respectively (Carruthers and Sibley, 1997; Paredes-Santos et al., 2012).

Lastly, Toxoplasma possesses an additional class of secretion organelles called dense granules which are named after being visualized as electron dense granules in the cytoplasm in EM images. These were not described in early EM studies as these granules were thought to be a common feature inside the cell cytoplasm of broader eukaryotes (Dubremetz and Ferguson, 2009; Gustafson et al., 1954; Ogino and Yoneda, 1966). These granules contain proteins that have been subsequently associated with host cell manipulation and maintenance of a structure called the parasitophorous vacuole (Mercier et al., 1998; Rommereim et al., 2016). The parasitophourous vacuole (PV) is a membranous sac that forms the physical barrier between the parasite and the host cell and protects the parasite from lysosomal degradation. It was known from EM studies that there was such a barrier between the parasites and host cell, but the link between the dense granules and the PV was not elucidated until much later (Jones and Hirsch, 1972). The PV is not a physical part of the free- roaming Toxoplasma tachyzoite although its formation and maintenance is critical for parasite replication inside the host cell (Mercier et al., 1998; Okada et al., 2013; Travier et al., 2008). Formation of the PV occurs when the parasite injects rhoptries into the host cells to establish a continuous membrane connection via the tight junction. Then, once invaded, the parasite releases dense granule proteins which modify and maintain this membrane barrier with the host cell through which nutrients, ions and small molecules can pass.

1.1.4 The apical complex in the cell division process of Toxoplasma tachyzoites.

In addition to the specialized organelles unique to Apicomplexa, Toxoplasma possesses the core eukaryotic organelles such as mitochondria, nucleus, endoplasmic reticulum and Golgi apparatus (Ogino and Yoneda, 1966). All of these organelles must be appropriately inherited during cell division, and, predictably, it utilizes the centrosome machinery to pull apart and replicate these organelles. Toxoplasma undergoes an unusual a mode of division, however, called endodyogeny. This process involves the formation of internal daughter cells inside the mother cell, and they emerge from the mother cell upon completion of cytokinesis (Sheffield and Melton, 1968). Model organisms for mitotic division such as mammalian fibroblasts undergo the same sequence of events of centrosome division, spindle formation, organelle segregation and cytokinesis. Toxoplasma is unusual in that, the apical complex foundation is formed first and it acts as a scaffold around which the IMC and the body of the parasite develops (Francia et al., 2012). The apical complex and centrosome are linked and the centrosome pulls the organelles into the daughter scaffold (Francia et al., 2012).This way, the daughter cells are largely developed by the time they undergo cytokinesis. Species of Apicomplexa undergo forms of replication known as endodyogeny, schizogeny or endopolygeny which differ in the number of daughter cells and the order of events of organelle segregation. But they all have in common the formation of the apical complex as an early step in establishing daughter buds.

6 1.1.5 Cell replication in Toxoplasma; Mitotic assembly, nuclear division and formation of nascent daughter buds.

The centrosome duplication and movement through the cell cycle was first characterized using canonical eukaryotic proteins such as centrin1 (Hu et al., 2006; Hu et al., 2002a). During interphase the centrosome is persistently localized at the anterior end of the nucleus. During division, the centrosome duplicates, then the divided centrosomes migrate around the basal end of the parasite and loop around back to the centrocone just at the apical end of the nucleus (Hartmann et al., 2006). The purpose of this migration is not yet clear. Spindle Fibre Assemblin proteins (SFA) are amongst the first proteins to appear at the centrosome and form a physical linker between the apical complex with the centrosome from the early stage of daughter cells(Francia et al., 2012). This link is maintained until the daughter cell reaches maturity and the SFA proteins disappear after the daughter cells have matured. It is not clear whether the attachment site is at the apical polar ring or the conoid. Previously, it was thought that this structure might have originated from flagella components and this study showed that the apical complex was indeed evolved from an elaborated flagellar system (Francia et al., 2012). The SFAs proteins only appear during the cell replication cycle and in accordance with this, ablation of SFA2 and SFA3 proteins results in a severe replication defect, specifically in the dysregulation of the formation of daughter buds, while nuclear division carries on normally (Francia et al., 2012). Similarly, SAS6L has been shown to localize to the Toxoplasma apical complex. SASL is a paralogue of the SAS6 protein, which is a ubiquitous basal body protein found in the centrosomes throughout Eukarya (de Leon et al., 2013a; Leidel et al., 2005). SAS6L however, localizes to the apical complex, further supporting the idea that the apical complex is evolutionarily derived from an ancestral flagellum, or at least evolved from the rootlet components of a flagellum. Taken together, this evidence shows that the apical complex is derived from flagellar rootlet, basal body components and the close physical association with the centrosome during division possibly reflects the association of these basal body proteins.

After the centrosomes have successfully duplicated and migrated, the daughter cells begin to form the IMC around the scaffold of the apical complex, and as they elongate, the centrosomes that link the segregating nuclei, are pulled into the daughter buds (Farrell and Gubbels, 2014; Nishi et al., 2008; Striepen et al., 2000). The Golgi and endoplasmic reticulum are pulled into the developing daughter cells, as is the apicoplast. In particular, the apicoplast is closely associated with the centrosomes during the division cycle and it appears to be pulled apart by the centrosomes, and moves into the daughter cells ahead of the nucleus (Striepen et al., 2000; van Dooren et al., 2009). The last organelle to be segregated is the mitochondrion (Nishi et al., 2008). The biological significance of this is not fully clear but it is possible that the mitochondrion is required for providing the IMC with energy even until cytokinesis. Once the daughter cells are in their very late stage, the cells can undergo cytokinesis. This involves the inheritance of the mother cell plasma membrane. After cytokinesis, the daughter cells become separated and can continue another round of replication, or if necessary, egress from the host cell to find a new host.

There are some components of the mother cell that are made de novo and so are not maternally inherited. The mother cell apical complex is not inherited by the daughter cells and is discarded by the daughters and segregated at the base of the rosette in the parasitophorous vacuole into what’s known as the residual body. This body also includes some contents of the IMC. This is because some proteins are made de novo in the daughter cells, and so the mother proteins are discarded, while others are maternally inherited so are less likely to be discarded (Anderson-White et al., 2012). While the proteinaceous composition of the pellicle is still poorly characterised, the identification of conserved alveolate repeat sequences in a family of IMC proteins greatly enhanced the number of

7 identifiable IMC proteins (Anderson-White et al., 2011; Gould et al., 2008). This has allowed the preliminary characterisation of many IMC proteins, including establishing the order of events of the IMC protein integration and assembly (Anderson-White et al., 2011).

The apical complex assembly is assembled in an ordered fashion. For example, SAS6L and RNG1 are both quite late stage markers of the apical complex but the apical complex clearly exists in some form shortly after centrosome duplication as indicated with tagging of tubulin-YFP (Hu et al., 2002a). However, the order of events has not been thoroughly characterized and it is even unclear if the tubulin components of the conoid form first, or if the sub-pellicular mictrotubules do. Currently the only known dedicated apical complex proteins, for which timing assembly has been observed, appear late in cell replication (de Leon et al., 2013a; Hu et al., 2002a; Tran et al., 2010). At the time of commencement of this thesis there were no known markers of the apical complex at this early stage. Since then, a new protein termed RNG2 has been shown to localize to the nascent daughter buds and showed that the apical complex had an intimate association at a very early stage with the centrosomes (Katris et al., 2014). IMC15 is the earliest identified marker to date of the nascent daughter buds although IMC15 could be said to be an apical complex protein given it has been seen to localize to the apical complex in addition to the IMC (Anderson-White et al., 2012; Anderson- White et al., 2011). That said, it is possible that IMC15 is both IMC and apical complex but the functional purpose of this dual localization has yet to be shown. In a similar way, a small amount of MORN1 has been shown to localize to the apical complex but the major defect is in daughter cell replication and basal complex assembly (Heaslip et al., 2010; Lorestani et al., 2010). The majority of the early components of the apical complex are not known and the order of assembly of these apical complex proteins is not known. Although CAM1, CAM2 and DLC1 were both seen to be localized to the apical complex, none had their timing of appearance established (Hu et al., 2006), so it is not known whether they appear early in daughter cells or at late stage.

1.2.1 Invasion components of Toxoplasma: Molecular composition of the apical complex.

In contrast to the acceleration of knowledge of IMC proteins with the discovery of the conserved alveolin domain, the apical complex has no identifiable sequences or functional motifs which are common to any group of apical complex proteins. The apical complex is, thus, poorly characterized with very few of its components confirmed, and fewer are functionally characterized (Figure 1.1, 1.2). The apical complex is proposed to be composed of approximately 200 proteins although there could well be more (Hu et al., 2006). The only proteomic study of the apical complex involved harvested apical complexes from Toxoplasma (Hu et al., 2006). The extraction procedure involved exposing the parasite to a harsh detergent extraction which removes all organelles and leaves the tightly bound proteins of the apical complex intact. This also includes the attached mictrotubules which are unable to be removed, so there will likely also be many proteins localizing to the sub- pellicular microtubules. The end result was a mixture of apical complexes with conoids attached and splayed microtubules which look rather like flowers in bloom, and are depleted of other organelles. This procedure will also likely remove any membrane bound proteins that might have localized to the apical complex. Currently validated apical complex proteins comprise a short list of about 20 proteins, (Figure 1.2) which have been assembled into a 3D model of the apical complex (Figure 1.1). In the initial apical complex proteome publication, four apical complex proteins were localized, DLC1, CAM1, CAM2, and Centrin2. Since then several other proteins have been identified such as AKMT, RNG1, MyoH (Graindorge et al., 2016; Heaslip et al., 2011; Tran et al., 2010). All of these proteins can be found in the Hu et al (2006) proteome, except for RNG1 which is likely due to mis- annotation of the gene model in the ToxoDB database used for proteomic identification (Tran et al., 2010). There are also some proteins which have multiple localizations such as Centrin2, which

8 localizes to the centrosomes, some apical annuli and the apical complex (Hu et al., 2006). Though it might be difficult to investigate the function of these annuli if Centrin2 has essential functions in daughter cell formation as they might have severe morphological defects in addition to function at the mother cell annuli if they have a function different to daughter cell fomration. Similarly, MORN1 shows a faint localization at the apical complex although it appears much more abundant at the basal complex and spindle poles of the nucleus (Anderson-White et al., 2012; Hu et al., 2006). It is difficult to test the function of MORN1 at the apical complex because the functional ablation of MORN1 results in severe daughter cell formation defects and these might be due to function of MORN1 at the other locations (Heaslip et al., 2010; Lorestani et al., 2010).The only protein known to localize exclusively to the polar ring is RNG1, whose function is not yet determined (Tran et al., 2010). Analysis of the behaviour of the tagged protein shows it is attached to the polar ring even when detergent extracted (Tran et al., 2010). In addition to this, there are examples of proteins whose exact relative localization is not clear but which clearly localize to the conoid such as SAS6L, which has been localized with reference to the apical polar ring marker RNG1, but no other conoid- specific markers (de Leon et al., 2013b). Also, while they weren’t exactly co-localized with MyoH, it is presumed that MLC5, MLC7 and presumably MLC3 all localize to the conoid as well, though there is a possibility that some could target the apical polar ring (Graindorge et al., 2016). In summary, the currently known list of apical complex proteins comprises a short list of diverse proteins, and identification has been slow due to a lack of a clear targeting domain.

1.2.2 Functional studies of apical complex proteins.

Of the previously described apical complex proteins, there are only a handful of them that have been functionally characterized. RNG1 was the first such protein with some basic functional characterization of the protein behaviour in terms of its localization, but functional mutagenesis of the RNG1 protein was not possible as it was unable to be knocked out (Tran et al., 2010).

Apical complex Lysine Methyltransferase (AKMT) was the first functionally characterized apical complex protein by gene knockout (Heaslip et al., 2011). A total knock-out of this gene resulted in a severe growth defect when analysed by plaque assay (Heaslip et al., 2011). AKMT was found to play a role in parasite motility and was the first publication to implicate the conoid in the function of motility. Curiously though, microneme secretion was unaffected suggesting a separation of function and sub-compartmentalisation of apical complex function. Conoid extrusion was also unaffected so although AKMT localized to the conoid, it didn’t affect the function of the conoid. Even more curious is that the role of AKMT appeared to be responsive to signalling of calcium. AKMT was visualized in tagged cell lines to disperse into the parasite cytosol upon elevated calcium levels, which was facilitated by shifting from a high potassium buffer to a low potassium buffer to mimic egress, as well as treatment with calcium ionophore. If the protein was sequestered at the apical complex and released upon the signal to egress, then it is unlikely that the role of AKMT would be mechanical. Subsequent studies on the enzymatic activity of AKMT showed that the protein did have lysine methyltransferase activity and that the N-terminal domain was dispensable for enzymatic activity (Sivagurunathan et al., 2013). It is not known how this protein would be involved in calcium signalling or the identity of any interacting proteins. Given the involvement of calcium in AKMT re- localization, it is curious that AKMT doesn’t have a defect in microneme secretion or conoid extrusion. Based on this the authors suggest that AKMT might engage the actomyosin motor somehow at the junction between the apical complex and the IMC. It is also worth noting that AKMT appears as a phosphorylation target of calcium dependent protein kinase 1, (CDPK1) a signalling protein shown to be involved in regulating microneme secretion and motility (Lourido et al. 2013). It

9 is worth noting that the gene list has since been updated and the previous identifier for AKMT (TGGT1_099170) has since been updated to a new numbering (TGGT1_216080), to conform with other strains. However, the identification of interacting partners would greatly enhance knowledge about the role of AKMT in Toxoplasma motility.

One of the few other well characterized apical complex proteins is the Myosin H protein (MyoH). MyoH is a myosin motor protein with a classical head and tail domain structure (Graindorge et al., 2016). In addition to this, it also has a sequence of ATS (Alpha-Tubulin Suppressor), microtubule binding, domains. It is thought that the MyoH may bind to the tubulin core of the conoid and connect it with the actin cytoskeleton. There has been much research into myosins and associated light chains as many have localized to the actin based glideosome machinery of Toxoplasma which is the engine that drives motility in these extracellular parasites (Graindorge et al. 2016). MyoH knockdown was found to cause a severe motility defect in Toxoplasma tachyzoites but parasites were still able to secrete micronemes suggesting its role was mechanical in nature as opposed to signalling like AKMT. Interestingly, conoid extrusion was not impaired in the MyoH inducible knockdown mutant which was slightly counter intuitive given it localizes there. Instead, it was found that MyoH associated with two myosin light chains, MLC5 and MLC7 whose expression or localization was altered in the absence of MyoH. Another myosin light chain, MLC3, was localized to the apical complex but there was no data on whether MLC3 could be knocked out inducibly or otherwise. It is possible that of the three MLC proteins localized to the apical complex, MLC3 might be the one that is essential for proper MyoH function. Neither MLC5 nor MLC7 genes were found to be essential in the parasites when knocked out either singly or together (Graindorge et al., 2016). However, it was seen that in the MLC5/MLC7 KO parasites, a band corresponding in size to the MLC1 protein, was found to be associated with epitope-tagged MyoH. MLC1 is a light chain of the motor protein MyoA localizing to the full length of the IMC, which is a prominent component of the glideosome machinery and is attached to the IMC (Frenal et al., 2010). These data suggested that there is a dynamic network of myosin light chains with separate localizations in the parasite which can compensate for the loss of one or more of these proteins. This plasticity and redundancy is an emerging theme in Toxoplasma biology in which the loss of one protein is replaced by another (Frenal et al., 2014; Graindorge et al., 2016; Liu et al., 2016). Recent controversy surrounding the ability to knock-out key components of the glideosome led investigators to initially suggest that there was an alternate mechanism of invasion which was independent of the actin based glideosome machinery (Andenmatten et al., 2013). However, follow up work showed that different motor proteins localized to different compartments of the IMC, for example MyoA localized along the full length of the IMC, while MyoC localized exclusively at the basal complex (Frenal et al., 2014). When MyoC was knocked out, it was seen that the other myosins would move along the length of the parasite to compensate for the loss of one of the components. In the same way, loss of MLC5/MLC7 caused MLC1 to move forward towards the apical complex to compensate for the loss of these proteins and interact with MyoH (Graindorge et al., 2016). Hence, MyoH can be thought of as part of the glideosome relay which initiates the movement cascade. It seems to suggest that the forward movement is initiated at the apical complex, and the relay is passed down toward the basal complex. Therefore, this can be reconciled with the absence of a conoid defect and, taken together, it suggests that MyoH links the conoid to the glideosome machinery. So while conoid extrusion can still occur in the MyoH iKD mutant, when it’s knocked down, MyoH is unable to transfer the torsion force that is produced by the conoid extrusion.

10

Figure 1.1. Schematic of some of the known apical complex proteins and connected sub-pellicular microtubules. Proteins involved in functional studies underlined. Asterisk denotes protein found at multiple locations (Image adapted from Anderson White 2012. Image Credit: Anderson-White et al. 2012)

The investigation of conserved centrosome and basal body proteins in Eukarya led researchers to another apical complex protein. The protein SAS6 is a conserved basal body protein that is closely associated with eukaryotic centrosomes (Leidel et al., 2005). This protein has been found to have a role in seeding the correct number of pro-centrioles to allow for stable centrosome duplication. It is closely tied to the ability to promote microtubule filament assembly and the nine-fold cartwheel symmetry of the centriole (Nakazawa et al., 2007). In accordance with this conserved role, SAS6 localizes to the centrosomes of Toxoplasma and remains there, presumably throughout the cell cycle though this was not rigorously tested (de Leon et al., 2013b). Curiously, there was found to be a SAS6 homologue that was found to be highly conserved among Eukarya which was dubbed SAS6-like (SAS6L). SAS6L localises not to the centrosomes like SAS6, but rather, exclusively to the apical complex (de Leon et al., 2013b). Knockouts were generated of the SAS6L gene and no growth defect was observed so a function for SAS6L could not be established, although SAS6L KO cells were out- competed in a competition assay with the parental cell line (de Leon et al., 2013b). In accordance with this, its conserved appearance throughout Eukarya suggests that it does fulfil some useful role.

11 SAS6 knockouts were not made, but would presumably have defects in cell replication as opposed to apical complex function, although it could cause defects in apical complex formation and daughter budding similar to the SFA proteins (Francia et al., 2012). This is supported by research in Plasmodium berghei, in which SAS6 knockouts showed severe defects in the gametocyte stage of the life cycle (Marques et al., 2015). This is unsurprising given the essential roles of basal body duplication in the formation of the flagella in what is the only flagellated stage in Plasmodium species (Marques et al., 2015). The fact that the Toxoplasma tachyzoite is not a flagellated stage, but does contain persistent centrioles, so SAS6 KO would likely have more extensive defects in asexual reproducing forms. It would also be interesting to know what role SAS6L might have in Toxoplasma male gamete formation. Follow up work on Toxoplasma also showed that TgSAS6L also could be resolved as a ring structure showing that this conoid structure was indeed a ring shape, similar to MyoH (Graindorge et al., 2016; Wall et al., 2016). It might also be that many other proteins which were localized to the apical complex might also be able to be resolved as such, such as DLC, CAM1 and CAM2. As more proteins are found to be resolved as rings, these data suggest that the apical complex is likely a tube of ring proteins.

1.2.3 The Apical Complex in Plasmodium.

The identification of the Toxoplasma SAS6L as an apical complex protein, and its conserved appearance across Eukarya, prompted researchers to investigate localization of the homologue in Plasmodium berghei. Interestingly, PbSAS6L localized to the apical complex of only the mosquito invasive forms, and not the blood stage merozoites or gametocytes (Wall et al., 2016). This is in stark contrast to the PbMyoB which is expressed in all motile invasive stages (Yusuf et al., 2015). The stage specific localization of PbSAS6L suggests that the apical complex is modified between stages and its composition depends on the requirements of the life stage. Moreover, using super-resolution microscopy, PbSAS6L was resolved as a ring structure, just like TgSAS6L. Prior to this, there were no known proteins that localized to the apical polar ring in any Plasmodium species. PbSAS6L is also the first molecular evidence of a possible rudimentary conoid element in Plasmodium species. Plasmodium species are part of the class Aconoidasida, members of Apicomplexa which do not possess a visible conoid. The Toxoplasma protein TgSAS6L was shown to localize at the apical complex, but more specifically, to the conoid as it appears anterior to the apical polar ring marker RNG1. This shows that a conoid protein appears at the apical complex of a Plasmoidum species which is otherwise without any ultrastructural evidence of a conoid. In evolutionary terms, it is generally accepted that the Plasmodium species lost the conoid through evolution and the Coccidia retained this ancient structure. In spatiotemporal terms, it is now a puzzle to resolve how the ancient apical complex evolved to this more modern structure. Plasmodium clearly lacks a conoid with a dense tubulin stucture like Toxoplasma does, but that is not to say that it has no orthologous structure nestled within its polar ring, or even fused to it. Certainly there are cytoskeletal structures in Toxoplasma which currently are not clearly identifiable under electron micrscopy, such as the peripheral annuli seen in Centrin2 localization, except with immuolocalization. It could be a similar scenario in Plasmodium in which the hypothetical conoid derivative might be less visible under EM. This will only be further elucidated using molecular data.

Toxoplasma, with its highly tractable genetic systems has made it possible to localize numerous apical complex proteins despite the difficulties in identifying such proteins from lack of readily identifiable conserved sequences. In Plasmodium, ease of genetic manipulation is not as efficient and so progress has been much slower. A novel myosin, MyoB was the first localized protein to the apical complex of Plasmodium species along with its associated light chain MLCB (Yusuf et al., 2015).

12 MLCB was localized to the apical complex of P. falciparum merozoites as was PfMyoB. It was found through pull down experiments that PfMyoB interacts with PfMLCB. It is tempting to consider a similar function for the Plasmodium Myosin B as Toxoplasma MyoH. PfMyoB is different from MyoH however, in that it is truncated and has little or no tail domain, whereas TgMyoH has the microtubule binding tail domains (Graindorge et al., 2016; Wall et al., 2016; Yusuf et al., 2015). When localized in Plasmodium berghei, PbMyoB was found to localize to the apical complex of blood stage merozoites as well. In addition to this, PbMyoB also localizes to the apical complex of invasive mosquito stages, ookinetes and sporozites. These data suggest that Plasmodium MyoB is present in the apical complex of all invasive life stages. However, PbMyoB disappeared in stages where the apical complex was dissociated such as in gametocytes (Yusuf et al., 2015). This is not unsurprising given the conservation of the apical complex in all invasive Plasmodium stages but contrasts with what was shown forPbSAS6L. No functional data is currently available for any of PfMLCB, PbMLCB, or PbMyoB because they were unable to be knocked out. However, now that there exists an increasingly large body of data of localized apical complex proteins in Toxoplasma, this will hopefully fuel discovery in Plasmodium species.

Figure 1.2 Summary of known Apical complex proteins:

Protein Gene ID Localization Published Functionally Characterized?

CAM1 TGME49_246930 apical Hu et al. - complex 2006

CAM2 TGME49_262010 apical Hu et al. - complex 2006

DLC TGME49_223000 apical Hu et al. - complex 2006

MORN1 TGME49_310440 spindle pole, Hu et al. Yes, (but basal 2006 unrelated to complex, apical complex apical function) complex

α-tubulin TGME49_316400A conoid core Hu et al. - 2006

Centrin2 TGME49_250340 centrosomes, Hu et al. - annuli, and 2006 apical complex, basal complex

13 RNG1 TGGT1_243545 apical Tran et al. Yes, This study (correct locus, but complex 2010 mis-annotated) (polar ring)

ViralA2 TGGT1_252880 apical Gould et - complex al. 2010

RNG2 TGGT1_244470 apical Gould et Yes, This study complex al. 2010, (polar ring, This study conoid)

MyoH TGGT1_243250) apical Graindorge Yes, essential complex et al. 2016 (conoid)

MLC5 TGGT1_311260 apical Graindorge Yes (not complex et al. 2016 essential)

MLC7 TGGT1_315780 apical Yes (not Yes (not complex essential) essential)

MLC3 TGGT1_250840 apical Graindorge - complex et al. 2016

CAP1 TGGT1_010810 apical Skariah et yes complex al. 2011

TgSAS6L TGGT1_301420 apical De Leon et Yes (not complex al. 2013. essential) Wall et al. 2016

TgAKMT TGGT1_216080 apical Heaslip et yes complex al. 2011

ICMAP1 TGGT1_039300 apical Heaslip et - complex al. 2009 (intraconoidal microtubules)

Centrin3 TGGT1_ 260670 apical Anderson- - complex White et al. 2012

IMC15 TGGT1_ 275670 IMC (apical Anderson- - portion), White et apical al. 2012 complex

14 SFA2 TgGT1_205670 apical Francia et yes complex, al. 2012 centrosomes (daughters only)

SFA3 TgGT1_ 218880 apical Francia et yes complex, al. 2012 centrosomes (daughters only)

DIP13 TGGT1_295450 Apical polar Leveque et Yes (not ring and al. 2016 essential) conoid

Protein (gene ID) (Plasmodium sp.)

PbSAS6L PBANKA_141490 apical Wall et al. Yes (not complex 2016 essential)

PbMyoB PBANKA_1103300 Apical Yusuf et al. - complex 2015

PfMyoB PF3D7_0503600 Apical Yusuf et al. - complex 2015

PfMLCB PF3D7_1118700 Apical Yusuf et al. - Complex 2015

A similar protein that was localized to the apical complex is the DIP13 protein which is a coiled coil protein conserved across Eukarya (Leveque et al., 2016). Homologues of this protein have been shown to be associated with cilia and flagella in vertebrates (Lai et al., 2011; Lai et al., 2016), so it is consistent that it localizes to the apical complex. Interestingly, DIP13 shows a peculiar localization with what appears to be a ring at the base of the conoid, not the polar ring, and then a smaller dot in the middle of the conoid. These coiled coil motifs are very likely facilitating protein interactions but otherwise yields no further information. Knockout of this gene was found to be tolerated and the gene was found to be non-essential.

15

CAP1:

There is one protein which is known to localize to the Toxoplasma apical complex that is called CAP1 (Skariah et al., 2012). This protein is associated with macrophage activation and was identified from a screen searching for defects in the ability of parasites to survive macrophage activation through production of reactive nitrogen intermediates (RNIs) of the macrophages. The protein was reported to localize to the conoid, and can clearly be seen somewhere near the tip of the conoid. However, without co-localizing with a reference marker such as RNG1, it is not conclusive and so may localize to the apical polar ring instead. CAP1 is also interesting in that it appears to localize in extracellular parasites to an unknown perinuclear structure (Skariah et al., 2012). It was not identified what this compartment is exactly, but it could be that this is the centrosome. In which case it would be in accordance with previous data implicating the centrosome with apical complex assembly and interesting to speculate how such a protein related to nitrogen intermediate resistance would localize there. CAP1 was able to be knocked out and showed no observable growth defect (Skariah et al., 2012). Looking specifically in macrophages, the KO parasites were able to invade and replicate within macrophages as efficiently as wildtype cells. However, when invading activated macrophages, the KO cells invaded but then stalled at the 1 cell stage as they were unable to continue the replication cycle while the wild type cells continue replicating into 2 cells per vacuole at the same time point. Also, the KO cell samples showed many more degraded parasites than the wild type controls. The mechanism for this is completely unknown and it is curious that a protein with this localization would have such a role. Perhaps the RNIs are sending some sort of signal to the parasites to cause their death, through CAP1. However, a more plausible scenario is that there is some defect in release of some particular secreted kinase, likely a rhoptry kinase that is unable to suppress the host defence response (Saeij et al., 2006). Rhoptry kinases are well known to play a role not just in formation of the tight junction but also in manipulation of the host immune response by modulating host cell regulatory pathways using secreted rhoptry and dense granule proteins (Saeij et al. 2006, Taylor et al. 2006). However, such a role in CAP1 is purely speculative at this stage and further analysis of these proteins would be required in the CAP1 KO.

Taken together, the functions of the apical complex are extremely diverse. It is implicated in signalling through the studies of AKMT (Heaslip et al., 2011), mechanical force transmission through the MyoH and extended glideosome network (Graindorge et al., 2016), and also here in what is presumably some sort of immunological response that could be tied to receptor binding or secretion events. Interestingly, all these functions relate to the invasion of host cells or in the case of CAP1, the modulation of an immune response (Skariah et al., 2012) although this will require further investigation to identify the exact mechanism. It will take further work to establish which apical complex proteins are important for structural stability and assembly.

1.2.4 The IMC.

The IMC is collectively comprised of the numerous flattened membrane sacs known as alveolae, and the proteinaceous structures that associate with them and provide rigidity and support for the motile parasite. In addition to this, the subpellicular microtubules attach at the apical polar ring and continue to run along about two thirds of the length of the IMC which itself reaches the posterior end of the parasite and the basal complex (Anderson-White et al., 2011; Chen et al., 2015; Morrissette, 2015; Tran et al., 2012b). The IMC houses numerous structural, cytoskeletal

16 components as well as kinases that act in diverse movement and signalling roles, in particular, the glideosome machinery that powers cell motility (Frenal et al., 2010). The structural integrity of the IMC appears to be essential for parasite morphology, as conditional ablation of the IMC anchored GAP50 results in cytoskeleton collapse (Harding et al., 2016).

The IMC, unlike the apical complex, is known to have a family of proteins defined by a set of conserved repeat motifs known as alveolin repeats (Gould et al., 2008). These motifs are conserved throughout Alveolata and are associated with cytoskeletal structures, particularly the alveolae of these diverse organisms. Given these proteins were easily identifiable through a conserved sequence, there have been many proteins localized to these compartments and many alveolin proteins have been grouped into a family termed ‘IMC’ proteins (Anderson-White et al., 2011). While most proteins that localize to the IMC are annotated by this three letter acronym, not all IMC proteins possess the consensus alveolin motif such as IMC2 (Anderson-White et al., 2011).The alveolin repeat is composed of a consensus sequence of EKIVEVP (Gould et al., 2011; Gould et al., 2008). A detailed analysis of the Tetrahymena cytoskeleton found that many cytoskeleton variants possessed similar charged repeat motifs and were termed CRMPs (charged repeat motif protein) (Gould et al., 2011). Not surprisingly, homologues of these proteins in Toxoplasma localized to cytoskeletal structures such as the apical complex (Gould et al., 2011).

Another family of cytoskeletal proteins that has been identified from the IMC is the ISP family of proteins. ISP1 was identified from a set of monoclonal antibodies from a mixed fraction of organelles (Beck et al., 2010a). It was identified as localizing to the apical capof Toxoplasma parasites and other ISP proteins ISP2, ISP3 and ISP4 were found by homology to ISP1. ISPs are unique to the phylum Apicomplexa and not found in any other group of organisms, although they do appear in the proto- Apicomplexans Chromera and Vitrella (Woo et al., 2015). Interestingly, ISPs show specific localization to different sub-compartments of the IMC. For example, while ISP1 is restricted to the apical cap, ISP2 begins at the bottom of the apical cap about a quarter of the parasite length from the apical complex, and extends three quarters of the length of the IMC (Beck et al., 2010b; Fung et al., 2012). Interestingly, when ISP1 is knocked out, ISP2 and ISP3, re-localize and extend their distribution along the apical cap where they previously would have met ISP1 and formed a barrier (Beck et al., 2010b; Fung et al., 2012). These data show complex sub-compartments within the Toxoplasma IMC (Chen et al., 2015)and this is similar to the study of MyoH in which MyoA was able to compensate for the loss of MLC5 and MLC7 (Graindorge et al., 2016).

1.2.5 The glideosome.

The IMC and its protein network provides a stable platform for the glideosome complex, so named after the function of enabling the parasites to glide along a surface (Harding et al., 2016). The basic principle relies on the parasites ability to secrete microneme proteins which allows the parasite to stick to a substrate (Huynh and Carruthers, 2006). Once the parasite has traction, the attachment of these microneme proteins via the glideosome then allow the parasite to pull itself along a surface creating forward thrust (Figure 1.2). It is this mechanism that also allows the parasite to invade a new host cell after attaching to form the tight junction (Mital et al., 2005). This junction is an attachment point formed by rhoptry-neck proteins and micronemes at the host plasma membrane that allows seamless entry into the host cytosol (Alexander et al., 2005). The major motor protein of the glideosome is the MyoA motor protein which generates forward movement by working against actin. The secreted microneme protein MIC2, which is a major requirement for motility (Huynh and Carruthers, 2006), is not simply shed into the extracellular environment and lost, rather its

17 extracellular domain is exposed to the external environment where it attaches to a yet to be identified host cell membrane ligand. The intracellular domain of MIC2 is connected through glideosome components to actin (Sheiner et al., 2010). The myosin motor complex is anchored in the IMC and is located between the IMC and the plasma membrane. This allows MIC2 to have a firm grip on the host surface and transfers this force to the actin cytoskeleton. MyoA binds to the actin cytoskeleton and drives along the length of the actin filaments pulling the IMC components along with it which are attached through the Myosin Light Chain proteins MLC1 and the Essential Light Chain proteins ELC1/ELC2 (Frenal et al., 2010; Williams et al., 2015). The GAP proteins GAP45, GAP40 and GAP50 most likely serve roles in stabilizing the complex between the IMC, cytoskeleton and plasma membrane (Harding et al., 2016). This collective mechanism underpins all of Toxoplasma motility in free roaming as well as invading parasites.

Figure 1.3 Schematic of different myosin motors in different compartments of the Toxoplasma cell body. (Image credit; Frenal et al. 2014 PLoS Pathogens)

Recently there has been some controversy regarding the essentiality of MyoA and GAP45 in the parasite. GAP45 inducible knock-down shows and inability to egress in response to a calcium stimulus. However, a knockout of GAP45 was found to be viable in culture, suggesting that the parasites were able to compensate for the loss of GAP45, however a sudden loss of the protein made the parasites unable to respond and adapt in time (Andenmatten et al., 2013). Similarly, MIC2 and MyoA were able to be knocked out using a similar mechanism, however a triple knockout was unviable (Andenmatten et al., 2013). Follow up experiments on this inexplicable observation revealed that the glideosome components were able to compensate for one another similar to the way that ISP proteins were able to re-localize upon deletion of one of these family members (Frenal et al., 2014). However, it should be noted that deletion of MyoA and MyoC was not tolerated, showing that there is a limit to how many of these myosins can be removed before it impacts on the parasite’s ability to invade (Egarter et al., 2014). By arranging the motor complex in this way, it allows MyoA and MLC1 to be conserved almost along the entire length of the parasite IMC and the different GAP proteins which have distinct localizations along the parasite length, differentially associate with the MyoA depending on where in the parasite it is localized. This can also be seen in the ELC1/2 KO in which knock out of either ELC1 or ELC2 is tolerated, but KO of both light chains together causes a severe growth defect (Williams et al., 2015). This shows that either ELCs can compensate for the loss of another, but that when both knocked out, there is no ability to

18 compensate. The compartmentalized localizations of these motor components probably has some role in controlling the rigidity and stability of the glideosome depending on which part of the parasite needs to interact with the host cell surface. It is very likely that the GAP80 has more of a role in turning around on the parasite’s basal end and this would require different properties of the protein itself in terms of its interaction with MyoC. Also, the fact that GAP45 and GAP70 both interact with MyoA suggests that there is some specificity for GAP70 at the apical end of the parasite that makes it necessary to be localized there. There is clearly a great deal of plasticity and redundancy in these proteins and this is an example of morphological flexibility. It is possible that this may allow the parasite to alter its motility slightly to better move around and invade new host cells depending on the species. If the parasite spends most of its life in a particular host, it is conceivable that sudden and unexpected changes in host cell physical properties may alter the parasites need to be a particular shape or move in a certain way or its requirements for a particular motility pattern.

1.2.6 Cytoskeletal Morphology and TgPhil1/TgSIP.

The parasite morphology plays a role in normal motility just as does the motor machinery that powers it. Historically, parasite motility assays were performed as 2D assays in which parasites were settled onto coverslips and allowed to move around with or without stimulus for a set period of time. The motility can be analysed by live microscopy but more commonly the coverslips are labelled with antibodies to the SAG1 protein which is a surface antigen that is deposited on the coverslip surface as the parasite moves over it (Carey et al., 2004). The end result is motility that can be visualized as trails which appear as very ornate circles and squiggles. However, the limitations of this is that it is an in vitro system that can be only analysed by 2D technology. A matrigel system that was developed to analyse Toxoplasma motility in 3D showed that these parasites moved in more directed patterns compared to the chaotic trails seen in 2D assays (Leung et al., 2014). In a matrigel environment, the parasites move in a corkscrew path in a clockwise manner (right hand thread). The matrigel is designed to mimic the internal tissue environment that would typically be the intermediate host, and there are still limitations in that it is still an in vitro system, but simply with increased spatial freedom of movement. All parasites always moved in a clockwise manner and never in the opposite hand motion, and a turn was defined as the distance required to move until the parasite was spatially back in the orientation in initiated the first turn. This type of predicted circular movement is very similar to what is seen in Plasmodium sporozoites (Kudryashev et al., 2012). When sporozoites are allowed to settles on coverlsips, they fall on a particular side and then proceed to turn clockwise in motion, repeatedly until they tire out (Kudryashev et al., 2012). Further still, if these parasites fall on their non-preferred side, they will keep turning anticlockwise until they flip over and return to their preferred side and clockwise turning orientation. Similar circular corkscrew style motility patterns are also seen in Plasmodium ookinetes. One notable mutant is a knock out of the apical localized protein PhiL1 (Leung et al., 2014). Phil1 is not essential and its loss has no general impact on cell growth. It also has no obvious role in the glideosome machinery required to power the actin based motor complex. However, knockout of Phil1 causes a morphological defect in which parasites move differently. Parasite depleted of Phil1 take longer to complete one full corkscrew turn. This means the phase of the distance required to complete one full turn is longer. As such, their motility is aberrant and effectively less efficient than wildtype cells. Similarly, knockout of a Toxoplasma protein known as TgSIP, causes parasites to become shorter and stubbier than their wild type counterparts (Lentini et al., 2015). TgSIP is a protein that appears to localize at the basal complex and in transverse structuresalong the length of the IMC, which appear

19 to correspond with the gaps in the alveolae of the parasite. Knockout of TgSIP resulted in a mild defect in invasion and a general increase in twirling and other patterns of uncoordinated motility when viewed by live microscopy. These defects are quite subtle and would not be easily identified without using an elaborate 3D assay as used above for Phil1. It could well be that non-essential knockout mutants such as SAS6L might have similar defects in motility profiles but which are as yet to be investigated. Further still, TgSIP KO parasites were less virulent in an in vivo mouse model, so this clearly shows that the morphology of the parasite plays a role in the coordinated motility and proper invasion. It would be interesting to see if MyoB/C or GAP mutants are similarly affected and display altered motility.

