ZRSR1 Cooperates with ZRSR2 in Regulating Splicing of U12-Type Introns in Murine Hematopoietic Cells

ZRSR1 cooperates with ZRSR2 in regulating splicing of U12-type introns in murine hematopoietic cells by Vikas Madan, Zeya Cao, Weoi Woon Teoh, Pushkar Dakle, Lin Han, Pavithra Shyamsunder, Maya Jeitany, Siqin Zhou, Jia Li, Hazimah Binte Mohd Nordin, JiZhong Shi, Shuizhou Yu, Henry Yang, Md Zakir Hossain, Wee Joo Chng, and H. Phillip Koeffler

Haematologica 2021 [Epub ahead of print]

Citation: Vikas Madan, Zeya Cao, Weoi Woon Teoh, Pushkar Dakle, Lin Han, Pavithra Shyamsunder, Maya Jeitany, Siqin Zhou, Jia Li, Hazimah Binte Mohd Nordin, JiZhong Shi, Shuizhou Yu, Henry Yang, Md Zakir Hossain, Wee Joo Chng, and H. Phillip Koeffler. ZRSR1 cooperates with ZRSR2 in regulating splicing of U12-type introns in murine hematopoietic cells. Haematologica. 2021; 106:xxx doi:10.3324/haematol.2020.260562

Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process. ZRSR1 cooperates with ZRSR2 in regulating splicing of

U12-type introns in murine hematopoietic cells

Running title: ZRSR2 & ZRSR1 cooperate in splicing of U12 introns

Vikas Madan1*, Zeya Cao1,2*, Weoi Woon Teoh1, Pushkar Dakle1, Lin Han1,2,

Pavithra Shyamsunder1,3, Maya Jeitany1,4, Siqin Zhou1, Jia Li1, Hazimah Binte Mohd

Nordin1, JiZhong Shi1, Shuizhou Yu1, Henry Yang1, Md Zakir Hossain1, Wee Joo

Chng1,2,5#, and H. Phillip Koeffler1,6,7#

1Cancer Science Institute of Singapore, National University of Singapore, Singapore; 2Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 3Programme in Cancer and Stem Cell Biology, Duke–NUS Medical School, Singapore 4School of Biological Sciences, Nanyang Technological University, Singapore 5Hematology-Oncology, National University Cancer Institute, NUHS, Singapore; 6Cedars-Sinai Medical Center, Division of Hematology/Oncology, UCLA School of Medicine, Los Angeles, USA; 7National University Cancer Institute, National University Hospital Singapore, Singapore. *VM and ZC contributed equally as co-first authors.

#WJC and HPK share senior authorship

*Correspondence: Vikas Madan, Cancer Science Institute of Singapore, National University of

Singapore, Singapore 117599, E-mail: [email protected]

Acknowledgements

We thank the staff of Comparative Medicine, NUS for their support in maintaining mouse colonies. We also acknowledge expert help and support from the FACS facility at CSI, Singapore.

This work was funded by the Leukemia and Lymphoma Society, the Singapore

Ministry of Health’s National Medical Research Council (NMRC) under its Singapore

Translational Research (STaR) Investigator Award to H. Phillip Koeffler

(NMRC/STaR/0021/2014), the NMRC Centre Grant awarded to National University

Cancer Institute of Singapore (NMRC/CG/012/2013) and the National Research

Foundation Singapore and the Singapore Ministry of Education under its Research

Centres of Excellence initiatives. This research is also supported by the RNA Biology

Center at the Cancer Science Institute of Singapore, NUS, as part of funding under the Singapore Ministry of Education’s Tier 3 grants, grant number MOE2014-T3-1-

006. We thank the Melamed Family for their generous support.

Conflict-of-interest disclosure

The authors declare no conflict of interest.

Authors’ contributions

V.M. conceived the study, designed and performed research, analysed data and wrote the manuscript; Z.C. designed and performed research, analysed data and

2 wrote the manuscript; W.W.T., L.H., P.S. and M.J. performed research and analysed data; P.D. performed bioinformatics and statistical analyses and wrote the manuscript; S.Z., J.L. and H.Y. performed and supervised bioinformatics and statistical analyses; S.J., Y.S. and M.Z.H. performed blastocyst injections to generate chimeras from targeted ES cells; W.J.C supervised the study and wrote the manuscript; H.P.K. conceived and supervised the study, interpreted the data and wrote the manuscript. All authors reviewed and approved the manuscript.

Abstract

Recurrent loss-of-function mutations of spliceosome gene, ZRSR2, occur in myelodysplastic syndromes (MDS). Mutation/loss of ZRSR2 in human myeloid cells primarily causes impaired splicing of the U12-type introns. To investigate further the role of this splice factor in splicing and hematopoietic development, we generated mice lacking ZRSR2. Unexpectedly, Zrsr2-deficient mice developed normal hematopoiesis with no abnormalities in myeloid differentiation evident in either young or ≥1-year old knockout mice. Repopulation ability of Zrsr2-deficient hematopoietic stem cells was also unaffected in both competitive and non-competitive reconstitution assays. Myeloid progenitors lacking ZRSR2 exhibited mis-splicing of

U12-type introns, however, this phenotype was moderate compared to the ZRSR2- deficient human cells. Our investigations revealed that a closely related homolog,

Zrsr1, expressed in the murine hematopoietic cells, but not human, contributes to splicing of U12-type introns. Depletion of Zrsr1 in Zrsr2 KO myeloid cells exacerbated retention of the U12-type introns, thus highlighting a collective role of

ZRSR1 and ZRSR2 in murine U12-spliceosome. We also demonstrate that aberrant retention of U12-type introns of MAPK9 and MAPK14 leads to their reduced protein expression. Overall, our findings highlight that both ZRSR1 and ZRSR2 are functional components of the murine U12-spliceosome, and depletion of both proteins is required to model accurately ZRSR2-mutant MDS in mice.

Introduction

Mutations in RNA splicing factors constitute the leading class of genetic alterations in myelodysplastic syndromes (MDS).1-4 Somatic mutations in spliceosome genes,

SF3B1, SRSF2, U2AF1 and ZRSR2 are observed in >50% of MDS.2, 3 These mutations are early events during disease development and largely occur mutually exclusive of each other.1-5 Intense efforts in the last few years have enhanced our understanding of the impact of spliceosome mutations on RNA splicing and defined a mis-splicing pattern for each mutation.6-17 Animal models expressing mutant hotspots of splice factor genes - SRSF2 (P95H), SF3B1 (K700E) and U2AF1 (S34F)

- have enabled elucidation of consequences of these genetic lesions on RNA splicing and hematopoietic development.6, 7, 12, 15, 16, 18-20 Unlike mutational hotspots observed in SF3B1, SRSF2 and U2AF1, alterations of ZRSR2 are truncating mutations spread throughout the transcript. ZRSR2 is located on human chromosome X and somatic mutations are primarily observed in males, suggesting its loss-of-function in MDS.1 It is involved in 3’ splice site recognition and interacts with U2AF2/U2AF1 heterodimer and SRSF2 during pre-spliceosome assembly.21

ZRSR2 is recruited in an ATP-dependent fashion to the U12-type intron splice site, and is required for the formation of spliceosome complex.22 We have previously illustrated that either truncating mutations of ZRSR2 in MDS or its silencing in AML cells impairs predominantly splicing of U12-type introns, excision of which is mediated by minor spliceosome assembly.8 However, animal models of ZRSR2 deficiency have not been reported and an in-depth understanding of its function is lacking.

In this study, we have generated a first mouse model of ZRSR2 deficiency to uncover further its function in splicing and to evaluate the effect of its loss on normal 5 and malignant hematopoiesis. Although deletion of Zrsr2 induces aberrant splicing of

U12-type introns in mouse myeloid precursors, myeloid differentiation is largely unaffected in young, as well as ≥1-year old Zrsr2 knockout (KO) male mice. ZRSR2- deficient hematopoietic stem cells (HSCs) retain multilineage reconstitution ability, suggesting limited function of ZRSR2 in mouse hematopoiesis. We investigated further its closely related homolog, ZRSR1, and uncovered that it compensates for the loss of ZRSR2 in mouse hematopoietic cells, and concurrent deficiency of both proteins leads to more profound defects in splicing of U12-type introns. Hence, murine models lacking both ZRSR2 and ZRSR1 are necessary to replicate faithfully mis-splicing caused by loss-of-function mutations of ZRSR2 in MDS.

