DOCSLIB.ORG

Cyclin-Dependent Kinases: a Family Portrait

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cyclin-Dependent Kinases: a Family Portrait CORRESPONDENCE Cyclin-dependent kinases: a family portrait Marcos Malumbres1,10, Edward Harlow2, Tim Hunt3, Tony Hunter4, Jill M. Lahti5, Gerard Manning6, David O. Morgan7, Li-Huei Tsai8 and Debra J. Wolgemuth9 To the Editor, tion with some cyclin-like regulatory subunit. (CrkRS) and Ched (Cdc2L5), were recently Cyclin-dependent kinases (CDKs) are protein Known family members were then renamed renamed CDK12 and CDK13, as they were kinases involved in critical cellular processes, CDK1–6, and further members (CDK7– reported to interact with cyclin L1 and cyclin such as cell cycle or transcription, whose activ- CDK10) were cloned and characterized in the L2 (refs 3, 4). ity requires association with specific cyclin sub- following years1. CDK11 has been used to refer Additional members of the family, such units. Based on sequence similarity, the human to the protein encoded by three different human as PCTAIRE and PFTAIRE proteins, CCRK genome contains 21 genes encoding CDKs and loci (CDC2L1, CDC2L2 and CDC2L6) in differ- and CDC2L6, although being very similar to five additional genes encoding a more distant ent publications. CDC2L1 and CDC2L2 are two other CDKs in their primary sequence (Fig. 1) group of proteins known as CDK-like (CDKL) highly similar human genes, which originated and their predicted cyclin-binding domains kinases. The current nomenclature for CDK by duplication in human chromosome 1, and (Supplementary Information, Fig. S1), still proteins includes 11 classical CDKs (CDK1–11), they encode almost identical protein kinases. maintain their original names (Supplementary two newly proposed family members (CDK12 Each of these loci encodes at least two major Information, Table S1). Ironically, some of these and 13) and additional proteins whose names peptides: a protein kinase of relative molecu- proteins have not received CDK names because are based on the presence of a cyclin-binding lar mass 110,000 (Mr 110K), and a smaller 58K their association with cyclins has not been element (PFTAIRE and PCTAIRE proteins) isoform that is expressed following alternative demonstrated, and yet they are known by their or simply based on a sequence relationship initiation of translation. To make the situation predicted cyclin-association element sequence with the original CDKs, such as CDC2-like more complex, some publications, including the (PFTAIRE or PCTAIRE; Supplementary kinases (CDC2L) or cell cycle-related kinases original description of the human kinome2, refer Information, Fig. S1). Although the strict ‘cyclin- (CCRK)1. Here we propose the use of ‘CDK’ to CDK11 as the protein encoded by CDC2L6 dependent’ rule was useful during the gradual for all CDK family members (CDK1–20) on (Supplementary Information, Table S1). The characterization of the CDK family, we feel the basis of similarities in sequence and func- single Cdc2l1 gene in the mouse genome that there is now enough evidence to group all tion as described below. This nomenclature will encodes a protein more similar to human these CDK-related proteins into a single protein facilitate the rational and comparative study of CDC2L2 (91% identity) than CDC2L1 (87%). family with sufficient sequence and functional the poorly understood family members and the We therefore propose the use of Cdk11 for the similarities to justify the use of the ‘CDK’ term analysis of their relevance to human disease. mouse gene and CDK11A and CDK11B for the for all family members. PFTAIRE (PFTK) and During the Cold Spring Harbor Symposium human CDC2L2 and CDC2L1 loci, respectively PCTAIRE (PCTK) proteins are encoded by on the Cell Cycle in 1991, a group of interested (Fig. 1; Supplementary Information, Table S1). five genes that are more related to CDK1 than scientists proposed that members of this kinase The corresponding human proteins should be other classic family members such as CDK4 family should be called cyclin-dependent kinases referred to as CDK11Ap58 or CDK11Ap110 for the or CDK6 (Fig. 1). Recent studies indicate that (CDKs). The consensus was that no kinase CDC2L2-encoded proteins, and CDK11Bp58 or PFTK1 is activated by cyclin D3 and cyclin Y, should be called a ‘CDK’ until it was proven CDK11Bp110 for the CDC2L1-encoded proteins. and phosphorylates the retinoblastoma protein rigorously that its activity depended on associa- Two additional kinases, formerly known as Crk7 (pRb; Supplementary Information, Table S1)5,6 . PFTK1 should therefore be renamed CDK14. 1Cell Division and Cancer Group, Spanish National Cancer Research Center (CNIO), 28029 Madrid, Spain. 2Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA PFTK2 displays 60% identity with CDK14/ 02115, USA. 3Cancer Research UK, Clare Hall Laboratories, South Mimms, Herts EN6 3LD, UK. 4Molecular PFTK1, but no studies of this protein have been and Cell Biology Laboratory, The Salk Institute, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA. 5Department of Genetics and Tumor Cell Biology, St Jude Children’s Research Hospital, Memphis, TN 38105, published since its identification in 2001. Based USA. 6Razavi Newman Center for Bioinformatics, Salk Institute, La Jolla, CA 92037, USA. 7Department of on conservation of the PFTAIRE motif and sur- Physiology, University of California, San Francisco, CA 94158, USA. 8Howard Hughes Medical Institute, rounding sequences, as well as overall similarity, Picower Institute for Learning and memory, Department of Brain and Cognitive Sciences, Massachusetts Institute of Technology, Stanley Center for Psychiatric Research, Broad Institute of Harvard and MIT, PFTK2 seems very likely to have a cyclin part- Cambridge, MA 02119, USA. 9Departments of Genetics and Development and Obstetrics and Gynecology, ner and should therefore be renamed as CDK15. The Institute of Human Nutrition, Herbert Irving Comprehensive Cancer Center, Columbia University Medical Center, NY 10032, USA. The related PCTAIRE kinases (PCTK1–3) are 10Correspondence should be addressed to M.M. (e-mail: [email protected]). also poorly studied, but retain a cyclin-binding NATURE CELL BIOLOGY VOLUME 11 | NUMBER 11 | NOVEMBER 2009 1275 © 2009 Macmillan Publishers Limited. All rights reserved. CORRESPONDENCE CDK1 CDC2 CDK2 CDK2 therapeutic value of the lesser-known CDKs, CDK3 CDK3 and also a failure to examine these protein CDK5 CDK5 kinases for specificity when developing CDK CDK14 PFTK1 CDK15 PFTK2 inhibitors. Protein names like PFTAIRE-1 do CDK16 PCTK1 not encourage the consideration of the thera- CDK17 PCTK2 peutic value of these proteins, which are usu- CDK18 PCTK3 CDK4 CDK4 ally not tested for therapeutic purposes. In CDK6 CDK6 summary, we believe that sequence and func- CDK7 CDK7 tional relationships suggest that all of the 21 CDK20 CCRK CDK11A CDC2L2 human CDKs should be given the ‘CDK’ pre- CDK11B CDC2L1 fix. This expanded CDK family nomenclature CDK10 CDK10 has also been agreed on by the HUGO Gene CDK12 CRK7 CDK13 CDC2L5 Nomenclature Committee (HGNC) and the CDK9 CDK9 Mouse Genomic Nomenclature Committee CDK family CDK8 CDK8 (MGNC), and will be listed in all the major CDK19 CDC2L6 CDKL1 CDKL1 databases for the human and mouse genes CDKL4 CDKL4 encoding the CDK family proteins. The anal- CDKL2 CDKL2 ysis of sequence and functional trends in the CDKL family CDKL3 CDKL3 CDKL5 CDKL5 CDK family may facilitate new research (for example, compensatory functions in loss- Figure 1 Human CDK and CDKL proteins. The proposed nomenclature for CDK (purple) proteins is of-function studies) directed toward their shown in bold, whereas current symbols are indicated in the right column (black). CDK-like proteins relevance in the cell cycle, transcription or (green) cluster together in a separate branch close to MAP kinases and GSK3 kinases2. The absence of evidence for cyclin association precludes us from considering these proteins as CDKs. The sequences of other cellular processes. In addition, this sim- the kinase domains were obtained from UniProt (http://www.uniprot.org/) and analysed using Clustal2 plified nomenclature may increase awareness (http://www.ebi.ac.uk/Tools/clustalw2/) by the neighbour-joining method. of their potential importance as therapeutic targets in human disease. Researchers and motif and have some evidence for cyclin interac- CDK2 (refs 9, 10). We therefore propose the use drug discoverers should keep the whole fam- tion. PCTK3 was found to interact with cyclin K of CDK20 for this protein. ily picture in mind. 7 in a large-scale interaction study . The two other Although a few of these kinases do not 1. Malumbres, M. & Barbacid, M. Mammalian cyclin- PCTK kinases also interact with p35, the major have an identified cyclin partner, we believe dependent kinases. Trends. Biochem. Sci. 30, 630–641 (2005). activator of CDK5 (Supplementary Information, that the CDK term should be applied to the 2. Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Table S1). Given their interaction with cyclin whole family. First, it is quite likely that all Sudarsanam, S. The protein kinase complement of the K and p35, and the high similarity between of these proteins are activated by cyclins or human genome. Science 298, 1912–1934 (2002). 3. Chen, H. H., Wang, Y. C. & Fann, M. J. Identification PCTAIRE proteins and CDK5, we suggest that cyclin-related proteins, many of which are and characterization of the CDK12/cyclin L1 complex these proteins should be renamed as CDK16, still poorly studied. Second, even if some involved in alternative splicing regulation. Mol. Cell. Biol. 26, 2736–2745 (2006). CDK17 and CDK18. The same rationale can be family members are not activated by cyclins, 4. Chen, H. H., Wong, Y. H., Geneviere, A. M. & Fann, applied to the remaining members of the family, this does not invalidate the use of the ‘CDK’ M. J. CDK13/CDC2L5 interacts with L-type cyclins and regulates alternative splicing. Biochem. Biophys. Res. CDC2L6 and CCRK. CDC2L6 is highly simi- root to denominate all family members. There Commun. 354, 735–740 (2007). lar to CDK8, contains an identical SMSACRE are multiple examples in gene nomenclature 5. Shu, F. et al.
