DOCSLIB.ORG

Eukaryotic and Prokaryotic Gene Structure Thomas Shafee*, Rohan Lowe

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Eukaryotic and Prokaryotic Gene Structure Thomas Shafee*, Rohan Lowe WikiJournal of Medicine, 2017, 4(1):2 doi: 10.15347/wjm/2017.002 Figure Article Eukaryotic and prokaryotic gene structure Thomas Shafee*, Rohan Lowe Abstract Genes consist of multiple sequence elements that together encode the functional product and regulate its expres- sion. Despite their fundamental importance, there are few freely available diagrams of gene structure. Presented here are two figures that summarise the different structures found in eukaryotic and prokaryotic genes. Common gene structural elements are colour-coded by their function in regulation, transcription, or translation. Introduction Previous images Gene structure Access to freely available diagrams is important for sci- entists, medical professions and the general pub- Genes contain the information necessary for living cells lic.[7][8]However, current open-access gene structure to survive and reproduce.[1][2] In most organisms, genes figures are limited in their scope (Supplementary fig- are made of DNA, where the particular DNA sequence ures 1-4), typically showing one or a few aspects (e.g. determines the function of the gene. A gene is tran- exon splicing, or promoter regions). Information-rich scribed (copied) from DNA into RNA, which can either diagrams that use a consistent colour scheme and lay- be non-coding (ncRNA) with a direct function, or an in- out should help the comprehension of complex con- termediate messenger (mRNA) that is then translated cepts.[9] into protein. Each of these steps is controlled by specific sequence elements, or regions, within the gene. Every This work provides two diagrams that summarise the gene, therefore, requires multiple sequence elements complex structure and terminology of genes. Common to be functional.[2] This includes the sequence that ac- elements of gene structure are presented in a con- tually encodes the functional protein or ncRNA, as well sistent layout and format to highlight the relationships as multiple regulatory sequence regions. These regions between components. Key differences between eukar- may be as short as a few base pairs, up to many thou- yotes and prokaryotes are indicated. sands of base pairs long. Much of gene structure is broadly similar between eu- karyotes and prokaryotes. These common elements Results largely result from the shared ancestry of cellular life in organisms over 2 billion years ago.[3] Key differences in Common gene structure features gene structure between eukaryotes and prokaryotes re- The structures of both eukaryotic and prokaryotic flect their divergent transcription and translation ma- genes involve several nested sequence elements. Each [4][5] chinery. Understanding gene structure is the foun- element has a specific function in the multi-step pro- dation of understanding gene annotation, expression, cess of gene expression. The sequences and lengths of [6] and function. these elements vary, but the same general functions are present in most genes.[2] Although DNA is a double- stranded molecule, typically only one of the strands en- codes information that the RNA polymerase reads to La Trobe Institute for Molecular Science, La Trobe University, produce protein-coding mRNA or non-coding RNA. Melbourne, Australia This 'sense' or 'coding' strand, runs in the 5' to 3' direc- *Author correspondence: [email protected] ORCID1: 0000-0002-2298-7593 tion where the numbers refer to the carbon atoms of ORCID2: 0000-0003-0653-9704 the backbone's ribose sugar. The open reading frame Supplementary material: Supplementary figures (ORF) of a gene is therefore usually represented as an Licensed under: CC-BY-SA Received 14-11-2016; accepted 17-01-2017 1 of 5 | WikiJournal of Medicine WikiJournal of Medicine, 2017, 4(1):2 doi: 10.15347/wjm/2017.002 Figure Article arrow indicating the direction in which the sense strand Eukaryotes is read.[10] The structure of eukaryotic genes includes features not Regulatory sequences are located at the extremities of found in prokaryotes (Figure 1). Most of these relate to genes. These sequence regions can either be next to the post-transcriptional modification of pre-mRNAs to pro- transcribed region (the promoter) or separated by duce mature mRNA ready for translation into protein. [11] many kilobases (enhancers and silencers). The pro- Eukaryotic genes typically have more regulatory ele- moter is located at the 5' end of the gene and is com- ments to control gene expression compared to prokar- posed of a core promoter sequence and a proximal pro- yotes.[5] This is particularly true in multicellular eukary- moter sequence. The core promoter marks the start site otes, humans for example, where gene expression var- for transcription by binding RNA polymerase and other ies widely among different tissues.[24] proteins necessary for copying DNA to RNA. The proxi- mal promoter region binds transcription factors that A key feature of the structure of eukaryotic genes is that modify the affinity of the core promoter for RNA poly- their transcripts are typically subdivided into exon and merase.