Methods

Generation of Zrsr2 KO mice

C57BL/6N embryonic stem (ES) cells (Zrsr2tm1(KOMP)Vlcg) with targeted deletion of mouse Zrsr2 were obtained from UC Davis KOMP Repository. Mice with constitutive deletion of Zrsr2 were generated at the transgenic facility of CSI Singapore. Briefly,

ES cells were microinjected into BALB/cJInv blastocysts and resulting chimera were mated with C57BL/6 mice. Black offspring were genotyped, and mice carrying the

Zrsr2 null allele were used to establish colony of Zrsr2 KO mice. Subsequently, mice were crossed with CMV-Cre strain to remove the neomycin selection cassette. In this study, Zrsr2 KO mice refer to those before or after Cre-mediated excision, as they were phenotypically identical in all experiments. Primers used for genotyping are listed in Supplementary Table S1.

All animal experiments were approved by the Institutional Animal Care and Use

Committee of National University of Singapore, Singapore.

Flow cytometric analysis and FACS sorting

Single cell suspensions from bone marrow (BM), spleen and thymus were stained with fluorochrome-conjugated antibodies for 30 min. Lineage cocktail comprised of antibodies targeting CD19, CD3ε, CD11b, Gr1 and TER119. Cells were washed with

2% FBS/PBS and resuspended in SYTOX Blue Dead Cell Stain (ThermoFisher

Scientific). Cells were acquired on FACS LSR II (BD Biosciences) and data were analysed using FACSDIVA software (BD Biosciences). Cells were sorted on

FACSAria cell sorter (BD Biosciences).

RNA-sequencing

Total RNA was extracted from sorted myeloid precursors [common myeloid precursors (CMP), granulocyte monocyte precursors (GMP) and megakaryocyte erythroid precursors (MEP)], murine embryonic fibroblasts (MEFs) and ex-vivo cultured Lin−Kit+ BM cells using either RNeasy Micro or Mini Kits (Qiagen). Libraries of polyA-selected RNA were prepared using either TruSeq sample preparation kit

(CMP, GMP, MEP and MEF) or NEBNext Ultra RNA Library Prep Kit (Lin−Kit+ BM cells). Libraries were sequenced on HiSeq 4000, and paired-end reads were mapped to either mouse reference transcriptome (GRCm38/mm10; Ensemble version 84) or hg38 reference genome using the STAR aligner23 with params ‘--

7 outSAMstrandField intronMotif --alignSJDBoverhangMin 6 --alignIntronMax 299999 -

-outFilterMultimapNmax 4 --scoreGapATAC -4’.

Differential splicing analysis

A list of valid introns was extracted from the Gencode24 gene transfer format file post removing transcripts with biotype ‘retained_intron’. Introns overlapping with an exon at their junctions were removed using pybedtools25, 26 and gffutils

(https://github.com/daler/gffutils). They were subsequently classified as either U2- type or U12-type based on position weight matrices from splicerack using gimmemotifs.27, 28

MSI (mis-splicing index) values were calculated for each intron as described before.8

Only those introns with a coverage of at least one read at each of their junctions and with total coverage of the two junctions higher than 4 were considered. Also, introns which did not have a coverage of at least one for 95% of their length were filtered out.

To identify differentially spliced introns, differences in MSI values (ΔMSI) were calculated as ΔMSI=MSIknockout−MSIwildtype. Significance of this difference was computed using a Fisher’s test, and the obtained p-values were corrected for multiple testing.

The python and R scripts used for analyses are available at https://github.com/pd321/intron-retention-scripts.

Accession codes

RNA-sequencing data were deposited in Gene Expression Omnibus database repository under accession numbers GSE151470 and GSE152432.

Results

Aberrant retention of U12-type introns in ZRSR2-deficient murine hematopoietic cells

Mice lacking the entire Zrsr2-coding sequence were obtained by germline transmission of the targeted allele (Fig. 1A). Following this, neomycin selection cassette was removed through mating with CMV-Cre transgenic mice, in effect replacing the Zrsr2 coding sequence with β-galactosidase gene (Fig. 1A). Complete lack of Zrsr2 transcripts was evident in quantitative PCR analysis of bone marrow, spleen and thymus cells, as well as RNA-sequencing of targeted ES cells from Zrsr2 knockout mice (Supplementary Fig. S1A-B). Loss of Zrsr2 did not alter expression of its homolog, Zrsr1, in hematopoietic cells (Supplementary Fig. S1B).

To assess the effect of ZRSR2 deficiency on RNA splicing, we performed RNA- sequencing on sorted wildtype (WT) and KO myeloid precursor populations from bone marrow: common myeloid progenitors (CMP; Lin−Kit+Sca1−CD34+FcγRII/IIIlo), granulocyte monocyte progenitors (GMP; Lin−Kit+Sca1−CD34+FcγRII/IIIhi), megakaryocyte erythrocyte progenitors (MEP; Lin−Kit+Sca1−CD34−FcγRII/III−) as well as embryonic fibroblasts from male WT and Zrsr2 KO embryos. Aberrant retention of

U12-type introns was observed in all three ZRSR2-deficient myeloid progenitors, but was not evident in murine embryonic fibroblasts (Fig. 1B-C and Supplementary

Table S2). Despite a trend towards mis-splicing of U12-type introns in murine hematopoietic cells, we noted that the effect of ZRSR2 deficiency on splicing (as 9 indicated by ΔMSI values) was significantly lower than that previously observed by us in ZRSR2 mutant human MDS bone marrow and ZRSR2-deficient human AML cell lines, TF1 and K562 (Fig. 1B-E and Supplementary Table S3).8 The number of aberrantly retained U12-type introns in Zrsr2 KO murine myeloid precursors was notably lower than ZRSR2 knockdown K562 and TF1 cells (Fig. 1F). Only a modest effect on splicing was unexpected, especially given a complete loss of ZRSR2 expression in our mouse model. Moreover, U12-type introns are highly conserved between human and mouse genomes (Supplementary Fig. S2), so a similar effect of

ZRSR2 deficiency would be expected in the two species. Overall, our findings indicated reduced dependence of the U12-spliceosome on ZRSR2 in murine myeloid cells.

Normal myeloid development in mice lacking ZRSR2

We analyzed hematopoietic compartment in ZRSR2-deficient (Zrsr2Δ/Y) compared to

WT (Zrsr2+/Y) male mice. No significant difference was observed in peripheral blood counts of young mice of both genotypes; and age-dependent defects were also not apparent (Fig. 2A and Supplementary Fig. S3). Initial analysis of young males (7-10 weeks old) showed that deficiency of ZRSR2 neither affected the bone marrow cellularity nor the frequency of Lin−Sca1+Kit+ (LSK) cells (Fig. 2B-C). Proportion of hematopoietic stem cells (HSCs; CD34–Flt3– LSK cells) and progenitors also remained unaltered in young male mice. MDS is primarily a disease of elderly, and to understand if loss of ZRSR2 manifested its effect with aging, bone marrows of ≥1- year old male mice were examined. Surprisingly, old ZRSR2 males also exhibited normal bone marrow cellularity and frequencies of HSCs and multipotent progenitors

(Fig. 2B-D). Moreover, proportion of myeloid precursors, CMPs, GMPs and MEPs, and stages of erythroid development were also largely unaltered in the bone marrow of young and old ZRSR2-deficient male mice (Fig. 2E and Supplementary Fig. S4A).

Normal myeloid differentiation was also evident by unchanged frequencies of granulocytes in spleen and bone marrow of Zrsr2 KO mice (Supplementary Fig.

S4B).

To evaluate the repopulation ability of Zrsr2 KO HSCs, competitive repopulation assays were performed. ZRSR2-deficient HSCs reconstituted both myeloid and lymphoid lineages in recipient mice as efficiently as WT cells (Fig. 2F), suggesting that repopulation potential of HSCs is maintained in the absence of ZRSR2. Further, in non-competitive repopulation assays, loss of ZRSR2 did not affect the peripheral blood cell counts in recipient mice even one year after transplantation

(Supplementary Fig. S5). Collectively, our comprehensive analyses of hematopoietic development in Zrsr2 KO mice and reconstitution ability of ZRSR2-deficient HSCs demonstrated that ZRSR2 is not essential for hematopoietic development in mice.

Murine Zrsr1 is a putative functional copy of Zrsr2

Given our unexpected observations that deletion of Zrsr2 in mice did not impact hematopoietic development and affected modestly splicing of U12-type introns, we postulated that other spliceosome protein(s) might compensate for its absence.