1.2.7 Sub-pellicular Microtubules (SPMs).

The sub-pellicular microtubules begin attached to the apical polar ring, not the conoid, and run along the approximately two thirds of the length of the parasite. These microtubules provide extra stability and support for the parasite in addition to the alveolae (Tran et al., 2012b). Very little is known about the proteins that are associated with these sub-pellicular microtubules, and as such knowledge of the exact nature of their function is limited. SPM1 and SPM2 were the first two proteins identified which localize to these microtubules (Tran et al., 2012a). SPM1 appears to localize to the full length of the parasite microtubules, whereas SPM2 is more restricted to the middle of the parasite body. These proteins possess an unusual repeat motif, similar to those identified as CRMPs in Tetrahymena (Gould et al., 2011) . Both SPM1 and SPM2 could be knocked out individually. SPM2 KO showed no growth defect, and was dispensable for parasite viability. Similarly, SPM1 was also able to be knocked out, but SPM1 KO parasites did show decreased fitness when compared to wild type cells by competition assay. Further analysis of SPM1 showed that these SPM1 KO cells were not resistant to detergent extraction (Tran et al., 2012b) . When parasites are treated with detergent, the apical complex and associated sub-pellicular microtubules remain intact and attached, but lose their parasite shape and can be splayed out like a flower. SPM1 KO cells lose their microtubules upon detergent extraction resulting in isolated apical complexes with conoids. SPM2 KO however, showed no such defect. This shows that SPM1 most likely has a structural role given its KO results in some instability of the supporting microtubules, similar to the way in which GAP50 is required for the integrity of the IMC . The repeat regions of SPM proteins show that these are important for targeting to the sub-pellicular microtubules, consistent with CRMPs and alveolin domain proteins localizing to the cytoskeleton, and particularly, the IMC.

1.3.1 Secretion factors in Toxoplasma and the tight junction.

The cytoskeleton of Toxoplasma is critical to its ability to egress from host cells, move around exploring the extracellular environment and invade and colonizing new host cells. However, this would not be possible without an arsenal of secretion factors which the parasite uses to facilitate almost every aspect of its lytic cycle, from attachment, to invasion, host manipulation and egress. It is these secretion factors that utilize and even manipulate the host cell for the parasite’s advantage by providing an interface between the two organisms. These secretion factors are compartmentalized in dedicated vesicular structures that are capable of being released exactly when required to facilitate all aspects of the lytic cycle. They are usually highly specific for particular stages in the lytic cycle and even differences in parasite strains can have significant differences between secretion factors. Toxoplasma, and apicomplexan secretion compartments in general, can be broadly

20 classified into three main categories; micronemes, rhoptries, and dense granules. Micronemes are broadly required for motility and attachment (Sheiner et al., 2010), rhoptries are broadly required for host cell entry by injecting proteins important for invasion and hijacking host functions (Mueller et al., 2013a), and dense granules are broadly required for maintenance of the parasitophorous vacuole (Rommereim et al., 2016). Microneme are secreted during extracellular stages to attach to a host cell and move along to find a new host. When a new host is found, the rhoptries are secreted and insert to the host cell. Rhoptries are only secreted upon entry into a new host cell and interact with microneme proteins to form what is commonly known as the ‘tight junction’ or more recently, the ‘moving junction’. This structure is a ring of rhoptry and microneme proteins in complex which form a seal that allows the parasite to enter the new host cell without damaging the host cell membrane (Alexander et al., 2005; Bradley et al., 2005; Lebrun et al., 2005). At this point, rhoptries are further secreted and assist in the suppression of the host immune system by modulating gene expression from the host cell nucleus. Lastly, dense granule proteins are secreted into the host cell parasitophorous vacuole and they assist in maintenance of this membrane which is the interface between the parasite and host cell. There is no evidence to suggest that GRA proteins have a role in the formation of the tight junction. The model as it stands, shows a cooperation between micronemes required for motility, and rhoptries which are secreted only upon invasion to create the tight junction with the micronemes.

1.3.2 Micronemes.

Micronemes are broadly attributed to roles of host cell attachment and motility. Micronemes are localized to the apical end of the parasites, are secreted through the apical complex and this facilitates the forward motion of the parasites by laying down the proteins on which the parasite then gains traction. Toxoplasma tachyzotiesare highly polarised cells and the secretory system is set up so that the micronemes are released at one end so the parasite gains traction and moves forward over them using the glideosome machinery. While micronemes are broadly similar in that they required for motility and attachment functions, they are often quite specialized (Kafsack et al., 2009; Mital et al., 2005; Sheiner et al., 2010). For example, AMA1 has a role in formation of the tight junction, but is dispensable for motility (Mital et al., 2005). Subsequent studies have pinpointed AMA1 as a key microneme protein that forms in complex with rhoptry proteins RON2, RON4 and RON5 and together they comprise the ‘tight junction’ or ‘moving junction’, which is the interface of the parasite and the host cell (Tonkin et al., 2011). Likewise PLP1 has a role in egress, but not in invasion of motility (Kafsack et al., 2009). Specifically in regard to motility, the microneme protein facilitates attachment to a host substrate and move forward (Huynh and Carruthers, 2006). MIC2 has an extracellular tail region which is exposed to a host cell surface and an intracellular domain which becomes attached to the actin cytoskeleton through the glideosome complex. MIC2 is believed to be the main microneme protein which is mediates attachment to the glideosome complex and on which the parasite gains traction to move forward. Once this movement is completed, MIC2 is shed and left on the cell substrate. MIC2 is the homologue of the TRAP protein in Plasmodium species which also has been shown to have a role in connecting the motor to the host surface of human erythrocytes (Moreira et al., 2008; Sultan et al., 1997).

What this highlights, is that there is a clear specialization of function of microneme proteins. This is consistent also with studies that show that subsets of microneme proteins have been differentially trafficked through the parasite secretory system. For example, microneme proteins MIC3, MIC8 and MIC11 both depend on Rab5A and Rab5C for correct trafficking (Kremer et al., 2013) . However, other microneme proteins such as AMA1 and MIC2 are not affected by mutants of these partiular

21 Rabs (Kremer et al., 2013). This shows that there is clearly a specialization of a subset of microneme proteins and that there are different types of microneme vesicles which may serve different functions at specific points in the lytic cycle. It is curious to see that AMA1 and MIC2, despite having differing roles in motility and attachment, were not differentially affected, however it is possible that there is another mechanism of vesicle sorting that is responsible for differentiating MIC2 and AMA1 vesicles that has yet to be discovered. Alternatively, the defect may not be at the level of sorting but rather vesicle release.

The microneme protein pecifically responsible for initiating egress from a host cell is PLP1 (Kafsack et al., 2009). PLP1 is a microneme protein that is classified as a perforin-like protein. It possesses a membrane attack complex that is responsible for tearing membranes apart (Kafsack et al., 2009). When a group of parasites signal that they are ready to egress from a host cell, microneme secretion is initiated to prepare for extracellular motility processes and PLP1 is the specific microneme responsible for piercing the host cell membrane for egress . PLP1 KO parasites were less able to efficiently egress from host cells (Kafsack et al., 2009). PLP1 KO cells could be seen under the microscope to form excessively large parasitophorous vacuoles and only emerged from the host after the host was presumably physically unable to hold such a large vacuole (Kafsack et al., 2009). Invasion and other motility related processes appeared normal, showing that PLP1 was not required for host cell entry (Roiko and Carruthers, 2013). This makes sense because the tight junction is quite an elaborate structure that allows that parasite to move seamlessly into the host cell, but that then begs the question of why PLP1 does not destroy the host cell upon entry.

Subsequent studies of PLP1 activity found the protein was differentially active under different pH conditions (Roiko and Carruthers, 2013; Roiko et al., 2014). PLP1 was found to be more active under basic pH and this activity decreased as the pH was lowered. The host cell physiology dictates that the interior of a mammalian fibroblast is typically more basic than the extracellular medium (Kafsack et al., 2004). The reason for this is related to the mechanism of the fibroblast to maintain homeostasis using a sodium/potassium pump to maintain high intracellular potassium and low sodium (Hopp et al., 1992). Similarly high potassium has also been found to hinder extracellular motility related processes in Toxoplasma as well as Plasmodium (Bansal et al., 2013; Kafsack et al., 2004). This provides an explanation for why PLP1 doesn’t pierce or destroy the host cell membrane upon invasion, which is because the PLP1 is less active in the acidic extracellular environment. Interestingly, it was also found that decreasing pH increased overall microneme secretion in Toxoplasma, showing that the secretion factors required for extracellular processes are secreted in conditions which mimic the extracellular environment. PLP1 secretion was also increased during these conditions which was not unexpected, but presumably its loss of activity is enough to avoid damaging host entry despite showing increased secretion. Taken together, these data show a highly specialized set of secretion factors which are segregated and compartmentalized based on their function but which also have some shared trafficking determinants but where function is modulated by virtue of their differential activities or interacting partners. In accordance with this specialization it has been shown that there are separate pools of microneme proteins which are dependent on particular types of Rabs (Kremer et al., 2013). Despite some compartmentalization, it is not fully clear whether Toxoplasma secretes a ubiquitous mixture of micronemes which operate correctly according to the extracellular environment or if Toxoplasma can differentially secrete certain micronemes upon particular signals.

22

1.3.3 Rhoptries,

Rhoptries are another type of secretory organelle and are different to micronemes in that they are only secreted during the invasion stage of the lytic cycle, and not required for motility (Mueller et al., 2013b). Early studies of broad classes of secretion factors found no evidence of rhotpries being able to secrete in the extracellular medium (Carruthers and Sibley, 1999). Morphologically, rhoptries are attached and inserted through the apical complex and occur as two compartments, the rhoptry bulb and the rhoptry neck (Mueller et al., 2013a). This terminology was established after the discovery of a specific class of rhoptry proteins which localized to the rhoptry neck (RONs), but not the bulb whereas previously identified proteins such as ROP1 localized to the full length of the organelle (Alexander et al., 2005; Lebrun et al., 2005). The discovery of the RON proteins also led to the discovery of the association of the micronemes upon invasion to form the structure we now call the tight or moving junction (Alexander et al., 2005; Bradley et al., 2005; Lebrun et al., 2005). The tight junction is formed by association of the proteins AMA1, RON2, RON4,RON5 and RON8 which allow the parasite to bind the host cell and move into the host cell. The tight junction has been extensively characterized in terms of localizations and positioning of RONs and MICs but functional characterization by genetic ablation was not established until much later (Beck et al., 2014; Lamarque et al., 2014a). Disruption of the RON-AMA1 complex results in devastating defects in the parasites ability to invade host cells (Beck et al., 2014). Interestingly, the tight junction of Toxoplasma parasites shows some level of plasticity and redundancy also. Recent controversy surrounding the essentiality of the myosin motor MyoA and GAP45 prompted investigation of the AMA1 under a similar approach investigating compensatory mechanisms in the event of its loss. It was found that there was a microneme protein which was termed AMA2 (Lamarque et al., 2014a). More related proteins were found which were termed AMA3 and AMA4. Interestingly, functional knockdown of AMA1 causes increased expression of AMA2 and AMA3 to compensate for the loss of AMA1 (Lamarque et al., 2014b). Similarly, functional ablation of RON4 results in an increase in a RON4 paralogue named RON4L1 (Lamarque et al., 2014b). Although curiously, conditional ablation of RON5 results in severe growth defect and it does not appear presently that RON5 can be compensated for (Beck et al., 2014).

The armadillo repeat protein (ARO) was first identified in Plasmodium and functionally characterized in Toxoplasma (Cabrera et al., 2012; Mueller et al., 2013b). It is not a secreted protein but rather a protein that is part of the rhoptry organelle that facilitates correct positioning in replication and attachment to the apical complex (Beck et al., 2013). Characterized by a unique set of Armadillo- repeats, knockdown of ARO resulted in parasites that possessed intact rhoptry organelles but which were detached from the apical complex (Beck et al., 2013; Mueller et al., 2013a). This showed ARO has a role in rhoptry positioning resulting in rhoptry organelles were unable to secrete from the apical complex. The ARO iKD invaded with very poor efficiency, approximately 10%, which is less than MIC2 iKD (Huynh and Carruthers, 2006). The ARO ikD however was able to move freely, and egress normally which is a role which supports the importance of micronemes in these processes. The lack of such a defect is also consistent with the fact that rhoptries are only observed to be secreted into host cells during invasion and at no other time (Carruthers and Sibley, 1999). Currently there are no developed rhoptry secretion mutants in Plasmodium species so at present Toxoplasma provides an important model for apicomplexan invasion with respect to rhoptry protein function (Beck et al., 2013; Mueller et al., 2016).

An important discovery in host cell virulence was the identification of novel kinases that are capable of manipulating the host cell’s gene expression, which are secreted from the rhoptry contents. Most

23 notable are the rhoptry kinases ROP16 and ROP18 (Ong et al., 2010; Saeij et al., 2006; Taylor et al., 2006). ROP18 acts by targeting the Immunity Related GTPases (IRG) of the host cell and suppressing the immune response (Ong et al., 2010). ROP16 operates differently by modulating the host cell STAT3 and STAT6 in a signalling cascade that is not yet fully elucidated. ROP16 is also interesting in that it targets to the host cell nucleus where it operates (Saeij et al., 2007). This work shows us that rhoptries are actually multifunction organelles which are required for more than just the formation of the tight junction. The contents injected into the host cells are required to silence the host immune response and evade degradation, similar to the way in which dense granules have been shown to operate (Bougdour et al., 2014; Pernas et al., 2014). There are also a number of unusual rhoptry proteins whose function is not completely understood. ROP5 and ROP18 have been shown to be important virulence determinants which act together in mouse models to activate host IRGs but otherwise are not essential in vitro (Behnke et al., 2012). It is likely that many rhoptry proteins have evolved to preferably parasitize particular hosts.

1.3.4 Dense Granule Proteins.

Dense granules appear as membrane-bound, electron-dense circular compartments in EM images in the Toxoplasma tachyzoites and functional studies show that they have prominent roles in host cell manipulation and parasitophorous vacuole maintenance (Bougdour et al., 2013; Bougdour et al., 2014; Pernas et al., 2014). They were first seen in the earliest Toxoplasma EM studies (Gustafson et al., 1954) but not described until much later (Ogino and Yoneda, 1966). The correlation of dense granules and host cell manipulation is known from mutants in which KO’s are unable to correctly subvert the host immune response (Pernas et al., 2014; Rommereim et al., 2016) . GRAs were first identified in the late 1980’s from the identification of a major excretory antigen of extracellular tachyzoites (Cesbron-Delauw et al., 1989). The first described dense granual protein, GRA1 was initially named P23 and later renamed to GRA1 to be in accordance with the three letter nomenclature (Cesbron-Delauw et al., 1989). Subsequent studies proceeded to identify more of these dense granule proteins arbitrarily numbered GRA1-GRA9 which are now commonly referred to as ‘classical’ GRAs (Rommereim et al., 2016). With the exception of GRA1, these proteins all possess an N-terminal signal sequence composed of mostly hydrophobic residues, which are required trafficking to the PV via the secretory system (Chaturvedi et al., 1999; Hsiao et al., 2013). By microscopy of intracellular parasites, these proteins all localize variably to punctate granules within the parasite, or in the PVM or within the space between the parasite and the PVM. Most of these dense granule proteins have been knocked out and they appear to have defects in proper formation of the parasitophorous vacuole (Rommereim et al., 2016). For example, GRA2 and GRA6 knockouts show a defect in structural integrity of the PVM and fail to form the intra-vacuolar network of supporting filant structures that stabilizes the parasitophorous vavuole (Rommereim et al., 2016). The remaining dense granules are all not essential although some defects in parasite growth rate are observed for particular pairs of double knockout GRAs such as GRA4/GRA6, GRA3/GRA5 and GRA3/GRA7 (Arrizabalaga et al., 2004; Rommereim et al., 2016). MAF1 is a prominent example of a recently identified protein involved in manipulation of the host cell response, and this solved a long standing question concerning how particular parasite strains recruit the host cell mitochondria to the parasitophorous vacuole (Pernas et al., 2014). Type I and III strains are known to recruit the host cell mitochondria to presumably acquire energy and nutrients more easily and possibly to control calcium signalling through the mitochondria. MAF1 localizes to the dense granules and when this protein is knocked out, Type I and Type III strains both are unable to recruit host cell mitochondria. MAF1 was otherwise not essential, which is not unexpected given it is not essential in type II strains,

24 so while the mechanism responsible is now identified, the exact benefits of this recruitment remains elusive.

Consistent with the roles of dense granule proteins in host cell manipulation and immune response subversion, there are a handful of GRAs that have been shown to target to the host cell nucleus, in particular GRA16 and GRA24 (Bougdour et al., 2013; Braun et al., 2013). GRA16 has been shown to alter the p53 signal pathway of the host cell nucleus. It forms a complex with the ubiquitin protease HAUSP which is a regulator of the tumor suppressor protein p53 (Bougdour et al., 2013). No definitive explanation was obtained for the action of GRA16 on p53 but it was concluded that it likely inhibits HAUSP activity. Similarly, GRA24 also manipulates host cell proteins, specifically by triggering prolonged autophosphorylation of the p38a MAP Kinase protein (Braun et al., 2013). This correlates with the increase in synthesis of key inflammatory cytokines involved in a stress response. So apart from simply hiding from the host cell within a discrete parasitophorous vacuole, the parasite also needs to be able to manipulate the host cell to suppress genes associated with the activation of the host defence system and inflammatory responses.

One unique dense granule protein that has been recently identified is the GRA22 protein, which was able to be knocked out, but showed a severe defect in parasite ability to egress following treatment with calcium ionophore A23187 (Okada et al., 2013). This protein is involved in the maintenance of the parasitophorous vacuole as opposed to host response such as MAF1. GRA22 possesses an exquisite set of charged repeat elements reminiscent of the CRMPs seen in Tetrahymena cytoskeletal proteins (Gould et al., 2011). It is unclear at this stage what role GRA22 plays in the stability of the PV. However, given that it is present in the PV in replicating cells, there must be some interaction or cue to allow GRA22 to facilitate egress when required but this has not yet been demonstrated. It is curious that PLP1 is clearly not sufficient to break down the host membrane although GRA22 may serve to break down the nanotubular network (Travier et al., 2008) instead of piercing the host membrane (Kafsack et al., 2009). Consistent with this, GRA22 appears to have a single residue whose phosphorylation is calcium dependent (Nebl et al., 2011). This is consistent with the intimate timing of egress with increases in calcium release from within the parasites internal stores. This was the first evidence of an involvement of a dense granule protein in an egress related process and more importantly in a calcium dependent signalling process. It is known that GRA1 possesses a calcium binding domain but functional proof of a relevant phenotype remains elusive. There have been a number of Nucleotide TriPhosphate enzymes (NTPase) proteins that have been identified which target to the PV (Hsiao et al., 2013). These NTPases are yet to be knocked out or functionally characterized but one hypothesis could be that these NTPases might be necessary for processing of ATP from the host cell to generate energy for egress. Their presence in the PV might be a way to tightly regulate the amount of ATP energy reserves from the host cell so that the parasite has more control over when it needs to egress (Silverman et al., 1998).

In terms of trafficking, dense granule proteins have been found to have hydrophobic N-terminal motifs including similarity to the PEXEL system in Plasmodium falciparum (Hsiao et al., 2013). The trafficking motif in Plasmodium is a motif containing RxLxD/E, and Toxoplasma has some variation on this (Coffey et al., 2015; Hsiao et al., 2013). There are some dense granule proteins, however, such as GRA2 which have been shown to possess a signal peptide but which do not appear to possess a canonical PEXEL motif (Hsiao et al., 2013). Despite extensive divergence of dense granule proteins between Toxoplasma and Plasmodium, there are clearly some proteins with homologous functions. A notable example of this is GRA17 which, together with GRA23 mediate the movement of small molecules across the Toxoplasma PVM (Gold et al., 2015). The GRA17 knockout on its own caused deformed PV formation in Toxoplasma and these PVs often collapsed when they became

25 enlarged. Interestingly, the GRA17 knockout was able to be successfully complemented with Plasmodium EXP2, which is known to be a component of the PTEX translocon machinery which is responsible for processing PEXELated proteins destined to be secreted and exported beyond the parasitophorous vacuole. It was shown that GRA17 knockouts are unable to properly mediate the movement of small molecules across the parasitophorous vacuole membrane. This was done by use of a small fluorescent dye which was shown to not be transported across the PVM in GRA17 KO cells. The export of larger proteins such as GRA16 and GRA19 was unaffected, suggesting that GRA17 functions in the movement of small metabolites. There was no phenotype detected in the GRA23 KO, but overexpression of GRA23 was able to partially complement the GRA17 mutant and knockout of GRA23 in a cell line with highly reduced expression of GRA17 resulted in a strain which was avirulent in mice (Gold et al., 2015).A double KO of GRA17 and GRA23 together was unattainable, and the GRA17 KO was able to be complemented by expression of the PfEXP2 gene. Hence, the dense granules of Toxoplasma and exported proteins of Plasmodium share some similarities, as do the micronemes and rhoptry proteins, even though direct homologues aren’t immediately identifiable in the same way that MIC2/TRAP and the RON proteins initially were (Gold et al., 2015; Moreira et al., 2008).

1.4.1 Signalling in Toxoplasma secretion and invasion.

Given that different secretion factors are located within different organelles, there must be some sort of mechanism of regulation for the correct timing of their release and this is a topic of intense investigation in recent years. Early studies of the broad classes of secretion factors showed that micronemes secretion was able to be upregulated upon addition of a calcium stimulus, and ablated upon the sequestration of intracellular calcium using a calcium chelator (Carruthers and Sibley, 1999). In extracellular parasites, dense granule secretion, as indicated by GRA1, was insensitive to treatment with BAPTA-AM, and were not seen to be responsive to calcium stimulus either (Carruthers and Sibley, 1999). Rhoptry secretion was investigated using the marker for ROP1, and ROP1 was not seen to be secreted at all, suggesting that rhoptry secretion is timed specifically to be released during invasion (Carruthers and Sibley, 1997, 1999). These early studies formed the foundation of calcium signalling in all future studies in Toxoplasma and Plasmodium. Subsequent studies found that increases in calcium flux within the Toxoplasma parasite caused a general increase in microneme secretion and motility and subsequent egress from host cells (Carruthers et al., 1999b; Wetzel et al., 2004). Calcium stimulus was also found to trigger conoid extrusion, which is in accordance with its recently discovered role in parasite motility (Del Carmen et al., 2009; Graindorge et al., 2016; Mondragon and Frixione, 1996). These studies established the dogma of internal calcium release leading to activation of invasion processes. Complementary studies have also shown that elevated potassium levels are able to inhibit these processes (Kafsack et al., 2004). This is in accordance with the homeostasis of mammalian fibroblast which have a higher concentration of potassium in their cytosol than in the extracellular environment. The sudden drop in potassium has been shown to cause egress (Fruth and Arrizabalaga, 2007) however the mechanism linking specific potassium receptors to proteins responsible for internal calcium release has yet to be determined.

1.4.2 Calcium and Calcium-dependent protein kinases (CDPKs).

26 Protein kinase C (PKC) is a widely conserved Eukaryotic kinase which responds to calcium release triggered from upstream Phosphoinositol Phospholipase C (PI-PLC). However, while Toxoplasma has been shown to possess a homologue of PI-PLC (Bullen et al., 2016), Toxoplasma does not possess a clearly identifiable PKC homologue. Instead, Apicomplexa appear to have a set of plant like Calcium Dependent Protein Kinases (CDPKs) and have been shown to have diverse roles in plant signalling biology (Zhang et al., 2015; Zhang and Choi, 2001). PbCDPK4 was the first CDPK which was functionally characterized in Apicomplexa in the P. berghei organism (Billker et al., 2004). It was found to be essential for responding to a calcium signal to trigger male gametocytes formation, and thus mosquito transmission. Subsequent investigations of the CDPK class of enzymes has found that they are essential for only particular stages of cell cycle progression through the mosquito, liver and blood stages hosts.

Subsequently, interest in the CDPK class of enzymes in Toxoplasma increased and they were found to be essential in motility related processes (Lourido et al., 2010; Lourido et al., 2012). In Toxoplasma, the first CDPK to be functionally characterized was CDPK1, which was generated by a tetracycline inducible knockdown system (Lourido et al., 2010). Knockdown of CDPK1 resulted in a strong growth defect. The knockdowns were unable to be stimulated using calcium ionophore to egress out of host cells and showed a severe motility defect which the authors found was the result of an inability to secrete micronemes in response to calcium stimulus (Lourido et al., 2010). CDPKs have also been extensively studied using a chemical genetic approach using a class of Bumped Kinase Inhibitor compounds (Lourido et al., 2012) which originated from studies in yeast (Bishop et al., 2000; Snead et al., 2007). Mutation of the CDPK1 ‘gatekeeper’ residue at the kinase domain from a glycine (G) to a methionine(M) resulted in parasites which were insensitive to treatment with either 3MB-PP1 or 3-Br-PP1 kinase inhibitors (Lourido et al., 2010). Interestingly, it was found that CDPK1 inhibited cells were unable to respond to stimulus with cGMP agonist zaprinast, suggesting that CDPK1 shared similar pathways to Protein kinase G (PKG) (Lourido et al., 2012). This gatekeeper strategy was also used to manipulate CDPK3. In this, the active site of the CDPK3 gene was converted from an Methionine (M) to Glycine (G) residue to make it sensitive to 3MB-PP1 in the background of the CDPK1 M strain (Lourido et al., 2012). Interestingly, CDPK3 inhibition was found to be more effective at blocking A23187 triggered egress than CDPK1 inhibition (Lourido et al., 2012). CDPK3 inhibited cells could egress only slightly when induced with A23187, however were noticeably more responsive to zaprinast treatment, more so than CDPK1 inhibited cells. These data showed that stimulus of PKG could largely compensate for inhibition of CDPK3. Concurrent studies on CDPK3 found that CDPK3 could be knocked out completely despite reports that it was unable to be manipulated by inducible knockdown (Garrison et al., 2012; Lourido et al., 2012; McCoy et al., 2012). One of the most interesting aspects of these studies on CDPK3, was the finding that CDPK3 was not essential for invasion. This stands in stark contrast with inhibition of CDPK1 but understandable given CDPK3 could be knocked out completely. However, there are some inconsistencies with these data in that while there is no invasion defect, Lourido et al. reported a motility defect and microneme secretion defect, which would be expected to hinder invasion. This is inconsistent with McCoy et al. who found that Δcdpk3 was still able to show adequate motility similar to the wild type, as well as normal microneme secretion. The authors claim however that the Δcdpk3 parasites were unable to secrete micronemes in response to a buffer shift from high K+ to low K+ buffer. So it is likely that CDPK3 plays a role only in initiating motility in intracellular parasites. Indeed, Lourido et al. did shift from high K+ to low K+ for many of their experiments, so this could be a reason for the discrepancy. However closer examination on these different observations on the role of CDPK3 in secretion and motility has yet to be published.

27 CDPK1 and CDPK3 are the most well studied genes of a total of 9 canonical CDPK genes in Toxoplasma, the remainder of which have been found to be mostly redundant during the lytic cycle (Long et al., 2016). Of these tachyzoite non-essential kinases, only CDPK6 shows a mild growth defect (Long et al., 2016). CDPK7 is the only other CDPK that is essential in the tachyzoite stage (Long et al., 2016). CDPK7 localizes to diffuse cytoplasmic regions outside of the nucleus in both intra and extracellular parasites, and despite being a similar cytosolic localization as has been commented on for CPDK1 (Donald et al. 2006), their functions are vastly different (Morlon-Guyot et al., 2014). Knockdown of CDPK7 was found to have severe defects in replication, in particular as a result of loss of integrity of the centrosome and kinetochore structures (Morlon-Guyot et al., 2014). The resulting cells show improper polarity of daughter cells which grow side-by side and never fully separate as a result of incomplete segregation of organelles. CDPK7 was able to be knocked out in Plasmodium falciparum, and resulted in viable but severely deformed parasites (Kumar et al., 2014). Interestingly, PfCDPK7 was shown to bind PIP2 through a PH2 domain (Kumar et al. 2014), so this is likely a mechanism implicating CDPK7 in a signal chain involving phosphoinositides, similar to what was shown with PKG (Brochet et al., 2014).

Many of the Toxoplasma CDPKs can be knocked out in the tachyzoite stage, suggesting they are non- essential. However CDPKs in Plasmodium appear to be essential only for particular life stages so it is very likely that the same is true for Toxoplasma in other stages of the parasite life cycle. This stage specific essentiality was illustrated in the detailed knockout study of TgCDPK2 (Uboldi et al., 2015). TgCDPK2 was found to be non-essential for all stages of the tachyzoite lytic cycle, but it was found that these tachyzoites showed abnormal amyloplectin storage which was found to have an essential role in the metabolism of carbohydrates in the conversion to bradyzoite stage parasites (Uboldi et al., 2015). TgCDPK2 localizes to punctate granules in the tachyzoite, and the loss of TgCDPK2 resulted in abnormal carbohydrate storage. Quantitative proteomics of these tachzyoites showed numerous proteins potentially regulated by TgCDPK2 which are likely involved in carbodydrate metabolism including the pyruvate phosphate di-kinase. This study highlights the limited extent to which other stages of Toxoplasma have been studied and how it appears to be very similar to Plasmodium in terms of stage specific expression and essentiality of CDPKs.

1.4.3 The role of cyclic-guanosine-monophosphate (cGMP) and PKG.

A life-cycle stage specific requirement of CDPKs has been shown in Toxoplasma and this has also been elegantly demonstrated in Plasmodium. Another major kinase in apicomplexan biology is the cGMP-dependent Protein Kinase G (PKG), which appears to be a master regulator of CDPKs by controlling downstream calcium release from internal stores, to which CDPKs respond. This has been shown elegantly using the calcium biosensor GCaMP6 in which Toxoplasma tachyzoites treated with the PKG inhibitor coumpound 1 are unable to trigger downstream calcium release in response to stimulus with the cGMP pathway agonist, zaprinast (Brown et al., 2016; Sidik et al., 2016a). This was subsequently shown to be consistent in Plasmodium also, in studies which showed the cGMP agonist triggered calcium release in Plasmodium falciparum schizonts, ookinetes and gametocytes (Brochet et al., 2014). It is in the study of Plasmodium that the role of PKG was fully realized in its functional relation to CDPKs. In the mouse model Plasmodium berghei, inhibition of PKG using Compound 1 and Compound 2 (Donald et al., 2006) resulted in severe defects in motility, invasion and gametogenesis at every stage of the life cycle (Brochet et al., 2014), while CDPKs are required differentially at different life stages. For example, disruption of PbCDPK3 blocked ookinete motility in mosquito stages but was dispensable for sporozoite and blood stage (Siden-Kiamos et al., 2006). Similarly, CDPK5 was found to be essential development of blood stage schizonts but only in the late

28 stage schizonts (Dvorin et al., 2010). So, it appears that PKG acts as a master regulator that controls downstream calcium release from internal stores, which is conserved in both Toxoplasma and Plasmodium.

The current evidence of PKG function in Toxoplasma stems from treatment with PKG inhibitors Compound 1 and Compound 2 which originated from drug screening trials at Merck (Donald and Liberator, 2002; Wiersma et al., 2004). Despite TgPKG being the main target, these compounds were shown to have some affinity for Calcium Dependent Protein Kinases (CDPKs) at elevated concentrations, particularly TgCDPK1 (Donald et al., 2006). There is only a single copy of the gene encoding PKG in Toxoplasma and Plasmodium species (Donald et al., 2002; Donald and Liberator, 2002). Recombinant wild-type PKG was localized approximately to the IMC, but was described as having a cytosolic and peripheral localization suggesting it may localize to both the cytosol and the IMC (Donald and Liberator, 2002). Tachyzoites treated with Compound 1 present defects in motility and are unable to secrete micronemes in response to either ethanol or A23187 (Wiersma et al., 2004). The phenotype is very similar to that seen in TgCDPK1 mutants and suggests that they may be share some of the same signal pathway components as has been published elsewhere (Lourido et al., 2012). Treatment of Plasmodium invasive stages with Compound 1 blocks microneme secretion (Collins et al., 2013), which has been shown to block motility (Brochet et al., 2014).

Some of these shared components likely involved phosphoinositide (PI) signalling intermediates. The inhibition of PKG with Compound 2 was shown to result in a drop in the turnover of phosphoinositide lipid precursors (Brochet et al., 2014). In particular, ookinetes were investigated in the presence of Compound 2 and it was found that Compound 2 inhibition caused a decrease in the turnover of phosphoinositide (PI) into PIP2 and PIP3, so that inhibition results in less PIP2 and PIP3. PKG likely triggers downstream calcium release from internal stores in a lipid dependent manner by release of IP3 from processing of PIP2in Plasmodium sp. similar to other eukaryotic systems (Abdul and Butterfield, 2007). It is likely that this is linked to phosphatidic acid signalling since the phosphatidic acid precursor DAG is produced by PIP2 (Bullen et al., 2016), which has been linked to PKG signalling (Brochet et al., 2014). Interestingly, stimulation of blood stage parasites with zaprinast resulted in a decrease in the production of PIP2 and PIP3 from PI. So, blood stage parasites and ookinetes appear to have opposing effects on PI turnover when PKG is inhibited. It is possible that the source of PA and DAG might be different between stages and hence may be subject to regulation by different kinases, although this has yet to be fully investigated. It is unclear what this means but could be due to differential recruitment of partner kinases involved in the regulation of these processes, although it has yet to be shown how this might operate.

A similar study in Toxoplasma found enzymes responsible for the lipid-dependent secretion of micronemes involved the conversion of diacylglycerol (DAG) into phosphatidic acid by DAG kinase (DGK1). Diacylglycerol is a secondary metabolite that can also result from the breakdown of PIP2 into diacylglycerol and IP3, which is a signalling factor of ER calcium stores in eukaryotes (Silverman- Gavrila and Lew, 2002). So it seems that PKG regulates, or together with, PIP2 and phosphatidic acid dependent signalling factors (Bullen et al., 2016). Proteomic analysis of PKG phosphorylation in P. falciparum was performed by comparing wild type with Compound 2-treated cells produced a large set of proteins from diverse classes which were differentially phosphorylated upon treatment with Compound 2 (Alam et al., 2015) and complements similar proteomic studies in P. berghei (Brochet et al., 2014). These included glideosome components such as GAP45, PbMTIP (TgMLC1 homologue) and other glideosome components which is consistent with observations of reduced motility upon inhibition of PKG (Brochet et al., 2014). There were also proteins involved in vesicle trafficking such as VPS10, and DrpB (homologues of TgSORTLR and TgDrpB respectively). Similar experiments on

29 Plasmodium falciparum have shown similar results in which PfPKG was found to have quite a diverse range of proteins differentially regulated when treated with Compound 2. Both datasets from P. falciparum and P. berghei both appear to show differences in phosphorylation of the glideosome motor complex which is consistent with the observations of Compound 1 and 2 inhibiting motility. Taken together, the identification of compounds 1 and 2 have been immensely helpful in elucidating the function and phospho-proteome of this critical kinase in Apicomplexa.

1.4.4 Cyclic Adenosine monophosphate (cAMP) signalling. cGMP relegated signalling has been exteneisvely studied in Toxoplasma but less is known about cAMP and PKA signalling. Currently, the only known roles of cAMP signalling in Toxoplasma biology centres of the conversion of tachyzoites to bradyzoites. (Eaton et al., 2006; Kirkman et al., 2001). This was first identified using chemical agonists and inhibitors of cAMP and cGMP which were known to be involved in the stress response signal pathways for many other eukaryotes (Kirkman et al., 2001). Some cAMP-modulating compounds were found to have no effect on the Toxoplasma tachyzoite, but it was found that prolonged and sustained cAMP elevation led to an induction of bradyzoite conversion in Toxoplasma tachyzoites (Kirkman et al., 2001). Since then, further research has shown a role for multiple cAMP responsive PKA proteins in the conversion from tachyzoite to bradyzoite (Sugi et al., 2016). Interestingly, the compounds H-89 and Compound 1 which inhibit mammalian PKA and apicomplexan PKG respectively, were shown to induce bradyzoite differentiation (Eaton et al., 2006), which complement earlier studies using stable analogues of cGMP and cAMP (Kirkman et al., 2001). This fits in with the evidence that PKG is important for activating invasion related processes, so loss of PKG activity would result in parasites moving to a more sedentary cyst like state that have no need for invasive activities.

The study of cGMP in Toxoplasma has been quite extensive owing to the discovery of Compound 1 and 2 which strongly inhibit PKG and the fact that there is only one copy of PKG in the genome. In contrast, very little has been done on the study of PKA or adenylate cyclases in Toxoplasma so the cAMP signalling system in Toxoplasma and almost nothing is known about cAMP outside of bradyzoite differentiation. In comparison, there are a handful of studies in Plasmodium which implicate cAMP in motility and invasion related processes (Dawn et al., 2014; Lasonder et al., 2012). A phosphoproteome analysis of Plasmodium schizonts showed extensive phosphorylation of diverse proteins (Lasonder et al., 2012). The role of PKA was investigated because the phopshorylated peptides which were detected of detected phosphorylation events matched with those commonly phosphorylated by PKA. However this is largely speculative as it is based on BLAST data based on other possibly unrelated signalling systems. There is also no control PKA mutant cell line to corroborate the findings.