[12][13] Genes may be regulated by multiple en- intron regions. Exon regions are retained in the final hancer and silencer sequences that further modify the mature mRNA molecule, while intron regions are activity of promoters by binding activator or repressor spliced out (excised) during post-transcriptional pro- [25] proteins.[14][15] Enhancers and silencers may be distantly cessing. Indeed, the intron regions of a gene can be located from the gene, many thousands of base pairs considerably longer than the exon regions. Once away. The binding of different transcription factors, spliced together, the exons form a single continuous therefore, regulates the rate of transcription initiation protein-coding regions, and the splice boundaries are at different times and in different cells.[16] not detectable. Eukaryotic post-transcriptional pro- cessing also adds a 5' cap to the start of the mRNA and Regulatory elements can overlap one another, with a a poly-adenosine tail to the end of the mRNA. These ad- section of DNA able to interact with many competing ditions stabilise the mRNA and direct its transport from activators and repressors as well as RNA polymerase. the nucleus to the cytoplasm, although neither of these For example, some repressor proteins can bind to the features are directly encoded in the structure of a [17] core promoter to prevent polymerase binding. For gene.[20] genes with multiple regulatory sequences, the rate of transcription is the product of all of the elements com- Prokaryotes bined.[18] Binding of activators and repressors to multi- ple regulatory sequences has a cooperative effect on The overall organisation of prokaryotic genes is mark- transcription initiation.[19] edly different from that of the eukaryotes (Figure 2). The most obvious difference is that prokaryotic ORFs Although all organisms use both transcriptional activa- are often grouped into a polycistronic operon under the tors and repressors, eukaryotic genes are said to be 'de- [5] control of a shared set of regulatory sequences. These fault off', whereas prokaryotic genes are 'default on'. ORFs are all transcribed onto the same mRNA and so The core promoter of eukaryotic genes typically re- are co-regulated and often serve related func- quires additional activation by promoter elements for tions.[26][27] Each ORF typically has its own ribosome expression to occur. The core promoter of prokaryotic binding site (RBS) so that ribosomes simultaneously genes, conversely, is sufficient for strong expression [5] translate ORFs on the same mRNA. Some operons also and is regulated by repressors. display translational coupling, where the translation An additional layer of regulation occurs for protein cod- rates of multiple ORFs within an operon are linked.[28] ing genes after the mRNA has been processed to pre- This can occur when the ribosome remains attached at pare it for translation to protein. Only the region be- the end of an ORF and simply translocates along to the tween the start and stop codons encodes the final pro- next without the need for a new RBS.[29] Translational tein product. The flanking untranslated regions (UTRs) coupling is also observed when translation of an ORF af- contain further regulatory sequences.[20] The 3' UTR fects the accessibility of the next RBS through changes contains a terminator sequence, which marks the end- in RNA secondary structure.[30] Having multiple ORFs point for transcription and releases the RNA polymer- on a single mRNA is only possible in prokaryotes be- ase.[21] The 5’ UTR binds the ribosome, which translates cause their transcription and translation take place at the protein-coding region into a string of amino acids the same time and in the same subcellular loca- that fold to form the final protein product. In the case of tion.[26][31] genes for non-coding RNAs the RNA is not translated but instead folds to be directly functional.[22][23] 2 of 5 | WikiJournal of Medicine WikiJournal of Medicine, 2017, 4(1):2 doi: 10.15347/wjm/2017.002 Figure Article Regulatory sequence Regulatory sequence Enhancer Enhancer /silencer Promoter 5’UTR Open reading frame 3 ’UTR /silencer Proximal Core Start Stop Terminator DNA Transcription Exon Exon Exon Intron Intron Pre- mRNA Post-transcriptional modification Protein coding region + 5’cap + Poly-A tail Mature mRNA Translation Protein Figure 1 | The structure of a eukaryotic protein-coding gene. Regulatory sequence controls when and where ex- pression occurs for the protein coding region (red). Promoter and enhancer regions (yellow) regulate the transcrip- tion of the gene into a pre-mRNA which is modified to remove introns (light grey) and add a 5' cap and poly-A tail (dark grey). The mRNA 5' and 3' untranslated regions (blue) regulate translation into the final protein product. Polycistronic operon Regulatory sequence Regulatory sequence Enhancer Enhancer /silencer Operator Promoter 5’UTR ORF UTR ORF 3’UTR /silencer Start Stop Start Stop DNA Transcription Protein coding region Protein coding region RBS RBS mRNA Translation Protein Figure 2 | The structure of a prokaryotic operon of protein-coding genes.
