OXIDATIVE STRESS IN ARCHAEA: PROTEOME RESPONSES AND CHARACTERIZATION OF AN INORGANIC PYROPHOSPHATASE THAT DRIVES E1-LIKE ACTIVATION OF UBIQUITIN-LIKE PROTEIN MODIFICATION

By

LANA MCMILLAN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

© 2017 Lana McMillan

To my parents and fiancé for their constant encouragement and support

ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my mentor, Dr. Julie Maupin-

Furlow, for her guidance, kindness, understanding, and support. She has been an incredible mentor, allowing space for personal growth while keeping me on track. She encouraged and introduced some wonderful opportunities during my graduate school career such as mentoring undergraduates, teaching, and attending conferences. I would like to thank my committee members Dr. Linda Bloom, Dr. Sixue Chen, and Dr.

Keelnatham Shanmugam for taking the time to provide advice and guidance. I would also like to thank the Genetics and Genomics Graduate Program, specifically Dr.

Connie Mulligan, Dr. Wilfred Vermerris, Dr. John Davis, Dr. Doug Soltis, and Dr.

Maurice Swanson for making the GG graduate students feel like we have a voice and for providing an excellent network of support. Thank you to the Department of

Microbiology and Cell Science, especially the laboratories of Dr. Shanmugam, Dr.

Romeo, Dr. Ingram, Dr. Preston, Dr. Rice, and Dr. Gurley for providing assistance and equipment which greatly helped my research projects. Thank you to Dr. Monika Oli for allowing me the wonderful opportunity to teach. Thank you to UF Interdisciplinary

Center for Biotechnology Research (ICBR) Proteomics and Mass Spectrometry Core, especially Dr. Jin Koh for helping with the proteomic data analysis.

I would like to acknowledge my parents for always making time to visit me from

Missouri a few times a year and for fueling my curiosity for science from the beginning. I must give a special thank you to my Granny, for being my snail-mail pen pal throughout my time at graduate school and always sending positive and encouraging thoughts. I need to give the biggest thanks to my fiancé, Guido Pardi IV for escorting me to the lab for mid-night time points, writing programs for my proteomics project, and always being

4

there for me. I would like to thank my Gainesville family, Dr. Lara Ianov and her wife

Okreatta Ianov for being an excellent support system and the very best friends.

Thank you to past lab members who have been excellent role models and teachers, especially Dr. Jonathan Martin, Dr. Nathanial Hepowit, Dr. Xian Fu, and Dr.

Shiyun Cao. I would like to thank my current lab members, especially Swathi Dantuluri and Sungmin Hwang, who keep the atmosphere in the lab light with their humor and wit.

I also owe a big thank you to the dedicated undergraduate researchers who have worked with me over the years: Rawan Farah, Miguel Gomez, and Whinkie Leung.

Being a mentor to undergraduate researchers has been an incredibly rewarding experience. Finally, I would like to thank my peers in the Genetics and Genomics and the Microbiology and Cell Science Graduate Programs, especially Winnie Hui and Anna

Gioseffi, for their support and friendship.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 9

LIST OF FIGURES ...... 10

LIST OF ABBREVIATIONS ...... 11

ABSTRACT ...... 14

CHAPTER

1 LITERATURE REVIEW ...... 16

Introduction ...... 16 Extreme Living Conditions of Halophilic Organisms ...... 16 High Salt Stress ...... 17 Desiccation and Starvation ...... 17 Oxidative Agents ...... 18 Oxidative Stress ...... 18 Reactive Oxygen Species in the Cell ...... 19 Archaeal Oxidative Stress Expression Studies ...... 21 Quantitative Proteomics ...... 22 Sample Preparation ...... 22 Mass Spectrometry ...... 23 Label Free ...... 26 Stable Isotope Labeling of Amino Acids in Cell Culture ...... 27 Isobaric Tags for Relative and Absolute Quantitation ...... 29 Absolute Quantification ...... 30 Selected Reaction Monitoring ...... 30 2-Dimesional Gel Electrophoresis ...... 31 Limitations ...... 32 Archaeal Quantitative Proteomics ...... 32 Inorganic Pyrophosphatase ...... 34 Commercially Available Inorganic Pyrophosphatases ...... 35 Archaeal Inorganic Pyrophosphatases ...... 36 Halophilic Enzymes and Industrial Applications ...... 36 Objectives ...... 37

2 MATERIALS AND METHODS ...... 39

Materials and Methods for SILAC study...... 39 Materials ...... 39 Strains and Media ...... 39 Generation of Mutant Strains ...... 39

6

Growth Assays for Minimal Amino Acid ...... 40 Assay of Cell Survival after Exposure to Sodium Hypochlorite (NaOCl) ...... 40 Ellman’s Reagent Assay for Free Sulfhydryl Groups ...... 41 Isotopic Incorporation ...... 42 SILAC Cultures, Sample Preparation, and Strong Cation Exchange Chromatography ...... 43 Reverse Phase LC-Mass Spectrometry and Protein Identification ...... 44 NaOCl sensitivity assay ...... 46 Materials and Methods for HvPPA study ...... 46 Materials ...... 46 Strains and Media ...... 47 DNA Manipulations ...... 47 Purification of HvPPA from Haloferax volcanii ...... 48 PPi Assay ...... 49 Coupled Assay of Ubiquitin-Like Protein Adenylation ...... 50 Protein Concentration Assay ...... 51 Protein Lyophilization ...... 51 SDS-PAGE and Immunoblotting ...... 51 Dendrogram Analysis ...... 51

3 DEVELOPMENT OF A MULTIPLEX SILAC-BASED APPROACH FOR QUANTIATIVE ANALYSIS OF A MODEL ARCAHAEAL PROTEOME UNDER DIFFERENT GROWTH CONDITIONS ...... 55

Introduction for SILAC Study ...... 55 Results ...... 56 Generation of a SILAC Compatible Double Auxotroph for Lysine and Arginine ...... 56 Sodium Hypochlorite Causes Oxidative Stress in Hfx. volcanii ...... 57 Two Subcultures Sufficient for Full Isotopic Incorporation ...... 58 SILAC as an Effective Method to Quantitatively Measure Protein Expression Under Different Conditions in Archaea ...... 59 Proteomic Changes Caused By Oxidative Stress ...... 61 Conclusion for SILAC Study ...... 62

4 ARCHAEAL INORGANIC PYROPHOSPHATASE DISPLAYS ROBUST ACTIVITY UNDER HIGH SALT CONDITIONS AND IN ORGANIC SOLVENTS .... 91

Introduction ...... 91 Results and Discussion...... 93 Inorganic Pyrophosphatase Homologs of Halophilic Archaea are Phylogenetically Distinct ...... 93 Purification of HvPPA in an Active Form as a Hexamer ...... 95 Catalytic activity of HvPPA ...... 95 HvPPA Tolerance to Temperature and Organic Solvents ...... 97 HvPPA for Detection of By-Product PPi in a Coupled Assay at High Temperature and Reduced Water Activity...... 98

7

Conclusions For HvPPA Study ...... 99

5 CONCLUSIONS AND FUTURE DIRECTIONS ...... 111

Summary of Results...... 111 Future Directions ...... 112

APPENDIX: SUPPLEMENTARY TABLES FROM SILAC STUDY ...... 117

LIST OF REFERENCES ...... 188

BIOGRAPHICAL SKETCH ...... 206

8

LIST OF TABLES

Table page

1-1 Comparisons of quantitative proteomic methods ...... 38

2-1 Strains and plasmids used in SILAC study ...... 53

2-2 Strains, plasmids, and primers used in HvPPA study ...... 54

3-1 Heavy proline conversion from arginine ...... 63

3-2 Fifty most abundant proteins in the SILAC study ...... 64

3-3 Fifty least abundant proteins in the SILAC study ...... 69

3-4 Label swap t-test with 50 most abundant proteins ...... 73

3-5 Proteins upregulated after treatment with NaOCl ...... 75

3-6 Proteins downregulated after treatment with NaOCl ...... 83

4-1 Purification of HvPPA from Haloferax volcanii ...... 100

4-2 Archaeal inorganic pyrophosphatases (E.C. 3.6.1.1) of the class A type (IPR008162 family) ...... 101

A-1 All proteins identified in SILAC study ...... 117

A-2 Differentially expressed proteins ...... 170

9

LIST OF FIGURES

Figure page

3-1 Lysine and arginine auxotrophy phenotype shown by absence of growth in media without lysine and arginine supplementation ...... 87

3-2 Double auxotrophic strain (LM08) for lysine and arginine exposure to different concentrations of lysine, arginine, and NaOCl ...... 88

3-3 Protein identification and expression ...... 89

3-4 Hypersensitivity of a small archaeal ubiquitin-like modifier protein mutant (Δsamp1) to oxidative stress as predicted by SILAC and observed by treatment with NaOCl...... 90

4-1 Evolutionary relationships of archaeal inorganic pyrophosphatases of the IPR008162 family ...... 103

4-2 Structural comparison of Class A type inorganic pyrophosphatases ...... 104

4-3 Comparison of electrostatic potential of PPAs...... 105

4-4 Class A type inorganic pyrophosphatase purified from Haloferax volcanii by tandem affinity and size exclusion chromatography...... 106

4-5 Effect of pH, temperature, salt and divalent cations on Haloferax volcanii inorganic pyrophosphatase (HvPPA) activity ...... 107

4-6 Sodium fluoride-based inhibition of Haloferax volcanii inorganic pyrophosphatase (HvPPA) ...... 108

4-7 Effect of salt, solvent, and temperature on Haloferax volcanii inorganic pyrophosphatase (HvPPA) ...... 109

4-8 Haloferax volcanii inorganic pyrophosphatase (HvPPA) coupled adenylation assay at high temperature and reduced water activity ...... 110

10

LIST OF ABBREVIATIONS

2DGE Two dimensional gel electrophoresis aa Amino acids

ADP Adenosine diphosphate

AMP Adenosine monophosphate

AMPPNP Adenylyl-imidodiphosphate, a non-hydrolysable form of ATP

Apr Ampicillin resistance

AQUA Absolute quantification, a quantitative proteomics method

ATP Adenosine triphosphate

CID Collision-induced dissociation

CTP Cytidine triphosphate

DC Direct current

DMF Dimethylformamide

SAMP Small archaeal modifier protein

DMSO Dimethyl sulfoxide

DTT Dithiothreitol

EC Enzyme Commission number – a number used to describe the chemical reaction an enzyme catalyzes.

EDTA Ethylenediaminetetraacetic acid emPAI Exponentially Modified Protein Abundance Index

ESI Electrospray ionization

FDR False discovery rate

GTP Guanosine triphosphate

HCD Higher energy collisional dissociation

11

HvPPA Haloferax volcanii inorganic pyrophosphatase

IMAC Immobilized metal affinity chromatography

IPP Isopentenyl pyrophosphate

IR Ionizing radiation iTRAQ Isobaric tag for relative and absolute quantitation

Kav Partition coefficient for gel filtration chromatography

Kcat Turnover rate constant

Michaelis constant, the substrate concentration at which the Km reaction rate is half the maximum velocity (Vmax)

LC-MS/MS Liquid chromatography and tandem mass spectrometry m/z Mass to charge ratio

MALDI Matrix assisted laser desorption/ionization

MMTS Methyl methanethiosulfonate

Methanobacterium thermoautotrophicum inorganic MtPPA pyrophosphatase

Nvr Novobiocin resistance

OD600 Optical density at 600 nm

PCR Polymerase chain reaction

PDB Protein data bank from the Research Collaboratory for Structural Bioinformatics

PhPPA Pyrococcus horikoshii inorganic pyrophosphatase

Pi Inorganic phosphate pI Isoelectric point

PPA Inorganic pyrophosphatase

PPi Inorganic pyrophosphate

12

PSM Peptide spectrum match

ROS Reactive oxygen species

SaPPA Sulfolobus acidocaldarius inorganic pyrophosphatase

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

SEC Size exclusion chromatography

SILAC Stable Isotope Labeling of Amino acids in Cell culture

SLIC Sequence and ligation independent cloning

SNP Single nucleotide polymorphism

SRM Selected reaction monitoring, also known as multiple reaction monitoring (MRM)

StPPA Sulfolobus tokodaii inorganic pyrophosphatase

TaPPA Thermoplasma acidophilum inorganic pyrophosphatase

TCEP Tris(2-carboxyethyl)phosphine

TOF Time of flight mass spectrometer

TTP Thymidine triphosphate

TtPPA Thermococcus thioreducens inorganic pyrophosphatase

UTP Uridine triphosphate

UVR Ultraviolet radiation

Vmax Maximum enzymatic rate with saturating levels of substrate

γGC γ-glutamylcysteine

ΔGG C-terminal diglycine motif deletion

13

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

OXIDATIVE STRESS IN ARCHAEA: PROTEOME RESPONSES AND CHARACTERIZATION OF AN INORGANIC PYROPHOSPHATASE THAT DRIVES E1-LIKE ACTIVATION OF UBIQUITIN-LIKE PROTEIN MODIFICATION

By

Lana McMillan

August 2017

Chair: Julie Maupin-Furlow Major: Genetics and Genomics

Halophilic archaea are exposed to extreme conditions and are ideal model systems for studying stress response. Because of their high tolerance to stress, their proteins evolved to withstand harsh conditions and are well suited for industrial applications. In the Dead Sea, Haloferax volcanii is exposed to high levels of oxidative stress, salt, UV radiation, and low oxygen conditions and has evolved to thrive in conditions that would be lethal for many other organisms on earth.

In this work, SILAC was adapted for study of halophilic archaea and their response to oxidative stress. SILAC has not been used in the domain of Archaea due to the need for amino acid auxotrophy. A double auxotrophic strain for arginine and lysine was created to ensure full label incorporation. After treatment with oxidant agent sodium hypochlorite, 565 proteins were found to be differentially expressed, from a total of

2,565 proteins identified out of 3,996 proteins predicted based on the genomic sequence. This cost-effective proteomic method was shown to have 100% labeling efficiency and only requires a small amount of cell material.

14

One of the most abundant proteins identified in the SILAC study was inorganic pyrophosphatase, HvPPA, an enzyme involved in important cell functions like nucleic acid, protein, and steroid synthesis. HvPPA was used in a coupled reaction to monitor

PPi release from the ATP-dependent adenylation reaction of ubiquitin-like protein

SAMP1 by E1 ubiquitin activating enzyme homolog UbaA. HvPPA displayed non-

-1 Michaelis-Menten kinetics with a Vmax of 465 U·mg for PPi hydrolysis (optimal at 42 °C and pH 8.5). Current characterized class A type PPAs are thermostable but unable to function in high salt and organic solvent where HvPPA retained activity in 25% v/v organic solvents. The overall surface charge of HvPPA is uniquely acidic when compared to other characterized class A type PPAs, which may provide protection in reduced water conditions. PPA is involved in biosynthetic reactions such as amino acid synthesis and ubiquitin-like protein activation, which are important responses to oxidative damage. Proteins identified in response to oxidative damage from this study highlight the high priority processes in remedying oxidative stress.

15

CHAPTER 1 LITERATURE REVIEW

Introduction

The literature review in this chapter highlights the extreme environment where halophilic archaea thrive. Some archaeal enzymes retain activity at temperature and pH extremes, making them well suited for industrial applications. Archaea are great model systems to study stress response due to the extreme conditions they have evolved to survive. Topics discussed are: extreme living conditions of halophiles including

Haloferax volcanii, oxidative stress, quantitative proteomics, and inorganic pyrophosphatase.

Extreme Living Conditions of Halophilic Organisms

Halophiles inhabit one of the harshest places on earth. In salt lakes, brine pools, and salterns, life is subjected to ionizing radiation, desiccation, low nutrients, low oxygen, high salt, and extreme temperatures (3, 4). In high salt environments, all domains of life are present; however, halophilic archaea are the most abundant form of life in bodies of water reaching saline saturation (5). Dunaliella salina, representing

Eukarya, is a moderately halophilic green alga cultivated for its ability to produce high levels of β-carotene (6, 7). D. salina was originally isolated from a French saltern and uses β-carotene for protection from damaging radiation (8). An extremely halophilic bacterium, Salinibacter ruber, isolated from a saltern pond in Spain, grows optimally with salt concentrations at 20-30% (9). A halophilic archaeon (Halobacterium lacusprofundi) inhabits Deep Lake in Antarctica where water reaches a temperature of -

20 C but never freezes due to the high concentration of salt (up to 27% salinity) (10).

16

In order to study halophilic archaea, a model species is necessary.

Halobacterium salinarum and Hfx. volcanii are both popular models used to study halophilic archaea as both genomes have been sequenced and annotated. For both

Hfx. volcanii and Hbt. salinarum genetic manipulation is possible, an important feature for a model organism. Hfx. volcanii is the model archaeon used in these studies as it grows at a comparatively higher rate and its genome is more stable than in Hbt. salinarum (11, 12).

High Salt Stress

To cope with high salt in their environment, halophilic archaea use a ‘salt-in’ strategy to balance the osmotic pressure on both sides of the cell membrane (3, 4, 13).

Hfx. volcanii imports up to 4 M KCl (14), and as a result the proteins in the cell are resistant to high salt. Proteomes of haloarchaea are more acidic than non-halophilic organisms with a calculated average isoelectric point (pI) of 5.1 for the Hfx. volcanii proteome (15). For comparison, the Escherichia coli and Homo sapiens proteomes have average pI values of 6.6 and 6.8, respectively (16). The surfaces of proteins from haloarchaea are often enriched with a high number of acidic residues which create a water shell around the protein surface allowing for solubility and flexibility in low water activity (6, 17). This acidic surface also allows for the proteins from haloarchaea to function in solvents with reduced water activity such as organic solvent (18, 19).

Desiccation and Starvation

In addition to high salt, microbes in hypersaline environments are sometimes cycling between desiccation and rehydration which can make finding nutrients and oxygen difficult. Hfx. volcanii metabolizes exogenous DNA as well as its own DNA for phosphorus, carbon, and nitrogen (20). Hfx. volcanii is polyploid and in exponential

17

phase contains up to 18 copies of its genome (21). This extra genetic material can provide a genetic back up against deleterious mutations and also act as a nutrient reserve (4, 20). In high salt environments, oxygen can be limited as the solubility is low.

Hfx. volcanii can grow anaerobically with fumarate, DMSO, or nitrate as terminal electron acceptors (22, 23).

Oxidative Agents

In their natural environment, halophilic archaea are exposed to reactive oxygen species (ROS) that can damage all biomolecules of the cell (24). Ionizing radiation leads to development of ROS in salt lakes and salterns in the form of hydroxyl radicals

- (OH ) from water autolysis (25). Hydrogen peroxide (H2O2), another ROS, is formed by a photochemical reaction induced by ultraviolet radiation (UVR) in natural waters including fresh and saltwater (26). Hbt. salinarum has resistance to high levels of UVR and ROS (27) and has been studied extensively as an archaeal model for oxidative and radiation stress. Hbt. salinarum can survive gamma radiation at a dose over 20 times the limit for E.coli (28).

Oxidative Stress

Oxidative stress occurs when ROS in the cell overwhelm the antioxidant abilities

• of the cell and permanent damage occurs. ROS such as H2O2, hydroxyl radical (HO ),

•- and superoxide (O2 ), are natural byproducts of aerobic metabolism (29). ROS can cause a wide variety of cellular damage from DNA to protein damage. Oxidized proteins can become misfolded, lose function, and need to be repaired or degraded. In eukaryotic systems, damaged or misfolded proteins are targeted to the proteasome for degradation by (poly)ubiquitination, a post-translational modification (30). Archaea can be used as a simple model system to study the basic oxidative damage response for

18

eukaryotic systems as there are similarities in transcription, translation, and replication machinery (31).

In archaea, ubiquitin-like proteins called small archaeal modifier proteins

(SAMPs) are attached to proteins by an isopeptide linkage between the SAMP C- terminal diglycine motif and the ε-amino group of a lysine residue on the target protein

(32-34). Three SAMPs have been identified in Hfx. volcanii; they all harbor the β-grasp fold and C-terminal diglycine motif conserved in ubiquitin and ubiquitin-like proteins (32,

33, 35). SAMP1 has implications with oxidative stress response and sulfur metabolism

(36), SAMP2 has been shown to target proteins for degradation by the proteasome (37), and SAMP3 modification plays a role in molybdenum cofactor biosynthesis regulation

(33).

Reactive Oxygen Species in the Cell

ROS form endogenously between O2 and metal centers of enzymes, FADH2 cofactors, and quinones (38). The strongest oxidant produced in biological systems is

HO• and can be generated in vivo by ionizing radiation and transition metal ion- catalyzed reactions such as the Fenton reaction (39). The Fenton reaction produces

• 2+ HO after reduced transition metals such as Fe react with H2O2. In vertebrates, ROS are produced by phagocytic cells such as macrophages and neutrophils as a defense mechanism against microbial pathogens (40). Salmonella enterica has evolved to evade the oxidative stress of the immune system with five genes encoding H2O2 degrading enzymes (41).

Cellular damage by ROS is widespread, affecting proteins, lipids, and nucleic acids. ROS damages DNA and RNA by creating single or double-strand breaks in the

19

backbone and forming base and sugar adducts (42). Free radicals attack unsaturated fatty acids in membranes, called lipid peroxidation, which decreases membrane fluidity and as a result disrupts membrane structure and membrane bound proteins (42, 43).

Sulfur containing amino acids cysteine and methionine are particularly susceptible to oxidation (39). Cysteine residues are sensitive to ROS and can form non-specific disulfide bonds when oxidized, causing a loss in protein function (42).

Protein damage by oxidants can cause activation of response enzymes. Cysteine residues can serve as a sensor for oxidative stress in transcription factors such as

OxyR in E. coli. Formation of a disulfide bond upon oxidation of the active site cysteine residue by H2O2 causes a conformational change and functional activation (44). Iron sulfur clusters can also serve as a sensor for transcriptional regulation in response to

•- oxidants. SoxR in E. coli contains an iron sulfur cluster, when oxidized by O2 , an allosteric change occurs activating transcription of antioxidant enzymes (44, 45).

Cellular methods of ROS detoxification are important to avoid an accumulation of oxidative damage. Low molecular weight thiols such as glutathione and γ- glutamylcysteine (γGC) are able to reduce disulfide bonds from oxidized cysteine residues (38, 46). Thioredoxins are conserved through all domains of life with a conserved C-G-P-C catalytic motif responsible for reducing disulfide bonds from oxidized proteins (47). Superoxide dismutase, with the addition of two H+, reduces two

•- O2 into O2 and H2O2 (48) to protect the cell from damage, particularly damage to iron

•- sulfur containing proteins, by O2 (49). H2O2 is then broken down by a catalase.

Catalases contain a heme active site and protect the cell from oxidative damage by

20

breaking down 2(H2O2 ) into 2(H2O) and O2 (50). When the antioxidant defenses of the cell are overwhelmed by ROS, oxidative stress occurs.

Archaeal Oxidative Stress Expression Studies

Archaea live in some of the harshest environments on earth and have adapted physiologically to overcome environmental stressors, such as oxidative stress, making them excellent models to study stress response. In transcriptomic and proteomic studies of oxidative stress in archaea, a handful of proteins are upregulated across multiple studies. Thermococcus kodakarensis, an obligate anaerobe, was treated with oxygen bubbling through the culture for 30 minutes and proteins analyzed by two dimensional gel electrophoresis (2-DGE) (51). Differential protein and transcription levels have been studied in Hbt. salinarum: i) isobaric tags for relative and absolute quantitation (iTRAQ) was used to study differential protein expression from gamma radiation (52) and ii) differential gene expression after oxidative stress was investigated

•- by microarray analysis after treatment with oxidants H2O2 and O2 generator paraquat

(29). Pyrococcus furiosus was treated with gamma radiation and studied via microarray analysis (53), and Sulfolobus solfataricus transcriptome (microarray) and proteome (2-

DGE) was studied after exposure to H2O2 (54).

Upregulated proteins or mRNA from these multiple studies were involved in detoxification of the cell, iron sequestration, and chaperones. Oxioreductases (51, 53,

54), peroxiredoxins (29, 51, 54), thioredoxins (51, 52), and superoxide dismutase (29,

52, 54) are upregulated that could reduce oxidative damage in the cell. Under oxidative stress, ferritin-like (DPS-like) proteins are upregulated (29, 53, 54). Ferritin sequesters iron for use by the cell, and may be up regulated as an effort to repair proteins with damaged Fe–S clusters. Thermosome subunits α and β are upregulated upon treatment

21

with ROS in S. solfataricus and T. kodakarensis (51, 54). Upregulation of chaperone proteins such as the thermosome after oxidative stress could promote refolding of damaged and misfolded proteins to avoid aggregation.

Quantitative Proteomics

In order to study cellular processes, identifying and quantifying protein expression under certain conditions or strains is crucial to biological understanding.

Quantitative proteomics can take snapshots of protein expression levels in the cell at a specific time point and give insight on cellular processes at the time using a mass spectrometer (55). Mass spectrometry (MS) is a method which can accurately identify and quantify molecules based on their mass to charge (m/z) ratio. Proteomic studies are complementary to transcriptomic and metabolomic studies for understanding cellular processes, providing information such as expression level and post-translational modifications. Quantitative proteomics is a tool that can be used for shotgun or discovery-based proteomics or for a more targeted approach where an enrichment or purification step is used before mass spectrometry. Several different methods are used to perform a quantitative proteomic study, from 2-dimentional gel electrophoresis (2-

DGE) to isotopic labeling. Two types of quantitation exist in proteomics, relative and absolute (56). Relative quantitation is the comparison of the same protein in different experimental states, and this value is given as a ratio. Absolute quantitation refers to the direct measurement of protein concentration, usually with a spiked-in standard of known concentration (56).

Sample Preparation

Before MS, steps need to be taken to ensure maximum amino acid sequence coverage is achieved (57). Thousands of proteins are in whole cell lysate after being

22

isolated away from other cellular components. In order to remove complexity from samples with many proteins, fractionation or enrichment, is important (58). Proteins are separated using chromatography by size, charge, hydrophobicity, or affinity tags.

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) is used to separate proteins by molecular weight (59), and 2-DGE separates proteins by molecular weight and isoelectric point (pI) (60). Ammonium sulfate precipitation is used to separate proteins by solubility in high salt (61).

After protein separation, proteins are digested into peptides using a proteolytic enzyme. One of the most common enzymes used is trypsin, a serine protease which cleaves proteins carboxyl to lysine and arginine residues (62). In order for trypsin digestion to be optimal, proteins need to be unfolded by the removal of disulfide bridges between cysteine residues. First, disulfide bonds are removed by a reducing agent such as dithiothreitol (DTT) or tris(2-carboxyethyl)phosphine (TCEP) (57). Once disulfide bonds are reduced, free cysteines are blocked by an alkylating agent such as iodoacetamide or methyl methanethiosulfonate (MMTS) to ensure the disulfide bonds do not reoccur (63). Following protein digestion, peptides can be fractionated or enriched, with methods mentioned above, prior to analysis by MS.

Mass Spectrometry

In order to identify proteins by their amino acid sequence, a mass spectrometer is used. MS separates charged molecules by m/z to allow for identification and quantification (64). A mass spectrometer has three main components: an ionization source, a mass analyzer, and a detector (64). Ionization sources used in proteomics are soft ionization methods, meaning molecules are mostly left in-tact after ionization (65).

Electrospray ionization (ESI) (66, 67) and matrix assisted laser desorption/ionization

23

(MALDI) (68) are two soft ionization methods used frequently in proteomic studies. For

ESI, peptides in solution are loaded into a metal capillary and a high voltage is applied, spraying an aerosol of charged droplets containing the peptides (65). As the solution evaporates, peptides are charged in multiple charge states. ESI can be coupled to LC, providing a streamlined process for fractionation and identification of complex mixtures

(64). In MALDI, peptides are crystalized onto a metal plate with a matrix. The peptide- matrix mixture is hit with a laser and the peptides are evaporated into the gas state with most peptides obtaining a single charge (69). After ionization, peptides are ready for separation by the mass analyzer.

The second main component to a mass spectrometer is the mass analyzer. Mass analyzers sort the charged peptides in either space or time by their m/z ratio (64). Some types of mass analyzers are quadrupole (Q), time of flight (TOF), and orbitrap. A quadrupole mass analyzer uses four parallel rods as electrodes where radio frequency and DC voltages create an oscillatory electric field, selecting for ions of a certain m/z window. Ions with a m/z outside of the predetermined window will experience a destabilized trajectory, crash into a rod, and will not be detected (64, 70). Quadrupole mass analyzers are used widely as they are less expensive and smaller than other mass analyzers (64). Time of flight mass analyzers use an electric current to separate ions by their m/z. Ions with lower m/z will hit the detector quicker than ions with a high m/z. The time it takes the ions to hit the mass detector is related to ion mass (71).

Orbitrap mass analyzers trap ions around a central spindle-like electrode surrounded by an outer barrel-like electrode (72). The ions orbit around the central electrode in harmonic oscillations with frequency proportional to (m/z)-1/2 (73). Mass analyzers can

24

be combined to make hybrid instruments, such as the Thermo Scientific LTQ orbitrap which couples quadrupole and orbitrap technologies to improve dynamic range and resolution (74).

The final component to a mass spectrometer is a detector. Some detectors used in proteomics are the electron multiplier and the Faraday cup. When ions hit the first dynode of the electron multiplier, electrons are emitted which hit the next dynode and emit more electrons, this is repeated a number of times to amplify the signal (64).

When the ion strikes the surface of the Faraday cup, electrons are ejected and induce a temporary current which is amplified for detection (75). Ion intensity is proportional to the number of ions which hit the detector in a predetermined time frame (76).

Tandem mass spectrometry is used to find the amino acid sequence of proteins de novo (77) by using two mass analyzers working in tandem. The sample is ionized and separated by m/z in the first mass analyzer. Pre-selected peptides, called precursor ions, with a certain m/z are fragmented by collision with neutral molecules such as nitrogen, argon, or helium gas, this collision method is called collision- induced dissociation (CID) (78). Fragmented peptides are separated by m/z in the second mass analyzer; this m/z information is what allows for interpretation of the amino acid sequence of the peptide. Peptides are fragmented in multiple places however cleavage at the peptide bond creates y and b ions, which contain the amino acid sequence information (79). Ions formed from the C-terminus of a peptide are y ions, and b ions are formed from the N-terminus. Peaks from both y and b ions are seen in spectra, and the peptide sequence can be inferred by subtracting the yi ion from the yi+1 ion to get the mass of the amino acid in the yi+1 position, and the same process is used for b ions

25

(77). Using both y and b ions for amino acid sequence identification gives the sequence in both directions (79). Several methods exist to perform quantitative proteomics with

MS/MS, some popular methods are described below and summarized in Table 1-1.

Label Free

Label free proteomics aims at quantifying peptides by one of two methods. One way to quantify peptides without labeling is by spectral counting, meaning the number of peptide spectral matches (PSMs) obtained for each protein (56). This method assumes the number of PSMs and individual peptides identified correlate with protein abundance.

Spectral counting is a more reproducible parameter than percent coverage and number of unique peptides found (80). The second label-free way to measure abundance is by the average intensity of the precursor ion peak of all peptide ion spectra for each protein

(80). This intensity based quantitation has better accuracy and a larger dynamic range than spectral counting (81).

Using a label free proteomic method has both strengths and weaknesses.

Sample preparation for label free proteomics is simple and cost efficient, as there is no added labeling step. Label-free is advantageous in that the number of samples is unlimited. In labeling approaches, experiments can be limited by the number of replicates allowed by the multiplexing capabilities of the label (56). The downside of label-free is the amount of technical variability introduced between replicates when compared to MS methods with multiplex capabilities. Differences in peptide retention time between individual LC-MS/MS runs are observed, so multiple replicates are needed for accurate quantitation (82). Each sample is processed and analyzed separately, so highly reproducible workflows and data normalization are a must (56).

26

Stable Isotope Labeling of Amino Acids in Cell Culture

Stable isotope labeling of amino acids in cell culture, or SILAC, is a quantitative proteomic method which incorporates isotopic labeling metabolically (83). Isotopic variants of amino acids containing 13C, 15N, and 2H are added to the growth medium, imported into the cell, and incorporated into proteins by protein synthesis like standard amino acids. For proteomics, proteins are digested into peptides with peptidases. One of the most common enzymes to use is trypsin, a serine protease, which cuts carboxyl to lysine and arginine residues. In human cell lines, lysine and arginine are essential amino acids for growth that must be supplemented in the growth medium (84). In a

SILAC study, if lysine and arginine are used as labels, every tryptic peptide will have a label incorporated. All proteins in the cell are labeled in SILAC studies, allowing for all proteins to be labeled regardless of abundance or modifications. A SILAC study quantifies protein by relative quantitation, by comparing expression levels of proteins from one experimental state to another. For example, the medium of experimental state

13 13 15 contains C6 lysine, giving a +6 Da mass shift for each lysine residue, and C6 N4 arginine, resulting in a +10 Da mass shift per arginine residue, while the medium of the control state is supplemented with standard, or light, 12C and 14N lysine and arginine and the cells are mixed at a 1:1 ratio after growth. Label switches are performed to test the effect of labeling on protein expression (85). Proteins are extracted, digested by trypsin, and analyzed by LC-MS/MS. Each peptide identified can be assigned to either the experimental state or the control, and based on the intensity of the peptides from each state, an abundance ratio is given.

SILAC has some strong points as well as some drawbacks. SILAC allows for multiplexing, so there is minimal technical variation between experimental states (56).

27

The experimental states are mixed at a 1:1 cellular or total protein ratio as soon as the experiment ends and are processed together through LC-MS/MS analysis. Multiplexing allows for increased reproducibility and accuracy when compared to other labeled or label-free methods (56). SILAC has a problem when it comes to microbes, in Archaea and Bacteria most amino acids can be synthesized de novo and auxotrophic strains must be created in order to attain 100% labeling of amino acids by SILAC. Beyond this need for auxotrophy, other downsides to SILAC studies exist. One issue is that heavy arginine can be converted into heavy proline, as observed in mammalian cells (86) and

Schizosaccharomyces pombe (87). An added issue is the retention characteristics of stable isotopes in reverse-phase chromatography. Deuterium (2H) labeled amino acids affect retention time (88) by making the deuterium-bound carbon less polar in most cases, and as a result the labeled peptides elute quicker than the same peptide with hydrogen instead of deuterium. These effects are not as dramatic with 13C and 15N isotopes, but are more expensive than 2H (86, 89).

An adaptation for SILAC was developed for studying proteomics from human tissue, as SILAC labeling of human cells can only be done in cell culture for ethical and financial reasons. The method is called super SILAC because it uses a superset of

SILAC labeled cell lines as an internal abundance standard representing the wide variety of proteins in human tissues (90). Super SILAC allows for accurate quantitation of proteins harvested from human tissues, which can provide more useful information for health-related studies than proteins harvested from cell culture. In the first super

SILAC experiment, four different breast cancer cell lines and one non-cancerous mammary epithelial cell line were labeled with heavy lysine (+8) and heavy arginine

28

(+10). Lysate from all five cell lines were combined equally to form the super SILAC standard (90). The super SILAC standard was mixed at a 1:1 ratio with lysate from a patient with a stage II mammary carcinoma and processed together for trypsin digestion through LC-MS/MS analysis (90). Prior to super SILAC the best way to study tissues was with label free proteomics but with super SILAC protein expression can be measured from animal models or human subjects with the accuracy of SILAC (80).

Isobaric Tags for Relative and Absolute Quantitation

Isobaric tags for relative and absolute quantitation (iTRAQ) is a quantitative proteomics method where chemical labeling is used. The label is covalently attached to the N-terminus and side chain amines of peptides after digestion. The isobaric tag has an overall mass of 145 Da, comprised of a reporter group and a balance group (91). For example, if the reporter group has a mass of 114 Da, the balance group will be 31 Da. A labeling kit for multiplex of 4 samples contains four different tags, each containing a different reporter ion mass from 114 to 117 Da. The balance group normalizes the masses from each tag so the total mass is 145 Da; therefore, the mass of the peptides in relation to each other remain unchanged, and sample complexity is constant between label states (92). When peptides containing these isobaric tags are fragmented by

MS/MS, the reporter ion gives a strong signal in the 114-117 Da range, providing information about which sample the peptide came from, included with the peptide b and y ions. Using iTRAQ is a great way to study up to 8 different experimental conditions at once but samples are processed separately which can introduce variability. Furthermore the labeling reaction can fail if there are N-terminal or ε-amino group modifications, resulting in a loss of quantifiable peptides (91).

29

Absolute Quantification

Absolute quantification (AQUA) is a quantitative proteomic method in which a stable isotope labeled peptide is synthesized and added to the protein sample at a known concentration after trypsin digestion. These peptides act as an internal standard for protein concentration on the peptide level (56). The peptide is made as a replica of one peptide that is expected in the protein mixture, with one isotopically modified amino acid substitution resulting in a mass shift. The peptides can be synthesized with covalent modifications like acetylation or methylation which mimic post-translational modifications occurring naturally (93). The concentration of the 13C and/or 15N labeled peptide is calculated based on the intensity of the peak, and data is normalized to the known concentration of the AQUA peptide. The peptide properties detected by LC-

MS/MS must be known prior to analysis such as elution time, fragmentation, and charge state (93). A couple downsides of AQUA are i) the high cost of peptide synthesis and ii) the errors in sample preparation, like sample loss, are not taken into account (80).

AQUA can be used with selected reaction monitoring, a technique described below, to identify and quantify low abundance proteins from complex mixtures.

Selected Reaction Monitoring

Selected reaction monitoring, or SRM, is a method where data are acquired by using triple quadrupole mass analyzers to focus on the flights of ions with predefined mass to charge ratios (94). SRM requires a parent mass list which contains two values, one for the precursor mass and the second for a unique fragment ion mass (95). This method is great for hypothesis driven experiments, as a list of particular proteins and even particular modifications can be created and searched for as long as there is an observable mass shift (94). The data from SRM is highly reproducible and precise and

30

does not have the reproducibility issues of the other label free quantitative proteomic methods (96). With SRM, up to 100 proteins can be searched for at a time, even protein isoforms that cannot be differentiated by immunoassay (94). The sensitivity of

SRM is demonstrated to be able to identify proteins with single digit copies per cell (97).

SRM can be used label free or combined with a labeled approach such as SILAC.

2-Dimesional Gel Electrophoresis

Separating proteins by two dimensions in a gel is a technique that has been around since 1974 and was greatly improved in 1975 (98, 99). Proteins are first separated by pI (100) using isoelectric focusing, then separated by molecular weight using SDS-PAGE (59). For label free experiments where expression differences are of interest, different samples are processed on separate gels and after staining the images are superimposed. Proteins from different samples can be labeled with different florescent dyes allowing for multiplexing (101). The different labeled samples are loaded on the same gel, pictures are taken using the individual excitation and emission wavelengths for each dye, and the images are superimposed to identify expression differences. This method reduces the variability introduced when multiple gels are used

(101). Differences such as modifications and expression differences are seen, and the spots are cut from the gel to be analyzed by MS. 2-DGE has high reproducibility, and can be a cost effective method compared to shotgun proteomics as LC separation is not needed and time occupying the mass spectrometer is minimal (60). The method of 2-

DGE is not as sensitive as other quantitative proteomic methods, as only a small subset of proteins in the gel with visual differences in labeling or migration will be selected for identification (60). Another downside of 2-DGE is quantification can be made difficult when more than one protein migrate to the same spot on the gel.