So, PKA appears to be active in Plasmodium and additionally has a role in secretion. The first study to examine such effects of cAMP looked at release of microneme proteins in Plasmodium berghei sporozoites (Ono et al., 2008). They found that treatment with cAMP signalling agonists triggered release of secretion factors in P. berghei sporozoites. However, similar studies on Toxoplasma found that similar cAMP manipulating compounds had little or no effect outside of the effect on bradyzoite transition (Kirkman et al., 2001). Despite this, one study in P. falciparum merozoites found that inhibition of cAMP kinases caused a block in secretion of micronemes (Dawn et al., 2014). A dominant negative mutant using a PKA regulatory subunit (PfPKAr) found that when PfPKAr was perturbed, it caused P. falciparum merozoites to be defective in secretion of micronemes as indicated by AMA1 release (Dawn et al., 2014). Complementary experiments using chemical agonists

30 and inhibitors of cAMP and PKA pathway showed similar results, whereby inhibition of PKA resulted in inhibition of microneme secretion and addition of cAMP agonists recovered this inhibition. Interestingly, addition of DiB-cAMP to the media was able to stimulate PfPKAr cells to secrete micronemes so this shows that cAMP promotes microneme secretion. However, it is still unclear how the parasites would be able to respond to cAMP without an active PKA, unless it is another kinase that is able to respond to this stimulus.

A separate study found that cAMP was responsible for integrity of cell shape in Plasmodium gametocytes (Ramdani et al., 2015). It was found that cyclic nucleotide phosphodiesterase inhibitors were able to manipulate cell shape by maintaining the rigid structure of immature gametocytes prior to maturation. This inhibition caused an accumulation of unprocessed cAMP in the cytosol and maintained the rigid structure and so during infection, the spleen would be able to filter out these gametocytes before maturation. This makes it easier for the human spleen to filter out these parasites. The authors modelled this using a filter unit with a specific pore size which served as a “synthetic spleen”, in which the treated parasite were blocked more easily. In light if this evidence, cAMP appears to contribute to modulating developmental changes in the cytoskeleton. This is unsurprising given the well-studied contributions of cAMP in mammalian cilia and eukaryotic flagella in general, although the authors do not describe any such impact as either present or absent in gametocytes. Taken together, these studies show that cAMP has quite diverse roles. It clearly has a role in reshaping the cytoskeleton in response to a life cycle development as indicated by Toxoplasma bradyzoite transition and Plasmodium gametocytes but also a role in development and motility of Plasmodium schizont and merozoites stages. But much more work is needed to identify roles of cAMP in Toxoplasma beyond bradyzoite conversion. The PKA and cAMP proteins are much more abundant than PKG and so the mechanism is likely much more complicated. It is also not clear at this stage whether the mechanism of cAMP function is conserved from Plasmodium to Toxoplasma.

1.4.5 Conclusions and perpectives:

The Toxoplasma parasite possesses an arsenal of secretion systems to successfully manipulate its host. The current known proteins involved in the regulation of these processes are primarily CDPKs and the PKG protein. The cytoskeleton of the Toxoplasma parasite provides a scaffold for the motility and invasion apparatus which is regulated by the aforementioned kinases. The apical complex in particular is a critical cytoskeletal feature. It seems to appear at a functional junction in that secretion factors are secreted through the apical complex, and the glideosome relay is initiated at the apical complex as well. The apical complex is a multifunction invasion tool with evidence of roles in signalling, secretion and mechanistic movement required for inavsion, that is key to the success of Toxoplasma as a dominant worldwide pathogen. The goal of this thesis is to functionally characterize some of the few apical complex proteins that are known in order to better understand the processes behind some of these invasion processes.

31

32 Chapter 2: Investigations of the location and behaviour of the novel apical complex protein RNG2. 2.1 Introduction.

The apical complex is the uniting feature of all apicomplexan parasites and the namesake of the group. The cytoskeleton is broadly separated into two parts, an apical complex, and an Inner Membrane Complex (IMC) (Anderson-White et al., 2012). The apical complex is comprised of an apical polar ring and a mobile conoid that can protrude partially ahead of the polar ring (Hu et al., 2006). The apical polar ring nucleates several sub-pellicular microtubules which run most of the length of the parasite along the IMC (Tran et al., 2010; Tran et al., 2012b). The apical complex can be considered as a modified pellicle cytoskeletal structure, and is the site of secretion of numerous secretion factors necessary for attachment to, invasion into, and egress from, host cells (Carruthers et al., 1999a; Kafsack et al., 2009). The apical complex is also important in daughter cell replication as it is the first structure to form in nascent internal daughter buds, from which the rest of the cytoskeleton develops, and organelles segregate (Hu et al., 2002a).

In order to investigate apical complex proteins, such proteins had to be identified for targeted localization. This proved to be quite difficult because of the cryptic nature of apical complex proteins in that they lack any conserved sequence homology and motifs. RNG1 was the first identified polar ring protein found by patterns of the Toxoplasma invasion cycle (Huynh and Carruthers, 2009). It was later followed up with characterization of the protein behaviour in the parasite cytoskeleton, but a comprehensive knock-down has yet to be done (Tran et al., 2010). RNG1 is a tiny protein of 81 amino acids, with no known functional domains. It is rich in prolines so possibly it is rigid with many turns in the secondary structure, although no biochemical analysis of RNG1 has been performed to validate this. It has clear homologues in closely related Sarcosystis and Eimeria parasites, but nothing outside of these groups including Plasmodium species (Tran et al., 2010).

A focused strategy for finding apical complex proteins involved isolating the Toxoplasma conoid and associated microtubules by detergent extraction (Hu et al., 2006). Included in these were the core eukaryotic centrin proteins, Centrin1 and Centrin2. Also, of specific interest to the apical complex were the proteins CAM1, CAM2 and DLC which were localized to structures in the apical complex. Immuno-EM of CAM1 and CAM2 suggested that they localized somewhere in the conoid but nothing more specific was shown. This approach isolated the apical complex and sent it through proteomic analysis to identify apical complex proteins. Curiously, though, centrins 1 and 2 were also identified in the results which do not appear to have an apical localization. However, Centrin2 has since been reported to have an additional apical complex localization as well as to the centrosome and peri- microtubular annuli (Anderson-White et al., 2012). MORN1 was also identified in this study and some evidence has been shown to suggest it may have a feint apical localization. It is most clearly visible at the basal ring and the perinuclear centrocone but may also be localized at the apical complex MORN1 is the only one of these to have been functionally characterized and functional ablation exhibits a unique phenotype in which the daughter cell replication is severely perturbed, in particular the defect appears to interfere with the organization of the mitotic spindle (Heaslip et al., 2010; Lorestani et al., 2010). Due to these severe replication defects it is difficult to gauge whether MORN1 has a role at the apical complex. This study also is limited because it would not identify proteins that are membrane bound which would be torn off in the detergent extraction.

33 The only other published protein to localize to the apical polar ring is a CRMP protein identified as part of a large scale screen for cytoskeleton protein homologues of the Tetrahymena pellicle (Gould et al. 2011). The protein (from here on known as, RNG2), appears to localize to the daughter cells as well as the mature mother cell. In sharp contrast to RNG1, it is a mammoth sized protein of 2595 amino acids and a predicted molecular mass of 295 kDa. Along with RNG2, the gene encoding protein TGGT1_52880 (from now on, termed ViralA2), was localized to the apical complex as well, though it does not appear to be a ring shape, and it’s localization profile appears more similar to the protein TgAKMT (Gould et al., 2011). It is also unknown if many of the aforementioned apical complex proteins such as CAM1 and CAM2 localize to the same spot on the conoid, or if some are at the polar ring, or if some are in between. There has been increasing interest in the growing pool of apical complex proteins and in particular efforts have focused on trying to piece together a 3D model of the apical complex (Anderson-White et al., 2012) from the growing pool of these proteins.

34 2.2 Results.

2.2.1 Bioinformatic analysis of the RNG2 protein.

The RNG2 protein is a large protein of 2595 amino acids. It has no predicted conserved motifs. Interestingly, both N and C termini of RNG2 are rich in prolines while the central region has almost no prolines (Figure 2.1A). Conversely, the central region is relatively rich in lysine, but the termini has comparatively very little lysine (Figure 2.1A). The charged lysine core is consistent with the initial discovery of RNG2 as a CRMP protein, and the highest score for repetition is found within the lysine rich central region (Figure 2.1B). While RNG2 has no conserved functional domains it is predicted to form extensive coiled coil structures from amino acid 550 to 2150 (Figure 2.1C). Interestingly, the coiled coil domains are predicted to be form exclusively within the central lysine rich region of RNG2, and not within the proline-rich termini (Figure 2.1C). The RNG2 protein is also predicted to have at least 2 predicted palmitoylation sites, and up to 8 with the most lenient (CSS-Palm 3.0) (Ren et al., 2008). However, a recent attempt at a comprehensive ‘palmitoylome’ did not detect any palmitoylation on the RNG2 protein (Foe et al., 2015). RNG2 has also been shown to be heavily phosphorylated at the N-terminal region, with one single phosphorylation site being calcium dependent, and comparatively few phosphorylation sites at the C-terminal region (Nebl et al., 2011; Treeck et al., 2011).

2.2.2 RNG2 localization in daughter cell formation:

Timing and localization of RNG2 protein appearance was investigated within the cell cycle by co- localizing with known proteins within the T. gondii replication cycle. It was previously shown that RNG2 appears in budding daughter cells, indicative that it appears early in the cell cycle (Gould et al., 2011). However, it was not known how early RNG2 appeared in the cell cycle and whether it localized to any other structures. To further investigate this, RNG2-HA was co-localized with an antibody to IMC1 (Figure 2.1D). RNG2 was seen to appear very early in the replication cycle before the daughter cell buds appeared (Figure 2.1D). This tells us that RNG2 first appears sometime before the daughter IMC has developed substantially, and nothing more relative to the centrosomes or mitotic spindle.

35

Figure 2.1, Bioinformatics analysis of RNG2 protein and observation of behaviour in the tachyzoite cell cycle.

A) Schematic of RNG2 showing proline and lysine rich regions. B) Predicted CRMP repeats within the RNG2 protein analysed by RadarRepeat software. C) Prediction of coiled coils within the RNG2 protein by COILS software. Coiled Coil region appears in the central region of the RNG2 protein. D) Co-labelling of RNG2-HA3 with anti-IMC1 during the tachyzoite replication cycle. A 3xHA tag was introduced onto the C terminus of RNG2 by 3’ replacement and hereafter termed RNG2-HA3

36 (Gould et al. 2011). Cells were probed with anti-HA and anti-IMC1. Scale bar = 3μm E) Co-labelling of RNG2-HA3 with anti-Centrin1 during the replication cycle. Cells were probed with anti-HA and anti-Centrin1. White arrowheads point to centrosome and residual localization of RNG2 at the centrosome. Scale bar =3 μm F) Co-labelling of RNG2-HA3 with transiently expressed 2xMyxc- MORN1. Cells were grown 30 hours before fixation and probed with anti-HA and anti-myc. White arrowhead labels the centrocone and black arrow with white outline labels the basal complex. Scale bar = 3μm G) Co-labelling of RNG2-HA3 and CAM1-Myc during intracellular replication stages. Cells were probed with anti-HA and anti-Myc. H) mRNA expression profile of RNG2 gene during the intracellular tachzyoite life cycle based on Behnke et al. 2010. Scale bar = 3μm

To more specifically identify the exact point when RNG2 first appears in the cell cycle, I co-stained with an antibody to centrin1, which serves as a marker for the centrosomes (Figure 2.1E). When co- localized with anti-centrin1, the centrosomes of most cells can be seen as a single dot, indicative of G phase (Figure 2.1E). When centrosomes first divide, a marker for S phase of the parasites, RNG2 is still not visible apart from in the mother cell apical complex (Figure 1E, second panel). However, subsequent to this RNG2 appears as two diffuse dots that each localize to the separate centrosomes (Figure 1E, third panel). Interestingly, some residual labelling of RNG2 can be seen to co-localize with the centrosome (Figure 2.1E, 4th panel). Co-localization of MORN1 corroborates this finding in which RNG2 can be seen to appear as diffuse dots around the time-point where the mitotic spindle develops indicated by centrocone duplication (Figure 2.1F). The residual labelling of RNG2 can also be seen slightly in late daughter cells between the MORN1 labelled centrocone and the RNG2 labelled apical complex. (Figure 2.1F). Taken together, this shows that RNG2 appears at the centrosomes shortly after their duplication but before the centrocones have fully separated. This is in accordance with mRNA expression data which shows that RNG2 expression is upregulated during the S phase. (Figure 2.1H).

To gain further insight into the relative appearance of apical complex proteins in the cell cycle, RNG2 was co-localized with other apical complex markers. RNG2-HA was co-localized in a transgenic cell line endogenously expressing CAM1-Myc. When co-localized with CAM1-Myc, it was seen that RNG2 appears much earlier also than CAM1 (Figure 2.1G). So CAM1 is a late stage marker for daughter cell conoids.

37

Figure 2.2. Co-staining of apical complex proteins.

A) Co-labelling of RNG2-HA3 with CAM1-Myc in extracellular parasites, where conoid is i),ii) extruded, and iii) retracted. Extracellular cells were smeared on coverslips fixed, and probed with anti-HA and anti-Myc. B) Co-labelling of RNG2-HA3 with transiently expressed RNG1-Myc in intracellular parasites. Cells were grown on host cells on coverslips 30 hours before fixation. Cells were labelled with anti-HA and anti-Myc. Scale bar = 3μm. C) Co-labelling of iΔHA-RNG2 with transiently expressed RNG1-Myc in intracellular parasites. Cells were grown on host cells on coverslips 30 hours before fixation. Cells were labelled with anti-HA and anti-Myc. Scale bar = 3μm. D) Co-labelling of both epitopes of the dual tagged iΔHA-RNG2 -Myc intracellular parasites. iΔHA-RNG2 -Myc cells were grown on host cells and labelled with anti-HA and anti-Myc. Scale bar = 3μm.

38 2.2.3 Constructing a 3D model of the apical complex:

At the apical complex, CAM1 localizes posterior to RNG2-HA (Figure 1G) in intracellular parasites. However, it is known that CAM1 localizes to the mobile conoid so it may be that this localization changes in extracellular parasites. When conoids are not extruded, CAM1 can be seen to co-localize with RNG2-HA, but when the conoid is extruded, CAM1 can be seen to move further ahead of the RNG2-HA (Figure 2A). This confirms previous evidence that CAM1 localizes to the conoid (Hu et al., 2006), and suggests that RNG2 may localize to the apical polar ring. Some proteins have been shown to localize to the apical polar ring (Tran et al., 2010), while others have been only broadly shown to be conoid localized (Hu et al., 2006). In an effort to build up a 3D-model of the apical complex, I sought to co-localize RNG2 with other known apical complex proteins. To confirm that RNG2 localizes to the apical polar ring, RNG2-HA was co-localized with transiently expressing RNG1-Myc (Figure 2 B-D). It was seen that RNG2-HA co-localized very well with RNG1-Myc, possibly with RNG2- HA slightly anterior to RNG1-Myc (Figure 2B). This suggested that RNG2 localizes to the apical polar ring. However, when RNG1-Myc was co-localized with a cell line expressing N-terminal HA-tagged RNG2, it was found that the HA epitope of HA-RNG2 localized slightly posterior to RNG1-Myc (Figure 2.2C). This suggested that the N and C termini of RNG2 locate to different parts of the apical complex relative to a fixed polar ring marker (RNG1), and suggested that the two termini of RNG2 localized to different parts of the apical complex.

Figure 2.3, Localization of the N and C termini of RNG2 protein by 3D-SIM microscopy.

A) Labelling of two termini of dual tagged RNG2 with N-terminal HA and C-terminal Myc, in the cell line iΔHA-RNG2 -Myc using 3D-SIM microscopy in i),ii) intracellular and iii),iv) extracellular parasites. N terminus was probed with rat anti-HA(green). C-terminus was probed with mouse anti-cMyc, (red). Parasites were imaged intracellular to visualize the conoid retracted, and extracellular parasites were treated with calcium ionophore (A23187) to induce conoid protrusion. Parasite were stained with antibodies to GAP45 to visualize the parasite body (blue) Scale bar = 500nm B) Western blot of either iΔHA-RNG2 -Myc parasites or RNG2-HA3 parasites. Blots were labelled with either anti-HA or anti-Myc. All tagged versions of each RNG2 protein were a similar size, above 188kDa.

39 To further investigate this, a dual tagged HA-RNG2-Myc cell line was generated. Labelling of the two tags simultaneously in intracellular parasites showed that the N-terminal HA localized posterior to the C-terminal Myc tag (Figure 2D), reinforcing what was seen in RNG1-Myc/HA-RNG2 (Figure 2C). This suggested that the C-terminal RNG2 localized to the polar ring and that the N-terminal localized somewhere posterior, possibly to the mobile conoid. To confirm this, the HA-RNG2-Myc cell line was visualized with super-resolution microscopy to localize the proteins with greater resolution. The C- terminal Myc was found to localize at the border of the apex of the parasite as indicated with GAP45 (Figure 3A), while the N-terminal HA localized somewhere posterior to this, suggesting that it may localize to the retracted conoid. To test this, extracellular parasites were imaged with conoids extruded and it was found that the N-terminal HA tag moved anterior to the C-terminal tag (Figure 3A). This confirmed that the N-terminus of RNG2 localized to the mobile conoid, while the C- terminus localizes to the apical polar ring. The cell lysates were analysed by western blot to confirm that the same RNG2 protein has been tagged (Figure 2.3B). RNG2-HA, and HA-RNG2-Myc all ran at the same size above 180 kDa consistent with the same large RNG2 protein having been tagged (Figure 2.3B). Taken together, the two termini of RNG2 localize to different parts of the apical complex.

In an effort to extend a 3D model of the apical complex I co-localized HA-RNG2-Myc with transiently expressing apical complex markers, in particular RNG1-GFP and CAM1-GFP (Figure 2.4). Parasites were then examined for transient expression of GFP from either RNG1 or CAM1 samples, and the parasite body was labelled with GAP45. Here it can be seen that RNG2-Myc co-localizes with RNG1 confirming that the RNG2 C-terminus is anchored to the apical polar ring. HA-RNG2 localizes posterior to RNG1-GFP and RNG2-Myc in retracted conoids, but anterior to RNG1-GFP and RNG2- Myc in extruded conoids. This confirms that the N-terminus of RNG2 localizes to the mobile conoid. Similarly, CAM1 can be seen to localize in a similar region to RNG2-Myc in retracted conoids (Figure 2.4E), but anterior to RNG2-Myc in extruded conoids (Figure 2.4F). In accordance with this, the localization of CAM1-GFP relative to HA-RNG2 never changes, with CAM1-GFP at the apex of the conoid and HA-RNG2 at the base or in the middle of the conoid. This suggests that they are attached to the same solid structure. In addition to this, we can see that both the N and C-terminal RNG2 form perfect rings, so likely form a tube of some sort (Figure 2.4). In addition to this, it can be seen that CAM1 forms a ring structure, which was not previously reported (Figure 2.4D-F).

40

Figure 2.4. Super-resolution 3D-SIM microscopy of apical ring proteins RNG1, RNG2 and CAM1.

Localization of iΔHA-RNG2 -Myc with transiently expressed RNG1-GFP (A, B, C), and CAM1-GFP (D, E, F) using 3D-SIM microscopy. RNG1-GFP (blue) or CAM1-GFP (blue) were co-stained with anti-HA (green) and anti-Myc (red) to label the N and C termini respectively of RNG2. Anti-GAP45 was used to visualize the parasite body (greyscale, right column). Individual channels are shown in greyscale and the parasite body is indicated by dashed lines in the merge. Scale bar=500nm.

41

42 2.3 Discussion.

2.3.1 RNG2 is the earliest known protein to appear at the apical complex.

The search for apical complex proteins has been slow in the absence of conserved domains or trafficking motifs. Many of the proteins localized to these structures have no conserved motifs or domains that would make us think that they target to the apical complex and each protein identified has quite diverse sequences.

The discovery of RNG2 has yielded new insights into the biology of the apical complex and its formation. RNG2 is now the earliest known apical complex protein to appear in the early dividing daughter cells, appearing much earlier than the previously described RNG1 (Katris et al., 2014; Tran et al., 2010). Early studies on tagged tubulin showed that the tubulin core of the conoid likely appears early in the daughter cell buds (Hu et al., 2002a). It may be that RNG2 is required to be positioned very early in the replication process in order to provide a scaffold around which the apical complex is built. It is possible that IMC15 may appear slightly earlier or at around the same time, but this has not yet been determined.

2.3.2 RNG2 and the centrosome.

The close association of RNG2 and the centrosome further establishes the role of the centrosome and basal bodies in the early formation of the apical complex. Several other proteins have also shown a link between the centrosome and the apical complex (de Leon et al., 2013b; Francia et al., 2012). SFA2 and SFA3 have both been shown to form a linker between the centrosome and the apical complex during replication. The SFA2/SFA3 study provided the first molecular evidence that a homologue of an algal flagella root protein localizes to the apical complex, and connects the apical complex to the centrosome in developing daughter cells (Francia et al., 2012). Similarly, another study has shown that a protein closely related to the centrosomal protein SAS6, termed SAS6-like (SAS6L), localizes to the conoid in Toxoplasma (de Leon et al., 2013b). The SAS6 protein has been shown to be involved in wider eukaryotes in organizing the correct 9+2 configuration of microtubules for normal flagella assembly and localizes to the basal bodies of centrosomes (Nakazawa et al., 2007; van Breugel et al., 2011). In a similar way, these observations of RNG2 of the apical complex first forming in close proximity with the centrosome fits with both of these studies and shows that the centrosome/centriole clearly serves as a platform for nascent daughter apical complexes (Figure 2.1E). This could be seen with co-localization of MORN1, in which there is some residual RNG2 labelling at the centrosome, which is then followed by the MORN1 labelled centrocone. Forming a new daughter cell is clearly an elaborate process and requires sequential addition of many proteins onto an existing scaffold. Proteins like CAM1 and RNG1 appear in later stages compared to RNG2, reinforcing a defined order of assembly (Figure 2.1G). Once the daughter cells have been formed and the organelles partition themselves into the nascent buds, the centrosome is closely associated with the daughter apical complex and the centrocone follows behind pulling the divided organelles (Figure 2.1F). Interestingly, identification of proteins by CRMP homology and from the conoid proteome list have each independently identified a number of centrosome proteins. The CMRP list identified ME49_090620 and ME49_012880 (Gould et al., 2011) while the conoid proteome study identified centrin1 and centrin2 (Gould et al., 2011; Hu et al., 2006; Suvorova et al., 2015). Curiously, ME49_290620 (CEP250L1) localizes exclusively to the centrosomes (Suvorova et al., 2015), and it also possesses a lysine rich charged core, and proline rich termini, just

43 like RNG2. It is possible that the proline rich termini may serve to connect different cell structures in a similar way to RNG2 at the apical complex.

2.3.3 RNG2 connects the apical polar ring and the conoid at the apical complex.

The displacement of the two termini of RNG2 was quite unexpected and is something that could be analysed in detail with recent advances in super-resolution microscopy (Gustafsson et al., 2008). Interestingly, the two termini of RNG2 form separate rings, with the N-terminus at the conoid, and the C-terminus at the apical polar ring (Figure 2.2, 2.3, 2.4). Together, it appears that RNG2 forms a collar that links the apical polar ring to the conoid, a model for which is shown in Figure 2.5. It is possible that the proline-rich ends serve to form some sort of link to the respective attachment sites, while the lysine rich central CRMP region may facilitate other protein-protein interactions. Clearly, RNG2 must be quite flexible if the two termini can be seen to move relative to each other. Such a structure has never been documented before in Toxoplasma ultrastructure, but clearly the conoid and polar ring are intimately linked by RNG2. Given its localization, it is possible that RNG2 may serve to facilitate conoid extrusion. It is likely that the N-terminal ring is similar size or slightly smaller to fit through the C-terminus when the conoid is extruded. In some images it was apparent that the polar ring shrank upon conoid extrusion (Figure 2.4), so it is possible but more likely, the polar ring may be able to expand and contract to facilitate extrusion of the conoid and other secretion events of micronemes and rhoptries. However these observations are at the limits of the resolution of the 3D-SIM used in these studies. It currently cannot be excluded that the N-terminus might fit around the C-terminus when extruding the conoid. However given the model of the way the conoid fits within the apical polar ring, we consider this unlikely. It is also interesting that RNG2 appears to attach to the middle of the conoid in areas that do not appear to have any sort of pronounced features that can be seen with TEM. The conoid is usually visualized by TEM as having a criss-cross pattern of tubulin that represents the tight knit tubulin core, but no superficial structure can be seen that would suggest a protein like RNG2 should localize there. However, it is possible that the RNG2 attachment site is within the conoid or that the supporting structures outside the conoid are not stained well using traditional EM techniques.

The evidence here supports previous claims that RNG1 localizes to the polar ring, as the N-terminus of RNG2 can be seen to move relative to RNG1 (Figure 2.4). Also, these results supports the localization of CAM1 to the conoid, but additionally, that CAM1 forms a conoidal ring (Figure 2.4). Despite this, we cannot determine if CAM1 localizes to the preconoidal rings at the very tip of the parasite. Comparison with MyoH has showed that MyoH is more apical and likely localizes to the preconoidal rings (Graindorge et al., 2016). However we cannot rule out the possibility that they both localize to the pre-conoidal rings and that there is separation of these rings in terms of which is anterior and which is posterior. Amino acid composition of RNG1 has shown that RNG1 is very rich is prolines suggesting that it is quite compact but rigid, however no known functional motifs have been detected (Tran et al., 2010). In contrast, CAM1 and also CAM2 have strong matches for a calmodulin binding domain suggesting a role in responding to levels of calcium (Hu et al., 2006). Recent work has shown CalcineurinA, (ClnA), a normally diffuse cytosolic protein, shows an apical localization similar to CAM1 and CAM2 in extracellular parasites (Paul et al., 2015). Calcineurin was found to be important for regulating the attachment from microneme secretion for invasion. Though it is unclear at this time whether CAM1 serves the same attachment function as what was reported for calcineurin, because CAM1 and CAM2 have both yet to be functionally characterized.

44 2.3.4 The apical complex as a tube of rings?

As more proteins are localized to the apical complex, it is becoming increasingly apparent that many of these proteins are in fact rings when viewed with super-resolution microscopy. The SAS6L protein in Toxoplasma was initially reported to be a dot at the apical complex (de Leon et al., 2013b), but I and others have since shown that TgSAS6L appears as a ring shape somewhere in the conoid. (Wall et al., 2016). Similarly, I showed that PbSAS6L appears as a ring shape in P. berghei which was unable to be resolved using conventional epifluorescence (Wall et al., 2016). It is not clear if it localizes to the pre-conoidal ring but does at least appear to be at the apical portion of the conoid. Given that RNG2 N-terminus forms a ring somewhere in the middle of the conoid it is possible that SAS6L also forms a slightly subapical ring on this structure (Katris et al., 2014). Similarly, AKMT appears to form a ring shape in super-resolution images (Sivagurunathan et al., 2013). Taken together, this study on RNG2 and others are showing that the apical complex is most likely a tube of proteins as opposed to a macromolecular complex of assorted shapes.

Figure 2.5 3D schematic of RNG2 protein at the apical complex.

A) 3D schematic of inferred positions of the two termini (N-RNG2 and RNG2-C) of the RNG2 protein within the apical complex. CAM1 approximately marks the tip of the conoid and RNG1 marks the polar ring. The conoid is shown as either retracted or extruded. Sub-pellicular microtubules are omitted in A) to better visualize internal structures. B) 3D model of the complete RNG2 protein which forms a collar linking the conoid and polar ring. The collar is coloured orange and yellow to show the internal and external faces of the collar formed by the assembly of RNG2 proteins. This collar becomes inverted during conoid extrusion so that the internal face shifts its orientation possibly turning inside-out.

2.3.5 Apical complex and conoid loss in Plasmodium.

Despite the challenges of discovery apical complex proteins, in Toxoplasma there has been substantial progress on identifying an otherwise very cryptic set of proteins. This however is not the case for Plasmodium species where progress has been much slower, so comparatively fewer apical complex proteins are known. However, the SAS6L protein originally identified as a conoid protein in Toxoplasma has been localized to what appears to be a ring at the apical complex in P. berghei (Wall et al., 2016), which could be the apical polar ring. There are no reported cases of a conoid present in Plasmodium species, in fact members of the class Aconoidisada thought to have lost their conoids through evolution (Wall et al., 2016). That said, it is apparent that SAS6L is targeting to an apical ring.

45 However, it is interesting that SAS6L is a conoid protein in Toxoplasma is also present as an apical ring protein in P. berghei. This raises some interesting questions on the evolution of the apical complex, as it suggests that the apical complex has evolved considerably, and that a conoid protein persists in a Plasmodium species. It is also conceivable that the conoid or a conoid like structure persists in Plasmodium species and that this ring structure may be some sort of polar ring/conoid fusion. As seen with N-terminal RNG2, which localizes to an area of the conoid where no complex structures can be seen outside of the tubulin core, so it may be that in Plasmodium species, the conoid is not necessarily absent, but rather heavily reduced and difficult to visualize using traditional EM methodologies. It is interesting that SAS6L should be expressed only in particular life cycle stages suggesting that the apical complex differs in composition even within a species. It is then consistent to see the PbSAS6L protein present in the invasive mosquito stages, which would be morphologically more similar to Toxoplasma tachyzoites compared to merozoites. The sporozoite and especially the ookinete, are significantly larger than merozoites and have a visibly larger IMC (Baum et al., 2008). The fact also that SAS6L is non-essential in either Toxoplasma or P. berghei suggests that the apical complex probably has a high degree of plasticity and is functionally very adaptable. What the SAS6L protein shows us is that the apical complex components have been possibly been repurposed during evolution of Apicomplexan species, and that the apical complex is different even within a single species between multiple life stages.

46

47 Chapter 3: Functional Characterization of apical polar ring proteins

3.1 Introduction.

The identification of apical complex proteins is the first step to understanding this structure, however we need to understand what the function of these proteins is to understand their significance and the role of the apical complex in parasite biology. I then proceeded to functionally dissect them using inducible knock-down methods. Prior to this study on RNG2 (Katris et al., 2014), there was no published mutant of an apical polar ring protein. There was some published functional analysis data on RNG1, but which was limited to structural assays performed on the mCherry-tagged protein within the tachyzoite (Tran et al., 2010). In this experiment, the authors performed detergent extraction assays to pull apar the cytoskeleton and found that RNG1 attacehment to the apical complex was resistant to detergent extraction and thus highly stable. Even now, many fundamental questions of apical complex function remain unanswered. It is still untested what the function of the polar rings is. It is presumed that they act as a microtubule organizing centre for nucleating the sub-pellicular microtubules which provide rigidity and support to the IMC which is attached to it. Similarly, the conoid is nestled within the lumen of the polar rings and moves within it, but only recently was it linked to the function of motility through the MyoH study (Graindorge et al., 2016). I have shown that the conoid is intimately linked to the polar ring through the RNG2 protein, although it is possible that other proteins might contribute to this linkage. It is still not known exactly how the micronemes are secreted through the apical complex, and there is still disagreement over whether they are secreted at the base of the conoid, or through its aperture, which it is also the predicted site of rhoptry secretion (Paredes-Santos et al., 2012). The micronemes and rhoptries are nestled just underneath the apical complex and the polarized shape and linear arrangement of the nucleus and organelles in the secretory pathway make it reasonable to see how this facilitates forward movement through attachment and invasion (Graindorge et al., 2016; Mueller et al., 2013b). However the contribution of the apical complex to these secretion and motility processes is poorly understood and the lack of identified proteins has hampered efforts to functionally characterize this structure.

Prior to this study, the only functionally characterized apical complex protein was TgAKMT, a novel lysine methyltransferase which was shown to localize as a dot at the apical complex, perhaps within the conoid (Heaslip et al., 2011). This protein was found to have an egress and a motility defect, but interestingly no defect in microneme secretion. The evidence seemed to suggest that the apical complex may have a role in motility. It is unusual however that TgAKMT was seen to relocate away from the apical complex in a diffuse cytosolic location upon the initiation of motility, suggesting that it did not have a cytoskeletal function critical to maintaining structure and integrity. Instead it suggested a role for some sort of enzymatic signal that was linked to elevated calcium. Similar to this, the TgMyoH protein has since been found to be involved in initiating parasite motility by relaying a set of myosin light chains toward the IMC as the parasite moves forward (Graindorge et al., 2016). It showed a very similar phenotype to the TgAKMT mutant in which it was capable of secreting micronemes but was unable to initiate motility or egress. However, TgMyoH did not show the same reported redistribution of the protein in response to elevated calcium levels. Instead TgMyoH remained anchored to the conoid via its ATS microtubule binding domains and is very likely

48 to have a mechanical function, initiating forward force to allow the parasite to move forward, by relaying the anchor point along a complementary relay of associated myosin light chains.

I proceeded to further investigate the functional aspects of the apical complex by knockdown of two proteins with very interesting localizations, RNG1 and RNG2. RNG1 localizes to the apical polar ring, and RNG2 has been shown to localize to the apical complex connecting the conoid and polar ring in Chapter 2 of this thesis. These two proteins were chosen because no functional knock-down data existed previously for these two proteins and it was thought that this strategy would give insight into the function of the apical complex in some of these invasion processes.

The aim of this chapter was to investigate the function of the apical polar rings. Almost no apical polar ring proteins have been functionally characterized in Apicomplexa. I sought to functionally analyse RNG1 and RNG2 proteins by tetracycline inducible gene knock-downs to investigate the effects of loss of these proteins have on the parasites in the hope of elucidating some sort of function for the polar rings. Preliminary experiments prior to this thesis on RNG2 showed that a tetracycline inducible knock-down mutant had a severe growth defect when knocked down. This defect was loosely tied to the invasion process, but required much more detailed characterization to pinpoint the exact protein function. Nothing was yet known about the function of RNG1 as it was published as unable to be knocked out, although recently a genome wide CRISPR screen showed that RNG2 disruption had a severe impact on growth (-4.21) and RNG1 had very little impact (+2.54) (Sidik et al. 2016b) which correlates very well with the findings in this chapter. So, our hypothesis was that if we knocked these apical complex proteins, then we might see defects in either invasion or daughter cell replication given that the apical complex appears to be physically associated with these events.

49 3.2 Results.

3.2.1 Generation of RNG2 mutant.

The RNG2 gene is identified as ME49_244470 on ToxoDB. A mutant cell line was generated by promoter replacement as per RNG1 of the endogenous promoter with a tetracycline responsive promoter, T7S4 (Figure 3.1A). Primers targeting the T7S4 promoter and the native RNG2 locus were used to amplify a band of 2.4 kb, present in the mutant but not in the parental strain. The native RNG2 locus was amplified with primers targeting the excised RNG2 native promoter and the endogenous 3’ RNG2 gDNA. A single band was seen for the parental cell line but not he knock-down cell line. Primers for the mitochondrial Tic22 gene was used to confirm the presence of gDNA. After identifying that RNG2 had integrated into the correct locus (Figure 3.1B) it was then confirmed that the RNG2 gene expression was able to be successfully downregulated by addition of ATc, by western blot. Knockdown cells were incubated with ATc for 1-3 days, and one sample with no ATc treatment as a positive control. Cell lysates were probed for HA-RNG2 and RNG2 was expression almost completely shut down after 1 day of ATc treatment and undetectable after 2 days on ATc treatment. (Figure 3.1C). GRA8 labelling confirmed similar levels of parasites in all samples (Figure 3.1C)). This was also confirmed by IFA where iΔHA-RNG2 cells were seeded onto coverslips and treated for 24 hours with or without ATc (Figure 3.1D). Parasites were labelled with anti-HA and anti-IMC to visualize parasites and RNG2 expression could be shut down almost completely after 24 hours (Figure 3.1D).

3.2.2 RNG2 knockdown has a severe growth defect.

To test for possible growth phenotypes in the lytic cycle with RNG2 knockdown, a plaque assay was performed in which parasites were grown in the presence or absence of ATc over 8 days (Figure 3.1E). iΔHA-RNG2 parasites exhibited a clear growth defect (Figure 3.1E) , indicating that it was important for some stage in the parasite lytic cycle. The iΔHA-RNG2 cells with no ATc formed large plaques consistent with the parental controls, while the knockdown showed some plaques but which were very small. A replication assay was then performed by pre-treating iΔHA-RNG2 cells for 72 hours. Cells were given a 1 hour window of time to invade host cells before non-invaded cells were washed away. Cells were then grown for a further 24 hours with or without ATc. It was found that the RNG2 parasites were able to replicate daughter cells normally showing that RNG2 appears to be non-essential for daughter cell formation and development (Figure 3.1D) . Similarly, IFAs showing iΔHA-RNG2 together with IMC1 shows that the daughter buds form normally without RNG2 present. This shows that the parasites are not dependent on RNG2 to form the daughter cell scaffold, and RNG2 likely does not play a role in forming daughter buds.

50

Figure 3.1. Generation of inducible knockdown of RNG2 protein by promoter replacement.

A) Schematic of promoter replacement at the endogenous RNG2 locus (WT RNG2) with a tetracycline inducible knockdown promoter (T7S4) and 5’ 3xHA tag, under which expression of RNG2

51 could be shut down by addition of ATc (anhydrotetracycline). Black boxes represent exons and lines between them represent introns. This was integrated using the DHFR selectable marker. Primers P1- 3 show PCR amplifications sites used to validate the correct integration of the construct at the RNG2 locus. B)PCR of IΔHA-RNG2 mutant gDNA with screening primers shown in Figure 3.1A. P2-P3 amplified the integrated T7S4 promoter with RNG2 3’flank, while P2/P1A amplified the native RNG2 ORF. P4/P5 amplified the Tic22 gene and was used as a positive control for DNA. Primer sequences can be found in Table S1. C) Western Blot of iΔHA-RNG2 with ATc treatment. iΔHA-RNG2 cells were grown for 0, 1,2 or 3 days on ATc to observe down-regulation of the RNG2 gene. GRA8 is used as a loading control to confirm similar parasite numbers. D) IFAs of iΔHA-RNG2. iΔHA-RNG2 cells were seeded onto host cells on coverslips and grown for 24 hours with or without ATc treatment. Cells were co-stained with anti-HA and anti-IMC1. Scale bars = 3µm E) Growth assay of iΔHA-RNG2 by plaque assay. Equal numbers of iΔHA-RNG2 cells were seeded onto host cells and incubated for 8 days in the presence or absence of ATc. Ku80 TATi cells were treated in the same way and served as a parental control.