Load more

Recommended publications
  • Investigating the Role of Cdk11in Animal Cytokinesis
    Investigating the Role of CDK11 in Animal Cytokinesis by Thomas Clifford Panagiotou A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto © Copyright by Thomas Clifford Panagiotou (2020) Investigating the Role of CDK11 in Animal Cytokinesis Thomas Clifford Panagiotou Master of Science Department of Molecular Genetics University of Toronto 2020 Abstract Finely tuned spatio-temporal regulation of cell division is required for genome stability. Cytokinesis constitutes the final stages of cell division, from chromosome segregation to the physical separation of cells, abscission. Abscission is tightly regulated to ensure it occurs after earlier cytokinetic events, like the maturation of the stem body, the regulatory platform for abscission. Active Aurora B kinase enforces the abscission checkpoint, which blocks abscission until chromosomes have been cleared from the cytokinetic machinery. Currently, it is unclear how this checkpoint is overcome. Here, I demonstrate that the cyclin-dependent kinase CDK11 is required for cytokinesis. Both inhibition and depletion of CDK11 block abscission. Furthermore, the mitosis-specific CDK11p58 kinase localizes to the stem body, where its kinase activity rescues the defects of CDK11 depletion and inhibition. These results suggest a model whereby CDK11p58 antagonizes Aurora B kinase to overcome the abscission checkpoint to allow for successful completion of cytokinesis. ii Acknowledgments I am very grateful for the support of my family and friends throughout my studies. I would also like to express my deep gratitude to Wilde Lab members, both past and present, for their advice and collaboration. In particular, I am very grateful to Matthew Renshaw, whose work comprises part of this thesis.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Cyclin K Interacts with Β-Catenin to Induce Cyclin D1 Expression And
    Theranostics 2020, Vol. 10, Issue 24 11144 Ivyspring International Publisher Theranostics 2020; 10(24): 11144-11158. doi: 10.7150/thno.42578 Research Paper Cyclin K interacts with β-catenin to induce Cyclin D1 expression and facilitates tumorigenesis and radioresistance in lung cancer Guojun Yao*, Jing Tang*, Xijie Yang, Ye Zhao, Rui Zhou, Rui Meng, Sheng Zhang, Xiaorong Dong, Tao Zhang, Kunyu Yang, Gang Wu and Shuangbing Xu Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. *These authors contributed equally to this work. Corresponding author: Shuangbing Xu or Gang Wu, Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China. E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.11.29; Accepted: 2020.08.24; Published: 2020.09.11 Abstract Rationale: Radioresistance remains the major cause of local relapse and distant metastasis in lung cancer. However, the underlying molecular mechanisms remain poorly defined. This study aimed to investigate the role and regulatory mechanism of Cyclin K in lung cancer radioresistance. Methods: Expression levels of Cyclin K were measured by immunohistochemistry in human lung cancer tissues and adjacent normal lung tissues. Cell growth and proliferation, neutral comet and foci formation assays, G2/M checkpoint and a xenograft mouse model were used for functional analyses. Gene expression was examined by RNA sequencing and quantitative real-time PCR.