31

Limitations

One of the biggest problems with quantitative proteomic studies is reproducibility.

Multiple replicates are needed to measure abundance with statistical significance and to identify as many proteins as possible. One reason for the reproducibility problem is technical variation between samples. Technical variation is introduced during sample processing, so having technical replicates can help make sense of this variation (80).

Another reproducibility problem is after raw data is collected, how the researcher interprets the data. Different search parameters on the same data set can alter results significantly, and different software with different algorithms will also interpret data differently (80). Because of the reproducibility problem, journal editors are becoming more stringent with data analysis and asking for database names, software versions, and search parameters. A second limitation of quantitative proteomics is the sensitivity of the mass spectrometer and the separation abilities of the liquid chromatography. In order to identify as many proteins in a complex sample, the proteins need to be separated or fractionated by SDS-PAGE or chromatography in order for the mass spectrometer to capture the majority of peptides present (102).

Archaeal Quantitative Proteomics

In the domain of Archaea, proteomics come with challenges as current techniques are streamlined for proteins with properties similar to human proteins. This is because health related studies have dominated proteomics. Studying archaeal proteins provides evolutionary insight and information about the limits of life on earth as well as identifying compounds and enzymes with industrial applications (31, 103, 104).

Archaea and their proteins are often resilient, which can pose a problem for some proteomic studies. P. furiosus proteins are extremely thermostable, resistant to

32

detergents, and resistant to standard proteolytic techniques for mass spectrometry

(105). Halophilic proteins are acidic, migrating in SDS-PAGE gels slower than non- halophilic proteins, and often times require high salt for solubility (17, 106, 107).

Annotation of the archaeal genome can provide some challenges to proteomic experiments. The proteins identified in a shotgun proteomics experiment are only as good as the genome annotation; proteins are identified through a database from existing annotations, and many genes in Hfx. volcanii are annotated as hypothetical, shown below. In annotation projects, small proteins less than 100 amino acids are usually left unannotated to minimize erroneous predictions (108). The low molecular weight proteome is statistically underrepresented in proteomic experiments as these proteins have fewer tryptic peptides and amino acids than larger proteins. Many proteins smaller than 20 kDa identified from Hbt. salinarum were involved in translation, however over 60% were of unknown function (109).

Archaeal quantitative proteomic studies have reduced complexity due to their small genome size (0.5 to 5.5 Mb) (110), and some recent studies will be discussed below. To find proteomic differences in metabolism an iTRAQ 8-plex study was performed to compare S. solfataricus P2, the lab wild-type strain, and S. solfataricus

PBL2025, a strain with 50 genes missing via spontaneous deletion (111). Six of the deleted genes are characterized to be critical for central carbohydrate metabolism and eight are involved in energy metabolism. Out of 2,977 predicted proteins, 740 were found (25% of the proteome) with a FDR < 1% and 158 proteins were differentially expressed between the two strains (111). A label-free approach was used to identify proteome changes in a conditional LonB protease mutant in Hfx. volcanii. A total of

33

1778 proteins were identified out of 3996 (44% of the proteome) and 142 were differentially expressed (≥2 fold) (112). Proteomes of two archaeal isolates, Halohasta litchfieldiae and Halorubrum lacusprofundi, from Deep Lake, Antarctica were studied with iTRAQ 8-plex (113). Differential expression between growth at 30, 10, and 4°C was investigated for both archaea. For Hht. litchfieldiae 1341 proteins were identified (39% of the proteome) and 149 proteins differentially expressed. For Hrr. lacusprofundi 1559 proteins (43% of the proteome) were identified with 210 differentially expressed. Protein identification was with 95% confidence and differential expression reported with p-value

< 0.05 (113). Hbt. salinarum proteome changes after exposure to gamma radiation were studied using iTRAQ which identified 1033 proteins (43% of the proteome) (52). A label-free shotgun proteomic study of Hfx. volcanii found 32% of the theoretical proteome after fractionation by SCX (102). Archaeal shotgun proteomics experiments discussed here have identified over 44% of the theoretical proteomes, as MS technology and methodology improve, this number will rise. Archaeal proteome studies provide information on physiological characteristics which allow for adaptation to extreme environments. Testing the physical limitations of an isolated protein is another way to investigate environmental adaptation.

Inorganic Pyrophosphatase

Inorganic pyrophosphatase (PPA) is an important enzyme, removing PPi as a byproduct from many basic biosynthetic processes in the cell which hydrolyze ATP to

AMP and PPi such as nucleic acid synthesis, ubiquitin-like protein conjugation, and lipid synthesis (114). PPA hydrolyzes the bond of pyrophosphate (PPi) into two molecules of orthophosphate (Pi) (EC 3.6.1.1). The reaction is highly exergonic and releases a

34

significant amount of energy (ΔG’ = -19.2 kJ/mol) making the reaction very favorable for the cell (30). The energy released from PPi hydrolysis by PPA drives these critical biosynthetic reactions to product formation in the cell. Inorganic pyrophosphatases have been purified as a homohexamer from thermophilic archaea and E. coli (115-118).

Commercially Available Inorganic Pyrophosphatases

PPAs sold commercially have a narrow range of capabilities; some are thermostable but all require aqueous reaction conditions and low salt. PPAs sold from

New England Biolabs and Sigma Aldrich are isolated from Saccharomyces cerevisiae,

E. coli, and Thermococcus litoralis (expressed heterologously in E. coli). The thermostable PPA from T. litoralis can be used in PCR reactions (advertised to retain

100% activity at 100 C for 4 h) to remove the PPi byproduct and to drive the reaction in the forward direction (119). PPA isolated from S. cerevisiae is used to increase yield for in vitro transcription reactions, at 37 C by removing PPi from the reaction (120). PPA from S. cerevisiae is added to completed PCR reactions to remove PPi, a source of high background which causes signal misinterpretation, for primer extension reactions for SNP genotyping (121). S. cerevisiae and E. coli PPAs are used to make guanidine diphosphate (GDP) sugars that were otherwise commercially unavailable or expensive

(122, 123). Aminoacyl tRNA synthetase activity is investigated as a drug target for treatment of tuberculosis (124), malaria (125), and African trypanosomiasis (126).

Amino-acyl tRNA synthetase activity can be measured with the addition of PPA to the reaction. By-products of aminoacyl tRNA synthetase reaction are AMP and PPi. PPi is then hydrolyzed to 2 molecules of Pi and can be quantitatively measured by colorimetric assay (126-128).

35

Archaeal Inorganic Pyrophosphatases

Archaeal PPAs of the class A type that have been characterized are primarily from thermophilic archaea. Thermostable PPA from Thermoplasma acidophilum, active at 75 C, improves DNA sequencing reactions by removing PPi byproduct to prevent the reverse reaction, and allows for less variability in signal intensity (129, 130). PPA of the thermophilic archaeon Pyrococcus horikoshii is characterized for use in PCR reactions with an optimal activity reported at 88 C (131). Sulfolobus acidocaldaris PPA heterologously expressed in E. coli and has optimal activity at 75 C and a pH optimum at 7.0 despite the optimal of growth for S. acidocaldaris is pH 2 (132). An additional

Sulfolobus PPA was characterized from Sulfolobus sp. strain 7, also expressed in E. coli with optimal conditions at 98 C and pH of 6.5 (133). The PPA of

Methanothermobacter thermautotrophicus (Methanobacterium thermoautotrophicum) deltaH has an optimal activity at 70 C and pH 7.7 (134).

Halophilic Enzymes and Industrial Applications

The vast majority of enzymes sold commercially and used in industrial applications are unable to perform in high salt or organic solvents. The acidic surface of halophilic proteins allows for proteins to be more stable in low water conditions by providing a water shell allowing for protein solubility and activity (17, 135). Halophilic enzymes are often inactivated in low salt but can regain activity after incubation with high salt buffer (17, 136, 137). Halophilic enzymes are tolerant of organic solvents, allowing for these enzymes to be explored for industrial uses (18, 138, 139). Several advantages for using enzymes in organic solvents are: increased solubility of hydrophobic substrates, favorable shifts of reaction equilibrium, suppression of water-

36

dependent side reactions, ease of product and/or enzyme recovery, and reduced microbial contamination (140). A lipase purified and characterized from Haloarcula sp.

G41 displays high activity in the presence of hydrophobic organic solvents and has a yield of 80.5-89.2% when applied for biodiesel production (18). The lipase is active in a wide range of salt concentrations (10-25%), temperatures (30-80 C), and pH (6-11). A laccase isolated from Hfx. volcanii is tolerant to organic solvents at 25% v/v, retaining

75% of activity after 24 h in methanol and ethanol (141). The laccase is thermostable and has a half-life of activity at 50 C for 31.5 h and might be a good candidate for detoxification of lignin for fermentable sugars for ethanol production (138).

Objectives

The main goals of this study are to investigate the roles of halophilic proteins involved in oxidative stress response and resistance and to explore the capabilities of halophilic enzymes for use in industrial applications.

Aim 1: Develop a double auxotrophic strain of Hfx. volcanii for lysine and arginine to perform SILAC, a quantitative proteomic method, and employ for the first time in the domain of Archaea to explore the proteomic response to oxidative stress caused by sodium hypochlorite (NaOCl).

Aim 2: Determine the biochemical properties of PPA from Hfx. volcanii and if

HvPPA can be used in coupled assays to monitor reactions that generate PPi as a byproduct. Find characteristics of HvPPA desirable for industrial applications, and identify novel uses for HvPPA in the biotechnology industry.

37

Table 1-1. Comparisons of quantitative proteomic methods Method Pros Cons References Label  No added labeling cost  High technical variability (81, 82, free  Unlimited samples, not  Quantitation not as accurate 142) constrained by multiplex as labeled methods

SILAC  Multiplex- samples are  Auxotrophy needed (83, 86, 88) mixed prior to MS  2H retention time in reverse preparation, reduced phase LC is not the same as variability 1H.  Labeling is 100%  Accurate relative quantitation iTRAQ  Multiplex  Technical variability due to (91, 92)  Accurate relative sample loss in labeling step quantitation

AQUA  Accurate absolute  Cost of synthetic peptide (56, 80, 93) quantitation  Technical variability from  Peptide standard helps with protein loss in sample abundance normalization preparation between replicates  Not global

SRM  Highly reproducible  Need list of peptides and (94-96)  Sensitive enough to find modifications low abundance proteins  Targeted

2-DGE  Cost effective  Low sensitivity (60, 98, 99)  High reproducibility  Low coverage of the  Can find modifications proteome easily  Quantitation problems with multiple proteins that migrate similarly on the gel

38

CHAPTER 2 MATERIALS AND METHODS

Materials and Methods for SILAC study

Materials

Biochemicals were from Sigma Aldrich (St. Louis, MO, USA). Other inorganic and organic analytical grade chemicals were from Fisher-Scientific (Atlanta, GA, USA).

Desalted oligonucleotide primers were from Integrated DNA Technologies (Coralville,

IA, USA). Polymerases, ligase, and restriction endonucleases were from New England

Biolabs (Ipswich, MA, USA). Amino acid isotopes were from Cambridge Isotope

Laboratories, Inc. (Tewksbury, MA, USA). Agarose for DNA analysis was purchased from Bio-Rad laboratories (Hercules, CA, USA).

Strains and Media

Strains used in this study are listed in Table 2-1. E. coli strains Top10 and

GM2163 were used for routine cloning and preparation of plasmid DNA for transformation into Hfx. volcanii, respectively (143). E. coli strains were grown at 37 C in Luria-Bertani (LB) medium supplemented with ampicillin (0.1 mg·ml-1). Hfx. volcanii strains were grown at 42 C at 200 rpm rotary shaking in ATCC974 medium or glycerol minimal medium (GMM) supplemented with novobiocin (0.1 µg · ml-1), L-Lysine, or L-

Arginine as needed (143). L-Lysine and L-Arginine concentrations in GMM were 0.3 mM unless specified otherwise. Ammonium chloride was used as the nitrogen source in

GMM. Growth was measured by the optical density at 600 nm (OD600).

Generation of Mutant Strains

Plasmids and primers used in this study are listed in Table 2-1. Plasmids were constructed using one step sequence and ligation independent cloning (SLIC) (144).

39

Gene deletions in Hfx. volcanii H26 were created by the strategy shown previously by

Allers et al. (145) and screened for auxotrophy on GMM supplemented with 1.5% (w/v) agar. The lysA (HVO_1098; diaminopimelate decarboxylase EC 4.1.1.20) and argH

(HVO_0048; argininosuccinate lyase EC 4.3.2.1) gene homologs were targeted for markerless deletion on the Hfx. volcanii H26 genome. To confirm the deletions, a

Southern blot (146) was performed by hybridization of genomic DNA to digoxigenin-11- dUTP (Sigma Aldrich, St. Louis, MO, USA) labeled probes. The DNA hybrids were detected by immunoblotting using alkaline phosphatase-conjugated antibody to digoxigenin and CDP-Star (Invitrogen, Thermo Fisher Scientific Waltham, MA, USA).

Growth Assays for Minimal Amino Acid

Auxotrophic strains were tested for the minimum concentration of amino acid required for growth rates similar to the parent strain. Cultures were grown in complex medium (ATCC974) to an OD600 of 0.8. Cells were harvested by centrifugation (4000 x g at 25 °C for 10 min), washed three times in GMM, resuspended in 5 ml GMM. This cell suspension was subcultured into 25 ml GMM supplemented with and without L-

Lysine or L-Arginine (0 to 0.5 mM) to a final OD600 of 0.01. Cultures were incubated with rotary shaking (200 rpm) at 42 °C in 125 ml Erlenmeyer flasks. Samples (0.1 to 1 ml) of culture were removed from 0-61 h for monitoring growth by OD600.

Assay of Cell Survival after Exposure to Sodium Hypochlorite (NaOCl)

Hfx. volcanii H26 cells were grown to late-log phase (OD600 of 0.7) in 25 ml of

GMM in 125 ml Erlenmeyer flasks in a rotary shaker (200 rpm) at 42 °C. Cells were immediately treated with 0, 1.25, 2.5, 4, and 7.5 mM NaOCl (10 µl in dH2O; diluted from

Sigma Aldrich product 425044) at room temperature (RT) with 10 sec of rotary shaking every 5 min for 20 min. Treated-cells were serially diluted in ATCC974 liquid and plated

40

at 10-6 to 10-7 on ATCC974 + agar medium. The colony forming units (CFU) per ml were determined to assess cell survival. Experiments were performed in biological triplicate.

Ellman’s Reagent Assay for Free Sulfhydryl Groups

Hfx. volcanii LM08 was grown to late log phase (OD600 of 0.8) in 50 ml GMM supplemented with 300 µM L-lysine and 300 µM L-arginine in 125 ml Erlenmeyer flasks in a rotary shaker (200 rpm) at 42 °C. The cultures were immediately treated with 0 and

2.5 mM NaOCl in biological triplicate as described for survival assays. After the 20-min treatment, cells were pelleted at 4,000 x g for 45 min at 4 C and resuspended in 1 ml reaction buffer (0.1 sodium phosphate pH 8.0 with 1 mM EDTA). Cells were lysed on ice by sonication (Sonic Dismembrator Model 500, Fisher Scientific) at 30% amplitude for 2 sec on, 2 sec off for 20 sec total, three times over. Cell lysate was clarified by centrifugation at 13,000 x g for 10 min at 4°C and passed through a 0.2 µm surfactant- free cellulose acetate (SFCA) filter (Nalgene, ThermoFisher Scientific). The filtrate was quantified for total protein by the bicinchoninic acid (BCA) assay (Pierce) and assayed for thiol content by Ellman's reagent assay. In brief, the Ellman’s reagent was generated by dissolving 4 mg of 5,5'-dithio-bis-(2-nitrobenzoic acid) (DTNB) (ThermoFisher

Scientific) in 1 ml reaction buffer (0.1 M sodium phosphate, pH 8.0, containing 1 mM

EDTA). Reactions (2.8 ml total volume) were mixtures of 50 μl Ellman’s reagent, 0.25 ml protein (0.97 mg total), and 2.5 ml reaction buffer in borosilicate glass tubes (13 x 100 mm Fisher Scientific, USA). The reactions were vortexed and incubated at RT for 15 min. Sample (250 µl) was transferred in triplicate to a clear polystyrene flat bottom 96- well plate (Fisher Scientific) and absorbance was measured at 412 nm using a Biotek

Synergy HTX Multi-Mode Reader. L-Cysteine hydrochloride monohydrate (Fisher

41

BioReagents, Fisher Scientific) was used as a standard to quantify the sulfhydryl groups.

Isotopic Incorporation

Hfx. volcanii LM08 was streaked with a toothpick from 20% v/v glycerol stocks stored at -80 °C onto a plate of GMM supplemented with 500 µM lysine and 500 µM arginine and grown at 42 °C for 5 days. Isolated colonies were transferred to 25 ml

GMM supplemented with either heavy or light amino acids separately (300 µM each) and allowed to grow for 24 h (about 6.5 doublings) (in a 125 ml Erlenmeyer flask at 42

°C in a rotary shaker at 200 rpm). Cultures were subcultured into 25 ml GMM to a starting OD600 of 0.01 and similarly grown in the same heavy/light medium for 24 h, twice sequentially for a total of three subcultures after 24 h each. The heavy amino acids were L-Lysine+8 (L-Lysine 2HCl, 13C6, 99%; 15N2, 99%; Item No. CNLM-291-H-

PK) and L-Arginine+6 (L-Arginine HCl, 13C6, 99%; Item No. CLM-2265-H-PK)

(Cambridge Isotope Laboratories, Inc.). The light amino acids were L-Lysine and L-

Arginine purchased from Sigma Aldrich (Item No. L8662 and A8094, respectively). The final cultures were harvested at log phase (OD600 0.6) by centrifugation (4000 x g).

Proteins were extracted with TRIzol (ThermoFisher Scientific) as described previously

(147). A preliminary study was done to determine the incorporation rate of heavy lysine

(+8) and heavy arginine (+6) into the proteome. This preliminary untreated sample was left unfractionated and analyzed by LC-MS/MS to monitor isotope incorporation as described below except with a 60 min linear gradient using the Easy-nLC 1200 system coupled to a Q Exactive Plus Hybrid Quadrupole-Orbitrap Mass Spectrometer. Methods of LC-MS/MS and data analysis are described in the mass spectrometry and protein identification section. To determine the extent of lysine (+8) and arginine (+6)

42

incorporation into the proteome, we searched for light lysine and arginine as variable modifications.

SILAC Cultures, Sample Preparation, and Strong Cation Exchange Chromatography

Hfx. volcanii LM08 was grown in GMM in four biological replicates for both the treatment and control groups. For two biological replicates the medium for the control group was supplemented with (heavy) 300 µM L-Lysine+8 and 300 µM L-Arginine+6 and the treatment group medium was supplemented with (light) L-Lysine+0 and L-

Arginine+0. The other two replicates were grown with the labels switched: (heavy) L-

Lysine+8 and L-Arginine+6 for the treatment group and (light) L-Lysine+0 and L-

Arginine+0 for the control. The cultures were grown at 42 C in a rotary shaker (200 rpm) to late log phase (OD600 0.7-0.8), culture volumes were normalized in each centrifuge tube to equivalent total OD units per sample, and cells were harvested by centrifugation (4000 x g). All of the supernatant was carefully removed, and the cell pellets were stored at -80 C. Cell pellets were mixed at a 1:1 ratio, and the proteins were extracted with TRIzol, as described previously (147). Protein pellets were stored at

-20 C. The protein pellets were processed as described previously (148) with a few modifications. Pellets were dissolved in a solubilization buffer (7 M urea, 2 M thiourea,

4% CHAPS) and quantified by EZQ assay kit (149) according to manufacturer instructions (Invitrogen Inc., Eugene, OR, USA). Protein (400 μg) was treated with methyl methanethiosulfonate (MMTS) and digested with 4 μg modified trypsin

(Promega, Madison, WI, USA) at 37 °C for 16 h. Peptides were lyophilized and solubilized in 3% v/v acetonitrile in 0.1% v/v formic acid and desalted on a Macrospin C-

18 reverse phase mini-column (The Nestgroup Inc., Southborough, MA, USA). The

43

column was pre-equilibrated with a mixture of 0.1% v/v formic acid and 99.9% v/v acetonitrile to avoid contamination from previous samples. After sample loading, the column was washed again with 0.1% v/v formic acid and peptides were eluted with 80% v/v acetonitrile and 0.1% v/v formic acid. Eluted peptides were lyophilized and fractionated by strong cation exchange chromatography (SCX) as described previously

(150) with gradient as in (148). In brief, solvent A (25% v/v acetonitrile, 10 mM ammonium formate, and 0.1% v/v formic acid, pH 2.8) was applied for 10 min and a linear gradient of 0–20% solvent B (25% v/v acetonitrile and 500 mM ammonium formate, pH 6.8) was applied over 80 min before applying another 5 min gradient to

100% solvent B and holding for 10 min. Peptide elution was monitored by absorbance at 280 nm and pooled into 14 fractions and lyophilized.

Reverse Phase LC-Mass Spectrometry and Protein Identification

Fractions were resuspended in LC solvent A (0.1% v/v formic acid in 3% v/v acetonitrile) and analyzed one at a time on an Easy-nLC 1200 system coupled to a Q-

Exactive Orbitrap Plus MS (Thermo Fisher Scientific, Bremen, Germany). Peptides were concentrated on an Acclaim Pepmap 100 pre-column (20 mm × 75 μm; 3 μm-C18) and separated on a PepMap RSLC analytical column (250 mm × 75 μm; 2 μm-C18) at a flow rate of 350 nl/min using solvent A (0.1% v/v formic acid) and B (0.1% v/v formic acid and 99.9% v/v acetonitrile) at a gradient of 2–30% solvent B in 100 min, 30–98% solvent B in 10 min before an isocratic flow of 98% solvent B for 10 min. The separated peptides were analyzed on a Q-Exactive Plus MS (Thermo Fisher Scientific, Bremen,

Germany) in positive ion mode and top 10 data dependent scanning with high collision dissociation (HCD) as previously described (148). Briefly, the spray voltage was 1800 V.

The full MS resolution was 70,000 with a scan range of 350–1800 m/z, an AGC target of

44

3e6 and maximum IT of 250 ms. The MS/MS resolution was 17,500 with a scan range of 200–2000 m/z, an AGC target of 5e5, and maximum IT of 50 ms, the normalized collision energy of 27. The underfill ratio was 1%, intensity threshold was 2e5, charge exclusion was unassigned, 1, 7–8, and >8. Proteome Discoverer 2.1 (Thermo

Scientific, Bremen, Germany) was used for protein identification and quantitation using the Hfx. volcanii DS2 database (downloaded from www.Uniprot.org April 2017) with

3,996 entries. Peptides were allowed two missed cleavages by trypsin and a static modification of methylthio on all cysteines. Dynamic modifications were lysine +8, arginine +6, proline +5, methionine oxidation, N-terminal acetylation, and diglycine remnant on lysines. The false discovery rate (FDR) for strict peptide and protein identification was < 1%. Peptide abundances were mean normalized and scaled by

Proteome Discoverer. Peptides identified for each protein were used to find the statistical significance of expression using Welch’s t-test in R (version 3.3.3) to a p- value of < 0.05 (142). Ambiguous peptides and peptides with no or non-unique quantitative information were excluded in the analysis. Tables of the 50 most abundant proteins and the 50 least abundant proteins were constructed using the highest and lowest exponentially modified protein abundance index (emPAI) values, respectively

(151). For the least abundant proteins, the proteins were identified in at least three replicates, and the most abundant proteins were found in all four replicates. The effect of label swapping was tested using Welch’s t-test at p-value < 0.01 using the peptide abundances from the control groups in the 50 most abundant proteins by emPAI value found in all four replicates. Proline conversion was calculated by taking the top three most abundant proteins by emPAI value and counting the number of heavy prolines (+5)

45

out of total proline residues. Protein arCOG information (152) was found in www.uniprot.org (153). Transmembrane domain was determined by Expasy TMpred server (154).

NaOCl Sensitivity Assay

Hfx. volcanii Δsamp1 and H26 were streaked onto GMM agar from -80 °C glycerol stocks and grown for 5 days in a closed plastic zippered bag at 42 °C. Isolated colonies were inoculated into 3 ml GMM in a capped 13 x 100 mm test tube and incubated at 42 °C with rotary shaking (200 rpm). At an OD600 0.9, the cultures were normalized to 1 OD unit · ml -1 and serially diluted in GMM from 10-1 to 10-6. Culture dilutions (20 µl) were spotted serially on GMM agar plates supplemented with 0 and 0.8 mM NaOCl. Plates were placed in a closed plastic zippered bag in a 42 °C incubator and allowed to grow for 5 days.

Materials and Methods for HvPPA Study

Materials

Biochemicals were from Sigma-Aldrich (St. Louis, MO). Other organic and inorganic analytical-grade chemicals were from Fisher Scientific (Atlanta, GA). Phusion and Taq DNA polymerases, restriction endonucleases, and T4 DNA ligase were from

New England BioLabs (Ipswich, MA). Desalted oligonucleotides were from Integrated

DNA Technologies (Coralville, IA). Agarose used for routine analysis of DNA was from

Bio-Rad Laboratories (Hercules, CA).

HvPPA study details were adapted with permission from McMillan LJ, Hepowit NL, Maupin-Furlow JA. 2015. Archaeal inorganic pyrophosphatase displays robust activity under high-salt conditions and in organic solvents. Appl Environ Microbiol 82:538-48. Copyright © 2016, American Society for Microbiology.

46

Strains and Media

The strains used in this study are listed in Table 2-2. E. coli TOP10 was used for routine recombinant DNA analysis. E. coli GM2163 was used for preparation of plasmid

DNA prior to transformation of Hfx. volcanii H26 by standard methods (143). E. coli strains were grown at 37 °C in Luria-Bertani (LB) medium supplemented with ampicillin

(Amp) (0.1 mg · ml1) as needed. Hfx. volcanii strains were grown at 42 °C in ATCC 974 medium supplemented with novobiocin (Nv) (0.1 µg · ml-1) as needed. Cells were grown in liquid cultures with rotary shaking at 200 rpm and on solid medium (1.5% [w/v] agar plates). Growth was monitored by measuring the optical density at 600 nm (OD600),

9 -1 where 1 OD600 unit equals approximately 1 x 10 CFU · ml .

DNA Manipulations

The plasmids and primers used in this study are listed in Table 2-2. Primers 1 and 2 were used for PCR-based amplification of the gene encoding PPA of Hfx. volcanii

(HvPPA) (HVO_0729; UniProt: D4GT97) with strain H26 genomic DNA as the template.

The 0.55-kb PCR product was ligated into the NdeI to BlpI sites of pJAM503 to generate plasmid pJAM2920 for expression of HvPPA with an N-terminal polyhistidine tag (His6-

HvPPA) linked with a thrombin cleavage site. Plasmid DNA was isolated with a QIAprep spin miniprep kit (Qiagen, Valencia, CA). PCRs were according to standard methods using an iCycler (Bio-Rad Laboratories). Genomic DNA was extracted from Hfx. volcanii cells by boiling colonies resuspended in double-distilled water (ddH2O) (155) or by DNA spooling (143). Phusion DNA polymerase was used for high-fidelity PCR-based cloning.

Taq DNA polymerase was used for colony screening. DNA fragments were separated by 0.8 to 2% (w/v) agarose gel electrophoresis (90 V, 30 to 45 min) in TAE buffer (40 mM Tris, 20 mM acetic acid, 1mM EDTA, pH 8.0). Gels were stained with ethidium

47

bromide at 0.25 µg · ml-1 and visualized with a Mini visionary imaging system

(Fotodyne, Hartland, WI). Hi-Lo DNA molecular weight markers (Minnesota Molecular,

Minneapolis, MN) were used for comparison. DNA fragments were isolated directly from

PCR by MinElute PCR purification (Qiagen) or from 0.8% (w/v) SeaKem GTG agarose

(FMC Bioproducts, Rockland, ME) gels in TAE buffer at pH 8.0 using the QIAquick gel extraction kit (Qiagen) as needed. The fidelity of DNA plasmid constructs was verified by Sanger DNA sequencing (UF ICBR DNA sequencing core).

Purification of HvPPA

HvPPA was expressed with an N-terminal polyhistidine (His6) tag in Hfx. volcanii

H26- pJAM2920 (Table 2-5). Hfx. volcanii cells were grown to stationary phase (OD600 of 3 to 3.5) (4 1-liter cultures in 2.8-liter Fernbach flasks) and harvested by centrifugation (10 to 15 min at 9,200 x g and 25°C). Cell pellets were resuspended at 5 ml per 1 g (wet weight) cells in Tris-salt buffer (20 mM Tris-HCl [pH 7.5], 2 M NaCl, and

2.5 mM MgCl2) supplemented with 40 mM imidazole and 1 minitablet protease inhibitor cocktail (Roche product no. 05892791001) per 10 ml buffer. Cells were lysed by passage through a French pressure cell (three times at 20,000 lb/in2). Whole-cell lysate was clarified by centrifugation (twice for 30 min at 9,200 x g and 4°C) and sequential filtration using 0.8-µm and 0.2- µm cellulose acetate filters (Thermo Scientific Nalgene).

Clarified cell lysate was applied to a HisTrap HP column (5 ml) (17-5248-01; GE

Healthcare) preequilibrated and washed in 100 ml of Tris-salt buffer with 40 mM imidazole. Fractions containing HvPPA were eluted in Tris-salt buffer with a 25-ml gradient from 40 mM to 500 mM imidazole. Fractions were tested for activity, dialyzed overnight with a buffer change after 4 h against Tris-salt buffer containing 2.5 mM MgCl2 and 1 mM dithiothreitol (DTT), and concentrated by centrifugal filtration using an Amicon

48

Ultra-x ml 10K device (EMD Millipore). HvPPA was further purified by size exclusion chromatography (SEC) in which protein (500 µl at 14.5 mg · ml-1) was applied at a flow rate of 0.3 ml · min-1 to a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in Tris-salt buffer supplemented with fresh 1 mM DTT. HvPPA fractions eluting at 14.8 ml (hexamer) and 15.9 ml (trimer) were further purified using a similar SEC strategy.

The purity of HvPPA was assessed with Coomassie blue-stained SDS-polyacrylamide gels and PPi activity assay. Molecular mass standards used for analytic SEC were blue dextran (for void volume), β-amylase (200 kDa), cytochrome c (12.4 kDa), bovine serum albumin (BSA) ( 66 kDa), and alcohol dehydrogenase (150 kDa) (Sigma-Aldrich, no. MWGF200-1KT). HvPPA fractions were pooled and stored at 4 °C.

PPi Assay

HvPPA-mediated hydrolysis of inorganic pyrophosphate (PPi) to orthophosphate was determined spectrophotometrically. Reagents were in nanopure water

(Barnstead/Thermolyne Nanopure lab water system). Sodium pyrophosphate tetrabasic decahydrate (Sigma-Aldrich) was used as the substrate. For kinetic measurements, reaction mixtures (500 µl total) contained 0.5 to 1 µg HvPPA and 1 mM PPi in high salt buffer (3 M NaCl and 20 mM Tris-HCl, pH 8.5). Reaction mixtures were incubated at

42°C for 1 to 3 min. Orthophosphate levels were determined by malachite green assay as previously described (156) with modification. Briefly, 2.5 ml of 14% (w/v) (NH4)2MoO4 and 0.2 ml of 11% (v/v) Tween 20 were added to 10-ml of color reagent (containing 1.67 ml concentrated sulfuric acid, 8.33 ml nanopure H2O, and 12.22 mg malachite green). In triplicate, 50 µl of the color reagent was mixed with 200 µl of the reaction mixture and

+ allowed to react at room temperature for 10 min. The formation of (MG )(H2PMo12O40)

+ (where MG represents ionized malachite green) was monitored by A630. A less

49

sensitive malachite green assay was also used as previously described (157), in which reaction aliquots (50 µl) were mixed with 250 µl Itaya color reagent [1 volume of 4.2%

(w/v) (NH4)2MoO4 in 5 N HCl was mixed with 3 volumes of 0.2% (w/v) malachite green, and after 30 min the solution was filtered with a 0.45-µm filter and stored at room temperature] and 10 µl 1.5% (v/v) Tween 20 in triplicate. The assay was immediately monitored at A650. Freeze-dried KH2PO4 was used as the standard. Assay mixtures with

PPi minus HvPPA were used for individual background subtraction. All proteins used in this assay were buffer exchanged with Tris– high-salt buffer in nanopure H2O prior to use. All experiments were performed in triplicate, and the mean standard deviation (SD)

2+ was calculated. Hill coefficients were calculated for Mg and PPi using the Enzyme

Kinetics Module of SigmaPlot, version 13.0.

Coupled Assay of Ubiquitin-Like Protein Adenylation

UbaA-mediated hydrolysis of ATP to AMP and PPi in the presence of the ubiquitin-like SAMP1 was monitored by coupled assay with HvPPA. Proteins were buffer exchanged with HEPES-salt buffer in nanopure H2O prior to use. Reaction mixtures (500 µl total) containing 20 µM UbaA, 20 µM SAMP1, 0.5 µM HvPPA, 2.5 mM nucleotide, 2.5 mM MgCl2, and 50 µM ZnCl2 in high-salt buffer (2 M NaCl and 50 mM

HEPES in nanopure H2O, pH 7.5) were incubated at 42°C for 1 h. Nucleotides were

ATP, AMP, ADP, AMPPNP, CTP, GTP, TTP, and UTP. Proteins were removed by

Ultracel-3 centrifugal filtration prior to determining orthophosphate levels by malachite green assay (156) modified as described above. Assay mixtures with nucleotide alone were used for individual background subtraction.

50

Protein Concentration Assay

The molar protein concentration was calculated using absorption at 280 nm and an extinction coefficient of 26,025M1 · cm-1 (with the assumption that all cysteines were cystines). These values were comparable to protein concentrations determined by the

Bradford method (158) using BSA (Thermo Scientific) as the standard.

Protein Lyophilization

HvPPA protein (40 µl at 1.5 mg/ml in buffer made with nanopure water containing

20 mM Tris-HCl [pH 7.5], 2 M NaCl, 2.5 mM MgCl2, and 1 mM DTT) was frozen at 80 °C for 20 min in a 1.5 ml Eppendorf tube and lyophilized over a 4 h period using a VirTis 2K

BenchTop XL freeze dryer. The sample was stored at room temperature and rehydrated with 40 µl nanopure H2O prior to assay.

SDS-PAGE and Immunoblotting

Proteins were separated by reducing SDS-PAGE according to the Laemmli system (59). His-tagged HvPPA was analyzed by immunoblotting using a monoclonal unconjugated anti- His IgG2 antibody from mouse (27-4710-01; GE Healthcare) and alkaline phosphatase-linked goat anti-mouse IgG antibody (A5153; Sigma-Aldrich).

Immunoreactive antigens were detected by chemiluminescence using CDP-Star

(Applied Biosystems) as the alkaline phosphatase substrate and X-ray film (Research

Products Intl. Corp.).

Dendrogram Analysis

Evolutionary analyses were conducted in MEGA6 (159). The evolutionary history of archaeal PPAs was inferred using the neighbor-joining method (160). The evolutionary distances were computed using the p-distance method (161) and were in units of number of amino acid differences per site. The analysis involved 225 amino

51

acid sequences. All ambiguous positions were removed for each sequence pair. A total of 263 positions were in the final data set.

52

Table 2-1. Strains and plasmids used in SILAC study Strain, plasmid, Source or Description or primer reference E. coli strains − − + TOP10 F recA1 endA1 hsdR17(rK mK ) supE44 thi-1gyrA relA1 Invitrogen GM2163 F– ara - 14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 New England mcrA dcm-6 hisG4 rfbD1 rpsL136 dam13::Tn9 xylA5 mtl-1 Biolabs thi-1 mcrB1 hsdR2 H. volcanii strains DS70 wild-type isolate DS2 cured of plasmid pHV2 (2) H26 DS70 ΔpyrE2 (1) LM06 H26 ΔlysA (hvo_1098) This study LM07 H26 ΔargH (hvo_0048) This study LM08 H26 ΔlysA ΔargH This study HM1041 H26 Δsamp1 (hvo_2619) (35) Plasmids r pTA131 Ap ; pBluescript II containing Pfdx-pyrE2 (1) pJAM2912 Apr ; pTA131 based plasmid containing pre-deletion This study sequence for lysA pJAM2914 Apr ; pTA131 based plasmid for ΔlysA This study pJAM2916 Apr ; pTA131 based plasmid containing pre-deletion This study sequence for argH pJAM2917 Apr ; pTA131 based plasmid for ΔargH This study r r pJAM202c Ap Nv ; Hfx. volcanii‐E. coli shuttle P2rrn expression (162) vector, empty vector pJAM2918 LysA complement This study pJAM2919 ArgH complement This study Primers LysA 500 up SLIC 5’ aggaattcgatatcaCCGCTATCACGACGTGCTCC 3’a This study LysA 500 dwn SLIC 5’ cggtatcgataagctTCCGGGAACACCGACGCGT 3’ a This study LysA inverse up 5’ TCACTCGCGCAGCGCCTCCTCC 3’ This study LysA inverse dwn 5’ CCAAGCACCCACACAGAATCATGAGCGTACTCAA 5’ This study LysA 700 up 5’ AGAAGACCGGCTCCGACGTGACCT 3’ This study LysA 700 dwn 5’ ACTGCGTCTCGCCCTCGACG 3’ This study LysAcompSLICfwd 5’ ctttaagaaggagatatacaATGAGCGGCGGCGGGC 3’ a This study LysAcompSLICrev 5’ tatgctagttattgctcataTCAGTTGGGGATGTGCTCGG3’ a This study ArgH 500 up SLIC 5’ aggaattcgatatcaAACTCATCTCGTTCCTCAA 3’a This study ArgH 500 dwn SLIC 5’ cggtatcgataagctAGTCCAACGTGCAATTTA 3’ a This study ArgH inverse up 5’ CTTACTCGTCGCTACCGC 3’ This study ArgH inverse dwn 5’ GTCCGAACGCGAGACGCC 5’ This study ArgH 700 up 5’ TGGTCCATCGACACGAACCTCTG 3’ This study ArgH 700 dwn 5’ AAGCGCGTGATGTAGATGCTCCTGC 3’ This study ArgHcompSLICfwd 5’ ctttaagaaggagatatacaATGGCAGGCGAGGACGGC This study GACT 3’ a ArgHcompSLICrev 5’ tatgctagttattgctcataTCAGACATAGCTCGAAACCTC This study CTCGTCGAG 3’ a a SLIC overhangs to vector are in lowercase. Apr, ampicillin resistance; Nvr, novobiocin resistance

53

Table 2-2. Strains, plasmids, and primers used in HvPPA study Strain, plasmid Description Source or or primer reference – – + E. coli TOP10 F recA1 endA1 hsdR17(rK mK ) supE44 thi-1 gyrA relA1 Invitrogen E. coli GM2163 F– ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 New England hisG4 rfbD1 rpsL136 dam13::Tn9 xylA5 mtl-1 thi-1 mcrB1 hsdR2 Biolabs Hfx. volcanii DS70 wild-type isolate DS2 cured of plasmid pHV2 (2) Hfx. volcanii H26 DS70 ΔpyrE2 (1) Plasmid pJAM503 Apr; Nvr; Hfx. volcanii-E. coli shuttle vector with coding sequence for (162) N-terminal His6 tag r r Plasmid Ap ; Nv ; pJAM503-derived, His6-HvPPA This study pJAM2920 Primer 1: PPA 5’- tacatatgGTGAACCTCTGGGAAGATATGGAG-3’ This study NdeI FW Primer 2: PPA BlpI 5’- tagctcagctcgcTTACGCGAAGTTCTCTTCGTAG-3’ This study RV Apr, ampicillin resistance; Nvr, novobiocin resistance. Underlining and lowercase in the primer sequences indicate restriction sites and linkers/overhangs, respectively.