3.2.3 Toxoplasma tachyzoites are morphologically intact following RNG2 knockdown.

While there was no defect in daughter cell assembly, the next step was to assay for the structural integrity of the apical complex which forms in the absence of RNG2. The iΔHA-RNG2 was co-stained with antibodies to RNG1-Myc by addition of a 3’ Myc tag on RNG1, as it is one of the only other known markers of the apical polar ring, to see if RNG1 targeting is disrupted at the apical complex. Addition of ATc resulted in downregulation of RNG2, cells continued to divide inside vacuoles as shown previously, and RNG1 was seen at the mother cell apical complex as normal (Figure 3.2A,B). This suggests that the absence of RNG2 does not result in the loss of RNG1 targeting to the polar ring(Figure 3.2 A,B). The stability of the apical complex was assayed by treating the parasites with a harsh detergent to break open the parasites and splay out the microtubules which remain connected to the apical polar rings (Figure 3.2C,D) (Tran et al., 2010). iΔHA-RNG2 parasites with or without ATc underwent treatment with deoxycholic acid detergent. These cells were then settled onto coverslips and stained using antibodies for tubulin and HA. It can be seen that RNG2 remains anchored to the apical complex after treatment with deoxycholic acid, which suggests that RNG2 is quite firmly embedded in the apical complex and not loosely attached to the exterior membrane (Figure 3.2C). In the absence of RNG2, the sub-pellicular microtubules remained attached to the apical complex (Figure 3.2D) suggesting that RNG2 is not necessary for the stability of the apical complex and supporting sub-pellicular microtubules. Lastly, ultrastructural analysis of the apical complex was performing using transmission electron microscopy (TEM) to see if there were any ultrastructural deformities in the apical complex or other cytoskeletal features with the depletion of RNG2. iΔHA-RNG2 parasites were treated with or without ATc for 48 hrs before fixation and staining. When the samples were viewed, iΔHA-RNG2 cells minus ATc looked as expected with all the major organelles clearly identifiable, and the features of the cytoskeleton clearly visible including the sub- pellicular microtubules, conoid, polar rings and IMC from various angles (Figure 3.3). Secretory organelles including micronemes and rhoptries were also visible and appeared just below the apical complex as expected. When RNG2 was knocked down no discernible change in the cell ultrastructure was seen. The sub-pellicular microtubules were clearly visible and attached to the apical polar ring. Secretory organelles, rhoptries could be seen close to the apical complex and did not appear to be deformed in any way. The polar rings also appeared intact, and is consistent with previous results showing RNG1 localization is unaffected by RNG2 knock-down (Figure 3.2). Lastly, the conoid appears to be intact and the pre-conoidal rings can be seen to be intact as well. The tubulin lattice structure can also be seen within the body of the conoid and there are no clearly visible signs that the conoid has any major deformities. Quantification of the replication rate of ,

52 iΔHA-RNG2 cells showed similar rates of replication regardless of treatment with or without ATc (Figure 4A).

Figure 3.2. Examination of structural integrity of iΔHA-RNG2 knockdown cell line.

A,B) Co-staining of RNG1-Myc in the iΔHA-RNG2 cell line with or without ATc. Cells were labelled with anti-HA and anti-Myc. Scale bars= 3µm. C, D) Detergent extraction of iΔHA-RNG2 with deoxycholic acid to isolate the Toxoplasma apical complex and sub-pellicular microtubules. Extracted pellicles were stained with anti-HA (green) and anti-tubulin (red). Scale bars = 3 µm

53 54

Figure 3.3. Transmission electron microscopy of iΔHA-RNG2 knockdown cell line.

Transmission electron microscopy images of iΔHA-RNG2 parasites grown two days with or without ATc. All cells show typical organelle distribution with apically localized micronemes (Mi) and rhoptries (Rh), and conoid (Co). Polar Ring (PR) and Sub-pellicular microtubules (SPM) also appear morphologically intact. Scale bars individually labelled.

3.2.4 RNG2 knockdown cells have an invasion defect.

Since there was no obvious defect in daughter cell formation, and yet the plaque assay showed a strong phenotype, iΔHA-RNG2 parasites were tested for their ability to invade host cells. RNG2 iHA KD cells were analysed by red/green invasion assay (Huynh et al., 2003; Kafsack et al., 2004) and it was found that these parasites were severely impaired in their ability to invade host cells when pre- treated treated with ATc (Figure 3.4B). With RNG2 present, parasites invaded with approximately 60% efficiency, while with RNG2 absent, they invaded with only 20% efficiency (Figure 3.4B). Analysis of basic lytic cycle stages was completed by investigating the ability of knockdown cells to egress. Having established an invasion defect in the iΔHA-RNG2, a static egress assay was performed in which iΔHA-RNG2 cells were pre-treated with or without ATc for 3 days prior to seeding onto host cells. iΔHA-RNG2 cells were grown for a further 30 hrs growth with or without ATc at which point they were stimulated to egress using a calcium stimulus (Figure 3.4C) . Curiously, iΔHA-RNG2 cells with RNG2 knocked down showed no egress defect when treated with calcium ionophore A23187 to activate motility and related processes (Figure 3.4C). This suggested that the function of RNG2 is invasion specific, and may possibly have some function in binding to the host cell upon invasion, as has been observed in knockdown of TgAMA1(Mital et al., 2005), as opposed to egress which is a more destructive process that tears apart the host plasma membrane (Kafsack et al., 2009).

3.2.5 RNG2 knockdown cells are impaired in motility and tight junction formation.

Given the localization of RNG2 at the apical complex and the presence of an invasion defect, I then tested for normal rhoptry secretion. These data show similarity to the invasion specific defects seen in rhoptry secretion mutants, which are unable to invade but can egress normally. (Beck et al., 2013). To test this, invasion was restricted by immobilizing the cells with cytochalasin D, and rhoptry secretion assayed by counting empty vacuoles formed by discharge of rhoptry contents in host cells. There was found to be a defect in secretion of rhoptry contents with RNG2 ablated, and while the difference was significant (P<0.05), there was still a large proportion of knock-down parasites which could secrete rhoptries (Figure 3.5A).

55

Figure 3.4. Functional characterization of iΔHA-RNG2 cell line show a defect in invasion, but not replication or A23187-stimulated egress.

A) Replication assay of iΔHA-RNG2. Cells were pre-treated for 3 days with or without ATc, then seeded onto new host cells and grown for a further 24 hrs with or without ATc before fixation. Cells were labelled with anti-SAG1 and counted for number of parasites per vacuole. Error bars represent SEM from 3 biological replicates. B) Invasion assay of iΔHA-RNG2. Cells were grown for 2 days with or without ATc prior to harvest. Extracellular parasites were settled onto host cells in a high potassium buffer before switching to a low potassium buffer to allowed invasion. Cells were allowed to invade for 10 minutes before fixation. Cells were labelled with anti-SAG1 before permeabilization of host cells and labelling with anti-GAP45. Uninvaded parasites were recognized as red/green (SAG1/GAP45) and invaded parasites were labelled as green (GAP45) only. Error bars represent SEM

56 from 3 biological replicates. Treatments with and without ATc were compared by a two-tailed student’s T-test, * denotes significant difference, P<0.05. C) Egress assay of iΔHA-RNG2 cells. Cells were treated with or without ATc for 3 days, and then seeded onto new host cells and allowed to grow for a further 30 hrs. Cells were stimulated to egress using 5μM A23187 or DMSO as a control. Error bars represent SEM from 3 biological replicates

Figure 3.5. iΔHA-RNG2 is defective in motility and rhoptry secretion.

A) Rhoptry secretion assay of iΔHA-RNG2. Cells were pre-treated for 3 days with or without ATc. Extracellular parasites were immobilized with 1 μM cytochalasin D, and settled onto host cells in a high potassium Endo buffer. Invasion was triggered by replacement with a low potassium buffer and cells were assayed for formation of empty vacuoles, ‘evacuoles’, as indicated by ROP1 secretion. Error bars represent SEM, n=6. Treatments with and without ATc were compared by a two-tailed student’s T-test, * denotes significant difference, P<0.05. B) Motility assay of iΔHA-RNG2. Cells pre- treated for 2 days with or without ATc were settled onto serum coated coverslips at room temperature, and treated with either 1 μM Cytochalasin D, 5 μM A23187, or DMSO solvent control for 1 hour at 37 °C.

To further elucidate the invasion phenotype of the iΔHA-RNG2 cells, the ability of iΔHA-RNG2 to exhibit extracellular motility was investigated. Because the egress assay cannot assay for constitutive, unstimulated motility, a 2D motility assay was performed by observing the SAG1 trails left by the parasites as they moved (Carey et al., 2004) (Figure 3.5B). iΔHA-RNG2 cells without ATc

57 treatment showed typical SAG1 trails, and the number of trails increased with addition of calcium ionophore A23187 as release of intracellular calcium has been linked to increases in motility (Wetzel et al., 2004) (Figure 3.5B).With RNG2 knocked down however, there were little or no trails in the constitutive DMSO control, and looked similar to what was seen in the cytochalasin D control (Figure 3.B). Cytochalasin D is a well-known actin polymerization inhibitor and is widely used to inhibit motility in Toxoplasma (Hakansson et al., 1999). In contrast, the iΔHA-RNG2 showed more trails in the constitutive DMSO treatment compared to the Cytochalsin D negative control in which there were no trails (Figure 3.B). This suggests that iΔHA-RNG2 does indeed have a motility defect, but that stimulus with a calcium stimulus can restore this motility. This complemements the egress results which both show parasites are able to move provided a calcium stimulus.

3.2.6 RNG2 has a role in regulated secretion of micronemes.

Having established a motility defect, microneme secretion was investigated given that loss of microneme secretion is known to result in a defect in tachyzoite motility (Farrell et al., 2012). Microneme secretion was analysed using cGMP and calcium signalling agonists which have been published as being able to stimulate microneme secretion (Farrell et al., 2012; Lourido et al., 2012). It was found that the iΔHA-RNG2 with ATc showed a defect in its ability to constitutively secrete the microneme protein MIC2(Figure 3.6 A, B, C). A single band could be seen to be secreted in the DMSO treated constitutive samples with no ATc added, but in the DMSO samples with addition of ATc, the single band of MIC2 could not be seen to be secreted by western blot (Figure 3.6 A, B ). Interestingly, this secretion could be recovered by stimulation with the calcium ionophore A23187 (Figure 3. 6 A, B, C). This is consistent with the results of the egress assay and motility assay in which the parasites were able to respond to external calcium stimulus (Figure 3.5, 6). I also investigated the cGMP signalling pathway since it is known to be overlapping with the calcium signalling pathways for regulation of secretion and motility. To do this, I used a cGMP phosphodiesterase inhibitor zaprinast which causes accumulation of cGMP in the parasite. While knock-down parasites were responsive to a calcium stimulus, when treated with 0.5mM zaprinast, they showed a defect in their ability to secrete MIC2 compared to –ATc control parasites (Figure 3.6 A, B, C). While zaprinast did provoke some secretion of MIC2 in the knockdown samples, it was much less than what was observed for the respective zaprinast stimulated iΔHA-RNG2 cells without ATc treatment. This suggests that RNG2 may have a function in the cGMP signalling pathway that is independent, or upstream, of calcium signalling.

58

Figure 3.6. RNG2 has a role in regulation of microneme secretion. iΔHA-RNG2 cells were pre-treated for 2 days with or without ATc and assayed for MIC2 (A-C) or AMA1 (D-F) secretion. Extracelluar cells were treated with either 0.5 mM zaprinast (cGMP) (A,D) or 5 μM A23187 (Ca2+) (B,E) for 20 minutes before separation of parasites from supernatant fraction. The ESA (Excreted/Secreted Antigen) supernatant fraction was analysed by western blot. Where no stimulus was used, DMSO was added as a vehicle only control, labelled as Con.(constitutive) in graphs. Relative secretion was measured by quantitative western blot for both MIC2 (C) and AMA1 (F). anti-TOM40 was used to label the parasites pellet to control for similar parasite numbers. Secretion averages for biological replicates (n=6 for constitutive secretion blots, n=4 for stimulated secretion). Error bars represent SEM.

I further investigated microneme secretion in the iΔHA-RNG2 cells by looking at other microneme proteins. Interestingly, with RNG2 absent, the parasites were still able to constitutively secrete a minute amount of the protein AMA1, which can be seen by western blot (Figure 3.6 D, E, F). Parasites were stimulated with cGMP and calcium agonists to gauge the responsiveness of AMA1 secretion in the iΔHA-RNG2 cells. Overall the secretion profile of AMA1 showed a similar trend as MIC2. That is to say that in iΔHA-RNG2 parasites +ATc, there appeared to be a defect in constitutive secretion of AMA1 and they were mostly responsive to calcium stimulus (Figure 3.7D, E, F). With RNG2 absent, parasites were also responsive to cGMP stimulus, but less so than with RNG2 present. While the relative proportions of the AMA1 protein released was not identical to MIC2, the overall trend in responsiveness of the iΔHA-RNG2 cells to calcium ionophore A23187 and zaprinast appeared to be similar(Figure 3.6, C, F) .. I also used 8Br-cGMP which is a membrane permeable cGMP stable analogue to complement the effects seen with zaprinast. In iΔHA-RNG2 cells with RNG2 present, 8Br-cGMP was able to stimulate MIC2 secretion as seen for zaprinast, supporting the effects of zaprinast as being via the cGMP pathway (Figure 3.7A). However, the stable analogue 8Br-cGMP

59 was unable to stimulate secretion in RNG2 ablated cells just like what was seen for zaprinast, and provides further evidence to confirm that the role of RNG2 is in cGMP dependent signalling (Figure 3.7A). Another alternative stimulus commonly used to examine microneme secretion is ethanol. Ethanol has long been thought to act via Phospholipase C (PI-PLC) and recent evidence has shown that a PI-PLC homologue exists in Toxoplasma (Bullen et al., 2016). The action of ethanol and PI-PLC was also found to be associated with elements of the cGMP pathway (Bullen et al., 2016), supporting previous observations of these pathways (Lourido et al., 2012). Interestingly, iΔHA-RNG2 cells with RNG2 absent showed an inability to respond to ethanol stimulus (Figure 3.7A). iΔHA-RNG2 cells –ATc were responsive to treatment with ethanol and increased microneme secretion as normal as indicated with the protein MIC2, but this response was ablated in the +ATc samples (Figure 3.7A), further supporting evidence of RNG2 in the cGMP or lipid-dependent cGMP-associated signalling components (Bullen et al. 2016). As a positive control to see if there is a problem with microneme content in the cells, iΔHA-RNG2 cells were treated with or without ATc and IFAs were performed labelling with antibodies to AMA1 and MIC2 (Figure 3.7 B,C). Both AMA1 and MIC2 localized at the apical region as expected and western blots confirmed that the parasites possessed similar amounts of cytosolic AMA1 and MIC2 proteins (Figure 3.7 D) , suggesting that microneme biogenesis is unchanged with RNG2 depletion, and, therefore, a role for RNG2 in microneme release.

3.2.7 RNG2 has an additional defect in conoid extrusion.

To continue this analysis of apical complex function, the ability of iΔHA-RNG2 cells to extrude their conoids was investigated. While the presence of a microneme secretion defect can potentially explain all of the downstream defects in motility and invasion, it does not exclude the possibility of a conoid extrusion defect in the RNG2 mutant. A conoid assay was then performed to investigate conoid extrusion in the iΔHA-RNG2 mutant. Extracellular iΔHA-RNG2 parasites were harvested after treatment for 72 hours with or without ATc and then conoid extrusion was stimulated with 5µM calcium ionophore A23187 for 30 seconds prior to fixation (Figure 3.8A). Typically the extracellular parasites show spontaneous conoid extrusion in about 20% of the population, and upon stimulation, about 80% extrude their conoids (Del Carmen et al., 2009). Unsurprisingly, no significant difference was seen in conoid extrusion in parasites with or without RNG2 present using A23187, consistent with previous results for motility and egress (Figure 3.8A). However, this is unexpected given iΔHA- RNG2 has been shown to be responsive to A23187 treatment (Figure 3.4C, 3.5B).To further explore the possibility of a conoid defect in iΔHA-RNG2, I needed to further investigate the possible role of cGMP signalling in conoid extrusion. cGMP signalling agonists are known to trigger downstream calcium release (Stewart et al., 2016) and it is conceivable that cGMP might serve to activate conoid protrusion in this way. The newly identified cGMP agonist BIPPO was found to be a potent agonist of conoid extrusion, with 2.5µM BIPPO triggering, 80% of the tachyzoite population to extrude similar to what was seen for A23187 (Figure 3.8). Under these conditions, 80% of iΔHA-RNG2 cells were able to extrude their conoids, but this number dropped to about 45% in cells with RNG2 ablated with ATc (Figure 3.8A). These data show that RNG2 has a cGMP-dependent conoid extrusion defect that mirrors the results of the microneme secretion assays.

60

Figure 3.7. iΔHA-RNG2 cell line is unable to respond to cGMP stimulus, but micronemes develop normally.

A) iΔHA-RNG2 cells were pre-treated for 2 days with or without ATc and assayed for MIC2 secretion. Cells were treated with either 5 mM 8Br-cGMP or 5 μM A23187 for 20 minutes or 3% ethanol for 10 minutes, before separation of parasites and supernatant fractions. ESA (Excreted/Secreted Antigen) supernatant fraction was analysed by western blot. Ku80 TATi cells were used as a parental control. B,C) IFAs showing microneme biogenesis in the iΔHA-RNG2 cells. iΔHA-RNG2 cells were pretreated for 3 days with or without ATc, before seeding onto new host cells on coverslips and grown for a further 24 hours with or without ATc. Cells were stained with either anti-MIC2 or anti-AMA1. Scale bars = 5 μm. D) Western blot of iΔHA-RNG2 parasites labelled with antibodies for MIC2 and AMA1 to test for microneme biogenesis. Anti-TOM40 was used to control for parasite populations and anti- HA shows inhibition of HA tagged RNG2 gene.

The microneme secretion defect was sufficient to explain all of the defects seen in motility, invasion and egress (Farrell et al., 2012) , so a defect in conoid extrusion for RNG2 was initially overlooked (Katris et al., 2014). In the past, more attention has been paid to the effects of microneme secretion to explain defects in motility and invasion so defects in conoid extrusion have in the past been less thoroughly investigated (Lourido et al., 2010; Lourido et al., 2012). After establishing the presence of a conoid extrusion defect in RNG2, other microneme secretion mutants were investigated to examine if there are any defects in conoid extrusion that might have been overlooked. I investigated CDPK1 in Toxoplasma which is known to have a defect in microneme secretion but it is not known if it has a role in conoid extrusion (Lourido et al., 2010; Lourido et al., 2012). Extracellular iΔHA-CDPK1 cells (Lourido et al., 2010) were harvested after treatment for 72 hrs with or without ATc as was done for iΔHA-RNG2. Harvested iΔHA-CDPK1 cells were exposed to 5µM A23187, 2.5µM BIPPO or DMSO solvent as a control and the proportion of conoid extrusion was examined in the population as was done for iΔHA-RNG2. The iΔHA-CDPK1 –ATc controls were able to extrude their conoids with approximately 80% efficiency upon A23187 and BIPPO stimulation as normal (Figure 3.8B), while

61 CDPK1 ablated cells showed a severe conoid extrusion defect with less than 20% extrusion in both A23187 (Ca2+) and BIPPO (cGMP) stimulated cells (Figure 3.8B ). A ΔCDPK mutant was also investigated. It has been observed that intracellular parasites can extrude conoids to some degree although this was not quantified (McCoy et al., 2012), and in some studies not investigated at all (Garrison et al., 2012; McCoy et al., 2012) . So, ΔCDPK cells were assayed for conoid extrusion by treatment with both A23187 and BIPPO as was done for both iΔHA-RNG2 and iΔHA-CDPK1, and ΔCDPK cells were found to be able to extrude their conoids normally as per the parental controls (Figure 3.8C ), supporting previous claims that conoid extrusion is unaffected in the ΔCDPK (McCoy et al., 2012). Taken together these results show that both RNG2 and CDPK1 possess a conoid extrusion defect which likely contributes to their invasion function in addition to their roles in regulating microneme secretion. Although the iΔHA-CDPK1, defect is directly tied to Ca2+ induced conoid extrusion, whereas the iΔHA-RNG2 defect is tied to cGMP signalling.

Figure 3.8. iΔHA-RNG2 is defective in conoid extrusion.

Conoid extrusion assays of iΔHA-RNG2, Δcdpk3 with Ku80+HX parental control or iΔHA-CDPK1. Cells were pre-treated for 3 days with or without ATc (except for Δcdpk3 which is not an inducible knockdown cell line). Extracellular cells were harvested in DMEM and treated with either 5 μM A23187, 2.5 μM BIPPO, or equivalent volumes of DMSO as a solvent controls. Conoids were allowed to extrude for 30 seconds at 37°C before fixation with 1.25% glutaraldehyde. Conoids were scored as either extruded or retracted, by phase contrast microscopy using either a 63x or 100x objective. For all graphs, error bars represent SEM. For RNG2, n=8 biological replicates, for CDPK3 (n=4 biological replicates), and for CDPK1, n=4 biological replicates.

62 3.2.8 RNG2 controls downstream calcium release in a cGMP dependent manner.

Recent insights into cGMP signalling suggest that cGMP stimulus causes downstream calcium release from internal stores in Toxoplasma (Brown et al., 2016; Sidik et al., 2016a). Based on this, the responsiveness of the RNG2 mutant to calcium suggested that RNG2 might be controlling downstream calcium release in a cGMP-dependent fashion. To test this, a GCaMP6-mCherry expressing plasmid was used as a calcium biosensor (Stewart et al., 2016) expressed in the iΔHA- RNG2 mutant. These extracellular parasites were treated with or without ATc, and then stimulated with BIPPO or A23187, and the GCaMP6 intensity was monitored by FACS. iΔHA-RNG2 cells with RNG2 present were able to respond to BIPPO stimulus which triggered a rise in GCaMP6 fluorescence indicating a rise in calcium release into the cytosol (Figure 3.9 ). In cells with RNG2 ablated, BIPPO was not able to trigger a downstream calcium release as readily at the same BIPPO concentrations as with the –ATc controls, although at high BIPPO concentrations a similar response was seen (Figure 3.9). These data again indicated that there is a relative insensitivity of RNG2 depleted cells to cGMP, however that downstream signalling events are possible with enough stimulus. Taken together, these data suggest that iΔHA-RNG2 has a role in triggering downstream calcium release from internal stores after cGMP stimulation. The phenotypes associated with microneme secretion and conoid extrusion could be explained by the failure of these calcium signals propagating in the RNG2 depleted cells.

Figure 3.9. RNG2 controls downstream calcium release in a cGMP dependent manner cGMP agonist BIPPO is less efficient at triggering downstream calcium release into the cytosol the iΔHA-RNG2 knockdown cell line. FACS analysis of iΔHA-RNG2 (ii,iii,v,vi) and Parental cells (i,iv) expressing GCaMP6 with mCherry background expression (Stewart et al., 2016). Cells were grown with or without ATc for 3 days prior to harvest. Extracellular cells were isolated and treated with

63 increasing concentrations of A23187 or BIPPO, and fluorescence from the GCaMP6 calcium biosensor was measured by FACS over time. 3.2.9 Generation of inducible Knockdown of RNG1 and phenotype assessment.

Being the first identified protein to target to the apical polar rings, and being reported to be unable to be knocked out (Tran et al., 2010), I sought to gain some insight into RNG1 function by testing for phenotypes associated with its knockdown using an inducible system. A plasmid was constructed which fused the tiny RNG1 ORF (267bp) including the 3’ UTR behind a tetracycline responsive T7S4 promoter (Sheiner et al., 2011). The RNG1 ORF was located through the previously identified protein sequence (Tran et al., 2010), to obtain the cDNA. From there, gene ID ME49_243545 was identified based on that matched the cDNA, but had a different protein sequence suggesting that the gene model was incorrectly annotated. A tetracycline inducible knockdown cell line was made by inducing double homologous recombination of the 5’ UTR and 3’ UTR of the RNG1 gene locus, replacing the endogenous promoter with the tetracycline responsive T7S4 promoter (Figure 3.10A). Correct integration of the promoter was screened for by PCR (Figure 3.10B). Primers P3A and P2 amplified the T7S4 promoter and endogenous RNG1 3’ UTR, giving a band of approximately 2 kb which was seen in the mutant, but not for the parental cell line. Primers P1A and P3A amplified the native RNG1 3’ UTR and a region of the excised 5’ UTR and promoter region. This gave a band of approximately 1.4 kb and was seen in the parental control but not the mutant showing the locus was successfully replaced.. Western Blot also confirmed that expression of the introduced iΔHA-RNG1 was able to be shut down after addition of ATc, and RNG1 expression was almost completely ablated after 2 days of ATc treatment (Figure 3.10D). IFAs were also used to confirm this observation where iΔHA-RNG1 cells were pre-treated for 72 hours before seeding onto host cells on coverslips and grown for a further 24 hours with or without ATc. Cells were fixed and stained with anti-HA and anti- IMC1. RNG1 lablelling disappeared with ATc treatment showing RNG1 was able to be downregulated successfully (Figure 3.10C).

64

Figure 3.10 Generation of inducible RNG1 knockdown cell line ( iΔHA-RNG1) by promoter replacement.

A) Schematic of promoter replacement at the endogenous RNG1 locus (RNG1 WT) with a tetracycline inducible knockdown promoter (T7S4) and 5’ 3xHA tag, under which expression of RNG1 could be shut down with ATc (anhydrotetracycline). This was integrated using the DHFR selectable marker. Primers P1-3 show PCR amplifications sites used to validate the correct integration of the construct at the RNG1 locus. B) PCR of iΔHA-RNG1 mutant with screening primers shown in Figure 3.1A. P2-P3A amplified the integrated T7S4 promoter with RNG1 3’flank, giving a band of approximately 2.0 kb, while P2/P1A amplified the native RNG1 ORF also giving a band of approximately 2.0 kb. P6/P7 amplified the UPRT flank and was used as a positive control for DNA, which gave a band of approximately 1.4 kb. Primer sequences can be found in Table S1. C) iΔHA- RNG1 cells labelled with anti-IMC1 and anti-HA to visualize Knock-down of RNG1 expression in response to the addition of anhydrotetracycline (ATc). Cells were grown for 3 days with or without ATc and seeded onto host cells on coverslips where they were grown for a further 24 hours with or without ATc before fixation. Scale bar = 3µm D) Western Blot of iΔHA-RNG1 cells labelled with anti- HA and anti-TOM40. Cells were grown in the presence or absence of ATc for 1-3 days or not at all, to test for RNG1 protein expression as indicated by HA labelling. Anti-TOM40 was used as a loading control to control for similar levels of parasites. E) Growth assay of iΔHA-RNG1 by plaque assay. Equal numbers of iΔHA-RNG1 cells were seeded onto host cells and incubated for approximately 8 days in the presence or absence of ATc. iΔHA-RNG2 cells were treated the same way and used as a negative control for the ATc compound. iΔHA-RNG2 is used as a control.

65 3.2.10 RNG1 knockdown displays normal growth.

After the clonal mutant cell line was obtained, growth assays were carried out to assess fitness of the mutant with the loss of RNG1. Equal numbers of iΔHA-RNG1 cells were added to host cells and grown in the presence or absence of ATc for approximately 8 days. Growth was measured by the zones of host cell clearance or lysis, which formed plaques in the host cell monolayer. Whether RNG1 was present or absent, both parasites sets grew equally well, as indicated by the zones of clearance where host cells where not stained.(Figure 3.10 E). In contrast, iΔHA-RNG2 cells were used as a negative control and the knockdown formed very fewer smaller plaques (Figure 3.10 E). To test for an invasion function, a red/green invasion assay was performed on RNG2 iHA KD cells where parasites were settled onto host cells in a high potassium buffer and then allowed to invade by replacing the medium with a low potassium buffer. The samples were then labelled with a surface protein antibody before permeabilizing and labelling with a cytoskeletal antibody which distinguish parasites as green (invaded) or red/green (non-invaded) (see Methods). It was found that these iΔHA-RNG1 mutants presented no invasion defect when treated with ATC (Figure 3.11A). A replication assay was also performed on the iΔHA-RNG2 cell lines in which iΔHA-RNG2 cells were treated with or without ATc for 72 hours prior to seeding onto new host cells and growing for a further 24 hours with or without ATc (Figure 3.11B). Both samples showed no defect in replication, as indicated by the comparable rate in parasite numbers per vacuole (Figure 3.11B). So RNG1 ablation appears to have no significant impact on the tachyzoite lytic cycle.

66

Figure 3.11. iΔHA-RNG1 has no defect in invasion or replication.

A) Replication assay of iΔHA-RNG1. Cells were grown for 3 days with or without ATc and seeded onto coverslips before a further 24 hrs growth with or without ATc. B) Invasion assay of iΔHA-RNG1. Cells were pretreated for 2 days with or without ATc and then harvested and settled onto host cells in Endo buffer, before switching to Invasion Buffer, and allowed to invade for 20 minutes. iΔHA-RNG2 is used as a control. For iΔHA-RNG2, P<0.05. iΔHA-RNG1., Difference is non-significant.

Despite this, it has been seen that some proteins may have functions that are not immediately obvious when tested by plaque assay, particularly in egress (Kafsack et al., 2009). I further characterized the RNG1 mutant to investigate whether or not it has a secretion or motility defect and found it could secrete micronemes normally as indicated by MIC2 (Figure 3.12A), responding to both calcium ( A23187) and cGMP (BIPPO) stimulus (Figure 3.12A). Analysis of motility of RNG1 found that RNG1 knockdown cells formed trails similar to those seen in the –ATc control (Figure 3.12B). Despite the expectation of RNG1 being essential based on reported failed attempts to knock

67 it out, my data suggests that parasites can accommodate the lack of RNG1: microneme secretion, motility and invasion are all normal in extracellular

Figure 3.12, iΔHA-RNG1 displayes normal microneme secretion and motility.

A) Microneme secretion assay of RNG1 iHA KD. Cells were stimulated with either 5 μM A23187 (Ca2+) or 5 μM BIPPO (cGMP) and DMSO as a solvent control. Pellets were labelled with anti-TOM40 to control for parasite population. ESA (Excreted/Secreted Antigen) supernatant fractions were probed with anti-MIC2. B) Motility assay of iΔHA-RNG1. Cells were treated with or without ATc as indicated for 2 days before harvest. Cells were stimulated with 5 μM A23187 or DMSO as a solvent only control. iΔHA-RNG2 cells were treated the same way and used as a negative control for a cell line with a known motility defect.

68

69 3.3 Discussion.

3.3.1 RNG1 and functional redundancy in the apical complex:

Despite RNG2 being very important for the lytic cycle of the parasites, RNG1 in comparison was apparently not essential for the parasites. iΔHA-RNG1 parasites grew perfectly well with or without RNG1 present. It is possible that the excised RNG1 ORF with its promoter somehow were randomly integrated elsewhere in the genome, but I tested integration of multiple clones which all showed correct excision of the RNG1 gene so I consider this is unlikely. The simplest explanation is that the RNG1 gene, is not essential and that knock-down with ATc has minimal impact on cell viability in vitro. Previous reports have stated that RNG1 is most likely essential as it was unable to be successfully knocked out (Tran et al., 2010). However a recent genome wide CRISPR screen of gene essentiality using a guide RNA library found that the gene locus encoding RNG1 was highly non- essential (Sidik et al. 2016b), in complete accordance with the data presented here. So the simplest explanation is that the RNG1 gene is indeed non-essential.

However it is possible that we may see differing results depending on which strategy is used to functionally ablate RNG1. For example, the GAP45 gene shows a severe growth defect when knocked down with ATc, but is able to be knocked out and is viable in culture (Andenmatten et al., 2013). A recent genome wide KO study tested gene essentiality on a genome wide scale (Sidik et al., 2016b), which yielded similar results for RNG1. Primers cutting the correct RNG1 ORF found that the RNG1 gene exhibited a wide range of gene retention under selective pressure when cut, but the CRISPR targeted RNG1 KO cells were largely without a phenotype. RNG2 appeared to be essential with low numbers of parasites growing with the gene knocked out, regardless of where the cut was made in the RNG2 gene (Sidik et al., 2016b). The cutting of RNG1 however appeared to exhibit a higher degree of variability in the retention of the gene with primers that cut within the correct ORF. This shows that the phenotype associated with RNG1 manipulation is highly variable and might explain these seemingly contradictory results, although the mechanism for this is still unknown.

If the apparent difficulty of perturbing RNG1 expression seen in some of the above experiments is genuinely linked to RNG1 function, a possible explanation for lack of a phenotype observed using the inducible knockdown approach is that by decreasing RNG1 expression slowly using ATC, the increasingly limiting amounts of RNG1 allow the apical complex to adapt and complement the loss of RNG1 in some other manner. The 48 hour time frame of ATc treatment prior to invasion, motility and secretion assays is long enough for several rounds of replication which may be enough for the apical complex to adapt for the loss of RNG1, however with sudden an immediate depletion using KO plasmid, perhaps such adaptation was not possible. However, in the case of GAP45 the evidence (Andenmatten et al., 2013) suggests that the reverse can be true, but this could simply reflect different requirements of the two genes for stability of their respective cytoskeletal compartments, or their expression regulation. A study on the Sub-pellicular microtubules (SPMs) of Toxoplasma found that while one or even two genes could be knocked out easily, the loss of three sub-pellicular microtubule genes SPM1, SPM2 and Trxl1 together caused severe growth defects specifically related to the stability of the IMC (Liu et al., 2016) . It is possible that the RNG1 knock-down is complemented in a similar way and we would require the identification and subsequent knock-down of more proteins targeting the apical polar rings to identify a function for RNG1 and others at this structure. Given that the IΔHA-RNG1 parasite line was not under continuous ATc selection, it might also be that the addition of an HA tag, or the constitutively expressing T7S4 promoter, caused the parasite to respond in some way that ultimately lead to their insensitivity to RNG1 depletion. A global proteomic or mRNA expression screen might give some insight into any genes whose

70 regulation is altered that might compensate for RNG1 loss The simplest explanation however, is that the RNG1 gene is not essential given the evidence presented here and the CRISPR phenotype, and that Tran et al. were simply unsuccessful in their attempts to knock this gene out.

3.3.2 Comparison of RNG2 with other apical complex protein mutants:

This functional study of RNG2 is the first to implicate the apical polar ring in motility and invasion. The observation that there was no replication defect was unexpected given that the RNG2 protein appears at a very early stage in apical complex formation. Why it should appear so early in the cell cycle when it is not essential for these processes is certainly interesting. Perhaps RNG2 is required to be present at this early stage to be properly integrated into the correct position of the apical complex. The phenotypes observed in the iΔHA-RNG2 can be compared to observations of other known proteins involved in similar processes, one of which is AKMT, which was the only previously published apical complex protein to be functionally characterized by knockout (Heaslip et al., 2011). The genetic ablation of AKMT suggested two very important ideas; first that the conoid has a role in motility, and the second that the apical complex may have some signalling capacity. RNG2 function clearly differs from that of AKMT, since mutant phenotypes differ drastically, which suggests that the apical complex has different sub compartments which coordinate its overall function. ΔAKMT showed a severe motility and egress defect, but curiously no defect in microneme secretion.

Furthermore, AKMT was shown in epitope tagged cell lines to be redistributed in response to elevated calcium signals and its methyltransferase domain suggested a role in some sort of enzymatic process that was likely linked to some sort of signal process. Despite this defect in motility, ΔAKMT mutant secretes micronemes normally, while the iΔHA-RNG2 does have a defect in microneme secretion. In this way, the defect of iΔHA-RNG2 was more similar to the phenotype of the inducible mutant of the DOC2.1 protein. DOC2.1 is a protein involved in membrane fusion events that has been shown to facilitate microneme secretion in Toxoplasma (Farrell et al., 2012). The inducible DOC2.1 mutant was made as a temperature sensitive protein that is inactive at 40 degrees celcius (Farrell et al., 2012). The mutant was found to exhibit a strong growth defect, caused by severe defects in all of motility, egress, invasion and microneme secretion. Hence it would seem that a microneme secretion defect can cause downstream defects in all motility related phenotypes further supporting previous evidence for micronemes being attachment points for the glideosome components (Sheiner et al., 2010). Pleiotropic effects are possible but unlikely given the immediacy with which this heat sensitive strategy can be enforced (Farrell et al., 2012). Hence, the literature suggests that the primary role of RNG2 is in cGMP dependent microneme secretion but this does not discount that there may be additional defects in conoid extrusion or elsewhere in the signalling network.

71 3.3.3 A role for RNG2 in conoid extrusion.

The discovery of the more potent cGMP agonist BIPPO (Howard et al., 2015) allowed investigation of conoid extrusion where only less efficient cGMP agonists such as zaprinast were previously available. The discovery of a conoid defect in RNG2 was hidden in the sense that an additional conoid defect was not needed to explain the motility and invasion defects seen due to loss of microneme secretion. The DOC2 mutant is unable to secrete micronemes yet able to extrude its conoid (Farrell et al. 2012). So despite being able to extrude the conoid normally, the DOC2 mutant presents a severe growth defect suggesting that the microneme secretion defect alone is enough to cause severe downstream defects in motility and invasion (Farrell et al., 2012). This is consistent with the MyoH study which shows evidence that conoid extrusion is critical for initiating motility (Graindorge et al., 2016). In this study, inducible knockdown of the conoid localized MyoH gene resulted in a mutant which was able to secrete micronemes but unable to initiate motility, resulting in defects in motility and invasion processes (Graindorge et al., 2016). Work on MyoH established the apical complex as an extension of the glideosome network. The MyoH mutant was also unresponsive to external stimuli such as A23187 to trigger egress, also consistent with a motility-based defect (Graindorge et al., 2016). iΔHA-RNG2 however, is responsive to calcium stimulus, but not cGMP stimulus, suggesting that it most likely acts in a signalling capacity as opposed to a mechanical one. iΔMyc-MyoH does not present a conoid extrusion defect when stimulated with ethanol or A23187, rather the defect is in the ability of the conoid to transfer this force through to the glideosome network in iΔMyc-MyoH. However, with RNG2 the defect appears to be the result of signalling. The fact that the conoid can be extruded with a calcium stimulus suggests that the machinery is there to transfer the force, but not to initiate it in a cGMP-dependent manner. It is unclear what this cGMP dependent conoid extrusion mutant would be in vivo, but presumably it will exacerbate the microneme secretion defect with a defect in the motility processes involving MyoH.

