Human Renin Gene: Structure and Sequence Analysis (Recombinant DNA/Aspartyl Protease/Hypertension/Homology to Pepsin Gene/Multiple Transcriptional Promoters) PETER M

Home , Gene structure

Proc. Natl. Acad. Sci. USA Vol. 81, pp. 5026-5030, August 1984 Biochemistry Human renin gene: Structure and sequence analysis (recombinant DNA/aspartyl protease/hypertension/homology to pepsin gene/multiple transcriptional promoters) PETER M. HOBART*, MICHAEL FOGLIANO*, BARBRA A. O'CONNOR*, IDA M. SCHAEFERt, AND JOHN M. CHIRGWINt *Molecular Genetics Research, Pfizer Central Research, Groton, CT 06340; and tDepartment of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO 63110 Communicated by Max Tishler, April 23, 1984

ABSTRACT The complete protein precursor of human NaDodSO4 prior to autoradiography. Positive plaques were kidney renin has been determined from the sequence of cloned purified by standard methods (8). Cloning procedures were genomic DNA. The gene spans 12 kilobases of DNA and is in- according to National Institutes of Health guidelines. terrupted by eight intervening sequences. The nine regions Hybridization to Filter-Bound mRNA. RNA was purified (exons) encoding the protein were mapped with a mouse renin (9) from human kidneys (obtained immediately postmortem cDNA probe, synthetic oligonucleotide probes, and by hybrid- or from surgical nephrectomy) and the poly(A)+ mRNA was ization of genomic restriction fragments to a 1600-nucleotide fractionated using poly(U)-Sepharose (Bethesda Research human kidney mRNA. The predicted 403-amino acid pre- Laboratories) column chromatography (10). RNA dot hy- prorenin consists of mature renin and a 66-residue amino-ter- bridization assays involved spotting 1-10 jug of RNA directly minal prepropeptide. The DNA sequence 5' to the first exon onto activated diazobenzyloxymethyl paper (Schleicher & indicates the location of a transcriptional promoter (T-A-T-A- Schuell). Papers were prehybridized (14-16 hr) and then hy- A-A) for a mRNA encoding preprorenin. An additional tran- bridized (24-28 hr) in 50% formamide as described (27). scriptional promoter site is located within the first intron, DNA Sequencing Methods. Genomic DNA fragments were which, if used, would express a shortened nonsecreted pro- subcloned into pUC9, pUC13 (11), or pUR222 (12) plasmid renin. The structure of the human renin gene is similar to that derivatives of pBR322 for mapping and sequencing. DNA of human pepsinogen, a closely related aspartyl protease en- restriction sites were labeled at their 5' termini with [- zyme. This observation suggests that renin and pepsinogen 32P]ATP and T4 polynucleotide kinase (P-L Biochemicals) have a common evolutionary origin. and at their 3' termini using either a DNA polymerase (Klenow fragment; New England Nuclear) fill-in reaction Renin is an endocrine hormone catalyzing the first step in a and [a-32P]dNTP or a terminal nucleotidyltransferase (P-L cascade of factors that modulate arteriole blood pressure. It Biochemicals) reaction with cordycepin [a-32P]triphosphate. hydrolyzes a single peptide bond in the circulating globulin, DNA sequencing procedures were according to Maxam and angiotensinogen, releasing the amino-terminal decapeptide Gilbert (13). angiotensin I. The absolute specificity of renin is in contrast Oligonucleotide Synthesis. DNA oligomer probes were pre- to other aspartyl proteases, which act on a broad range of pared on a Genetic Design (Watertown, MA) automated substrates (1). The characterization of this specificity is of DNA synthesizer using a modification (14) ofthe phosphora- considerable pharmaceutical and medical interest. However, midate procedure of Caruthers (15). Oligomers were purified detailed biochemical analysis of the protein has been limited by acrylamide gel electrophoresis. because the hormone is produced in such small amounts by Peptide Numbering Convention. To clarify the relationship its known physiological source, the juxtaglomerular cells of of this predicted renin sequence to other aspartyl proteases the kidney cortex. Renin purified from human tissue has (16, 17), the first amino acid of mature renin is designated 1. shown variations in molecular weight and amino acid com- References to the predicted mouse submandibular prepro- position (2-4). renin (18) and human prepepsinogen (19) sequences use their We report here the isolation and sequence analysis of the respective numbering systems. human renin gene. RESULTS EXPERIMENTAL PROCEDURES Isolation of the Human Renin Gene. A cloned mouse sub- Plaque Screening. A library of bacteriophage Charon 4A mandibular gland renin cDNA probe (20) was used to screen containing human fetal DNA (5) was grown in Escherichia 300,000 plaques of a X bacteriophage library of human geno- coli strain LE392 (6). Nitrocellulose filter (Schleicher & mic DNA. Ten positive plaques were purified to homogene- Schuell) replicas of -300,000 plaques were incubated in 2x ity and shown by restriction endonuclease mapping to repre- NaCl/Cit (lx NaCl/Cit is 0.15 M NaCl/0.015 M Na cit- sent six nonidentical, overlapping DNA fragments spanning rate)/0.1% NaDodSO4/5x Denhardt's solution (lx Den- 32.5 kilobases (kb) of the genome (Fig. 1A). Two cloned frag- hardt's solution is 0.02% polyvinylpyrrolidone/Ficoll (Phar- ments, designated XH6 (18.9 kb) and XH10 (20.2 kb) were macia)/bovine serum albumin) at 55°C overnight and then selected for further analysis. hybridized (106 cpm per filter) to a mouse renin probe [la- Location of Renin Exons. Southern blot analysis of AH10 beled to greater than 108 cpm/,g ofDNA by nick-translation DNA with the mouse submandibular renin probe localized (7) in the presence of [a-32P]dATP and dCTP (New England the cross-hybridizing region to a 2.3-kb EcoRI/Pst I (XH10- Nuclear)] at 55°C for 24 hr in 2x NaCl/Cit/0.1% Na- EP2.3) fragment. DNA sequence analysis revealed the four DodSO4/1x Denhardt's solution/10% dextran sulfate (Phar- carboxyl-terminal exons (Fig. 1 B and C) encoding amino macia). Filters were washed at 50°C in 0.1x NaCl/Cit/0.1% acids 165-337 of mature human renin (Fig. 2). Since this mouse probe (20) carries only the 3' 57% of the full-length The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: NaCI/Cit, standard saline citrate (0.15 M NaCI/ in accordance with 18 U.S.C. §1734 solely to indicate this fact. 0.015 M Na citrate); kb, kilobase(s). 5026 Downloaded by guest on September 23, 2021 Biochemistry: Hobart et aL Proc. Natl. Acad. Sci, USA 81 (1984) 5027 A