54

CHAPTER 3 DEVELOPMENT OF A MULTIPLEX SILAC-BASED APPROACH FOR QUANTIATIVE ANALYSIS OF A MODEL ARCAHAEAL PROTEOME UNDER DIFFERENT GROWTH CONDITIONS

Introduction for SILAC Study

Quantitative proteomics is a valuable tool for researchers to investigate protein abundance in cells under different growth conditions. Two main types of quantitative proteomic methods are used in current studies: label and label-free (163). Labeling methods allow for the direct quantification of proteins and reduce bias between samples by enabling multiplexing. By contrast, label-free methods for protein quantification avoid the expense of labeling but do not allow for multiplexing (83, 163). Proteomic studies that use stable isotope labeling in cell culture (SILAC) yield robust quantitative comparisons and allow for multiplexing (83). SILAC relies upon the incorporation into the proteome of labeled (heavy) amino acids containing isotopes such as 13C, 15N, 2H, and 18O (83, 88). SILAC is best performed when the labeled amino acids are essential for growth as seen for study of bacteria and eukaryotes (88). Externally added heavy amino acids, if essential, are fully incorporated into the proteome after several cell doublings.

Archaea provide ideal models to understand how a cellular proteome may withstand harsh environmental conditions and stress, as many microbes from this domain of life are extremophiles that thrive in hydrothermal vents, acidic hots springs, hypersaline bodies of water, or other extreme conditions (164-166). Archaeal proteomes have been analyzed quantitatively by use of isobaric tags for relative and absolute quantitation (iTRAQ), isotope-coded protein label (ICPL), and label-free methods (102,

112, 166-169). However, archaeal proteomes have yet to be analyzed by the preferred

55

method of SILAC, most likely due to the strain construction required to generate targeted amino acid auxotrophs.

Here, the generation of a SILAC-compatible strain of Haloferax volcanii was used to investigate differential protein expression under oxidative stress conditions in this archaeon, originally isolated from the Dead Sea. Stress-based studies are of particular interest within the domain of Archaea (29, 166, 170, 171), due to the extreme environments these microbes populate (104). Our findings provide insight into cellular responses to oxidative stress and are the first report of SILAC to analyze an archaeal proteome.

Results for SILAC Study

Generation of a SILAC Compatible Double Auxotroph for Lysine and Arginine

Hfx. volcanii H26, a pHV2- ΔpyrE2 derivative of DS2 (172), can biosynthesize all

20 standard amino acids when cultured in minimal medium and, thus, is not compatible for study by SILAC. To overcome this limitation, the pathways of lysine and arginine biosynthesis were targeted for deletion. The rationale for generating this mutant strain was that the proteins analyzed by LC-MS/MS would first be enzymatically digested into peptides using trypsin, a serine protease which cuts carboxyl to lysine and arginine residues. Thus, growth of the Hfx. volcanii double auxotroph for lysine and arginine in medium supplemented with heavy lysine and arginine would theoretically label each tryptic peptide and allow for identification and quantification of proteins by a multiplexed

SILAC approach.

To predict the best gene candidates for generating a Hfx. volcanii double auxotroph for lysine and arginine, we relied on the Kyoto Encyclopedia of Genes and

56

Genomes (KEGG) pathway predictions. The lysA (diaminopimelate decarboxylase EC

4.1.1.20) (HVO_1098) gene homolog was targeted for deletion based on its putative function in synthesis of L-Lysine and CO2 from meso-2,6-diaminoheptanedioate.

Likewise, the argH (argininosuccinate lyase EC 4.3.2.1) (HVO_0048) gene homolog was selected for deletion based on its predicted catalysis of the last step of arginine biosynthesis: the production of L-Arginine and fumarate from L-Arginino-succinate.

Using a markerless deletion strategy, the lysA and argH gene homologs were deleted from the Hfx. volcanii genome, and the mutations were found to confer amino acid auxotrophy. The H26 ΔlysA mutant (LM06) was unable to grow on solid and liquid minimal medium (GMM) unless supplemented with 1 mM L-Lysine. The lysine auxotrophy of LM06 was relieved when the lysA homolog was ectopically expressed, compared to the empty vector control (Figure 3-1A). Similarly, the H26 ΔargH mutant

(LM07) was unable to grow on solid and liquid GMM unless supplemented with 1 mM L-

Arginine and was restored in growth to parental (‘wild-type’) levels when the argH gene homolog was ectopically expressed (Figure 3-1B). The double deletion strain LM08

(H26 ΔargH ΔlysA) was found auxotrophic for both lysine and arginine, and a concentration of 300 µM of both amino acids was sufficient to restore growth of this mutant strain to wild-type levels (Figure 3-2A).

Sodium Hypochlorite Causes Oxidative Stress in Hfx. volcanii

To test the SILAC-ready strain, protein expression was investigated under conditions of oxidative stress. Reactive oxygen species (ROS) cause damage to all biomolecules when intracellular levels exceed the antioxidant and reducing capabilities of the cell (42, 173). Sodium hypochlorite (NaOCl) in solution forms hypochlorous acid

(HOCl), a potent oxidant that disrupts protein structure and causes irreversible protein

57

aggregation, leading to a loss of function (174, 175). In the mammalian host defense system, phagocytic cells produce oxidants like HOCl to kill invading microbial pathogens by means of protein damage (176, 177). Damage by HOCl is not limited to proteins, in

E. coli the cell wall becomes more permeable, allowing the oxidant to get into the cell

(178). Nucleotides also interact with HOCl causing disruption of purine and pyrimidine rings (179). To generate oxidative stress, NaOCl was added to cell cultures at late log- phase to compare differential expression of Hfx. volcanii proteins between standard laboratory and oxidative stress conditions.

The survival rate and protein oxidation state of Hfx. volcanii LM08 cells were found to be impacted by treatment with NaOCl. LM08 was observed to have a survival rate of 63% when treated with 2.5 mM NaOCl for 20 min and plated on GMM agar, but did not recover when the concentration of NaOCl was increased to 7.5 mM (Figure 3-

2B). In GMM liquid cultures, LM08 cells were sensitive, but recovered, from treatment with 2 mM NaOCl (Figure 3-2C). By contrast, LM08 did not fully recover when treated with 5 mM NaOCl and appeared non-viable at 8-11 mM NaOCl (Figure 3-2C), consistent with what was observed by plate assay (Figure 3-2B). In an oxidized proteome, cysteine residues form promiscuous disulfide bonds and can be detected by

Ellman’s reagent/DTNB assay. The DTNB assay revealed a 20-min treatment of 2.5 mM NaOCl reduced the number of free sulfhydryl groups by 63.2% when compared to the control (Figure 3-2D).

Two Subcultures Sufficient for Full Isotopic Incorporation

In order to achieve full isotopic incorporation of the SILAC amino acids, LM08 cells were subcultured twice and allowed to grow for 6.5 doublings in the labeled medium before proteins were analyzed by LC-MS/MS. Out of 3,094 peptide groups

58

identified, 100% had full incorporation of lysine (+8) and arginine (+6). In eukaryotes,

13 13 [ C6] arginine becomes [ C5] proline through the arginase pathway (180-182). Hfx. volcanii has a predicted arginase homolog (EC:3.5.3.1) HVO_1575 (rocF) so proline conversion was monitored. Conversion of heavy proline (+5) from arginine occurred

34.3 ± 5.3% of the time from peptides in the top three most abundant proteins (Table 3-

1). While this conversion could cause problems in studies where multiple isotopic forms of arginine are used (87, 181, 182), conversion was not an issue in this study which relied upon the use of one form of heavy arginine coupled with light arginine.

SILAC as an Effective Method to Quantitatively Measure Protein Expression under Different Conditions in Archaea

Using the SILAC method, 2,565 out of 3,996 predicted proteins were identified across all four replicates, and 1,806 proteins were identified in all four replicates at a

FDR of < 1% (Figure 3-3A, Table A-1). The 50 most abundant proteins found in all four replicates, irrespective of condition (Table 3-2) contained 17 proteins with a predicted transmembrane domain. With arCOG analysis, 14 were involved in translation and ribosomal structure, 9 in amino acid transport and metabolism, and 8 in energy production and conversion. Only 6 out of 50 most abundant proteins are either unannotated or have unknown function by arCOG. In the 50 least abundant proteins

(Table 3-3), 27 proteins are unannotated and 5 have unknown function by arCOG. The highest represented arCOG group contains 5 proteins involved in carbohydrate transport and metabolism, 3 proteins signal transduction, and 3 in amino acid transport and metabolism. Nearly half of the least abundant proteins have predicted transmembrane domains (48%). Studies with human cell lines have shown that proteins involved in translation are some of the highest expressed proteins (183), and

59

transmembrane domain proteins are underrepresented in proteomics studies (184). Our findings show the most abundant proteins in Archaea, similarly to human cells, are proteins involved in translation. Using the 50 most and 50 least abundant proteins together to represent the proteome, 41% of the proteins identified contained predicted transmembrane domains, suggesting coverage of transmembrane domain containing proteins was good. In comparison to the Hfx. volcanii proteome, around 23% of the proteins contain predicted transmembrane domains (102). To determine tryptic digest, peptides from the top 3 most abundant proteins by emPAI value were used to count missed cleavages out of total theoretical cleavages. The trypsin digest had 48.6% mean efficiency and a standard deviation of 8.9%.

We used a label-swap replication of SILAC experiments to correct for experimental errors that may occur. Replicates 1 and 3 of the control group had light lysine and arginine added to the growth medium and in replicates 2 and 4 the control group was labeled with heavy lysine (+8) and heavy arginine (+6) (with the treatment group replicates inversely correlated). When comparing the control peptide abundance values for the 50 most abundant proteins by emPAI value, only one protein, a putative phosphoserine phosphatase (HVO_0880, UniProt D4GUU7) was found to be expressed at a statistically significant (p-value > 0.01) at a fold change of 0.93 (light/heavy) (Table

3-4). HVO_0880 is expressed unlabeled at 92.9% ± SD 5.9% when compared to abundances of the same peptides with lysine (+8) and arginine (+6) labeling. Due to the small fold change difference of only one protein due to the label swap, SILAC labeling likely had little effect on protein expression in Hfx. volcanii.

60

Proteomic Changes Caused By Oxidative Stress

Significant changes in the Hfx. volcanii proteome were observed when cells were treated with sub-lethal doses of NaOCl. Proteins were extracted after only 20 min of treatment in order to capture the very first responders to oxidative damage. In response to NaOCl stress, 565 proteins were significantly differentially expressed at a p-value of <

0.05 (Figure 3-3B, Table A-2). Increased proteins were primarily involved in transcription and translation in response to NaOCl (Table 3-5). The small archaeal ubiquitin-like modifier protein SAMP1 (HVO_2619) was increased1.8-fold. Based on this finding, the deletion strain of SAMP1 was analyzed and found to be more sensitive to

NaOCl stress than the parent strain H26 (Figure 3-4). SAMP1 might play a role in detoxifying the cell by marking oxidized proteins for degradation by the proteasome and has been found to modify proteins involved in oxidative stress (36). A putative Fe-S containing oxidoreductase (HVO_0215) was upregulated 4-fold, an indicator Fe-S cluster sensing of oxidative stress is a frontline defense. Oxidants can also damage

DNA, and the 2.6 fold upregulation of a RecJ domain protein (HVO_0073) and nearly 2- fold upregulation of universal stress protein UspA (HVO_0428) suggests DNA repair is an urgent matter. In order to survive exposure to DNA damaging agents in E. coli, UspA is required (185). Proteins (Table 3-6) such as iron and other inorganic metal transporters were decreased 1.5- to 2-fold, suggesting the cell may decrease the amount of intracellular iron to reduce Fenton chemistry and the exacerbation of oxidative damage through regulation of its transport machinery. 52.6% of the significantly downregulated and 47% of the upregulated proteins with a fold change larger than 1.5 fold have no predicted functions from arCOG analysis, so future work is needed to find the roles of these important first responders of oxidative stress.

61

Conclusions for SILAC Study

Here we successfully implemented the first archaeal SILAC-ready strain to study differential protein expression under oxidative stress conditions in Hfx volcanii. We created lysine and arginine auxotrophs to allow for full isotopic incorporation and maximum quantitative coverage after trypsin digestion. In Hfx. volcanii, both lysA and argH have not yet been reported to be essential in lysine and arginine biosynthesis, respectively. We identified 2,565 proteins, covering 64% of the theoretical proteome of

Hfx. volcanii. While arginine to proline conversion is detected in the Hfx. volcanii LM08 strain at a rate of 34%, quantitative problems can be avoided by use of only one form of heavy arginine and may be overcome by deletion of the predicted arginase homolog

(EC:3.5.3.1) HVO_1575 (rocF). We find the SILAC studies with Hfx. volcanii require only small amounts of cell material for whole-cell proteome studies, thus, minimizing costs. The SILAC method captured over half of the proteome, while maintaining coverage of membrane proteins, using 2 mg total protein (250 µg per replicate per experimental state). This method allows for conservative use of reagents, due to the small amount of protein needed, and 100% labeling proficiency. The development of this strain now allows for multiplexed quantitative proteomic analysis with accurate relative expression values in archaea.

62

Table 3-1. Heavy proline conversion from arginine Standard Heavy Total Ratio Average Replicate Deviation Prolines Prolines (heavy/ total) (ratio) (ratio) 1 2640 6580 0.4012 0.3427 0.0529 2 1169 3128 0.3737

3 1211 4131 0.2931

4 1005 3316 0.3030 Heavy and light prolines enumerated from peptides of the 3 most abundant proteins by emPAI score in all four replicates.

63

Table 3-2. Fifty most abundant proteins in the SILAC study Trans- Mean Mean mem- Coverage emPAI Unique brane Length Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix (aa) D4GZY6 HVO_RS06435, elongation Translation, ribosomal 94.30 2.3E+14 32.5 - 421 HVO_0359 factor 1-alpha structure and biogenesis D4GXX8 HVO_RS18925, nonhistone Replication, 71.87 8.4E+13 10.8 - 104 HVO_2941 chromosomal recombination and protein repair D4GWB2 HVO_RS10220, 30S ribosomal Translation, ribosomal 67.90 3.3E+12 14.5 - 155 HVO_1148 protein S15 structure and biogenesis D4GST5 HVO_RS13475, 30S ribosomal Translation, ribosomal 74.44 5.8E+09 8.75 - 133 HVO_1827 protein S6e structure and biogenesis D4GYF3 HVO_RS11975, acetolactate Amino acid transport 87.04 7.3E+08 22.5 - 218 HVO_1507 synthase small and metabolism subunit D4GW49 HVO_RS17860, ribonuclease J Translation, ribosomal 68.89 3.0E+07 28.0 - 450 HVO_2724 structure and biogenesis D4GXF1 HVO_RS10985, 2-ketoglutarate Energy production and 60.14 1.4E+07 23.8 Y 631 HVO_1305 ferredoxin conversion oxidoreductase subunit alpha D4GUU7 HVO_RS08920, phosphoserine Amino acid transport 76.38 1.1E+09 36.8 - 307 HVO_0880 phosphatase and metabolism D4GYD4 HVO_RS11885, mandelate Cell 51.82 7.4E+06 16.5 - 412 HVO_1488 racemase wall/membrane/envelo pe biogenesis D4GTZ6 HVO_RS17080, 50S ribosomal Translation, ribosomal 74.56 1.6E+07 18.0 - 338 HVO_2564 protein L3 structure and biogenesis D4GZY7 HVO_RS06440, 30S ribosomal Translation, ribosomal 78.19 4.7E+06 8.25 - 102 HVO_0360 protein S10 structure and biogenesis

64

Table 3-2. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Length Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix (aa) D4GU28 HVO_RS14380, hypothetical Cell cycle control, cell 53.91 1.9E+06 15.5 Y 345 HVO_2015 protein division, chromosome partitioning D4GYI5 HVO_RS12100, glycerol kinase Energy production and 62.50 2.4E+07 33.0 Y 510 HVO_1541 conversion P43386 HVO_RS05870, glutamine Amino acid transport 68.86 1.0E+06 28.5 - 456 HVO_0239 synthetase and metabolism D4GTY4 HVO_RS17020, 30S ribosomal Translation, ribosomal 57.79 8.9E+05 14.8 - 247 HVO_2552 protein S4e structure and biogenesis D4GTB7 HVO_RS08265, nucleotide Function unknown 45.10 1.6E+07 28.5 - 449 HVO_0743 pyrophosphata se D4GXE9 HVO_RS10980, 2-ketoglutarate Energy production and 75.32 2.9E+06 16.5 - 312 HVO_1304 ferredoxin conversion oxidoreductase subunit beta D4GY92 HVO_RS19205, O- Amino acid transport 47.22 5.4E+05 11.5 Y 431 HVO_2997 acetylhomoseri and metabolism ne aminocarboxyp ropyltransferas e D4GUV4 HVO_RS08950, 2-oxoacid Energy production and 71.95 2.2E+06 16.5 Y 287 HVO_0887 ferredoxin conversion oxidoreductase subunit beta D4GUZ3 HVO_RS09080, glyoxalase Amino acid transport 64.00 1.4E+05 14.5 - 259 HVO_0914 and metabolism D4GYF2 HVO_RS11970, ketol-acid Amino acid transport 75.22 8.5E+05 18.0 - 348 HVO_1506 reductoisomera and metabolism se D4GX17 HVO_RS18220, hypothetical Function unknown 79.48 2.5E+07 7.00 - 106 HVO_2796 protein

65

Table 3-2. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Length Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix (aa) D4GT97 HVO_RS08200, inorganic Energy production and 43.79 4.0E+06 10.0 - 177 HVO_0729 pyrophosphata conversion se D4GZY3 HVO_RS06420, elongation Translation, ribosomal 90.89 8.2E+06 58.0 - 727 HVO_0356 factor EF-2 structure and biogenesis D4GXX3 HVO_RS11455, BMP family Function unknown 59.35 3.5E+05 14.3 Y 377 HVO_1401 ABC transporter substrate- binding protein D4GYM0 HVO_RS04825, sulfurtransferas Inorganic ion transport 61.45 2.0E+07 12.0 - 286 HVO_0025 e and metabolism D4GZV8 HVO_RS06285, branched chain Amino acid transport 78.37 1.8E+06 28.5 - 312 HVO_0329 amino acid and metabolism aminotransfera se D4GSR4 HVO_RS07845, 50S ribosomal Translation, ribosomal 56.18 7.5E+07 7.50 - 89 HVO_0654 protein L37 structure and biogenesis D4GS21 HVO_RS07030, type I Carbohydrate 81.07 1.8E+06 23.0 - 350 HVO_0481 glyceraldehyde transport and -3-phosphate metabolism dehydrogenase D4GVT8 HVO_RS15380, peptidyl-prolyl Post-translational 89.83 3.7E+06 6.75 - 172 HVO_2222 cis-trans modification, protein isomerase turnover, and chaperones D4GXG2 HVO_RS18540, serine Amino acid transport 79.04 1.6E+06 21.5 Y 415 HVO_2862 hydroxymethylt and metabolism ransferase D4GTC9 HVO_RS13795, 30S ribosomal Translation, ribosomal 74.50 3.5E+06 7.75 - 101 HVO_1896 protein S24e structure and biogenesis

66

Table 3-2. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Length Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix (aa) D4GP73 HVO_RS00340, IMP - 49.86 2.6E+06 14.5 Y 349 HVO_B0071 dehydrogenase D4GW83 HVO_RS10140, adenylosuccina Nucleotide transport 55.36 2.2E+05 31.5 Y 443 HVO_1132 te synthase and metabolism D4GWA5 HVO_RS10205, 30S ribosomal Translation, ribosomal 75.34 3.2E+05 18.8 - 220 HVO_1145 protein S3ae structure and biogenesis D4GWZ3 HVO_RS18155, 30S ribosomal Translation, ribosomal 82.29 8.8E+04 16.8 - 175 HVO_2783 protein S4 structure and biogenesis D4GPJ9 HVO_RS00975, iron ABC - 66.14 1.5E+06 16.8 Y 398 HVO_B0198 transporter substrate- binding protein D4GXP3 HVO_RS18725, BolA family Signal transduction 93.10 1.4E+07 3.50 - 87 HVO_2899 transcriptional mechanisms regulator D4GYR5 HVO_RS05035, hypothetical Post-translational 50.40 8.5E+05 4.75 Y 125 HVO_0070 protein modification, protein turnover, and chaperones D4GQN4 HVO_RS02755, CRISPR- - 79.41 1.0E+06 19.5 - 272 HVO_A0205 associated protein Cas6 D4GUL6 HVO_RS08870, glutamate Amino acid transport 67.64 2.4E+05 91.0 Y 1151 HVO_0869 synthase and metabolism subunit alpha D4GTX4 HVO_RS16970, 50S ribosomal Translation, ribosomal 53.94 8.5E+04 9.75 - 165 HVO_2542 protein L15 structure and biogenesis

67

Table 3-2. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Length Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix (aa) D4GT33 HVO_RS16520, ribonucleoside- Nucleotide transport 55.08 2.5E+05 52.0 Y 1033 HVO_2452 diphosphate and metabolism reductase, adenosylcobalam in-dependent D4GV67 HVO_RS09295, oxidoreductase Energy production 76.78 5.3E+05 18.3 - 281 HVO_0960 and conversion D4GU92 HVO_RS17200, isocitrate Energy production 56.03 6.3E+05 23.5 Y 419 HVO_2588 dehydrogenase and conversion (NADP(+)) D4GX92 HVO_RS10820, IMP Nucleotide transport 67.37 3.8E+07 25.0 Y 498 HVO_1273 dehydrogenase and metabolism D4GZX5 HVO_RS06380, DNA-directed Transcription 60.71 1.2E+05 35.5 - 609 HVO_0348 RNA polymerase subunit B D4GV86 HVO_RS15050, membrane Secondary 63.96 3.4E+06 19.0 Y 385 HVO_2153 protein metabolites biosynthesis, transport, and catabolism D4GUV5 HVO_RS08955, oxoglutarate-- Energy production 52.30 1.8E+05 29.5 Y 586 HVO_0888 ferredoxin and conversion oxidoreductase D4GWM1 HVO_R16125, 30S ribosomal Translation, 70.20 4.6E+07 7.75 - 125 HVO_2373 protein S8e ribosomal structure and biogenesis Most abundant proteins by emPAI score found in all 4 SILAC replicates. Y, transmembrane helix predicted, -, no predicted transmembrane helix or arCOG function.

68

Table 3-3. Fifty least abundant proteins in the SILAC study Trans- Mean Mean mem- Coverage emPAI Unique brane Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix Length D4H0C4 HVO_RS19425, hypothetical protein - 2.51 0.04 1.3 - 1304 HVO_C0036 D4GUN6 HVO_RS14740, beta-glucosidase Carbohydrate transport 3.89 0.07 1.0 Y 745 HVO_2088 and metabolism D4H0C3 HVO_RS19420, transfer complex - 3.22 0.08 1.0 Y 231 HVO_C0035 protein D4GWI8 HVO_RS15960, two-component Signal transduction 2.15 0.11 1.0 Y 606 HVO_2339 system sensor mechanisms histidine kinase D4GRI3 HVO_RS04170, phenylacetyl-CoA - 2.45 0.12 1.0 Y 448 HVO_A0521 ligase D4GXV6 HVO_RS11400, hypothetical protein Function unknown 5.18 0.12 1.3 - 328 HVO_1390 D4GUN8 HVO_RS14755, aspartate Amino acid transport 4.91 0.12 1.0 - 441 HVO_2091 aminotransferase and metabolism family protein D4GPP5 HVO_RS01200, aldehyde ferredoxin - 3.37 0.12 1.3 Y 586 HVO_B0244 oxidoreductase D4GPE2 HVO_RS00685, PQQ repeat protein - 2.39 0.13 1.0 Y 418 HVO_B0141 D4GRP2 HVO_RS04455, 2-methylcitrate - 6.27 0.13 1.3 Y 457 HVO_A0582 dehydratase D4GPW6 HVO_RS01530, transcriptional - 5.30 0.14 1.0 - 264 HVO_B0319 regulator D4GQR9 HVO_RS02920, IS5 family - 2.54 0.14 1.0 - 276 HVO_A0240 transposase ISHvo3 D4GZ25 HVO_RS12375, hypothetical protein Replication, 4.27 0.14 1.3 - 500 HVO_1596 recombination and repair D4GVA5 HVO_RS15150, hypothetical protein - 3.21 0.14 1.5 Y 727 HVO_2172

69

Table 3-3. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix Length D4GSL6 HVO_RS07685, secretion system Post-translational 5.71 0.15 2.3 Y 788 HVO_0620 protein modification, protein turnover, and chaperones; Replication, recombination and repair D4GW91 HVO_RS10165, metal transporter Inorganic ion transport 2.42 0.15 1.0 Y 552 HVO_1137 and metabolism D4GP15 HVO_RS00060, glycine cleavage - 3.11 0.15 1.3 Y 837 HVO_B0014 system protein T D4GQP3 HVO_RS02800, hypothetical - 3.06 0.15 1.0 Y 359 HVO_A0214 protein D4GRJ7 HVO_RS04235, aminopeptidase - 4.01 0.15 1.0 - 416 HVO_A0535 D4GYY3 HVO_RS12165, conjugal transfer Function unknown 3.03 0.15 1.0 Y 561 HVO_1554 protein TraB D4GR03 HVO_RS03315, beta- - 6.21 0.15 2.0 - 684 HVO_A0326 galactosidase D4GPS0 HVO_RS01330, histidine kinase - 3.39 0.16 1.8 Y 568 HVO_B0273 D4GTL2 HVO_RS14215, malate synthase Carbohydrate transport 4.56 0.16 1.3 - 433 HVO_1983 and metabolism D4GU45 HVO_RS14470, heme ABC Defense mechanisms 5.68 0.16 2.0 - 522 HVO_2032 transporter ATP- binding protein D4GQU7 HVO_RS03040, anaerobic - 7.37 0.16 1.7 Y 452 HVO_A0270 glycerol-3- phosphate dehydrogenase subunit B D4GR53 HVO_RS03570, 5-oxoprolinase - 8.87 0.16 1.7 - 682 HVO_A0385

70

Table 3-3. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix Length D4GXA9 HVO_RS10860, glycosyl Cell wall/membrane/ 4.83 0.17 1.0 Y 357 HVO_1281 transferase envelope biogenesis D4GZ87 HVO_RS05400, phenazine Function unknown 6.16 0.17 1.0 - 292 HVO_0143 biosynthesis protein D4GUR0 HVO_RS14855, sugar ABC Carbohydrate 2.74 0.17 1.0 Y 475 HVO_2113 transporter transport and substrate-binding metabolism protein D4GV63 HVO_RS09280, serine/threonine Signal transduction 11.30 0.17 1.3 - 345 HVO_0956 protein mechanisms phosphatase D4GUN5 HVO_RS14735, glycosyl Carbohydrate 4.11 0.17 1.7 Y 700 HVO_2087 hydrolase transport and metabolism D4GXC4 HVO_RS18465, AbrB family Replication, 5.90 0.17 2.3 - 669 HVO_2846 transcriptional recombination and regulator repair D4GQH8 HVO_RS02525, glucan 1,4-alpha- - 3.40 0.17 1.5 - 669 HVO_A0149 glucosidase D4GSA7 HVO_RS13275, peptidase M20 Amino acid transport 4.35 0.18 1.0 - 414 HVO_1784 and metabolism D4GV21 HVO_RS09175, formate - 5.70 0.18 2.0 - 680 HVO_0935 dehydrogenase subunit alpha D4GPA7 HVO_RS00510, amidohydrolase - 8.13 0.18 1.0 - 289 HVO_B0105 D4GZG0 HVO_RS05750, Fe-S Energy production and 4.07 0.18 1.3 Y 704 HVO_0215 oxidoreductase conversion D4GPR0 HVO_RS01280, amidohydrolase - 5.50 0.19 1.0 - 436 HVO_B0263

71

Table 3-3. Continued Trans- Mean Mean mem- Coverage emPAI Unique brane Accession Gene Numbers Description arCOG function (%) Mean Peptides Helix Length D4GQP0 HVO_RS02785, subtype I-B - 8.76 0.19 1.7 Y 331 HVO_A0211 CRISPR- associated endonuclease Cas1 D4GQB4 HVO_RS02245, ArcR family - 6.14 0.19 1.0 - 255 HVO_A0082 transcription regulator D4GS17 HVO_RS07005, leucyl Amino acid transport 10.89 0.19 1.0 - 319 HVO_0477 aminopeptidase and metabolism D4H053 HVO_RS12915, membrane protein - 2.62 0.19 1.0 Y 781 HVO_1708 D4GPI5 HVO_RS00905, peptide ABC - 2.10 0.20 1.0 Y 523 HVO_B0184 transporter substrate-binding protein D4GUQ6 HVO_RS14835, xylulose kinase Carbohydrate transport 4.66 0.20 1.3 Y 486 HVO_2109 and metabolism D4GV24 HVO_RS17540, signal transduction Signal transduction 7.51 0.20 2.0 - 629 HVO_2660 histidine kinase mechanisms

D4GPG9 HVO_RS00820, molecular - 9.14 0.20 1.0 - 248 HVO_B0167 chaperone D4GPE3 HVO_RS00690, hypothetical - 9.30 0.20 1.3 - 344 HVO_B0142 protein D4GX63 HVO_RS10740, DUF58 domain- Function unknown 8.47 0.20 1.3 - 299 HVO_1256 containing protein D4GRI4 HVO_RS04175, 3-ketoacyl-CoA - 6.33 0.20 1.3 - 387 HVO_A0522 thiolase D4GU65 HVO_2052 hypothetical Function unknown 1.71 0.20 1.0 Y 586 protein Least abundant proteins by emPAI score found in at least 3 SILAC replicates. Y, transmembrane helix predicted, -, no predicted transmembrane helix or arCOG function.

72

Table 3-4. Label swap t-test with 50 most abundant proteins Mean abundance Accession Gene Numbers Description P-value (heavy / light) HVO_RS08920, D4GUU7 phosphoserine phosphatase 0.001 0.929 HVO_0880 HVO_RS06435, D4GZY6 elongation factor 1-alpha 0.055 0.910 HVO_0359 HVO_R16125, D4GWM1 30S ribosomal protein S8e 0.065 0.799 HVO_2373 HVO_RS06420, D4GZY3 elongation factor EF-2 0.069 1.074 HVO_0356 HVO_RS11970, D4GYF2 ketol-acid reductoisomerase 0.078 0.886 HVO_1506 HVO_RS11455, BMP family ABC transporter D4GXX3 0.080 0.896 HVO_1401 substrate-binding protein HVO_RS06440, D4GZY7 30S ribosomal protein S10 0.086 1.216 HVO_0360 HVO_RS10980, 2-ketoglutarate ferredoxin D4GXE9 0.092 0.885 HVO_1304 oxidoreductase subunit beta HVO_RS00340, D4GP73 IMP dehydrogenase 0.095 1.126 HVO_B0071 HVO_RS18725, D4GXP3 BolA family transcriptional regulator 0.097 1.403 HVO_2899 HVO_RS11975, D4GYF3 acetolactate synthase small subunit 0.111 1.106 HVO_1507 HVO_RS15050, D4GV86 membrane protein 0.145 0.924 HVO_2153 HVO_RS09080, D4GUZ3 glyoxalase 0.159 0.910 HVO_0914 HVO_RS10140, D4GW83 adenylosuccinate synthase 0.177 1.067 HVO_1132 HVO_RS10205, D4GWA5 30S ribosomal protein S3ae 0.202 0.929 HVO_1145 HVO_RS18155, D4GWZ3 30S ribosomal protein S4 0.225 1.073 HVO_2783 HVO_RS04825, D4GYM0 sulfurtransferase 0.245 1.091 HVO_0025 HVO_RS17860, D4GW49 ribonuclease J 0.255 1.070 HVO_2724 HVO_RS14380, D4GU28 hypothetical protein 0.259 0.931 HVO_2015 HVO_RS18220, D4GX17 hypothetical protein 0.272 1.132 HVO_2796 HVO_RS15380, D4GVT8 peptidyl-prolyl cis-trans isomerase 0.290 1.114 HVO_2222 HVO_RS06380, DNA-directed RNA polymerase D4GZX5 0.292 1.048 HVO_0348 subunit B HVO_RS16970, D4GTX4 50S ribosomal protein L15 0.295 0.912 HVO_2542 ribonucleoside-diphosphate HVO_RS16520, D4GT33 reductase, adenosylcobalamin- 0.309 0.961 HVO_2452 dependent HVO_RS08955, oxoglutarate--ferredoxin D4GUV5 0.329 1.055 HVO_0888 oxidoreductase

73

Table 3-4. Continued Mean abundance Accession Gene Numbers Description P-value (heavy / light) HVO_RS13795, D4GTC9 30S ribosomal protein S24e 0.344 0.934 HVO_1896 HVO_RS12100, D4GYI5 glycerol kinase 0.397 0.967 HVO_1541 HVO_RS17080, D4GTZ6 50S ribosomal protein L3 0.432 1.049 HVO_2564 HVO_RS05035, D4GYR5 hypothetical protein 0.442 1.096 HVO_0070 HVO_RS08870, D4GUL6 glutamate synthase subunit alpha 0.483 1.019 HVO_0869 HVO_RS07845, D4GSR4 50S ribosomal protein L37 0.484 1.068 HVO_0654 HVO_RS13475, D4GST5 30S ribosomal protein S6e 0.562 0.934 HVO_1827 HVO_RS10820, D4GX92 IMP dehydrogenase 0.625 1.024 HVO_1273 HVO_RS11885, D4GYD4 mandelate racemase 0.638 1.034 HVO_1488 HVO_RS10985, 2-ketoglutarate ferredoxin D4GXF1 0.657 1.026 HVO_1305 oxidoreductase subunit alpha HVO_RS10220, D4GWB2 30S ribosomal protein S15 0.689 0.969 HVO_1148 HVO_RS08200, D4GT97 inorganic pyrophosphatase 0.699 0.960 HVO_0729 HVO_RS17020, D4GTY4 30S ribosomal protein S4e 0.700 0.972 HVO_2552 HVO_RS02755, D4GQN4 CRISPR-associated protein Cas6 0.721 1.022 HVO_A0205 HVO_RS08950, 2-oxoacid ferredoxin oxidoreductase D4GUV4 0.724 0.978 HVO_0887 subunit beta HVO_RS17200, D4GU92 isocitrate dehydrogenase (NADP(+)) 0.729 1.020 HVO_2588 HVO_RS06285, branched chain amino acid D4GZV8 0.759 0.984 HVO_0329 aminotransferase HVO_RS18925, D4GXX8 nonhistone chromosomal protein 0.769 0.976 HVO_2941 HVO_RS00975, iron ABC transporter substrate- D4GPJ9 0.847 1.013 HVO_B0198 binding protein HVO_RS08265, D4GTB7 nucleotide pyrophosphatase 0.918 1.006 HVO_0743 HVO_RS19205, O-acetylhomoserine D4GY92 0.930 1.008 HVO_2997 aminocarboxypropyltransferase HVO_RS05870, P43386 glutamine synthetase 0.948 1.004 HVO_0239 HVO_RS09295, D4GV67 oxidoreductase 0.956 0.996 HVO_0960 HVO_RS18540, D4GXG2 serine hydroxymethyltransferase 0.975 1.002 HVO_2862 HVO_RS07030, type I glyceraldehyde-3-phosphate D4GS21 0.979 0.998 HVO_0481 dehydrogenase Label swap measured by Welch’s t-test

74

Table 3-5. Proteins upregulated after treatment with NaOCl Log2 Mean Mean (treatment Coverage Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GXX9 HVO_RS11475, 2.59E-05 2.60 hypothetical protein Function unknown 10.54 1.5 HVO_1405 D4GXP0 HVO_RS11230, 2.34E-02 2.53 hypothetical protein Function unknown 12.00 1.0 HVO_1355 D4GUK2 HVO_RS08795, 2.41E-06 2.30 hypothetical protein Transcription 14.25 1.7 HVO_0855 D4GYZ2 HVO_RS12205, 8.98E-03 2.26 hypothetical protein Function unknown 16.80 2.0 HVO_1563 D4GXA9 HVO_RS10860, 4.12E-02 2.16 glycosyl transferase Cell wall/membrane/ envelope 4.83 1.0 HVO_1281 biogenesis D4GZG0 HVO_RS05750, 1.91E-02 2.03 Fe-S oxidoreductase Energy production and conversion 4.07 1.3 HVO_0215 D4GRP8 HVO_RS04480, 1.74E-04 2.02 transcriptional - 21.09 2.3 HVO_A0588 regulator D4GRM4 HVO_RS04365, 3.13E-03 1.98 transcriptional - 5.56 1.0 HVO_A0563 regulator D4GZR8 HVO_RS06095, 3.76E-03 1.76 hypothetical protein Replication, recombination and 12.20 1.3 HVO_0289 repair D4GZI5 HVO_RS05875, 3.79E-02 1.66 AsnC family Transcription 25.49 2.0 HVO_0240 transcriptional regulator D4GY41 HVO_RS19070, 3.42E-09 1.55 transcriptional Transcription 41.67 3.3 HVO_2970 regulator D4GVA9 HVO_RS15170, 1.13E-05 1.52 hypothetical protein Signal transduction mechanisms 34.85 1.0 HVO_2176 D4GUB4 HVO_RS08560, 1.57E-03 1.48 hypothetical protein - 28.05 1.0 HVO_0805 D4GYR9 HVO_RS05055, 2.65E-05 1.38 recombinase RecJ Replication, recombination and 19.80 4.8 HVO_0073 repair D4GRQ3 HVO_RS04505, 1.65E-03 1.35 transcriptional - 6.99 1.0 HVO_A0593 regulator D4GTL7 HVO_RS14245, 4.47E-02 1.32 hypothetical protein Function unknown 12.82 1.8 HVO_1988 D4GY39 HVO_RS11645, 1.27E-02 1.26 cysteine synthase Amino acid transport and 19.63 2.8 HVO_1439 metabolism