3.3.4 Comparison of RNG2 with other components of the cGMP signalling network:

Having established an important role of RNG2 in cGMP-dependent microneme secretion and conoid extrusion, we can compare this with other known mutants involved in cGMP and calcium signalling. The phenotype for IΔHA-CDPK1 (Lourido et al., 2010) is also very similar to RNG2 and DOC2 mutants under constitutive conditions, without any stimulus, which is a severe motility defect most readily explained by a defect in microneme secretion. So the presence of a conoid extrusion defect was not required to explain any of the defects in CDPK1 invasion and motility, and yet I have shown that there indeed was an undescribed conoid extrusion defect in iΔHA-CDPK1, just as there was with RNG2. Interestingly, the extrusion defect seen in CDPK1 was more severe than what was seen with RNG2, where less than 20% of the population could extrude their conoids with either cGMP or calcium stimulus in the iΔHA-CDPK1 cells. When stimulated with BIPPO, RNG2 knockdown cells could still extrude conoids to about 40% efficiency compared to 78% with RNG2 present. This suggests that RNG2 probably still has some ability to respond to stimulus but that the signalling components are not properly aligned. This is consistent with the FACS data which showed that cGMP dependent calcium release still occurred in the iΔHA-RNG2 mutant provided enough stimulus (Figure 3.6, 3.7), and likely represents responsiveness to muted calcium release from internal stores. It is known that Zaprinast and BIPPO have differing potency for stimulating Toxoplasma secretion and motility processes, likely due to their differing affinities for cAMP instead of cGMP. This is unlikely considering GCaMP studies in Toxoplasma have shown BIPPO and Zaprinast cause the parasite to behave very similarly and both are unable to stimulate PKG inhibited cells, so we consider this unlikely, but cannot rule out the possibility that calcium flux in the RNG2 mutant might behave

72 differently using Zaprinast. The CDPK1 protein is an endpoint to this calcium release which is probably why the defect in extrusion was much lower in iΔHA-CDPK1 and for both cGMP and calcium stimuli. This also supports previous findings that CDPK1 is at an intersection with cGMP and calcium signalling, in which CDPK1 inhibited cells were unresponsive to either calcium or cGMP triggered egress (Lourido et al., 2012), which is consistent with CDPK1 having a downstream role in responding to calcium release.

It has been reported that inhibition of PKG using Compound 1 results in an inability to respond to stimulus with calcium ionophore or ethanol (Wiersma et al., 2004). This suggests that stimulation with either stimulus is not possible with inhibition of PKG. The phenotype of the RNG2 mutant differs from inhibition of PKG in that RNG2 knockdown is responsive to calcium ionophore to stimulate microneme secretion while PKG-inhibited cells are not. This particular combination of responsiveness of MIC2 secretion to calcium but not cGMP has not been seen in any previously reported mutant (Katris et al., 2014). Interestingly, the RNG2 mutant was also unable to secrete MIC2 in response to stimulus with ethanol which fits in accordance with recent research which supported the existence of an Apicomplexan PLC in Toxoplasma (Bullen et al., 2016), which is thought to stimulate Phospholipase C (PI-PLC) activity in the breakdown of PIP2 into DAG and IP3. This is related to the cGMP signalling pathway because PKG inhibition has been shown to impact Phosphoinositide (PIP) turnover which in turn impacts the turnover of PIP2 into DAG and IP3 Given RNG2 was unresponsive to both 8Br-cGMP and zaprinast, it makes sense that RNG2 should also be unresponsive to ethanol stimulus. In contrast, , CDPK3 inhibited cells have been shown to secrete micronemes and egress in response to an ethanol stimulus (Lourido et al., 2012) in accordance with recent insights on PLC activity (Bullen et al., 2016) which affects phosphoinositol-related components of the cGMP signalling pathway (Brochet et al., 2014).

PKG, CDPK1 and CDPK3 all have very clear kinase domains and so it is easy to pinpoint a mechanism of action to their function, so it’s unclear exactly how RNG2 is involved in cGMP signalling. Recent work on CDPK1 and CDPK3 has served to identify numerous substrates and proteins which are differentially phosphorylated upon functional ablation of these proteins (Lourido et al., 2013; Treeck et al., 2014). No such data has been yet generated for PKG, but it would equally important to define the substrates of this kinase. Similarly, to know what changes in protein phosphorylation occur with RNG2 depleted would help provide further insight into the consequences of its loss. In terms of discovering the mechanism of action of RNG2, this is challenging because there are no clearly defined motifs in the RNG2 protein that provide a clue to how it acts. There are at least two predicted palmitoylation sites on the RNG2 protein that might serve as membrane attachment regions, and these could be important for locating RNG2 at the top of the IMC. However, a recent palmitoylome has found no evidence of palmitoylation of the RNG2 protein (Foe et al., 2015). Most likely RNG2 is facilitating protein-protein interactions through its extensive coiled coil domains and it is possible that these proteins will functional domains that facilitate its role in signalling. This would potentially be elucidated by pull down of the HA-tagged RNG2, however since it is attached firmly in the conoid/subpellicular microtubular array it might be quite difficult to find its cognate partners amongst this extensive proteinaceous structure. Or alternatively, RNG2 could be tagged using the BirA/BioID system to search for proximal partners. It would be interesting to see if the CDPKs or PKG interact with RNG2 to some degree at the junction of the IMC and the polar ring. CDPK3 localizes to the entire length of the parasite plasma membrane, up to the apical complex (McCoy et al., 2012), and CDPK1 has an extensive cytosolic localization (Donald et al., 2006; McCoy et al., 2012).. It is not yet clear why CDPK1 should have a conoid defect and not CDPK3, but perhaps CDPK1 can access the

73 conoid from the cytosol. Another avenue of research would be to investigate the lipid profile of key lipid precursors such as phosphatidylinositides and phosphatidic acid in the iΔHA-RNG2 mutant. In particular, PIP2 is broken down into DAG and IP3 and DAG in turn forms phosphatidic acid which is a lipid dependent mediator of microneme secretion (Bullen et al., 2016). So, RNG2 could be positioned somewhere in this chain of signalling components. It was recently shown in P. berghei that the inhibition of PKG using Compound 2 resulted in a decrease in the turnover of PI into PIP2 and PIP3 (Brochet et al., 2014), which links these lipid processing events to cGMP signalling. It is possible that RNG2 acts somewhere in these lipid processing events. So performing a metabolic profile of lipid metabolites of RNG2 mutants might hone in on its position and mode of action in this signalling pathway. TgAPH is a lipid sensing protein that was recently localized to the micronemes of Toxoplasma and was found to have a role in sensing phosphatidic acid at the plasma membrane which triggers microneme release. It is conceivable that RNG2 might serve to facilitate correct docking of TgAPH to the plasma membrane. Clearly RNG2 acts somewhere in the cGMP signalling pathway but exactly where is currently unknown.

It is interesting to note the fact that a homologue of RNG2 is absent in Plasmodium species, yet the components for cGMP and PKG signalling are conserved. Clearly, the conoid is absent in plasmodium species although they do possess an apical polar ring which nucleates sub-pellicular microtubules (Garnham et al., 1961; Gustafson et al., 1954). Given they have the polar ring in common, maybe only the C-terminus of RNG2 is conserved in Plasmoidum which is attached to the polar ring. RNG2 is a structural protein with coiled coil motifs which suggests a structural function, so it is unsurprising that it should be rapidly evolving and poorly conserved. However, maybe a protein structurally similar but evolutionary distant fulfils this role. Coiled coil proteins are highly dynamic and rapidly evolving so perhaps the function of one or more coiled coil proteins performs a similar function in Plasmodium as it does in RNG2. Recently it has been shown that the protein SAS6L localizes to an apical ring structure in Plasmodium sporozoites and ookinetes, but not merozoites. This shows firstly, that the apical complex is different in composition between the motile stages of Plasmodium so perhaps the coiled-coil RNG2 homologue is stage specific. Secondly, SAS6L is localized to the conoid in Toxoplasma yet still present in the Plasmodium apical complex. This shows that while Plasmodium has lost it’s conoid, elements of the conoid persist in the apical complex. I consider it likely that a homologous coiled-coil protein in Plasmodium facilitates the same function as in Toxoplasma and that the mechanism of cGMP signalling is conserved between these species, or at least some life stages, although this requires further evidence to confirm.

3.3.5 The apical complex as a sensory organelle?

The relationship of RNG2 to Toxoplasma secretion is an idea that is also echoed in the release of lytic granules from human lymphocytes. Lymphocytes have been shown to reorient their centrosomes towards an area of the cell nearest to pathogens targeted for degradation (Stinchcombe et al., 2006). This basal body structure nucleates microtubules in such a way that they facilitate delivery and secretion of lytic factors to destroy the pathogen. In a similar way, Toxoplasma has an apically oriented apical complex, seemingly derived from basal body/ flagellar rootlet components, facilitating a polarized secretion system which lays out the secreted factors needed forward motion, tight junction formation, and invasion. Mutational studies on centrosomal CEP proteins, in particular CEP83, have shown reduction of a lymphocytes ability to secrete vesicles caused by an inability for the centrosome to dock to the immunological synapse(Stinchcombe et al., 2015) . Curiously, it has also been shown that the site of secretion is depleted of actin and this coincides with a redistribution of PIP2 away from the site of lytic granule secretion (Ritter et al., 2015). These observations bear some resemblance to our understanding of events of apical secretion in apicomplexans, and RNG2 is

74 seemingly integral to the signalling events that are apparently driving the biochemical events of invasion. Based on this it might be that RNG2 has a dual signalling role. It may be that RNG2 controls conoid movement which in turn impacts on actin and PIP2 regulation which affects downstream functions relating to IP3 release from PIP2. This way, RNG2 might be acting in both a signalling and a mechanical function, so investigation of phosphoinositde turnover, in particular PIP2 would be a worthwhile avenue for future research in the iΔHA-RNG2 mutant.

The evidence that RNG2 controls downstream calcium flux after cGMP accumulation suggests that the apical complex in Toxoplasma functions in a sensory capacity. Flagella are similarly highly adaptable self-organizing structures with diverse functions. Many somatic mammalian cells are ciliated and use these as sensors to respond to extracellular cues and pheromones elsewhere in the body. Similarly, free roaming protists have flagella which they use to probe the extracellular environment to identify surrounding objects such as food and shelter to attach to. If the apical complex is indeed derived from flagellar-associated structures, such a role in signalling key events in relation to the external environment is consistent with these flagellar functions. The evidence for RNG2 in cGMP signalling, presumably downstream of PKG, makes sense given that the presence of PKG in an organism is closely correlated with the presence of a flagellated stage (Johnson and Leroux, 2010). The only exception to this are trypanasomatids which have repurposed their PKA to respond to cGMP (Shalaby et al., 2001) . At present we have little knowledge of extracellular receptors that might directly sense the outside environment, but RNG2 is apparently part of the cascade of events necessary for the coordinated activation of the events necessary for successful invasion and propagation of the lytic cycle.

75

76 Chapter 4: Investigations of cGMP, cAMP and calcium in regulated secretion. 4.1 Introduction.

Apicomplexa has evolved an arsenal of secretion factors with have diverse functions to accommodate an obligate parasitic lifestyle. These are broadly classified as microneme, rhoptry and dense granule proteins, according to the secretory compartment in which they reside. Micronemes are localized to the apical portion of the parasites and generally are associated with function involving attachment to a substrate and motility along this substrate (Huynh and Carruthers, 2006). Rhoptry proteins which are club shaped organelles at the apical end of the parasite and are required to form the tight junction required to discretely enter a host cell in tandem with micronemes (Alexander et al., 2005). The third class, dense granules, are secreted once inside the host cell and are thought to be required for maintaining the parasitophorous vacuole and modulating the host immune response throughout the replicative cycle of the parasites, (Pernas et al., 2014). Indeed, while it has not been disproven that dense granules may be required for extracellular functions the vast majority of dense granule mutants have all been shown to have roles in intracellular processes (Rommereim et al., 2016).

There is quite a lot known about microneme secretion which is controlled by intracellular calcium release, cGMP stimulus and turnover of lipid metabolites (Bullen et al., 2016; Carruthers and Sibley, 1999; Wiersma et al., 2004). In contrast, almost nothing is known about the signalling controls for dense granule and rhoptry release. Early work on signalling of micronemes showed that they are secreted constitutively in an extracellular environment, and secretion is increased upon addition of a calcium stimulus which raised cytosolic calcium levels (Carruthers and Sibley, 1999). In accordance with this, microneme secretion was stopped upon removal of intracellular calcium using a calcium chelator such and BAPTA-AM (Carruthers and Sibley 1999). Dense granules however, were unresponsive to removal of intracellular calcium, and some secretion can still be seen when stimulated with calcium ionophores. It was thought, that dense granules were unresponsive to elevated levels of calcium because some secretion can still be seen when given an agonist to elevate intracellular levels of calcium (Carruthers and Sibley, 1999). However, this was not accurately quantified, and looking at these studies there is noticeably less GRA1 secreted by cells treated with calcium ionophore (Carruthers and Sibley 1999, Carruthers et al. 1999). Since then, it has been seen in subsequent studies performing similar experiments that calcium stimulus can lead to reduced secretion of dense granule proteins, in particular GRA1 (Kafsack et al. 2009, Farrell et al. 2012, Paul et al. 2015). The current model for signalling however, maintains that mechanisms controlling dense granule secretion are not known. Rhoptry secretion has not been observed in extracellular parasites using antibodies to rhotptry bulb proteins and are thought to only be secreted upon contact with a host cell surface and subsequent invasion (Carruthers and Sibley, 1999). Indeed previous mutants with defects in rhoptry targeting show only a defect in invasion and at no other stage during the lytic cycle (Beck et al., 2013; Mueller et al., 2013b). However, these studies did not address the question of the mechanics of signalling behind rhoptry protein secretion control, which are still completely unknown.What is known about signalling involved in secretion in Apicomplexa is largely derived from studies on the cGMP-activated PKG (Wiersma et al., 2004) and calcium-activated CDPKs (Lourido et al. 2012) that arose from earlier studies establishing the central role of calcium in invasion processes (Carruthers and Sibley 1999, Carruthers et al. 1999). Early studies established the link between elevated intracellular calcium and the increase in microneme secretion and motility

77 using chemical agonists such as calcium ionophores and inhibitors such as the membrane permeable calcium chelator BAPTA-AM (Carruthers et al., 1999b; Carruthers and Sibley, 1999). With these chemical agonsits it was established that motility can be inhibited by removing calcium and upregulated by promoting its release from internal stores. PKG was one of the earliest known proteins involved in microneme secretion and motility in Toxoplasma andits role in motility and invasion was first found through drug studies which identified PKG as the target for the potential therapeutic chemical termed Compound 1. Compound 2 was also identified as inhibiting PKG, with some off targets including some CDPKs (Donald et al., 2006; Wiersma et al., 2004). In these studies, Compound 1 was shown to inhibit motility and microneme secretion which resulted in defects in invasion and egress. It was also shown that Compound 1 treated parasites were unresponsive to agonists such as ethanol or A23187 which completely blocked microneme secretion and linked the function of PKG to calcium signalling (Wiersma et al. 2004).

Despite a rapidly growing body of evidence to show calcium is directly responsible for signalling in motility related events, the proteins responsible for implementing these signals were initially largely unknown beyond PKG. Growing interest moved towards a family of plant-like CDPKs in Toxoplasma after many studies showed these to be important proteins for stage specific development in Plasmodium species (Billker et al., 2004; Dvorin et al., 2010; Lourido et al., 2010). CDPK1 was the first published CDPK in Toxoplasma to be shown to have an important role in initiating microneme secretion and motility (Lourido et al. 2010). Since then work has focused on elucidating the function of other CDPKs (Lourido et al. 2012, Long et al. 2016). CDPK3 was shown to be responsible for motility related processes, though they could invade with no significant defect, although were strongly defective in egress (Lourido et al. 2012, McCoy et al. 2012, Garisson et al. 2012). One study aimed to elucidate the relationship between PKG, CDPK1 and CDPK3, and showed that inhibition of CDPK1 showed less egress response with a cGMP agonist than CDPK3 mutants (Lourido et al. 2012). At the time, it was unclear if cGMP and calcium dependent signal pathways acted in parallel or in series, and whether PKG was upstream of CDPKs or vice versa. Though since then it has been shown that PKG triggers downstream calcium release from internal stores in tachyzoites (Sidik et al. 2016, Brown et al. 2016, Stewart et al. 2016) which has been complemented by studies in Plasmodium berghei life stages (Brochet et al. 2014).

Comparatively less has been published on role of cAMP during the lytic cycle of Toxoplasma tachyzoites, however a growing body of research has been published focusing on the conversion from tachyzoites to bradyzoites for which cAMP evidently has a role (Sugi et al. 2016, Eaton et al. 2005, Kirkman et al. 2001). cAMP has been shown to be involved in this conversion and that it is an essential part of the long term viability of chronic infection in mammalian hosts (Sugi et al. 2016). Calcium signalling has recently been implicated in the conversion of tachyzoites to bradyzoites via CDPK2 (Uboldi et al. 2016), but the exact relationship between cAMP and calcium in this process is not fully clear. Even in better studied eukaryotic systems, the relationship between cAMP and calcium is under scrutiny and not fully clear (Jansen et al. 2015). Calcium signalling was implicated in bradzyoite conversion through the action of CDPK2. Specifically, CDPK2 was shown to be involved in carbohydrate metabolism in bradyzoites. Knockout of CDPK2 results in cells that over-accumulate carbohyrdates which impacts bradyzoite conversion but links between cAMP and calcium were not investigated (Uboldi et al. 2016). If it is anything like the relationship between cGMP and calcium, cAMP might be involved in influencing calcium levels in the parasite, but it is not conclusive at this stage. The function of stage conversion in Toxoplasma appear to be in contrast to what is known about cAMP and PKA signalling in P. falciparum in which PKA regulatory subunit (PKAr) was shown to

78 have roles in secretion of Plasmodium merozoites (Dawn et al., 2014). In this study, a dominant negative PKAr mutant was shown to be defective in microneme secretion and showed that cAMP was necessary for secretion of PfAMA1 (Dawn et al. 2014). So it appears likely that cAMP might be utilized for motility related processes similar to cGMP (Collins et al. 2013) but it is unclear at present how they interplay in the control secretion events or even if Plasmodium is a good model for cAMP signalling in Toxoplasma. While there is growing interest in cAMP in Apicomplexa, it is still in its infancy compared to mammalian or yeast systems (Mukherjee et al., 2016; Oldenburger et al., 2012; Tamaki et al., 2007).

While the work presented in this thesis has shown RNG2 to be involved in cGMP dependent secretion, it is conceivable that the role of RNG2 may also contribute to some unknown cAMP mechanism given that cAMP signalling has been known to be associated with flagella function (Jansen et al., 2015). The current body of literature shows that cGMP is required for microneme secretion in Toxoplasma tachyzoites (Wiersma et al. 2004) but cAMP is required for bradyzoite conversion(Sugi et al. 2016). In Plasmodium merozoites, on the other hand, cAMP is evidently involved in controlling microneme secretion (Dawn et al. 2014), although it is possible that the inhibitors and agonists used to make these conclusions have some off-targets (Dawn et al. 2014). Alternatively, it could be that cAMP performs different functions in Plasmodium, compared to Toxoplasma.

With this information, I set out to explore possible regulatory mechanisms of secretion in Toxoplasma, in particular that of dense granules for which little clear insight has been gained. In many publications, a slight reduction in secretion is noticed (Farrell et al. 2012, Kafsack et al. 2009, Carruthes et al. 1999) when stimulated with A23187 but this is thought to be a non-specific pleiotropic effect. The idea was to further explore this area together with novel signalling agonists such as the newly identified cGMP Phosphodiesterase inhibitor, BIPPO (Howard et al., 2015). BIPPO is reported to be much more efficient at triggering egress and microneme secretion than the commonly used zaprinast drug (Howard et al. 2015). BIPPO has also been shown to act on cAMP PDEs as well (Howard et al. 2015), so it may be that BIPPO might trigger these processes in a different way to zaprinast depending on the affinity of particular cGMP or cAMP PDEs. BIPPO provides an exciting new tool to investigate the exact role of RNG2 in cGMP and possibly cAMP signalling events, where previously there weren’t many available agonists of these pathways (Howard et al., 2015). I also wanted to investigate the secretion profile of dense granules and investigate whether this novel compound has any effect on these secretion factors as nothing is known about the effect of cGMP agonists on signalling of dense granule release. This chapter represents an exploration into the interplay between cGMP, cAMP and calcium using chemical agonists, inhibitors and parasite mutant cell lines to investigate how the signalling network fits together, in particular with regard to secretion. In doing so, I hope to explore and possibly discover new ways in which these signalling factors contribute to the parasite motility and invasion processes already established from the implication of RNG2 in signalling and secretion.

79

80 4.2 Results.

4.2.1 Observations on dense granule secretion in Toxoplasma.

During the course of the RNG2 analysis of regulated secretion, I noticed that the secretion of dense granule proteins in extracellular secretion assays was not constant in all treatments as had been expected for constitutive secretion. Tracking the secretion of GRA1 indicated that in conditions where microneme secretion was increased, GRA1 secretion was often reduced. Regardless of the state of RNG2 presence or depletion, treatment with A23187 inhibited dense granules from being secreted. A titration of A23187 analysing several dense granule proteins showed that a secretion of all of them (GRA1, GRA2 and GRA5) were inhibited with increasing concentrations of this calcium ionophore up to 5µM (Figure 4.1). This was also seen with Ionomycin, a different compound which also acts as a calcium ionophore (Figure 4.1). Further, the release of ProMIC5, which has previously been shown to behave like a dense granule protein (Brydges et al. 2008) , also shows reduced secretion with increasing calcium stimulus (Figure 4.1). The processed mature form, MIC5 is upregulated as expected for a canonical microneme the same as MIC2 (Figure 4.1). TOM40 was used as a pellet control to confirm equal parasite numbers across these treatments (Figure 4.1).

Figure 4.1. Secretion assay of tachyzoites treated with calcium ionophore A23187 or Ionomycin.

Effects of increasing concentrations (μM) of A23187 and Ionomycin on secretion in extracellular parasites. DMSO was used as a solvent control. Wild type (Ku80+HX) parasites were harvested after 2 days of growth and stimulated to secrete for 20 minutes before separation of parasites and supernatant fractions. ESA (Excreted/Secreted Antigen) supernatant fractions were probed with antibodies to MIC2, MIC5, GRA1, GRA2 and GRA5. anti-TOM40 was used to label the parasite pellets to confirm similar levels of parasites within each sample.

81 To explore this further, secretion of dense granules was observed upon treatment with cGMP agonists. Given that it is known now that cGMP stimulus leads to calcium release from internal stores, treatment with cGMP agonists would be predicted to also result in inhibition of dense granule secretion. Extracellular secretion assays were performed using increasing concentrations of zaprinast and BIPPO (Figure 4.2 A). Interestingly, zaprinast did not appear to inhibit GRA1 release even using a high concentration of 500µM, although at these levels it could increase MIC2 secretion (Figure 4.2A). BIPPO, however was able to stimulate MIC2 secretion at much lower concentrations compared to zaprinast, and BIPPO was able to inhibit GRA1 release at concentrations of more than 1µM, similar to that seen for calcium ionophore A23187 (Figure 4.1, 4.2). However, at very low concentrations, BIPPO behaved the same way as zaprinast and upregulated MIC2 secretion without causing a noticeable decrease in GRA1 secretion (Figure 4.2B). Based on this, it appears that cGMP agonists can suppress dense granule release but only provided with a strong enough stimulus.

82

Figure 4.2. Effects of zaprinast and BIPPO on secretion in extracellular parasites.

A) Wild type (Ku80+HX) parasites were grown for 2 days prior to harvest. Extracellular parasites were treated with increasing concentrations (μM) of zaprinast or BIPPO. ESA (Excreted/Secreted Antigen) supernatant fractions were probed with antibodies to MIC2, GRA1. Anti-TOM40 was used to control for similar populations of parasites within each sample. B) Secretion of extracellular parasites upon treatment with calcium and cGMP agonists. Wild type (Ku80+HX) cells were grown for 2 days prior to harvest. Extracellular parasites were treated with indicated concentrations of each agonist for 20 minutes before separation of supernatant and parasites. ESA fractions were probed for MIC2 and GRA1. TOM40 was used to label pellet fractions to confirm similar levels of parasites within each

83 sample. Error bars represent SEM, A23187 n=8 biological replicates, BIPPO n=10 biological replicates. P<0.05 =*, <0.01=**, <0.001=***, <0.0001=****, <0.00001=*****

4.2.2 PKG inhibition prevents cGMP dependent inhibition of dense granule secretion.

Having tested the effects of cGMP and calcium-dependent secretion with agonists of these pathways, I used the PKG inhibitor Compound 2 to more directly test for the role of PKG (Wiersma et al., 2004). Similarly, the PKG inhibitor Compound 1 has been shown to make tachyzoites unresponsive to BIPPO stimulus (Stewart et al. 2016).ΔKu80 TATi parasites (Sheiner et al. 2011) were treated with increasing concentrations of BIPPO, while in the presence of Compound 2 or DMSO solvent control, to examine if parasites could still inhibit GRA1 release under PKG inhibition (Figure 4.3). Even at low concentrations of 1µM Compound 2, this was enough to prevent BIPPO from triggering inhibition of dense granule secretion as indicated by GRA1 (Figure 4.3). Curiously, the levels of GRA1 secretion appeared to stay fairly constant and were not noticeably increased by treatment with Compound 2 (Figure 4.3), consistent with previous reports that BAPTA-AM has no effect on dense granule release (Carruthers and Sibley 1999). So while downstream calcium increase appears to be necessary for inhibition of dense granule proteins, inhibition of calcium release via cGMP-responsive protein PKG does not appear to increase GRA1 secretion. CDPK1 is a known off- target of Compound 2 (Donald et al. 2006), however for the purpose of this experiment, it is not the main questions since we are simply testing a drug known to target one or more kinases involved in calcium signalling.

Figure 4.3. Secretion assay of tachyzoites in response to Compound 2:

Wild type (Ku80+HX) tachyzoites were grown for 2 days prior to harvest. Extracellular parasites were pre-treated with Compound 2 as indicated for 5 minutes at room temperature, before treatment with BIPPO as indicated. Cells were shifted to 37°C for 20 minutes, before separation of parasites

84 from supernatant. ESA (Excreted/Secreted Antigen) supernatant fractions was analysed by western blot and probed for MIC2 and GRA1. Anti-TOM40 was used to label the parasite pellets to confirm similar parasite population per sample.

Figure 4.4, Secretion assays of RNG2 iHA in response to A23187 and BIPPO treatment.

A) iΔHA-RNG2 cells were pre-treated for 2 days with or without ATc. Extracellular cells were treated with either 5 μM A23187 (Ca2+) or 2.5 μM BIPPO (cGMP) for 20 minutes at 37 °C, before pelleting of parasites from supernatant fraction. The ESA (Excreted/Secreted Antigen) supernatant fraction was

85 analysed by western blot and probed for MIC2 and GRA1 secreted proteins. Anti-TOM40 was used to label the parasite pellets to control for similar parasite populations, and anti-HA was used to confirm RNG2 downregulation. Where no stimulus was used, DMSO was added as a vehicle only control. B) Quantitative analysis of secretion in western blots. Relative secretion was measured by quantitative western blot for both MIC2 and GRA1 from western blots in (A). Pixel intensity values for MIC2 or GRA1 were standardized to TOM40 to control for variations in parasite numbers. Each biological replicate set (-ATc DMSO, -ATc stimulated, +ATc DMSO, +ATc stimulated) was then normalized again to the respective –ATc DMSO control within each replicate set to adjust for variations in secretion levels between experiments. Hence –ATc DMSO have zero error bars. Error bars represent SEM, for A23187 samples n=8 biological replicates, and for BIPPO n=10 biological replicates. C) Relative secretion of MIC2 in DMSO control samples. Graph provides a scaled-up view of the samples underlined in red in (B). Error bars represent SEM, A23187 n=8 biological replicates, BIPPO n=8 biological replicates. P<0.05 =*, <0.01=**, <0.001=***, <0.0001=****, <0.00001=*****

4.2.3 RNG2 and CDPK mutants are unresponsive to agonists that inhibit dense granule release.

Having established a role for cGMP and calcium in inhibiting dense granule release, I sought to test mutants of proteins known to be involved in these pathways to better define the mechanism for this dense granule secretion control. First I used my iΔHA-RNG2 cell line that upon RNG2 depletion is defective in cGMP-dependent secretion of MIC2 and AMA1, to test for the effect of RNG2 loss on dense granule secretory control. iΔHA-RNG2 cells were grown with or without ATc for 48 hours and treated with either 5µM A23187 or 2.5 µM BIPPO, which was found to be the most appropriate minimal concentration needed to trigger cGMP-dependent inhibition of GRA1. When treated with A23187, IΔHA-RNG2 cells responded very similarly regardless of presence or absence of RNG2, and showed increase in secretion of MIC2 and inhibition of release of GRA1 (Figure 4.4). However, when treated with BIPPO, RNG2 ablated cells showed less inhibition of GRA1 secretion compared with the –ATc controls (Figure 4.4). Consistent with this, in +ATc cells, MIC2 was unable to be secreted up to the levels seen in the –ATc control with RNG2 present. This supports the previous evidence of both zaprinast and 8Br-cGMP being less able to trigger MIC2 secretion in the IΔHA-RNG2 mutant.

To further explore the role of calcium in dense granule secretion control, mutants with known defects in calcium signalling were investigated to see if they could respond to this stimulus. In particular, the tetracycline-responsive iΔHA-CDPK1 mutant (Lourido et al., 2010) and the Δcdpk3 mutant (McCoy et al., 2012) were examined since they have previously been shown to have defects in calcium responses. When the Δcdpk3 cells were treated with A23187, inhibition of dense granule release was substantially lost, supporting the role of calcium sensing in this effect (Figure 4.5). However, when Δcdpk3 was treated with BIPPO, the dense granules appeared to be able to respond to this stimulus almost as efficiently as the parent Ku80 +HX cell line (Figure 4.5). Concurrent with this inhibition of GRA1 release, Δcdpk3 was able to increase MIC2 secretion substantially when given a cGMP stimulus with BIPPO (Figure 4.5). Interestingly, the Δcdpk3 was able to secrete micronemes constitutively almost as efficiently as the parental control (Figure 4.5). However, Δcdpk3 was unable to increase this basal secretion of MIC2 when given a calcium stimulus with A23187 (Figure 4.5).

When iΔHA-CDPK1 cells were treated with A23817, with CDPK1 depleted (+ATc) dense granule secretion was less inhibited by calcium stimulus than those cells with CDPK1 present (Figure 4.6).

86 Concurrent with this, stimulated secretion of MIC2 was reduced in CDPK1 ablated cells in accordance with previous findings that knockdown of CDPK1 results in reduced A23187 triggered MIC2 secretion (Lourido et al., 2010). The CDPK1 ablated cells were also less microneme-responsive to cGMP stimulus consistent with previous findings (Lourido et al., 2012), and although a considerable amount of secretion was still observed, it is still less than the control with CDPK1 present (Figure 4.6). It should be noted that even after 72 hours of ATc treatment, there was still a small amount of CDPK1 protein present in the knockdown cells, and this residual CDPK1 could be why there was still a noticeable response to cGMP stimulus (Figure 4.6). CDPK1 knock-down also caused cells to be less responsive to BIPPO induced inhibition of GRA1 secretion. Levels of secretion of GRA1 in DMSO controls of ATc treated and untreated iΔHA-CDPK1 cells show some minor variation, but are mostly unchanged (Figure 4.6)

6). Interestingly, it is shown here for the first time that loss of CDPK1 results in a severe constitutive secretion defect of MIC2 secretion, where previously only responsiveness to A23187 and ethanol stimuli was tested (Lourido et al., 2010; Lourido et al., 2012). Taken together, these results show that mutants defective in calcium signalling are less responsive to calcium agonists that inhibit dense granule secretion, showing that the A23187-dependent inhibition of dense granules is most likely due to calcium flux and not pleiotropic effects, or reduced fitness.

87

Figure 4.5, Secretion assays of Δcdpk3 in response to A23187 and BIPPO treatment.

A) Δcdpk3 cells or wild type (Ku80+HX) cells were grown for 2 days prior to harvest. Extracellular cells were treated with either 5 μM A23187 (Ca2+) or 2.5 μM BIPPO (cGMP) for 20 minutes at 37 °C, before separation of parasites from supernatant fraction. The ESA (Excreted/Secreted Antigen) supernatant fraction was analysed by western blot and probed for MIC2 and GRA1 secreted proteins. anti-TOM40 was used to label the parasite pellets to control for similar parasite numbers, and anti-CDPK3 was used to confirm loss of CDPK3. Where no stimulus was used, DMSO was added as a vehicle only control. B) Quantitative analysis of secretion in western blots. Relative secretion was measured by quantitative western blot for both MIC2 and GRA1 from western blots in (A). Pixel intensity values for MIC2 or GRA1 were standardized to TOM40 to control for variations in parasite populations. Each biological replicate set (-ATc DMSO, -ATc stimulated, +ATc DMSO, +ATc

88 stimulated) was then normalized again to the respective –ATc DMSO control within each replicate set to adjust for variations in secretion efficiency between experiments. Hence –ATc DMSO have zero error bars. Error bars represent SEM, and for A23187 samples, n=7 biological replicates, and for BIPPO, n=5 biological replicates. B) Relative secretion of MIC2 in DMSO control samples. Graph provides a close-up view of the samples underlined in red in (B). Error bars represent SEM, A23187 n=8 biological replicates, BIPPO n=10 biological replicates. P<0.05 =*, <0.01=**, <0.001=***, <0.0001=****, <0.00001=*****

Figure 4.6. Secretion assays of CDPK1 iHA KD in response to A23187 and BIPPO treatment.

89 A) iΔHA-CDPK1 cells were pre-treated for 72 hours with or without ATc. Extracellular cells were treated with either 5μM A23187 (Ca2+) or 2.5μM BIPPO (cGMP) for 20 minutes at 37°C, before separation of parasites from supernatant fraction. The ESA (Excreted/Secreted Antigen) supernatant fraction was analysed by western blot and probed for MIC2 and GRA1 secreted proteins. anti- TOM40 was used to label the parasite pellets to control for similar parasite populations, and anti-HA was used to confirm CDPK1 downregulation. Where no stimulus was used, DMSO was added as a vehicle only control. B) Quantitative analysis of secretion in western blots. Relative secretion was measured by quantitative western blot for both MIC2 and GRA1 from western blots in (A). Pixel intensity values for MIC2 or GRA1 were standardized to TOM40 to control for variations in parasite populations. Each biological replicate set (-ATc DMSO, -ATc stimulated, +ATc DMSO, +ATC stimulated) was then normalized again to the respective –ATc DMSO control within each replicate set to adjust for variations in secretion efficiency between experiments. Hence –ATc DMSO have zero error bars. Error bars represent SEM, and for A23187 samples, n=8 biological replicates, and for BIPPO, n=8 biological replicates. C) Relative secretion of MIC2 in DMSO control samples. Graph provides a close-up view of the samples underlined in red in (B). Error bars represent SEM, A23187 n=8 biological replicates, BIPPO n=10 biological replicates. P<0.05 =*, <0.01=**, <0.001=***, <0.0001=****, <0.00001=*****

4.2.4 cAMP and cGMP have antagonistic effects on microneme secretion.

Lastly, I explored the possible role of cAMP in the control of microneme and dense granule secretion. It has been reported that BIPPO has some inhibitory activity in Plasmodium cAMP Phosphodiesterases (PDEs) as well as cGMP pPDEs (Howard et al. 2015). So, it could be that the increased potency of BIPPO is in part due to the ability to inhibit both multiple cGMP and cAMP PDEs. The effects of cAMP were investigated by direct addition of stable analogues of cAMP and cGMP, in order to gauge the effect of cAMP compared to cGMP. 8Br-cGMP was previously shown to trigger MIC2 secretion in extracellular tachyzoites (Figure 3.7) (Katris et al. 2014) . Equal concentrations of the 8Br-cAMP analogue, which is identical in structure except for the adenine base, were added to extracellular parasites. With increasing concentrations of 8Br-cGMP, microneme secretion of MIC2 was increased, and the levels of constitutively expressed GRA1 remained constant (Figure 4.7) (Figure 4.7). Surprisingly, when treated with equal and increasing concentrations of 8Br-cAMP, MIC2 secretion is slowly decreased (Figure 4.7). GRA1 secretion remained constant regardless of increasing drug concentration indicating that the cells are still viable and the loss of MIC2 secretion is due to the chemical stimulus not the viability of the cells. TOM40 served as a pellet control to ensure similar numbers of parasites being assayed. This suggests that cGMP and cAMP both have opposing roles in regard to microneme secretion.

90

Figure 4.7. Secretion assays of wild type extracellular parasites in response to treatment with stable analogues of cGMP or cAMP.

A) Wild type (Ku80+HX) cells were grown for 2 days prior to harvest. Extracellular cells were treated with increasing concentrations (mM) of 8Br-cAMP or 8Br-cGMP for 20 minutes at 37 °C, before separation of parasites from supernatant fraction. Equivalent volume of 1xPBS was used as a solvent control (0mM). The ESA (Excreted/Secreted Antigen) supernatant fraction was analysed by western blot and probed for MIC2 and GRA1 secreted proteins. Anti-TOM40 was used to label the parasite pellets to control for similar parasite numbers. B) Quantitative analysis of six biological replicates of the cAMP and cGMP secretion assays shown in A. Pixel intensity values of MIC2 or GRA1 were standardized to TOM40 to control for small variations in cell numbers, and plotted on a bar graph. Error bars represent SEM, n=6, *P<0.05.

91

92 4.3 Discussion.