Load more

Recommended publications
  • Exploring the Structure of Long Non-Coding Rnas, J
    IMF YJMBI-63988; No. of pages: 15; 4C: 3, 4, 7, 8, 10 1 2 Rise of the RNA Machines: Exploring the Structure of 3 Long Non-Coding RNAs 4 Irina V. Novikova, Scott P. Hennelly, Chang-Shung Tung and Karissa Y. Sanbonmatsu Q15 6 Los Alamos National Laboratory, Los Alamos, NM 87545, USA 7 Correspondence to Karissa Y. Sanbonmatsu: [email protected] 8 http://dx.doi.org/10.1016/j.jmb.2013.02.030 9 Edited by A. Pyle 1011 12 Abstract 13 Novel, profound and unexpected roles of long non-coding RNAs (lncRNAs) are emerging in critical aspects of 14 gene regulation. Thousands of lncRNAs have been recently discovered in a wide range of mammalian 15 systems, related to development, epigenetics, cancer, brain function and hereditary disease. The structural 16 biology of these lncRNAs presents a brave new RNA world, which may contain a diverse zoo of new 17 architectures and mechanisms. While structural studies of lncRNAs are in their infancy, we describe existing 18 structural data for lncRNAs, as well as crystallographic studies of other RNA machines and their implications 19 for lncRNAs. We also discuss the importance of dynamics in RNA machine mechanism. Determining 20 commonalities between lncRNA systems will help elucidate the evolution and mechanistic role of lncRNAs in 21 disease, creating a structural framework necessary to pursue lncRNA-based therapeutics. 22 © 2013 Published by Elsevier Ltd. 24 23 25 Introduction rather than the exception in the case of eukaryotic 50 organisms. 51 26 RNA is primarily known as an intermediary in gene LncRNAs are defined by the following: (i) lack of 52 11 27 expression between DNA and proteins.
    [Show full text]
  • Upstream Sequences Other Than AAUAAA Are Required for Efficient Messenger RNA 3’-End Formation in Plants
    The Plant Cell, Vol. 2, 1261-1272, December 1990 O 1990 American Society of Plant Physiologists Upstream Sequences Other than AAUAAA Are Required for Efficient Messenger RNA 3’-End Formation in Plants Bradley D. Mogen, Margaret H. MacDonald, Robert Graybosch,’ and Arthur G. Hunt2 Plant Physiology/Biochemistry/MolecularBiology Program, Department of Agronomy, University of Kentucky, Lexington, Kentucky 40546-009 1 We have characterized the upstream nucleotide sequences involved in mRNA 3’-end formation in the 3‘ regions of the cauliflower mosaic virus (CaMV) 19S/35S transcription unit and a pea gene encoding ribulose-l,5-bisphosphate carboxylase small subunit (rbcs). Sequences between 57 bases and 181 bases upstream from the CaMV polyade- nylation site were required for efficient polyadenylation at this site. In addition, an AAUAAA sequence located 13 bases to 18 bases upstream from this site was also important for efficient mRNA 3’-end formation. An element located between 60 bases and 137 bases upstream from the poly(A) addition sites in a pea rbcS gene was needed for functioning of these sites. The CaMV -181/-57 and rbcS -137/-60 elements were different in location and sequence composition from upstream sequences needed for polyadenylation in mammalian genes, but resembled the signals that direct mRNA 3’-end formation in yeast. However, the role of the AAUAAA motif in 3’-end formation in the CaMV 3’ region was reminiscent of mRNA polyadenylation in animals. We suggest that multiple elements are involved in mRNA 3‘-end formation in plants, and that interactions of different components of the plant polyadenyl- ation apparatus with their respective sequence elements and with each other are needed for efficient mRNA 3‘-end formation.