75

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GYG2 HVO_RS12010, 1.06E-02 1.26 hypothetical protein Function unknown 12.96 1.0 HVO_1516 D4GZE1 HVO_RS05660, 1.62E-08 1.20 cytochrome c Function unknown 20.75 4.0 HVO_0197 D4GSA7 HVO_RS13275, 1.70E-03 1.16 peptidase M20 Amino acid transport and 4.35 1.0 HVO_1784 metabolism D4GYG0 HVO_RS12000, 9.31E-04 1.11 hypothetical protein Function unknown 16.29 2.5 HVO_1514 D4GQU9 HVO_RS03050, 2.38E-05 1.10 DNA polymerase III - 53.74 3.5 HVO_A0272 subunit delta' D4GPT8 HVO_RS01410, 1.37E-03 1.10 glycerophosphodiester - 15.70 2.0 HVO_B0291 phosphodiesterase D4GPE0 HVO_RS00675, 2.90E-02 1.08 PQQ repeat protein - 6.45 1.7 HVO_B0139 D4GR62 HVO_RS03620, 1.90E-05 1.07 hypothetical protein - 15.07 3.3 HVO_A0396 D4GX63 HVO_RS10740, 3.63E-03 1.05 DUF58 domain- Function unknown 8.47 1.3 HVO_1256 containing protein D4GZ94 HVO_RS05435, 3.46E-04 1.03 urease accessory protein Post-translational 23.07 2.8 HVO_0150 UreG modification, protein turnover, and chaperones D4GUQ7 HVO_RS14840, 4.88E-03 1.02 ArcR family transcription Transcription 4.33 1.0 HVO_2110 regulator D4GPD7 HVO_RS00660, 1.88E-02 0.99 alpha/beta hydrolase - 9.31 1.0 HVO_B0136 D4GXY3 HVO_RS11485, 3.56E-04 0.99 transcriptional regulator Transcription 17.11 2.8 HVO_1407 D4GSI1 HVO_RS07520, 3.95E-05 0.99 haloacid dehalogenase Function unknown 36.73 3.5 HVO_0586 D4GZY4 HVO_RS06425, 4.57E-06 0.98 hypothetical protein Amino acid transport and 30.95 4.8 HVO_0357 metabolism D4GUC7 HVO_RS08590, 1.07E-03 0.97 tyrosine decarboxylase Amino acid transport and 10.15 3.0 HVO_0811 MfnA metabolism

76

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GRW9 HVO_RS06755, 7.76E-03 0.97 universal stress protein Signal transduction 7.38 1.0 HVO_0428 UspA mechanisms D4GUN9 HVO_RS14760, 3.12E-03 0.96 transcriptional regulator Transcription 10.67 2.0 HVO_2092 D4GZK1 HVO_0256 3.82E-02 0.96 hypothetical protein Function unknown 17.02 1.0 D4GTN8 HVO_RS14355, 4.38E-05 0.95 hypothetical protein Transcription 23.86 2.0 HVO_2010 D4GWP4 HVO_RS16245, 5.33E-04 0.95 adhesin Inorganic ion transport and 34.78 8.0 HVO_2397 metabolism D4GQ58 HVO_RS01985, 1.45E-02 0.94 hypothetical protein - 10.49 1.0 HVO_A0025 D4GT50 HVO_RS08070, 5.52E-04 0.93 50S ribosomal protein Translation, ribosomal 24.73 2.5 HVO_0701 L44e structure and biogenesis D4GTT7 HVO_RS08450, 2.97E-06 0.93 nicotinamide-nucleotide Coenzyme transport and 35.50 4.0 HVO_0782 adenylyltransferase metabolism D4H0B7 HVO_C0029 3.55E-04 0.92 hypothetical protein - 18.25 2.3 D4GPE6 HVO_RS00705, 5.47E-03 0.92 creatininase - 23.38 2.7 HVO_B0145 D4GPI5 HVO_RS00905, 8.54E-03 0.91 peptide ABC transporter - 2.10 1.0 HVO_B0184 substrate-binding protein D4GWP5 HVO_RS16250, 4.37E-02 0.91 ABC transporter ATP- Inorganic ion transport and 11.25 2.5 HVO_2398 binding protein metabolism D4GRL6 HVO_RS04325, 1.95E-03 0.91 lactate utilization protein - 11.35 1.3 HVO_A0555 D4GTR6 HVO_RS16760, 1.05E-02 0.90 amino acid transporter Amino acid transport and 2.91 1.5 HVO_2500 metabolism, Signal transduction mechanisms D4GTE3 HVO_RS13875, 5.50E-03 0.89 acetyl-CoA Lipid transport and 22.15 3.5 HVO_1914 acetyltransferase metabolism D4H036 HVO_RS12830, 4.58E-02 0.88 photosystem reaction Function unknown 24.40 2.0 HVO_1691 center subunit H D4GPT0 HVO_RS01370, 5.09E-03 0.87 transcriptional regulator - 9.60 1.7 HVO_B0283

77

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GWA8 HVO_RS10210, 7.38E-03 0.87 hypothetical protein Transcription 37.50 1.5 HVO_1146 D4GUF6 HVO_RS17345, 2.25E-03 0.87 molybdopterin synthase Coenzyme transport and 44.25 2.0 HVO_2619 sulfur carrier subunit metabolism D4GP32 HVO_RS00145, 4.32E-05 0.87 short-chain - 16.21 2.5 HVO_B0031 dehydrogenase D4H084 HVO_RS13100, 2.03E-02 0.87 hypothetical protein Replication, recombination 7.27 1.5 HVO_1745 and repair D4GT93 HVO_RS16655, 3.01E-02 0.86 2-phospho-L-lactate Coenzyme transport and 5.98 1.8 HVO_2479 transferase metabolism D4GVK0 HVO_RS09610, 3.44E-02 0.86 hypothetical protein Function unknown 18.63 3.0 HVO_1023 D4GSS9 HVO_RS13445, 9.33E-03 0.84 HAT (histone Transcription 15.22 1.8 HVO_1821 acetyltransferase) family protein D4GSJ0 HVO_RS07560, 1.48E-03 0.83 chromosome partitioning Cell cycle control, cell 23.25 3.5 HVO_0595 protein ParA division, chromosome partitioning D4GZA7 HVO_RS05500, 3.93E-05 0.83 transcriptional regulator Transcription 44.71 6.0 HVO_0163 D4GRE9 HVO_RS04010, 8.08E-04 0.82 hydrogenase expression - 10.62 2.0 HVO_A0486 protein D4GQE7 HVO_A0115 4.91E-03 0.80 hypothetical protein - 51.72 1.8 D4GW18 HVO_RS09965, 4.93E-02 0.79 succinyl-diaminopimelate Amino acid transport and 27.74 3.3 HVO_1096 desuccinylase metabolism D4GTW1 HVO_RS16905, 1.12E-06 0.78 short-chain Lipid transport and 42.93 7.3 HVO_2529 dehydrogenase metabolism D4GTP0 HVO_RS14365, 4.49E-02 0.78 sensor histidine kinase Signal transduction 13.23 1.3 HVO_2012 mechanisms D4GRD0 HVO_RS03910, 1.60E-04 0.77 transcription regulator - 25.95 4.5 HVO_A0465 D4GZI2 HVO_RS05860, 1.29E-03 0.77 hypothetical protein Replication, recombination 10.96 4.0 HVO_0237 and repair

78

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GU30 HVO_RS14390, 1.91E-02 0.76 hypothetical protein Transcription 10.84 2.8 HVO_2017 D4GUS7 HVO_RS14935, 2.13E-06 0.76 transcriptional regulator Transcription 38.33 8.3 HVO_2130 D4GUG5 HVO_RS08685, 3.02E-03 0.76 methylmalonyl-CoA Lipid transport and 9.35 1.0 HVO_0830 mutase metabolism D4GQJ9 HVO_RS02625, 2.76E-04 0.76 hypothetical protein - 35.17 2.5 HVO_A0170 D4GW51 HVO_RS17865, 1.43E-08 0.76 phosphoesterase Coenzyme transport and 38.07 12 HVO_2725 metabolism D4GVT6 HVO_RS15370, 4.99E-03 0.75 chemotaxis protein Carbohydrate transport and 4.10 2.0 HVO_2220 metabolism, Cell motility D4GQ02 HVO_RS01715, 2.72E-03 0.75 hypothetical protein - 12.77 1.8 HVO_B0355 D4GRU3 HVO_RS04695, 8.66E-03 0.74 cysteine desulfurase - 18.73 4.3 HVO_A0635 D4GXD2 HVO_RS18485, 2.68E-04 0.74 hypothetical protein Function unknown 31.94 2.5 HVO_2850 D4GXS4 HVO_RS18795, 8.29E-03 0.74 hypothetical protein Function unknown 16.96 2.0 HVO_2914 D4GSK8 HVO_RS07645, 2.54E-03 0.73 universal stress protein Signal transduction 17.48 1.0 HVO_0612 UspA mechanisms D4GYU8 HVO_RS05185, 2.38E-03 0.73 zinc metalloprotease Post-translational 8.96 2.8 HVO_0102 HtpX modification, protein turnover, and chaperones D4GXS5 HVO_RS11315, 2.92E-03 0.73 acyl-CoA dehydrogenase Lipid transport and 14.27 3.0 HVO_1373 metabolism D4GZG8 HVO_RS05790, 5.97E-04 0.73 hypothetical protein Function unknown 17.36 4.3 HVO_0223 D4GR79 HVO_RS03695, 3.34E-05 0.72 cyclase - 45.48 3.8 HVO_A0415 D4GV78 HVO_RS09350, 7.73E-03 0.72 DEAD/DEAH box Replication, recombination 13.30 4.3 HVO_0971 helicase and repair

79

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GXN5 HVO_RS11215, 1.62E-02 0.71 hypothetical protein Function unknown 17.74 1.5 HVO_1352 D4GYN8 HVO_RS04910, 2.55E-04 0.71 acetylornithine Amino acid transport and 11.90 3.3 HVO_0043 aminotransferase metabolism D4GYW3 HVO_RS05260, 5.27E-05 0.70 translation initiation factor Translation, ribosomal 36.54 4.8 HVO_0117 IF-6 structure and biogenesis D4GYA5 HVO_RS11800, 1.87E-02 0.70 sulfite oxidase Function unknown 15.23 2.3 HVO_1471 D4GVM0 HVO_RS09715, 1.23E-07 0.69 imidazole glycerol Amino acid transport and 37.04 7.3 HVO_1044 phosphate synthase metabolism cyclase subunit D4H097 HVO_RS19315, 1.35E-04 0.69 hypothetical protein - 26.54 2.3 HVO_C0006 D4GVS6 HVO_RS09885, 3.50E-07 0.69 hypothetical protein Function unknown 66.76 9.0 HVO_1080 D4GZN3 HVO_RS12725, 1.14E-03 0.68 fibrillarin-like rRNA Translation, ribosomal 16.78 2.5 HVO_1669 methylase structure and biogenesis D4GSI5 HVO_RS07540, 2.05E-03 0.68 hypothetical protein Coenzyme transport and 42.68 6.8 HVO_0590 metabolism D4GZ90 HVO_RS05415, 2.10E-02 0.67 phosphatidylserine Lipid transport and 10.20 1.5 HVO_0146 decarboxylase metabolism D4GV89 HVO_RS15065, 5.84E-04 0.67 universal stress protein Signal transduction 27.24 5.5 HVO_2156 UspA mechanisms D4GSH2 HVO_RS07470, 2.44E-02 0.66 transcriptional regulator Transcription 10.43 1.3 HVO_0576 D4GZ62 HVO_RS12540, 8.00E-04 0.66 hypothetical protein Replication, recombination 41.73 5.0 HVO_1633 and repair D4GVM6 HVO_RS09735, 2.17E-05 0.65 asparagine synthase Amino acid transport and 26.58 6.8 HVO_1050 metabolism D4GPI4 HVO_RS00900, 1.93E-02 0.65 racemase - 14.29 2.5 HVO_B0183 D4GYT9 HVO_0094 3.63E-02 0.64 hypothetical protein Function unknown 53.88 1.8

80

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides P18304 HVO_RS08475, 1.86E-02 0.63 indole-3-glycerol- Amino acid transport and 39.34 6.5 HVO_0787 phosphate synthase metabolism D4GRT9 HVO_RS04675, 2.31E-02 0.63 hypothetical protein - 19.40 1.7 HVO_A0631 D4GRJ6 HVO_RS04230, 2.27E-02 0.63 hypothetical protein - 10.14 1.7 HVO_A0534 D4GUF0 HVO_RS08645, 1.72E-03 0.63 NAD(P)-dependent Energy production and 29.17 4.3 HVO_0822 glycerol-1-phosphate conversion dehydrogenase D4GSW4 HVO_RS13630, 2.14E-02 0.63 thiamine-phosphate Coenzyme transport and 16.16 3.7 HVO_1861 kinase metabolism D4GR09 HVO_RS03340, 4.45E-02 0.63 ArcR family transcription - 18.75 3.3 HVO_A0332 regulator D4GT42 HVO_RS08045, 2.64E-02 0.62 diaminopimelate Function unknown 7.11 1.8 HVO_0696 epimerase D4GY67 HVO_RS11710, 9.28E-03 0.62 CoA ester lyase Carbohydrate transport and 25.54 5.0 HVO_1452 metabolism D4GXY2 HVO_RS18935, 5.58E-03 0.62 dihydroorotate Nucleotide transport and 32.76 6.3 HVO_2943 dehydrogenase (quinone) metabolism D4GUK9 HVO_RS08830, 3.24E-03 0.62 hypothetical protein Function unknown 23.77 3.3 HVO_0862 D4GPF2 HVO_RS00730, 6.51E-03 0.61 nickel-responsive - 14.79 2.0 HVO_B0151 transcriptional regulator NikR D4GTY8 HVO_RS17040, 2.76E-03 0.61 ribonuclease P Translation, ribosomal 36.71 4.0 HVO_2556 structure and biogenesis D4GW28 HVO_RS09990, 2.75E-07 0.61 4-hydroxy- Amino acid transport and 50.08 11 HVO_1101 tetrahydrodipicolinate metabolism synthase D4GWL9 HVO_RS16115, 1.30E-03 0.61 hypothetical protein Function unknown 19.03 1.5 HVO_2371 D4GTH0 HVO_RS14010, 4.74E-03 0.61 magnesium chelatase Function unknown 15.09 2.8 HVO_1941

81

Table 3-5. Continued Log2 Mean (treatment Coverage Mean Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GYT2 HVO_RS05120, 1.17E-08 0.61 delta-aminolevulinic acid Coenzyme transport and 37.84 8.5 HVO_0087 dehydratase metabolism D4GRI9 HVO_RS04195, 4.37E-03 0.60 transcriptional regulator - 14.51 2.8 HVO_A0527 D4GZ81 HVO_RS05370, 7.64E-04 0.60 lipase/esterase - 16.18 2.0 HVO_0137 D4GUL2 HVO_RS08850, 3.72E-04 0.60 SAM-dependent Secondary metabolites 15.38 2.8 HVO_0865 methyltransferase biosynthesis, transport, and catabolism D4GW93 HVO_RS10175, 2.79E-06 0.60 farnesyl-diphosphate Lipid transport and 28.70 4.5 HVO_1139 farnesyltransferase metabolism D4GQY0 HVO_RS03205, 4.13E-03 0.59 L-asparaginase - 21.60 4.5 HVO_A0302 Proteins upregulated at least 1.5 fold after treatment with NaOCl (p < 0.05). Proteins had at least 2 unique peptides identified across 4 replicates. -, no arCOG function predicted.

82

Table 3-6. Proteins downregulated after treatment with NaOCl Log2 Mean Mean (treatment Coverage Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GP45 HVO_RS00205, 9.11E-04 -0.560 N-acetyltransferase - 44.01 6.5 HVO_B0043 D4GVB6 HVO_RS15205, 4.29E-06 -0.567 aldehyde ferredoxin Energy production and 14.70 6.3 HVO_2183 oxidoreductase conversion D4GX56 HVO_RS18315, 3.59E-02 -0.579 3-hydroxyacyl-CoA Lipid transport and 4.34 1.3 HVO_2815 dehydrogenase metabolism D4GRP3 HVO_RS04460, 2.73E-04 -0.581 IclR family transcriptional - 29.98 5.5 HVO_A0583 regulator D4GYV1 HVO_RS05200, 6.23E-03 -0.591 pyridine nucleotide-disulfide Function unknown 26.64 7.5 HVO_0105 oxidoreductase D4GWU6 HVO_RS10410, 9.30E-04 -0.593 hypothetical protein Function unknown 18.57 1.3 HVO_1188 D4GRU1 HVO_RS04685, 1.52E-04 -0.597 flagellin - 10.96 1.0 HVO_A0633 D4GTQ1 HVO_0758 6.01E-03 -0.604 hypothetical protein Function unknown 51.34 4.5 D4GXN8 HVO_RS18715, 3.23E-02 -0.607 hypothetical protein Function unknown 17.99 1.8 HVO_2897 D4GXW7 HVO_RS11430, 8.55E-04 -0.612 two-component sensor histidine Signal transduction 8.46 2.0 HVO_1397 kinase mechanisms D4GPE1 HVO_RS00680, 3.61E-02 -0.614 PQQ repeat protein - 2.29 1.0 HVO_B0140 D4GXH3 HVO_RS11050, 2.81E-02 -0.633 AAC(3) family N- Defense mechanisms 14.68 1.3 HVO_1318 acetyltransferase D4GU20 HVO_RS17180, 3.67E-05 -0.643 hypothetical protein Cell motility 48.88 8.5 HVO_2584 D4GTG4 HVO_RS13975, 1.81E-02 -0.667 phosphoesterase Function unknown 27.03 2.3 HVO_1935 D4GS70 HVO_RS07290, 3.97E-02 -0.674 iron-dependent repressor Transcription 28.13 2.5 HVO_0538 D4H090 HVO_RS13125, 8.29E-06 -0.675 copper-translocating P-type Inorganic ion transport 14.95 10 HVO_1751 ATPase and metabolism D4GR81 HVO_RS03705, 1.93E-03 -0.683 hypothetical protein - 49.51 1.5 HVO_A0417

83

Table 3-6. Continued Log2 Mean Mean (treatment Coverage Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GU12 HVO_RS17155, 5.52E-06 -0.711 nicotinate-nucleotide Coenzyme transport and 23.51 4.5 HVO_2579 diphosphorylase (carboxylating) metabolism D4GVI8 HVO_RS09550, 5.97E-05 -0.712 hypothetical protein Post-translational 33.77 2.0 HVO_1011 modification, protein turnover, and chaperones D4GQ40 HVO_RS01900, 4.78E-06 -0.713 transposase - 8.56 3.5 HVO_A0008 D4GPU7 HVO_RS01450, 4.39E-02 -0.714 urate oxidase - 14.77 2.8 HVO_B0300 D4GWD1 HVO_RS10300, 4.45E-02 -0.726 mechanosensitive ion channel Cell 6.87 1.5 HVO_1165 protein wall/membrane/envelop e biogenesis D4GY48 HVO_RS19090, 1.30E-03 -0.729 cupin Function unknown 26.19 3.3 HVO_2974 D4GXJ8 HVO_RS11110, 5.06E-03 -0.750 transcriptional regulator Transcription 13.53 1.0 HVO_1331 D4GW91 HVO_RS10165, 1.16E-02 -0.755 metal transporter Inorganic ion transport 2.42 1.0 HVO_1137 and metabolism D4GST3 HVO_RS13465, 6.66E-05 -0.759 hypothetical protein Function unknown 53.52 3.5 HVO_1825 D4GTH4 HVO_RS14030, 2.39E-02 -0.772 Uncharacterized protein Cell wall/ membrane/ 11.96 2.7 HVO_1945 envelope biogenesis D4GXX5 HVO_RS11465, 1.19E-02 -0.783 acylphosphatase Energy production and 17.55 1.5 HVO_1403 conversion D4GXJ9 HVO_RS11115, 9.49E-04 -0.788 hypothetical protein Function unknown 28.29 2.5 HVO_1332 D4GU33 HVO_RS14410, 3.41E-02 -0.789 hypothetical protein Function unknown 7.12 1.3 HVO_2020 D4GY64 HVO_RS19130, 1.16E-03 -0.798 hypothetical protein Function unknown 46.27 2.3 HVO_2982 D4GUF9 HVO_RS08670, 9.95E-03 -0.800 hypothetical protein Function unknown 27.94 1.3 HVO_0827

84

Table 3-6. Continued Log2 Mean Mean (treatment Coverage Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GVV0 HVO_RS15440, 2.12E-02 -0.813 peptide-methionine (R)-S-oxide Post-translational 17.11 2.8 HVO_2234 reductase modification, protein turnover, and chaperones D4GRX6 HVO_RS06790, 4.00E-02 -0.842 phosphoribosyl-ATP Amino acid transport 16.50 1.3 HVO_0435 diphosphatase and metabolism D4GS78 HVO_RS13135, 4.45E-05 -0.871 heavy metal transporter Inorganic ion transport 52.31 2.8 HVO_1753 and metabolism D4H0A3 HVO_RS19345, 3.80E-05 -0.882 hypothetical protein - 11.32 1.0 HVO_C0012 D4GZ26 HVO_RS12380, 5.40E-06 -0.903 hypothetical protein Function unknown 20.00 2.3 HVO_1597 D4GT84 HVO_RS08160, 7.97E-07 -0.929 hypothetical protein Function unknown 30.00 2.0 HVO_0720 D4GSP0 HVO_RS07760, 2.70E-02 -0.934 hypothetical protein Amino acid transport 14.45 2.3 HVO_0635 and metabolism D4GSD2 HVO_RS13380, 4.16E-03 -0.989 hypothetical protein Function unknown 3.57 1.0 HVO_1808 D4H0F8 HVO_RS19590, 6.05E-05 -1.006 ArcR family transcriptional - 12.36 2.5 HVO_C0076 regulator L9V9K4 HVO_RS14590 9.99E-03 -1.017 hypothetical protein - 29.24 1.3 D4GXB9 HVO_RS10890, 4.80E-03 -1.028 protease Inorganic ion transport 29.55 2.8 HVO_1287 and metabolism D4GWK8 HVO_RS16060, 4.34E-02 -1.109 LD-carboxypeptidase Defense mechanisms 7.35 1.5 HVO_2360 D4GTM0 HVO_RS14265, 1.08E-02 -1.119 cold shock protein Transcription 10.94 1.0 HVO_1992 D4GY43 HVO_RS19075, 3.66E-02 -1.130 hypothetical protein Function unknown 32.05 1.5 HVO_2971 D4H005 HVO_RS06525, 5.81E-03 -1.139 integrase Replication, 28.35 2.0 HVO_0379 recombination and repair D4GRE2 HVO_RS03970, 1.10E-02 -1.183 phosphate ABC transporter - 14.20 3.0 HVO_A0477 substrate-binding protein

85

Table 3-6. Continued Log2 Mean Mean (treatment Coverage Unique Accession Gene Numbers P-value /control) Description arCOG Function (%) Peptides D4GU98 HVO_RS17210, 3.25E-02 -1.188 short-chain dehydrogenase Lipid transport and 21.54 3.3 HVO_2590 metabolism D4GTU1 HVO_RS16805, 2.80E-02 -1.198 light- and oxygen-sensing Signal transduction 4.25 1.0 HVO_2509 transcription regulator mechanisms D4GQ08 HVO_RS01745, 1.55E-06 -1.259 transcriptional regulator - 12.68 1.8 HVO_B0361 D4GUR5 HVO_RS14880, 1.86E-03 -1.275 sugar ABC transporter ATP- Carbohydrate transport 6.40 2.0 HVO_2118 binding protein and metabolism D4GQW3 HVO_RS03120, 9.63E-03 -1.282 hypothetical protein - 7.98 1.8 HVO_A0286 D4GYF8 HVO_RS11990, 1.63E-02 -1.339 hypothetical protein Function unknown 12.11 1.0 HVO_1512 D4GYQ6 HVO_RS04995, 2.42E-02 -1.431 peptide ABC transporter Amino acid transport 1.72 1.0 HVO_0061 permease and metabolism D4GS81 HVO_RS13150, 6.73E-03 -1.635 N-acetyltransferase Transcription 8.53 1.0 HVO_1756 D4GXP8 HVO_RS11250, 2.05E-10 -2.425 hypothetical protein Function unknown 22.55 1.7 HVO_1359 Proteins downregulated at least 1.5 fold after treatment with NaOCl (p < 0.05). Proteins had at least 2 unique peptides identified across 4 replicates. -, no arCOG function predicted.

86

Figure 3-1. Lysine and arginine auxotrophy phenotype shown by absence of growth in media without lysine and arginine supplementation, respectively. A. Top row: glycerol minimal medium supplemented with 1 mM lysine, bottom row: glycerol minimal medium alone. In the left column, LM06, ΔlysA, is plated with H26, parent. In the center column, LM06 and H26 both harbor pJAM2918, expressing LysA in trans. In the right column, LM06 and H26 both contain the empty vector, pJAM202c. B. Top row: glycerol minimal medium supplemented with 1 mM arginine, bottom row: glycerol minimal medium alone. In the left column, LM07, ΔargH is plated with H26, parent. In the center column, LM07 and H26 both harbor pJAM2919, expressing ArgH in trans. In the right column, LM07 and H26 both contain the empty vector, pJAM202c.

87

Figure 3-2. Double auxotrophic strain (LM08) for lysine and arginine exposure to different concentrations of lysine, arginine, and NaOCl. A. LM08 was grown in glycerol minimal medium (GMM) supplemented with lysine and arginine at 0, 200, 300, 500 µM of each. Parent strain (H26) was grown in GMM without lysine or arginine supplementation. B. Cell survival after NaOCl treatment. Hfx. volcanii H26 cells were grown in liquid GMM to OD600 0.6-0.9 and treated with 0, 1.25, 2.5, 4, and 7.5 mM NaOCl for 20 min. Treated cells were plated at 10-7 dilution on ATCC974 solid medium and individual colony forming units (CFUs) were counted. C. H26 cells were grown to OD600 0.6-0.9 in GMM, treated with NaOCl at 0, 2, 5, 8, 11 mM and monitored for growth after treatment for 15 h. D. Ellman’s reagent assay for free sulfhydryl groups. LM08 cells were grown in GMM supplemented with 300 µM lysine and 300 µM arginine and treated with 0 mM (control) and 2.5 mM NaOCl for 20 min. Cells were lysed by sonication and total protein was assayed for sulfhydryl content by Ellman’s reagent.

88

Figure 3-3. Protein identification and expression. A. Venn diagram constructed with Venny 2.1.0 (186) of proteins identified in each replicate with at least two peptides with a FDR of ≤ 1%. B. Volcano plot of protein expression values expressed as log2 of the fold change ratio and -log10 of p-value. Black points are statistically significant with p < 0.05.

89

Figure 3-4. Hypersensitivity of a small archaeal ubiquitin-like modifier protein mutant (Δsamp1) to oxidative stress as predicted by SILAC and observed by treatment with NaOCl. Parent H26 and Δsamp1 mutant and were serial diluted and spot plated onto glycerol minimal medium (GMM) with and without 0.8 mM NaOCl.

90

CHAPTER 4 ARCHAEAL INORGANIC PYROPHOSPHATASE DISPLAYS ROBUST ACTIVITY UNDER HIGH SALT CONDITIONS AND IN ORGANIC SOLVENTS

Introduction for HvPPA Study

Inorganic pyrophosphatase (PPA) was one of the most abundant proteins in the cell identified from the SILAC study. PPAs (EC 3.6.1.1) catalyze the hydrolysis of the

4- phosphoanhydride bond of inorganic pyrophosphate (PPi) (P2O7 ) to form 2 mol of

3- orthophosphate (Pi) (PO4 ) (187). PPi is a common by-product of metabolism, including the biosynthesis of DNA, RNA, protein, peptidoglycan, lipids (e.g., cholesterol), cellulose, starch, and other biopolymers (30). PPi is also formed during the posttranslational modification of proteins, including adenylation, uridylation, and ubiquitylation (30).

The hydrolysis of PPi by PPA releases a considerable amount of energy (ΔG’ = -

19.2 kJ/mol) that can drive unfavorable biochemical transformations to completion. One example is in the synthesis of DNA by DNA polymerase. In this endergonic (ΔG’ = 2.1 kJ/mol) reaction, the 3’-hydroxyl group of the nucleotide that resides at the 3’ end of the growing DNA strand serves as a nucleophile in the attack of the α phosphorus of the incoming deoxynucleoside 5’-triphosphate (dNTP), thus releasing PPi (30). The polymerization of DNA is highly dependent on PPA to hydrolyze the energy-rich PPi to

2Pi and to drive the synthesis reaction forward (30). Under standard conditions, DNA polymerase alone converts DNA to dNTPs.

HvPPA study details were adapted with permission from McMillan LJ, Hepowit NL, Maupin-Furlow JA. 2015. Archaeal inorganic pyrophosphatase displays robust activity under high-salt conditions and in organic solvents. Appl Environ Microbiol 82:538-48. Copyright © 2016, American Society for Microbiology.

91

PPAs are used in a wide variety of biotechnology applications based on the ability of these enzymes to drive reactions forward and generate an easily assayed product. PPAs prevent the accumulation of PPi during DNA sequencing reactions (188,

189), PCR (131), and single-base extension (SBE) reactions (121). PPAs are also used to increase the yields of RNA during in vitro transcription (120) and of GDP-modified sugars by enzymatic synthesis (122, 123). PPAs are used routinely to quantify rates of reactions that release PPi as a byproduct, such as single nucleotide polymorphism

(SNP) genotyping reactions (190-192), RNA synthesis by viral RNA-dependent RNA polymerases (193), and aminoacyl-tRNA synthetase activity (127, 128). The advantage of PPA-coupled assays is that PPA hydrolyzes PPi to a product (2Pi) which is readily detected by colorimetric assay (156, 157).

PPAs that operate in a wide variety of organic solvents and salt concentrations are desirable in bioindustry to increase the solubility of hydrophobic substrates, allow for novel synthetic chemistry, alter substrate specificity, ease product recovery, and reduce microbial contamination (140, 194-199). Biotechnological applications of solvent-tolerant

PPAs can be envisioned in the biosynthesis of hydrophobic compounds derived from carbon skeletons such as cholesterol and rubber. In cholesterol biosynthesis, PPi is released in several of the early and foundational steps leading to the production of steroid hormones and vitamin D (200). Likewise, natural rubber is synthesized from allylic diphosphate and polymers of isopentenyl diphosphate (IPP), releasing one PPi per IPP incorporated by this rate-limiting reaction (201). Solvent-tolerant PPAs could be used to drive forward the initiation and elongation reactions of rubber and cholesterol- derived compounds by performing the reactions in extracting reagents that enhance

92

reactant and product solubility. In addition to increasing natural product yield, the hydrophobic products generated by this type of approach could be retrieved by precipitation under aqueous conditions while allowing for reuse of any enzymes that are solvent tolerant.

Here a new archaeal PPA of the class A type (IPR008162 family) is shown to hold the answer to the solvent and salt tolerance dilemma. PPAs of the class A type are not associated with the membrane and are widespread in all domains of life, including

Archaea. Class A type PPAs of hyperthermophilic archaea are already used in PCR and

DNA sequencing reactions (131, 202). In contrast, PPAs with DHHA2 domains

+ 2+ (IPR004097) and PPAs of the PPi-energized H pump (IPR004131), Mn -dependent

(IPR022934), and PpaX-type (IPR023733) families are not as widely distributed in archaea and/or can be difficult to purify due to their association with membranes.

Results and Discussion for HvPPA Study

Inorganic Pyrophosphatase Homologs of Halophilic Archaea are Phylogenetically Distinct

To identify new PPAs with novel biochemical properties for use in bioindustry, the

PPA sequences available in the public databases were analyzed. Our focus was on archaeal PPAs of the class A type (IPR008162), since members of this family are widespread in archaea compared to PPAs of other protein families (i.e., IPR004131,

IPR022934, IPR004097, and IPR023733). Based on hierarchical clustering, the class A type PPA homologs of the halophilic archaea were found to share a close evolutionary relationship that was distinct from the PPAs that have been biochemically characterized as represented by Dendrogram plot (Figure 4-1). The PPA homolog of the halophilic archaeon Hfx. volcanii (HvPPA) was further analyzed by multiple amino acid sequence

93

alignment and Phyre2-based homology modeling. HvPPA was found to be 42 to 55% identical and 60 to 71% similar in amino acid sequence to biochemically characterized

PPAs of the class A type, including those from the archaea T. acidophilum (130, 189,

203), P. horikoshii (115, 131, 204, 205), Sulfolobus sp. (117, 132, 133, 206, 207), M. thermautotrophicus (134), and Thermococcus thioreducens (116) (Figure 4-2A).

Three-dimensional (3D) homology modeling suggested HvPPA to have an OB fold consisting of a central-barrel structure and α-helices associated in a β1–8-α1-β9-α2 topology and to homo-oligomerize into a trimer and/or dimer of trimers (Figure 4-2A and

B). Active-site residues of PPi hydrolysis were found conserved in HvPPA, including

Asp69, which is predicted to provide the carboxylate functional group that performs the

2+ nucleophilic attack on the PPi substrate when Mg ions are present (208, 209).

Interestingly, the two cysteine residues (Cys24 and Cys85) of HvPPA were found in a

Cys-X63-Cys configuration that was highly conserved among haloarchaeal PPAs and distinct from other class A type PPAs (Figure 4-2A and B). These cysteine residues were at a significant distance from the putative active site of HvPPA, with Cys85 predicted to reside at an intersubunit interface, suggesting that redox status could modulate the quaternary structure of this enzyme.

HvPPA was also found to have an unusually high abundance of acidic residues on its surface (Figure 4-3), which could enhance the solubility and flexibility of this PPA under high-salt conditions (17, 210). In contrast, proteins with less surface charge have a tendency to aggregate and become rigid under conditions of reduced water activity.

Thus, the PPAs of the halophilic archaea were pursued as a resource for identifying new enzymes with novel biochemical properties for use in biotechnology.

94

Purification of HvPPA in an Active Form as a Hexamer

HvPPA was purified over 300-fold from Hfx. volcanii H26- pJAM2920 (a strain that ectopically expressed the protein with an N-terminal His6 tag from an rRNA P2 promoter) (Table 4-1). HvPPA was purified by a two-step method that relied upon Ni2+- based immobilized metal ion affinity chromatography (IMAC) and size exclusion chromatography (SEC) (Figure 4-4A). Based on SEC, HvPPA was associated in trimeric and hexameric configurations (Figure 4-4B). The trimeric form was 23% less active than the hexamer and was not further characterized. The HvPPA hexamer was composed primarily of the His6-tagged form but included genome-encoded (untagged) forms (Figure 4-4B). The molecular masses observed (25.6 and 36.6 kDa) for the

HvPPA subunits by SDS-PAGE were 5 to 8 kDa larger than the calculated molecular masses, likely due to altered SDS coating of the acidic polypeptide, which would retard its migration by SDS-PAGE (211, 212). HvPPA purified as homotrimers and -hexamers and was consistent with our 3D model and subunit arrangement of class A type PPAs from thermophilic and hyperthermophilic archaea (Table 4-2). HvPPA is likely a dimer of trimers, as has been observed in X-ray crystal structures of related PPA enzymes (e.g.,

PDB 1QEZ and 3I98).

Catalytic Activity of HvPPA

HvPPA hexamers were found to readily hydrolyze PPi to Pi, with optimal activity detected at 42°C and basic pH (pH 8 to 9) (Figure 4-5A and B). Supplementation of reaction mixtures with NaCl (in a 120-fold concentration range of 25 mM to 3 M) had little, if any, effect on the catalytic activity (Figure 4-5C). HvPPA was inactivated when divalent cations were removed from the reaction by dialysis against the metal chelator

EDTA. The PPi -hydrolyzing activity of the EDTA-treated HvPPA could be partially

95

restored by supplementation with Mn2+ or Mg2+ ions but not by addition of Zn2+, Ca2+,

Co2+, or Ni2+ (Figure 4-5D). We note that the EDTA treated enzyme was restored to only half the activity of the untreated control when assayed with 2.5 mM MgCl2. Furthermore, the untreated HvPPA was significantly stimulated by addition of high concentrations of

2+ Mg to the reaction buffer, with optimal PPi-hydrolyzing activity at 20 to 40 mM MgCl2

(Figure 4-5E). Addition of other divalent cations such as Mn2+ did not stimulate the activity of the HvPPA when it was not pretreated with EDTA. Together, these results suggest that HvPPA is most likely coordinated to Mg2+ (and not Mn2+) ions upon purification from Hfx. volcanii and requires relatively high concentrations of Mg2+ for full activity. Mg2+ ions are present at high concentrations in the cytosol of haloarchaea, with reported concentrations at 120 mM for Hbt. salinarum (213).

Similarly to other class A type PPAs, HvPPA was inhibited by sodium fluoride

(NaF), with Ki values of 1.8 mM NaF at pH 8.5 and 0.2 mM NaF at pH 7.5 (Figure 4-6A).

Increased sensitivity to fluoride inhibition at pH 6 to 7 compared to basic pH is commonly observed for class A type PPAs (214) and other hydrolyzing enzymes such as catalases (215) and peroxidases (216). F- ions inhibit activity of class A type PPAs by substituting the attacking nucleophile in the PPi hydrolysis reaction (208). Consistent

- with the NaF inhibition of HvPPA, amino acid residues interacting with the F -, PPi -,

2+ H2O-, and Mg -bound molecules in the X-ray crystal structure of E. coli PPA (PDB

2AUU) were found conserved in the haloarchaeal enzyme (Figure 4-6B).

HvPPA displayed non-Michaelis-Menten kinetics for PPi hydrolysis. When

-1 assayed at 42°C, HvPPA was found to have a Vmax of 465 U · mg and a Km of 0.55

-1 mM for the PPi substrate. In contrast, HvPPA had a reduced Vmax of 53 U · mg and a

96

Km of 0.26 mM for PPi at 25 °C. Sigmoidal kinetic profiles indicative of positive cooperative binding were detected for Mg2+, with the degree of cooperativity

2+ represented by a Hill coefficient of 2.62 at 25°C (and a Km of 13 mM for Mg determined under these conditions).

HvPPA hydrolysis of nucleoside triphosphates (ATP, TTP, GTP, or CTP) or nucleoside diphosphate (ADP) was not detectable, making HvPPA useful for coupling

PPAs with nucleotide- dependent enzymes in assays. Based on these results, HvPPA was found to catalyze the hydrolysis of PPi with kinetic properties that were most closely related to those of the PPA of M. thermautotrophicus among the archaeal class A type

2+ PPAs (Table 4-2). The low affinity of HvPPA for Mg and PPi based on Km values is consistent with the unusually high levels of these types of ions in the cytosol of haloarchaea (3).