4.3.1 Dense granule secretion is inhibited by increased calcium release.

Prior to this study there had been no report of the effect of cGMP signalling on dense granule proteins. The fact that we see this inhibition of secretion for BIPPO but not for zaprinast or 8-Br- cGMP appears to be more a reflection on the potency of the compounds as opposed to the targets of the two. At 0.5µM, BIPPO appears to have no effect on GRA1 secretion and is still able to elevate MIC2 secretion just like zaprinast (Figure 4.2). It is interesting though that microneme secretion can be increased with cGMP before the dense granule release is suppressed (Figure 4.2). This seems to be in accordance with recent evidence that the phosphatidic acid signalling system is capable of inducing microneme secretion without triggering a sustained downstream calcium flux (Bullen et al., 2016). In this study, the authors found that there was lipid dependent signalling pathway based on the activity of DAG kinase 1, which produced phosphatidic acid from diacylglycerol to activate microneme secretion, which was independent of calcium flux (Bullen et al. 2016). An agonist of PA synthesis had no effect on downstream calcium flux suggesting that MIC2 secretion can be independent of calcium release (Bullen et al. 2016). So, the evidence presented here suggests that GRA1 inhibition can be seen as an indirect marker for calcium flux. The observation that BIPPO can inhibit GRA1 secretion only at elevated concentrations fits with the notion that calcium flux is responsible for inhibiting dense granule release (Figure 4.2). This observation of inhibition of dense granule proteins has been observed in some publications where the secreted GRA1 protein in the A23187 treated samples is slightly lower than the respective DMSO control (Carruthers and Sibley, 1999; Kafsack et al., 2009). The authors of the early publications (Carruthers and SIbley 1999, Carruthers et al. 1999)which established the model that dense granules are constitutively secreted and unresponsive to calcium stimulus came to this conclusion because GRA1 secretion was seen to be less dynamic than MIC2 secretion given GRA1 secretion cannot be upregulated by BAPTA-AM (Carruthers and Sibley, 1999). Also, ethanol reportedly did not cause a decrease in GRA1 secretion (Carruthers and Sibley, 1999), but given the evidence that implicates ethanol in stimulating PI-PLC dependent IP3 release from the breakdown of PIP2 (Bullen et al. 2016), ethanol might be expected cause a decrease in GRA1 secretion. But the mechanism of action has not been extensively researched and may be such that it doesn’t produce a sustained calcium flux and is more physiologically relevant as it can be used to stimulate the same parasite population multiple times (Bullen et al., 2016; Del Carmen et al., 2009).

This data suggests that a strong calcium response is seen to lead to inhibition of GRA1 release (Figure 4.1), and this can be seen with either the calcium ionphore A23187 (Figure 4.1, 4.4, 4.5, 4.6), or BIPPO (Figure 4.2, 4.3, 4.4, 4.5, 4.6), both of which are known to produce a wide-spread calcium response in the tachyzoite (Stewart et al. 2016) . However some of the other agents used to create signalling responses, including zaprinast, 8-Br-cGMP, and ethanol, while they do lead to increased secretion of micronemes, these don’t lead to dense granule inhibition. This might be because their level of stimulated calcium flux is below a particular threshold needed to see the effect of dense granule inhibition, or that any calcium response generated is localised and not appropriately positioned to affect dense granule secretion. An example of this is thapsigargin, which is reported to stimulate localized calcium release via inhibition of a predicted SERCA calcium ATPase (Pace et al. 2014). This localized calcium flux is less efficient at increasing tachyzoite motility but its effect is increased by exposure to higher levels of extracellular calcium in the media (Pace et al. 2014). It would be interesting to investigate if this effect of thapsigargin is applicable to dense granule secretion inhibition. Taken together, it appears that inhibition of dense granule secretion in

93 extracellular tachyzoites most likely requires a particular threshold of calcium flux, which only certain agonists are able to provide.

4.3.2 Inhibition of dense granule secretion is regulated by CDPKs and is not a pleiotropic effect.

It has been observed and well documented that calcium ionophores are capable of killing parasites in a process known as Ionophore Induced Death (IID) (Arrizabalaga et al., 2004; Black et al., 2000). In these studies, extracellular parasites treated for 40 minutes with calcium ionophore became unviable after dying presumably from hyperactive calcium flux (Arrizabalaga et al., 2004; Black et al., 2000). A chemical mutagenesis screen under ionophore treatment identified IID mutants which were resistant to ionophore induced death (Arrizabalaga et al., 2004; Black et al., 2000). The authors of this study concluded that the ionophore caused parasites to become exhausted from hyperactive movement, and possibly cytotoxicity from systemic calcium release (Arrizabalaga et al., 2004; Black et al., 2000). A possible concern regarding the results shown in this chapter is that these compounds are causing the parasites excessive stress that results in them losing normal metabolic processes facilitating secretion of dense granules. An argument against this is that MIC2 secretion is upregulated, but it is conceivable that the during the 20 minutes at 37°C in which the secretion assay was carried out, MIC2 might be secreted while the parasites are still healthy and arrest at some point after stimulus. Furthermore, the knockout of CDPK3, and inducible knockdown of CDPK1, resulted in an inability of cells to respond to A23187 stimulus and inhibit dense granule secretion, suggesting that this is a real signalling event, and not an indirect effect on cell health. It would be interesting to see if this inability to inhibit dense granule secretion can be seen in all IID mutants (Arrizabalaga et al., 2004; Black et al., 2000) or just the ones with CDPK3 mutated (Garrison et al., 2012), which would give insight into whether additional proteins are responsible for controlling dense granule inhibition. The responsiveness of Δcdpk3 to cGMP dependent stimulus of MIC2 increase and GRA1 inhibition, but not CDPK1 knockdown cells is in complete agreement with data published investigating egress and secretion of chemical mutagenesis mutants of CDPK1 and CDPK3 in response to zaprinast (Lourido et al., 2012). The authors began looking at CDPK1 and CDPK3 using a gatekeeper mutation strategy in which these kinases have a mutation that makes them susceptible or resistant to a class of Bumped Kinase inhibitor compounds (Lourido et al. 2012). Inhibition of CDPK1 resulted in similar defects in motility and microneme secretion in response to cGMP or calcium stimulus, just as has been seen here where iΔHA-CDPK1 is unable to modulate secretion by upregulating secretion of MIC2 and downregulating secretion of GRA1 (Figure 4.6). This is evidence that CDPK1 forms an important endpoint of both cGMP and calcium signalling. The levels of secretion in iΔHA-CDPK1 does show reduced but considerable MIC2 secretion so it is unclear if this is due to activity of CDPK3 compensating for loss of CDPK1 or if there is residual CDPK1 in the knockdown samples (Figure 4.6). Despite this, CDPK1 is most likely the main enzyme responsible for activating the motility related processes in response to both of these signals. It is conceivable that the cells might be losing viability over the 20 minute incubation, and given the tight coordination seen together with MIC2 secretion I would consider this unlikely, but this can be tested for over a time course at multiple time points from about 1 minute onwards to see if these time points match up well to the 20 minute time point. However, there is a problem here of obtaining enough secreted material to test this. But this would seem unlikely Therefore, the simplest conclusion would be that CDPK1 is downstream of both cGMP and calcium signals.

Similarly in Compound 2-dependent PKG inhibition and RNG2 knockdown, both are unresponsive to BIPPO with respect to inhibition of GRA1 secretion. RNG2 knockdown appears to be sensitive to A23187, and recovery of MIC2 secretion with A23187 co-occurs with reduction in GRA1 secretion

94 (Figure 4.4) . Given that functional ablation of both PKG (Stewart et al. 2016) and RNG2 causes an inability to trigger downstream calcium flux, this further supports that calcium is indeed responsible for regulating dense granule secretion. Although it has been shown that Compound 2 can inhibit CDPK1 as well as PKG (Donald et al. 2006), and it can’t be ruled out completely that the results in Figure 4.3 represent co-inhibition of CDPK1.

4.3.3 Consolidating secretion with invasion in the Δcdpk3.

CDPK3 is unusual in that there was no reported defect in invasion of CDPK3 mutants (Lourido et al., 2012; McCoy et al., 2012). This was also confirmed by two other independent publications which showed a Δcdpk3 was capable of invading normally (Garrison et al., 2012; McCoy et al., 2012). CDPK3 gatekeeper mutants also showed a defect in motility and microneme secretion in response to calcium stimulus (Lourido et al. 2012). However, this was not reported for the Δcdpk3 (McCoy et al. 2012). Instead they found that there was no defect in motility or in microneme secretion (McCoy et al. 2012). McCoy et al. suggest that CDPK3 has a role specifically in calcium dependent upregulation of microneme secretion associated with egress, but otherwise are most likely capable of secreting micronemes or at least partially responding to stimulus. However, McCoy et al. did not find a defect in motility as was reported by Lourido et al. 2012. These differences might be due to differences in experimental procedure where Lourido et al. used a K+ buffer shift for their motility assays, while McCoy et al. did not. It should also be pointed out that neither study showed conclusively whether or not CDPK3 had a constitutive secretion defect or not. This is a critical detail because evidence of a mutant that is unable to secrete micronemes but is still able invade is extremely unusual and contradicts the dogma of microneme necessity for invasion processes.

Despite recent evidence that there may be alternate mechanisms of invasion that the parasites can use to enter host cells (Andenmatten et al. 2013), the levels of invasion that were reported for the CreLox mutants in Andenmatten et al. were not as high as what was reported for the Δcdpk3 (McCoy et al. 2012), suggesting CDPK3 has normal and not residual invasion. My data seems to reconcile these seemingly conflicting datasets of McCoy et al. and Lourido et al. by addressing the question of whether CDPK3 can constitutively secrete micronemes (Figure 4.5). In my assays Δcdpk3 cells secreted MIC2 at a basal level, but could not upregulate MIC2 secretion or downregulate GRA1 secretion with A23187 treatment, but could with BIPPO stimulus. This might explain how CDPK3 could have a defect in regulation of microneme secretion but still invade normally because cGMP is able to generate secretory events not seen by calcium stimulation alone. In contrast, knockdown of CDPK1 results in a severe constitutive secretion defect of MIC2. In fact, this is the first data showing CDPK1 has a constitutive secretion defect where previously only responses to A23187 and ethanol were documented(Lourido et al. 2010, Lourido et al. 2012). These data together consolidate the secretion defects of CDPK1 and CPDK3 mutants with their respective invasion defects, to explain seemingly conflicting datasets (McCoy et al., 2012). It has previously been shown that CDPK3 inhibited cells are capable of egressing in response to zaprinast, but not A23187 (Lourido et al. 2012). Also, CDPK3 inhibited cells can secrete MIC2 quite well in response to ethanol stimulus but not A23187(Lourido et al. 2012). Given the recent evidence linking ethanol and PLC to the cGMP signalling pathway (Bullen et al. 2016), these results are in complete agreement with the results presented here showing that CDPK3 can respond to BIPPO stimulus to upregulate MIC2 and downregulate GRA1 secretion. The ability to inhibit GRA1 secretion correlates very well with the ability of the cells to secrete micronemes in all CDPK3 mutants and chemical inhibition experiments. So it appears that the regulation of secretion of microneme and dense granules has an inverse relationship dependent on calcium.

95 4.3.4 PKG and cGMP as the major determinant for microneme secretion?

Taken together, the RNG2 and Compound 2 data (Figure 4.3, 4.4), together with CDPK1 (Figure 4.6) suggest that the cGMP-dependent PKG pathway is a major mechanism for activating microneme secretion, and is still active in the Δcdpk3 (Figure 4.5). PKG can still upregulate MIC2 secretion together with CDPK1 via cGMP,. This could explain why constitutive secretion is active in Δcdpk3 but not CDPK1 knockdown. This would suggest that PKG and CDPK1 act like the ignition to turn on the invasion process, while CDPK3 acts as an accelerator to increase secretion and motility when it is required. In accordance with this model, it has been shown that CDPK1 is hyperphosphorylated in the Δcdpk3 cell line (Treeck et al. 2014), although it is unclear if this is required for increased responsiveness to calcium or to increase activity of the cGMP signal path. Also it is presently unclear if activation or expression of the calcium-independent phosphatidic acid signalling module (Bullen et al. 2016) is upregulated in the Δcdpk3 as has been shown for hyperphosphorylation of CDPK1 in the Δcdpk3 (Treeck et al. 2014). The authors of Lourido et al. 2012 sought to identify the link between cGMP and calcium and their results which show that CDPK1 is an endpoint for cGMP and calcium signalling, but that CDPK3 is only an endpoint for calcium but not cGMP, are in agreement with what has been presented here for both CDPK1 and CDPK3 (Figure 4.5, 4.6). Here I present evidence thatiΔHA-CDPK1 cannot inhibit dense granules with calcium or cGMP stimulus, and that Δcdpk3 cannot inhibit dense granules with a calcium stimulus, but it can with a cGMP stimulus. Functional ablation of PKG, RNG2 and CDPK1 are all unresponsive to cGMP stimulus and all show a constitutive secretion defect, suggesting that PKG is likely the main signal path involved in initiating microneme secretion. This may be related to the phosphatidic acid and phosphoinositide signalling components as has been previously described to be associated with PKG (Bullen et al. 2016, Brochet et al. 2014).

4.3.5 Proteomic studies suggest possible phosphorylation targets involved in regulation of dense granule secretion.

Interestingly, proteomic studies of CDPK1 and CDPK3 have been performed and provide candidates which might be responsible for trafficking control of these dense granules (Lourido et al. 2013, Treeck et al. 2014). Both investigations showed that CDPK1 and CPDK3 were associated with a diverse array of proteins involved in secretion, vesicle fusion and also some specific dense granules CDPK1 was shown to phosphorylate GRA3 and GRA7 (Lourdio et al. 2013) while GRA5 was hyper- phosphorylated in the Δcdpk3 (Treeck et al. 2014). However, there were no other known dense granule proteins, including GRA1 was detected in these screens, although there may be some unknown dense granule proteins listed as hypothetical proteins in the screens which are yet to be localized. The fact that so few dense granule proteins are found would suggest that phosphorylation of dense granule proteins by CDPK1 and CDPK3 were likely not responsible for regulating this inhibition of secretion, although this cannot be completely ruled out. More likely, that CDPK1 and CDPK3 phosphorylate other proteins which in turn control the calcium dependent inhibition of dense granule release, such as vesicle fusion proteins. For example, Rab5 is differentially phosphorylated in the Δcdpk3 (Treeck et al. 2014) but no such proteins appear as phosphorylation targets of CDPK1 (Lourido et al. 2013). It is not even known at this point if CDPK1 and CDPK3 control the same protein or set of proteins responsible for inhibiting dense granule secretion in extracellular tachyzoites. Possibly CDPK1 and CDPK3 are responsible for phosphorylating different proteins both of which are equally important for dense granule secretion regulation. There is currently no validated target list for PKG in Toxoplasma so it is not known whether any phosphorylation targets overlap between PKG, CDPK1 and CDPK3. Although a phosphoproteome has been obtained for P. falciparum (Alam et al., 2015), it is not known if these targets are an accurate comparison for PKG

96 targets in Toxoplasma or even if Plasmodium species would even regulate dense granules in a similar manner. A phosphoproteome screen might also be useful for iΔHA-RNG2 in Toxoplasma to compare with PKG inhibition to see how many proteins are differently phosphorylated between the two to get an idea of how similar their knockdown effects are on parasites.

4.3.6 Contributions to the signal network to invasion from proteomic studies:

In comparison to the proteomic studies on PKG inhibited Plasmodium, it was found that many similar diverse sets of proteins involved in motility and metabolism were differentially phosphorylated in the Δcdpk3 (Treeck et al., 2014). Among the proteins of the phosphoproteome of CDPK3 (Treeck et al., 2014) were the motor components MyoA and MLC1, and a BioID interaction study confirmed that CDPK3 was directly phosphorylating MyoA to activate the gliding machinery (Gaji et al., 2015). However, there is no evidence yet that CDPK1 phosphorylates glideosome components beyond actin (Lourido et al., 2013). It is very conceivable that this might have something to do with their relative localizations, because CDPK1 might not be able to access the glideosome machinery. CDPK1 has previously been reported to localize broadly to the cytosol (Donald et al., 2006; Lourido et al., 2010), while CDPK3 has been shown to localize exclusively to the plasma membrane (McCoy et al., 2012). So, since CDPK1 is such a highly expressed ubiquitous protein within the cytosol, it is conceivable that it can interact with a large number of proteins including those toward the apical complex, but not have access the plasma membrane. In fact, apical complex AKMT is essential for activating parasite motility (Heaslip et al. 2011) and has been shown to be phosphorylated by CDPK1 (Lourido et al. 2013). The possible lack of AKMT phosphorylation by CDPK1 shows that CDPK1 is capable of phosphorylating apical complex proteins and could contribute to the motility defect seen in the iΔHA-CDPK1 (Lourido et al. 2010). These different localizations could also account for the different behaviours of CDPK1 and CDPK3 in conoid extrusion. Although the model described is still unclear because ∆AKMTwas not found to have a conoid defect (Heaslip et al. 2011) and it is not known if this is related to the function of CDPK1. The presence of a conoid extrusion defect in iΔHA-CDPK1 suggests that maybe the conoid extrusion defect contributes more to the invasion defect than micronemes as was initially thought (Lourido et al. 2010). It should also be mentioned that many of the proteins listed in these phosphorylation studies are hypothetical proteins of unknown function and without a clear idea of what these hypothetical proteins are, there are still gaps in the current models for phosphorylation by CDPKs (Treeck et al. 2014, Lourido et al. 2013).

4.3.7 Effects of cAMP suggest a role for shutting down invasion processes.

In interpreting the behaviour of parasites in response to BIPPO stimulus, it remained a possibility that BIPPO was capable of targeting alternative cyclic dinucleotide phosphodiesterases (PDEs), including those that could modulate levels of cAMP in addition to cGMP in Toxoplasma. This prompted me to test for function of cAMP in Toxoplasma using chemical analogues of the two cyclic nucleotides to try to discern their effects on Toxoplasma secretion. Previous research has reported that cGMP and cAMP stable analogues have no effect on Toxoplasma secretion (Brown et al. 2016) however the authors didn’t use these drugs at high enough concentrations as presented here (Figure 4.7). It is unlikely my results would represent an artefact of high concentrations of these analogues because dense granule secretion is unaffected (Figure 4.7). 8-Br-cGMP gave similar responses to BIPPO and zaprinast in wild type cells (Figure 4.2, 4.7) (Katris et al. 2014) and none could successfully stimulate MIC2 secretion in iΔHA-RNG2 cells (Katris et al. 2014), suggesting relevant physiological cGMP-dependent responses. My data shows that increasing cAMP leads to decreasing microneme secretion, although no change in dense granule secretion (Figure 4.7). It is possible that cAMP is reducing free calcium in the cytosol, although that might possibly be expected to result in increased

97 dense granule release, which is not seen in my experiments. Either that is because the fluctuations in calcium here are too small to trigger this response, or cAMP acts at a different part of the signalling pathway, potentially inhibiting elements of the cGMP/PKG response. Either way, if BIPPO does have any activity on cAMP PDEs, the effect would apparently be to counter the apparent cGMP response. So the increase in microneme and decrease in dense granule secretion that I report for BIPPO are most likely due to it generating an increase in cGMP. This might also explain the differences in effectiveness of BIPPO and zaprinast (Figure 4.2) because it might be that zaprinast is inhibiting at least some cAMP PDEs, which counter the effect of cGMP PDE inhibition. However, at least some cAMP processing activity has been reported for BIPPO (Howard et al., 2015), so it is impossible to completely rule out the effect of BIPPO on a cAMP PDE, or a combination of cGMP and cAMP PDE proteins. The same is true of zaprinast and while this antagonistic effect of cGMP and cAMP is one explanation for the differing potency of these two drugs, more work is needed to conclusively show this is the case.

It is interesting to consider my data that suggests that cAMP inhibits invasion-related behavours with evidence of cAMP’s involvement in the conversion to the bradyzoite stage of the Toxoplasma life cycle (Sugi et al. 2016) . Functional ablation of cAMP signalling components results in tachzyzoites which are unable to convert to bradyzoite cyst stages (Sugi et al., 2016). Bradyzoites cysts are considered to be relatively dormant replicative stages and stimulus with cAMP agonists will accelerate this process (Eaton et al. 2006). This is consistent with the invasion processes being less needed in slow growing stages and so cAMP would suppress these processes. However the effects of cAMP signal pathway proteins have not been extensively investigated in tachyzoite stages and it is curious to speculate on what might happen to cAMP mutants in tachyzoite stages. Interestingly, inhibition of PKG with Compound 1 has been shown to increase tachyzoite to bradyzoite conversion as well (Eaton et al. 2006). So it seems that cGMP has an inverse relationship with cAMP with respect to bradyzoite conversion and it is interesting that an inverse relationship is also seen in extracellular tachyzoites with respect to microneme secretion. It would be interesting to see how mutants of cAMP signalling behave in extracellular tachyzoite stages, and would be a productive avenue for future research.

4.3.8 PKA and cAMP in P. falciparum:

The current studies in P. falciparum, suggests that functional ablation of PKA results in parasites which are unable to secrete micronemes (Dawn et al., 2014). This suggests that PKA might be performing different functions in Plasmodium compared to Toxoplasma. Similarly the authors found that PKA and cAMP stimulating agonists, such as IBDX, stimulated secretion of AMA1, so cAMP appears to be necessary for microneme secretion (Dawn et al. 2014). However, the authors never examined the effects of just cAMP analogue on its own. Instead they always used it together with a cAMP or PKA agonist. Itis also likely that the concentrations of cAMP and PKA agonists used in Dawn et al. 2014 may not be appropriate for visualizing this effect as seen with Toxoplasma. It is also unclear whether the dominant negative PKAr mutant used has any pleiotropic effects since an equivalent dominant negative mutant using the wild type sequence of PKAr was not used as a control in this study (Dawn et al. 2014). Taken together, my data show that cAMP stable analogues have an inhibitory effect on the secretion of micronemes, which is contradictory to current literature in Plasmodium which suggests agonists of the cAMP pathway can stimulate microneme secretion in extracellular invasive merozoites (Dawn et al. 2014), so cAMP may be operating differently between the two species, but further work is needed to validate this.

98 Cyclic AMP and PKA signalling is still a mysterious black box, owing to the lack of available molecular tools to dissect these processes. There are also numerous predicted cAMP-dependent protein kinases in Toxoplasma (toxodb.org) (Gajria et al. 2008) which makes the cAMP signalling system more complicated compared to the signalling of PKG, for which there is only one gene (Donald et al. 2002). Much more work needs to be done to put together a clear and concise network of interactions of cAMP signalling components, and to consolidate what is known in Plasmodium with Toxoplasma.

Figure 4.8. Schematic of signalling pathway of cGMP and calcium signalling components in Toxoplasma tachyzoites, leading to microneme secretion and dense granule inhibition.

4.3.9 Model for signalling events related to invasion in Toxoplasma.

The results presented here collectively represent an effort to undertake a global understanding of cGMP, cAMP and calcium signalling in secretion (Figure 4.8). It has been shown that cGMP and PKG signalling leads to a downstream calcium flux, which activates CDPKs to cause microneme secretion.

CDPK1 is most likely the most important downstream effector of microneme secretion given that it can’t respond to cGMP stimulus to increase MIC secretion or inhibit dense granule secretion (Figure 4.6). CDPK3, most likely acts as an accelerator to upregulate these processes initially turned on by

99 PKG and CDPK1 together. However, CDPK3 is still needed to assist CDPK1 (Figure 4.8) in upregulating microneme secretion and inhibiting dense granule secretion, but it’s presence to activate basal levels of microneme secretion (Figure 4.5) appear to be compensated for by CDPK1 and PKG activity, supporting previous reports (Treeck et al. 2014, Lourdio et al. 2012).

Assuming that dense granule inhibition in extracellular tachyzoites in suppressed by calcium, then it suggests that cGMP and PKG can lead to microneme secretion independent of calcium flux (Figure 4.2, 4.5). ). This is similar to what is seen in plasmodium gametocytes in which rounding up of Plasmodium gametocytes is PKG dependent but calcium independent (McRobert et al., 2008). It is likely that some aspects of Toxoplasma biology present a similar signalling pattern and microneme secretion might be one example. The notion that microneme secretion can be triggered by Zaprinast or BIPPO without internal calcium release is also consistent with previous evidence that stimulation of the phosphatidic acid signalling portion of the signal chain can trigger microneme secretion without sustained release of calcium from internal stores. Taken together, figure 4.3 is consistent with evidence that cGMP and PKG are associated with phosphatidic acid signalling components (Bullen et al. 2016).This phosphatidic acid signalling path has been shown to lead to microneme secretion without a sustained calcium release from internal stores and is linked to regulation by cGMP signalling (Bullen et al. 2016). However a direct molecular link is still elusive and would require more work to establish how these two portions of the signal chain fit together. Additionally, it is not clear if the secretion of dense granule proteins in extracellular parasites reflects the rates of intracellular secretion since they exhibit different calcium homeostasis. While there is some evidence to suggest cGMP stimulus can trigger microneme secretion with a sustained calcium flux, further work is required to investigate this to see if either zaprinast or BIPPO can behave the same way as propranolol under any conditions. Similarly, RNG2 must be downstream of cGMP-dependent activation of PKG because iΔHA-RNG2 is unresponsive to BIPPO treatment (Figure 4.4), although providing a calcium flux can activate downstream CDPKs (Figure 4.4). It is unclear if the phosphatidic acid signal agonist propranolol (Bullen et al. 2016) can increase microneme secretion in the iΔHA- RNG2 knockdown as has been reported elsewhere (Bullen et al. 2016), but would be interesting to pursue as it would give an idea of whether RNG2 operates in this pathway (Figure 4.8). Indeed, RNG2 has been shown to localize to a similar apical localization as has been reported for some of the phosphatidic acid signal components such as TgAPH and PI-PLC (Bullen et al. 2016). Clearly, more work is required to identify exactly where RNG2 sits in the signal chain to identify interacting partners and, perhaps just as importantly, to identify if this signal chain is conserved in Plasmodium species.

It is likely that PKG can stimulate microneme release independent of RNG2 given BIPPO can be seen to partially stimulate microneme secretion in the iΔHA-RNG2, so perhaps PKG is still operating in the iΔHA-RNG2, just less efficiently than with RNG2 present (Figure 4.4). It would be interesting to further investigate whether phosphatidic acid signalling components (Bullen et al. 2016) are still active in absence of PKG. This has been partially shown but it is unclear if there was any off target inhibition of CDPKs using Compound 2 in this study (Bullen et al. 2016). Based on this we might expect propranolol to be able to stimulate at least some microneme secretion in PKG inhibited cells unless PKG is affecting the synthesized pool of available lipid precursors such as diacylglycerol which is needed to make phosphatidic acid (Bullen et al. 2016). Yet while PI-PLC is the main protein requiring DAG for activation, binding to DAG at the plasma membrane, it is not clear what role PI- PLC plays in the invasion events since PI-PLC iKD has severe defects in cell morphology and structural integrity is compromised (Bullen et al. 2016). The role of PI-PLC in this model is still unclear except that it is known to bind DAG. Does PI-PLC act on DGK1 to amplify the signal? Does it bypass it altogether and stimulate micronemes on its own or does it process DAG at the Plasma membrane?

100 Possibly an accumulation of DAG at the apical complex might interfere with the curvature o the PM required for vesicle release so possibly PI-PLC facilitates this by removing or sequestering DAG. This is still un clear so has been left an open question in this model. This model is intended to represent the activation of secretion and motility, so the role for PI-PLC in invasion is speculative given ethanol is thought to act on PI-PLC as a target to increase secretion and requires more work to draw solid conclusions.

With regard to rationalizing MIC2 secretion with GRA inhibition, it is likely that there is a way for PKG to act on PI-PLC or part of the PA signal chain to stimulate micronemes without an excessive calcium flux. If GRA1 secretion inhibition is calcium dependent, but MIC2 can be secretion can be increased with both zaprinast and BIPPO without severely impacting GRA1 secretion then it stands to reason that PKG can bypass the IP3 cleavage of PIP2 to promote calcium release. In this way, micronemes might be able to be secreted without affecting GRA1 secretion. However, the problem of PI-PLC iKD remains in which it has severe morphological defects which would make it difficult to identify an invasion function.

Many of these lipid metabolites can be synthesized by multiple proteins in multiple compartments. For example, phosphatidic acid is made as part of a pathway for bulk phospholipid synthesis in the apicoplast yet the PA produced by DGK1 in the cytosol is important for microneme secretion. Looking at multiple proteins that could be used to provide these lipid second messengers might provide key insight into how some of these kinases can bypass each other. For example, DAG is a by- product of sphingomyelin synthesis and could be used to activate PI-PLC without stimulating calcium release from cleavage of PIP2 to make DAG and IP3. There are still many gaps in the above model and these patterns of synthesis of lipid second messengers will likely provide the answer to how some of these kinases can bypass each other.

Lastly, the effects of stable cGMP and cAMP analogues argue against previous reports that these analogues have no effect on secretion, likely because I have used higher doses of drug more applicable to eliciting a response in Toxoplasma. Probably cAMP is competing with cGMP abundance in the cytosol, which would impact on PKG activity (Figure 4.8). If PKG is inhibited, microneme secretion is reduced so this is probably the way in which cAMP is acting. Although it can’t be ruled out that cAMP is acting on some unknown cAMP responsive kinase but this would be a worthwhile avenue of future research. This antagonistic effect of cGMP and cAMP provides a simple answer to the regulation of micronemes between intra and extra-cellular parasites and suggests that cAMP might also prevent calcium release in intracellular parasites, although that is speculative at this stage.

In summary, the discovery and functional characterization of the RNG2 protein presented in this thesis has advanced our understanding of the structure and function of the apical complex and its formation during daughter cell development. This has also led to a better understanding of structure of the apical complex in directing the events of the lytic cycle and in doing so this has contributed to the overall model of the signalling networks important for secretion. Finally, this work has serendipitously identified an inverse relationship for the control of dense granule and microneme release. The principles of these discoveries are relevant to other Apicomplexans, including Plasmodium and this study will hopefully stimulate further research into these other important systems.

101

102

103 5.1 Materials and Methods

5.1.1 Parasites cultures.

T. gondii tachyzoites were grown by serial passage in human foreskin fibroblast 533 (HFF) cells as previously described (Striepen B, 2007). Briefly, Toxoplasma RH strain parasites were allowed to grow within human foreskin fibroblasts until the host cell lawn was completely lysed. Approximately300 microliters of a fully lysed culture was then used to inoculate a new T25 flask of confluent Human Foreskin Fibroblast (HFF) cells containing 10 ml of ED1 media (Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1% Foetal Bovine Serum (FBS), 0.2mM additional L- Glut, 50 Units/ml Penicillin/Streptomycin, and 0.25 µg/ml of amphotericin-B) , and allowed to grow until complete or near complete lysis of the host cell lawn, and sub-cultured as before.

HFF cells were typically defrosted from freezing at passage 7.5 and allowed to grow until around pass 16. HFF cultures were typically grown in 50 ml of D10 media (as per ED1, except with 10% FBS), until the host cell lawn covered the entire surface area of a T175. Upon passage, cultures were aspirated and treated with 5 ml of 0.25% Trypsin/1mM EDTA. 3 ml was left in the flask after aspiration and then incubated for 60 seconds at 37 °C degrees, after which the flask was quenched with approximately 250 ml of D10 media. HFF cell suspension was then aliquoted into new flasks, 10 ml per T25 and 50ml per T175, and approximately 0.5 ml per cm2 of each well of a multiwell plate.

5.1.2 Parasite transfection.

Extracellular parasites from a fully lysed culture were filtered through a 3 µm polycarbonate filter and spun down and resuspended in Cytomix (120mM KCl, 0.15mM CaCl2, 10mM K2HPO4, 10mM 7 KH2PO4, 25mM HEPES, 2M EGTA and 5mM MgCl2), to a concentration of 3.3x10 cells per ml. 50 µg of plasmid DNA was ethanol precipitated and resuspended in 100 µL of cytomix. Parasite and DNA solutions were mixed together and electroporated in a standard 2 mm electroporation cuvette (BiorRad), at 1.5kV and 25µF. Cells were transferred to a 10 ml culture flask with host cells and selected for using 1 µM pyrimethamine, or 30 µg/ml chloramphenicol until polyclonal cells grew. Cells were then cloned out by limiting dilution and screened for by IFA, western blot or PCR.

5.1.3 Western Blotting.

Parasites were filtered using a 3 µm polycarbonate filter as before, pelleted by centrifugation at 1000xg for 10 minutes, washed in PBS, and then spun down again. Parasite pellets were typically resuspended to a concentration of 1x107 cells per ml in Samples Buffer (Life Tech), and boiled for 5 minutes. Approximately between 2x105 and 2x106 cells (between 10 and 20 microliters) were typically loaded onto each well of a 12% BisTris acrylamide SDS PAGE gel. 3 microliters of NUPAGE SeebluePlus2 was used as a ladder control. Gels were run by electrophoresis for approximately 30 minutes at 200V. Gel was then electro-blotted onto 0.2 µm pore size nitrocellulose supported membrane at 30 V for 90 minutes. Membranes were blocked overnight in 5% milk powder in 1x TBS.

Membranes were probed using immuno-chemi-luminescence. Antibodies were probed at the indicated concentrations for 1 hr at room temperature, followed by 2 washes with 5%milk powder in 1xTBS, followed by 2 washes with TTBS (1x TBS with 0.05% Tween20). Each wash lasted 5 minutes (20 minutes total washes). Secondary antibodies were probed at dilutions recommended by

104 manufacturer for 1 hr, followed by washes as before. Chemiluminescent tags were activated by incubation with Pierce PicoWest®, chemiluminescent substrate for 5 minutes. Membranes were placed between two clear plastic sheets and imaged on BioRad Chemidoc digital imager or using X- ray film on a traditional wet developing machine.

5.1.4 Immunofluorescence assays.

Parasites either in host cells or on coverslips in multi-well plates were fixed using 2% Paraformaldehyde (PFA) in 1xPBS for 15 minutes. Cells were permeabilized using 0.25% TritonX-100 (TX100) in 1xPBS for 10 minutes. Samples were then blocked using 2% BSA in 1xPBS overnight at 4 degrees or 1hr at room temperature. Coverslips were probed with antibodies diluted in blocking solution at the indicated concentrations for 1 hr, followed by at least three rinses in 1xPBS. Secondary Alexafluor®antibodies were probed at the manufacturer’s recommended concentrations for 1hr and washed at least 3 times in 1xPBS. Coverslips were then mounted onto glass microscope slides using 20 μLof Fluorogel® and allowed to set overnight. Alternatively for 3D-SIM super resolution, samples were mounted using 5μL Vectashield® for 3D-SIM work and sealed with nail varnish or melted VALAP (equal volumes of Vasoline®, Lanolin, and Paraffin wax).

Samples were imaged using a Leica SP2 Confocal microscope or a Nikon Eclipise WideField Epifluorescence microscope. For Super resolution images, samples were prepared on 1.5 µm glass coverslips and mounted onto glass slides using either Vectashield, or DABCO in 50% glycerol 50% PBS, and then sealed using either VALAP or Nail Varnish. Samples were imaged using a 3D-SIM OMX BLAZE and optimized for oil refractory index, usually .16 or .18 Cargill oil.

5.1.5 Red/Green Invasion Assay.

Parasites were grown for at least 48 hours with or without ATC, until there was a moderate amount of host cell lysis but still with a large proportion of parasites in big vacuoles ready to egress. Cultures were allowed to cool to room temperature before harvesting by scraping the host cell lawn, needle passing through a 26G needle, and filtering through 3 µM filters. Parasite suspensions were then pelleted at 1000 xg for 10 minutes. Samples were aspirated and resuspended in Endo buffer

(44.7mM K2SO4, 10mM MgSO4, 106Mm Sucrose, 5mM glucose, 20mM Tris-H2SO4, 3.5mg/ml BSA dissolved in dH2O and adjusted to pH 8.2 with H2SO4), to a concentration of approximately 2.5x 107cells per ml. 24 well plates with host cells on coverslips were aspirated and 200 uL of parasites were added to the host cells and allowed to settle at room temperature for 15 minutes. Once settled, the ENDO buffer medium was carefully aspirated and replaced with 200ul of Invasion Buffer (DMEM supplemented with 10mM HEPES and 3% FBS). The samples were then moved to 37 oC and allowed to invade for 10 minutes. Samples were then fixed by addition of 200 uL of fixative solution containing 4% Paraformaldehyde and 0.04% gutaraldehyde in 1xPBS (2%PFA, 0.02%GA final concentration) and allowed to fix for 10 minutes. Fixative was removed and replaced with 2% BSA in 1xPBS, and allowed to block overnight at 4oC . Coverslips were probed with mouse anti-SAG1 (1:1000) for 1 hour at room temperature before washing 3 times with 1xPBS. Samples were then permeabilized using 0.2% TX100 in 1xPBS for 10 minutes, before washing again three times with 1xPBS. Samples were then probed with rabbit anti-GAP45 (1:1000) for 1 hr, before washing 3 times in 1x PBS. Samples lastly were probed with Alexafluor secondary antiboides, goat anti-mouse 546 and goat anti-rabbit 588 for 1 hr at room temperature. Coverslips were washed three times in 1x PBS, rinsed in distilled water, dried and mounted on glass slides using 5-10 ul of Fluorogel®mounting medium. Fields of view were then imaged on either a Leica SP2 or a Zeiss Axiovision, and then

105 overlaid to observe either green or red/green parasites. A minimum of 100 parasites were scored for each of three biological replicates and invasion percentage calculated as invaded over total parasites.

5.1.6 Egress Assay.

Parasites were grown +/-ATc for 72 hours until the majority of the parasites were extracellular. Extracellular parasites were then used to inoculate HFF cells on coverslips and allowed to invade for 1 hr. Non-invaded cells were washed away with ED1 or DMEM and replaced with ED1 +/- ATc and allowed to grow for approximately 28 hours before assay. Coverslips were aspirated and replaced with DMEM media containing 5µM A23187 or with the equivalent volume of DMSO control. Cell were then fixed by addition of a 2x solution of 4% PFA and 0.2% glutaraldehyde in 1xPBS (final concentration 2% PFA, 0.2% Glutaraldehyde), directly to the medium. Cells were fixed for 15 minutes before aspirating and permeabilizing with 0.25% TX100 in 1xPBS for 10 minutes. Cells were then blocked overnight with 2%BSA in 1xPBS and labelled with anti SAG1 antibodies by IFA the following day and mounted onto slides with 20 µM fluorogel. Vacuoles with at least one parasite clearly escaping from the vacuole were scored as egressed and intact vacuoles with parasites intact or slightly shifted within the vacuole but not egressed were scored as non-egressed.