1 kb

B , ' p5I1HS3. - pn 1U0-4.4 pH 10-EP2.3 pH sx0.8 pH W.8 pH 10-R1.3 pH 10.BEO.6 pH iOX1.8 1 kb - n_ - pH 6.1.2 pH 640.3 pH 10-RO.8 pH 10-XI.6

2 3 4 5 6 7 8 9 (A) (B) (C) (D) (E) (F) (G) (H) H X x H X B E HB X EH XE X C a I m I m _ _ K S S . PP S P K S P SP Pow s.o P-o _ ._ FIG. 1. Restriction endonuclease mapping and DNA sequencing strategy for cloned genomic DNA fragments of human renin. (A) Restric- tion map of six fragments isolated from the human renin gene and cloned into the EcoRI site of Charon 4A phage. (B) Subcloned fragments from the XH6 and XH10 phage fragments shown in A. All subcloned fragments shown were tested for ability to hybridize to human kidney mRNA.

, Fragment that hybridized specifically to a 1600-base mRNA; '-, fragment that did not hybridize; , fragment containing one or more Alu-type repetitive sequences that hybridized to multiple size classes of mRNA. (C) Strategy for sequencing. Arrows indicate direction and approximate length of sequence determined. Restriction sites used for sequencing are not necessarily shown. Exons are numbered 1 through 9. Introns are designated (A) through (H). Restriction enzymes used are abbreviated as follows: B, BamHI; E, EcoRI; H, HindlI; K, Kpn I; P, Pst I; S, Sac I; X, Xba I.