ZRSR1, a closely-related homolog, is a single exon gene formed by retrotransposition of ZRSR2 cDNA sequence. This autosomal copy of X-linked

ZRSR2 gene is highly similar to the parent gene in coding sequence (95% and 77% identical in human and mouse, respectively) and amino acid sequences (92% and 75%

11 identical in human and mouse, respectively) with a conserved open reading frame.

While ZRSR2 is ubiquitously expressed, human ZRSR1 is designated as a pseudogene with negligible transcript levels in human tissues

(https://gtexportal.org/home/), including in the hematopoietic cells (Fig. 3A). In contrast, the mouse Zrsr1 gene is expressed in hematopoietic cells, albeit at levels lower than Zrsr2 (Fig. 3B). This difference in transcriptional regulation of murine and human ZRSR1 genes is possibly caused by their location in distinct, non-orthologous genomic loci (Fig. 3C). Human ZRSR1 is located in the intron of the REEP5 gene on chromosome 5q while the mouse gene localizes to the first intron of the Commd1 gene on chromosome 11 (Fig. 3C), a genomic locus not syntenic to human chromosome 5. This demonstrates that retrotransposition of ZRSR2 gene occurred independently in rodents and primates, after the evolutionary divergence between the two mammalian orders.

Furthermore, we inspected chromatin structure and presence of histone marks associated with transcriptional activation at the ZRSR1 locus in human and murine cells, using available DNase-seq/ATAC-seq and ChIP-Seq data, respectively. While no ZRSR1 locus-specific signal was observed for histone marks associated with gene activation (H3K4me3, H3K4me1 and H3K27ac) in human common myeloid progenitors, significant ChIP-Seq peaks for all three histone modifications were detected in murine hematopoietic cells (Fig. 3D). Correspondingly, accessible chromatin was evident at murine but not human ZRSR1 locus (Fig. 3D). Based on epigenetic profiles and expression levels, we hypothesized that murine ZRSR1 encodes for a functional protein that could possibly regulate splicing of the U12-type introns.

Loss of ZRSR1 impairs splicing of U12-type introns in the absence of ZRSR2

To investigate if ZRSR1 functionally compensates for deficiency of ZRSR2 in splicing of U12-type introns, we silenced expression of Zrsr1 in murine myeloid precursors using short hairpin RNA (shRNA) (Supplementary Fig. S6A). Stable knockdown of

Zrsr1 in WT Lin−Kit+ BM cells did not alter notably splicing of the U12-type introns, although it resulted in reduced number of myeloid colonies in the methylcellulose medium (Fig. 4A, Supplementary Fig. S6B, Supplementary Fig. S7A and

Supplementary Table S4). Zrsr2 KO myeloid cells exhibited sizable retention of the

U12-type introns (Fig. 4A-B, Supplementary Fig. S7A and Supplementary Table S4), similar to that described previously for sorted CMP, GMP and MEP populations (Fig.

1B-C). Notably, knockdown of Zrsr1 in ZRSR2-deficient myeloid cells further exacerbated mis-splicing of the U12-type introns (Fig. 4A-B, Supplementary Fig. S7A and Supplementary Table S4), suggesting that ZRSR1 can also regulate their splicing. Comparison of Zrsr2 single KO with Zrsr2/Zrsr1 double deficient Lin−Kit+ BM cells showed two subclasses of retained introns in Zrsr2/Zrsr1 double deficient cells.

The first subclass comprises those introns which are retained in Zrsr2 KO cells, and their ΔMSI increases significantly in double-deficient cells; while the second category includes introns which are retained only when both ZRSR1 and ZRSR2 are lacking

(Supplementary Fig. S7B).

Retention of U12-type introns in the Zrsr2/Zrsr1 double-deficient cells was validated by qRT-PCR analysis of 10 introns, which illustrated a modest effect of loss of

ZRSR2 on splicing of U12-type introns, while concomitant deficiency of ZRSR1 and

ZRSR2 significantly enhanced intron retention compared to either WT or single KO cells (Fig. 4C).

Further, to verify the compensatory role of murine ZRSR1 in splicing of U12-type introns, CRISPR/Cas9 technique was used to generate myeloid cells lacking either one or both ZRSR proteins. Firstly, the whole Zrsr2 coding sequence was deleted using two guideRNAs targeting exons 2 and 11 of Zrsr2 gene (Supplementary Fig.

S8A-B). Two single cell clones of Zrsr2 knockout 32D cells were generated

(Supplementary Fig. S8B-C). Subsequently, we deleted N-terminus portion of the

Zrsr1 gene to generate single or double KO 32D cells (Supplementary Fig.

S8A,B,D,E). Quantitative RT-PCR analysis demonstrated aberrant retention of U12- type introns in Zrsr1/Zrsr2 double-deficient cells compared to control cells

(Supplementary Fig. S8F).

To verify that human ZRSR1 is a non-functional copy of ZRSR2, we generated K562 cells lacking either ZRSR1 or ZRSR2 or both proteins together. ΔZRSR1 cells were first generated using CRISPR/Cas9 technique followed by silencing of ZRSR2 using shRNAs. As expected, ZRSR2 deficiency alone impaired splicing of U12-type introns.

However, loss of ZRSR1, either alone or when combined with ZRSR2, did not significantly alter the splicing of U12-type introns in K562 cells (Supplementary Fig.

S9). Taken together, our experiments highlight a functional role of murine ZRSR1 in splicing of the U12-type introns.

Mis-splicing of MAPK9 and MAPK14 impacts their protein expression in murine and human cells

Several crucial genes harbour U12-type introns including members of the mitogen- activated protein kinase (MAPK) family of serine-threonine kinases. MAPK proteins play a crucial role in a wide range of biological processes including hematopoiesis.29

We focused on splicing of two members, MAPK9 (JNK2) and MAPK14 (p38α), as aberrant retention of U12-type introns was verified in murine myeloid precursors deficient in both Zrsr1 and Zrsr2 (Fig. 4C). Intron retention of both MAPK9 and

MAPK14 resulted in generation of aberrant transcripts containing a premature stop codon. To investigate if retention of U12-type introns in these two genes affects their protein expression, western blotting was performed with anti-MAPK9 and anti-

MAPK14 antibodies. Protein levels of both MAPK9 and MAPK14 were reduced, albeit modestly, in murine myeloid precursors, and MAPK14 levels were also reduced in 32D cells lacking ZRSR2 and ZRSR1 (Supplementary Fig. S10A-B).

Retention of U12-type introns of MAPK9 and MAPK14 was also observed in ZRSR2 knockdown K562 and TF1 cells (Fig. 5A-B). This was accompanied by significantly reduced MAPK9 and MAPK14 protein expression in human cells with silencing of

ZRSR2 (Fig. 5C). Amongst the two cell lines, K562 cells exhibited increased mis- splicing of both MAPK9 and MAPK14, which correlated with a more profound effect on their protein levels, compared to the TF1 cells (Fig. 5A-C). These observations illustrate that mis-splicing of MAPK9 and MAPK14 results in lower levels of these proteins, potentially impacting their function in hematopoietic development.

Discussion

Mouse models have been effective in deciphering key splicing and hematopoietic defects caused by mutations of spliceosome genes. Hematopoietic cells from mice expressing either mutant SF3B1, SRSF2 or U2AF1 recapitulated the patterns of splicing changes observed in mutant MDS samples.6, 12, 15, 16, 18-20 Although the splice factors are evolutionary conserved, intronic sequences are divergent between

15 human and mouse. These differences in intronic splicing elements and regulatory motifs between the two species possibly lead to divergent set of mis-spliced transcripts, which can contribute to phenotypic differences in hematopoietic development. This presents a conundrum about the utility of mouse models to identify genes whose splicing is altered by spliceosome mutation in MDS. We have previously demonstrated that ZRSR2 mutations/deficiency impairs splicing of the

U12-type intron in human cells.8, 17 U12-type introns are highly conserved during evolution, and the tissue-specific expression of transcripts harbouring this class of introns is largely preserved between mouse and human.30, 31 Therefore, we envisaged that a murine model would faithfully replicate loss of ZRSR2 in leukemic human cells. Indeed, ZRSR2 KO myeloid cells exhibited aberrant retention of U12- type introns. Unexpectedly, splicing of the U12-type introns was unaffected in

ZRSR2-deficient MEFs, suggesting tissue-specific effects of ZRSR2-deficiency on splicing. A previous study also demonstrated a more pronounced mis-splicing of

U12-type introns in blood cells compared to fibroblast and amniocytes in Taybi–

Linder syndrome (TALS) cases harbouring germline mutations of a U12 spliceosome-specific component, RNU4ATAC.32

One limitation of our constitutive KO mouse model is that complete absence of

ZRSR2 caused by germline loss of ZRSR2 might promote functional compensation during development. Therefore, findings from our KO mice may not reflect the consequences of acute loss of ZRSR2 in myeloid cells. Hematopoietic cell-specific inducible knockout models of ZRSR2 deficiency are needed to further elucidate the effect of conditional depletion of ZRSR2 during adult hematopoiesis, akin to what is observed in ZRSR2 mutant MDS.