5.1.7 Conoid Assay.

Extracellular parasites were filtered, counted and spun at 1000 xg for 10 minutes. Parasites were resuspended in DMEM (without additional supplements), to a concentration of approximately 5.0x107 parasites/ml. 100 microliters of parasites were then mixed with equivalent volumes of solutions containing double concentrations of 10 µM calcium ionophore A23187 or 5µM BIPPO to make a 200 µl solution (final concentration 5µM A23187 and 2.5µM BIPPO), or equivalent concentration of DMSO control (200 µL total volume per sample). Parasites with agonist or DMSO were allowed to extrude conoids by shifting to a 37 °C water bath. Cells were incubated for 30 seconds and then fixed by addition of 10 µl of 25% glutaraldehyde (final concentration 1.25%), for 30 minutes. 50 microliters of parasites was then smeared onto Polyethylenimine( PEI )-coated coverslips and parasites were allowed to settle for 20 minutes, before being rinsed in deionized water and mounted onto microscope slides using 20 microliters of Fluorogel®. Parasite conoids were scored by phase contrast on a 63x or 100x objective.

5.1.8 Motility assays.

Parasites were allowed to grow +/- ATc for at least 48 hours. On the day of experiment, coverslips were flamed and treated with 0.1% PEI, smeared with FCS and allowed to incubate at 37 °C for approximately 1 hour. Parasite cultures were scraped if necessary, needle passed, filtered, counted and spun at 1000 xg for approximately 10 minutes. Pellets were resuspended to a concentration of at least 1x 107 cells per ml in ED1 media. 1 ml of each culture was added to each well of a 6 well plate, and allowed to settle for 10 minutes. If necessary, any agonists and inhibitors were added at this time. Parasites were then transferred to 37°C incubator and allowed to move around on coverslips for approximately 1 hour. Samples were then fixed by addition of a 2x concentration solution of 5%paraformaldehyde/0.04% glutaraldehyde in 1xPBS (final concentration 2.5%PFA/0.02%GA) for 15 minutes. Samples were then blocked overnight at 4 °C using 2%BSA in 1xPBS. Coverslips were then probed by IFA using anti-SAG1 followed by Alexafluor 488 and analysed by fluorescence microscopy.

106 5.1.9 Rhoptry/Evacuole Assay.

Parasites were grown for 72 hours with or without ATC. Parasites were filtered and spun at 1000 xg for 10 minutes. Parasites were resuspended to concentration of 1.5x107 cells per ml in Endo buffer containing 1 µM Cytochalasin D and incubated at RT for 10 minutes. Host cells on coverslips were then aspirated and 1 ml of parasites were added to each well of a 6 well plate and allowed to settle for 20 minutes. Once settled, ENDO buffer was carefully aspirated and replaced with 1ml of Invasion Buffer, and well plate(s) were moved to 37 °C incubator for 15 minutes. Samples were then fixed by addition of a 2x solution of 5.0% paraformaldehyde (2.5% final concentration) at room temperature for 10 minutes. Fixative was then aspirated and samples were fixed using methanol. 1ml of 100% methanol was added to each well and fixed for a further 10 minutes at -20 °C . Cells were then aspirated and blocked overnight at 4°C by addition of 2% BSA in 1x PBS. Samples were then probed by IFA with mouse anti-ROP1 and rabbit anti-GAP45, followed by Alexafluor® secondaries. Coverslips were then rinsed in water and mounted onto slides using Fluorogel ®. Parasite evacuoles were then scored randomly using a 100x objective

5.1.10 Secretion Assay.

Parasite cultures were pre-incubated for at least 48 hours with or without ATc. Efforts were made to harvest parasites at around the time of host cell egress when vacuoles were large, and easily ruptured. Cultures were scraped, needle passed, filtered, counted and spun at 1000xg at 15 degrees for 10 minutes. Pellets were aspirated and washed with 3 ml of Invasion Buffer and spun as before at 1000xg for 10 minutes at 15 °C. Pellets were aspirated and resuspended in Invasion Buffer at 2.5x108 cells per ml. 50 µl of parasites was then added to 50 microliters of Invasion Buffer containing 2x the final concentration of agonist. Typically, these were 10 µM A23187, 5 µM BIPPO or 1.0 mM zaprinast (final concentrations of 5 µM, 2.5 µM or 0.5mM respectively). Any other agonists listed in Figures were assayed the same with 2x final concentration used to prepare the buffer above. Final concentration of parasites was thus halved to 1.25x108 parasites per ml. Parasite samples were then incubated at 37°C for 20 minutes to allow secretion and quenched on ice for 2 minutes to stop secretion. Samples were then spun down at 8000 rpm, for 2 minutes on ice . 85 µl of supernatant was then transferred to new tube termed S1, and pellet was washed with 1x PBS. Samples were spun as before at 8000 rpm for 2 minutes at 4 °C . 75 µl of S1 tube was transferred to S2 tube and original pellet tubes were aspirated of PBS. 25 µl of 4x or 100 µl of 1x Sample buffer with betamercaptoethanol reducing agent was added to samples to a final volume of 100 µl with 0.2% betamercaptoethanol. Samples were then boiled for 3 minutes and allowed to cool before running on a poly acrylamide gel. 10 µl protein sample was then separated on 12 well 12% Bis-Tris gel at 200 V for 30 minutes. Gels were then transferred to 0.2 µM supported nitrocellulose membranes at 30 V for 90 minutes, and blocked overnight at 4 degrees in 4.5% Milk/1xTBS. Western blots were probed using antibodies to MIC2, AMA1, GRA1 or TOM40 as described in western blot procedure. For quantification, data generated from the BioRad Chemidoc imager was quantified for MIC2 and GRA and this was normalised against the TOM40 signal in the pellet samples. Independent biological replicates were assayed using the above method, the secretion response between these replicates was normalised on the DMSO controls, and averages and variance plotted as bar graphs.

5.1.11 Detergent extraction assays.

Parasite pellicles were extracted using deoxycholate as previously described (Tran et al., 2010). Briefly, parasites were filtered through a 3 µm filter and resuspended in phosphate-buffered saline (1xPBS). Parasites were settled onto coverslips smeared with 0.1% polyethyleneimine (PEI) and extracted in 10 mM deoxycholate for 10 min at room temperature. Parasites were fixed in 4%

107 paraformaldehyde for 10 min and then stained with anti HA and tubulin by IFA. Isolated pellicles were analysed on a Leica TCS SP2 confocal laser scanning microscope.

5.1.12 Electron Microscopy.

For transmission electron microscopy, parasites were cultured for three days on 0.5 mg ml ATc, fixed with 2.5% paraformaldehyde and 1% glutaraldehyde in PBS solution, post fixed in 1% OsO4, and gently pellet-embedded in 1% low-melting point agarose. The agarose block was ethanol dehydrated, embedded in LR White resin and polymerized. Ultrathin sections were cut on a Leica Ultracut R microtome, lead and uranium stained and visualized with a Philips CM120 BioTWIN transmission electron microscope at 120 kV.

5.1.13 GCaMP6 FACS experiments.

The GCaMP6 plasmid expressing a background mCherry (Stewart et al. 2016) was integrated into the iΔHA-RNG2 cells. iΔHA-RNG2-GCaMP6/mCherry cells were pre-incubated with or without ATc for 3 days until the majority of cells were non-egressed in large vacuoles, and harvested by needle passage and filtered through a 3 µm filter. Cells were pelleted by centrifugation at 1000xg for 10 minutes. Cells were kept at room temperature from this point on. Cells were then resuspended in Reduced-Serum Invasion Buffer (DMEM with 1% FBS and 10mM HEPES.). 1ml of parasites were then then individually put into Flow-Cytometry Assisted Cell Sorter (FACS) and read for 10 seconds to establish a baseline calcium flow signal. The sample was removed and mixed with 1ml of 2x the concentration of BIPPO or A23187 dissolved in Low-Serum Invasion Buffer resulting in a 2ml reaction volume. This sample were then read in the FACS machine for a further 3 minutes per sample and the fluorescence was measured over the length of this time. This was repeated for each individual concentration of A23187 or BIPPO in the dilution series. Data was then processed in FloJo software. Here the kinetic parameter was used to calculate the line using median intensity. These experiments were performed in collaboration by Dr. Chris Tonkin of the Walter and Eliza Hall Institute (WEHI), Melbourne Australia.

5.1.14 Bioinformatics Software analysis.

Coiled coil prediction software used was the COILS program, found via expasy.org: http://embnet.vital-it.ch/software/COILS_form.html

Repeat regions of RNG2 was identified via repeat sequence software RadarRepeat: http://www.ebi.ac.uk/Tools/pfa/radar/

Palmitoylation prediction was identified using CSS-PALM http://csspalm.biocuckoo.org/

ToxoDB gene and protein analysis http://toxodb.org

5.1.15 Plasmid and Cell line construction details.

RNG1 pgCM3 was made by PCR amplifying the product from genomic T. gondii DNA using the primers listed in Table 1. The RNG1 PCR product was cut with BglII and AvrII and placed into the equivalent sites of the pgCM3 plasmid (van Dooren et al. 2016). Plasmid was linearized with AatII

108 before transformation into T. gondii to promote integration by 3’ replacement and selected under chloramphenicol selection into the RNG2-iHAKD cell line, to make RNG2iHA KD/RNG1-Myc.

RNG1 pBTM3 was made using primers in Table 1. The PCR product was cut with BglII/AvrII and ligated into the pBTM3 plasmid (Glaser et al., 2012). RNG1 was localized by transient expression.

RNG1 pBTGFP was made by cutting out the Myc tag with AvrII/NotI and replaced with the GFP from pCTG using equivalent restriction sites. RNG1-GFP was localized transiently.

CAM1 pgCM3 was made using primers listed in Table 1. The PCR product was cut with BglII and AvrII and placed into the equivalent sites of the pgCM3 plasmid. Plasmid was linearized with Nhe1 to integrate by 3’ replacement and transfected into RNG2-HA cells and placed under chloramphenicol selection, to make RNG2-HA/CAM1-Myc.

RNG2 pgCM3 was made by PCR amplifying the product from the primers listed in Table 1. The RNG2 PCR product was cut with BglII and XbaI and placed into the BglII and AvrII sites of the pgCM3 plasmid. It was then linearized with AvrII and transfected in the RNG2 iHA KD cell line and placed under chloramphenicol selection, to make iHA-RNG2-Myc-KD

RNG1 iHA KD in pPR2-HA3 DHFR: The RNG1 iHA KD construct was generated by using PCR to amplify the regions of the 5’ flank and 3’ flanks using the primers listed in Table 1 which targeted the gene locus annotated as TGME49_243545 (locus is correct but gene model is wrong, based on published protein sequence). For the 5’ flank, the PCR product was cut with ApaI/PacI and ligated into equivalent sites in plasmid pPR2-HA3. The 3’ flank was then PCR amplified, cut with XmaI/NotI and ligated into equivalent sites in the aforementioned plasmid. Plasmid was linearized with NotI and transfected into Ku80-TATi cells.

RNG2 iHA KD in pPR2-HA3 DHFR: Plasmis based around RNG2 gene locus identified as gene TGME49_244470, was made using primers listed in Table 1. For the 5’ flank, the PCR product was cut with NdeI/NsiI and ligated into equivalent sites in plasmid pPR2-HA3. The 3’ flank was then PCR amplified, cut with XmaI/NotI and ligated into equivalent sites in the aforementioned plasmid. Plasmid was linearized with NotI and transfected into Ku80-TATi cells.

5.1.16 Cell lines, chemicals,

The CDPK1 iHA KD was a kind gift from Dr. Sebastian Lourido, MIT, Boston USA. The Δcdpk3 was a kind gift from Dr. Chris Tonkin, WEHI, Melbourne, Australia. Ku80 +HX was sourced from Dr. Giel van Dooren, Canberra, Australia. Ku80 TATi was a gift from Dr. Lilach Sheiner, Glasgow Scotland. Compound 2 used in this study was gift from Dr. Oliver Billker, Sanger Institute, Cambridge, UK. The cGMP agonist BIPPO was a gift from Dr. Phil Campbell, Monash University, Melbourne, Australia. All other chemicals agonists and inhibtors including Anhydtrotetracycline, A23187, Ionomycin, zaprinast, cytochalsin D, 8Br-cGMP and 8Br-cAMP were sourced from Sigma and Tocris biosciences.

Table 1: Primers used to synthesize plasmids used in this study.

Table 1

Plasmid name Primer Forward 5'-3' Primer Reverse 5'-3' Source

109 RNG1 iHA KD (5' flank) (5' flank) This Study DHFR GACTTTAATTAACGCATGAAATTA GACTGGGCCCTGGCGCTC ACGAGCAGGGGA GCGAACGACCAACCC

(3' flank) (3' flank) GACTCCCGGGATGGCGCTAATTCC GACTGCGGCCGCCGAGGT CTCGCC TGAACATCTCCAGAGTGCC

RNG2 iHA KD (5' flank) (5' flank) Katris et al. DHFR CTGACATATGGAGACTGCCACAAA ATCATCCATCGAAACGCTC 2014 (This GGAAGG CGTGACGGAAGTA study)

(3' flank) (3' flank) GATCCCCGGGATGCACCCCCACCT CGATGCGGCCGCGACGGT TTCTTCCGCAG GGTGTTATTGATTGGTTGC

RNG1 pBTM3 GATCAGATCTAAAATGGCGCTAAT GATCCCTAGGCGCCAGGTA Katris et al. TCCCTCGC GTAGACAGGTGGA 2014 (This study)

RNG1 pgCM3 Katris et al. 2014 (This study)

RNG2 pgCM3 GATCAGATCTGCAGCTGACACACT GCATTCTAGAGTTTGTTGA Katris et al. CCTGACG TGCGTCCGAGACAAC 2014 (This study)

CAM1 pgCM3 GATCCCTAGGTTTATTCGCGGAAG TGGACTGTGGTCGACGCA This Study GCAGAGAC GAAG

Other plasmids… - -

CAM1 eGFP - - Hu et al. 2006

2xMyc-MORN1- - - Gubbels et CAT al. 2006

RNG1 pBTGFP - - made from RNG1 pBTM3(this study)

Table 2: Primers used for screening integration of knockdown cell lines.

Table 2

Other Primer names Sequence 5' -3'

Native RNG2 Forward (P1) CAGATTCCGAATTCTTTGG

110 T7S4 (P2) TGTAGAGCTGGTGCGTGAG

RNG2 3' screen (P3) AAGGGGACGCAGTTCTCGGA

Native RNG1 Forward (P1a) GACAGACCGACTCCCGTTGC

T7S4 (P2) TGTAGAGCTGGTGCGTGAG

RNG1 3' screen (P3a) CAAAACACCAGTTGAAATGCC

Tic22 forward (P4) TACTTCCAATCCAATTTAGCACGCTCGTCGGCAGTCGGGTT

Tic22 reverse (P5) TCCTCCACTTCCAATTTTAGCTGCTTGTCCTTGATCGTCGGGA

UPRT forward (P6) AGGTCTCAAGCGTTTCTTTTCTGTGTACACCGAG

UPRT reverse (P7) GGGTCTCGGGAGCACGCCTCAAGAGGATAAACACC

Table 3: Cell lines used in this study

Table 3

Cell line Function/Purpose Source

RNG1 iHAx3 KD DHFR HA tagged Tet inducible knock down Unpublished (This study) promoter replacement

RNG2 iHAx3 KD DHFR HA tagged Tet inducible knock down Katris et al. 2014 (This study) promoter replacement

CDPK1 iHAx9 KD HA tagged Tet inducible knock down of Lourido et al. 2010 CDPK1, with endogenous knockout.

Δcdpk3 Gene gene of CDPK3 gene. McCoy et al. 2012

Ku80+HX Mutant facilitating homologous Hyunh et al. 2009 recombination

Ku80 TATi TATi strain with Ku80 knocked out. Sheiner et al. 2011

RNG2-HA3 DHFR RNG2-HA tagged line for localization Gould et al. 2011

RNG2 iHA KD/RNG1 co-localization Katris et al. 2014(This study) pgCM3 iHA-RNG2-Myc KD dual tagged RNG2 for co-localization Katris et al. 2014(This study)

RNG2-HA /CAM1 co-localization Unpublished (This study) pgCM3

Table 4: Antibodies used in this study.

Antibody Source

111 Rat anti-HA Roche Mouse anti c-myc Roche Mouse anti-IMC1 Gary Ward (University of Vermont, USA) Rabbit anti-GAP45 Dominique Soldati-Favre (University of Geneva, Switzerland) Rabbit anti-Centrin1 Abcam Mouse anti-tubulin mAb 12G10, Developmental Studies Hybridoma Bank, University of Iowa Mouse anti-MIC2 clone 6D10 David Sibley (Washington University, USA)

Mouse anti-AMA1 clone B3.93 John Boothroyd (Stanford University, USA) Rabbit anti-Tom40 Giel van Dooren (Australian National University, Australia) Mouse anti-ROP1 John Boothroyd (Stanford University, USA) Mouse anti-SAG1 Abcam Mouse anti-GRA8 Gary Ward (University of Vermont, USA) Mouse anti-AMA1 CL.22 Chris Tonkin (WEHI, Australia) Rabbit anti-CDPK3 Chris Tonkin (WEHI, Australia)

112

113

114

115 References 6.1.1 References

Abdul, H.M., and Butterfield, D.A. (2007). Involvement of PI3K/PKG/ERK1/2 signaling pathways in cortical neurons to trigger protection by cotreatment of acetyl-L-carnitine and alpha-lipoic acid against HNE-mediated oxidative stress and neurotoxicity: implications for Alzheimer's disease. Free Radic Biol Med 42, 371-384. Adl, S.M., Leander, B.S., Simpson, A.G., Archibald, J.M., Anderson, O.R., Bass, D., Bowser, S.S., Brugerolle, G., Farmer, M.A., Karpov, S., et al. (2007). Diversity, nomenclature, and taxonomy of protists. Syst Biol 56, 684-689. Adl, S.M., Simpson, A.G., Farmer, M.A., Andersen, R.A., Anderson, O.R., Barta, J.R., Bowser, S.S., Brugerolle, G., Fensome, R.A., Fredericq, S., et al. (2005). The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. The Journal of eukaryotic microbiology 52, 399-451. Alam, M.M., Solyakov, L., Bottrill, A.R., Flueck, C., Siddiqui, F.A., Singh, S., Mistry, S., Viskaduraki, M., Lee, K., Hopp, C.S., et al. (2015). Phosphoproteomics reveals malaria parasite Protein Kinase G as a signalling hub regulating egress and invasion. Nat Commun 6, 7285. Alexander, D.L., Mital, J., Ward, G.E., Bradley, P., and Boothroyd, J.C. (2005). Identification of the moving junction complex of Toxoplasma gondii: a collaboration between distinct secretory organelles. PLoS pathogens 1, e17. Andenmatten, N., Egarter, S., Jackson, A.J., Jullien, N., Herman, J.P., and Meissner, M. (2013). Conditional genome engineering in Toxoplasma gondii uncovers alternative invasion mechanisms. Nature methods 10, 125-127. Anderson-White, B., Beck, J.R., Chen, C.T., Meissner, M., Bradley, P.J., and Gubbels, M.J. (2012). Cytoskeleton assembly in Toxoplasma gondii cell division. International review of cell and molecular biology 298, 1-31. Anderson-White, B.R., Ivey, F.D., Cheng, K., Szatanek, T., Lorestani, A., Beckers, C.J., Ferguson, D.J., Sahoo, N., and Gubbels, M.J. (2011). A family of intermediate filament-like proteins is sequentially assembled into the cytoskeleton of Toxoplasma gondii. Cell Microbiol 13, 18-31. Arrizabalaga, G., Ruiz, F., Moreno, S., and Boothroyd, J.C. (2004). Ionophore-resistant mutant of Toxoplasma gondii reveals involvement of a sodium/hydrogen exchanger in calcium regulation. The Journal of cell biology 165, 653-662. Arroyo-Olarte, R.D., Brouwers, J.F., Kuchipudi, A., Helms, J.B., Biswas, A., Dunay, I.R., Lucius, R., and Gupta, N. (2015). Phosphatidylthreonine and Lipid-Mediated Control of Parasite Virulence. Plos Biol 13, e1002288. Aspock, H., Husslein, P., Janisch, H., Mose, J.R., Pollak, A., Vander-Mose, A., and Winter, R. (1994). [Toxoplasmosis. Recommendations for treatment of primary toxoplasma infection in pregnancy and congenital toxoplasmosis]. Gynakol Geburtshilfliche Rundsch 34, 50-51. Bansal, A., Singh, S., More, K.R., Hans, D., Nangalia, K., Yogavel, M., Sharma, A., and Chitnis, C.E. (2013). Characterization of Plasmodium falciparum calcium-dependent protein kinase 1 (PfCDPK1) and its role in microneme secretion during erythrocyte invasion. The Journal of biological chemistry 288, 1590-1602. Baum, J., Gilberger, T.W., Frischknecht, F., and Meissner, M. (2008). Host-cell invasion by malaria parasites: insights from Plasmodium and Toxoplasma. Trends in parasitology 24, 557-563. Beck, J.R., Chen, A.L., Kim, E.W., and Bradley, P.J. (2014). RON5 is critical for organization and function of the Toxoplasma moving junction complex. PLoS pathogens 10, e1004025. Beck, J.R., Fung, C., Straub, K.W., Coppens, I., Vashisht, A.A., Wohlschlegel, J.A., and Bradley, P.J. (2013). A Toxoplasma palmitoyl acyl transferase and the palmitoylated armadillo repeat protein

116 TgARO govern apical rhoptry tethering and reveal a critical role for the rhoptries in host cell invasion but not egress. PLoS pathogens 9, e1003162. Beck, J.R., Rodriguez-Fernandez, I.A., de Leon, J.C., Huynh, M.H., Carruthers, V.B., Morrissette, N.S., and Bradley, P.J. (2010a). A Novel Family of Toxoplasma IMC Proteins Displays a Hierarchical Organization and Functions in Coordinating Parasite Division. PLoS pathogens 6. Beck, J.R., Rodriguez-Fernandez, I.A., de Leon, J.C., Huynh, M.H., Carruthers, V.B., Morrissette, N.S., and Bradley, P.J. (2010b). A novel family of Toxoplasma IMC proteins displays a hierarchical organization and functions in coordinating parasite division. PLoS pathogens 6, e1001094. Behnke, M.S., Fentress, S.J., Mashayekhi, M., Li, L.X., Taylor, G.A., and Sibley, L.D. (2012). The polymorphic pseudokinase ROP5 controls virulence in Toxoplasma gondii by regulating the active kinase ROP18. PLoS pathogens 8, e1002992. Billker, O., Dechamps, S., Tewari, R., Wenig, G., Franke-Fayard, B., and Brinkmann, V. (2004). Calcium and a calcium-dependent protein kinase regulate gamete formation and mosquito transmission in a malaria parasite. Cell 117, 503-514. Bishop, A.C., Ubersax, J.A., Petsch, D.T., Matheos, D.P., Gray, N.S., Blethrow, J., Shimizu, E., Tsien, J.Z., Schultz, P.G., Rose, M.D., et al. (2000). A chemical switch for inhibitor-sensitive alleles of any protein kinase. Nature 407, 395-401. Black, M.W., Arrizabalaga, G., and Boothroyd, J.C. (2000). Ionophore-resistant mutants of Toxoplasma gondii reveal host cell permeabilization as an early event in egress. Mol Cell Biol 20, 9399-9408. Bobic, B., Nikolic, A., Klun, I., Vujanic, M., and Djurkovic-Djakovic, O. (2007). Undercooked meat consumption remains the major risk factor for Toxoplasma infection in Serbia. Parassitologia 49, 227-230. Boothroyd, J.C. (2009). Expansion of host range as a driving force in the evolution of Toxoplasma. Mem Inst Oswaldo Cruz 104, 179-184. Bougdour, A., Durandau, E., Brenier-Pinchart, M.P., Ortet, P., Barakat, M., Kieffer, S., Curt-Varesano, A., Curt-Bertini, R.L., Bastien, O., Coute, Y., et al. (2013). Host cell subversion by Toxoplasma GRA16, an exported dense granule protein that targets the host cell nucleus and alters gene expression. Cell Host Microbe 13, 489-500. Bougdour, A., Tardieux, I., and Hakimi, M.A. (2014). Toxoplasma exports dense granule proteins beyond the vacuole to the host cell nucleus and rewires the host genome expression. Cell Microbiol 16, 334-343. Box, E.D., Celaya, B.L., and Gingrich, W.D. (1953). Development of Plasmodium berghei in Anopheles quadrimaculatus. Am J Trop Med Hyg 2, 624-627. Bradley, P.J., Ward, C., Cheng, S.J., Alexander, D.L., Coller, S., Coombs, G.H., Dunn, J.D., Ferguson, D.J., Sanderson, S.J., Wastling, J.M., et al. (2005). Proteomic analysis of rhoptry organelles reveals many novel constituents for host-parasite interactions in Toxoplasma gondii. The Journal of biological chemistry 280, 34245-34258. Braun, L., Brenier-Pinchart, M.P., Yogavel, M., Curt-Varesano, A., Curt-Bertini, R.L., Hussain, T., Kieffer-Jaquinod, S., Coute, Y., Pelloux, H., Tardieux, I., et al. (2013). A Toxoplasma dense granule protein, GRA24, modulates the early immune response to infection by promoting a direct and sustained host p38 MAPK activation. J Exp Med 210, 2071-2086. Bringmann, G., and Holz, J. (1953). [Toxoplasma gondii in the electronmicroscopical picture]. Z Hyg Infektionskr 137, 186-191. Bringmann, G., and Holz, J. (1954). [The locomotor organelles of Toxoplasma gondii]. Z Tropenmed Parasitol 5, 54-57. Brochet, M., Collins, M.O., Smith, T.K., Thompson, E., Sebastian, S., Volkmann, K., Schwach, F., Chappell, L., Gomes, A.R., Berriman, M., et al. (2014). Phosphoinositide metabolism links cGMP- dependent protein kinase G to essential Ca(2)(+) signals at key decision points in the life cycle of malaria parasites. Plos Biol 12, e1001806.

117 Brown, K.M., Lourido, S., and Sibley, L.D. (2016). Serum Albumin Stimulates Protein Kinase G- dependent Microneme Secretion in Toxoplasma gondii. The Journal of biological chemistry 291, 9554-9565. Bullen, H.E., Jia, Y., Yamaryo-Botte, Y., Bisio, H., Zhang, O., Jemelin, N.K., Marq, J.B., Carruthers, V., Botte, C.Y., and Soldati-Favre, D. (2016). Phosphatidic Acid-Mediated Signaling Regulates Microneme Secretion in Toxoplasma. Cell Host Microbe 19, 349-360. Cabrera, A., Herrmann, S., Warszta, D., Santos, J.M., John Peter, A.T., Kono, M., Debrouver, S., Jacobs, T., Spielmann, T., Ungermann, C., et al. (2012). Dissection of minimal sequence requirements for rhoptry membrane targeting in the malaria parasite. Traffic 13, 1335-1350. Carey, K.L., Westwood, N.J., Mitchison, T.J., and Ward, G.E. (2004). A small-molecule approach to studying invasive mechanisms of Toxoplasma gondii. Proceedings of the National Academy of Sciences of the United States of America 101, 7433-7438. Carruthers, V.B., Giddings, O.K., and Sibley, L.D. (1999a). Secretion of micronemal proteins is associated with toxoplasma invasion of host cells. Cell Microbiol 1, 225-235. Carruthers, V.B., Moreno, S.N., and Sibley, L.D. (1999b). Ethanol and acetaldehyde elevate intracellular [Ca2+] and stimulate microneme discharge in Toxoplasma gondii. The Biochemical journal 342 ( Pt 2), 379-386. Carruthers, V.B., and Sibley, L.D. (1997). Sequential protein secretion from three distinct organelles of Toxoplasma gondii accompanies invasion of human fibroblasts. European journal of cell biology 73, 114-123. Carruthers, V.B., and Sibley, L.D. (1999). Mobilization of intracellular calcium stimulates microneme discharge in Toxoplasma gondii. Molecular microbiology 31, 421-428. Cavalier-Smith, T. (1987). The origin of eukaryotic and archaebacterial cells. Ann N Y Acad Sci 503, 17-54. Cesbron-Delauw, M.F., Guy, B., Torpier, G., Pierce, R.J., Lenzen, G., Cesbron, J.Y., Charif, H., Lepage, P., Darcy, F., Lecocq, J.P., et al. (1989). Molecular characterization of a 23-kilodalton major antigen secreted by Toxoplasma gondii. Proceedings of the National Academy of Sciences of the United States of America 86, 7537-7541. Chaturvedi, S., Qi, H., Coleman, D., Rodriguez, A., Hanson, P.I., Striepen, B., Roos, D.S., and Joiner, K.A. (1999). Constitutive calcium-independent release of Toxoplasma gondii dense granules occurs through the NSF/SNAP/SNARE/Rab machinery. The Journal of biological chemistry 274, 2424-2431. Chen, A.L., Kim, E.W., Toh, J.Y., Vashisht, A.A., Rashoff, A.Q., Van, C., Huang, A.S., Moon, A.S., Bell, H.N., Bentolila, L.A., et al. (2015). Novel components of the Toxoplasma inner membrane complex revealed by BioID. Mbio 6, e02357-02314. Choumet, V., Carmi-Leroy, A., Laurent, C., Lenormand, P., Rousselle, J.C., Namane, A., Roth, C., and Brey, P.T. (2007). The salivary glands and saliva of Anopheles gambiae as an essential step in the Plasmodium life cycle: a global proteomic study. Proteomics 7, 3384-3394. Coffey, M.J., Sleebs, B.E., Uboldi, A.D., Garnham, A., Franco, M., Marino, N.D., Panas, M.W., Ferguson, D.J., Enciso, M., O'Neill, M.T., et al. (2015). An aspartyl protease defines a novel pathway for export of Toxoplasma proteins into the host cell. eLife 4. Collins, C.R., Hackett, F., Strath, M., Penzo, M., Withers-Martinez, C., Baker, D.A., and Blackman, M.J. (2013). Malaria parasite cGMP-dependent protein kinase regulates blood stage merozoite secretory organelle discharge and egress. PLoS pathogens 9, e1003344. Cook, G.C. (1990). Toxoplasma gondii infection: a potential danger to the unborn fetus and AIDS sufferer. Q J Med 74, 3-19. Dawn, A., Singh, S., More, K.R., Siddiqui, F.A., Pachikara, N., Ramdani, G., Langsley, G., and Chitnis, C.E. (2014). The central role of cAMP in regulating Plasmodium falciparum merozoite invasion of human erythrocytes. PLoS pathogens 10, e1004520. de Leon, J.C., Scheumann, N., Beatty, W., Beck, J.R., Tran, J.Q., Yau, C., Bradley, P.J., Gull, K., Wickstead, B., and Morrissette, N.S. (2013a). A SAS-6-like protein suggests that the Toxoplasma conoid complex evolved from flagellar components. Eukaryot Cell 12, 1009-1019.

118 de Leon, J.C., Scheumann, N., Beatty, W., Beck, J.R., Tran, J.Q., Yau, C., Bradley, P.J., Gull, K., Wickstead, B., and Morrissette, N.S. (2013b). A SAS-6-Like Protein Suggests that the Toxoplasma Conoid Complex Evolved from Flagellar Components. Eukaryot Cell 12, 1009-1019. Del Carmen, M.G., Mondragon, M., Gonzalez, S., and Mondragon, R. (2009). Induction and regulation of conoid extrusion in Toxoplasma gondii. Cell Microbiol 11, 967-982. Donald, R.G., Allocco, J., Singh, S.B., Nare, B., Salowe, S.P., Wiltsie, J., and Liberator, P.A. (2002). Toxoplasma gondii cyclic GMP-dependent kinase: chemotherapeutic targeting of an essential parasite protein kinase. Eukaryot Cell 1, 317-328. Donald, R.G., and Liberator, P.A. (2002). Molecular characterization of a coccidian parasite cGMP dependent protein kinase. Molecular and biochemical parasitology 120, 165-175. Donald, R.G., Zhong, T., Wiersma, H., Nare, B., Yao, D., Lee, A., Allocco, J., and Liberator, P.A. (2006). Anticoccidial kinase inhibitors: identification of protein kinase targets secondary to cGMP-dependent protein kinase. Molecular and biochemical parasitology 149, 86-98. Dubey, J.P., and Frenkel, J.K. (1972). Cyst-induced toxoplasmosis in cats. J Protozool 19, 155-177. Dubey, J.P., and Frenkel, J.K. (1973). Experimental toxoplasma infection in mice with strains producing oocysts. The Journal of parasitology 59, 505-512. Dubey, J.P., and Frenkel, J.K. (1976). Feline toxoplasmosis from acutely infected mice and the development of Toxoplasma cysts. J Protozool 23, 537-546. Dubey, J.P., Miller, N.L., and Frenkel, J.K. (1970). Toxoplasma gondii life cycle in cats. J Am Vet Med Assoc 157, 1767-1770. Dubremetz, J.F., and Ferguson, D.J. (2009). The role played by electron microscopy in advancing our understanding of Toxoplasma gondii and other apicomplexans. International journal for parasitology 39, 883-893. Dvorin, J.D., Martyn, D.C., Patel, S.D., Grimley, J.S., Collins, C.R., Hopp, C.S., Bright, A.T., Westenberger, S., Winzeler, E., Blackman, M.J., et al. (2010). A plant-like kinase in Plasmodium falciparum regulates parasite egress from erythrocytes. Science 328, 910-912. Eaton, M.S., Weiss, L.M., and Kim, K. (2006). Cyclic nucleotide kinases and tachyzoite-bradyzoite transition in Toxoplasma gondii. International journal for parasitology 36, 107-114. Egarter, S., Andenmatten, N., Jackson, A.J., Whitelaw, J.A., Pall, G., Black, J.A., Ferguson, D.J., Tardieux, I., Mogilner, A., and Meissner, M. (2014). The toxoplasma Acto-MyoA motor complex is important but not essential for gliding motility and host cell invasion. PloS one 9, e91819. Farrell, A., Thirugnanam, S., Lorestani, A., Dvorin, J.D., Eidell, K.P., Ferguson, D.J., Anderson-White, B.R., Duraisingh, M.T., Marth, G.T., and Gubbels, M.J. (2012). A DOC2 protein identified by mutational profiling is essential for apicomplexan parasite exocytosis. Science 335, 218-221. Farrell, M., and Gubbels, M.J. (2014). The Toxoplasma gondii kinetochore is required for centrosome association with the centrocone (spindle pole). Cell Microbiol 16, 78-94. Fernandez Robledo, J.A., Caler, E., Matsuzaki, M., Keeling, P.J., Shanmugam, D., Roos, D.S., and Vasta, G.R. (2011). The search for the missing link: a relic plastid in Perkinsus? International journal for parasitology 41, 1217-1229. Fleck, D.G. (1975). Congenital infection due to toxoplasma. Proc R Soc Med 68, 368-369. Foe, I.T., Child, M.A., Majmudar, J.D., Krishnamurthy, S., van der Linden, W.A., Ward, G.E., Martin, B.R., and Bogyo, M. (2015). Global Analysis of Palmitoylated Proteins in Toxoplasma gondii. Cell Host Microbe 18, 501-511. Francia, M.E., Jordan, C.N., Patel, J.D., Sheiner, L., Demerly, J.L., Fellows, J.D., de Leon, J.C., Morrissette, N.S., Dubremetz, J.F., and Striepen, B. (2012). Cell Division in Apicomplexan Parasites Is Organized by a Homolog of the Striated Rootlet Fiber of Algal Flagella. Plos Biol 10. Frech, C., and Chen, N. (2011). Genome comparison of human and non-human malaria parasites reveals species subset-specific genes potentially linked to human disease. PLoS Comput Biol 7, e1002320.

119 Frenal, K., Marq, J.B., Jacot, D., Polonais, V., and Soldati-Favre, D. (2014). Plasticity between MyoC- and MyoA-glideosomes: an example of functional compensation in Toxoplasma gondii invasion. PLoS pathogens 10, e1004504. Frenal, K., Polonais, V., Marq, J.B., Stratmann, R., Limenitakis, J., and Soldati-Favre, D. (2010). Functional dissection of the apicomplexan glideosome molecular architecture. Cell Host Microbe 8, 343-357. Fruth, I.A., and Arrizabalaga, G. (2007). Toxoplasma gondii: induction of egress by the potassium ionophore nigericin. International journal for parasitology 37, 1559-1567. Fung, C., Beck, J.R., Robertson, S.D., Gubbels, M.J., and Bradley, P.J. (2012). Toxoplasma ISP4 is a central IMC sub-compartment protein whose localization depends on palmitoylation but not myristoylation. Molecular and biochemical parasitology 184, 99-108. Gajadhar, A.A., Marquardt, W.C., Hall, R., Gunderson, J., Ariztia-Carmona, E.V., and Sogin, M.L. (1991). Ribosomal RNA sequences of Sarcocystis muris, Theileria annulata and Crypthecodinium cohnii reveal evolutionary relationships among apicomplexans, dinoflagellates, and ciliates. Molecular and biochemical parasitology 45, 147-154. Gaji, R.Y., Johnson, D.E., Treeck, M., Wang, M., Hudmon, A., and Arrizabalaga, G. (2015). Phosphorylation of a Myosin Motor by TgCDPK3 Facilitates Rapid Initiation of Motility during Toxoplasma gondii egress. PLoS pathogens 11, e1005268. Garnham, P.C., Bird, R.G., Baker, J.R., and Bray, R.S. (1961). Electron microsope studies of motile stages of malaria parasites. II. The fine structure of the sporozoite of Laverania (Plasmodium) falcipara. Trans R Soc Trop Med Hyg 55, 98-102. Garnham, P.C., Lainson, R., and Cooper, W. (1958). The complete life cycle of a new strain of Plasmodium gonderi from the drill (Mandrillus leucophaeus), including its sporogony in Anopheles aztecus and its pre-erythrocytic schizogony in the rhesus monkey. Trans R Soc Trop Med Hyg 52, 509-517. Garrison, E., Treeck, M., Ehret, E., Butz, H., Garbuz, T., Oswald, B.P., Settles, M., Boothroyd, J., and Arrizabalaga, G. (2012). A forward genetic screen reveals that calcium-dependent protein kinase 3 regulates egress in Toxoplasma. PLoS pathogens 8, e1003049. Gnanguenon, V., Govoetchan, R., Agossa, F.R., Osse, R., Oke-Agbo, F., Azondekon, R., Sovi, A., Attolou, R., Badirou, K., Tokponnon, F.T., et al. (2014). Transmission patterns of Plasmodium falciparum by Anopheles gambiae in Benin. Malar J 13, 444. Gold, D.A., Kaplan, A.D., Lis, A., Bett, G.C., Rosowski, E.E., Cirelli, K.M., Bougdour, A., Sidik, S.M., Beck, J.R., Lourido, S., et al. (2015). The Toxoplasma Dense Granule Proteins GRA17 and GRA23 Mediate the Movement of Small Molecules between the Host and the Parasitophorous Vacuole. Cell Host Microbe 17, 642-652. Gould, S.B., Kraft, L.G., van Dooren, G.G., Goodman, C.D., Ford, K.L., Cassin, A.M., Bacic, A., McFadden, G.I., and Waller, R.F. (2011). Ciliate pellicular proteome identifies novel protein families with characteristic repeat motifs that are common to alveolates. Mol Biol Evol 28, 1319-1331. Gould, S.B., Tham, W.H., Cowman, A.F., McFadden, G.I., and Waller, R.F. (2008). Alveolins, a new family of cortical proteins that define the protist infrakingdom Alveolata. Mol Biol Evol 25, 1219- 1230. Graindorge, A., Frenal, K., Jacot, D., Salamun, J., Marq, J.B., and Soldati-Favre, D. (2016). The Conoid Associated Motor MyoH Is Indispensable for Toxoplasma gondii Entry and Exit from Host Cells. PLoS pathogens 12, e1005388. Gubbels, M.J., and Duraisingh, M.T. (2012). Evolution of apicomplexan secretory organelles. International journal for parasitology 42, 1071-1081. Gustafson, P.V., Agar, H.D., and Cramer, D.I. (1954). An electron microscope study of Toxoplasma. Am J Trop Med Hyg 3, 1008-1022. Gustafsson, M.G., Shao, L., Carlton, P.M., Wang, C.J., Golubovskaya, I.N., Cande, W.Z., Agard, D.A., and Sedat, J.W. (2008). Three-dimensional resolution doubling in wide-field fluorescence microscopy by structured illumination. Biophys J 94, 4957-4970.