mRNA [excluding poly(A)] (18), the positions of the remain- sequences necessitated the use of the synthetic 21-mer probe ing amino-terminal exons were determined from the ability described above. of subcloned genomic DNAs to hybridi4e tp oligonucleotide Prediction of mRNA Sequence. The boundaries of exons probes and/or human kidney mRNA. were positioned by searching the genomic DNA sequence Mapping with Oligonucleotide Probes. A 20-base oligonu- for consensus splice junction (G-T/A-G) sequences (23) and cleotide (Fig. 3 A and C), synthesized complementary to nu- by comparing the predicted spliced mRNA sequence with cleotides 359-379 (18) of mouse submandibular renin cDNA that of mouse submandibular renin (17). When this predicted (a region encoding an amino acid sequence that is highly con- mRNA sequence was compared with the recently published served in several aspartyl proteases) specifically hybridized human kidney renin cDNA sequences (21, 24), only the to a 2.0-kb BamHI and a 1.2-kb Pst I fragment of XH10. In splice site of intron H had to be revised. addition, the 20-mer hybridized to a 0.6-kb BamHI/EcoRI fragment of the XH10-E2.8 subclone (not shown). This frag- DISCUSSION ment contained exon 3, encoding amino acids 18-58. A sec- Restriction mapping and partial seqtence analysis of cloned ond probe (21-mer) whose sequence was predicted from ami- human genomic DNA fragments have revealed the structure no acid residues -63 to -57 of the signal peptide for human of the human renin gene (Fig. 1). The amino acid sequence of preprorenin (30) hybridized to an 800-base Xba I fragment in human preprorenin was deduced from the DNA sequence the H6-H3.5 subclone (Fig. 3 B and D). This fragment con- (Fig. 2). This precursor contains a signal peptide consisting tained the signal peptide exon and 5' flanking DNA sequence. of an initiating methionine followed by several charged resi- Location of Exons by Using Kidney mRNA Blots. Sub- dues and a hydrophobic leucine-rich region. The actual site cloned genomic DNA fragments were labeled by nick-trans- of signal peptide cleavage has not been experimentally deter- lation and hybridized to filter-immobilized human kidney mined for any renin. Structural homologies to other signal poly(A)+ RNA (dot blots). In this assay, positive hybridiza- peptides predict that cleavage could occur after glycine- tion indicated the presence of coding sequence in the geno- (-49), cysteine-(-47), or glycine-(-44), resulting in a signal mic DNA fragment. Initially, large restriction fragments peptide of 18, 20, or 23 amino acids. The assignment of the were tested, and those that proved positive were successive- amino terminus of the mature human renin enzyme to leu- ly subdivided and rehybridized to the mRNA (Fig. 1B). In cine-(+1) is based on sequence homology with mouse sub- addition to XH10-EP2.3 (described above), the XH10-E3.4 mandibular renin whose amino terminus has been deter- and -E2.8 fragments were positive in this assay. The XH10- mined experimentally (16, 18). Activation of the human and EO.9 fragment was negative. Hybridization to kidney renin mouse prohormones, therefore, occurs by removal of the mRNA was localized to Rsa I fragments of 800 and 400 bases precursor peptide at paired basic residues [lysine-(-2)/ly- in the XH10-E2.8 subclone and to a 1600-base EcoRI/Xba I sine-(-1) in human renin], a common mechanism in the fragment in the XH10-E3.4 subclone. These three fragments processing of hormone precursors. Other paired basic resi- encoded exons 2, 3, 4, and 5 based on subsequent DNA se- dues [lysine-(-35)/arginine-(-34), lysine-(-30)/arginine- quence analysis. When this strategy for the location of exons (-29)] are present in the propeptide region and may repre- was applied to genomic fragments 5' to exon 2, extensive sent alternative processing sites. The resulting mature hu- hybridization to human Alu-like repetitive sequences (22) man renin peptide is 337 amino acids long with a calculated was seen (unpublished work). The presence of these Alu-like molecular weight of 36,858. It is 68% homologous in amino Downloaded by guest on September 23, 2021 5028 Biochemistry: Hobart et al. Proc. Natl. Acad. Sci. USA 81 (1984)