HvPPA Tolerance to Temperature and Organic Solvents

Haloarchaeal proteins are notable for their stability at 40 to 65 °C and for their high tolerance of organic solvents (18, 137, 141, 217, 218). Here HvPPA was found to be moderately thermostable, with a half-life of thermal inactivation of 2 h at 65°C, and to retain 82% activity after incubation for 2 h at 42 °C (Figure 4- 7A). In contrast, class A type PPAs of the hyperthermophilic archaea are highly resistant to thermal inactivation

(e.g., P. horikoshii PPA displays a half-life of 1 h at 105°C (204) (Table 3-2). The unique feature of HvPPA was its high tolerance of organic solvents, with little if any enzyme inactivation after 2 h of incubation in buffers supplemented with 50% (v/v) dimethyl sulfoxide (DMSO), dimethylformamide (DMF), ethanol, or methanol (Figure 4-7B). The catalytic activity of HvPPA was also found to be robust when assayed in organic solvents. HvPPA displayed 110 to 150% activity in buffers supplemented with 25% (v/v)

97

methanol and ethanol and 63 to 94% activity in buffers with 25% (v/v) DMSO and DMF, compared to the no-solvent controls (Figure 4-7C). HvPPA was found to be more stable when stored in buffers supplemented with 2 to 3 M NaCl than in those with 1.5M NaCl or less (Figure 4-7D). However, the enzyme was fully active over a wide range of salts

(as noted in Figure 4-5C) and was active after storage at 20 °C in 20% (v/v) glycerol and after lyophilization (with 100% and 85% of the activity of the untreated control, respectively).

HvPPA for Detection of By-Product PPi in a Coupled Assay at High Temperature and Reduced Water Activity

PPAs are not yet available for use under conditions of high salt concentrations or organic solvents to drive the activity of enzymes that generate PPi as a by-product.

Here the use of HvPPA was demonstrated with a PPi-generating enzyme that functions at reduced water activity and high temperature by a coupled assay. In particular, HvPPA was used to monitor the PPi by-product of the “salt-loving” enzyme UbaA of Hfx. volcanii at 42 °C in a buffer system with 2 M NaCl. UbaA has a NAD/FAD-binding fold domain common to ubiquitin-activating E1 family enzymes and is required for the formation of ubiquitin-like bonds in archaea (35). UbaA is presumed to adenylate the C-terminal - carboxylate groups of ubiquitin- like proteins (named SAMPs in archaea) and to release

PPi as a by-product (Figure 4-8A). To monitor this activity, HvPPA was used in a coupled assay to drive UbaA-mediated adenylation of SAMP1 and hydrolyze the PPi by- product to 2Pi for detection by colorimetric assay. Significant levels of Pi were detected when UbaA and HvPPA were coupled with ATP and SAMP1 in the reaction (Figure 4-

8B). Pi was not detected when ATP, UbaA, HvPPA, or SAMP1 was omitted from the adenylation assay (Figure 4-8B). Deletion of the C-terminal diglycine residues of

98

SAMP1 (ΔGG) was found to significantly reduce the level of Pi detected. Likewise, the reaction was found to be highly specific for ATP, with little if any Pi generated enzymatically when ATP was replaced by other nucleotides (AMP, ADP, AMPPNP,

CTP, GTP, TTP, and UTP) (Figure 4-8B). Based on these results, HvPPA was found to be useful for hydrolysis of PPi in coupled assays that require conditions of reduced water activity and high temperature.

Conclusions for HvPPA Study

Here a class A type PPA of the haloarchaeon Hfx. volcanii (HvPPA) is reported that is evolutionarily, structurally, and biochemically distinct from PPAs that have been characterized. HvPPA displays thermostable and solvent-tolerant properties and has catalytic activities that are useful for biotechnology applications. HvPPA was found to be useful for coupled assay with enzymes that generate PPi as a by-product, and it can perform this activity under conditions of high temperature and reduced water activity and is functional over a wide range of salt concentrations. We demonstrate the use of

HvPPA in a novel coupled assay to detect the PPi by-product released at reduced water activity (2 M NaCl) by ATP-dependent adenylation of the ubiquitin-like SAMP1 by the salt-loving E1-like enzyme UbaA. In contrast, current PPAs are inactivated in dose- dependent manner by salt and organic solvents (197-199). Our discovery of HvPPA and its function opens new possibilities for the hydrolysis of PPi and related compounds in systems which benefit from the use of high-ionic strength compounds and/or organic solvents.

99

Table 4-1. Purification of HvPPA from Haloferax volcanii Purification Total Activity Sp act Approx. (fold -1 Fraction Protein (mg) (U ± SD) (U·mg ± SD) Yield (%) enrichment) Lysate 1680 356 ± 30 0.21 ± 0.02 100 1 HisTrap HP 23 180 ± 14 8.0 ± 0.6 51 38 Superdex 200 3.0 204 ± 0.3 68 ± 0.5 57 322 a Based on standard purification from 4 x 1-liter culture of Hfx. volcanii strain H26- pJAM2920. PPA activity monitored in Tris-salt buffer at 37 °C and pH 8.5 with 0.1 mM PPi for 10 min. U, units defined as µmol product·min-1. SD, standard deviation of three experiments.

100

Table 4-2. Archaeal inorganic pyrophosphatases (E.C. 3.6.1.1) of the class A type (IPR008162 family) Thermoplasma Pyrococcus Sulfolobus Methanothermobacter Thermococcus Organism Haloferax volcanii acidophilum horikoshii sp. thermautotrophicus thioreducens STK_05240 MTH_263 H0USY5_ Gene locus_tag Ta0399 PH1907 HVO_0729 Saci_0955 (presumed) 9EURY Amino acid 179 aa 178 aa 172-173 aa 176 aa 178 aa 177 aa number (aa) 4.83 – 4.92 (4.8 pI (theoretical) 5.33 4.97 4.69 4.76 3.98 obs)

Mr (theoretical) 20.5 kDa 20.8 kDa 19.4 kDa 20.1 kDa 20.9 kDa 20.4 kDa

Mr (observed) 6 × 22 kDa 6 × 24.5 kDa 4-6 × 17-21 kDa 2-4 × 25 kDa ̶ 3-6 × 27 kDa Cation- 2+ 2+ 2+ 2+ 2+ 2+ 2+ 2+ Mg ; Co , Zn , Mg ; Co , Zn , Mg ; 2+ 2+ dependence Mg 2+ 2+ 2+ ̶ Mg , Mn Mn (partial) Mn (partial) Co (partial)

Ca2+, NaF, Ca2+, Inhibitors NaF NaF ̶ NaF phenylglyoxal phenylglyoxal

PPi [pNP, PEP (1- PP [P3 (2.7%); Substrate(s) i 2%); ATP, P , PP ATP (5.9%); ADP 3 PP ̶ PP hydrolyzed i ADP (3-6%); TTP, i i (2.9%)] ITP (10%)] 0.55 mM PPi (42 ºC) 7 μM PPi 14-11 μM PPi 5 μM PPi 0.16 mM PPi 0.26 mM PPi (25 ºC) K 2+ 2+ 2+ 2+ ̶ 2+ m 1.7 mM Mg 0.3 mM Mg 0.9 mM Mg 4.9 mM Mg 13.4 mM Mg ( 25 ºC) -1 -1 -1 1100 U·mg 930 U·mg -1 -1 465 U·mg (42 ºC) V 860 U·mg (75ºC) 570 U·mg ̶ -1 max (56ºC) (60ºC) 53 U·mg (25 ºC) -1 -1 -1 -1 Kcat 2200 s 744-3436 s 1700 s ̶ ̶ 1050 s 2.1 (PPi, 42 ºC) 2+ Cooperative 2+ 3.3 (PPi), Hill coefficient(s) 1.8 (Mg ) 1.9 (Mg ) 2+ ̶ 1.4 (PPi, 25 ºC) binding 2.0 (Mg ) 2+ 2.6 (Mg , 25 ºC) Temp., optimum 85 ºC 70-88 ºC 75 ºC 70 ºC ̶ 42 ºC pH, optimum pH 7.5-10 pH 6.5-7.0 pH 7.7 (60ºC) ̶ pH 8.5 (25 ºC) Thermal 50 min 2.5 h (95 ºC) inactivation ̶ ̶ 2 h (65 ºC) (105 ºC) >24 h (75 ºC) (half-life)

101

Table 4-2. Continued Thermoplasma Pyrococcus Sulfolobus Methanothermobacter Thermococcus Organism Haloferax volcanii acidophilum horikoshii sp. thermautotrophicus thioreducens Soluble, Yes Yes Yes Yes ̶ Yes cytoplasmic Heterologous E. coli E. coli E. coli ̶ E. coli ̶ system 3Q4W, 3I98, Crystal structure ̶ 1UDE 1QEZ ̶ 3R5U, 3R5V, ̶ (PDB number) 3R6E, 3Q9M DNA polymerase DNA polymerase Coupled assay ̶ ̶ ̶ Ub/Ubl adenylation (PCR, sequencing) (PCR) (115, 131, 204, (117, 132, 133, 206, (116), Ref. (130, 202, 203) (134) This study 205) 207) unpublished a Accession numbers: HVO_0729, D4GT97; PH1907, O59570; Ta0399, P37981; MTH_263, O26363; STK_05240, Q974Y8; Saci_0955, P50308; H0USY5_9EURY, H0USY5. Sulfolobus species included S. acidocaldarius ATCC 33909 and S. tokodaii strain 7. b —, not reported. -1 -1 -1 c U · mg is µmol PPi hydrolyzed min (mg protein) . Vmax is the highest reported.

102

Figure 4-1. Evolutionary relationships of archaeal inorganic pyrophosphatases of the IPR008162 family. Phylogenetic tree of amino acid sequences was used to represent the evolutionary relationships of archaeal PPAs. Archaeal PPAs biochemically characterized are highlighted (●) including Thermoplasma acidophilum TaPPA (Ta0399) (130, 202, 203), Pyrococcus horikoshii PhPPA (PH1907) (115, 131, 204, 205), Sulfolobus sp. StPPA (STK_05240) and SaPPA (Saci_0955) (117, 132, 133, 206, 207), Methanobacterium thermoautotrophicum MtPPA (MTH_263) (134), and Thermococcus thioreducens TtPPA (H0USY5_9EURY) (116) and Hfx. volcanii HvPPA (HVO_0729) [this study]. The optimal tree with the sum of branch length of 15.65877199 is represented. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. See methods for details.

103

Figure 4-2. Structural comparison of Class A type inorganic pyrophosphatases. A) Multiple amino acid sequence alignment of PPAs. Highlighted are identical (black), functionally similar (grey), Cys-X63-Cys motif (blue) and conserved active site (red) residues. Predicted α-helix and β-sheet structures and Asp residues (*) coordinating Mg2+/Mn2+ are indicated above the alignment. Abbreviations are as in Figure 1. B) 3D-structural comparison of PPAs. 3D- structural model of HvPPA (blue ribbon) compared to the X-ray crystal structures of PhPPA (PDB:1UDE) (tan ribbon), SaPPA (PDB:1QEZ), TtPPA (PDB:3R5U) and S. cerevisiae ScPPA (PDB:1E9G). Mn2+ ions (purple ball), phosphate ions (orange and red stick), and water (red ball) ligands are overlaid onto the 3D model. C-terminal (Ct) and N-terminal (Nt) residues are indicated. HvC24 and HvC85 are cysteine residues conserved in all haloarchaeal PPAs. Conserved active site residues analogous to ScPPA include: HvK31 (ScK56), HvE33 (ScE58), HvR45 (ScR78), HvY57 (ScY93), HvD67 (ScD115), HvD69 (ScD117), HvD72 (ScD120), HvD99 (ScD147), HvD104 (ScD152), HvK106 (ScK154), HvY141 (ScY192) and HvK142 (ScK193). HvD67, HvD72 and HvD104 are predicted to coordinate the Mg2+ and Mn2+ ions. HvPPA 3D-structure was modeled by Phyre2 intensive-mode at a confidence of >90% accuracy for 175 out of 177 residues (99%).

104

Figure 4-3. Comparison of electrostatic potential of PPAs. Electrostatic potential as represented by Coulombic Surface Coloring with the unit of the potential colored in a range of values -10 (red), 0 (white), and 10 (blue) kcal/mol · e using Chimera v 1.7.

105

Figure 4-4. Class A type inorganic pyrophosphatase purified from Haloferax volcanii by tandem affinity and size exclusion chromatography. A) HvPPA fractions analyzed by SDS-PAGE. Hfx. volcanii H26 (lane 1) and H26-pJAM2920 2+ expressing His6-HvPPA (lane 2) applied at OD600 of 0.065 per lane. Ni - Sepharose (lane 3) and Superdex 200 GL10/300 (lane 4) chromatography fractions of HvPPA applied at 1 µg protein per lane. Protein was separated by reducing 10 % SDS-PAGE and analyzed by Coomassie Blue R-250 staining (upper) and anti–His6 immunoblotting (lower). B) HvPPA analyzed by Superdex 200 30/100 GL size exclusion chromatography. Column fractions are represented by a semi-log plot of molecular weight (Mr in kDa) verses Kav with molecular mass standards (●) and HvPPA hexamer (□, 134 kDa) and trimer (○, 64 kDa) indicated.

106

Figure 4-5. Effect of pH, temperature, salt and divalent cations on Haloferax volcanii inorganic pyrophosphatase (HvPPA) activity. A-C) HvPPA was equilibrated for 10 min at the pH, temperature, and NaCl concentrations indicated prior to addition of PPi (0.25 mM). MgCl2 (2.5 mM) was included in the activity assays. For pH optimum, assays were in 3 M NaCl with 20 mM buffer [sodium acetate (pH 4-5), MES (pH 6-6.5), Tris-Cl (pH 7-9) and CAPS (pH 10)] and 100% activity reported is 3.19 U · mg-1. For temperature optimum assays, reactions were in 20 mM Tris-Cl pH 8 buffer containing 3 M NaCl and 100% activity reported is 28.37 U · mg-1. For salt optimum, HvPPA was diluted into 20 mM Tris-Cl pH 8 buffer with NaCl concentrations as indicated and 100% activity reported is 1.02 U · mg-1. D) To test the influence of cations, HvPPA was dialyzed sequentially against 500 ml of buffer (20 mM Tris-Cl pH 8, 2 M NaCl and 1 µM EDTA) (4 h at 4ᵒC) and the same buffer with EDTA omitted (4 h at 4ᵒC). Reactions for panel D contained HvPPA (0.93 μg), 20 mM Tris-Cl pH 8, 2 M NaCl, 0.25 mM PPi and divalent metal at the concentration indicated and 100% activity reported is 0.83 U · mg-1. Metals used were: CaCl2·2H2O, ZnCl2, CoCl2·6H2O, MnCl2·4H2O, NiCl2·6H2O and MgCl2·6H2O. E) Non-EDTA treated HvPPA assayed in 20 mM Tris-Cl pH 8, 2 M NaCl, 0.25 mM PPi and MgCl2 at the concentrations indicated and 100% activity reported is 23.9 U · mg-1. Reactions were monitored for 10 min at RT unless otherwise indicated. 100% activity is relative to highest reported within each panel (A-E).

107

Figure 4-6. Sodium fluoride-based inhibition of Haloferax volcanii inorganic pyrophosphatase (HvPPA). A) HvPPA (1.3 µg) was assayed in 1 ml reaction volume containing 1 mM PPi, 10 mM MgCl2, 3 M NaCl and 20 mM Tris-Cl buffer pH 7.5 supplemented with NaF as indicated. Reactions were monitored for 15 min at RT and 100% activity reported is 1.34 U · mg-1. B) Amino acid residues of HvPPA predicted to interact with F-, PPi, H2O and Mg2+ bound molecules as determined by modeling compared to the x-ray crystal structure of E. coli PPA (PDB: 2AUU).

108

Figure 4-7. Effect of salt, solvent, and temperature on Haloferax volcanii inorganic pyrophosphatase (HvPPA) activity. A) HvPPA thermostability. HvPPA was incubated at 42 °C and 65 °C as indicated with enzyme at 0.093 mg per ml of buffer (20 mM Tris-Cl [pH 8], 2.5 mM MgCl2, and 3 M NaCl). HvPPA was diluted to 0.28 µg per 100 µl buffer (with MgCl2 increased to 10 mM) and assayed by addition of 1 mM PPi substrate (10 min, room temperature). Activity is relative to that of samples incubated on ice and 100% activity reported is 6.08 U · mg-1. B) HvPPA stability in 50% (v/v) solvent. HvPPA was incubated for 2 h (on ice) at 0.47 mg per ml buffer (20 mM Tris-Cl [pH 8] and 2 M NaCl) supplemented with solvent as indicated. HvPPA was diluted to 2.4 µg per 100 µl buffer (20 mM Tris-Cl [pH 8], 2.5 mM MgCl2, and 2 M NaCl) and assayed by addition of 50 µM PPi substrate (10 min, room temperature). Activity is relative to that of samples incubated with no solvent and 100% activity reported is 0.16 U · mg-1 for 30% solvent and 0.15 U · mg-1 for 40 and 50% solvent. C) HvPPA activity in 25% (v/v) solvent. Reaction mixtures were 500 µl with 2.8 µg HvPPA, 1.5 M NaCl, 1.5 mM PPi, and 10 mM MgCl2. Reaction was for 10 min at room temperature and 100% activity reported is 1.38 U · mg-1. D) HvPPA stability in salt. HvPPA was incubated for 2 h (on ice) at 0.3 mg per ml of buffer (20 mM Tris-Cl, pH 8) supplemented with NaCl at the concentrations indicated. HvPPA was diluted to 0.87 µg per 100 µl reaction buffer as for panel B. Activity is relative to that of samples incubated in buffer supplemented with 3 M NaCl and 100% activity reported is 0.515 U · mg-1.

109

Figure 4-8. Haloferax volcanii inorganic pyrophosphatase (HvPPA) coupled adenylation assay at high temperature and reduced water activity. A) Schematic of the coupled assay. Adenylation of the ubiquitin-like SAMP by the E1-like enzyme 4- UbaA was monitored by HvPPA-mediated hydrolysis of the PPi (P2O7 ) by- 2- product to 2Pi (2 mol HPO4 ) at 42°C. B) Generation of Pi correlated with the addition of ATP, UbaA, HvPPA, and SAMP1 to the assay buffer. ΔGG, C- terminal diglycine residue deletion.

110

CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS

Summary of Results

The SILAC study was a successful start to identifying the proteomic oxidative stress response in Hfx. volcanii. This study revealed likely protein first-responders to oxidative stress including transcription factors and metal transport proteins. Over half of the predicted proteins in the Hfx. volcanii proteome were identified with high confidence making this is one of the most comprehensive studies of archaeal proteomics to date.

The results from this study is expected to impact the archaeal and oxidative stress research areas by providing expression data for proteins involved in oxidative stress, abundances for some of the most and least expressed proteins in the archaeal cell, and representation of several predicted hypothetical proteins. This study has raised several questions and experiments to address them are elaborated below in the future directions section.

Characterization of the inorganic pyrophosphatase has provided more evidence that halophilic proteins are quite resilient. HvPPA is a class-A type inorganic pyrophosphatase and stands out from other characterized archaeal PPAs. HvPPA is functional from 25 °C to 50 °C, a broad range for many applications. HvPPA was able to tolerate a wide range of salt concentrations and up to 25% (v/v) organic solvents. These characteristics set HvPPA apart from other characterized inorganic pyrophosphatases and might have unique industrial applications (19). Organic solvent activity allows for

PPA to be used in applications where substrates or products are insoluble in water for the first time.

111

Future Directions

Using quantitative proteomics to discover effects of certain treatments provides only a snapshot of one time point in the cell. In order to understand the full cellular response to oxidative stress by NaOCl, more SILAC proteomics experiments need to be done. Ideally, monitoring proteomic changes on a logarithmic time scale after treatment until the cellular response is complete (meaning there are no more expression changes between the control and treatment groups) through as many subcultures as needed. A time course would provide evidence for what protein expression changes are necessary for oxidative damage monitoring, response, and cleanup. In order to understand gene regulation under oxidative stress, RNA-seq or microarray experiments should be done to monitor transcriptome changes, specifically to complement the proteomics data and to connect global transcriptional regulators to roles they play. In addition to transcriptome and proteome information, a metabolome study would tell us the biochemistry occurring in the cell after oxidant treatment. In this study, NaOCl was added only at late log phase; studies should be done monitoring proteome changes when added to stationary phase or early log phase. While the response to oxidative stress by NaOCl is highlighted in this work, other oxidants might have different cellular responses and could be studied using SILAC and the approaches mentioned above.

In addition to large “-omic” style studies, a Hfx. volcanii transposon library (219) is being used to identify isolates which have resistance to NaOCl levels beyond tolerable for the parent strain. In isolates displaying resistance to NaOCl, the transposon is interrupting a gene, operon, or regulatory element allowing for resistance to oxidative damage. This project is complementary to the SILAC project by providing in vivo data,

112

on genes which, if disrupted/altered/upregulated, will allow the cell to overcome higher levels of stress. Confirmation will be done by markerless deletion or gene overexpression to mimic the resistance phenotype.

The shotgun proteomic data contained a large amount of uncharacterized and hypothetical proteins. The archaeal community would greatly benefit from identification and characterization of hypothetical genes. Searching the SILAC proteomic data from a database containing all 6 reading frames in Hfx. volcanii would be helpful in identifying new genes. Re-annotation of genes from proteomic data is a great way to assign gene names and functions after confirmation they are expressed. By learning expression characteristics of hypothetical proteins or annotated proteins with no experimental data after exposure stressors, functions can be predicted and tested.

Differentially expressed first responder proteins to oxidative stress annotated as hypothetical have potential to be important regulator or sensor proteins which could have implications in human health. Oxidative damage is a contributing factor to aging and many diseases such as cardiovascular and Alzheimer’s (220). Archaeal proteins often have similarities to their eukaryotic and bacterial homologs (31) working as a model system for understanding function of conserved proteins as well as a model for evolutionary understanding. In addition to health related findings, proteome studies could provide insight into the earliest oxidative stress response systems in ancient life.

The SILAC-ready strain was originally developed to study the ubiquitin-like small archaeal proteins (SAMPs) and proteins they modify under different conditions in Hfx. volcanii. The ubiquitin-like proteins have been studied after in trans overexpression but have not yet been studied when expressed from the genome. To study SAMP protein

113

partners where the SAMPs are expressed at physiological levels, an N-terminal Flag tag fused to a His6 tag was integrated onto the genome of SAMP2 and SAMP3. When Hfx. volcanii cells are treated with bortezomib, a specific inhibitor of the proteasome, SAMP2 expressed in trans is attached to many more protein partners than when compared to the mock control (33), suggesting these proteins have been modified with SAMP2 as a degradation signal for proteasome-mediated degradation. SAMP3 and SAMP1 protein partners are increased when the cells are treated with DMSO, a mild oxidizing agent, when compared to no treatment (33, 36). Using SILAC, we can determine the protein partners of archaeal ubiquitin-like proteins under oxidizing conditions or under proteasome inhibition in Hfx. volcanii to better understand the role of each modification.

The SILAC-ready strain can be used in endless applications where relative abundances for protein expression are of interest. Mass spectrometers require only a few micrograms of protein and SILAC can be used to label all proteins without sample loss.

The double auxotrophic strain used for the SILAC study was created by deleting two amino acid biosynthesis genes not yet reported to have a function in Hfx. volcanii.

Both lysA and argH functions have not yet been studied from Hfx. volcanii, and could be overexpressed, purified, and characterized. The single auxotrophic strain for lysine or arginine could be used as a parent strain for experiments which need a new selectable marker. Both LysA and ArgH are able to complement the deletion when expressed in trans and could be used as a selectable marker in minimal medium.

Inorganic pyrophosphatase from Hfx. volcanii has solvent tolerance likely due to the high proportion of acidic amino acids on the protein surface. Using site-directed mutagenesis, the non-acidic amino acids which model to the protein surface could be

114

changed into acidic amino acids to make the protein resistant to higher levels of organic solvents. There are 2 conserved cysteine residues found only in the halophilic PPAs, one, Cys85, models to the intersubunit surface. This cysteine residue might play a role in the increased stability of HvPPA in low water conditions. In order to test this hypothesis, site directed mutagenesis can be used to change the cysteine residue to determine the effect on protein activity in organic solvents and higher temperatures.

Another question worth investigating is if proteins from E. coli or S. cerevisiae can be engineered with acidic residues on the surface to allow for stability in organic solvents.

Altering too many residues can impact structure, and function as a result, so engineering non-halophilic proteins to be tolerant to solvents could be challenging.

The activity of HvPPA was not recorded in the presence of urea or detergents and could be explored further to determine if the enzyme can retain activity after treatment. Class A type inorganic pyrophosphatases are inhibited with phenylglyoxal, and that was not tested either. We determined Mg+2 was likely the divalent cation used by HvPPA in the active site at an optimal concentration of 25 mM. To determine the active site metal, we dialyzed HvPPA with EDTA to chelate metals bound to the active sites then added various divalent metals to test activity. The addition of Mn+2 at 1 mM allowed for high activity, and only after treatment with EDTA. HvPPA activity with Mn+2 at concentrations higher than 1 mM became inhibitory, and Mn+2 was unable to activate

HvPPA without EDTA treatment. EDTA treatment likely allowed Mn+2 to replace Mg+2 in the active site due to a higher affinity for Mg+2. In order to address this question experimentally, Km can be determined for both divalent cations.

115

X-ray crystallography can be used to determine the structure of HvPPA under different conditions. When inhibitor is bound, HvPPA structure might be altered when compared to the control enzyme with no inhibitor. HvPPA structure after exposure to organic solvents and saturating levels of salt might provide insight as to how HvPPA can sustain activity in low water conditions. Monitoring structure changes over various salt concentrations can show how HvPPA and other halophilic proteins lose activity after storage in low salt.

Each study provides information to be questioned which will inspire the next study. Many research projects can be rooted from a shotgun proteomics data set, leading to endless new research topics.

116

APPENDIX SUPPLEMENTARY TABLES FROM SILAC STUDY

Table A-1. All proteins identified in SILAC study Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GZY6 94.30 32.5 130 elongation factor 1-alpha D4GXP3 93.10 3.5 14 BolA family transcriptional regulator D4GZY3 90.89 58 232 elongation factor EF-2 D4GVT8 89.83 6.75 27 peptidyl-prolyl cis-trans isomerase D4GY71 87.25 19.5 78 aspartate carbamoyltransferase D4GYF3 87.04 22.5 90 acetolactate synthase small subunit D4GWU2 85.31 13.75 55 polyketide cyclase D4GTY0 85.25 9 36 50S ribosomal protein L6 D4GS68 84.38 7.75 31 DNA starvation/stationary phase protection protein D4GZS0 84.18 13.5 54 rpa-associated protein D4GRX4 83.78 11.75 47 NADPH-dependent F420 reductase D4GWZ3 82.29 16.75 67 30S ribosomal protein S4 D4GSX8 81.31 17.25 69 acetyltransferase D4GS21 81.07 23 92 type I glyceraldehyde-3-phosphate dehydrogenase D4GQN6 80.96 21.25 85 type I-B CRISPR-associated protein Cas7/Csh2 anaerobic glycerol-3-phosphate dehydrogenase D4GYI3 80.75 21 84 subunit B Q8NKQ2 80.71 15.75 63 orotate phosphoribosyltransferase D4H018 80.51 7 28 hypothetical protein D4GP55 80.31 7.5 30 hypothetical protein D4GZH5 80.07 3.75 15 HIT family protein D4GZ06 79.66 14.5 58 TrmB family transcriptional regulator D4GSH7 79.63 26.5 106 cell division protein FtsZ D4GX17 79.48 7 28 hypothetical protein D4GQN4 79.41 19.5 78 CRISPR-associated protein Cas6 D4GQV1 79.21 15 60 fructose 1,6-bisphosphatase Q48329 79.12 15.75 63 ATP synthase subunit E D4GXG2 79.04 21.5 86 serine hydroxymethyltransferase D4GY31 78.84 13.25 53 phosphoserine phosphatase SerB D4GXF2 78.44 20.25 81 chorismate synthase D4GTF0 78.37 38 152 serine--tRNA ligase D4GZV8 78.37 28.5 114 branched chain amino acid aminotransferase D4GZY7 78.19 8.25 33 30S ribosomal protein S10 D4GVH4 77.58 18.75 75 peptidase D4GU21 76.88 14 56 fructose-bisphosphate aldolase D4GV67 76.78 18.25 73 oxidoreductase D4GSW1 76.66 12 48 30S ribosomal protein S19e D4GWY3 76.51 8.25 33 50S ribosomal protein L18e D4GUU7 76.38 36.75 147 phosphoserine phosphatase D4GUJ7 75.55 26.75 107 Proteasome-activating nucleotidase 1 pan1/ panA D4GWA5 75.34 18.75 75 30S ribosomal protein S3ae 2-ketoglutarate ferredoxin oxidoreductase subunit D4GXE9 75.32 16.5 66 beta D4GYF2 75.22 18 72 ketol-acid reductoisomerase D4GW81 74.62 6.5 26 50S ribosomal protein L24 D4GTZ6 74.56 18 72 50S ribosomal protein L3 D4GTC9 74.50 7.75 31 30S ribosomal protein S24e

117

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GST5 74.44 8.75 35 30S ribosomal protein S6e D4GZ77 74.07 20.75 83 S-adenosylmethionine synthetase D4GXL4 73.81 11 44 acetyltransferase D4GW85 73.76 7 28 hypothetical protein D4GWR0 73.51 23.25 93 elongation factor 1-alpha D4H026 73.21 10.5 42 hypothetical protein D4GPT4 72.82 7.5 30 hypothetical protein D4GXM1 72.37 15.25 61 rRNA metabolism protein D4GYK7 72.37 11 44 IMP cyclohydrolase D4GW02 72.34 6.5 26 universal stress protein D4GUV4 71.95 16.5 66 2-oxoacid ferredoxin oxidoreductase subunit beta D4GUK7 71.90 28.5 114 Fe-S cluster assembly protein SufB D4GXX8 71.87 10.75 43 nonhistone chromosomal protein O30561 71.87 31.25 125 thermosome subunit 1 D4GTZ5 71.47 15.75 63 50S ribosomal protein L4 D4GP86 71.38 5 20 DNA polymerase III subunit delta' D4GVI6 71.10 19 76 aryl-alcohol dehydrogenase D4GVU2 70.90 20 80 anthranilate phosphoribosyltransferase D4GU26 70.88 17.25 69 cell division protein FtsZ D4GTR9 70.71 10.75 43 deoxyribonuclease D4GS48 70.71 12.25 49 NAD-dependent epimerase Q9HHA2 70.61 31.5 126 thermosome subunit 3 D4GXX2 70.57 25.75 103 heme ABC transporter ATP-binding protein D4GXM0 70.51 43.5 174 nuclease D4GQN5 70.43 49.25 197 type I-B CRISPR-associated protein Cas8b/Csh1 D4GWM1 70.20 7.75 31 30S ribosomal protein S8e D4GUY2 70.16 26.25 105 dihydroxy-acid dehydratase D4GZS1 69.94 18.25 73 hypothetical protein D4GTI5 69.90 5 20 deoxyuridine 5'-triphosphate nucleotidohydrolase D4GWM8 69.89 45.5 182 ATPase D4GYA8 69.84 4.25 17 hypothetical protein D4GW49 68.89 28 112 ribonuclease J P43386 68.86 28.5 114 glutamine synthetase P50563 68.75 5.75 23 50S ribosomal protein L18 D4GYI2 68.69 29.5 118 FAD/NAD(P)-binding oxidoreductase D4GV06 68.55 24.5 98 electron transfer flavoprotein D4GQ53 68.51 9.25 37 hypothetical protein D4GP54 68.45 19.75 79 dehydrogenase D4GR72 68.39 4.25 17 hypothetical protein D4GXI4 68.31 5.25 21 hypothetical protein D4GWX9 68.30 6.25 25 transcriptional regulator D4GUW2 68.30 19.25 77 phage shock protein A D4GVJ9 68.09 15.25 61 oxidoreductase D4GVT4 67.90 28.5 114 phosphoribosylglycinamide formyltransferase D4GWB2 67.90 14.5 58 30S ribosomal protein S15 D4GUM3 67.72 8.25 33 methylglyoxal synthase D4GUL6 67.64 91 364 glutamate synthase subunit alpha D4GZ01 67.61 39.75 159 DNA gyrase subunit B D4GX33 67.59 16.75 67 aldo/keto reductase D4GWR6 67.58 26 104 hydroxymethylglutaryl-CoA synthase

118

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GXL0 67.56 20.25 81 replication protein A D4GUK6 67.52 15.75 63 ABC transporter ATP-binding protein D4GUL4 67.50 13.5 54 phosphohydrolase D4GVS7 67.47 53.5 214 ATPase AAA D4GX92 67.37 25 100 IMP dehydrogenase D4GTE0 67.30 26 104 ATPase AAA D4GY45 67.28 15.75 63 hypothetical protein D4GYV8 67.17 12 48 hypothetical protein D4GT52 67.15 7 28 hypothetical protein D4GRW2 67.09 32.75 131 ATPase D4GT09 66.94 20.25 81 aspartate--tRNA(Asn) ligase D4GVS6 66.76 9 36 hypothetical protein D4GXP5 66.58 17.75 71 class II fumarate hydratase D4GTX5 66.56 8 32 50S ribosomal protein L30 D4GW53 66.45 29.5 118 glutamate--tRNA ligase D4GS85 66.38 14.5 58 ferrichrome ABC transporter ATP-binding protein D4GXB4 66.38 13.25 53 GTP cyclohydrolase IIa D4GVR1 66.36 9.25 37 adenine phosphoribosyltransferase D4GW43 66.28 18.5 74 amidophosphoribosyltransferase Q48333 66.19 25.25 101 V-type ATP synthase subunit B D4GPJ9 66.14 16.75 67 iron ABC transporter substrate-binding protein D4GZC4 66.12 11 44 23S rRNA methyltransferase D4GVH6 65.74 18.25 73 hypothetical protein D4GUL7 65.73 25.75 103 proline--tRNA ligase D4GS20 65.71 19.75 79 phosphoglycerate kinase D4GVP3 65.64 13 52 thioredoxin reductase D4GSB2 65.62 37.75 151 ferredoxin--nitrite reductase D4GU13 65.50 24.5 98 aspartate oxidase D4GQQ7 65.46 9.5 38 phosphatase D4GZT9 65.45 6.75 27 V-type ATP synthase subunit H Q48328 65.45 16.5 66 DNA repair and recombination protein RadA D4GTJ3 65.43 4.25 17 photosystem reaction center subunit H D4GPQ1 65.26 11 44 fructose 1,6-bisphosphatase D4GZC8 65.09 4 16 CopG family transcriptional regulator D4GZY5 65.06 8.75 35 homoserine dehydrogenase D4GTK2 64.97 7.25 29 hypothetical protein D4GSM9 64.93 13.5 54 N-acetyltransferase D4GWG6 64.92 6.25 25 translation initiation factor IF-5A D4GVJ5 64.89 36 144 hypothetical protein D4GZ00 64.66 45.75 183 DNA topoisomerase VI subunit B P41199 64.62 12.75 51 50S ribosomal protein L1 D4GT67 64.49 11 44 zinc-binding dehydrogenase D4GVX2 64.45 32.25 129 hypothetical protein D4GYD8 64.29 8.5 34 hypothetical protein D4GZF1 64.10 46 184 alanine--tRNA ligase D4GT91 64.06 13.75 55 short-chain dehydrogenase/reductase D4GUZ3 64.00 14.5 58 glyoxalase D4GV86 63.96 19 76 membrane protein D4GZV0 63.95 26.75 107 peptide chain release factor 1 D4GSR8 63.93 18.5 74 tRNA pseudouridine(13) synthase TruD

119

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GRU4 63.92 6 24 prolyl-tRNA editing protein D4GZN1 63.64 8.75 35 transcriptional regulator D4GWT1 63.56 16 64 endoglucanase D4GTB8 63.52 13.5 54 aspartate-semialdehyde dehydrogenase D4GP60 63.44 13.75 55 cobalt-precorrin-2 C(20)-methyltransferase D4GR98 63.22 2.75 11 Uncharacterized protein HVO_A0432 D4GSQ2 63.18 21.25 85 citramalate synthase D4GZR9 63.14 6 24 CopG family transcriptional regulator D4GTR3 63.12 8 32 molecular chaperone Hsp20 O30560 63.11 31.25 125 thermosome subunit 2 D4GP43 63.03 38.25 153 iron transporter D4GTB6 63.01 9.75 39 hypothetical protein D4GYS6 62.92 17.25 69 aspartate aminotransferase family protein 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N- D4GW24 62.77 14.25 57 succinyltransferase D4GXP9 62.74 31.5 126 glutamyl-tRNA(Gln) amidotransferase subunit E D4GXW9 62.74 24.25 97 electron transfer flavoprotein D4GVS5 62.66 6 24 peroxiredoxin D4GTB5 62.65 31.25 125 carbamoyl phosphate synthase D4GS18 62.61 12.75 51 glyceraldehyde-3-phosphate dehydrogenase D4GQE6 62.58 9 36 transcriptional regulator D4GZE4 62.53 19.75 79 phosphoglucomutase D4GYI5 62.50 33 132 glycerol kinase D4GYW2 62.50 6.25 25 50S ribosomal protein L31e D4GTY1 62.50 8.75 35 30S ribosomal protein S8 methylated-DNA--protein-cysteine D4GU11 62.42 6.25 25 methyltransferase D4GYS8 62.40 5 20 nitrogen regulatory protein P-II D4H0A8 62.30 6.5 26 hypothetical protein D4GTX9 62.23 13.75 55 50S ribosomal protein L32e D4GVC4 62.08 15.75 63 formyltetrahydrofolate deformylase D4GYW4 62.07 3.75 15 50S ribosomal protein L18a D4GZX4 61.90 34.5 138 DNA-directed RNA polymerase subunit B'' D4GTY7 61.62 6.5 26 30S ribosomal protein S17 D4GX88 61.48 9 36 DNA-binding protein D4GYM0 61.45 12 48 sulfurtransferase D4GVF7 61.13 25.5 102 NADH-quinone oxidoreductase subunit C D4GUG6 61.11 26.5 106 CTP synthetase D4GTZ4 61.04 5 15 50S ribosomal protein L23 D4GZP8 60.96 37.25 149 threonine--tRNA ligase D4GVR8 60.94 3 9 transcriptional regulator D4GZX5 60.71 35.5 142 DNA-directed RNA polymerase subunit B D4GUC3 60.57 37.25 149 methionine--tRNA ligase D4GUK1 60.53 55 220 chromosome segregation protein SMC D4GWI5 60.43 15.25 61 pyridoxal 5'-phosphate synthase lyase subunit PdxS D4H019 60.20 55.75 223 ABC-ATPase UvrA 2-ketoglutarate ferredoxin oxidoreductase subunit D4GXF1 60.14 23.75 95 alpha D4GRU5 60.11 4.75 19 translation initiation factor 1A D4GXR9 60.08 19.75 79 gamma-glutamyl-phosphate reductase