120 Hakansson, S., Morisaki, H., Heuser, J., and Sibley, L.D. (1999). Time-lapse video microscopy of gliding motility in Toxoplasma gondii reveals a novel, biphasic mechanism of cell locomotion. Molecular biology of the cell 10, 3539-3547. Harding, C.R., Egarter, S., Gow, M., Jimenez-Ruiz, E., Ferguson, D.J., and Meissner, M. (2016). Gliding Associated Proteins Play Essential Roles during the Formation of the Inner Membrane Complex of Toxoplasma gondii. PLoS pathogens 12, e1005403. Hartmann, J., Hu, K., He, C.Y., Pelletier, L., Roos, D.S., and Warren, G. (2006). Golgi and centrosome cycles in Toxoplasma gondii. Molecular and biochemical parasitology 145, 125-127. Heaslip, A.T., Dzierszinski, F., Stein, B., and Hu, K. (2010). TgMORN1 is a key organizer for the basal complex of Toxoplasma gondii. PLoS pathogens 6, e1000754. Heaslip, A.T., Nishi, M., Stein, B., and Hu, K. (2011). The motility of a human parasite, Toxoplasma gondii, is regulated by a novel lysine methyltransferase. PLoS pathogens 7, e1002201. Herm-Gotz, A., Weiss, S., Stratmann, R., Fujita-Becker, S., Ruff, C., Meyhofer, E., Soldati, T., Manstein, D.J., Geeves, M.A., and Soldati, D. (2002). Toxoplasma gondii myosin A and its light chain: a fast, single-headed, plus-end-directed motor. Embo J 21, 2149-2158. Hill, D.E., Chirukandoth, S., and Dubey, J.P. (2005). Biology and epidemiology of Toxoplasma gondii in man and animals. Anim Health Res Rev 6, 41-61. Hofflin, J.M., and Remington, J.S. (1985). Tissue culture isolation of Toxoplasma from blood of a patient with AIDS. Arch Intern Med 145, 925-926. Hopp, L., Lasker, N., Bamforth, R., and Aviv, A. (1992). Characterization of Na(+)-K+ homeostasis of cultured human skin fibroblasts in the presence and absence of fetal bovine serum. J Cell Physiol 151, 427-432. Howard, B.L., Harvey, K.L., Stewart, R.J., Azevedo, M.F., Crabb, B.S., Jennings, I.G., Sanders, P.R., Manallack, D.T., Thompson, P.E., Tonkin, C.J., et al. (2015). Identification of potent phosphodiesterase inhibitors that demonstrate cyclic nucleotide-dependent functions in apicomplexan parasites. ACS chemical biology 10, 1145-1154. Hsiao, C.H., Luisa Hiller, N., Haldar, K., and Knoll, L.J. (2013). A HT/PEXEL motif in Toxoplasma dense granule proteins is a signal for protein cleavage but not export into the host cell. Traffic 14, 519-531. Hu, K. (2008). Organizational changes of the daughter basal complex during the parasite replication of Toxoplasma gondii. PLoS pathogens 4, e10. Hu, K., Johnson, J., Florens, L., Fraunholz, M., Suravajjala, S., DiLullo, C., Yates, J., Roos, D.S., and Murray, J.M. (2006). Cytoskeletal components of an invasion machine--the apical complex of Toxoplasma gondii. PLoS pathogens 2, e13. Hu, K., Mann, T., Striepen, B., Beckers, C.J., Roos, D.S., and Murray, J.M. (2002a). Daughter cell assembly in the protozoan parasite Toxoplasma gondii. Molecular biology of the cell 13, 593-606. Hu, K., Roos, D.S., and Murray, J.M. (2002b). A novel polymer of tubulin forms the conoid of Toxoplasma gondii. The Journal of cell biology 156, 1039-1050. Huynh, M.H., and Carruthers, V.B. (2006). Toxoplasma MIC2 is a major determinant of invasion and virulence. PLoS pathogens 2, e84. Huynh, M.H., Rabenau, K.E., Harper, J.M., Beatty, W.L., Sibley, L.D., and Carruthers, V.B. (2003). Rapid invasion of host cells by Toxoplasma requires secretion of the MIC2-M2AP adhesive protein complex. Embo J 22, 2082-2090. Jacobs, L., Remington, J.S., and Melton, M.L. (1960). The resistance of the encysted form of Toxoplasma gondii. The Journal of parasitology 46, 11-21. Janitschke, K., and Werner, H. (1972). [Studies on the host specificity of the sexual development cycle of toxoplasma gondii]. Z Parasitenkd 39, 247-254. Janouskovec, J., Horak, A., Obornik, M., Lukes, J., and Keeling, P.J. (2010). A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids. Proceedings of the National Academy of Sciences of the United States of America 107, 10949-10954.

121 Janse, C.J., Boorsma, E.G., Ramesar, J., Grobbee, M.J., and Mons, B. (1989). Host cell specificity and schizogony of Plasmodium berghei under different in vitro conditions. International journal for parasitology 19, 509-514. Jansen, V., Alvarez, L., Balbach, M., Strunker, T., Hegemann, P., Kaupp, U.B., and Wachten, D. (2015). Controlling fertilization and cAMP signaling in sperm by optogenetics. eLife 4. Johnson, J.L., and Leroux, M.R. (2010). cAMP and cGMP signaling: sensory systems with prokaryotic roots adopted by eukaryotic cilia. Trends Cell Biol 20, 435-444. Jones, T.C., and Hirsch, J.G. (1972). The interaction between Toxoplasma gondii and mammalian cells. II. The absence of lysosomal fusion with phagocytic vacuoles containing living parasites. J Exp Med 136, 1173-1194. Kafsack, B.F., Beckers, C., and Carruthers, V.B. (2004). Synchronous invasion of host cells by Toxoplasma gondii. Molecular and biochemical parasitology 136, 309-311. Kafsack, B.F., Pena, J.D., Coppens, I., Ravindran, S., Boothroyd, J.C., and Carruthers, V.B. (2009). Rapid membrane disruption by a perforin-like protein facilitates parasite exit from host cells. Science 323, 530-533. Katris, N.J., van Dooren, G.G., McMillan, P.J., Hanssen, E., Tilley, L., and Waller, R.F. (2014). The apical complex provides a regulated gateway for secretion of invasion factors in Toxoplasma. PLoS pathogens 10, e1004074. Ke, H., Sigala, P.A., Miura, K., Morrisey, J.M., Mather, M.W., Crowley, J.R., Henderson, J.P., Goldberg, D.E., Long, C.A., and Vaidya, A.B. (2014). The heme biosynthesis pathway is essential for Plasmodium falciparum development in mosquito stage but not in blood stages. The Journal of biological chemistry 289, 34827-34837. Kirkman, L.A., Weiss, L.M., and Kim, K. (2001). Cyclic nucleotide signaling in Toxoplasma gondii bradyzoite differentiation. Infection and immunity 69, 148-153. Kremer, K., Kamin, D., Rittweger, E., Wilkes, J., Flammer, H., Mahler, S., Heng, J., Tonkin, C.J., Langsley, G., Hell, S.W., et al. (2013). An overexpression screen of Toxoplasma gondii Rab-GTPases reveals distinct transport routes to the micronemes. PLoS pathogens 9, e1003213. Kudryashev, M., Munter, S., Lemgruber, L., Montagna, G., Stahlberg, H., Matuschewski, K., Meissner, M., Cyrklaff, M., and Frischknecht, F. (2012). Structural basis for chirality and directional motility of Plasmodium sporozoites. Cell Microbiol 14, 1757-1768. Kumar, P., Tripathi, A., Ranjan, R., Halbert, J., Gilberger, T., Doerig, C., and Sharma, P. (2014). Regulation of Plasmodium falciparum development by calcium-dependent protein kinase 7 (PfCDPK7). The Journal of biological chemistry 289, 20386-20395. Lai, C.K., Gupta, N., Wen, X., Rangell, L., Chih, B., Peterson, A.S., Bazan, J.F., Li, L., and Scales, S.J. (2011). Functional characterization of putative cilia genes by high-content analysis. Molecular biology of the cell 22, 1104-1119. Lai, M., Pifferi, M., Bush, A., Piras, M., Michelucci, A., Di Cicco, M., del Grosso, A., Quaranta, P., Cursi, C., Tantillo, E., et al. (2016). Gene editing of DNAH11 restores normal cilia motility in primary ciliary dyskinesia. J Med Genet 53, 242-249. Lamarque, M.H., Roques, M., Kong-Hap, M., Tonkin, M.L., Rugarabamu, G., Marq, J.B., Penarete- Vargas, D.M., Boulanger, M.J., Soldati-Favre, D., and Lebrun, M. (2014a). Plasticity and redundancy among AMA-RON pairs ensure host cell entry of Toxoplasma parasites. Nat Commun 5, 4098. Lamarque, M.H., Roques, M., Kong-Hap, M., Tonkin, M.L., Rugarabamu, G., Marq, J.B., Penarete- Vargas, D.M., Boulanger, M.J., Soldati-Favre, D., and Lebrun, M. (2014b). Plasticity and redundancy among AMA-RON pairs ensure host cell entry of Toxoplasma parasites. Nat Commun 5. Lasonder, E., Green, J.L., Camarda, G., Talabani, H., Holder, A.A., Langsley, G., and Alano, P. (2012). The Plasmodium falciparum schizont phosphoproteome reveals extensive phosphatidylinositol and cAMP-protein kinase A signaling. J Proteome Res 11, 5323-5337. Lebrun, M., Michelin, A., El Hajj, H., Poncet, J., Bradley, P.J., Vial, H., and Dubremetz, J.F. (2005). The rhoptry neck protein RON4 re-localizes at the moving junction during Toxoplasma gondii invasion. Cell Microbiol 7, 1823-1833.

122 Leidel, S., Delattre, M., Cerutti, L., Baumer, K., and Gonczy, P. (2005). SAS-6 defines a protein family required for centrosome duplication in C. elegans and in human cells. Nat Cell Biol 7, 115-125. Lentini, G., Kong-Hap, M., El Hajj, H., Francia, M., Claudet, C., Striepen, B., Dubremetz, J.F., and Lebrun, M. (2015). Identification and characterization of Toxoplasma SIP, a conserved apicomplexan cytoskeleton protein involved in maintaining the shape, motility and virulence of the parasite. Cell Microbiol 17, 62-78. Leung, J.M., Rould, M.A., Konradt, C., Hunter, C.A., and Ward, G.E. (2014). Disruption of TgPHIL1 alters specific parameters of Toxoplasma gondii motility measured in a quantitative, three- dimensional live motility assay. PloS one 9, e85763. Leveque, M.F., Berry, L., and Besteiro, S. (2016). An evolutionarily conserved SSNA1/DIP13 homologue is a component of both basal and apical complexes of Toxoplasma gondii. Sci Rep 6, 27809. Limenitakis, J., and Soldati-Favre, D. (2011). Functional genetics in Apicomplexa: potentials and limits. FEBS Lett 585, 1579-1588. Liu, J., He, Y., Benmerzouga, I., Sullivan, W.J., Jr., Morrissette, N.S., Murray, J.M., and Hu, K. (2016). An ensemble of specifically targeted proteins stabilizes cortical microtubules in the human parasite Toxoplasma gondii. Molecular biology of the cell 27, 549-571. Long, S., Wang, Q., and Sibley, L.D. (2016). Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9. Infection and immunity 84, 1262-1273. Lorestani, A., Sheiner, L., Yang, K., Robertson, S.D., Sahoo, N., Brooks, C.F., Ferguson, D.J., Striepen, B., and Gubbels, M.J. (2010). A Toxoplasma MORN1 null mutant undergoes repeated divisions but is defective in basal assembly, apicoplast division and cytokinesis. PloS one 5, e12302. Lourido, S., Jeschke, G.R., Turk, B.E., and Sibley, L.D. (2013). Exploiting the unique ATP-binding pocket of toxoplasma calcium-dependent protein kinase 1 to identify its substrates. ACS chemical biology 8, 1155-1162. Lourido, S., Shuman, J., Zhang, C., Shokat, K.M., Hui, R., and Sibley, L.D. (2010). Calcium-dependent protein kinase 1 is an essential regulator of exocytosis in Toxoplasma. Nature 465, 359-362. Lourido, S., Tang, K., and Sibley, L.D. (2012). Distinct signalling pathways control Toxoplasma egress and host-cell invasion. Embo J 31, 4524-4534. Marques, S.R., Ramakrishnan, C., Carzaniga, R., Blagborough, A.M., Delves, M.J., Talman, A.M., and Sinden, R.E. (2015). An essential role of the basal body protein SAS-6 in Plasmodium male gamete development and malaria transmission. Cell Microbiol 17, 191-206. McCoy, J.M., Whitehead, L., van Dooren, G.G., and Tonkin, C.J. (2012). TgCDPK3 regulates calcium- dependent egress of Toxoplasma gondii from host cells. PLoS pathogens 8, e1003066. McFadden, G.I., Reith, M.E., Munholland, J., and Lang-Unnasch, N. (1996). Plastid in human parasites. Nature 381, 482. McRobert, L., Taylor, C.J., Deng, W., Fivelman, Q.L., Cummings, R.M., Polley, S.D., Billker, O., and Baker, D.A. (2008). Gametogenesis in malaria parasites is mediated by the cGMP-dependent protein kinase. Plos Biol 6, e139. Meissner, M., Schluter, D., and Soldati, D. (2002). Role of Toxoplasma gondii myosin A in powering parasite gliding and host cell invasion. Science 298, 837-840. Mercier, C., Howe, D.K., Mordue, D., Lingnau, M., and Sibley, L.D. (1998). Targeted disruption of the GRA2 locus in Toxoplasma gondii decreases acute virulence in mice. Infection and immunity 66, 4176-4182. Miller, N.L., Frenkel, J.K., and Dubey, J.P. (1972). Oral infections with Toxoplasma cysts and oocysts in felines, other mammals, and in birds. The Journal of parasitology 58, 928-937. Mital, J., Meissner, M., Soldati, D., and Ward, G.E. (2005). Conditional expression of Toxoplasma gondii apical membrane antigen-1 (TgAMA1) demonstrates that TgAMA1 plays a critical role in host cell invasion. Molecular biology of the cell 16, 4341-4349.

123 Mondragon, R., and Frixione, E. (1996). Ca(2+)-dependence of conoid extrusion in Toxoplasma gondii tachyzoites. The Journal of eukaryotic microbiology 43, 120-127. Moreira, C.K., Templeton, T.J., Lavazec, C., Hayward, R.E., Hobbs, C.V., Kroeze, H., Janse, C.J., Waters, A.P., Sinnis, P., and Coppi, A. (2008). The Plasmodium TRAP/MIC2 family member, TRAP-Like Protein (TLP), is involved in tissue traversal by sporozoites. Cell Microbiol 10, 1505-1516. Morlon-Guyot, J., Berry, L., Chen, C.T., Gubbels, M.J., Lebrun, M., and Daher, W. (2014). The Toxoplasma gondii calcium-dependent protein kinase 7 is involved in early steps of parasite division and is crucial for parasite survival. Cell Microbiol 16, 95-114. Morrissette, N. (2015). Targeting Toxoplasma tubules: tubulin, microtubules, and associated proteins in a human pathogen. Eukaryot Cell 14, 2-12. Mueller, C., Klages, N., Jacot, D., Santos, J.M., Cabrera, A., Gilberger, T.W., Dubremetz, J.F., and Soldati-Favre, D. (2013a). The Toxoplasma protein ARO mediates the apical positioning of rhoptry organelles, a prerequisite for host cell invasion. Cell Host Microbe 13, 289-301. Mueller, C., Klages, N., Jacot, D., Santos, J.M., Cabrera, A., Gilberger, T.W., Dubremetz, J.F., and Soldati-Favre, D. (2013b). The Toxoplasma Protein ARO Mediates the Apical Positioning of Rhoptry Organelles, a Prerequisite for Host Cell Invasion. Cell Host Microbe 13, 289-301. Mueller, C., Samoo, A., Hammoudi, P.M., Klages, N., Kallio, J.P., Kursula, I., and Soldati-Favre, D. (2016). Structural and functional dissection of Toxoplasma gondii armadillo repeats only protein. Journal of cell science 129, 1031-1045. Mukherjee, S., Jansen, V., Jikeli, J.F., Hamzeh, H., Alvarez, L., Dombrowski, M., Balbach, M., Strunker, T., Seifert, R., Kaupp, U.B., et al. (2016). A novel biosensor to study cAMP dynamics in cilia and flagella. eLife 5. Nair, S.C., Brooks, C.F., Goodman, C.D., Sturm, A., McFadden, G.I., Sundriyal, S., Anglin, J.L., Song, Y., Moreno, S.N., and Striepen, B. (2011). Apicoplast isoprenoid precursor synthesis and the molecular basis of fosmidomycin resistance in Toxoplasma gondii. J Exp Med 208, 1547-1559. Nakazawa, Y., Hiraki, M., Kamiya, R., and Hirono, M. (2007). SAS-6 is a cartwheel protein that establishes the 9-fold symmetry of the centriole. Current biology : CB 17, 2169-2174. Nebl, T., Prieto, J.H., Kapp, E., Smith, B.J., Williams, M.J., Yates, J.R., 3rd, Cowman, A.F., and Tonkin, C.J. (2011). Quantitative in vivo analyses reveal calcium-dependent phosphorylation sites and identifies a novel component of the Toxoplasma invasion motor complex. PLoS pathogens 7, e1002222. Nishi, M., Hu, K., Murray, J.M., and Roos, D.S. (2008). Organellar dynamics during the cell cycle of Toxoplasma gondii. Journal of cell science 121, 1559-1568. Ogino, N., and Yoneda, C. (1966). The fine structure and mode of division of Toxoplasma gondii. Arch Ophthalmol 75, 218-227. Okada, T., Marmansari, D., Li, Z.M., Adilbish, A., Canko, S., Ueno, A., Shono, H., Furuoka, H., and Igarashi, M. (2013). A novel dense granule protein, GRA22, is involved in regulating parasite egress in Toxoplasma gondii. Molecular and biochemical parasitology 189, 5-13. Oldenburger, A., Roscioni, S.S., Jansen, E., Menzen, M.H., Halayko, A.J., Timens, W., Meurs, H., Maarsingh, H., and Schmidt, M. (2012). Anti-inflammatory role of the cAMP effectors Epac and PKA: implications in chronic obstructive pulmonary disease. PloS one 7, e31574. Ong, Y.C., Reese, M.L., and Boothroyd, J.C. (2010). Toxoplasma rhoptry protein 16 (ROP16) subverts host function by direct tyrosine phosphorylation of STAT6. The Journal of biological chemistry 285, 28731-28740. Ono, T., Cabrita-Santos, L., Leitao, R., Bettiol, E., Purcell, L.A., Diaz-Pulido, O., Andrews, L.B., Tadakuma, T., Bhanot, P., Mota, M.M., et al. (2008). Adenylyl cyclase alpha and cAMP signaling mediate Plasmodium sporozoite apical regulated exocytosis and hepatocyte infection. PLoS pathogens 4, e1000008. Palmer, J.D. (1992). Green ancestry of malarial parasites? Current biology : CB 2, 318-320.

124 Pappas, G., Roussos, N., and Falagas, M.E. (2009). Toxoplasmosis snapshots: global status of Toxoplasma gondii seroprevalence and implications for pregnancy and congenital toxoplasmosis. International journal for parasitology 39, 1385-1394. Paredes-Santos, T.C., de Souza, W., and Attias, M. (2012). Dynamics and 3D organization of secretory organelles of Toxoplasma gondii. J Struct Biol 177, 420-430. Paul, A.S., Saha, S., Engelberg, K., Jiang, R.H., Coleman, B.I., Kosber, A.L., Chen, C.T., Ganter, M., Espy, N., Gilberger, T.W., et al. (2015). Parasite Calcineurin Regulates Host Cell Recognition and Attachment by Apicomplexans. Cell Host Microbe 18, 49-60. Pernas, L., Adomako-Ankomah, Y., Shastri, A.J., Ewald, S.E., Treeck, M., Boyle, J.P., and Boothroyd, J.C. (2014). Toxoplasma effector MAF1 mediates recruitment of host mitochondria and impacts the host response. Plos Biol 12, e1001845. Plattner, H., and Kissmehl, R. (2003). Dense-core secretory vesicle docking and exocytotic membrane fusion in Paramecium cells. Biochim Biophys Acta 1641, 183-193. Ramdani, G., Naissant, B., Thompson, E., Breil, F., Lorthiois, A., Dupuy, F., Cummings, R., Duffier, Y., Corbett, Y., Mercereau-Puijalon, O., et al. (2015). cAMP-Signalling Regulates Gametocyte-Infected Erythrocyte Deformability Required for Malaria Parasite Transmission. PLoS pathogens 11, e1004815. Ren, J., Wen, L., Gao, X., Jin, C., Xue, Y., and Yao, X. (2008). CSS-Palm 2.0: an updated software for palmitoylation sites prediction. Protein Eng Des Sel 21, 639-644. Ritter, A.T., Asano, Y., Stinchcombe, J.C., Dieckmann, N.M., Chen, B.C., Gawden-Bone, C., van Engelenburg, S., Legant, W., Gao, L., Davidson, M.W., et al. (2015). Actin depletion initiates events leading to granule secretion at the immunological synapse. Immunity 42, 864-876. Roiko, M.S., and Carruthers, V.B. (2013). Functional dissection of Toxoplasma gondii perforin-like protein 1 reveals a dual domain mode of membrane binding for cytolysis and parasite egress. The Journal of biological chemistry 288, 8712-8725. Roiko, M.S., Svezhova, N., and Carruthers, V.B. (2014). Acidification Activates Toxoplasma gondii Motility and Egress by Enhancing Protein Secretion and Cytolytic Activity. PLoS pathogens 10, e1004488. Rommereim, L.M., Bellini, V., Fox, B.A., Petre, G., Rak, C., Touquet, B., Aldebert, D., Dubremetz, J.F., Cesbron-Delauw, M.F., Mercier, C., et al. (2016). Phenotypes Associated with Knockouts of Eight Dense Granule Gene Loci (GRA2-9) in Virulent Toxoplasma gondii. PloS one 11, e0159306. Roos, D.S., Crawford, M.J., Donald, R.G., Kissinger, J.C., Klimczak, L.J., and Striepen, B. (1999). Origin, targeting, and function of the apicomplexan plastid. Current opinion in microbiology 2, 426-432. Rudzinska, M.A., and Trager, W. (1959a). Electron-microscope studies on malaria parasites. Triangle 4, 97-104. Rudzinska, M.A., and Trager, W. (1959b). Phagotrophy and two new structures in the malaria parasite Plasmodium berghei. J Biophys Biochem Cytol 6, 103-112. Saeij, J.P., Boyle, J.P., Coller, S., Taylor, S., Sibley, L.D., Brooke-Powell, E.T., Ajioka, J.W., and Boothroyd, J.C. (2006). Polymorphic secreted kinases are key virulence factors in toxoplasmosis. Science 314, 1780-1783. Saeij, J.P., Coller, S., Boyle, J.P., Jerome, M.E., White, M.W., and Boothroyd, J.C. (2007). Toxoplasma co-opts host gene expression by injection of a polymorphic kinase homologue. Nature 445, 324-327. Shalaby, T., Liniger, M., and Seebeck, T. (2001). The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei. Eur J Biochem 268, 6197-6206. Sheffield, H.G., and Melton, M.L. (1968). The fine structure and reproduction of Toxoplasma gondii. The Journal of parasitology 54, 209-226. Sheffield, H.G., and Melton, M.L. (1970). Toxoplasma gondii: the oocyst, sporozoite, and infection of cultured cells. Science 167, 892-893. Sheiner, L., Demerly, J.L., Poulsen, N., Beatty, W.L., Lucas, O., Behnke, M.S., White, M.W., and Striepen, B. (2011). A Systematic Screen to Discover and Analyze Apicoplast Proteins Identifies a Conserved and Essential Protein Import Factor. PLoS pathogens 7.

125 Sheiner, L., Santos, J.M., Klages, N., Parussini, F., Jemmely, N., Friedrich, N., Ward, G.E., and Soldati- Favre, D. (2010). Toxoplasma gondii transmembrane microneme proteins and their modular design. Molecular microbiology 77, 912-929. Siden-Kiamos, I., Ecker, A., Nyback, S., Louis, C., Sinden, R.E., and Billker, O. (2006). Plasmodium berghei calcium-dependent protein kinase 3 is required for ookinete gliding motility and mosquito midgut invasion. Molecular microbiology 60, 1355-1363. Sidik, S.M., Hortua Triana, M.A., Paul, A.S., El Bakkouri, M., Hackett, C.G., Tran, F., Westwood, N.J., Hui, R., Zuercher, W.J., Duraisingh, M.T., et al. (2016a). Using a Genetically Encoded Sensor to Identify Inhibitors of Toxoplasma gondii Ca2+ Signaling. The Journal of biological chemistry 291, 9566-9580. Sidik, S.M., Huet, D., Ganesan, S.M., Huynh, M.H., Wang, T., Nasamu, A.S., Thiru, P., Saeij, J.P., Carruthers, V.B., Niles, J.C., et al. (2016b). A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell 166, 1423-1435 e1412. Silverman-Gavrila, L.B., and Lew, R.R. (2002). An IP3-activated Ca2+ channel regulates fungal tip growth. Journal of cell science 115, 5013-5025. Silverman, J.A., Qi, H., Riehl, A., Beckers, C., Nakaar, V., and Joiner, K.A. (1998). Induced activation of the Toxoplasma gondii nucleoside triphosphate hydrolase leads to depletion of host cell ATP levels and rapid exit of intracellular parasites from infected cells. The Journal of biological chemistry 273, 12352-12359. Sivagurunathan, S., Heaslip, A., Liu, J., and Hu, K. (2013). Identification of functional modules of AKMT, a novel lysine methyltransferase regulating the motility of Toxoplasma gondii. Molecular and biochemical parasitology 189, 43-53. Skariah, S., Bednarczyk, R.B., McIntyre, M.K., Taylor, G.A., and Mordue, D.G. (2012). Discovery of a novel Toxoplasma gondii conoid-associated protein important for parasite resistance to reactive nitrogen intermediates. J Immunol 188, 3404-3415. Snead, J.L., Sullivan, M., Lowery, D.M., Cohen, M.S., Zhang, C., Randle, D.H., Taunton, J., Yaffe, M.B., Morgan, D.O., and Shokat, K.M. (2007). A coupled chemical-genetic and bioinformatic approach to Polo-like kinase pathway exploration. Chem Biol 14, 1261-1272. Soulard, V., Bosson-Vanga, H., Lorthiois, A., Roucher, C., Franetich, J.F., Zanghi, G., Bordessoulles, M., Tefit, M., Thellier, M., Morosan, S., et al. (2015). Plasmodium falciparum full life cycle and Plasmodium ovale liver stages in humanized mice. Nat Commun 6, 7690. Stewart, R.J., Whitehead, L., Nijagal, B., Sleebs, B.E., Lessene, G., McConville, M.J., Rogers, K.L., and Tonkin, C.J. (2016). Analysis of Ca2+ mediated signalling regulating Toxoplasma infectivity reveals complex relationships between key molecules. Cell Microbiol. Stinchcombe, J.C., Majorovits, E., Bossi, G., Fuller, S., and Griffiths, G.M. (2006). Centrosome polarization delivers secretory granules to the immunological synapse. Nature 443, 462-465. Stinchcombe, J.C., Randzavola, L.O., Angus, K.L., Mantell, J.M., Verkade, P., and Griffiths, G.M. (2015). Mother Centriole Distal Appendages Mediate Centrosome Docking at the Immunological Synapse and Reveal Mechanistic Parallels with Ciliogenesis. Current biology : CB 25, 3239-3244. Striepen, B. (2011). The apicoplast: a red alga in human parasites. Essays Biochem 51, 111-125. Striepen, B., Crawford, M.J., Shaw, M.K., Tilney, L.G., Seeber, F., and Roos, D.S. (2000). The plastid of Toxoplasma gondii is divided by association with the centrosomes. The Journal of cell biology 151, 1423-1434. Sugi, T., Ma, Y.F., Tomita, T., Murakoshi, F., Eaton, M.S., Yakubu, R., Han, B., Tu, V., Kato, K., Kawazu, S., et al. (2016). Toxoplasma gondii Cyclic AMP-Dependent Protein Kinase Subunit 3 Is Involved in the Switch from Tachyzoite to Bradyzoite Development. Mbio 7. Sultan, A.A., Thathy, V., Frevert, U., Robson, K.J., Crisanti, A., Nussenzweig, V., Nussenzweig, R.S., and Menard, R. (1997). TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites. Cell 90, 511-522. Suvorova, E.S., Francia, M., Striepen, B., and White, M.W. (2015). A novel bipartite centrosome coordinates the apicomplexan cell cycle. Plos Biol 13, e1002093.

126 Tamaki, H., Shimada, A., Ito, Y., Ohya, M., Takase, J., Miyashita, M., Miyagawa, H., Nozaki, H., Nakayama, R., and Kumagai, H. (2007). LPT1 encodes a membrane-bound O-acyltransferase involved in the acylation of lysophospholipids in the yeast Saccharomyces cerevisiae. The Journal of biological chemistry 282, 34288-34298. Taylor, F.J.R. (1976). Flagellate Phylogeny - Study in Conflicts. Journal of Protozoology 23, 28-40. Taylor, K.A., Koros, J.K., Nduati, J., Copeland, R.S., Collins, F.H., and Brandling-Bennett, A.D. (1990). Plasmodium falciparum infection rates in Anopheles gambiae, An. arabiensis, and An. funestus in western Kenya. Am J Trop Med Hyg 43, 124-129. Taylor, S., Barragan, A., Su, C., Fux, B., Fentress, S.J., Tang, K., Beatty, W.L., Hajj, H.E., Jerome, M., Behnke, M.S., et al. (2006). A secreted serine-threonine kinase determines virulence in the eukaryotic pathogen Toxoplasma gondii. Science 314, 1776-1780. Tonkin, M.L., Roques, M., Lamarque, M.H., Pugniere, M., Douguet, D., Crawford, J., Lebrun, M., and Boulanger, M.J. (2011). Host cell invasion by apicomplexan parasites: insights from the co-structure of AMA1 with a RON2 peptide. Science 333, 463-467. Tran, J.Q., de Leon, J.C., Li, C., Huynh, M.H., Beatty, W., and Morrissette, N.S. (2010). RNG1 is a Late Marker of the Apical Polar Ring in Toxoplasma gondii. Cytoskeleton 67, 586-598. Tran, J.Q., Li, C., Chyan, A., Chung, L., and Morrissette, N.S. (2012a). SPM1 stabilizes subpellicular microtubules in Toxoplasma gondii. Eukaryot Cell 11, 206-216. Tran, J.Q., Li, C., Chyan, A., Chung, L., and Morrissette, N.S. (2012b). SPM1 Stabilizes Subpellicular Microtubules in Toxoplasma gondii. Eukaryot Cell 11, 206-216. Travier, L., Mondragon, R., Dubremetz, J.F., Musset, K., Mondragon, M., Gonzalez, S., Cesbron- Delauw, M.F., and Mercier, C. (2008). Functional domains of the Toxoplasma GRA2 protein in the formation of the membranous nanotubular network of the parasitophorous vacuole. International journal for parasitology 38, 757-773. Treeck, M., Sanders, J.L., Elias, J.E., and Boothroyd, J.C. (2011). The phosphoproteomes of Plasmodium falciparum and Toxoplasma gondii reveal unusual adaptations within and beyond the parasites' boundaries. Cell Host Microbe 10, 410-419. Treeck, M., Sanders, J.L., Gaji, R.Y., LaFavers, K.A., Child, M.A., Arrizabalaga, G., Elias, J.E., and Boothroyd, J.C. (2014). The calcium-dependent protein kinase 3 of toxoplasma influences basal calcium levels and functions beyond egress as revealed by quantitative phosphoproteome analysis. PLoS pathogens 10, e1004197. Uboldi, A.D., McCoy, J.M., Blume, M., Gerlic, M., Ferguson, D.J., Dagley, L.F., Beahan, C.T., Stapleton, D.I., Gooley, P.R., Bacic, A., et al. (2015). Regulation of Starch Stores by a Ca(2+)-Dependent Protein Kinase Is Essential for Viable Cyst Development in Toxoplasma gondii. Cell Host Microbe 18, 670-681. van Breugel, M., Hirono, M., Andreeva, A., Yanagisawa, H.A., Yamaguchi, S., Nakazawa, Y., Morgner, N., Petrovich, M., Ebong, I.O., Robinson, C.V., et al. (2011). Structures of SAS-6 suggest its organization in centrioles. Science 331, 1196-1199. van Dooren, G.G., Reiff, S.B., Tomova, C., Meissner, M., Humbel, B.M., and Striepen, B. (2009). A novel dynamin-related protein has been recruited for apicoplast fission in Toxoplasma gondii. Current biology : CB 19, 267-276. van Dooren, G.G., and Striepen, B. (2013). The algal past and parasite present of the apicoplast. Annu Rev Microbiol 67, 271-289. Wall, R.J., Roques, M., Katris, N.J., Koreny, L., Stanway, R.R., Brady, D., Waller, R.F., and Tewari, R. (2016). SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector. Sci Rep 6, 28604. Waller, R.F., Keeling, P.J., Donald, R.G., Striepen, B., Handman, E., Lang-Unnasch, N., Cowman, A.F., Besra, G.S., Roos, D.S., and McFadden, G.I. (1998). Nuclear-encoded proteins target to the plastid in Toxoplasma gondii and Plasmodium falciparum. Proceedings of the National Academy of Sciences of the United States of America 95, 12352-12357.

127 Waller, R.F., Ralph, S.A., Reed, M.B., Su, V., Douglas, J.D., Minnikin, D.E., Cowman, A.F., Besra, G.S., and McFadden, G.I. (2003). A type II pathway for fatty acid biosynthesis presents drug targets in Plasmodium falciparum. Antimicrobial agents and chemotherapy 47, 297-301. Wetzel, D.M., Chen, L.A., Ruiz, F.A., Moreno, S.N., and Sibley, L.D. (2004). Calcium-mediated protein secretion potentiates motility in Toxoplasma gondii. Journal of cell science 117, 5739-5748. Wiersma, H.I., Galuska, S.E., Tomley, F.M., Sibley, L.D., Liberator, P.A., and Donald, R.G. (2004). A role for coccidian cGMP-dependent protein kinase in motility and invasion. International journal for parasitology 34, 369-380. Williams, M.J., Alonso, H., Enciso, M., Egarter, S., Sheiner, L., Meissner, M., Striepen, B., Smith, B.J., and Tonkin, C.J. (2015). Two Essential Light Chains Regulate the MyoA Lever Arm To Promote Toxoplasma Gliding Motility. Mbio 6, e00845-00815. Wilson, I. (1993). Plastids better red than dead. Nature 366, 638. Wolters, J. (1991). The troublesome parasites--molecular and morphological evidence that Apicomplexa belong to the dinoflagellate-ciliate clade. Biosystems 25, 75-83. Woo, Y.H., Ansari, H., Otto, T.D., Klinger, C.M., Kolisko, M., Michalek, J., Saxena, A., Shanmugam, D., Tayyrov, A., Veluchamy, A., et al. (2015). Chromerid genomes reveal the evolutionary path from photosynthetic algae to obligate intracellular parasites. eLife 4, e06974. Yusuf, N.A., Green, J.L., Wall, R.J., Knuepfer, E., Moon, R.W., Schulte-Huxel, C., Stanway, R.R., Martin, S.R., Howell, S.A., Douse, C.H., et al. (2015). The Plasmodium Class XIV Myosin, MyoB, Has a Distinct Subcellular Location in Invasive and Motile Stages of the Malaria Parasite and an Unusual Light Chain. The Journal of biological chemistry 290, 12147-12164. Zhang, K., Han, Y.T., Zhao, F.L., Hu, Y., Gao, Y.R., Ma, Y.F., Zheng, Y., Wang, Y.J., and Wen, Y.Q. (2015). Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp. BMC Plant Biol 15, 164. Zhang, X.S., and Choi, J.H. (2001). Molecular evolution of calmodulin-like domain protein kinases (CDPKs) in plants and protists. J Mol Evol 53, 214-224.

128

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Katris, Nicholas Jeremy

Title: Functional analysis of the apical polar ring its role in secretion and motility of Toxoplasma parasites

Date: 2017

Persistent Link: http://hdl.handle.net/11343/192333

File Description: KATRIS, NICHOLAS JEREMY

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.