150 160 Ile Phe Asp Asn Ile Ile Ser Gln Gly Val Leu Lys Glu Asp Val Phe Ser Phe ATC TTC GAC MC ATC ATC TCC CAA GGG GTG CTA AAA GAG GAC GTC TTC TCT TTC -66 164 165 Met Asp Gly Trp Arg Arg Met Tyr Tyr Asn Arg INTRON E Asn Ser Gln Ser AACCTCAGTGGATCTCAGAGAGAGCCCCAGACTGAGGGMGC ATG GAT GGA TGG AGA AGG ATG TAC TAC AAC AG GTGGGGACTGGG:: (2.4kb):::TCCCCCTGCCAG GMT TCC CAA TCG -50 170 180 Pro Arg Trp Gly Leu Leu Leu Leu Leu Trp Gly Ser Cys Thr Phe Gly Leu Pro Leu Gly Gly Gln Ile Val Leu Gly Gly Ser Asp Pro Gln His Tyr Glu Gly Asn CCT CGC TGG GGA CTG CTG CTG CTG CTC TGG GGC TCC TGT ACC TTT GGT CTC CCG CTG GGA GGA CAG ATT GTG CTG GGA GGC AGC GAC CCC CAG CAT TAC GAA GGG AAT -34 1 90 200 204 Thr Asp Thr Thr Thr Phe Lys Arg INTRON A Phe His Tyr Ile Asn Leu Ile Lys Thr Gly Val Trp Gln Ile Gln Met Lys Gly ACA GAC ACC ACC ACC TTT AAA CG GTAATTGGTMC::: (4.Okb):::ACMGAAGTAACTC TTC CAC TAT ATC AAC CTC ATC MG ACT GGT GTC TGG CAG ATT CAA ATG MG GGG 205 210 INTRON F Val Ser Val Gly Ser Ser Thr Leu TTATAAATGCTCCAGAGGCCCTCAGTGACAGAGGTGATTTCCAGGTGGCTGGGCTAACGTTAAAGGTGGTT GTCAGAAATCCT:: (0.3kb)::: GCCTCCCCCAAG GTG TCT GTG GGG TCA TCC ACC TTG -33 -30 220 230 Ile Phe Leu Lys Arg Met Pro Leu Cys Glu Asp Gly Cys Leu Ala Leu Val Asp Thr Gly Ala Ser Tyr Ile Ser GACAGCACTTTTCTATTTTTGCTTCCTCCACCCTGGGCCAG GATC TTC CTC MG AGA ATG CCC CTC TGT GAA GAC GGC TGC CTG GCA TTG GTA GAC ACC GGT GCA TCC TAC ATC TCA -20 -10 240 Ser Ile Arg Glu Ser Leu Lys Glu Arg Gly Val Asp Met Ala Arg Leu Gly Pro Gly Ser Thr Ser Ser Ile Glu Lys Leu Met Glu Ala Leu Gly Ala Lys Lys Arg TCA ATC CGA GAA AGC CTG AAG GAA CGA GGT GTG GAC ATG GCC AGG CTT GGT CCC GGT TCT ACC AGC TCC ATA GAG AAG CTC ATG GAG GCC TTG GGA GCC MG MG AGG -1 1 10 250 251 252 Glu Trp Ser Gln Pro Met Lys Arg Leu Thr Leu Gly Asn Thr Thr Ser Ser Val Leu Phe Asp INTRON G Tyr Val Val Lys Cys GAG TGG AGC CAA CCC ATG AAG AGG CTG ACA CTT GGC AAC ACC ACC TCC TCC GTG CTG TTT GAT GTAAGAAGCCAAA:: (0.2kb)::CCCCCACCCCAG TAT GTC GTG AAG TGT 17 18 260 270 Ile Leu Thr Asn Tyr Met Asp INTRON B Thr Asn Glu Gly Pro Thr Leu Pro Asp Ile Ser Phe His Leu Gly Gly Lys Glu Tyr ATC CTC ACC AAC TAC ATG GAC GTGAGTGCCTGG::: (0.6kb):::TTACCCCCACAG ACC AAC GAG GGC CCT ACA CTC CCC GAC ATC TCT TTC CAC CTG GGA GGC MA GAA TAC 20 30 280 284 Gln Tyr Tyr Gly Glu Ile Gly Ile Gly Thr Pro Pro Gln Thr Phe Lys Val Val Thr Leu Thr Ser Ala Asp Tyr Val Phe Gln INTRON H CAG TAC TAT GGC GAG ATT GGC ATC GGC ACC CCA CCC CAG ACC TTC AAA GTC GTC ACG CTC ACC AGC GCG GAC TAT GTA TTT CAG GTGAGGTTCGAG::(0.6kb):::CCTTCC 40 50 285 290 300 Phe Asp Thr Gly Ser Ser Asn Val Trp Val Pro Ser Ser Lys Cys Ser Arg Leu Glu Ser Tyr Ser Ser Lys Lys Leu Cys Thr Leu Ala Ile His Ala Met TTT GAC ACT GGT TCG TCC AAT GTT TGG GTG CCC TCC TCC AAG TGC AGC CGT CTC TGCCAG GAA TCC TAC AGT AGT MA MG CTG TGC ACA CTG GCC ATC CAC GCC ATG 58 59 60 310 Tyr Thr Ala Cys INTRON C Val Tyr His Lys Asp Ile Pro Pro Pro Thr Gly Pro Thr Trp Ala Leu Gly Ala Thr Phe Ile Arg TAC ACT GCC TGTG GTGAGACCTAAG::: (0.6kb)::TCCCCCTGCCAG TG TAT CAC AAG GAT ATC CCG CCA CCC ACT GGA CCC ACC TGG GCC CTG GGG GCC ACC TTC ATC CGA 70 80 320 330 Leu Phe Asp Ala Ser Asp Ser Ser Ser Tyr Lys His Asn Gly Thr Glu Leu Thr Lys Phe Tyr Thr Glu Phe Asp Arg Arg Asn Asn Arg Ile Gly Phe Ala Leu Ala CTC TTC GAT GCT TCG GAT TCC TC$ AGC TAC AAG CAC AAT GGA ACA GAA CTC ACC MG TTC TAC ACA GAG TTT GAT CGG CGT AAC AAC CGC ATT GGC TTC GCC TTG GCC 90 98 337 Leu Arg Tyr Ser Thr Gly Thr Val Ser Gly Phe Leu Ser Gln Asp Ile Ile Thr Arg OP CTC CGC TAT TCA ACA GGG ACA GTC AGT GGC TTT CTC AGC CAG GAC ATC ATC ACC CGC TGA GGCCCTCTGCCACCCAGGCAGGCCCTGCCTTCAGCCCTGGCCCAGAGCTGGMCACTCTCTG 99 100 INTRON D Val Gly Gly Ile Thr Val Thr Gln GTAAGTTGGGCC::(0.9kb):::TTCCTCCCACAG GTG GGT GGA ATC ACG GTG ACA CAG AGATGCCCCTCTGCCTGGGCTTATGCCCTCAGATGGAGACATTGGATGTGGAGCTCCTGCTGGATGCGTGC 110 120 Met Phe Gly Glu Val Thr Glu Met Pro Ala Leu Pro Phe Met Leu Ala Glu Phe ATG TTT GGA GAG GTC ACG GAG ATG CCC GCC TTA CCC TTC ATG CTG GCC GAG TTT 130 140 Asp Gly Val Val Gly Met Gly Phe Ile Glu Gln Ala Ile Gly Arg Val Thr Pro GAT GGG GTT GTG GGC ATG GGC TTC ATT GMA CAG GCC ATT GGC AGG GTC ACC CCT CGTTGCATCTGGGTTCACTAGGGTTAGMCAGAGGGAGGGGCTGCGTGATCATGTGTGGACAGGAMTGTGA FIG. 2. Composite nucleotide and predicted amino acid sequences of the human renin gene. Predicted 5' and published (21) 3' termini of the transcribed region. An additional 68 bases