    [Show full text]
  • POST-TRANSCRIPTIONAL REGULATION of AFP and Igm GENES
    University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2011 POST-TRANSCRIPTIONAL REGULATION OF AFP AND IgM GENES Lilia M. Turcios University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Turcios, Lilia M., "POST-TRANSCRIPTIONAL REGULATION OF AFP AND IgM GENES" (2011). University of Kentucky Doctoral Dissertations. 210. https://uknowledge.uky.edu/gradschool_diss/210 This Dissertation is brought to you for free and open access by the Graduate School at UKnowledge. It has been accepted for inclusion in University of Kentucky Doctoral Dissertations by an authorized administrator of UKnowledge. For more information, please contact [email protected]. ABSTRACT OF DISSERTATION Lilia M. Turcios The Graduate School University of Kentucky 2011 POST-TRANSCRIPTIONAL REGULATION OF AFP AND IgM GENES ABSTRACT OF DISSERTATION A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Medicine at the University of Kentucky By Lilia M. Turcios Director: Dr. Martha Peterson Lexington, KY 2011 Copyright © Lilia M. Turcios 2011 ABSTRACT OF DISSERTATION POST-TRANSCRIPTIONAL REGULATION OF AFP AND IgM GENES Gene expression can be regulated at multiple steps once transcription is initiated. I have studied two different gene models, the α-Fetoprotein (AFP) and the immunoglobulin heavy chain (IgM) genes, to better understand post-transcriptional gene regulation mechanisms. The AFP gene is highly expressed during fetal liver development and dramatically repressed after birth. There is a mouse strain-specific difference between adult levels of AFP, with BALB/cJ mice expressing 10 to 20-fold higher levels compared to other mouse strains.
    [Show full text]
  • The Nucleotide Sequence of the Gene for Human Protein C (DNA Sequence Analysis/Vitamin K-Dependent Proteins/Blood Coagulation) DONALD C
    Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4673-4677, July 1985 Biochemistry The nucleotide sequence of the gene for human protein C (DNA sequence analysis/vitamin K-dependent proteins/blood coagulation) DONALD C. FOSTER, SHINJI YOSHITAKE, AND EARL W. DAVIE Department of Biochemistry, University of Washington, Seattle, WA 98195 Contributed by Earl W. Davie, April 9, 1985 ABSTRACT A human genomic DNA library was screened MATERIALS AND METHODS for the gene for protein C by using a cDNA probe coding for the human protein. Three different overlapping A Charon 4A Screening of the Genomic Library. A human genomic phage were isolated that contain inserts for the gene for protein library in X Charon 4A phage (14) was screened for genomic C. The complete sequence of the gene was determined by the clones of human protein C by the plaque hybridization dideoxy method and shown to span about 11 kilobases ofDNA. procedure ofBenton and Davis as modified by Woo (15) using The coding and 3' noncoding portion of the gene consists of a cDNA for human protein C (9) as the hybridization probe. eight exons and seven introns. The eight exons code for a The cDNA started at amino acid 64 of human protein C and preproleader sequence of 42 amino acids, a light chain of 155 extended to the second polyadenylylation signal (9). It was amino acids, a connecting dipeptide of Lys-Arg, and a heavy radiolabeled by nick-translation to a specific activity of 8 X chain of 262 amino acids. The preproleader sequence and the 108 cpm/,ug with all four radioactive ([a-32P]dNTP) connecting dipeptide are removed during processing, resulting deoxynucleotides.