120

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GXU5 60.06 8.75 35 SAM-dependent methyltransferase D4GS31 59.97 8 32 pyridoxamine 5'-phosphate oxidase D4GV80 59.83 18.25 73 aspartate aminotransferase D4GWS5 59.80 8 32 transcription factor D4GU69 59.78 6.75 27 dTDP-4-dehydrorhamnose 3,5-epimerase D4GTY5 59.75 6.5 26 50S ribosomal protein L24 D4GWX0 59.71 14.75 59 phosphopyruvate hydratase Q1XBW3 59.63 15 60 nucleotide exchange factor GrpE D4H0F1 59.57 15.75 63 glucose-fructose oxidoreductase D4GY38 59.49 21.25 85 threonine synthase D4GZE8 59.48 16 64 ATPase AAA BMP family ABC transporter substrate-binding D4GXX3 59.35 14.25 57 protein D4GYM3 59.27 3.75 15 hypothetical protein D4GQ44 59.23 6 24 hypothetical protein D4GU24 59.12 16.75 67 3-dehydroquinate synthase II D4GXD0 59.05 7.5 30 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase D4GTI4 58.98 30.75 123 aconitate hydratase D4GWZ7 58.98 14 56 30S ribosomal protein S13 Q9V2V6 58.93 13 52 proteasome endopeptidase complex,subunit alpha D4GUG3 58.84 25 100 S9 family peptidase D4H056 58.77 65.25 261 glucoamylase D4GRV6 58.60 27.75 111 repair helicase D4GUD8 58.59 22.75 91 phytoene dehydrogenase D4GSX0 58.51 26.75 107 lysine--tRNA ligase D4GTW6 58.46 5 20 universal stress protein UspA D4GYM2 58.42 5.5 22 hypothetical protein D4GZL9 58.42 13.75 55 cysteine synthase Q9P9L2 58.39 15 60 malate dehydrogenase D4GUA4 58.37 26 104 phosphoesterase D4GVR4 58.37 8.5 34 DJ-1/PfpI/ThiJ superfamily protein D4GUM1 58.32 34.25 137 hypothetical protein D4GVT3 58.26 18.25 73 adenylosuccinate lyase D4GW69 58.24 15 60 thioredoxin reductase D4H014 58.14 24 96 ribonuclease R D4GUG0 58.11 52 208 phosphoenolpyruvate carboxylase D4GVV8 58.04 11 44 translation initiation factor IF-2 D4GWT5 57.97 13 52 mevalonate kinase D4GRY2 57.93 5 20 MBL fold hydrolase D4GU72 57.90 12.75 51 dTDP-glucose 4,6-dehydratase D4GZF8 57.83 6.5 26 rubrerythrin D4GVL9 57.80 9.25 37 hypothetical protein D4GTY4 57.79 14.75 59 30S ribosomal protein S4e D4GP48 57.79 15.25 61 diaminobutyrate--2-oxoglutarate transaminase D4H0D4 57.74 3 12 hypothetical protein D4GZJ0 57.70 6.75 27 phosphodiesterase D4GXE3 57.66 8.75 35 HTH DNA-binding protein D4GX38 57.64 27.25 109 succinate dehydrogenase D4GP61 57.52 19 76 cobalamin biosynthesis protein CbiG D4GVK4 57.50 6.5 26 twin-arginine translocase TatA/TatE family subunit

121

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GS22 57.50 3.5 14 type III effector protein Q977V2 57.42 20.5 82 signal recognition particle D4GUG8 57.38 16.25 65 GMP synthase D4GPB9 57.30 39 156 SMC-like protein Sph2 D4GWU7 57.28 25.5 102 hypothetical protein D4GZY0 57.22 9.5 38 30S ribosomal protein S12 D4GRU7 57.10 23.5 94 RNA-binding protein D4GP46 57.00 22.5 90 iron transporter D4GVU1 56.89 13.75 55 succinylglutamate desuccinylase D4GWX7 56.82 7.75 31 30S ribosomal protein S9 D4GXV8 56.79 7.75 31 biotin transporter BioY D4GRC3 56.79 11.5 46 chromosome partitioning protein ParA D4GUD0 56.60 39 156 phosphoenolpyruvate synthase D4GSC3 56.59 17.25 69 FAD-dependent oxidoreductase D4GTY9 56.43 3 12 50S ribosomal protein L29 D4GU70 56.37 16.5 66 glucose-1-phosphate thymidylyltransferase D4GTW8 56.31 12.5 50 TIGR00300 family protein D4GZX6 56.25 47 188 DNA-directed RNA polymerase subunit A' D4GZB1 56.19 19.25 77 adenosylhomocysteinase D4GSR4 56.18 7.5 30 50S ribosomal protein L37 D4GT80 56.05 2.5 10 30S ribosomal protein S17e D4GU92 56.03 23.5 94 isocitrate dehydrogenase (NADP(+)) D4GTX8 55.96 12.25 49 50S ribosomal protein L19e D4GTJ4 55.92 5.25 21 DNA-binding protein D4GXX4 55.91 18.25 73 phosphomannomutase D4GT46 55.83 12 48 translation initiation factor IF-2 subunit alpha D4H091 55.78 8.5 34 transcriptional regulator P41198 55.75 11.5 46 50S ribosomal protein L10 D4GY93 55.74 13 52 1,4-dihydroxy-2-naphthoyl-CoA synthase D4GU76 55.66 2.25 9 hypothetical protein D4GVD8 55.65 10.5 42 NADH dehydrogenase D4GVL7 55.65 12.75 51 MBL fold hydrolase D4GST2 55.59 17.5 70 hypothetical protein D4GQ22 55.58 21 84 aryl-alcohol dehydrogenase D4GU97 55.56 9.75 39 asparaginase D4GUU6 55.50 5.25 21 hypothetical protein D4GVT1 55.48 9.75 39 carboxylesterase D4GVC1 55.47 9.25 37 phosphoribosylformylglycinamidine synthase I D4GRD7 55.41 5.75 23 thioredoxin reductase D4GW72 55.36 21.75 87 cysteine--tRNA ligase D4GW83 55.36 31.5 126 adenylosuccinate synthase D4GZ07 55.35 18.75 75 NADH dehydrogenase D4GZX3 55.33 2.25 9 DNA-directed RNA polymerase subunit H D4GTE7 55.30 11 44 MBL fold hydrolase D4GP52 55.24 53.25 213 cobaltochelatase subunit CobN D4GW26 55.24 11.25 45 4-hydroxy-tetrahydrodipicolinate reductase D4GSQ0 55.23 13.25 53 Xaa-Pro aminopeptidase D4GYV3 55.11 5.25 21 iron-sulfur cluster scaffold-like protein ribonucleoside-diphosphate reductase, D4GT33 55.08 52 208 adenosylcobalamin-dependent

122

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GU60 55.06 13.75 55 N-acetylgalactosamine-6-sulfatase S-adenosylmethionine hydroxide D4GTT6 55.06 9 36 adenosyltransferase D4GPB8 55.05 10.75 43 hypothetical protein D4GXU1 55.00 2.75 11 DUF1508 domain-containing protein Q48331 54.95 4.5 18 ATP synthase subunit F D4GVF6 54.94 10.25 41 NADH dehydrogenase D4GZY1 54.78 10.5 42 30S ribosomal protein S7 D4GYS2 54.78 10.75 43 uroporphyrin-III C-methyltransferase D4GT36 54.72 10.75 43 methylthioadenosine phosphorylase D4GWZ1 54.62 6.5 26 30S ribosomal protein S11 D4GVK7 54.61 15.25 61 thioredoxin-disulfide reductase D4GXI7 54.52 26.5 106 ATPase AAA D4GY81 54.52 9 36 trehalose utilization protein ThuA D4GVS4 54.31 14.25 57 sulfate adenylyltransferase D4GZ79 54.17 5 20 translation initiation factor 1A bifunctional malic enzyme D4GSQ3 54.16 28 112 oxidoreductase/phosphotransacetylase D4GVY2 54.16 17 68 hypothetical protein D4GWT7 54.13 6.5 26 isopentenyl phosphate kinase D4GTX4 53.94 9.75 39 50S ribosomal protein L15 D4GU28 53.91 15.5 62 hypothetical protein D4GXD7 53.91 8.5 34 succinylglutamate desuccinylase D4GTG6 53.89 11.25 45 5,10-methylenetetrahydromethanopterin reductase D4GYT9 53.88 1.75 7 Uncharacterized protein HVO_0094 D4GV14 53.87 4.75 19 UspA domain-containing protein D4GXV1 53.87 7.5 30 transcriptional regulator D4GYG5 53.87 11.5 46 methyltransferase AglP D4GQU9 53.74 3.5 14 DNA polymerase III subunit delta' D4GXZ3 53.63 12.5 50 diphosphomevalonate decarboxylase D4GYF6 53.58 16.5 66 2-isopropylmalate synthase D4GST3 53.52 3.5 14 hypothetical protein D4GYS3 53.37 19 76 hydroxymethylbilane synthase D4GQB9 53.37 8 32 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase Q48332 53.37 23.75 95 ATP synthase subunit A Propionyl-CoA carboxylase carboxyltransferase D4GT75 53.25 22.25 89 component pccB2 D4GWP8 53.22 16.25 65 glycine dehydrogenase (aminomethyl-transferring) D4GT62 52.95 13 52 succinate--CoA ligase subunit beta D4GZV6 52.95 7.25 29 3,4-dihydroxy-2-butanone-4-phosphate synthase D4GSE8 52.89 25.5 102 DNA mismatch repair protein MutL D4GYC6 52.88 11.75 47 hypothetical protein D4GWK9 52.82 40.5 162 carbamoyl phosphate synthase large subunit D4GP49 52.63 18.5 74 iron ABC transporter substrate-binding protein D4GYY6 52.47 9 36 phosphoribosylformylglycinamidine cyclo-ligase D4GTJ2 52.46 27 108 translation initiation factor IF-2 inositol-1(or 4)-monophosphatase / fructose-1 6- D4GXF0 52.45 13 52 bisphosphatase type D4GSA2 52.44 25.5 102 catalase-peroxidase D4GWA6 52.34 5.75 23 50S ribosomal protein L21e

123

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GZS7 52.34 5.25 21 deoxyribonuclease D4GZU8 52.34 14.5 58 V-type ATP synthase subunit D D4GS78 52.31 2.75 11 heavy metal transporter D4GUV5 52.30 29.5 118 oxoglutarate--ferredoxin oxidoreductase D4GQ36 52.28 12.75 51 chromosome partitioning protein D4GTN7 52.25 2.25 9 hypothetical protein tRNA uridine(34) 5-carboxymethylaminomethyl D4GXL7 52.23 23.5 94 modification radical SAM/GNAT enzyme Elp3 D4GW15 52.16 9.25 37 ribonuclease P D4GSS1 51.92 8.25 33 deoxycytidine triphosphate deaminase D4H035 51.91 14 56 hypothetical protein D4GYD4 51.82 16.5 66 mandelate racemase D4GYB5 51.74 11.25 45 transcription initiation factor IIB 2 D4GQE7 51.72 1.75 7 hypothetical protein D4GTT9 51.66 30.25 121 ATP-dependent protease LonB D4GYQ0 51.50 10.25 41 CBS domain-containing protein D4GST7 51.44 12.25 49 aminopeptidase D4GTQ1 51.34 4.5 18 hypothetical protein D4GVQ6 51.23 13.25 53 oxidoreductase D4GQ37 51.11 16.75 67 XerC/D-like integrase D4GSG8 51.03 10.5 42 endonuclease IV D4GW35 50.94 6.75 27 tRNA-guanine transglycosylase phosphoribosylaminoimidazolesuccinocarboxamide D4GVC6 50.81 21.25 85 synthase Q9V2V5 50.80 9.75 39 proteasome subunit alpha Tat (twin-arginine translocation) pathway signal D4GXD3 50.73 5.75 23 sequence D4GYA6 50.71 2 8 surface glycoprotein-like protein D4GVG6 50.60 6.5 26 hypothetical protein D4GRZ1 50.56 7 28 molecular chaperone Hsp20 D4GQ18 50.55 14.5 58 aldehyde dehydrogenase D4GZJ8 50.50 6 24 threonylcarbamoyl-AMP synthase D4GZN0 50.45 7.5 30 phosphopantetheine adenylyltransferase D4GYR5 50.40 4.75 19 hypothetical protein D4GRF0 50.28 14.75 59 cobyrinic acid a,c-diamide synthase D4GYD7 50.25 15.25 61 haloacid dehalogenase D4GWA3 50.21 4.25 17 DNA-directed RNA polymerase subunit F D4GVW4 50.18 8.5 34 hypothetical protein phosphoribosylaminoimidazole carboxylase catalytic D4GVF4 50.12 7.5 30 subunit D4GTP6 50.08 11.25 45 NAD(P)-dependent oxidoreductase D4GW28 50.08 11.25 45 4-hydroxy-tetrahydrodipicolinate synthase D4GYC9 50.00 8.5 34 GTP-binding protein D4GQG4 50.00 3 12 MarR family transcriptional regulator D4GUV6 50.00 5.5 22 oxidoreductase precorrin-6Y C5,15-methyltransferase D4GP64 49.86 7 28 (decarboxylating) subunit CbiT D4GP73 49.86 14.5 58 IMP dehydrogenase aminotransferase class V-fold PLP-dependent D4GV29 49.80 18.5 74 enzyme

124

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GU81 49.80 9.75 39 cell division protein D4GW62 49.77 3.75 15 hypothetical protein Q7ZAG7 49.74 22.75 91 3-isopropylmalate dehydratase large subunit D4GP59 49.71 10 40 precorrin-3B C(17)-methyltransferase D4GTS3 49.68 7.25 29 short-chain dehydrogenase D4GZ54 49.66 26 104 hypothetical protein D4GW20 49.65 11.75 47 diaminopimelate epimerase D4GS55 49.64 21.5 86 replication protein A D4GXI0 49.51 6.5 26 chorismate mutase D4GR81 49.51 1.5 6 hypothetical protein D4GT23 49.50 21.75 87 aspartyl/glutamyl-tRNA amidotransferase subunit B D4GUF8 49.47 6.25 25 hypothetical protein D4GSZ6 49.46 16.75 67 serine/threonine protein kinase D4GWW8 49.42 9 36 30S ribosomal protein S2 D4GVC2 49.40 3.75 15 phosphoribosylformylglycinamidine synthase D4GV31 49.39 12 48 diguanylate cyclase D4GSH6 49.38 14.5 58 arginosuccinate synthase Q5UT56 49.33 16.25 65 peptidase D4GUK8 49.32 13.25 53 Fe-S cluster assembly protein SufD ribosome biogenesis/translation initiation ATPase D4GRW5 49.21 23.75 95 RLI D4GP47 49.18 21.75 87 2,4-diaminobutyrate decarboxylase D4GVL2 49.18 3 12 mannose-6-phosphate isomerase D4GU31 49.16 4.25 17 hypothetical protein D4GUB6 49.15 22.25 89 pyruvate kinase D4GWG7 49.14 12.75 51 molybdopterin molybdenumtransferase MoeA D4GWS3 49.13 12.25 49 UDP-glucose 4-epimerase D4H0E4 49.10 15.25 61 Orc1-type DNA replication protein D4GX49 49.06 15.75 63 hypothetical protein D4GYQ3 49.04 14.75 59 peptide ABC transporter ATP-binding protein D4GUS4 48.99 14.5 58 indole-3-acetyl-L-aspartic acid hydrolase D4GU20 48.88 8.5 34 hypothetical protein D4GVD7 48.86 20 80 cell division protein Q9C4M3 48.84 18.75 75 tRNA-guanine(15) transglycosylase D4GZG5 48.75 28.75 115 MCM DNA helicase D4GVT2 48.74 9.75 39 glucose dehydrogenase D4GYE1 48.73 4.25 17 PTS sugar transporter subunit IIC D4GR08 48.70 11.25 45 galactonate dehydratase D4GZF3 48.63 8.25 33 hypothetical protein D4GRY5 48.48 6.25 25 uracil-DNA glycosylase D4GUB9 48.48 11 44 type II methionyl aminopeptidase D4GTS6 48.41 5.25 21 isopentenyl-diphosphate Delta-isomerase D4GZ66 48.37 10.25 41 peptidylprolyl isomerase D4GYF9 48.25 7.5 30 hypothetical protein P18285 48.22 16 64 tryptophan synthase subunit beta D4GR16 48.20 17.25 69 peptide ABC transporter substrate-binding protein D4GZE0 48.18 4 16 DUF1931 domain-containing protein D4GS83 48.10 15.75 63 thioredoxin reductase D4GW86 48.05 27.25 109 hypothetical protein Q1XBW2 48.04 27.25 109 molecular chaperone DnaK

125

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GVX1 47.99 13 52 hypothetical protein D4GSQ7 47.95 4.5 18 GMP synthase D4GUL5 47.95 12 48 epimerase D4GWY1 47.93 5.5 22 50S ribosomal protein L13 D4GW03 47.86 6.25 25 3-methyl-2-oxobutanoate hydroxymethyltransferase D4GRJ3 47.83 1 1 hypothetical protein D4GSY6 47.81 7.75 31 potassium transporter Trk D4GYL9 47.77 9 36 thiosulfate sulfurtransferase D4GT30 47.76 56.25 225 chromosome segregation protein SMC D4GTZ1 47.71 6.75 27 50S ribosomal protein L22 D4GUY1 47.68 5.75 23 molybdenum cofactor biosynthesis protein D4GTF1 47.65 4.5 18 hypothetical protein D4GQ80 47.63 3.5 14 amphi-Trp domain-containing protein PBS lyase HEAT-like repeat domain-containing D4GVJ7 47.61 20.5 82 protein D4GP44 47.48 15.5 62 lysine 6-monooxygenase D4GS24 47.44 8.25 33 50S ribosomal protein L16 D4H074 47.42 27.25 109 hypothetical protein D4GV02 47.41 9.25 37 2-hydroxyacid dehydrogenase D4GWW0 47.41 5.25 21 universal stress protein UspA D4GR12 47.38 5.75 23 hypothetical protein P33975 47.23 20.75 83 anthranilate synthase component I D4GUK0 47.22 17.25 69 metallophosphatase D4GY92 47.22 11.5 46 O-acetylhomoserine aminocarboxypropyltransferase D4GTY6 47.16 8.5 34 50S ribosomal protein L14 D4GXT2 46.99 9.25 37 thymidylate synthase Q48327 46.90 13.5 54 cell division protein FtsZ branched-chain alpha-keto acid dehydrogenase D4GY19 46.88 21.75 87 subunit E2 D4GZ37 46.87 12.75 51 translation-associated GTPase 16S rRNA (adenine(1518)-N(6)/adenine(1519)- D4GWA1 46.86 10 40 N(6))-dimethyltransferase D4GSM4 46.82 12.25 49 ABC transporter substrate-binding protein D4GUS3 46.82 28.75 115 peptide ABC transporter substrate-binding protein D4GZF7 46.77 3.5 14 lactoylglutathione lyase D4GYG6 46.77 9.75 39 agl cluster protein AglQ D4GZB9 46.76 7.75 31 DNA polymerase sliding clamp D4H0F7 46.73 13.75 55 peptide ABC transporter substrate-binding protein D4GSE9 46.73 36 144 DNA mismatch repair protein MutS D4GT20 46.73 29.5 118 DNA topoisomerase I D4GVM7 46.72 3.75 15 NUDIX hydrolase D4GZV3 46.68 25.75 103 arginine--tRNA ligase D4GTH9 46.66 5 20 hypothetical protein D4GXK6 46.58 26.75 107 hypothetical protein D4GSI0 46.56 13.25 53 aldo/keto reductase D4GYX3 46.56 8.75 35 hypothetical protein D4GSA8 46.54 8.5 34 hypothetical protein D4GYH1 46.50 9.5 38 UTP--glucose-1-phosphate uridylyltransferase P18284 46.48 7.5 30 tryptophan synthase subunit alpha D4GWN2 46.38 12.75 51 CBS domain-containing protein

126

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GZ93 46.37 2.75 11 urease subunit gamma D4GYE0 46.29 10.75 43 fructose-bisphosphate aldolase D4GY64 46.27 2.25 9 hypothetical protein D4GTS8 46.12 9.25 37 N-methyltransferase-like protein D4GWX5 46.09 2 8 DNA-directed RNA polymerase subunit N D4GSC8 46.07 11.75 47 nicotinate phosphoribosyltransferase P52563 45.93 5 20 N-(5'-phosphoribosyl)anthranilate isomerase pyruvate dehydrogenase (acetyl-transferring) E1 D4GY15 45.92 13.5 54 component subunit alpha D4GTZ2 45.89 4.25 17 30S ribosomal protein S19 D4GTH5 45.88 5 20 translation initiation factor D4GSW0 45.83 4.25 17 DNA-binding protein D4GX09 45.81 10.75 43 ATP-binding protein D4GTN6 45.77 17 68 tRNA-ribosyltransferase D4GU07 45.75 7.25 29 orotidine 5'-phosphate decarboxylase D4GSG7 45.73 8.75 35 biotin/lipoate A/B protein ligase D4GT59 45.67 8.75 35 succinate--CoA ligase subunit alpha D4GTR8 45.66 17.25 69 radical SAM protein D4GXT3 45.62 8.25 33 dihydrofolate reductase D4GYK3 45.60 11.25 45 aspartate kinase D4GWR3 45.57 8.25 33 deoxyribonuclease D4GR79 45.48 3.75 15 cyclase D4GY73 45.48 4.5 18 aspartate carbamoyltransferase regulatory subunit P33974 45.47 6.75 27 glutamine amidotransferase D4GZE7 45.45 1 3 hypothetical protein D4GXH2 45.44 6.75 27 hypothetical protein D4GTD4 45.44 15 60 translation initiation factor IF-2 subunit gamma D4GWY4 45.37 9.25 37 DNA-directed RNA polymerase subunit D D4GYI9 45.37 9.5 38 dihydroxyacetone kinase subunit L D4GTG5 45.32 9 36 coenzyme F420-0:L-glutamate ligase D4GRZ3 45.22 35.25 141 leucine--tRNA ligase D4GXE4 45.21 6.75 27 triose-phosphate isomerase D4GY94 45.18 12 48 homoserine O-acetyltransferase D4GTX2 45.14 5.75 23 hypothetical protein D4GPK1 45.13 11.25 45 malate synthase D4GTB7 45.10 28.5 114 nucleotide pyrophosphatase D4GQN7 45.09 9.5 38 type I-B CRISPR-associated protein Cas5 acetolactate synthase, large subunit, biosynthetic D4GYF4 45.02 17 68 type D4H0F6 44.93 21.25 85 ABC transporter ATP-binding protein D4GYZ9 44.88 12.75 51 DNA topoisomerase VI subunit A D4GRC4 44.85 5.5 22 hypothetical protein D4GWJ7 44.81 9.25 37 GTP cyclohydrolase I FolE2 D4GU79 44.78 11 44 hypothetical protein D4GZA7 44.71 6 24 transcriptional regulator D4GYH8 44.70 4.5 18 S-adenosylmethionine-dependent methyltransferase D4GYJ1 44.63 34 136 isoleucine--tRNA ligase D4GVF9 44.61 6.25 25 (4Fe-4S)-binding protein D4GRZ0 44.59 8.25 33 prephenate dehydratase D4GRG5 44.57 7.25 29 amidohydrolase

127

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GRV5 44.57 9.75 39 Xaa-Pro aminopeptidase D4H050 44.52 10.5 42 iron ABC transporter substrate-binding protein D4GUJ4 44.50 5.25 21 alpha/beta hydrolase D4GXD4 44.49 12.5 50 GMC family oxidoreductase D4GXP2 44.45 18.75 75 bacterio-opsin activator D4GWL5 44.45 20.25 81 ATPase AAA D4GSF6 44.39 8 32 50S ribosomal protein L15e D4GP51 44.36 8.5 34 precorrin isomerase D4GXY9 44.34 16 64 phenylalanine--tRNA ligase subunit beta D4GYD1 44.33 9 36 sulfurase D4GYU6 44.27 11.75 47 hypothetical protein D4GW82 44.26 1.33 4 hypothetical protein D4GUF6 44.25 2 8 molybdopterin synthase sulfur carrier subunit D4GP89 44.22 14 56 mandelate racemase D4GZ02 44.20 36.25 145 DNA gyrase subunit A D4GYK9 44.17 30.5 122 DEAD/DEAH box helicase D4GYI4 44.15 16.5 66 sn-glycerol-3-phosphate dehydrogenase subunit C D4GW23 44.14 19.75 79 RNA-splicing ligase RtcB D4GWB3 44.07 2 2 RNA-binding protein D4GUC0 44.05 4 16 hydrolase D4GP45 44.01 6.5 26 N-acetyltransferase D4GYF1 43.97 1.75 7 hypothetical protein D4GXW6 43.91 13.25 53 N-acyl-L-amino acid amidohydrolase D4GU73 43.91 4.75 19 NUDIX hydrolase D4GY00 43.90 18.75 75 tryptophan--tRNA ligase D4H037 43.86 24.75 99 hypothetical protein 2,3-bisphosphoglycerate-independent D4GTU8 43.82 17.75 71 phosphoglycerate mutase D4GT97 43.79 10 40 inorganic pyrophosphatase D4GYJ0 43.75 13.75 55 dihydroxyacetone kinase subunit DhaK D4H080 43.75 12.5 50 hypothetical protein D4GU54 43.71 6.75 27 nucleoside-diphosphate sugar epimerase D4GWP3 43.67 2 8 glutaredoxin D4GW56 43.66 8.25 33 DNA-binding protein D4GYX4 43.65 7 28 hypothetical protein D4GTQ6 43.63 9.5 38 adenylate kinase D4GXM5 43.62 4.75 19 NADPH-dependent oxidoreductase D4GTA2 43.53 7.5 30 ribonuclease H D4GTX6 43.46 7.5 30 30S ribosomal protein S5 D4GWQ7 43.46 18 72 DUF2309 domain-containing protein D4GXM7 43.43 5.25 21 cyclic pyranopterin monophosphate synthase MoaC D4GRW6 43.37 7.5 30 glyoxalase D4GS73 43.36 24.5 98 aconitate hydratase D4GY62 43.36 7.5 30 uracil phosphoribosyltransferase D4GPR5 43.31 8.5 34 alkane monooxygenase D4GVE0 43.27 5.25 21 dTMP kinase D4GZ24 43.26 4.75 19 hypothetical protein D4GY69 43.23 13.5 54 glutamate dehydrogenase D4GSM3 43.21 28 112 ABC transporter ATP-binding protein D4GSJ6 43.20 6.25 25 homoserine dehydrogenase

128

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GU61 42.99 10.5 42 hypothetical protein D4GTW1 42.93 7.25 29 short-chain dehydrogenase Q03301 42.84 4.75 19 superoxide dismutase Q1XBW1 42.79 14 56 molecular chaperone DnaJ D4GYP1 42.78 8.25 33 lysine biosynthesis enzyme LysX D4GSE0 42.77 12.25 49 dihydroorotase D4GQ96 42.69 16 64 cell division control protein Cdc6 D4GSI5 42.68 6.75 27 hypothetical protein Q03300 42.63 4.75 19 superoxide dismutase D4GZ04 42.56 5.25 21 arginase D4GWH4 42.55 2.75 11 amphi-Trp domain-containing protein D4GTZ0 42.52 11.25 45 30S ribosomal protein S3 D4GP19 42.51 8.5 34 chromosome partitioning protein ParA D4H073 42.48 4 16 hypothetical protein D4GRV8 42.48 17.25 69 carboxypeptidase M32 type I restriction-modification system methylation D4GVY6 42.46 16.25 65 subunit D4GTV1 42.41 11.5 46 hypothetical protein D4GSW9 42.41 9 36 UMP kinase D4H0F9 42.38 10 40 N-methyltryptophan oxidase D4GUH5 42.36 11.75 47 peptidase M28 D4GY36 42.33 17 68 phosphoglycerate dehydrogenase D4GXS0 42.29 4 16 thimanine synthesis protein ThiJ D4H0D0 42.29 43.75 175 helicase D4GWS4 42.22 6 24 tRNA (cytidine(56)-2'-O)-methyltransferase D4GRE1 42.15 8.5 34 hypothetical protein D4H093 42.07 3.75 15 hypothetical protein D4GZD4 42.03 9 36 alpha hydrolase D4GUE6 41.94 6 24 uridine phosphorylase D4GV69 41.94 3 12 IclR family transcriptional regulator D4GSV7 41.88 13.75 55 histidine--tRNA ligase D4H085 41.87 9.5 38 hypothetical protein D4GZ62 41.73 5 20 hypothetical protein D4GVF3 41.73 14 56 5-(carboxyamino)imidazole ribonucleotide synthase D4GU95 41.72 8 32 transcription initiation factor IIB 2 D4GX53 41.71 4 16 thioredoxin family protein D4GXW1 41.67 10 40 translation-associated GTPase D4GY41 41.67 3.25 13 transcriptional regulator D4GR60 41.62 3.75 15 transcriptional regulator D4GUW1 41.58 12.75 51 acetyl-coenzyme A synthetase D4H0D1 41.57 21 84 hypothetical protein D4GYE8 41.44 11.25 45 3-isopropylmalate dehydrogenase D4GXL3 41.40 12.25 49 glycosyltransferase type 1 D4GTY2 41.38 4 4 30S ribosomal protein S14 D4GZ78 41.38 23.75 95 RNA degradosome polyphosphate kinase D4GTU6 41.36 6.25 25 transcriptional regulator D4GSU7 41.33 1 2 hypothetical protein D4GW54 41.32 4.75 19 cyclase aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase D4GVM9 41.30 2 8 subunit C

129

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GVU5 41.28 11.75 47 NAD/FAD-dependent oxidoreductase D4GQV0 41.24 5 20 trehalose utilization protein ThuA D4GUX6 41.18 12.75 51 alcohol dehydrogenase D4GV54 41.16 3.25 13 hypothetical protein D4GWM7 41.15 9.5 38 phosphate transport system regulatory protein PhoU D4GV33 41.07 6.75 27 oxidoreductase D4GWJ6 41.07 4.5 18 hypothetical protein D4GYZ6 41.06 6 24 hydrolase D4GYZ3 41.06 13.25 53 hypothetical protein type I restriction-modification system restriction D4GVY5 41.05 28.75 115 subunit D4GVA1 41.03 11.5 46 ATPase D4GWM2 40.99 11 44 histidine kinase D4GUI4 40.98 9 36 hypothetical protein D4GRG1 40.96 13.75 55 hypothetical protein D4GSJ7 40.89 8.75 35 3-dehydroquinase D4GRA5 40.87 8.75 35 hypothetical protein D4GZ28 40.82 1 2 hypothetical protein D4GW84 40.75 6.5 26 nucleoside-diphosphate kinase D4GS58 40.74 15.25 61 CCA tRNA nucleotidyltransferase D4GW14 40.68 8.25 33 xylose isomerase D4H061 40.68 8.25 33 7-cyano-7-deazaguanine synthase D4GXW2 40.61 3.67 11 hypothetical protein D4GZT8 40.58 5.5 22 SAM-dependent methyltransferase D4GUD9 40.57 4.67 14 2-deoxyribose-5-phosphate aldolase D4GY90 40.56 13.75 55 iron ABC transporter substrate-binding protein D4H067 40.54 20.25 81 DEAD/DEAH box helicase D4GWD0 40.46 9.25 37 phosphohydrolase D4GT57 40.45 1 1 hypothetical protein D4GUZ0 40.45 12.25 49 small GTP-binding protein D4GYJ7 40.43 18.75 75 cell division control protein Cdc6 D4GT26 40.37 12.25 49 amidohydrolase D4GRB0 40.34 2 4 hypothetical protein D4GZ60 40.33 14.75 59 diphthamide biosynthesis enzyme Dph2 D4GR92 40.21 15.25 61 peptide ABC transporter substrate-binding protein D4GZ53 40.18 8.75 35 hypothetical protein D4GSZ4 40.12 5.5 22 non-canonical purine NTP pyrophosphatase D4GZN7 40.05 6.5 26 hypothetical protein D4GTU0 40.00 7.75 31 carbamoyl-phosphate synthase small subunit D4GP53 39.98 24.75 99 magnesium chelatase D4GSN1 39.96 20 80 ATPase AAA site-specific DNA-methyltransferase (cytosine- D4H0C8 39.90 16 64 specific) D4GYA2 39.90 12 48 isochorismate synthase D4GZP7 39.87 17.5 70 4-alpha-glucanotransferase D4GST4 39.83 3.25 13 hypothetical protein bifunctional 5,10-methylene-tetrahydrofolate D4GXG9 39.81 11.25 45 dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase D4GQF1 39.76 3 12 cyclase

130

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description Tat (twin-arginine translocation) pathway signal D4GQG3 39.73 8.5 34 sequence domain protein D4GZM0 39.68 4 16 thiol reductase thioredoxin D4GQC7 39.64 8.75 35 amidohydrolase D4GTQ0 39.58 5 20 cytidylate kinase D4GR24 39.55 8 32 Uncharacterized protein HVO_A0350 D4GUK5 39.55 45.5 182 hypothetical protein D4GZC0 39.54 4.75 19 ArsC family transcriptional regulator D4GY08 39.51 23.75 95 DEAD/DEAH box helicase D4GV57 39.50 4.5 18 2-dehydro-3-deoxy-phosphogluconate aldolase D4GZ03 39.42 4 16 DNA mismatch repair protein MutT D4H0G1 39.40 1.25 5 hypothetical protein D4H023 39.38 10.75 43 glycine cleavage system protein T D4GYP4 39.38 14.5 58 argininosuccinate synthase P18304 39.34 6.5 26 indole-3-glycerol-phosphate synthase D4GTZ3 39.32 11.5 46 50S ribosomal protein L2 D4GVE2 39.30 10 40 2-oxo acid dehydrogenase D4GPP7 39.27 7.75 31 oxidoreductase D4GZ22 39.11 5 20 3-isopropylmalate dehydratase D4GXR8 39.09 3.5 14 hypothetical protein D4GW90 39.01 11.5 46 methionine synthase D4GVK1 39.00 4.25 17 hypothetical protein D4GY77 38.99 12.5 50 phosphoglucosamine mutase D4GVK2 38.90 10 40 3-ketoacyl-CoA thiolase D4GY37 38.85 2.5 5 CoA-binding protein D4GTR4 38.78 4.75 19 universal stress protein UspA tRNA (pseudouridine(54)-N(1))-methyltransferase D4GTL8 38.76 5.25 21 TrmY D4GYH9 38.71 2 8 hypothetical protein D4GS45 38.68 4.75 19 hypothetical protein D4GZP9 38.61 15.75 63 hypothetical protein D4GVL8 38.54 3.25 13 DNA-directed RNA polymerase subunit L D4GPE5 38.53 8.5 34 iron ABC transporter substrate-binding protein D4GWE9 38.53 7.5 30 hypothetical protein D4GZ82 38.49 8.5 34 tyrosine--tRNA ligase D4GZM1 38.48 20 80 thioredoxin domain-containing protein D4GWN1 38.43 6.75 27 DNA repair protein RadB D4GW05 38.42 21.5 86 dihydropteroate synthase D4GWI7 38.40 6.25 25 homoserine kinase D4GX27 38.35 7.75 31 amidase D4GUS7 38.33 8.25 33 transcriptional regulator D4GUG9 38.31 8.25 33 alpha/beta hydrolase D4GXW0 38.30 4.5 18 30S ribosomal protein S10 D4GT48 38.28 1 2 30S ribosomal protein S27e D4GTT0 38.23 7.5 30 amidohydrolase D4GY96 38.21 10.75 43 O-acetylhomoserine aminocarboxypropyltransferase D4GTH8 38.15 4.25 17 hypothetical protein D4GWT4 38.12 9.25 37 histidine kinase D4GUW6 38.12 9 36 dipeptide epimerase D4GZN2 38.11 11.25 45 carboxylate--amine ligase

131

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GP62 38.08 4.75 19 precorrin-4 C(11)-methyltransferase D4GXM4 38.08 5.25 21 thymidine kinase D4GXR0 38.08 5.25 21 hypothetical protein D4GYC7 38.08 4 16 hypothetical protein D4GW51 38.07 12 48 phosphoesterase D4GUS8 38.06 6 24 fructose-bisphosphatase class I D4GXM6 38.05 10.75 43 GTPase HflX D4GZN4 38.04 8.75 35 nucleolar D4GXS7 38.02 11.25 45 long-chain-fatty-acid--CoA ligase D4GWA7 38.02 7.5 30 cystathionine beta-lyase D4GVU6 38.01 5.25 21 hydrolase D4GWR1 37.95 2 8 hypothetical protein D4GUP9 37.91 2 2 PTS galactitol enzyme II, A component D4GVX9 37.86 23.75 95 transcriptional regulator D4GYT2 37.84 8.5 34 delta-aminolevulinic acid dehydratase D4GZ40 37.81 2.33 7 hypothetical protein D4GXS9 37.74 14.75 59 2-succinylbenzoate-CoA ligase D4GRM3 37.70 17.5 70 urocanate hydratase D4GPF6 37.59 32.5 130 11-domain light and oxygen sensing his kinase D4GWJ4 37.53 10.75 43 NADH oxidase D4GYC2 37.50 25 100 Hef nuclease D4GWA8 37.50 1.5 6 hypothetical protein D4GYU5 37.50 1 1 hypothetical protein D4GXS6 37.50 1 3 hypothetical protein D4GTN2 37.46 11 44 serine acetyltransferase D4GP57 37.44 8.25 33 hypothetical protein D4GTW9 37.42 4 16 hypothetical protein D4GVM4 37.36 16.5 66 phosphoribosylformylglycinamidine synthase II bifunctional ADP-dependent NAD(P)H-hydrate D4GXM8 37.34 11.5 46 dehydratase/NAD(P)H-hydrate epimerase D4H044 37.30 9.25 37 aminotransferase class I/II D4GWG8 37.25 6.75 27 AP endonuclease D4GWX8 37.16 5 20 hypothetical protein D4GTX0 37.14 7.75 31 alpha/beta hydrolase D4GSY1 37.12 5.5 22 enoyl-CoA hydratase imidazole glycerol phosphate synthase cyclase D4GVM0 37.04 7.25 29 subunit D4GQ35 36.98 5.5 22 hypothetical protein D4GTU3 36.87 12 48 glutamyl-tRNA(Gln) amidotransferase subunit D D4GXT1 36.81 2.75 11 methylmalonyl-CoA epimerase D4GYE9 36.76 5.75 23 3-isopropylmalate dehydratase small subunit D4GT00 36.73 9.5 38 glutathione-dependent reductase D4GSI1 36.73 3.5 14 haloacid dehalogenase D4GTY8 36.71 4 16 ribonuclease P D4GP63 36.70 6.75 27 precorrin-2 C(20)-methyltransferase D4GWJ9 36.68 14 56 hypothetical protein D4GYC1 36.66 4 16 universal stress protein UspA D4GXQ8 36.64 8.25 33 RNA methyltransferase D4GXG6 36.62 11 44 hypothetical protein D4GYT5 36.57 1.5 6 hypothetical protein