of 5' and 70 bases of 3' flanking regions are shown. The approximate size of the intron is given in parentheses. The T-A-T-A-A-A sequence in the 5' flanking region and the one in intron A proximal to exon 2 are overlined and underlined. The A-A-T-A-A-A polyadenylylation signal sequence in the 3' untranslated region is underlined. acid sequence to the 338-residue mouse enzyme. The two quence of mouse submandibular renin cDNA. By this meth- coding nucleotide sequences are 77% homologous. Purified od, exon junctions with introns D, E, and F were unambigu- mouse submandibular renin may be cleaved into a 288-amino ous. There are, however, alternative splice sites for introns acid A peptide and 48-amino acid B peptide at paired argi- A, B, C, G, and H that retain reasonable homology to the nine residues (16, 18). There is currently no published evi- mouse sequence (Fig. 4). The junctions shown in Fig. 4 cor- dence that human renin is cleaved into a two-peptide en- respond to those found in the human kidney cDNA sequence zyme. Moreover, recent biosynthetic studies in the mouse (21, 24). Alternative splice sites could result in significant suggest that the two-chain form of submandibular renin may changes to the translated sequence. For example, the alter- not be an obligatory intermediate in the activation pathway native sites for introns A and C would eliminate basic resi- of the enzyme (25, 26). dues in exon 2 and a cysteine residue in exon 3, respectively. Human renin, which is reported to be a glycoprotein (4), Such changes could affect both the processing and the struc- has two presumptive N-glycosylation sites, Asn-Thr-Thr ture of the human renin precursor peptide. (positions 5-7) and Asn-Gly-Thr (positions 75-77). These Polymorphism. The only difference between the sequence sites are located in exons 2 and 4, respectively, placing them of human renin mRNA predicted from the gene (Fig. 2) and near the amino terminus of the mature renin enzyme and on the sequence derived from the complete cDNA clone (21) separate domains from the catalytically important aspartic occurs at the splice site of exons 5 and 6, where both cDNAs acid residues. The mouse submandibular renin, a nonserum have three additional amino acids. Our sequence of this protein, lacks any recognizable glycosylation acceptor sites splice junction is unambiguous and involves sequence deter- (16, 18). mination of both DNA strands. Neither alternative splice The positions of aspartates-38 and -223 (residues 32 and sites nor the appropriate extra codons in this region have 215 in the pepsin numbering) and the conservation of flank- been found. These three amino acids (Asp-Ser-Glu) do not ing residues between aspartyl proteases indicate that they occur in mouse submandibular renin. Since Southern blots are the two acidic groups directly involved in the renin cata- of genomic DNA (unpublished work; ref. 24) support only a lytic activity (17). From the gene sequence, it is clear that single-copy human renin gene, located on chromosome 1 these aspartic acid residues lie in the middle of separate ex- (27), two reasonable explanations for the extra three amino ons, suggesting that these domains may contribute to the acids can be offered. Either they are carried on a nine-base structure of the active site. exon that was not detectable in the 2.8-kb intron E by the Alternative Exon-Intron Junctions. It is possible to predict screening methods employed here or there is a coding se- splice junctions for all eight introns using homologies to the quence polymorphism in humans, resulting in two slightly splice site consensus sequence G-T/A-G (23) and to the se- different renins. If this latter explanation is correct, we have Downloaded by guest on September 23, 2021 Biochemistry: Hobart et al. Proc. NatL. Acad. Sci USA 81 (1984) 5029 A B * + ^+ Trp Val Pro Ser Thr Lys Cys Mouse Submandibular Renin Trp Arg Arg Met Pro Arg Trp Human Signal Peptide 5'TGG GTG CCC TCC ACC AAG TGC Mouse Coding Region 5'TGG AGG AGG ATG CCT CGC TGG Predicted Coding Sequence ACC CAC GGG AGG TGG TTC AC 5' 20 Base Oligonucleotide Probe x ACC TCC TCC TAC GGA GCG ACC 5' 21 Base Oligonucleotide Probe 5'TGG GTG CCC TCC TCC AAG TGC Human Coding Sequence x Trp Val Pro Ser Ser Lys Cys Human Renin Peptide Sequence 5'TGG AGA AGG ATG CCT CGC TGG Human Coding Sequence