    [Show full text]
  • Classification and Function of Small Open-Reading Frames Abstract
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Sussex Research Online 1 Classification and function of small open-reading frames Juan-Pablo Couso1,2* and Pedro Patraquim2 1Centro Andaluz de Biologia del Desarrollo, CSIC-UPO, Sevilla, Spain and 2Brighton and Sussex Medical School, University of Sussex, Brighton, United Kingdom. *Author for correspondence: [email protected] Abstract Small open-reading frames (smORFs or sORFs) of 100 codons or less are usually - if arbitrarily - excluded from canonical proteome annotations. Despite this, the genomes of a wide range of metazoans, including humans, contain hundreds of smORFs, some of which fulfil key physiological functions. Recently, ribosomal profiling has been employed to show that the transcriptome of the model organism Drosophila melanogaster contains thousands of smORFs of different classes actively undergoing translation which produces peptides of mostly unknown function. Here we present a comprehensive analysis of the smORF repertoire in flies, mice and humans. We propose the existence of several classes of smORFs with different functions, from inert DNA sequences to transcribed and translated cis- regulators of translation, and finally to expression of functional peptides with a propensity to act as regulators of canonical membrane-associated proteins, or as components of ancestral protein complexes in the cytoplasm. We suggest that the different smORF classes could represent steps during the evolution of novel peptide and protein sequences. Our analysis introduces a distinction between different peptide-coding classes in animal genomes, and highlights the role of Drosophila melanogaster as a model organism for the study of small peptide biology in the context of development, physiology and human disease.
    [Show full text]
  • Gene Structure 1
    Gene Structure & Gene Finding David Wishart Rm. 3-41 Athabasca Hall [email protected] Outline for Next 3 Weeks • Genes and Gene Finding (Prokaryotes) • Genes and Gene Finding (Eukaryotes) • Genome and Proteome Annotation • Fundamentals of Transcript Measurement • Microarrays • More Microarrays 30,000 metabolite DNA Structure DNA - base pairing • Hydrogen Bonds • Base Stacking • Hydrophobic Effect Base-pairing (Details) 2 H-bonds 3 H-bonds DNA Sequences 5’ 3’ Single: ATGCTATCTGTACTATATGATCTA 5’ 3’ Paired: ATGCTATCTGTACTATATGATCTA TACGATAGACATGATATACTAGAT Read this way-----> 5’ 3’ ATGATCGATAGACTGATCGATCGATCGATTAGATCC TACTAGCTATCTGACTAGCTAGCTAGCTAATCTAGG 3’ 5’ <---Read this way DNA Sequence Nomenclature 5’ 3’ +(Sense) Forward: ATGCTATCTGTACTATATGATCTA _ Complement: TACGATAGACATGATATACTAGAT (Antisense) 5’ 3’ Reverse: TAGATCATATAGTACAGAGATCAT Complement The Fundamental Paradigm DNA RNA Protein RNA Polymerase 5’ 3’ Forward: ATGCTATCTGTACTATATGATCTA Complement: TACGATAGACATGATATACTAGAT AU GC UA Forward: UCTGTACTATATGATCTA Complement: TACGATAGACATGATATACTAGAT The Genetic Code The Genetic Code Translating DNA/RNA Frame3 A Y S D A H Frame2 C V * R C A Frame1 M R I A M R I ATGCGTATAGCGATGCGCATT TACGCATATCGCTACGCGTAA Frame-1 H T Y R H A N Frame-2 R I A I R M Frame-3 A Y L S A C DNA Sequencing Shotgun Sequencing Isolate ShearDNA Clone into Chromosome into Fragments Seq. Vectors Sequence Principles of DNA Sequencing Primer DNA fragment Amp PBR322 Tet Ori Denature with Klenow + ddNTP heat to produce + dNTP + primers ssDNA The Secret to Sanger
    [Show full text]
  • Mrna Editing, Processing and Quality Control in Caenorhabditis Elegans
    | WORMBOOK mRNA Editing, Processing and Quality Control in Caenorhabditis elegans Joshua A. Arribere,*,1 Hidehito Kuroyanagi,†,1 and Heather A. Hundley‡,1 *Department of MCD Biology, UC Santa Cruz, California 95064, †Laboratory of Gene Expression, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 113-8510, Japan, and ‡Medical Sciences Program, Indiana University School of Medicine-Bloomington, Indiana 47405 ABSTRACT While DNA serves as the blueprint of life, the distinct functions of each cell are determined by the dynamic expression of genes from the static genome. The amount and specific sequences of RNAs expressed in a given cell involves a number of regulated processes including RNA synthesis (transcription), processing, splicing, modification, polyadenylation, stability, translation, and degradation. As errors during mRNA production can create gene products that are deleterious to the organism, quality control mechanisms exist to survey and remove errors in mRNA expression and processing. Here, we will provide an overview of mRNA processing and quality control mechanisms that occur in Caenorhabditis elegans, with a focus on those that occur on protein-coding genes after transcription initiation. In addition, we will describe the genetic and technical approaches that have allowed studies in C. elegans to reveal important mechanistic insight into these processes. KEYWORDS Caenorhabditis elegans; splicing; RNA editing; RNA modification; polyadenylation; quality control; WormBook TABLE OF CONTENTS Abstract 531 RNA Editing and Modification 533 Adenosine-to-inosine RNA editing 533 The C. elegans A-to-I editing machinery 534 RNA editing in space and time 535 ADARs regulate the levels and fates of endogenous dsRNA 537 Are other modifications present in C.