Mice with constitutive ZRSR2 deletion developed normally with no overt hematopoietic defects and functionally competent hematopoietic stem cells. This is in contrast with mice expressing mutant SF3B1, SRSF2 or U2AF1, which displayed a range of hematopoietic phenotypes.6, 12, 15, 16, 18-20, 33 Isolated loss-of-function mutations of ZRSR2 have been associated with macrocytic anaemia in patients with myeloid diseases.34 However, our Zrsr2 KO mice did not display any significant changes in size and counts of blood cells. Moreover, while ZRSR2 deficiency affected splicing of U12-type introns in murine hematopoietic cells, magnitude of splicing defects was modest compared to either MDS bone marrow cells or human leukemia cell lines. This led us to investigate whether ZRSR1 can functionally compensate for the lack of ZRSR2.

ZRSR1 is a retrotransposed copy of ZRSR2, which originated via independent transposition events in rodents and primates. Murine Zrsr1 is an imprinted gene and expressed from the unmethylated, paternal allele.35-40 Unlike the human counterpart, which is designated as a pseudogene, the murine gene is expressed in hematopoietic cells, albeit at lower levels compared with Zrsr2. Our analyses revealed open chromatin and enrichment of epigenetic marks associated with transcriptional activation only at the murine Zrsr1 locus, supporting evidence for transcription of the murine retrogene.

In our study, silencing of Zrsr1 had no evident effect on the splicing of U12-type introns in Zrsr2 WT myeloid cells. In contrast, deficiency of ZRSR1 clearly exacerbated the mis-splicing of U12-type introns in cells lacking ZRSR2, thereby underlining that both ZRSR1 and ZRSR2 collectively contribute to splicing of U12- type introns in mouse hematopoietic cells. While RNA splicing was not studied in

Zrsr1 KO mice,41 recent studies have shown that expression of truncated Zrsr1

17 impacts splicing of the U12-type introns in testis and hypothalamus.42, 43 Interestingly,

Zrsr1-mutant mice exhibit defects in erythrocyte maturation and fewer peripheral red blood cells, with apparent morphological abnormalities.42 The differences observed in impact of ZRSR1 deficiency on splicing of U12-type introns in our study (myeloid precursors) vs studies investigating mutant Zrsr1 expressing spermatocytes/hypothalamus could possibly arise because of relative levels of

ZRSR2 and ZRSR1 in different cell types. Another possibility is that the truncated

ZRSR1 can impair recruitment of ZRSR2 to U12-type intron splice site, thereby perturbing its splicing function.

Signal transduction mediated by MAP kinase pathway plays a vital role in numerous biological processes via phosphorylation of several downstream substrates.44 Genes encoding several members of MAP kinase family harbour U12-type introns, hence their splicing is dependent on ZRSR2 activity. We identified two candidates, MAPK9 and MAPK14, where aberrant splicing resulted in decreased protein levels both in human and murine cells. The effect of ZRSR2/ZRSR1 double deficiency on MAPK9 and MAPK14 protein levels in murine cells was less pronounced compared to human cells lacking ZRSR2, which corresponds with milder effect on splicing of U12-type introns in murine cells. While MAPK9 regulates T cell apoptosis and proliferation, and MAPK14 is indispensable for definitive erythropoiesis in mice,45, 46 these proteins have not been directly implicated in pathogenesis of MDS. Although we validated experimentally mis-splicing of just two of the MAPK members, a broader effect on splicing of multiple components can be envisaged. For instance, in murine myeloid precursors, we also validated aberrant retention of U12-type intron of MCTS1, which modulates MAPK pathway by promoting phosphorylation of MAPK1 and MAPK3.47

Given an essential role of MAPK proteins in regulating hematopoiesis,29 collective

18 decrease in their protein levels can potentially be detrimental to myeloid/erythroid differentiation and expansion, thereby contributing to the disease phenotype in MDS.

Taken together, unlike human ZRSR1 pseudogene, Zrsr1 in mice is a functional autosomal copy of Zrsr2 and contributes to splicing of U12-type introns. This is also supported by a recent study which demonstrated that expression of at least one copy of either maternal Zrsr2 or paternal Zrsr1 is necessary for viability of murine embryos.48 Additionally, our study highlights that splicing of U12-type introns in murine cells depends conceivably on the balance between expression levels of

ZRSR2 and ZRSR1. Hence, deficiency of ZRSR2 alone is insufficient to impact extensively RNA splicing in mice, and further studies with concurrent deficiency of

ZRSR1 and ZRSR2 are warranted to replicate complete loss of ZRSR activity.

Notably, germline expression of truncated Zrsr1 and Zrsr2 alleles showed that double mutant mice are non-viable, with Zrsr1/Zrsr2 double mutant embryos exhibiting defects in early preimplantation development.48 Hence, conditional knockout alleles of both Zrsr1 and Zrsr2 are required to investigate their combined loss in adult mice.

References

1. Yoshida K, Sanada M, Shiraishi Y, et al. Frequent pathway mutations of splicing machinery in myelodysplasia. Nature. 2011;478(7367):64-69. 2. Haferlach T, Nagata Y, Grossmann V, et al. Landscape of genetic lesions in 944 patients with myelodysplastic syndromes. Leukemia. 2014;28(2):241-247. 3. Papaemmanuil E, Gerstung M, Malcovati L, et al. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood. 2013;122(22):3616-3627. 4. Papaemmanuil E, Cazzola M, Boultwood J, et al. Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Engl J Med. 2011;365(15):1384-1395. 5. Damm F, Kosmider O, Gelsi-Boyer V, et al. Mutations affecting mRNA splicing define distinct clinical phenotypes and correlate with patient outcome in myelodysplastic syndromes. Blood. 2012;119(14):3211-3218. 6. Kim E, Ilagan JO, Liang Y, et al. SRSF2 Mutations Contribute to Myelodysplasia by Mutant- Specific Effects on Exon Recognition. Cancer Cell. 2015;27(5):617-630. 7. Komeno Y, Huang YJ, Qiu J, et al. SRSF2 Is Essential for Hematopoiesis, and Its Myelodysplastic Syndrome-Related Mutations Dysregulate Alternative Pre-mRNA Splicing. Mol Cell Biol. 2015;35(17):3071-3082. 8. Madan V, Kanojia D, Li J, et al. Aberrant splicing of U12-type introns is the hallmark of ZRSR2 mutant myelodysplastic syndrome. Nat Commun. 2015;6:6042. 9. Zhang J, Lieu YK, Ali AM, et al. Disease-associated mutation in SRSF2 misregulates splicing by altering RNA-binding affinities. Proc Natl Acad Sci U S A. 2015;112(34):E4726-4734. 10. Ilagan JO, Ramakrishnan A, Hayes B, et al. U2AF1 mutations alter splice site recognition in hematological malignancies. Genome Res. 2015;25(1):14-26. 11. Okeyo-Owuor T, White BS, Chatrikhi R, et al. U2AF1 mutations alter sequence specificity of pre-mRNA binding and splicing. Leukemia. 2015;29(4):909-917. 12. Shirai CL, Ley JN, White BS, et al. Mutant U2AF1 Expression Alters Hematopoiesis and Pre- mRNA Splicing In Vivo. Cancer Cell. 2015;27(5):631-643. 13. Alsafadi S, Houy A, Battistella A, et al. Cancer-associated SF3B1 mutations affect alternative splicing by promoting alternative branchpoint usage. Nat Commun. 2016;7:10615. 14. Darman RB, Seiler M, Agrawal AA, et al. Cancer-Associated SF3B1 Hotspot Mutations Induce Cryptic 3' Splice Site Selection through Use of a Different Branch Point. Cell Rep. 2015;13(5):1033- 1045. 15. Mupo A, Seiler M, Sathiaseelan V, et al. Hemopoietic-specific Sf3b1-K700E knock-in mice display the splicing defect seen in human MDS but develop anemia without ring sideroblasts. Leukemia. 2017;31(3):720-727. 16. Obeng EA, Chappell RJ, Seiler M, et al. Physiologic Expression of Sf3b1(K700E) Causes Impaired Erythropoiesis, Aberrant Splicing, and Sensitivity to Therapeutic Spliceosome Modulation. Cancer Cell. 2016;30(3):404-417. 17. Madan V, Li J, Zhou S, et al. Distinct and convergent consequences of splice factor mutations in myelodysplastic syndromes. Am J Hematol. 2020;95(2):133-143. 18. Fei DL, Zhen T, Durham B, et al. Impaired hematopoiesis and leukemia development in mice with a conditional knock-in allele of a mutant splicing factor gene U2af1. Proc Natl Acad Sci U S A. 2018;115(44):E10437-E10446. 19. Kon A, Yamazaki S, Nannya Y, et al. Physiological Srsf2 P95H expression causes impaired hematopoietic stem cell functions and aberrant RNA splicing in mice. Blood. 2018;131(6):621-635. 20. Smeets MF, Tan SY, Xu JJ, et al. Srsf2(P95H) initiates myeloid bias and myelodysplastic/myeloproliferative syndrome from hemopoietic stem cells. Blood. 2018;132(6):608- 621.