D xH6-H3.5 XH1O-E2.8 XH6-H3.5 XHI1O-E2.8 C r -- r 1 1 [ Std. E E/P P Std. E Xb R E Xb R Std. E Xb R E Xb R

- 23.1 23.1 -

9.4 - 9.4 - 6.6 - 6.6 - 1 ... .M j 4.4

4.4 -

2.3 - 2.3 - EcoRI 2.0 i: 2.0 - - 2.0 1.3 - PW,; 1.1 :., .;.. PstI - : t .~~~~ ~~..:~ ..... 0.9 ~~~.....~~~~~ Xba - 1.2 .... - 0.8 0.6 - .....

0.3 - Rsal 0.25 0.56 -

FIG. 3. Mapping of cloned genomic DNA fragments with oligonucleotide probes. Oligonucleotides were chemically synthesized and end labeled for use as probes. (A and B) Rationale for choosing the two oligonucleotide sequences. (C and D) Ethidium bromide-stained gels of restriction endonuclease-digested cloned genomic DNAs (Left) and the corresponding autoradiographs (Right) of filters blotted and hybridized to the respective oligonucleotide labeled probe. Hybridization was for 48 hr at 50°C in 4x NaCV/Cit/lOx Denhardt's solution containing tRNA at 2 mg/ml and glycine at 8 mg/ml. Filters were washed (six times, 10 min each) at room temperature in 2x NaCl/Cit. (A and C) Results of hybridization of the 20-mer to XH10 DNA. *, Amino acid residues conserved in all known aspartyl proteases; +, amino acid residues conserved in mammalian aspartyl proteases; X, mismatch of the oligonucleotide probe relative to the determined human renin gene sequence. The lanes of the agarose gel and corresponding filter autoradiograph are as follows: Std., HindIII-digested X DNA molecular weight standard; E, EcoRI digest; P, Pst I digest; E/P, EcoRI/Pst I digest. (B and D) Results of hybridization of the 21-mer to XH6-H3.5 and XH1O-E2.8DNAs. *, Amino acid residues conserved between human and mouse preprorenins; X, mismatch of the oligonucleotide probe relative to the determined human renin gene sequence. The lanes of the agarose gel and corresponding filter autoradiograph are as follows: Std., HindIII-digested X DNA and Hae III-digested 4X174 DNA molecular weight standards; E, EcoRI digest; Xb, Xba I digest; R, Rsa I digest.

sequenced a renin structural allele different from that de- using denaturing agarose gel electrophoresis (27). scribed by others. Comparison of Human Renin and Pepsin Genes. The struc- Regulatory Regions of the Renin mRNA. DNA sequencing tures of human renin and human pepsinogen genes are re- 5' to the region encoding the signal peptide indicated a Hog- markably similar (19). Both genes are split by eight interven- ness box ("TATAAA") sequence at -73 nucleotides from ing sequences, all occurring in the protein coding region. In the initiation codon. Comparing this human renin sequence addition, the size of the corresponding exons and the loca- with the 5' untranslated region of the human pepsinogen tion of introns in the expressed (mRNA) gene sequence for gene (19), the mouse submandibular renin cDNA (18), and renin and pepsinogen are nearly congruent (Table 1). The the human kidney cDNA (21) predicts that initiation of tran- major exception is exon 1, which encodes a longer renin pre- scription could occur 28 bases 3' to the T-A-T-A-A-A se- propeptide (46 residues versus 33 residues in human pepsin- quence. If this is correct, the mRNA will possess a 45-nucle- ogen). However, this exon does not contribute to the struc- otide 5' untranslated region. ture of the mature enzyme. There is also 66% homology be- Partial sequence analysis of the first renin intron (A) indi- tween the amino acid sequences of exon 3, which includes cates that there are at least three additional T-A-T-A-A-A the first catalytic aspartyl residues for both human renin and sequences in the gene. One such T-A-T-A-A-A sequence ex- human pepsinogen. This conservation of sequence (Table 1) ists 110 bases before the 3' end of intron A. If this presump- is exceptional relative to the rest of the enzyme and certainly tive Hogness box were functional, transcription would give differentiates it from exon 7 (33%), which carries the other rise to a mRNA encoding a 48-residue-foreshortened nonse- catalytic aspartic acid residue. creted prorenin molecule beginning with methionine-28 in The similarities in the structure of the human renin and exon 2. This would support the evidence showing that neuro- human pepsinogen genes support the view that the mammali- blastoma cells from the rat have an intracellular renin (28). an aspartyl protease family of enzymes (which includes chy- There is a standard polyadenylylation signal sequence (A- mosin and cathepsin D) share a common protein structure A-U-A-A-A) 184 nucleotides after the translation termina- essential for activity (17). This conserved structure is appar- tion UGA codon. Thus, the calculated size of the mRNA is ently built from peptide domains of similar size that are en- 1448 nucleotides plus poly(A) tail. This is consistent with the coded by individual exons. However, the substrate specific- estimated length of the kidney message (1550-1600 bases) ities of these aspartyl proteases differ widely. For example, Downloaded by guest on September 23, 2021 5030 Biochemistry: Hobart et aLPProc. NatL Acad Sci. USA 81 (1984)