    [Show full text]
  • Computational Gene Finding
    Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Markov models and Hidden Markov models Lec 2 Ab-initio methods for gene finding Comparative methods for gene finding Lec 3 Evaluating gene finding programs (c) Devika Subramanian, 2009 2 The biological context Introduction to the human genome and genes The central dogma: transcription and translation (c) Devika Subramanian, 2009 3 Facts about the human genome The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G). About 20,500 genes are estimated to be in the human genome. Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231). http://www.pnas.org/content/104/49/19428.abstract ~17,000 genes confirmed experimentally/Ensembl2009 (c) Devika Subramanian, 2009 4 More facts The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.4 million bases. (c) Devika Subramanian, 2009 5 More facts Genes appear to be concentrated in random areas along the genome, with vast expanses of non-coding DNA between. About 2% of the genome encodes instructions for the synthesis of proteins. We do not know the function of more than 50% of the discovered genes. (c) Devika Subramanian, 2009 6 More facts The human genome sequence is almost (99.9%) exactly the same in all people. There are about 3 million locations where single-base DNA differences occur in humans (Single Nucleotide Polymorphisms or SNPs). Over 40% of the predicted human proteins share similarity with fruit-fly or worm proteins.
    [Show full text]
  • What Is a Gene, Post-ENCODE? History and Updated Definition
    Downloaded from genome.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Perspective What is a gene, post-ENCODE? History and updated definition Mark B. Gerstein,1,2,3,9 Can Bruce,2,4 Joel S. Rozowsky,2 Deyou Zheng,2 Jiang Du,3 Jan O. Korbel,2,5 Olof Emanuelsson,6 Zhengdong D. Zhang,2 Sherman Weissman,7 and Michael Snyder2,8 1Program in Computational Biology & Bioinformatics, Yale University, New Haven, Connecticut 06511, USA; 2Molecular Biophysics & Biochemistry Department, Yale University, New Haven, Connecticut 06511, USA; 3Computer Science Department, Yale University, New Haven, Connecticut 06511, USA; 4Center for Medical Informatics, Yale University, New Haven, Connecticut 06511, USA; 5European Molecular Biology Laboratory, 69117 Heidelberg, Germany; 6Stockholm Bioinformatics Center, Albanova University Center, Stockholm University, SE-10691 Stockholm, Sweden; 7Genetics Department, Yale University, New Haven, Connecticut 06511, USA; 8Molecular, Cellular, & Developmental Biology Department, Yale University, New Haven, Connecticut 06511, USA While sequencing of the human genome surprised us with how many protein-coding genes there are, it did not fundamentally change our perspective on what a gene is. In contrast, the complex patterns of dispersed regulation and pervasive transcription uncovered by the ENCODE project, together with non-genic conservation and the abundance of noncoding RNA genes, have challenged the notion of the gene. To illustrate this, we review the evolution of operational definitions of a gene over the past century—from the abstract elements of heredity of Mendel and Morgan to the present-day ORFs enumerated in the sequence databanks. We then summarize the current ENCODE findings and provide a computational metaphor for the complexity.