132

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GQU3 36.57 7.75 31 ArcR family transcription regulator D4GYW3 36.54 4.75 19 translation initiation factor IF-6 D4GPE4 36.52 16 64 HTR-like protein D4GXU3 36.43 3.25 13 nascent polypeptide-associated complex protein D4GYM4 36.43 17.25 69 excinuclease ABC subunit B D4GVF1 36.38 2.5 10 6,7-dimethyl-8-ribityllumazine synthase D4GYI1 36.38 8.25 33 ATPase AAA D4H057 36.34 3.25 13 cyclase D4GPD1 36.30 3.5 14 hypothetical protein D4GT22 36.29 6 24 hypothetical protein D4H052 36.25 8 32 sugar ABC transporter D4GU83 36.21 15.25 61 sialidase D4GTG1 36.20 10.25 41 D-2-hydroxyacid dehydrogenase D4GUE0 36.12 10 40 threonine synthase D4GRZ5 36.10 5.75 23 alanine dehydrogenase D4GX08 36.08 18.75 75 cytochrome Fbr D4GRP9 36.07 4.25 17 transcriptional regulator D4GUR2 36.04 5.5 22 aldehyde oxidoreductase D4GXR1 35.95 8.5 34 dihydropteroate synthase D4H042 35.87 30 120 FAD-dependent oxidoreductase D4GW66 35.82 11.25 45 radical SAM/SPASM domain-containing protein D4GZ88 35.79 7.5 30 ribonuclease Z D4GZA5 35.77 8 32 ATP phosphoribosyltransferase D4GWD5 35.73 9.5 38 hypothetical protein D4GXV3 35.69 6.5 26 hypothetical protein D4GRK9 35.66 10.25 41 hypothetical protein D4GXS8 35.62 6.5 26 short-chain dehydrogenase D4GRX9 35.58 3.67 11 thiol reductase thioredoxin D4GX52 35.56 3.75 15 hypothetical protein D4GXS1 35.55 7.5 30 glutamate 5-kinase D4GYI8 35.55 4 16 PTS mannose transporter subunit IID D4GQT6 35.53 12 48 cell division control protein Cdc6 D4GTT7 35.50 4 16 nicotinamide-nucleotide adenylyltransferase D4GU66 35.48 10 40 lipopolysaccharide transferase family protein D4GXZ2 35.47 9 36 phenylalanyl--tRNA ligase subunit alpha D4GXK0 35.46 7.5 30 mRNA surveillance protein pelota D4GZS5 35.44 6.25 25 oxidoreductase D4GVR7 35.40 8.75 35 sugar ABC transporter substrate-binding protein D4GYV5 35.38 13.5 54 cysteine desulfurase D4GUJ5 35.35 4.75 19 endonuclease III D4GYZ1 35.29 6 24 proteasome subunit beta D4GST8 35.28 4.75 19 6-phosphogluconate dehydrogenase D4GP02 35.24 10 40 cell division control protein Cdc6 D4GVH7 35.19 21 84 acetyl-CoA synthetase D4GQJ9 35.17 2.5 5 hypothetical protein D4GZA0 35.12 8 32 RNA methylase D4GX19 35.06 5.5 22 uridine kinase D4GSX7 35.01 9.75 39 general stress protein D4GYQ4 34.96 10.5 42 ABC transporter ATP-binding protein D4GZP5 34.95 7 28 8-oxoguanine DNA glycosylase

133

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4H0B8 34.92 1 2 hypothetical protein D4GXI8 34.89 7.5 30 flap endonuclease-1 D4GZL1 34.88 1.5 3 hypothetical protein D4GQK9 34.87 15.75 63 hypothetical protein D4GVA9 34.85 1 4 hypothetical protein D4GZI1 34.84 9.25 37 tRNA (guanine(10)-N(2))-dimethyltransferase L9UXM8 34.81 14.5 58 Acyl-CoA synthetase HVO_A0097A D4GWP4 34.78 8 24 adhesin D4GT90 34.78 8.25 33 arsenic-transporting ATPase 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene- D4GYA1 34.76 14 56 1-carboxylate synthase D4GS06 34.70 11 44 citrate (Si)-synthase D4GYE2 34.69 13.75 55 phosphoenolpyruvate--protein phosphotransferase D4GW29 34.65 3.5 14 phosphoglycolate phosphatase D4GWC8 34.62 1.5 6 twin-arginine translocase TatA/TatE family subunit D4GUP2 34.57 8.75 35 NADP-dependent oxidoreductase D4GX40 34.56 11.75 47 succinate dehydrogenase D4GTB4 34.54 10.75 43 DNA polymerase/3'-5' exonuclease PolX P17736 34.49 8.75 35 histidinol-phosphate aminotransferase D4GXE0 34.47 3.75 15 hypothetical protein D4GVU3 34.44 9.25 37 heme biosynthesis protein D4GPD3 34.38 7.5 30 PQQ repeat protein D4GYP9 34.34 14.5 58 glycine--tRNA ligase D4GQC4 34.32 8.75 35 acyl-CoA dehydrogenase D4GZ58 34.27 14.5 58 hypothetical protein D4GZP2 34.26 3.75 15 translation initiation factor IF-2 subunit beta D4GX13 34.24 4.5 18 uracil-DNA glycosylase D4GSX4 34.23 17 68 hypothetical protein D4GYN6 34.20 6.25 25 ornithine carbamoyltransferase D4GZE3 34.18 2 8 hypothetical protein D4H049 34.16 10.25 41 hypothetical protein D4GXH1 34.09 2.25 9 hypothetical protein D4GSV9 34.06 3.25 13 alpha hydrolase D4GZ42 33.99 4.75 19 glycosyl transferase family 2 D4GTA8 33.94 3.5 14 hypothetical protein D4GSA9 33.93 1 1 hypothetical protein D4GSF4 33.90 1.33 4 sulfurtransferase D4GVI8 33.77 2 8 hypothetical protein D4GX81 33.75 7.75 31 aminotransferase D4GXY5 33.74 24.75 99 valine--tRNA ligase D4GW04 33.73 1.67 5 flagellin D4GUL3 33.71 5.25 21 alanyl-tRNA editing protein O07118 33.70 9 36 tRNA splicing endonuclease D4GR38 33.67 2.25 9 CopG family transcriptional regulator D4GSE6 33.67 7.5 30 2-keto-3-deoxygluconate kinase D4GWL7 33.67 10 40 nuclease D4GW13 33.65 4.25 17 S-adenosylmethionine-dependent methyltransferase D4GTK8 33.61 10 40 tRNA pseudouridine(54/55) synthase Pus10 D4GZA9 33.60 9.75 39 S-adenosylhomocysteine deaminase

134

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description type I restriction-modification system specificity D4GVY7 33.60 12 48 subunit D4GT85 33.56 5 20 metal-dependent phosphoesterase D4H055 33.53 16.75 67 alpha-amylase D4GZR4 33.53 3 12 cupin D4GZ33 33.51 7.75 31 aspartate aminotransferase D4GWG0 33.50 8.75 35 deoxyhypusine synthase D4GU80 33.50 4.33 13 DNA-binding protein transcriptional regulator D4GZD2 33.44 4.75 19 polyketide cyclase D4GSZ5 33.42 1.75 7 hypothetical protein D4GWG4 33.39 6 24 agmatinase D4GPF4 33.33 13.25 53 Mur ligase family CapB protein D4GPB6 33.30 5.75 23 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase D4GYY1 33.19 8.75 35 serine/threonine protein kinase D4GYP0 33.07 8.25 33 N-acetyl-gamma-glutamyl-phosphate reductase D4GQ95 33.02 1.33 4 hypothetical protein D4GZG6 33.00 1.5 3 hypothetical protein D4GQF0 32.98 1.5 6 PadR family transcriptional regulator D4H079 32.98 4.5 18 hypothetical protein D4GW95 32.96 8 32 vitamin-B12 independent methionine synthase D4GY89 32.95 3.75 15 ferredoxin D4GWM6 32.94 10.25 41 Phosphate import ATP-binding protein PstB pstB1 D4GVY1 32.91 3.5 14 hypothetical protein D4GZ43 32.91 2.75 11 hypothetical protein D4GZG2 32.83 3.5 14 ABC transporter ATP-binding protein D4GP26 32.80 7 28 alcohol dehydrogenase D4GXY2 32.76 6.25 25 dihydroorotate dehydrogenase (quinone) D4GT28 32.71 3.5 14 hypothetical protein D4GUG2 32.71 5.5 22 aldehyde oxidoreductase D4GYQ1 32.68 4.75 19 hypothetical protein D4GRY7 32.68 5 20 phosphonate ABC transporter ATP-binding protein D4GRF1 32.64 3.5 14 cob(I)alamin adenosyltransferase bifunctional biotin--[acetyl-CoA-carboxylase] D4GTB0 32.63 8.25 33 synthetase/biotin operon repressor Q04829 32.63 12.25 49 dihydrolipoamide dehydrogenase D4GYR2 32.63 2.5 10 hypothetical protein D4GZ89 32.62 6.75 27 ATPase AAA D4GZ45 32.59 4.75 19 DUF159 family protein D4H069 32.54 10 40 cell division control protein Cdc6 D4GU15 32.53 11.75 47 quinolinate synthetase D4GTB1 32.53 1.75 7 hypothetical protein D4GRV0 32.51 4.33 13 riboflavin synthase D4GZ05 32.43 6.25 25 nucleoside-diphosphate sugar epimerase D4H081 32.43 5.75 23 hypothetical protein D4GYN7 32.41 8 32 acetyl-lysine deacetylase D4GSX1 32.40 7 28 hypothetical protein P41200 32.39 3.25 13 50S ribosomal protein L11 D4GVN0 32.39 11 44 aspartyl/glutamyl-tRNA amidotransferase subunit A D4GWB1 32.39 1.75 7 elongation factor 1-beta D4GR87 32.29 6 24 bacterio-opsin activator-like protein

135

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GTJ6 32.21 8.75 35 glucose-6-phosphate isomerase D4GZR3 32.20 17.25 69 DEAD/DEAH box helicase D4GYR0 32.15 25 100 DNA polymerase II large subunit D4GZB8 32.11 5 20 hypothetical protein D4GXF3 32.05 4 16 ArsR family transcriptional regulator D4GY43 32.05 1.5 3 hypothetical protein D4GS87 32.03 3.75 15 ferredoxin D4GQT5 32.01 3 12 hypothetical protein D4GTQ4 32.00 8.25 33 hypothetical protein D4GYY0 31.94 4.5 18 RNA-processing protein D4GXD2 31.94 2.5 10 hypothetical protein D4GZI7 31.94 9 36 aminopeptidase D4GYW6 31.91 11 44 signal recognition particle-docking protein FtsY Tat (twin-arginine translocation) pathway signal D4H0E1 31.90 6.25 25 sequence domain protein D4GPU6 31.90 2 2 hydroxyisourate hydrolase D4GXB2 31.85 6.25 25 oxidoreductase D4GXH6 31.84 2 8 PadR family transcriptional regulator D4GV47 31.84 5.75 23 alanine--glyoxylate aminotransferase D4GX80 31.83 3.75 15 AsnC family transcriptional regulator D4GP72 31.82 8 32 aspartate aminotransferase family protein basic amino acid ABC transporter substrate-binding D4GSP2 31.82 8 32 protein D4GYN9 31.80 5.33 16 acetylglutamate kinase D4GXY0 31.79 1.33 4 hypothetical protein D4GW08 31.74 7 28 initiation factor 2B-like protein D4GSW7 31.70 7.75 31 molybdopterin synthase D4GVJ3 31.68 1.75 7 Mov34-MPN-PAD-1 superfamily protein D4GWS6 31.67 6 24 hypothetical protein D4GW10 31.65 9.75 39 oxidoreductase D4GXN6 31.64 5.75 23 adenine glycosylase D4GZ13 31.61 5 20 N-acetyltransferase D4GUB5 31.59 16.75 67 RNA degradosome polyphosphate kinase D4GZ61 31.57 2.75 11 phospholipase D4GY98 31.55 14.5 58 DNA ligase (NAD(+)) LigA D4GYA3 31.52 7.25 29 copper ABC transporter ATP-binding protein D4GW38 31.50 4.75 19 transcriptional regulator D4GPT9 31.49 8.75 35 ABC transporter substrate-binding protein D4GZ91 31.47 2.5 10 urease subunit beta D4GZT2 31.43 3.5 14 isopentenyl pyrophosphate isomerase D4GZU0 31.41 16.25 65 ATP synthase subunit I D4GYL5 31.37 6.5 26 ABC transporter ATP-binding protein D4GTA4 31.37 4.5 18 transcription initiation factor IIB 2 D4GYQ7 31.33 13.25 53 peptide ABC transporter substrate-binding protein D4GZ55 31.32 5.5 22 MBL fold metallo-hydrolase D4GT60 31.29 8.25 33 branched chain amino acid aminotransferase A0A1C9J 31.28 5.25 21 Uncharacterized protein HVO_0379B 6T3 D4GZX7 31.26 11.5 46 DNA-directed RNA polymerase subunit A'' D4GS28 31.25 3.75 15 transcriptional regulator

136

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GSR3 31.25 2.25 9 DNA-directed RNA polymerase subunit P D4H027 31.25 3.5 14 universal stress protein D4GS57 31.23 7 28 histone deacetylase L9VGF7 31.20 2.5 10 response regulator D4GZM2 31.19 10.75 43 phosphoribosylamine--glycine ligase D4GSK5 31.16 3 3 MBL fold metallo-hydrolase D4GQD3 31.15 1 1 hypothetical protein D4GQG7 31.15 1 1 hypothetical protein D4GXU9 31.13 1.75 7 transcription factor S D4GYS1 31.07 5 20 uroporphyrinogen-III synthase D4H060 31.07 4.33 13 SAM-dependent methyltransferase D4GUC8 31.06 11 44 tRNA modifying enzyme D4GP95 31.03 11.5 46 peptide ABC transporter substrate-binding protein D4GTL9 30.99 7.5 30 iron ABC transporter substrate-binding protein D4GT74 30.98 8.75 35 hypothetical protein D4GW32 30.97 8.25 33 acyl-CoA dehydrogenase D4GZY4 30.95 4.75 19 hypothetical protein D4GZF9 30.94 7.5 30 L-lactate dehydrogenase D4GZ48 30.91 4.75 19 hypothetical protein D4GXR7 30.84 9.75 39 deoxyribodipyrimidine photo-lyase P52562 30.82 5.5 22 anthranilate phosphoribosyltransferase D4GWI2 30.60 7.25 29 hypothetical protein D4GT40 30.59 6 24 phosphoribosyltransferase D4GTG0 30.57 5.67 17 GTP-binding protein D4GXF5 30.52 9.5 38 3-phosphoshikimate 1-carboxyvinyltransferase D4GX15 30.46 3.25 13 hypothetical protein D4GZL6 30.43 6.75 27 tRNA 4-thiouridine(8) synthase ThiI D4GS26 30.40 6.25 25 endonuclease NucS D4GW77 30.39 5.5 22 hypothetical protein D4GUH4 30.35 7 28 3-ketoacyl-CoA thiolase D4GP71 30.28 7.75 31 succinate-semialdehyde dehydrogenase D4GZ84 30.26 12.75 51 hypothetical protein D4GUY7 30.25 1 3 hypothetical protein D4GU71 30.25 4.5 18 NAD(P)-dependent oxidoreductase D4GPN4 30.23 12.25 49 alpha-N-arabinofuranosidase D4GYA4 30.22 1.75 7 hypothetical protein D4GY68 30.19 6.5 26 hypothetical protein D4GZV5 30.17 5.5 22 riboflavin kinase D4GW94 30.13 7.25 29 acyl-CoA dehydrogenase D4GVF0 30.04 4.25 17 hypothetical protein D4GXN9 30.04 11.75 47 DNA mismatch repair protein D4GT44 30.00 3.5 14 proteasome assembly chaperone family protein D4GXB0 30.00 2.25 9 6-pyruvoyltetrahydropterin synthase D4GT84 30.00 2 8 hypothetical protein D4GU32 30.00 1 2 photosystem reaction center subunit H D4GRP3 29.98 5.5 22 IclR family transcriptional regulator D4GVL3 29.94 4.75 19 hypothetical protein D4GRL4 29.93 8 32 cobyric acid synthase CobQ D4GTQ2 29.92 7.5 30 HTR-like protein D4GZJ7 29.91 2.25 9 peroxiredoxin-like protein

137

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4H028 29.89 4.25 17 TIGR00266 family protein D4GS16 29.82 5.75 23 hypothetical protein D4GQY6 29.80 2.75 11 hypothetical protein D4GS09 29.80 6.75 27 deacylase D4GW80 29.79 3 12 hypothetical protein D4GZ23 29.79 7 28 SAM-dependent methyltransferase D4H092 29.78 10.25 41 Orc1-type DNA replication protein D4GRX0 29.77 4 16 peptidase M54 D4GU99 29.77 2.5 5 hypothetical protein D4GYY2 29.75 10.75 43 hydroxypyruvate reductase D4GSR1 29.72 2 8 prefoldin subunit beta D4GYI7 29.67 1 2 phosphocarrier protein HPr D4GZ92 29.67 10.25 41 urease subunit alpha D4GSH9 29.64 3.75 15 CopG family transcriptional regulator D4GSV2 29.62 8.5 34 aminopeptidase D4GP91 29.60 7.75 31 ABC transporter ATP-binding protein D4H063 29.59 3.5 14 6-carboxy-5,6,7,8-tetrahydropterin synthase D4GXB9 29.55 2.75 11 protease D4GV30 29.44 13.25 53 heavy metal translocating P-type ATPase D4GXQ1 29.42 2 8 transcriptional regulator D4GS66 29.37 4.75 19 ABC transporter ATP-binding protein D4GWR4 29.36 4 16 hypothetical protein D4GRM5 29.32 2.5 10 lactoylglutathione lyase D4GV52 29.32 6.75 27 histidinol dehydrogenase D4GV87 29.30 9.25 37 phosphomethylpyrimidine synthase D4GZN5 29.29 2 4 hypothetical protein L9V9K4 29.24 1.25 5 hypothetical protein D4GX57 29.23 1 1 hypothetical protein D4GTF7 29.22 4 16 5-formyltetrahydrofolate cyclo-ligase D4GV96 29.22 4.75 19 ABC transporter ATP-binding protein NAD(P)-dependent glycerol-1-phosphate D4GUF0 29.17 4.25 17 dehydrogenase D4GS15 29.17 6.75 27 hypothetical protein D4GST9 29.15 3 12 (2Fe-2S)-binding protein D4GZ08 29.14 6 24 uridine phosphorylase D4GUH6 29.12 3.75 15 ATP-NAD kinase D4GW78 29.05 3 12 30S ribosomal protein S28e D4GT82 29.00 2.75 11 transcription elongation factor Spt5 D4GV77 28.99 8 32 type III ribulose-bisphosphate carboxylase D4GVE6 28.94 2.5 10 hypothetical protein D4GYK0 28.93 5.5 22 NADH:flavin oxidoreductase D4GXA7 28.91 2.5 5 response regulator D4GY14 28.87 4.5 18 hypothetical protein D4GRW3 28.87 2 2 MarR family transcriptional regulator D4H0A0 28.86 1 1 hypothetical protein D4GYH5 28.84 10.75 43 UDP-glucose 6-dehydrogenase D4GV91 28.83 8.75 35 NADP-dependent malic enzyme D4GZP1 28.81 2 4 hypothetical protein D4GST1 28.76 3.5 14 universal stress protein UspA D4GY33 28.74 2 6 hypothetical protein

138

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GW93 28.70 4.5 18 farnesyl-diphosphate farnesyltransferase D4GWP9 28.69 10.5 42 glycine dehydrogenase (aminomethyl-transferring) D4GR61 28.67 2 4 hypothetical protein D4GYW5 28.66 4 16 prefoldin subunit alpha D4GS33 28.65 2.5 10 transcriptional regulator D4GTP9 28.65 5.5 22 oxidoreductase D4GT64 28.59 5.75 23 hypothetical protein D4GZ76 28.51 4.75 19 adenylate cyclase D4GRL2 28.50 19.25 77 11-domain light and oxygen sensing his kinase D4GSK1 28.50 3.75 15 IclR family transcriptional regulator D4GRJ4 28.46 2.25 9 hypothetical protein D4GVN2 28.43 5.25 21 potassium transporter Trk D4GUM8 28.43 8.5 34 hypothetical protein D4GSD6 28.40 5.25 21 hypothetical protein D4H005 28.35 2 2 integrase D4GVG9 28.33 2.5 10 hypothetical protein D4GPA4 28.31 6 24 glycosyl hydrolase family 88 D4GXJ9 28.29 2.5 5 hypothetical protein D4GU04 28.22 4.25 17 hypothetical protein D4GVV7 28.17 1 2 hypothetical protein D4GYT0 28.15 1.5 6 nitrogen regulatory protein P-II D4GQW5 28.13 5.5 22 3-oxoacyl-ACP reductase D4GS70 28.13 2.5 5 iron-dependent repressor D4GWS0 28.06 6 24 glycosyl transferase family 1 D4GUB4 28.05 1 4 hypothetical protein D4GTQ7 28.03 4 16 coenzyme A pyrophosphatase D4GQC2 28.01 5.75 23 gentisate 1,2-dioxygenase D4GTK5 27.96 10.25 41 preprotein translocase subunit SecD D4GUF9 27.94 1.25 5 hypothetical protein D4GYN0 27.90 4.75 19 stomatin-prohibitin-like protein D4GX37 27.78 1 1 hypothetical protein D4H024 27.78 1 2 hypothetical protein D4GW18 27.74 3.25 13 succinyl-diaminopimelate desuccinylase D4GSI6 27.72 5.25 21 threonine-phosphate decarboxylase D4GVI5 27.71 6.25 25 dehydrogenase D4GW34 27.70 8 32 hypothetical protein D4GX39 27.69 3.5 14 photosynthetic protein synthase I D4GQ21 27.65 5 20 hypothetical protein D4GYB0 27.64 3.5 14 RNA methyltransferase D4GXW3 27.60 1.5 6 hypothetical protein D4H098 27.59 1.75 7 hypothetical protein D4GX65 27.51 7.25 29 ATPase AAA D4GUW0 27.47 7.5 30 methylmalonyl-CoA mutase D4GYM9 27.44 3.75 15 acyl-CoA thioesterase D4GSS2 27.42 5 20 DNA-binding protein D4GSR6 27.39 5.5 22 hypothetical protein D4GTF4 27.38 8.5 34 GTP-binding protein D4GTZ9 27.38 1 1 hypothetical protein D4GRS9 27.37 4 16 hypothetical protein D4GVG7 27.37 7.75 31 DHH family phosphoesterase

139

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GUV1 27.36 3.75 15 aldehyde reductase D4GY40 27.34 4.25 17 hypothetical protein D4GRZ7 27.31 1.75 7 hypothetical protein D4GV89 27.24 5.5 22 universal stress protein UspA D4GYL0 27.16 1.25 5 ferredoxin D4GRK7 27.14 4.5 18 TetR family transcriptional regulator L9VDP5 27.13 2.5 5 hypothetical protein D4H038 27.10 2.5 10 hypothetical protein D4GWQ1 27.07 4.75 19 glycine cleavage system protein T D4GV25 27.05 2.25 9 hypothetical protein D4GTG4 27.03 2.33 7 phosphoesterase D4GYG3 26.98 4.5 18 glycosyl transferase D4GZP4 26.88 3 12 hypothetical protein D4H0D8 26.88 4.75 19 hypothetical protein pyridoxal 5'-phosphate synthase glutaminase D4GRX7 26.73 3 12 subunit PdxT D4GZ44 26.69 6.5 26 exonuclease D4GXT0 26.69 2 8 flavoprotein D4GPQ4 26.69 8.5 34 aspartate aminotransferase family protein D4GSY9 26.68 7.5 30 molybdenum transporter D4GYV1 26.64 7.5 30 pyridine nucleotide-disulfide oxidoreductase D4GSH8 26.64 1.25 5 transcriptional regulator D4GUP3 26.64 4.33 13 NAD-dependent epimerase D4GVM6 26.58 6.75 27 asparagine synthase D4GZB7 26.57 7.75 31 DNA primase D4H097 26.54 2.25 9 hypothetical protein D4GRV9 26.51 9 36 HNH endonuclease D4GWI3 26.50 6.25 25 hypothetical protein D4GUD2 26.48 8.25 33 PQQ repeat-containing protein D4GU63 26.47 5.25 21 rhamnosyl transferase-like protein D4GYR6 26.35 2.67 8 hypothetical protein D4GXE5 26.28 12 48 ATPase D4GVS1 26.23 8 32 DNA primase D4GYG7 26.23 4.25 17 glycosyltransferase AglE D4GPD2 26.22 5.25 21 hypothetical protein D4GYR4 26.21 12.25 49 sulfatase D4GY48 26.19 3.25 13 cupin D4GRX2 26.14 4 16 haloacid dehalogenase D4GSN2 26.13 7 28 alcohol dehydrogenase D4GPL3 26.09 1 1 hypothetical protein D4GP98 26.08 6 24 epimerase D4GVA0 26.07 5.25 21 hypothetical protein D4GZT6 26.03 9 36 hypothetical protein D4GRD0 25.95 4.5 18 transcription regulator D4GPB3 25.94 8.25 33 mandelate racemase D4GVS0 25.93 6.5 26 glucose-1-phosphate thymidylyltransferase D4GWK4 25.92 7 28 hypothetical protein D4GR89 25.89 5 20 peptide ABC transporter ATP-binding protein D4H0C6 25.86 1 3 hypothetical protein D4GV73 25.85 5.75 23 ribose 1,5-bisphosphate isomerase

140

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GU43 25.82 1.5 6 AsnC family transcriptional regulator D4GTP8 25.78 5.75 23 tRNA pseudouridine(55) synthase TruB D4GRM0 25.76 6.75 27 histidine ammonia-lyase D4GP56 25.74 7.25 29 ferredoxin D4GWL4 25.69 2.33 7 universal stress protein UspA D4GPQ6 25.69 3.5 14 hypothetical protein D4GRX1 25.67 1.5 3 hypothetical protein D4GTG9 25.65 16 64 DNA mismatch repair protein MutS D4GZL0 25.58 1 1 hypothetical protein D4GPX1 25.56 7.5 30 Uncharacterized protein HVO_B0324 D4GYI0 25.55 4.25 17 phosphoglycolate phosphatase D4GY67 25.54 5 20 CoA ester lyase D4GT17 25.51 2 8 hypothetical protein D4GZI5 25.49 2 8 AsnC family transcriptional regulator D4GSF3 25.46 4.5 18 adenylyltransferase D4GS23 25.43 5.25 21 alpha-L-glutamate ligase D4GY76 25.43 5 20 hypothetical protein D4GS10 25.41 4.75 19 threonine synthase D4GWY5 25.41 5.5 22 circadian clock protein KaiC D4GYZ4 25.38 11.75 47 DNA ligase D4GU35 25.37 4 16 hypothetical protein D4GPJ5 25.30 6 18 hypothetical protein D4GZM5 25.28 5.5 22 hypothetical protein D4GVC0 25.28 7 28 TIGR01210 family radical SAM protein D4GYL1 25.26 6.75 27 hypothetical protein D4GWV5 25.25 15 60 ATPase AAA D4GWF3 25.24 6.5 26 di-trans,poly-cis-decaprenylcistransferase D4GY47 25.23 6.25 25 ABC transporter ATP-binding protein geranylgeranylglyceryl/heptaprenylglyceryl D4GT16 25.21 2.25 9 phosphate synthase D4H047 25.17 1 2 hypothetical protein D4H071 25.13 5 20 transcription factor D4GS44 25.10 3.75 15 creatininase D4GRS0 25.07 4.5 18 ABC transporter substrate-binding protein D4GSG0 25.07 7 28 ABC transporter ATP-binding protein D4H072 25.00 3.5 14 hypothetical protein D4GYK2 25.00 2 8 hypothetical protein D4GRD9 25.00 1 1 hypothetical protein D4GR83 25.00 5 20 Nucleotidyltransferase domain protein D4GP92 24.93 4.75 19 ABC transporter ATP-binding protein D4GZS3 24.93 3.75 15 mannose-1-phosphate guanyltransferase D4GZ96 24.89 5 20 urease accessory protein UreE D4GXP4 24.83 9 36 hypothetical protein D4GP87 24.81 6.25 25 Glycoside hydrolase family protein HVO_B0085 D4GWT3 24.79 1 3 hypothetical protein D4GSG1 24.78 11.75 47 hypothetical protein D4GSG4 24.75 5 20 atypical protein kinase D4GT50 24.73 2.5 5 50S ribosomal protein L44e D4GZW8 24.70 6.5 26 tRNA(Ile2) 2-agmatinylcytidine synthetase D4GWN7 24.68 3 12 haloacid dehalogenase

141

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GUR9 24.66 5.5 22 ABC transporter ATP-binding protein D4GXF6 24.62 8.25 33 peptidase M24 D4GQG5 24.56 2 2 hypothetical protein D4GZS9 24.55 6.75 27 radical SAM protein D4GRA9 24.54 2.5 10 zinc ribbon domain-containing protein D4GP85 24.48 5.5 22 gluconolactonase D4GSD3 24.47 3 12 cysteine hydrolase D4GWD6 24.45 9.25 37 molybdopterin biosynthesis protein D4GR56 24.43 3.5 14 AsnC family transcriptional regulator D4GXD8 24.41 3.25 13 adenylate kinase D4H036 24.40 2 6 photosystem reaction center subunit H D4GUW8 24.34 7 28 hypothetical protein D4GSJ9 24.33 5 20 epimerase D4GUN1 24.30 3.33 10 ABC transporter ATP-binding protein D4GP18 24.29 2 8 hypothetical protein P50559 24.27 4.75 19 50S ribosomal protein L5 D4GWL6 24.27 1.75 7 hypothetical protein D4GUC9 24.26 9.5 38 hypothetical protein A0A1C9J 24.18 1 1 Uncharacterized protein HVO_1792A 6V6 D4GWJ3 24.17 5 20 transcriptional regulator D4GPS6 24.15 3 12 SAM-dependent methyltransferase D4GQ03 24.14 1.5 3 hypothetical protein D4GSY2 24.11 3.5 14 hypothetical protein D4H0D9 24.07 1.75 7 hypothetical protein D4GZ49 24.07 5 20 integrase D4GUS0 24.02 6 24 ABC transporter ATP-binding protein D4GZI6 24.00 1 3 hypothetical protein D4GW46 23.90 7.25 29 heme ABC transporter ATP-binding protein D4GTN8 23.86 2 6 hypothetical protein D4GUM5 23.79 4.5 18 endonuclease III D4GUK9 23.77 3.25 13 hypothetical protein D4GYB7 23.76 5 20 hypothetical protein D4GPA6 23.75 1.25 5 hypothetical protein D4GYY9 23.74 2.25 9 hypothetical protein D4GW79 23.72 7.5 30 hypothetical protein D4GY56 23.69 9 27 propionyl-CoA carboxylase D4GYJ4 23.59 3 12 acyl-CoA thioesterase D4GS80 23.53 1.5 6 hypothetical protein nicotinate-nucleotide diphosphorylase D4GU12 23.51 4.5 18 (carboxylating) D4GTK7 23.49 3.5 14 ribonuclease HII D4GYN2 23.48 2.75 11 phosphoesterase D4GVA8 23.47 12.25 49 chromosome segregation protein SMC D4GZH9 23.45 3.75 15 hypothetical protein D4GXG3 23.44 4.25 17 prephenate dehydrogenase D4GVJ2 23.42 2 8 FAD synthase D4GT63 23.41 8.5 34 anthranilate synthase component I D4GPV9 23.40 1 1 hypothetical protein D4GT99 23.40 4.75 19 phosphohydrolase

142

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GZF4 23.39 5.75 23 acyl-CoA dehydrogenase D4GYW8 23.38 4.75 19 2-hydroxyacid dehydrogenase D4GPE6 23.38 2.67 8 creatininase D4GUP1 23.37 7 28 iron ABC transporter substrate-binding protein D4GUF3 23.37 5.5 22 glycosyl transferase family 1 D4GTG3 23.37 6.5 26 translation initiation factor 2 D4H017 23.34 4 16 hypothetical protein D4GW76 23.33 1 4 50S ribosomal protein L7ae D4GWH6 23.30 4.25 17 hypothetical protein D4GPW8 23.30 6 24 NADH-dependent dehydrogenase D4GPM5 23.28 1.67 5 cupin D4GW73 23.28 11.5 46 tRNA cytosine(34) acetyltransferase TmcA D4GSJ0 23.25 3.5 14 chromosome partitioning protein ParA D4GWT0 23.23 5.5 22 N-acetylglucosamine-1-phosphate uridyltransferase D4GPF1 23.21 5.25 21 ABC transporter substrate-binding protein D4GV83 23.19 4.25 17 halocyanin D4GVS3 23.19 6.5 26 hypothetical protein D4GS27 23.18 2 2 pyridoxamine 5'-phosphate oxidase D4H0B2 23.17 1 1 hypothetical protein D4GS19 23.15 1.25 5 phosphodiesterase D4GTR7 23.10 5 20 alpha/beta hydrolase D4GZ94 23.07 2.75 11 urease accessory protein UreG D4GYL2 23.05 4.75 19 hypothetical protein D4GYW1 23.00 1.5 6 50S ribosomal protein L39e D4GX43 22.97 6.75 27 Tat pathway signal protein D4GZH8 22.97 4 16 ribose-phosphate diphosphokinase D4GVA7 22.91 2.5 10 hypothetical protein D4GZA2 22.88 4 16 transcription factor D4GRT8 22.83 2.75 11 lactoylglutathione lyase D4GZ57 22.82 1 2 hypothetical protein D4GXI2 22.76 7 28 hypothetical protein D4GU29 22.74 5 20 hypothetical protein D4GP67 22.71 1 3 hypothetical protein D4GTW0 22.60 9.5 38 phytoene dehydrogenase D4GRG3 22.58 2.25 9 peptidyl-prolyl cis-trans isomerase D4GRU8 22.58 2.33 7 hypothetical protein D4GS89 22.58 5 20 hypothetical protein D4GXP8 22.55 1.67 5 hypothetical protein D4GXC5 22.54 3.25 13 hypothetical protein D4GZ20 22.54 3.25 13 alpha/beta hydrolase D4GT77 22.47 1.5 3 hypothetical protein D4GSR2 22.47 1 1 KEOPS complex Pcc1 subunit D4GX84 22.47 3.5 14 hypothetical protein D4H082 22.45 6.5 26 hypothetical protein D4GZD8 22.39 6 24 ATPase AAA D4GWH7 22.34 3.25 13 cysteine hydrolase D4GUL0 22.33 2.75 11 transcriptional regulator D4GSC5 22.33 1 3 hypothetical protein D4GWP2 22.32 3.75 15 ATP--cob(I)alamin adenosyltransferase D4GSJ5 22.32 3.25 13 hypothetical protein

143

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GSN9 22.30 6.5 26 cell division control protein Cdc6 D4GQC9 22.27 9.5 38 3-hydroxybutyryl-CoA dehydrogenase methylmalonyl Co-A mutase-associated GTPase D4GUG7 22.24 5.25 21 MeaB D4GTL6 22.24 4.75 19 proteinase IV-like protein D4GSY7 22.22 3.67 11 phosphate ABC transporter ATP-binding protein D4GTE5 22.20 8.75 35 potassium transporter D4GQU5 22.20 7.5 30 L-fuculose phosphate aldolase D4GTA0 22.18 2.5 10 hypothetical protein 1-(5-phosphoribosyl)-5-((5- D4GY74 22.16 2.25 9 phosphoribosylamino)methylideneamino)imidazole- 4-carboxamide isomerase D4GTE3 22.15 3.5 14 acetyl-CoA acetyltransferase D4GWL8 22.15 2.5 10 haloacid dehalogenase D4GWB4 22.12 2.5 10 IS200/IS605 family transposase D4GY54 22.05 3 12 fructose-bisphosphatase class I D4GTK6 22.04 1.25 5 hypothetical protein D4GYJ8 22.04 5 20 S26 family signal peptidase D4GZL8 22.00 2.5 5 hypothetical protein D4GU96 21.92 2.5 10 iron ABC transporter substrate-binding protein D4GQ72 21.92 1 1 hypothetical protein D4GX87 21.91 4 16 hypothetical protein D4GZ27 21.90 6 24 helicase D4H025 21.89 9.5 38 hypothetical protein D4GXT9 21.86 8 32 methylmalonyl-CoA mutase D4GWS1 21.83 4.75 19 hypothetical protein D4GXV2 21.79 4.25 17 enoyl-CoA hydratase D4GRA7 21.78 7.5 30 DNA repair helicase diaminohydroxyphosphoribosylaminopyrimidine D4GXL5 21.77 2.33 7 reductase D4GWU8 21.76 5 20 transcriptional regulator D4GWQ9 21.74 3.25 13 transcriptional regulator D4GS14 21.72 3.5 14 protein-L-isoaspartate O-methyltransferase D4GRY8 21.70 2.75 11 phosphate-binding protein D4GRM2 21.68 4.75 19 formimidoylglutamase D4GYB4 21.68 8.75 35 excinuclease ABC subunit C D4GYT8 21.64 6 24 hypothetical protein D4GVG8 21.63 3.5 14 hypothetical protein D4GYN4 21.63 9.75 39 helicase D4GQY0 21.60 4.5 18 L-asparaginase D4GU98 21.54 3.33 10 short-chain dehydrogenase D4GV79 21.53 2.25 9 hypothetical protein D4GPH4 21.45 11.75 47 hypothetical protein D4GXE6 21.45 4.5 18 DNA polymerase IV D4GYJ9 21.44 6.5 26 DNA polymerase II D4GWE6 21.37 8 32 glutamyl-tRNA reductase D4GVW6 21.36 1.33 4 adenine phosphoribosyltransferase D4GUM9 21.35 14.75 59 hypothetical protein D4GWS7 21.31 4.25 17 hypothetical protein D4GYT6 21.31 3.5 14 histidinol-phosphatase

144

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GZ14 21.29 9.75 39 acetyl-CoA synthetase D4GUX0 21.28 6.25 25 hypothetical protein D4GS47 21.24 1.33 4 hypothetical protein D4GSM6 21.23 3 12 N-acetyltransferase D4GTD8 21.17 3.75 15 ATP-binding protein D4GZ98 21.14 2.75 11 hypothetical protein D4GSP6 21.12 5.25 21 ATPase AAA D4GRF9 21.12 4.25 17 universal stress protein UspA D4GRP8 21.09 2.25 9 transcriptional regulator D4GUZ9 21.09 1 3 (2Fe-2S)-binding protein D4GZK5 21.05 1 1 hypothetical protein D4GZD5 21.01 10.25 41 DNA mismatch repair protein MutS D4GST6 21.00 1 1 protease La-like protein type 2 D4GR05 20.99 5.25 21 2-keto-3-deoxygluconate kinase D4GYV6 20.98 5.25 21 two-component sensor histidine kinase D4GXP1 20.97 2.5 10 hypothetical protein D4GSV0 20.95 10.5 42 oligoendopeptidase F D4GQI5 20.93 2.25 9 acetyl-coenzyme A synthetase D4GYH3 20.93 5.5 22 glycosyl transferase family A D4GT61 20.92 2 8 glutamine amidotransferase D4GVL4 20.91 3 12 uracil-DNA glycosylase D4H0B6 20.91 5.25 21 hypothetical protein D4GU27 20.91 1.5 6 hypothetical protein D4GU62 20.89 5 20 mannosyltransferase B D4GY13 20.89 6 24 hypothetical protein D4H062 20.88 3 9 radical SAM protein D4GUC1 20.79 1 1 hypothetical protein D4GZE1 20.75 4 16 cytochrome c D4GWD2 20.73 1 1 hypothetical protein D4GZJ5 20.70 6.75 27 DNA-binding protein D4GPF0 20.70 7 21 oleate hydratase D4GWR9 20.68 4.75 19 glycosyl transferase family 1 D4GQJ0 20.66 3 12 TetR family transcriptional regulator D4GQY1 20.64 5.5 22 allantoinase D4GUF4 20.56 8.25 33 hypothetical protein D4GVU0 20.51 1 1 hypothetical protein D4GV15 20.51 2.75 11 Rieske iron-sulfur protein D4H0D2 20.50 4 16 phospholipase D Active site motif domain protein D4GQK7 20.49 4.75 19 V-type ATP synthase subunit D Q48330 20.47 5.5 22 ATP synthase subunit C D4GVW9 20.47 6 24 hypothetical protein D4GXQ9 20.42 4 12 MBL fold metallo-hydrolase D4GX28 20.42 8 32 AMP-dependent synthetase D4H048 20.40 11.5 46 ATP-dependent helicase D4GVP1 20.37 2.5 5 universal stress protein UspA D4GUC6 20.36 1.67 5 GNAT family N-acetyltransferase D4GT92 20.35 2.75 11 endonuclease V D4GVW0 20.29 2.75 11 fumarylacetoacetase D4GUF5 20.29 1 3 halocyanin D4GWA4 20.27 1 3 halocyanin