TARN 6TIA6T Pyrimidine rich....NqA6 619 We thank Dr. Glenn Andrews for preparation of oligonucleotide -34 -33 f genomic ThrThrPheLysArq fIIPhoLuLysArg probes, Dr. Tom Maniatis for providing us with the human ACCACCTTTAAAC6 6TAATT66TAACTCASS TCCTCCACCCTS66CCA6 SATCTTCCTCAASAGA (H) INTRON A DNA library, and Drs. Steven Atlas and Edwin Clayton for their ACCACCTTTSAAC6 AATCCCACTCAA6AAA (N) help in obtaining human kidney tissue. We also appreciate the assist- ThrThrPhe61uArg IleProLeuLysLys ance of Beatrice L. Ralls in preparation of the manuscript. J.M.C. is 131 ~~~~~~~~~~~~~31 supported in part by a Basil O'Connor Starter Grant from the March 17 Sa Association. AmnTyrketAip Thr6lnTyrTyr6I ySu of Dimes and by the American Heart AACTACATS66A 6T6A6T6CCT66CTCA6 CTCTTTTTACCCCCACA6ACCCABTACTATS6C6A6S(H) INTRON 1***t to * tf**I AACTACCT6AAT A6CCA6TACTAT66CGA6 (H) 1. Foltmann, B. & Pedersen, V. B. (1977) in Acid Proteases, AsnTyrLeuA t irrfnTyrTyr6lvyIu Structure, Function, and Biology, ed. Tang, J. (Plenum, New W 59 York), pp. 3-22. TyrThrAl iCy Y& Ter~isLysLeu 2. Galen, F.-X., Devaux, C., Guyenne, T., Menard, J. & Corvol, TACACTSCCTST6 6T6AGACCTAA6 TCCCCCT6CCAS TOTATCACAASCTC (H) INTRON C P. (1979) J. Biol. Chem. 254, 4848-4855. TACCTTSCTT6TB SBATTCACABCCTC (N) TyrLeuAlaC s 61 lleHiiSerLeu 3. Yokosawa, H., Holladay, L. A., Inagami, T., Haas, E. & Mur- 121 122I akami, K. (1980) J. Biol. Chem. 255, 3498-3502.