21. Tronchere H, Wang J, Fu XD. A protein related to splicing factor U2AF35 that interacts with U2AF65 and SR proteins in splicing of pre-mRNA. Nature. 1997;388(6640):397-400. 22. Shen H, Zheng X, Luecke S, Green MR. The U2AF35-related protein Urp contacts the 3' splice site to promote U12-type intron splicing and the second step of U2-type intron splicing. Genes Dev. 2010;24(21):2389-2394. 23. Dobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15-21. 24. Frankish A, Diekhans M, Ferreira AM, et al. GENCODE reference annotation for the human and mouse genomes. Nucleic Acids Res. 2019;47(D1):D766-D773. 25. Dale RK, Pedersen BS, Quinlan AR. Pybedtools: a flexible Python library for manipulating genomic datasets and annotations. Bioinformatics. 2011;27(24):3423-3424. 26. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26(6):841-842. 27. Sheth N, Roca X, Hastings ML, Roeder T, Krainer AR, Sachidanandam R. Comprehensive splice-site analysis using comparative genomics. Nucleic Acids Res. 2006;34(14):3955-3967. 28. van Heeringen SJ, Veenstra GJ. GimmeMotifs: a de novo motif prediction pipeline for ChIP- sequencing experiments. Bioinformatics. 2011;27(2):270-271. 29. Geest CR, Coffer PJ. MAPK signaling pathways in the regulation of hematopoiesis. J Leukoc Biol. 2009;86(2):237-250. 30. Lin CF, Mount SM, Jarmolowski A, Makalowski W. Evolutionary dynamics of U12-type spliceosomal introns. BMC Evol Biol. 2010;10:47. 31. Olthof AM, Hyatt KC, Kanadia RN. Minor intron splicing revisited: identification of new minor intron-containing genes and tissue-dependent retention and alternative splicing of minor introns. BMC Genomics. 2019;20(1):686. 32. Cologne A, Benoit-Pilven C, Besson A, et al. New insights into minor splicing-a transcriptomic analysis of cells derived from TALS patients. RNA. 2019;25(9):1130-1149. 33. Xu JJ, Smeets MF, Tan SY, Wall M, Purton LE, Walkley CR. Modeling human RNA spliceosome mutations in the mouse: not all mice were created equal. Exp Hematol. 2019;70:10-23. 34. Fleischman RA, Stockton SS, Cogle CR. Refractory macrocytic anemias in patients with clonal hematopoietic disorders and isolated mutations of the spliceosome gene ZRSR2. Leuk Res. 2017;61:104-107. 35. Hatada I, Sugama T, Mukai T. A new imprinted gene cloned by a methylation-sensitive genome scanning method. Nucleic Acids Res. 1993;21(24):5577-5582. 36. Hayashizaki Y, Shibata H, Hirotsune S, et al. Identification of an imprinted U2af binding protein related sequence on mouse chromosome 11 using the RLGS method. Nat Genet. 1994;6(1):33-40. 37. Hatada I, Kitagawa K, Yamaoka T, et al. Allele-specific methylation and expression of an imprinted U2af1-rs1 (SP2) gene. Nucleic Acids Res. 1995;23(1):36-41. 38. Shibata H, Yoshino K, Sunahara S, et al. Inactive allele-specific methylation and chromatin structure of the imprinted gene U2af1-rs1 on mouse chromosome 11. Genomics. 1996;35(1):248- 252. 39. Feil R, Boyano MD, Allen ND, Kelsey G. Parental chromosome-specific chromatin conformation in the imprinted U2af1-rs1 gene in the mouse. J Biol Chem. 1997;272(33):20893-20900. 40. Nabetani A, Hatada I, Morisaki H, Oshimura M, Mukai T. Mouse U2af1-rs1 is a neomorphic imprinted gene. Mol Cell Biol. 1997;17(2):789-798. 41. Sunahara S, Nakamura K, Nakao K, Gondo Y, Nagata Y, Katsuki M. The oocyte-specific methylated region of the U2afbp-rs/U2af1-rs1 gene is dispensable for its imprinted methylation. Biochem Biophys Res Commun. 2000;268(2):590-595. 42. Horiuchi K, Perez-Cerezales S, Papasaikas P, et al. Impaired Spermatogenesis, Muscle, and Erythrocyte Function in U12 Intron Splicing-Defective Zrsr1 Mutant Mice. Cell Rep. 2018;23(1):143- 155.

43. Alen F, Gomez-Redondo I, Rivera P, et al. Sex-Dimorphic Behavioral Alterations and Altered Neurogenesis in U12 Intron Splicing-Defective Zrsr1 Mutant Mice. Int J Mol Sci. 2019;20(14):3543. 44. Cargnello M, Roux PP. Activation and function of the MAPKs and their substrates, the MAPK- activated protein kinases. Microbiol Mol Biol Rev. 2011;75(1):50-83. 45. Tamura K, Sudo T, Senftleben U, Dadak AM, Johnson R, Karin M. Requirement for p38alpha in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell. 2000;102(2):221-231. 46. Sabapathy K, Kallunki T, David JP, Graef I, Karin M, Wagner EF. c-Jun NH2-terminal kinase (JNK)1 and JNK2 have similar and stage-dependent roles in regulating T cell apoptosis and proliferation. J Exp Med. 2001;193(3):317-328. 47. Hsu HL, Choy CO, Kasiappan R, et al. MCT-1 oncogene downregulates p53 and destabilizes genome structure in the response to DNA double-strand damage. DNA Repair (Amst). 2007;6(9):1319-1332. 48. Gomez-Redondo I, Ramos-Ibeas P, Pericuesta E, Fernandez-Gonzalez R, Laguna-Barraza R, Gutierrez-Adan A. Minor Splicing Factors Zrsr1 and Zrsr2 Are Essential for Early Embryo Development and 2-Cell-Like Conversion. Int J Mol Sci. 2020;21(11):4115.

Figure Legends

Figure 1. Deficiency of ZRSR2 causes aberrant retention of U12-type introns in murine myeloid cells. (A) Generation of Zrsr2 knockout (KO) mice. Mice carrying the targeted Zrsr2 allele were crossed with CMV-Cre mice to excise the neomycin resistance cassette (post-Cre allele). PCR analysis (right) shows genotyping of deleted Zrsr2 alleles in male and female mice. (B) Dot plots show intron retention in

Zrsr2-deficent murine myeloid precursors (CMP, GMP and MEP) and MEFs compared to wildtype (WT) cells. U12-type introns are depicted as red circles. (C)

Range of ΔMSI values for retention of U12-type introns in murine cells. Outliers were removed from the plot using Gout method (Q=1). (D) Intron retention in ZRSR2 knockdown K562 cells (expressing either shRNA1 or shRNA2) compared to control transduced cells. (E) Range of ΔMSI values for intron retention (U12-type introns) in

TF1, K562 and MDS bone marrow cells. Outliers were removed from the plot using

Gout method (Q=1). RNA-seq data of ZRSR2-deficient TF1 cells and ZRSR2 mutant

MDS used in this analysis has been previously published.8 (F) Number of U12-type introns retained in murine and human cells lacking ZRSR2 (p<0.05; Fisher's exact test).

Figure 2. Hematopoietic development and reconstitution potential are unperturbed upon deletion of Zrsr2. (A) Peripheral blood WBC counts in WT and

Zrsr2 KO mice. (B) Total BM leukocyte counts (femurs + tibias) in young (7-10 weeks) and old (≥1-year old) WT and Zrsr2-deficient mice. (C) Proportion of LSK cells in bone marrow of young and old WT and Zrsr2 KO mice. (D-E) Frequencies of

LT-HSCs, ST-HSCs and MPPs (D) (Young mice: 5 WT and 5 KO; Old mice: 5 WT

23 and 3 KO) and myeloid precursors (CMPs, GMPs, MEPs) (E) (Young mice: 5 WT and 5 KO; Old mice: 6 WT and 4 KO). (F) Donor-derived B cells, T cells, granulocytes and monocytes in peripheral blood of recipient mice in competitive repopulation assays (6 recipient mice/group).