    [Show full text]
  • Are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway Is Associated with a More Favorable Phenotype
    Cancers 2019, 11 S1 of S19 Supplementary Material Functional Toll-Like Receptors (TLRs) are Expressed by a Majority of Primary Human Acute Myeloid Leukemia Cells and Inducibility of the TLR Signaling Pathway is Associated with a More Favorable Phenotype Annette K. Brenner and Øystein Bruserud Table S1. Median concentration increase in the secretion of 19 (16 patients with G-CSF, 67 patients with GM-CSF) soluble mediators as a result of targeting with four different TLR agonists. More than 5-fold increase is highlighted. LPS (TLR4) Flagellin (TLR5) R848 (TLR7/8) Pam3CSK4 (TLR1/2) IL-6 301.0 45.9 10.2 5.3 TNFα 188.7 10.6 5.0 1.5 IL-1β 89.7 9.2 1.1 1.5 CCL3 56.4 6.0 2.4 1.5 CCL2 52.6 9.4 4.3 2.8 G-CSF 51.9 2.7 1.0 1.0 CXCL1 38.0 5.8 1.4 1.5 CCL4 17.2 3.3 2.0 1.3 CCL5 14.5 2.1 1.3 1.1 MMP-1 11.1 3.4 1.4 1.1 CXCL5 8.3 4.3 1.3 1.4 CXCL8 6.0 4.3 1.7 1.3 GM-CSF 5.2 1.5 1.4 1.0 MMP-2 4.0 1.5 1.2 1.1 CXCL10 3.9 1.6 2.2 1.1 HGF 2.0 1.1 1.0 1.0 MMP-9 1.9 2.5 1.3 1.7 IL-1RA 1.8 1.3 1.3 1.0 Serpin E1 1.3 1.3 1.1 1.1 Cystatin C 1.1 1.1 1.0 1.0 Cancers 2019, 11 S2 of S19 Table S2.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Human Kinome Profiling Identifies a Requirement for AMP-Activated
    Human kinome profiling identifies a requirement for AMP-activated protein kinase during human cytomegalovirus infection Laura J. Terrya, Livia Vastagb,1, Joshua D. Rabinowitzb, and Thomas Shenka,2 aDepartment of Molecular Biology and bDepartment of Chemistry and the Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544 Contributed by Thomas Shenk, January 11, 2012 (sent for review December 29, 2011) Human cytomegalovirus (HCMV) modulates numerous cellular (7). Thus, the connections between AMPK activity and metabolic signaling pathways. Alterations in signaling are evident from the changes during HCMV infection have remained unclear. broad changes in cellular phosphorylation that occur during HCMV We confirmed the requirement for AMPK during infection, infection and from the altered activity of multiple kinases. Here we and we show that an AMPK antagonist, compound C, blocks report a comprehensive RNAi screen, which predicts that 106 cellular HCMV-induced changes to glycolysis and inhibits viral gene kinases influence growth of the virus, most of which were not expression. These studies argue that AMPK or a related, com- previously linked to HCMV replication. Multiple elements of the pound C-sensitive kinase is an essential contributor to metabolic AMP-activated protein kinase (AMPK) pathway scored in the screen. changes initiated by HCMV and provide unique insight into As a regulator of carbon and nucleotide metabolism, AMPK is poised potential antiviral strategies. to activate many of the metabolic pathways induced by HCMV infection. An AMPK inhibitor, compound C, blocked a substantial Results portion of HCMV-induced metabolic changes, inhibited the accumu- HumanKinomeScreenIdentifies Putative Effectors of HCMV Replication. lation of all HCMV proteins tested, and markedly reduced the We conducted an siRNA screen of the human kinome to perform an production of infectious progeny.
    [Show full text]
  • Support Info
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2014 Supporting Information Design and synthesis of pyrrole–5-(2,6-dichlorobenzyl)sulfonylindolin-2-ones with C- 3’ side chains as potent Met kinase inhibitors Chia-Wei Liu,a Chun-Liang Lai,a Yu-Hsiang Lin,a Li-Wei Teng,a Sheng-chuan Yang,a Win-Yin Wei,a Shu Fu Lin,a Ju-Ying Yang,a Hung-Jyun Huang,a Ru-Wen Wang,a Chao-Cheng Chiang,a Mei-Hui Lee,a Yu- Chuan Wang,b Shih-Hsien Chuang,a Jia-Ming Chang,a Ying-Shuan E. Lee,a and Jiann-Jyh Huang*a,b aDevelopment Center for Biotechnology, No. 101, Lane 169, Kangning St., Xizhi District, New Taipei City 22180, Taiwan bDepartment of Applied Chemistry, National Chiayi University, No. 300, Syuefu Rd., Chiayi City 60004, Taiwan *Corresponding Author. Tel.: +886 5 271 7959; Fax: +886 5 271 7901. E-mail address: [email protected] (J.-J. Huang) Table of Contents: Page Supporting Figure. Ligplot diagrams of the ATP binding site of Met S2 complexed with compounds 2 and 20. Supporting Table. Kinase profiling data of compound 20. S3 References S10 - S1 - Supporting Figure. Ligplot diagrams1 of the ATP binding site of Met complexed with compounds 2 and 20: (A) Met with 2, and (B) Met with 20. - S2 - Supporting Table. Kinase profiling data of 20. Ambit KinomeScan Kinase Profiling (1.0 μM test concentration): Percentage of Percentage of Ambit Gene Symbol control (%) Ambit Gene Symbol control (%) 20 20 AAK1 68 ARK5 27 ABL1(E255K)-phosphorylated 85 ASK1 100 ABL1(F317I)-nonphosphorylated 78 ASK2 67
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration
    Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction.
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]