251 2r521 V 4. Slater, E. E. & Strout, H. V. (1981) J. Biol. Chem. 256, 8164- ArtLeuPheAspTVyr A66CTGTTTGAT 6TAAAA6CCAAAS CCCCCCACCCCAG TATSTCST6AAS INTRON 6 8171. A6ACTACAT6AA TAT6TT6T6A6C 5. Lawn, R. M., Fritsch, E. F., Parker, R. C., Blake, G. & Man- ArgLeuies6lu TyrYalYV1Ser iatis, T. (1978) Cell 15, 1157-1174. 31531 6. Woo, S. L. C. (1979) Methods Enzymol. 68, 389-395. 254 285 Tyr~aIPhe~in SluSerTyrSerSer 7. Rigby, P., Dieckmann, M., Rhodes, C. & Berg, P. (1977) J. TAT6TATTTCA6 6T6A66TTC6A6TC66CCC CCCCCTTCCT6CCAG 6AATCCTACA6TAST (H) INTRON H Mol. Biol. 113, 237-251. TAC6T6CTACA6 TATCCCAACA66AGA (N) 8. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular TyrValLeu3ln T rProAsnArgArg 348 1 Cloning: A Laboratory Manual (Cold Spring Harbor Labora- tory, Cold Spring Harbor, NY). FIG. 4. Alternative human renin intron-exon junction sites. Ca- 9. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, nonical intron-exon junction sequences are depicted at the top of W. J. (1979) Biochemistry 24, 5294-5299. the figure. The splice sites shown correspond to those determined 10. Deeley, R. G., Gordon, J. I., Burns, A. T. H., Mullinix, from the human renin cDNA sequence (21, 24). Alternative junc- K. P., Bina-Stein, M. & Goldberger, R. F. (1977) J. Biol. tions are indicated by vertical arrows. H, human renin gene se- Chem. 252, 8310-8319. quence; M, mouse submandibular cDNA sequence. *, Homology in 11. Vieira, J. & Messing, J. (1982) Gene 19, 259-268. the coding sequences. Amino acid numbers correspond to those in 12. Ruther, U., Koenen, M., Otto, K. & Muller-Hill, B. (1981) Nu- Fig. 2 for the human sequence and to those of Panthier et al. (18) for cleic Acids Res. 9, 4087-4098. the mouse sequence. 13. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65, 499-560. pepsin cleaves at all internal aromatic residues whereas re- 14. Adams, S. P., Kavka, K. S., Wykes, E. J., Holder, S. B. & nin, the most specific of this group of enzymes, cleaves at Galluppi, G. R. (1983) J. Am. Chem. Soc. 105, 661-663. only one site in a single peptide substrate, angiotensinogen. 15. Caruthers, M. H. & Beaucage, S. L. (1981) Tetrahedron Lett., Moreover, individual mammalian renins exhibit reduced ac- 1859-1862. tivity with other mammalian angiotensinogens (29). Thus, 16. Misono, K. S., Chang, J. J. & Inagami, T. (1982) Proc. NatI. specific amino acid side chains at the active site cleft of hu- Acad. Sci. USA 79, 4858-4862. man renin and species-specific structural features of angio- 17. Blundell, T., Sibanda, B. L. & Pearl, L. (1983) Nature (Lon- tensinogens (T. Blundell, personal communication) must don) 304, 273-275. the of the human renin- 18. Panthier, J.-J., Foote, S., Chambraud, B., Strosberg, A. D., contribute to stringent specificity Corvol, P. & Rougeon, F. (1982) Nature (London) 298, 90-92. angiotensin interaction. 19. Sogawa, K., Fujii-Kuriyama, Y., Mizukami, Y., Ichihara, Y. Table 1. Comparison of the human renin and pepsinogen & Takahashi, K. (1983) J. Biol. Chem. 258, 5306-5311. 20. Chirgwin, J. M., Schaefer, I. M., Diaz, J. A. & Lalley, P. A. gene structures (1984) Somatic Cell Mol. Genet., in press. Exon size* Percent homology 21. Imai, T., Miyazaki, H., Hirose, S., Hori, H., Hayashi, T., Ka- Amino Nucleic geyama, R., Ohkubo, H., Nakanishi, S. & Murakami, K. Human Human (1983) Proc. NatI. Acad. Sci. USA 80, 7405-7409. renin pepsinogen acid acid 22. Deininger, P. L., Jolly, D. J., Rubin, C. M., Friedmann, T. & Exon 1 33 19 18% (6/33) 27% (26/98) Schmid, C. W. (1981) J. Mol. Biol. 151, 17-33. Exon 2 50 54 30% (16/54) 43% (69/162) 23. Sharp, P. A. (1981) Cell 23, 643-646. Exon 3t 41 39 66% (27/41) 67% (82/123) 24. Soubrier, F., Panthier, J.-J., Corvol, P. & Rougeon, F. (1983) Exon 4 40 40 30% (12/40) 55% (67/120) Nucleic Acids Res. 11, 7181-7190. Exon 5 66 67 37% (25/67) 48% (96/201) 25. Catanzaro, D. F., Mullins, J. J. & Morris, B. J. (1983) J. Biol. 41% Chem. 258, 7364-7368. Exon 6 40 39 25% (10/40) (50/120) 26. Pratt, R. E., Ouellette, A. J. & Dzau, V. J. (1983) Proc. Natl. Exon 7t 47 48 33% (16/48) 51% (74/144) Acad. Sci. USA 80, 6809-6813. Exon 8 37 33 28% (12/33) 41% (46/111) 27. Chirgwin, J. M., Schaefer, I. M., Rotwein, P. S., Piccini, N., Exon 9 53 49 36% (19/53) 51% (79/154) Gross, K. W. & Naylor, S. L. (1984) Somatic Cell Mol. Genet. The nucleic acid and predicted amino acid sequences of human 10, 415-421. renin and human pepsinogen (19) were compared for homologous 28. Okamura, T., Clemens, D. L. & Inagami, T. (1981) Proc. Natl. sequence within the peptide coding region. Where corresponding Acad. Sci. USA 78, 6940-6943. exons of either renin or pepsinogen differed in size, the smaller exon 29. Tewksbury, D. A., Dart, R. A. & Travis, J. (1981) Biochem. was gapped so as to align the remaining amino acid sequence with Biophys. Res. Commun. 99, 1311-1315. maximum homology. 30. Miyazaki, T., Imai, T., Hirose, S., Hori, H., Hayashi, R., Ka- *Expressed as number of amino acid residues. geyama, R., Ohkubo, H., Nakanishi, S. & Morakami, K. tExon containing catalytic aspartic acid residues. (1983) Jpn. J. Hypertension 6, 19 (abstr.). Downloaded by guest on September 23, 2021