Figure 3. Human and mouse ZRSR1 are located in non-orthologous genomic loci. (A) Levels of ZRSR1 and ZRSR2 transcripts in human whole blood and spleen cells. Expression data are collated from Genotype-Tissue Expression (GTEx) portal.

(B) Expression levels of Zrsr1 and Zrsr2 transcripts in murine spleen cells (Bgee database) and myeloid precursors (in-house RNA-seq of sorted CMP, GMP and

MEP cells). TPM: Transcripts per million reads. (C) Genomic location of human and murine ZRSR1 genes. Orange arrows denote the direction of transcription for each gene. (D) H3K4me3, H3K4me1 and H3K27ac ChIP-seq signals and regions of open chromatin at human and murine ZRSR1 locus. All data were downloaded from the

ENCODE Consortium. Human ChIP-seq and DNase-seq data are for common myeloid progenitors, while murine data are from following sources - H3K4me3: CD1 embryonic erythroblasts, H3K4me1: CD1 embryonic megakaryocytes, H3K27ac: bone marrow macrophages, and ATAC-seq: adult erythroblasts.

Figure 4. Loss of ZRSR1 exacerbates retention of U12-type introns in ZRSR2- deficient murine hematopoietic cells. (A) Distribution of ΔMSI values for retention of U12-type introns in Lin−Kit+ BM cells lacking either ZRSR1 (sh1 or sh10) or

ZRSR2 or both compared to control cells. (B) Number of U12-type introns retained

(p<0.05; Fisher's exact test) in various pair-wise comparisons of Lin−Kit+ BM cells

24 deficient in either one or both ZRSR proteins. (C) Normalized expression of representative U12-type introns in Lin−Kit+ BM cells determined using quantitative

RT-PCR. Expression of U12-type introns was measured relative to expression of flanking exons. Data are from at least three replicates and represented as mean ±

SEM. P-values for each group compared to the ‘ZRSR2 WT; con sh’ group are depicted in the plot. Statistical difference between the Zrsr2/Zrsr1-double deficient and Zrsr2 KO cells are shown below the graph. *p<0.05, **p<0.01, ***p<0.001,

****p<0.0001, ns=not significant.

Figure 5. Aberrant retention of U12-type introns in human MAPK9 and MAPK14 genes impacts their protein expression. (A-B) Normalized expression of U12-type introns of MAPK9 (A) and MAPK14 (B) in TF1 and K562 cells stably expressing shRNA targeting human ZRSR2. The expression of U12-type introns was measured relative to the expression of flanking exons using quantitative PCR. Data are from five PCR experiments and represented as mean ± SEM. *p<0.05, **p<0.01,

***p<0.001, ns=not significant. (C) Protein levels of human MAPK9 and MAPK14 in

TF1 and K562 cells transduced with shRNA targeting ZRSR2.

Supplementary Information

ZRSR1 cooperates with ZRSR2 in regulating splicing of U12- type introns in murine hematopoietic cells

Running title: ZRSR2 & ZRSR1 cooperate in splicing of U12 introns

Vikas Madan1*, Zeya Cao1,2*, Weoi Woon Teoh1, Pushkar Dakle1, Lin Han1,2, Pavithra

Shyamsunder1,3, Maya Jeitany1,4, Siqin Zhou1, Jia Li1, Hazimah Binte Mohd Nordin1,

Shi Jizhong1, Yu Shuizhou1, Henry Yang1, Md Zakir Hossain1, Wee Joo Chng1,2,5#, and H. Phillip Koeffler1,6,7#

#WJC and HPK share senior authorship

Supplementary Methods

Peripheral blood analysis

Peripheral blood was analyzed using Abbott Cell-Dyn 3700 Hematology Analyzer

(Abbott Laboratories).

Murine embryonic fibroblasts (MEFs)

Heterozygous Zrsr2 KO mice were used for timed matings, and embryos from 14.5 days post coitus pregnant females were dissected out. Head and liver were removed, and remaining carcasses were digested for 30 min using Trypsin-EDTA solution with gentle stirring at 37°C. Undigested tissue were removed using 40 μm cell strainer and cell suspension was plated in 10 cm dishes. Adherent cells were expanded in DMEM medium containing 10% FBS, and RNA was extracted using Qiagen RNeasy Mini Kit.

Embryos were genotyped for Zrsr2 KO allele, and their sex was determined using PCR with primers GATGATTTGAGTGGAAATGTGAGGTA and

CTTATGTTTATAGGCATGCACCATGTA, as described before.1 Amplification was performed using GoTaq Green Master Mix (Promega) and PCR products were analysed on 1.5% agarose gel; bands corresponding to 685 bp and 480 bp were obtained for female embryos while 280 bp amplicon was obtained for male embryos.

Competitive and non-competitive repopulation assays

Bone marrow cells were harvested in 5% FBS-PBS and Lin−Kit+Sca1+ (LSK) cells were

FACS-sorted from the Zrsr2 KO and WT mice (CD45.2+). For competitive transplant assays, 2,000 LSK cells from either Zrsr2 KO or WT mice were mixed with 500,000 total bone marrow cells from the competitor B6.SJL-Ptprca Pepcb/BoyJ (B6.SJL) strain (CD45.1+), and injected intravenously in lethally irradiated (5.5 Gy x 2) recipient

(B6.SJL) mice. Blood was collected every four weeks after transplantation and leukocytes were analyzed for donor chimerism using both lymphoid (CD3 and CD19) and myeloid (CD11b, Gr1 and F4/80) markers.

For non-competitive repopulation assays, two million bone marrow cells from either

WT or Zrsr2 KO mice were injected intravenously in lethally irradiated B6.SJL mice.

Peripheral blood counts were analysed at indicated time points post transplantation.

ZRSR1 expression analysis

Expression levels of ZRSR1 transcripts in human spleen and blood cells were obtained from Genotype-Tissue Expression (GTEx) portal

(https://gtexportal.org/home/). Transcript levels of murine Zrsr1 were gathered either from the Bgee database (spleen),2 or our RNA-sequencing data (myeloid precursors).

Generation of Zrsr1 knockdown Lin−Kit+ bone marrow cells

Short hairpin RNA (shRNA) sequences targeting mouse Zrsr1 gene were cloned in

AgeI/EcoRI sites of pLKO.1-RFP lentiviral vector. To generate lentiviral particles, 293T cells were transfected using Lipofectamine 2000, and supernatant containing virus particles were collected 48h and 72h after transfection. shRNAs were screened in mouse fibroblast cell line, NIH3T3, and two shRNA sequences (sh1 and sh10), which resulted in significant downregulation of Zrsr1 transcript levels were selected. The target sequence for mouse Zrsr1 sh1 and sh10 are 5’- GCAGAGCGATTACTGGAGATA-3’ and 5’-AGTGCAGAAGGGATGACTATG-3’, respectively.

Sorted Lin−Kit+ bone marrow cells were transduced twice, 24h apart, using

RetroNectin reagent (Takara). Cells were cultured in IMDM supplemented with 15%

FBS and 10 ng/ml recombinant mouse IL-3, 10 ng/ml recombinant mouse IL-6 and 20 ng/ml recombinant mouse stem cell factor (SCF). RFP+ cells were sorted and either used for clonogenic assays or lyzed for RNA/protein extraction. For methylcellulose colony assay, cells were plated in MethoCult GF M3434 medium (STEMCELL

Technologies) containing recombinant mouse IL-3, mouse SCF, human IL-6 and human erythropoietin; and colonies were enumerated after 8 days.

Reverse transcription and quantitative PCR analysis for mis-splicing

RNA was treated with DNase I (Thermo Fisher Scientific) to remove genomic DNA contamination followed by reverse transcription using RevertAid First Strand cDNA

Synthesis Kit (Thermo Fisher Scientific). To verify intron retention, primers were designed to estimate the levels of both spliced and unspliced transcripts, and retention of U12-type introns was measured as relative quantity of unspliced to spliced transcripts. Quantitative RT-PCR was employed to measure the expression levels of spliced and unspliced transcripts using KAPA SYBR FAST universal kit according to manufacturer’s protocol.