    [Show full text]
  • MODULE 5: ALTERNATIVE OPEN READING FRAME Module 5: Alternative Open Reading Frame
    GENI-ACT MANUAL MODULE 5: ALTERNATIVE OPEN READING FRAME Module 5: Alternative Open Reading Frame Objective The objectives of this module are: 1. To verify the work of the gene caller by looking for evidence supporting the proposed start codon. 2. To provide evidence for an alternative start codon if you the one identified by the gene caller is incorrect. Materials To perform this activity you will need: • Access to the internet on a computer equipped with the most recent version of Firefox (preferred), Chrome or Safari. • To have completed the sign up for GENI-ACT described in the Signing Up for GENI-ACT section of the manual. Background Review the ”Prokaryotic Gene Structure, Transcription and Translation” section in the Background document to familiarize yourself with start and stop codons, open reading frames and the process of translation of a bacterial mRNA. The procedures you will be performing in this module attempt to confirm the start (or initiation) codon for your protein. The gene caller program has automatically analyzed the genome of your bacterium and has already predicted the start and stop codons for your protein, but this is one of the areas where automated gene calling results in errors. The way the gene caller works to predict that a gene exists is to find a start, or initiation codon (ATG, methionine; TTG, leucine or CTG, valine) codon in the genomic sequence followed by an open reading frame of significant length, that ends in a stop codon (TAA, TAG or TGA) in frame with the initiation codon. The gene caller looks at both the top and bottom strands of DNA and in all 6 reading frames to identify long open reading frames.
    [Show full text]
  • The Human Genome: Structure and Function of Genes and Chromosomes
    3 The Human Genome: Structure and Function of Genes and Chromosomes Over the past 20 years, remarkable progress has been DNA STRUCTURE: A BRIEF made in our understanding of the structure and func- REVIEW tion of genes and chromosomes at the molecular level. More recently, this has been supplemented by DNA is a polymeric nucleic acid macromolecule an in-depth understanding of the organization of the composed of three types of units: a five-carbon sugar, human genome at the level of its DNA sequence. deoxyribose; a nitrogen-containing base; and a phos- These advances have come about in large measure phate group (Fig. 3–1). The bases are of two types, through the applications of molecular genetics and purines and pyrimidines. In DNA, there are two genomics to many clinical situations, thereby provid- purine bases, adenine (A) and guanine (G), and two ing the tools for a distinctive new approach to med- pyrimidine bases, thymine (T) and cytosine (C). ical genetics. In this chapter, we present an overview Nucleotides, each composed of a base, a phosphate, of the organization of the human genome and the and a sugar moiety, polymerize into long polynu- aspects of molecular genetics that are required for an cleotide chains by 5Ј–3Ј phosphodiester bonds understanding of the genetic approach to medicine. formed between adjacent deoxyribose units (Fig. This chapter is not intended to provide an extensive 3–2). In the human genome, these polynucleotide description of the wealth of new information about chains (in their double-helix form) are hundreds of gene structure and regulation.
    [Show full text]
  • Basics of Molecular Biology
    Basics of Molecular Biology Martin Tompa Department of Computer Science and Engineering Department of Genome Sciences University of Washington Seattle, WA 98195-2350 U.S.A. July 6, 2003 Updated December 18, 2009 We begin with a review of the basic molecules responsible for the functioning of all organisms’ cells. Much of the material here comes from the introductory textbooks by Drlica [4], Lewin [7], and Watson et al. [10]. Good short primers have been written by Hunter [6] and Brazma¯ et al. [2]. What sorts of molecules perform the required functions of the cells of organisms? Cells have a basic tension in the roles they need those molecules to fulfill: 1. The molecules must perform the wide variety of chemical reactions necessary for life. To perform these reac- tions, cells need diverse three-dimensional structures of interacting molecules. 2. The molecules must pass on the instructions for creating their constituent components to their descendents. For this purpose, a simple one-dimensional information storage medium is the most effective. We will see that proteins provide the three-dimensional diversity required by the first role, and DNA provides the one-dimensional information storage required by the second. Another cellular molecule, RNA, is an intermediary between DNA and proteins, and plays some of each of these two roles. 1 Proteins Proteins have a variety of roles that they must fulfill: 1. They are the enzymes that rearrange chemical bonds. 2. They carry signals to and from the outside of the cell, and within the cell. 3. They transport small molecules. 4. They form many of the cellular structures.
    [Show full text]