Generation of Zrsr1/Zrsr2 double knockout 32D cells 32D cells were cultured in IMDM supplemented with 10% FBS and 2 ng/ml recombinant mouse IL-3. Cells lacking Zrsr1 and/or Zrsr2 were generated by sequential deletion of both genes using CRISPR/Cas9. Cells were first transduced with two guide RNAs targeting murine Zrsr2 gene (LentiCRISPR v2; Addgene #52961), one targeting exon 2 (target sequence GGCGACGGCAGGCGCTCGCT) and the other targeting exon 11 (target sequence AGCATTAACTGATGCTCTCG). Two million cells in 6-well plates were transduced using spinoculation (1000g for one hour) in the presence of 5 µg/ml protamine sulphate. Transduction was repeated after 24h; and cells were selected with 2 µg/ml puromycin for one week. PCR on the cell pool using primers TTCTTCCTTTGCCTCCGAGC and AGAGGTGCACAGGCAGAAAACAGG confirmed deletion of the Zrsr2 coding sequence. Guide RNA targeting lacZ gene of

Escherichia coli (TGCGAATACGCCCACGCGAT) was used as control. Single cell clones of Zrsr2-deleted (ΔZrsr2) and control cells were expanded and transduced with two guideRNAs targeting murine Zrsr1 gene (Lenti sgRNA Hygro; Addgene #104991), as described above. The target sequence for murine Zrsr1 sgRNA1 and sgRNA3 are

CCTGGACAGCAACTTCAGGG and AGAAGGGTGGGACTTGACGT, respectively.

Cells were selected with 1,100 µg/ml hygromycin; and deletion was assessed using primers CAAACACTGGCCTTCGACTG and TGTCGTCCTGCGTACCATCTT. Single cell clones with deletion of either Zrsr2 or Zrsr1 or both were expanded, and RNA and protein were extracted for splicing analyses and western blot, respectively.

Generation of ZRSR1 knockout K562 cells

K562 cells were transduced with two guideRNAs targeting human ZRSR1 gene (target sequences ATAAGTAGAATCACTGACAG and CATAGAAATCTAGGAACTGT) cloned into separate vectors expressing either mCherry or GFP (LentiCRISPRv2- mCherry, Addgene #99154 and LentiCRISPRv2GFP, Addgene #82416). 1-1.5 million cells in 6-well plates were transduced using spinoculation (1000g for one hour) in the presence of 5 µg/ml protamine sulphate. Transduction was repeated after 24h; and cells were FACS-sorted for GFP and mCherry expression. Once deletion of ZRSR1 locus in transduced cell pool was confirmed using PCR, single cell clones were generated for ZRSR1 guideRNAs- and control guideRNA-transduced cells. Both single cell clone and cell pool of ZRSR1-deleted and control cells were expanded and transduced with shRNAs targeting human ZRSR2 gene.

Western blot analysis for MAPK9 and MAPK14

Total protein lysates were prepared using M-PER Mammalian Protein Extraction

Reagent (Thermo Scientific) containing protease inhibitor cocktail (Roche) and phosphatase inhibitor (Roche). Protein concentration was measured using Pierce

BCA Protein Assay Kit (Thermo Scientific). Proteins resolved on SDS-PAGE gel were transferred to PVDF membrane (Millipore). Antibodies for MAPK9 (JNK2) (4672S) and MAPK14 (p38α) (9218T) were purchased from Cell Signaling Technology. Anti-

GAPDH and anti-ACTB antibodies were used as loading controls.

References

1. McFarlane L, Truong V, Palmer JS, Wilhelm D. Novel PCR assay for determining the genetic sex of mice. Sex Dev. 2013;7(4):207-211. 2. Komljenovic A, Roux J, Wollbrett J, Robinson-Rechavi M, Bastian FB. BgeeDB, an R package for retrieval of curated expression datasets and for gene list expression localization enrichment tests. F1000Res. 2016;5(2748.

Supplementary Figure S1

Supplementary Figure S1. (A) RNA-seq reads at Zrsr2 locus in WT and Zrsr2 KO ES cells. (B) Transcript levels of Zrsr2 and Zrsr1 in bone marrow, spleen and thymus of WT and Zrsr2 KO mice. Transcript levels were normalized to those of β-actin. Bars represent mean ± SEM.

Supplementary Figure S2

Supplementary Figure S2. Overlap of genes containing U12-type introns between human and murine genomes.

Supplementary Figure S3

Supplementary Figure S3. Periodic analysis of RBC and platelet counts, mean corpuscular volume (MCV) and haematocrit (HCT) in peripheral blood of WT and Zrsr2-deficient mice. Error bars represent SEM.

Supplementary Figure S4

Supplementary Figure S4. (A) Frequency of erythroid precursors (proE: CD71+TER119lo; EryA: CD71+TER119+FSChi; EryB: CD71+TER119+FSClo and EryC: CD71−TER119+FSClo) in BM of young (7-10 weeks old) and old (≥1-year old) WT and Zrsr2 KO mice. (B) Proportion of granulocytes (CD11b+Gr1high) in the bone marrow and spleen of WT and Zrsr2 KO mice. Data are from at least four mice of each genotype and age group, and represented as mean ± SEM.

Supplementary Figure S5

Supplementary Figure S5. Blood cell counts, HCT and MCV measured in the peripheral blood of recipient mice transplanted with either WT or Zrsr2 KO BM cells in non-competitive repopulation assay. Blood was drawn at indicated time points post transplantation.

Supplementary Figure S6

Supplementary Figure S6. (A) Transcript levels of Zrsr1 and Zrsr2 in Lin−Kit+ BM cells (from either WT or Zrsr2 KO mice) transduced with lentivirus expressing shRNAs (either sh1 or sh10) targeting Zrsr1. Transduced cells (RFP+) were sorted and RNA was extracted. Transcript levels were normalized to those of β-actin. (B) Clonogenic ability of sorted RFP+ Lin−Kit+ BM cells expressing Zrsr1 shRNA. Data are represented as mean ± SEM. Statistical significance was calculated compared to the control cells (Zrsr2 WT; con sh). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Supplementary Figure S7

Supplementary Figure S7. (A) Dot plots depict intron retention in either Zrsr2- deficient, Zrsr1-deficient or Zrsr2/Zrsr1 double deficient Lin−Kit+ BM cells. FACS- sorted Lin−Kit+ BM cells from either WT or Zrsr2 KO mice were transduced with lentivirus expressing shRNAs (shRNA1 or 10) targeting Zrsr1. Stably transduced (RFP+) cells were sorted and used for RNA-seq. Red circles represent U12-type introns. (B) Change in ΔMSI values for intron retention in Zrsr2-deficient and Zrsr2/Zrsr1 double deficient Lin−Kit+ BM cells. Representative plots from one of the two experiments are shown (sh1-targeted cells on left and sh10-targeted cells on right). Introns depicted in blue are those which are retained in both sh1 and sh10-targeted cells. These introns also have a ΔMSI value greater than 5 in Zrsr2/Zrsr1 double deficient cells, and display an increase in ΔMSI≥5 in Zrsr2/Zrsr1 double deficient cells compared to Zrsr2 KO cells.

Supplementary Figure S8

Supplementary Figure S8. (A) Schematic representation of strategy used for sequential deletion of Zrsr2 and Zrsr1 using CRISPR/Cas9 approach in 32D murine myeloid cells. (B) PCR analyses to verify deletion in Zrsr2 (upper) and Zrsr1 (lower) genomic loci in 32D cells. Locations of guide RNAs targeting each gene and PCR primers are depicted. (C) Sanger sequencing of PCR amplicon verifies deletion in Zrsr2 gene in two single cell clones. (D-E) Sanger sequencing analyses of PCR products (shown in b) corresponding to Zrsr1 genomic deletions in Zrsr1 single KO (D) and Zrsr1/Zrsr2 double KO (E) single cell clones. (F) Quantitative RT-PCR to estimate levels of retained U12-type introns in 32D single cell clones lacking either ZRSR1 or ZRSR2 or both. Data are represented as mean ± SEM. Statistical significance was calculated compared to the control cells (con clone 1.1). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Supplementary Figure S9

Supplementary Figure S9. (A) Schematic shows locations of guideRNAs targeting human ZRSR1 gene and PCR primers used to verify deletion. (B) Quantitative RT- PCR to estimate levels of retained U12-type introns in pool of K562 cells expressing guideRNAs targeting ZRSR1 and transduced with shRNAs targeting ZRSR2. Control cells (con sg + con sh) are used for statistical comparison. (C) PCR to verify deletion of ZRSR1 locus in K562 single cell clone. (D) Sanger sequencing of ZRSR1-deleted single cell clone revealed excision of 797 bp of genomic sequence. (E) Western blot verifies shRNA-mediated knockdown of ZRSR2 in control and ΔZRSR1 K562 single cell clone. (F) Quantitative PCR analysis as shown in (B) to estimate retention of U12- type introns in ZRSR1-deficient single cell clone transduced with shRNAs targeting ZRSR2. Data are represented as mean ± SEM. Statistical significance was calculated compared to the control cells (con sg clone 1 + con sh). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Supplementary Figure S10

Supplementary Figure S10. (A) Protein expression of MAPK9 and MAPK14 in WT and Zrsr2 KO Lin−Kit+ BM cells transduced with shRNA (either sh1 or sh10) targeting Zrsr1. (B) Western blot for MAPK14 in 32D cells lacking either Zrsr1 or Zrsr2 or both. Band intensities were measured using ImageJ software and ratio of intensities (relative to GAPDH band intensities) are indicated below the images.

Supplementary Tables

Supplementary Table S1

Genotyping PCR primers

Primer A - mZrsr2-wt-F ACAAAACCACCCAGAGTCCCAAATC Primer B - mZrsr2-wt-R AGAGGTGCACAGGCAGAAAACAGG Primer C - NeoR-F GCAGCCTCTGTTCCACATACACTTCA Primer D - LacZ-F ACTTGCTTTAAAAAACCTCCCACA

Mouse Zrsr1/Zrsr2 expression analysis

mZrsr1 F CAAGAAACGTCGGCAGAAAATG mZrsr1 R CTATCTCCAGTAATCGCTCTGCAAG mZrsr2 F AGACTTCTATTATGATGTCCTGCCTG mZrsr2 R GGCTGCTTGACAGTCTTCTTCC mActb F GGCACCACACCTTCTACAATGAG mActb R GGGTGTTGAAGGTCTCAAACATG

Intron retention analysis (mouse)

Mcts1-ex4-F AGGAGCCATCAAATTTGTACTCAG Mcts1-in4-R TCAGCAGTTAAACCCTGGGA Mcts1-ex5-R TGACACCCACACATAAAGCATG Ccdc28b-ex5-F GGAAGATCTTAGCAATTCCAT Ccdc28b-in5-R TGTGTGAATAGAGATAGGAACG Ccdc28b-ex6-R TGAAGAGGAGAGTAGCAGAAGAG Pola2-ex3-F AAAAAACTCTCCAAAGCCTG Pola2-in3-R GGGAAATTACATAGCACATGTATG Pola2-ex4-R GGGTGTGGTATAAGAGCTTAGG Inpp5b-ex21-F AGGTCTGAGGCCAGAGTTTG Inpp5b-in21-R TGAGCTTTGGGATAGTCTTCTCTC Inpp5b-ex22-R GCTCTGGCAGGCTCTCTAGG Vac14-ex16-F ACAACCCAGTCACCACCGTG Vac14-in16-R CTGGGGGATGGATGACAATG Vac14-ex17-R GCACGAGTTTGTCCACCTCTG Mapk14-ex8-F TGAGCTGTTGACCGGAAGAAC Mapk14-in8-R AGTCTTCCCCACCAATGAGTTAGG Mapk14-ex9-R TCTTCAGAAGCTCAGCCCCTG Ccnt2-ex1-F GATGAAGAGCTGTCGCATCGC Ccnt2-in1-R GACACTAGGCCCGGTCACCC Ccnt2-ex2-R CCTGTGCATATAAACAATCGCAGTG Sfi1-ex10-F GTCCTGCGGAGGGCCTTTAC Sfi1-in10-R AGCTCCTCACACTAGGGACACTCTG Sfi1-ex11-R AGGTAGTGCTGGCGGTGTTCAG Taf2-ex12-F GAAGTCCATTTCCAATGTCTCTGG Taf2-in12-R TCTTCCCTGTCTTCCACACAGC Taf2-ex13-R ACTTCCGTAAAACTTTACCACTCCAC Lmbr1l-ex13-F TCTCCAAACTGGGATCCTTTG Lmbr1l-in13-R CAGTGCTCTCAGGGGTCTATTAAG Lmbr1l-ex14-R CCTCAGGCTTCCAAAGAGTG Mapk9-ex7-F TCATGGCAGAAATGGTCCTC Mapk9-ex8-R TCTTCATGAACTCTGCGGAT Mapk9-in7-F GTTTCTGCGGATCCTCTAGGA Mapk9-in7-R ACAGTCCTCTCATGCAAAGG Vps16-ex13-F ACAGCTTCGTGCACATGTGTC Vps16-in13-R TAAACACCCTCATGCCATACATAGG Vps16-ex14-R AGCACCTGGATGGTGAGCTG

Intron retention analysis (human)

MAPK9-In7-F GACAAAGTCGTAAAATCCACTCCAG MAPK9-In7-R GTCTCAAAGTCATCACAGGTAGTCAAG MAPK9-ex7-F GTGAAAGGTTGTGTGATATTCCAAG MAPK9-ex8-R ATAATTCCTCACAGTTGGCTGAAG MAPK14-In8-F CTGTATTCCAGTGTCCATGGGTG MAPK14-In8-R AGCAAAATACTGAGAGTCTTCCCTAG MAPK14-ex8-F ATAATGGCCGAGCTGTTGACTG MAPK14-ex9-R GGTTCCAACGAGTCTTAAAATGAGC UFD1L -In-5F TATTGAATCTGTGCCTGCTTTGG UFD1L -In-5R TGTGCTAGCTGAACCCCATTATTC UFD1L -Ex-5F CTGACTTCCTGGACATCACCAAC UFD1L -Ex-6R TCATTATAGTTGATGGCAATCACATC ATG3 -In-11F ATCCTTCCCTGTATGTAAGATTAGTGG ATG3 -In-11R GGACATGTTCTAATCAACTAAGCAAGG ATG3 -Ex-11F TCATTGAGACTGTTGCAGAAGGAG ATG3 -Ex-12R GTCATATTCTATTGTTGGAATGACAGC MAPK1 -In-2F AATTCCACTGCTTGGTAACCTTG MAPK1 -In-2R CCAAGATTTTCCATGACTAGACTTAGG MAPK1 -Ex-2F GCTTCAGACATGAGAACATCATTG MAPK1 -Ex-3R GTGTCTTCAAGAGCTTGTAAAGATCTG MAPK8 -Ex-7F ATTATGGGAGAAATGGTTTGC MAPK8 -In-7R AGAGAACATAAAGAAGTTCATCGC MAPK8 -Ex-8R CAACGTAAGTCCTTACTGTTGGT PTEN -In-1F TAGAACGTGGGAGTAGACGGATG PTEN -In-1R AGAGTTCCGTCTAGCCAAACACAC PTEN -Ex-1F CATTTCCATCCTGCAGAAGAAG PTEN -Ex-2R GGAAATCCCATAGCAATAATGTTTG DDB1 Ex-25F GCTGGACATGCAGAATCGACTCAA DDB1 In-25R AGACATGTAGTAGCTTCCGGGT DDB1 In-26R ACTTGTCTGGCCCAGGGTTAAA CAPN1 -In-17F TTGTCTCCTGAGTGGGGTTTTG CAPN1 -In-17R AACAGGAAGACGTCCAGGGAG CAPN1 -Ex-17F GCTTCAGCCTAGAGTCGTGCC CAPN1 -Ex-18R AGGTAATTCCGGATGCGGTTC

Primers for checking deletion of Zrsr2 and Zrsr1 in 32D cells

mZrsr2-F TTCTTCCTTTGCCTCCGAGC mZrsr2-R AGAGGTGCACAGGCAGAAAACAGG mZrsr1-F CAAACACTGGCCTTCGACTG mZrsr1-R TGTCGTCCTGCGTACCATCTT

Primers for checking deletion of ZRSR1 in K562 cells

hZRSR1-F ACCGCACCTGGCCATAAGTA hZRSR1-R GCATTCTTCTTCCGACTGGT hZRSR1-R CCTCCTCCTGTGAGAGTCCT

Supplementary Table S2 (excel file): Introns aberrantly retained in Zrsr2 KO CMP, GMP, MEP and MEFs Supplementary Table S3 (excel file): Introns aberrantly retained in K562 and TF1 cells expressing shRNAs targeting ZRSR2 Supplementary Table S4 (excel file): Introns aberrantly retained in murine Lin−Kit+ bone marrow cells lacking either ZRSR1 or ZRSR2 or both