145

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GTG8 20.25 6.5 26 DNA mismatch repair protein MutL D4GSB3 20.21 1.75 7 hypothetical protein acetoin:2,6-dichlorophenolindophenol D4GSZ9 20.20 5.5 22 oxidoreductase subunit alpha D4GZI8 20.16 5 20 threonine aldolase D4GP41 20.12 7 28 aldehyde dehydrogenase D4GZS6 20.12 2.75 11 DNA-directed RNA polymerase sigma-70 factor D4GT06 20.10 3.25 13 hypothetical protein D4GUN0 20.08 5.25 21 hypothetical protein D4GPH5 20.07 4 16 hypothetical protein D4GT66 20.06 1 2 shikimate 5-dehydrogenase two-component system sensor histidine D4GSD5 20.05 12.75 51 kinase/response regulator D4GVN8 20.00 1 1 dodecin-related protein D4H0E3 20.00 1 4 hypothetical protein D4GZ26 20.00 2.25 9 hypothetical protein D4GU05 19.99 6.75 27 GTP-binding protein D4GW87 19.93 3.75 15 hypothetical protein D4GTU2 19.90 5.5 22 N-acetyltransferase D4GUY3 19.90 1 3 universal stress protein UspA D4GUA5 19.88 2 8 DSBA oxidoreductase D4GWL3 19.88 1.67 5 NADH oxidase-like protein D4GW97 19.86 1.25 5 hypothetical protein D4GX83 19.86 1 2 universal stress protein UspA D4GW30 19.85 2 8 NYN domain-containing protein D4GWQ0 19.84 3.25 13 glycine cleavage system protein H D4GV28 19.81 1.5 6 hypothetical protein D4GYR9 19.80 4.75 19 recombinase RecJ D4GZD9 19.78 3.75 15 ribose-5-phosphate isomerase D4GZG4 19.78 3.25 13 hypothetical protein D4GUI0 19.77 4 16 GHMP kinase D4GVZ2 19.76 20.25 81 hypothetical protein D4GP17 19.74 1 1 hypothetical protein D4GRY4 19.70 2 2 hypothetical protein D4GQB6 19.69 5.75 23 similar to bll7610 D4GY12 19.69 3.5 14 lipoyl synthase D4GRD5 19.69 3.75 15 diguanylate cyclase D4GY03 19.67 3.25 13 transcriptional regulator D4GQU4 19.65 4.5 18 galactonate dehydratase D4GPZ2 19.64 5.5 22 mandelate racemase D4GY39 19.63 2.75 11 cysteine synthase D4GSV1 19.61 1 1 small CPxCG-related zinc finger protein D4GVL0 19.59 7 28 type II secretion system protein D4GTS9 19.58 3.75 15 glycosyl transferase family 2 D4GY50 19.58 5 20 3-hydroxybutyryl-CoA dehydrogenase D4GT04 19.58 2.25 9 hypothetical protein D4GVB0 19.57 1.5 6 molybdopterin synthase sulfur carrier subunit D4GTE6 19.56 8 32 long-chain fatty acid--CoA ligase D4GTF2 19.55 2.5 10 hypothetical protein D4GYK6 19.52 2.5 10 DNA repair protein

146

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GV27 19.51 2 8 tautomerase D4GYD3 19.51 4 16 galactokinase D4H016 19.50 2.5 10 RNA-binding protein D4GYE4 19.48 2 6 PTS fructose transporter subunit IIA D4GXM9 19.47 1.5 6 hypothetical protein D4GTA3 19.44 4.75 19 nucleoside deaminase D4GRT9 19.40 1.67 5 hypothetical protein D4GVA2 19.36 4 16 hypothetical protein D4GYL4 19.36 3.25 13 SAM-dependent methyltransferase D4GXS3 19.36 3.75 15 pyrroline-5-carboxylate reductase D4GVY3 19.35 5.5 22 hypothetical protein D4GVY0 19.32 1 1 hypothetical protein D4GTE8 19.30 1 1 Uncharacterized protein HVO_1919 D4GZU9 19.29 2 8 hypothetical protein D4GU59 19.23 1 1 hypothetical protein D4GS07 19.22 7 28 potassium channel protein D4GUI8 19.20 2.25 9 hypothetical protein D4GTP2 19.15 1 2 hypothetical protein D4GWW2 19.14 4 16 acyl-CoA dehydrogenase D4GX36 19.12 4.75 19 Tat pathway signal protein D4GYE3 19.10 1 3 phosphocarrier protein HPr D4GXK9 19.06 10.25 41 hypothetical protein D4GZZ8 19.05 1 2 hypothetical protein D4GUF7 19.04 4.25 17 peptidase M42 D4GWL9 19.03 1.5 6 hypothetical protein D4GSH3 19.01 1 2 hypothetical protein D4GQ05 18.98 2.25 9 hypothetical protein TPP-dependent acetoin dehydrogenase complex, D4GSZ8 18.97 3 12 E1 protein subunit beta D4GTD2 18.95 5 20 DNA-directed RNA polymerase D4GSM2 18.93 1 2 hypothetical protein D4GUK3 18.92 1.33 4 hypothetical protein D4GPN8 18.89 1 1 Uncharacterized protein HVO_B0237 D4GX50 18.85 2.33 7 NUDIX hydrolase D4GXE1 18.80 5.75 23 adaptive-response sensory-kinase D4GXD5 18.79 1.5 6 hypothetical protein D4GR09 18.75 3.25 13 ArcR family transcription regulator D4GRM7 18.75 1 2 3-isopropylmalate dehydratase small subunit D4GSR9 18.75 1 4 peptidyl-tRNA hydrolase D4GR46 18.74 6.5 26 N-methylhydantoinase D4GRU3 18.73 4.25 17 cysteine desulfurase P15093 18.72 2 6 dihydrofolate reductase D4GTH7 18.72 1.5 3 NUDIX hydrolase D4GWR8 18.68 1 1 ribonuclease P D4GQQ9 18.65 3.5 14 peptide-methionine (S)-S-oxide reductase D4GVK0 18.63 3 12 hypothetical protein D4GY88 18.59 5.25 21 hypothetical protein D4GWU6 18.57 1.25 5 hypothetical protein D4GWN0 18.55 3.5 14 hypothetical protein D4GUN7 18.55 2 2 hypothetical protein

147

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GWU3 18.55 4.75 19 metal-dependent hydrolase D4GWU9 18.52 3.33 10 proline dehydrogenase D4GPZ9 18.52 1.67 5 hypothetical protein D4GWL1 18.50 4.5 18 NAD(+) kinase D4GVN9 18.46 4.25 17 2',3'-cyclic-nucleotide 2'-phosphodiesterase D4GSB1 18.46 3.25 13 hypothetical protein D4GRE8 18.45 5 20 aminotransferase class V D4H003 18.45 1 1 hypothetical protein D4GPM4 18.41 3.33 10 hypothetical protein D4GWE2 18.41 2 8 4a-hydroxytetrahydrobiopterin dehydratase D4GTH3 18.39 5.75 23 hypothetical protein D4GW09 18.38 2 4 transcription factor D4GYD9 18.37 1 3 hypothetical protein D4GRM1 18.33 3.5 14 imidazolonepropionase D4H006 18.31 1 3 hypothetical protein D4GQA3 18.27 2.33 7 DUF159 family protein D4H0B7 18.25 2.25 9 hypothetical protein D4GTS5 18.23 2.5 10 MBL fold hydrolase D4GWF1 18.18 1 1 hypothetical protein D4GXG4 18.18 1 3 hypothetical protein D4GZ32 18.18 2.5 10 nitrate ABC transporter substrate-binding protein D4GXI3 18.17 3.75 15 shikimate kinase D4GYQ9 18.17 1.5 6 DNA-binding protein D4GV10 18.14 4.5 18 tRNA (guanine-N1)-methyltransferase D4GZ10 18.10 2.33 7 cytidine deaminase D4GYV9 18.05 1 1 histidine phosphatase family protein phosphate ABC transporter substrate-binding D4GWM3 18.04 3.75 15 protein D4GXN8 17.99 1.75 7 hypothetical protein D4H022 17.99 5 20 electron transfer flavoprotein D4GQY4 17.98 5 20 aspartate aminotransferase family protein D4GQ34 17.97 7 28 cell division control protein Cdc6 D4GTB2 17.93 4 16 hypothetical protein D4GX12 17.89 1.75 7 hypothetical protein D4GPY0 17.88 4.75 19 oxidoreductase D4GQV4 17.86 2.67 8 sugar fermentation stimulation protein SfsA D4GZL7 17.86 1 2 hypothetical protein D4GSG2 17.85 7.25 29 alpha-amylase D4GWJ0 17.81 3.67 11 transcriptional regulator D4GRS6 17.79 6 24 pyridine nucleotide-disulfide oxidoreductase D4GXN5 17.74 1.5 3 hypothetical protein D4GPA3 17.70 3.75 15 IclR family transcriptional regulator D4GW07 17.70 2.75 11 hypothetical protein D4GQI6 17.69 6.25 25 bacterio-opsin activator D4GU02 17.63 1.67 5 hypothetical protein Q59468 17.62 4.5 18 3-hydroxy-3-methylglutaryl-CoA reductase D4GXY8 17.62 1.33 4 flavin reductase D4GS63 17.61 4 16 sugar ABC transporter substrate-binding protein D4GSH5 17.60 2.67 8 hypothetical protein D4GUW3 17.59 1.5 6 hypothetical protein

148

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GTL4 17.59 3.75 15 ABC transporter ATP-binding protein D4GWW1 17.58 5 20 hypothetical protein D4GXX5 17.55 1.5 6 acylphosphatase D4GYU4 17.53 6.5 26 helicase D4GYU2 17.52 2.75 11 hypothetical protein D4GWF5 17.49 7 28 serine protease D4GY35 17.49 3.25 13 hypothetical protein D4GXU4 17.48 3 12 sulfurase D4GSK8 17.48 1 4 universal stress protein UspA D4GU06 17.47 2 8 molecular chaperone DnaJ D4GZF6 17.45 1 3 ferredoxin D4GQT3 17.41 5 20 ATPase D4GR96 17.41 1.33 4 hypothetical protein D4GZG8 17.36 4.33 13 hypothetical protein D4GTW5 17.34 3.25 13 PGF-CTERM sorting domain-containing protein D4GYJ2 17.33 2.25 9 hypothetical protein D4GPP3 17.31 1.67 5 IS200/IS605 family transposase ISHvo18 D4GP12 17.30 4.25 17 N-methyltryptophan oxidase D4H0E9 17.28 3.5 14 FAD-dependent oxidoreductase HVO_C0067 D4GS74 17.27 1.75 7 hypothetical protein D4GZW6 17.26 2.75 11 glutaredoxin D4GS04 17.25 4.5 18 threonine ammonia-lyase D4GW44 17.24 1.5 6 50S ribosomal protein L37.eR D4GYJ5 17.23 1.33 4 hypothetical protein D4H077 17.21 1 3 calcium-binding protein D4GYC8 17.12 5.25 21 transducer protein HemAT D4GXY3 17.11 2.75 11 transcriptional regulator D4GVV0 17.11 2.75 11 peptide-methionine (R)-S-oxide reductase D4H078 17.09 2.5 10 hypothetical protein D4GYP7 17.08 3.25 13 potassium transporter TrkA D4GQS1 17.08 2 8 hypothetical protein D4H043 17.08 2.5 10 chromosome partitioning protein ParB D4GTD3 17.05 1 1 hypothetical protein D4GP40 17.05 4.25 17 D-xylonate dehydratase D4GUW5 17.04 5.3 16 acyl-CoA synthetase D4GZK1 17.02 1 3 hypothetical protein D4GXK1 17.02 12 48 helicase D4GP27 16.99 2.67 8 short-chain dehydrogenase D4GZW0 16.97 4.33 13 proline dehydrogenase D4GXS4 16.96 2 8 hypothetical protein D4GX47 16.96 3.75 15 DSBA oxidoreductase D4GQ56 16.96 1 2 hypothetical protein D4GZT5 16.90 6.25 25 hypothetical protein GTP--adenosylcobinamide-phosphate D4GSI4 16.88 1.5 6 guanylyltransferase D4GS42 16.85 1 1 hypothetical protein D4GT32 16.80 3.75 15 segregation/condensation protein A D4GYZ2 16.80 2 2 hypothetical protein D4GZN3 16.78 2.5 10 fibrillarin-like rRNA methylase D4GV12 16.67 2 4 hypothetical protein

149

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GW70 16.67 1 2 hypothetical protein D4GTS7 16.67 1 2 ArsR family transcriptional regulator D4GXU0 16.67 1 2 caffeoyl-CoA O-methyltransferase D4GVJ4 16.67 3 9 fructosamine kinase D4GX51 16.67 1.5 6 hypothetical protein D4GRS7 16.65 5.25 21 hypothetical protein D4GX45 16.64 3.5 14 hypothetical protein D4GSC7 16.63 3.25 13 hypothetical protein D4GXV5 16.59 4.75 19 ethylammeline chlorohydrolase D4GXV4 16.58 2.5 10 S-adenosylmethionine-dependent methyltransferase D4GUI6 16.57 2 6 hypothetical protein D4GPD5 16.57 2.25 9 multidrug ABC transporter ATP-binding protein D4H064 16.54 1 1 thioesterase D4GX00 16.52 1 1 thiol reductase thioredoxin D4GRX6 16.50 1.25 5 phosphoribosyl-ATP diphosphatase D4GWA2 16.50 2.5 10 adenosine deaminase D4GPF8 16.48 2.25 9 hypothetical protein D4GVC7 16.47 2.75 11 NAD-dependent protein deacetylase D4GZB4 16.43 1 3 nucleoid-structuring protein H-NS D4GYD0 16.35 2 8 hypothetical protein D4GVM8 16.34 2 8 transcription initiation factor IIB 2 D4GSG5 16.31 4.25 17 ATP-binding protein D4GTS4 16.31 1.67 5 peptidase D4GYG0 16.29 2.5 10 hypothetical protein D4GPZ3 16.28 4 16 mandelate racemase D4GRH5 16.27 1 3 thioesterase D4GY57 16.27 5.25 21 GTP-binding protein D4GYE6 16.23 2.75 11 1-phosphofructokinase D4GWW3 16.23 1.5 3 fla cluster protein FlaD2 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline D4GPU8 16.22 2.25 9 decarboxylase D4GT19 16.21 4.75 19 aryl-alcohol dehydrogenase D4GP32 16.21 2.5 5 short-chain dehydrogenase D4GXG1 16.19 2.5 5 short chain dehydrogenase D4GVM5 16.19 2.25 9 phosphoesterase D4GZ81 16.18 2 8 lipase/esterase D4GSW4 16.16 3.67 11 thiamine-phosphate kinase D4GR88 16.11 4 16 peptide ABC transporter ATP-binding protein D4GT18 16.09 3 12 restriction endonuclease D4GQS2 16.07 1 1 Uncharacterized protein HVO_A0243 D4GXR4 16.06 1 1 hypothetical protein D4GU48 16.06 4 16 transcriptional regulator D4GZW7 16.05 3.75 15 transcriptional regulator Q9YGA5 16.04 1.5 6 transcription initiation factor IIB 2 Q1XBW0 16.04 1 4 cupin D4GSN4 16.03 1 1 hypothetical protein D4GPP6 16.01 1.75 7 molybdenum cofactor guanylyltransferase D4GW71 15.96 1 1 hypothetical protein D4GQX9 15.94 3.33 10 polysaccharide deacetylase D4GZ64 15.94 1 1 hypothetical protein

150

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GPZ4 15.93 3 12 oxidoreductase D4GXI6 15.91 1 1 hypothetical protein D4GZC3 15.90 3.25 13 AsnC family transcriptional regulator D4GRB8 15.87 2 6 hypothetical protein D4GTS1 15.87 1.67 5 zinc/iron-chelating domain-containing protein D4GP68 15.85 1 1 transcriptional regulator D4GTA5 15.83 4.75 19 hypothetical protein D4GV72 15.80 6.75 27 AMP phosphorylase D4GX79 15.78 2.25 9 membrane protein D4GRA0 15.78 1.33 4 hypothetical protein D4GXL8 15.77 1.5 6 thiol reductase thioredoxin D4GVJ8 15.75 2 4 hydrolase D4GTZ7 15.71 3 12 hypothetical protein D4GPT8 15.70 2 6 glycerophosphodiester phosphodiesterase D4GRW0 15.66 2.5 5 peptidase M20 D4GPM8 15.63 2.75 11 ABC transporter ATP-binding protein D4GPK3 15.63 2.5 10 PAS domain-containing protein D4GYH4 15.61 13.75 55 MFS transporter D4GY17 15.60 4.25 17 2-oxoisovalerate dehydrogenase subunit beta D4GXG7 15.59 3 12 5'/3'-nucleotidase SurE D4GXN3 15.56 11.75 47 DNA repair helicase D4GSV6 15.54 1.33 4 universal stress protein UspA D4GVD5 15.53 2 2 2-phospho-L-lactate guanylyltransferase D4GSG9 15.51 3.25 13 SAM-dependent methyltransferase D4GVR6 15.48 2.5 10 HNH endonuclease D4GPE7 15.45 4.75 19 aminotransferase class V D4GVK8 15.44 2 8 S-adenosylmethionine-dependent methyltransferase D4GRL9 15.41 3.33 10 iron ABC transporter substrate-binding protein D4GSG6 15.39 1.75 7 hypothetical protein D4GSN5 15.39 3 12 arginine ABC transporter ATP-binding protein D4GTN0 15.38 1 3 transcriptional regulator D4GUL2 15.38 2.75 11 SAM-dependent methyltransferase D4GPR3 15.34 7 28 glutamate dehydrogenase D4GQF7 15.34 4.5 18 integrase 2-oxoacid dehydrogenase E1 component subunit D4GUA9 15.30 2 2 alpha D4GSG3 15.26 3.25 13 transcriptional regulator D4GYZ7 15.25 2.75 11 alpha/beta hydrolase D4GYA5 15.23 2.25 9 sulfite oxidase D4GU56 15.22 4 16 cell division control protein Cdc6 D4GSS9 15.22 1.75 7 HAT (histone acetyltransferase) family protein D4GZQ3 15.15 1 1 hypothetical protein D4H0E5 15.15 1 3 CopG family transcriptional regulator D4GV59 15.15 2.5 10 carbonic anhydrase D4GTH0 15.09 2.75 11 magnesium chelatase D4GUI7 15.09 1 1 halocyanin D4GPB5 15.08 3 12 IclR family transcriptional regulator D4GRN1 15.08 4.25 17 amidohydrolase D4GR62 15.07 3.25 13 hypothetical protein D4GPT3 15.07 1 2 hypothetical protein

151

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GSQ6 15.00 1.5 3 hypothetical protein D4H090 14.95 10.25 41 copper-translocating P-type ATPase D4GYN3 14.90 4.75 19 cytochrome P450 D4GVA4 14.89 4.5 18 DUF58 domain-containing protein D4GT58 14.89 1.5 6 (2Fe-2S)-binding protein D4GSK9 14.88 1 1 MBL fold metallo-hydrolase D4H0C9 14.88 8.75 35 hypothetical protein D4GV53 14.88 1 4 iron-sulfur cluster assembly accessory protein D4GX03 14.86 1 1 purine-binding chemotaxis protein CheW D4GWW6 14.83 4.5 18 rhodanese D4GPK0 14.81 1.67 5 tRNA-specific adenosine deaminase D4GZL2 14.81 1.25 5 hypothetical protein D4GSB6 14.81 1.5 6 transcriptional regulator D4GSV3 14.81 1 1 hypothetical protein cobalamin ABC transporter substrate-binding D4GW42 14.79 3.25 13 protein D4GPF2 14.79 2 8 nickel-responsive transcriptional regulator NikR D4GPU7 14.77 2.75 11 urate oxidase D4H040 14.77 3.25 13 hypothetical protein D4GU37 14.77 4.75 19 hypothetical protein D4H0A7 14.72 3.5 14 chromosome partitioning protein ParA D4GRT4 14.71 1 2 hypothetical protein D4GSD4 14.70 1 3 esterase D4GVB6 14.70 6.25 25 aldehyde ferredoxin oxidoreductase D4GX07 14.69 3.5 14 GTP 3',8-cyclase MoaA D4GXH3 14.68 1.33 4 AAC(3) family N-acetyltransferase D4GQA5 14.63 1 1 hypothetical protein D4GZT0 14.63 5.75 23 hybrid sensor histidine kinase/response regulator D4GWL2 14.62 4.5 18 KaiC domain-containing protein D4GTX1 14.62 1.5 6 hypothetical protein D4GZV1 14.59 6.25 25 septum site-determining protein MinD D4GTN5 14.54 2 8 hypothetical protein D4GRI9 14.51 2.75 11 transcriptional regulator D4GTR1 14.50 1.67 5 hypothetical protein D4GUU8 14.49 4.25 17 signal peptide peptidase SppA D4GU75 14.48 1 4 flagellin D4GSP0 14.45 2.25 9 hypothetical protein D4GT55 14.43 3 9 dolichol-P-glucose transferase D4GYM5 14.39 1.5 6 NTP pyrophosphohydrolase D4GU84 14.31 5.25 21 Uncharacterized protein HVO_2071 D4GVQ8 14.29 1 1 transcriptional regulator D4GPI4 14.29 2.5 10 racemase D4GXS5 14.27 3 9 acyl-CoA dehydrogenase D4GUK2 14.25 1.67 5 hypothetical protein phosphate ABC transporter substrate-binding D4GRE2 14.20 3 12 protein D4GYC3 14.20 1.33 4 (2Fe-2S)-binding protein D4GSC1 14.15 4.75 19 MBL fold metallo-hydrolase D4GZ63 14.15 1 2 CDP-4-keto-6-deoxy-D-glucose-3-dehydrase D4GZ39 14.13 2.5 10 hypothetical protein

152

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GXZ7 14.13 1.25 5 haloacid dehalogenase D4GUE3 14.10 2.67 8 sugar kinase D4GQH9 14.05 3.25 13 transcription regulator D4GXK7 14.04 2.25 9 phosphoesterase D4GPB4 14.04 2.5 10 LLM class F420-dependent oxidoreductase D4GZI0 14.04 1 1 hypothetical protein D4GU52 14.03 3.5 14 iron ABC transporter substrate-binding protein D4H076 14.00 3.25 13 hypothetical protein D4GZE9 13.99 7 28 histidine kinase D4GZS2 13.98 1 4 hypothetical protein D4GPM9 13.94 3.75 15 ABC transporter substrate-binding protein D4GS41 13.94 1.25 5 hypothetical protein D4GVN7 13.93 4.5 18 Trk system potassium transport protein TrkA D4GTL3 13.91 2.75 11 isocitrate lyase D4GZH6 13.90 1.67 5 uracil-DNA glycosylase ABC-type transport system periplasmic substrate- D4GQW0 13.89 4.75 19 binding protein (Probable substrate sugar) tsgA5 D4GXF8 13.88 3.5 7 fatty acid-binding protein D4GWG5 13.88 5 20 hypothetical protein D4GSJ2 13.87 2 4 osmotically inducible protein C D4GYW0 13.86 1.5 6 2'-5' RNA ligase D4GR47 13.84 6.75 27 N-methylhydantoinase D4GRQ1 13.83 1.75 7 histidine kinase D4GVI1 13.83 1 4 hypothetical protein D4GX82 13.82 10.25 41 exonuclease V subunit beta D4GXF9 13.82 1.67 5 hypothetical protein D4GP94 13.77 1 1 peptide ABC transporter permease D4GSP8 13.76 1.25 5 5,6-dimethylbenzimidazole synthase D4GRL3 13.75 7 28 acyl-CoA synthetase D4GVP0 13.75 1.75 7 polyketide cyclase D4GRP6 13.75 3.5 14 glucose-1-phosphate thymidylyltransferase D4GYK5 13.67 4.25 17 L-cysteine desulfhydrase D4GQG9 13.67 2 8 phosphohydrolase D4GXA1 13.67 2 8 Histidine kinase HVO_2835 D4GUE9 13.65 2.5 10 potassium channel protein D4GQ54 13.55 3 12 hypothetical protein D4GR30 13.55 1 1 Uncharacterized protein HVO_A0361 D4GU03 13.55 2 4 methenyltetrahydromethanopterin cyclohydrolase D4GPU3 13.53 1 3 hypothetical protein D4GXJ8 13.53 1 2 transcriptional regulator D4GPA2 13.51 5 20 aldehyde dehydrogenase D4GRP7 13.50 2.75 11 HTR-like protein D4GVJ1 13.49 2 8 cytochrome c oxidase subunit II D4GX55 13.47 1 1 3-methyladenine DNA glycosylase D4GU74 13.44 3.75 15 glycosyl transferase D4GRT2 13.44 7.25 29 cadmium-transporting ATPase D4GQ28 13.43 1.75 7 transcription factor D4GR13 13.42 5.5 22 dipeptide ABC transporter ATP-binding protein D4GRL8 13.42 4 16 iron ABC transporter substrate-binding protein D4GZG7 13.39 1 3 hypothetical protein

153

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GQV6 13.33 1 3 DNA-directed RNA polymerase subunit M D4GQP4 13.33 1 1 metal-dependent hydrolase D4GSS7 13.32 3.25 13 hypothetical protein D4GV78 13.30 4.25 17 DEAD/DEAH box helicase D4GV75 13.30 2.75 11 NADH dehydrogenase subunit D D4GQF8 13.30 3.25 13 tryptophan--tRNA ligase D4GRU0 13.29 1 2 flagellin D4GX98 13.28 0.5 1 hypothetical protein D4GY84 13.28 3 9 o-succinylbenzoate synthase D4GQA6 13.27 9 36 hypothetical protein D4GRY9 13.24 3 12 imidazole glycerol phosphate synthase subunit HisH D4GP50 13.24 2.75 11 cobalt-precorrin-7 (C(5))-methyltransferase D4GTP0 13.23 1.33 4 sensor histidine kinase D4GRG8 13.21 1 1 transcriptional regulator D4GUU5 13.21 1 1 CGCGG family rSAM-modified RiPP protein D4GW99 13.19 1 1 hypothetical protein D4GVR0 13.16 1.5 6 hypothetical protein D4GTW3 13.12 4 16 phosphoribosylamine--glycine ligase D4GYU1 13.12 1.33 4 NADH-binding protein D4GP65 13.11 1 1 hypothetical protein D4GV98 13.11 4 16 ABC transporter permease D4GXZ9 13.10 2.5 10 phosphotransferase D4GQN8 13.07 9 36 helicase D4GWD8 13.06 2 8 3-phosphoglycerate kinase D4GZ95 13.04 2 6 urease accessory protein UreD D4GVP4 13.02 3.25 13 phosphopantothenoylcysteine decarboxylase D4GYG2 12.96 1 3 hypothetical protein D4GTP5 12.95 1 3 hypothetical protein D4GXI1 12.94 3.75 15 aspartate aminotransferase family protein D4GT86 12.94 2 2 triphosphoribosyl-dephospho-CoA synthase D4GXZ0 12.90 1 1 hypothetical protein BMP family ABC transporter substrate-binding D4GU44 12.90 2 8 protein D4GP33 12.89 2.5 10 epimerase branched-chain amino acid ABC transporter D4GPL8 12.87 4 16 substrate-binding protein D4GSA4 12.87 1.33 4 hypothetical protein D4GZT3 12.85 2 8 electron transfer flavoprotein subunit alpha D4GPQ2 12.83 3 3 ArcR family transcriptional regulator D4GTL7 12.82 1.75 7 hypothetical protein D4GPZ5 12.82 1 1 dihydrodipicolinate synthase family protein D4GRU2 12.81 2.5 5 acetylornithine deacetylase D4GUF1 12.78 4.75 19 potassium transporter TrkA D4GQ02 12.77 1.75 7 hypothetical protein D4GXZ5 12.73 3 12 NADH dehydrogenase D4GQB8 12.69 1.25 5 UspA domain protein D4GQ41 12.69 1.67 5 hypothetical protein D4GVV5 12.68 1 3 universal stress protein UspA D4GQ08 12.68 1.75 7 transcriptional regulator D4GT34 12.66 1 2 hypothetical protein

154

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GPX0 12.65 3.33 10 oxidoreductase D4GSF9 12.62 2.75 11 sugar ABC transporter substrate-binding protein D4H046 12.57 1.25 5 hypothetical protein D4GQS4 12.57 1.5 6 hypothetical protein D4GRE7 12.57 1 2 Uncharacterized protein HVO_A0482 D4GS32 12.56 2 6 DNA-binding protein D4GPC8 12.54 2.5 10 LLM class flavin-dependent oxidoreductase D4GY53 12.54 3.5 14 arsenical pump-driving ATPase D4GUQ5 12.52 2 6 IclR family transcriptional regulator D4GZE6 12.50 1 2 N-acetyltransferase D4GRR1 12.48 1.33 4 nitrous oxide reductase accessory protein NosL D4GXR6 12.45 2.5 10 MBL fold metallo-hydrolase D4GQF3 12.44 1.75 7 transcriptional regulator D4GWS8 12.39 1.5 6 competence damage-inducible protein A D4H0F8 12.36 2.5 10 ArcR family transcriptional regulator D4GYR7 12.33 1 1 hypothetical protein D4GR67 12.31 4.25 17 Fic family protein D4GX90 12.29 4 16 TrmB family transcriptional regulator D4GV93 12.28 19.25 77 PGF-CTERM sorting domain-containing protein D4GZF2 12.27 1.67 5 3-oxoadipate enol-lactonase D4GQI8 12.27 3.25 13 aminotransferase class I/II D4GQG1 12.25 1.75 7 hypothetical protein D4GSL4 12.24 1 1 hypothetical protein D4GWK7 12.22 1.5 3 hypothetical protein D4GTK1 12.20 2 8 N-acetyltransferase D4GVL6 12.20 4 16 molecular chaperone DnaJ D4GZR8 12.20 1.33 4 hypothetical protein D4GWE5 12.14 3.75 15 Uncharacterized protein HVO_2291 D4GP74 12.11 1.33 4 bacterio-opsin activator D4GYF8 12.11 1 2 hypothetical protein D4GVI0 12.08 1 1 ZIP family metal transporter D4GRG7 12.07 1.67 5 enoyl-CoA hydratase L9V8L1 12.06 1.67 5 hypothetical protein D4GRA3 12.06 1.5 6 hypothetical protein P25062 12.06 4.5 18 major cell surface glycoprotein 7,8-didemethyl-8-hydroxy-5-deazariboflavin D4GVD4 12.02 4 16 synthase subunit CofG D4GSC2 12.00 1 1 hypothetical protein D4GXP0 12.00 1 2 hypothetical protein D4GSE2 12.00 1 4 hypothetical protein D4GQI9 11.97 5.75 23 HTR-like protein D4GTH4 11.96 2.67 8 Uncharacterized protein HVO_1945 D4GPC9 11.93 1 1 glucose 1-dehydrogenase related protein D4GTR0 11.92 2 2 hypothetical protein D4GT08 11.92 1 3 hypothetical protein D4GZV9 11.92 1.25 5 hypothetical protein D4GRM9 11.91 2.5 5 hydroxymethylglutaryl-CoA lyase D4GYN8 11.90 3.25 13 acetylornithine aminotransferase D4GRP4 11.88 2 2 guanosine monophosphate reductase D4GWJ2 11.88 2 8 hypothetical protein

155

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GUG1 11.88 1.5 3 hypothetical protein D4GQ77 11.86 2 2 HtpX-like protease htpX3 D4GR48 11.86 4.5 18 peptide ABC transporter substrate-binding protein D4GW47 11.84 1 2 snRNP-like protein D4GRJ8 11.82 4 16 5-oxoprolinase D4GV71 11.82 2 6 thioredoxin D4GPZ7 11.81 1.33 4 trehalose utilization protein ThuA D4GT98 11.76 1 1 PadR family transcriptional regulator D4GVD6 11.74 2 8 hypothetical protein D4GRJ9 11.74 4.25 17 5-oxoprolinase D4GRI5 11.73 3 12 ACP synthase D4GX72 11.71 4 4 membrane protein D4H068 11.67 1 3 hypothetical protein D4GRN2 11.64 1.5 6 isochorismatase D4GSD8 11.63 2.25 9 hypothetical protein D4GPY1 11.63 2 6 hypothetical protein D4GSV4 11.63 2 2 hydrolase D4GYB9 11.63 1 2 universal stress protein UspA D4GUB7 11.59 1.67 5 metallophosphoesterase D4GYC0 11.58 1 1 hypothetical protein D4GQK8 11.58 2.33 7 hypothetical protein D4GWW4 11.56 2.67 8 hypothetical protein D4GT07 11.55 2 6 sugar kinase D4GP30 11.46 3.25 13 glucose-fructose oxidoreductase D4GWC9 11.45 1 3 peroxiredoxin D4GR01 11.40 1 2 hypothetical protein D4GVR9 11.38 2 4 aldo/keto reductase D4GRL6 11.35 1.25 5 lactate utilization protein D4GVU9 11.35 1.67 5 hypothetical protein D4GUG4 11.35 1 2 maltose O-acetyltransferase D4GY85 11.33 2 6 peptidase A24 D4H0A3 11.32 1 3 hypothetical protein D4GV39 11.31 1.75 7 cytochrome c oxidase subunit II D4GXV7 11.31 1.5 6 N-acetyltransferase D4GXC9 11.30 5 20 serine protein kinase PrkA D4GV63 11.30 1.33 4 serine/threonine protein phosphatase D4GVX0 11.30 2 6 hypothetical protein D4H012 11.29 1 2 hypothetical protein D4GWP5 11.25 2.5 10 ABC transporter ATP-binding protein D4GR21 11.20 3.25 13 integrase D4GQB5 11.20 1.5 3 (2Fe-2S)-binding protein D4GYB2 11.20 1.33 4 hypothetical protein D4GWZ8 11.19 1.67 5 chemotaxis protein CheR D4GUR7 11.17 4 16 BNR/Asp-box repeat domain-containing protein D4GWE7 11.16 1.25 5 uroporphyrin-III C-methyltransferase D4GP84 11.16 3 12 peptide ABC transporter substrate-binding protein D4GZ97 11.14 1.5 3 urease accessory protein UreF D4GWI9 11.10 3 12 protoporphyrinogen oxidase D4GY34 11.10 1.75 7 hypothetical protein D4GYB3 11.09 1.75 7 endonuclease

156

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GWT8 11.05 1.5 6 hypothetical protein D4GRQ5 11.05 1 1 nucleoside-diphosphate-sugar pyrophosphorylase D4GS86 11.04 1.33 4 peptidyl-prolyl cis-trans isomerase D4GPT7 11.02 1 1 fructose 1,6-bisphosphatase D4GRQ0 11.02 1 1 hypothetical protein D4GU77 10.98 1.5 3 Uncharacterized protein HVO_2064 D4GUZ5 10.97 1.5 6 diphthine synthase D4GRU1 10.96 1 4 flagellin D4GZI2 10.96 4 16 hypothetical protein D4GX21 10.94 1 3 cold-shock protein D4GS37 10.94 1 3 cold-shock protein D4GTM0 10.94 1 3 cold-shock protein D4GS36 10.94 1 3 cold-shock protein D4GXC1 10.93 3.25 13 deoxyribodipyrimidine photo-lyase D4GTS0 10.91 2.25 9 hydrogenase expression protein D4GQ55 10.91 1 1 hypothetical protein D4GYY8 10.89 1.75 7 transcriptional regulator D4GS17 10.89 1.5 6 leucyl aminopeptidase D4GVF5 10.87 1 2 NADH dehydrogenase D4GR45 10.87 1.5 6 hypothetical protein D4GU94 10.85 2.75 11 site-specific DNA-methyltransferase D4GQ46 10.84 1.5 3 IS110 family transposase ISHvo9 D4GU30 10.84 2.75 11 hypothetical protein D4GPY7 10.83 1.25 5 glycosyl hydrolase D4GSJ1 10.82 1 1 hypothetical protein D4GPU2 10.81 2.75 11 ABC transporter ATP-binding protein D4GP05 10.78 1 4 serine hydroxymethyltransferase D4GWR2 10.76 1 1 NYN domain-containing protein D4GRS1 10.71 1 1 hypothetical protein D4GUN9 10.67 2 8 transcriptional regulator D4GPL7 10.67 1.67 5 hypothetical protein D4GTL0 10.66 1.5 6 hypothetical protein D4GTS2 10.65 2.75 11 kynureninase D4GRN5 10.64 3 12 FAD-binding dehydrogenase D4H070 10.63 2 8 hypothetical protein D4GWL0 10.63 2 8 3-beta hydroxysteroid dehydrogenase D4GVZ5 10.63 3 9 hypothetical protein D4GRE9 10.62 2 6 hydrogenase expression protein D4GX77 10.61 1 1 hypothetical protein D4GQS3 10.61 1 2 death-on-curing protein D4GPK9 10.60 1 2 xylose isomerase D4GQH4 10.59 1.75 7 sugar ABC transporter ATP-binding protein D4GPQ3 10.59 3.5 14 aldehyde ferredoxin oxidoreductase D4GPQ8 10.57 3 12 aspartate aminotransferase family protein D4GPI3 10.57 2.75 11 deoxyhypusine synthase D4GWV9 10.57 2 4 aminoglycoside phosphotransferase D4GXX9 10.54 1.5 3 hypothetical protein D4GRI6 10.54 1.5 3 3-hydroxyacyl-CoA dehydrogenase D4GZ30 10.52 2 8 sulfonate ABC transporter ATP-binding protein D4GSY0 10.51 3 12 NAD(+) synthetase

157

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GP77 10.50 1 1 hypothetical protein D4GTQ5 10.49 1 1 hypothetical protein D4GQ58 10.49 1 3 hypothetical protein D4GVI3 10.49 1.75 7 ABC transporter ATP-binding protein D4GWD4 10.48 1.5 3 response regulator D4GXT4 10.48 1 2 hypothetical protein D4GQV8 10.48 1.75 7 ABC transporter ATP-binding protein D4GXJ7 10.47 2.5 10 ornithine cyclodeaminase D4GX46 10.46 1 2 hypothetical protein D4GP97 10.46 1 1 UspA domain protein D4GWM9 10.45 3.5 14 hypothetical protein D4GSH2 10.43 1.25 5 transcriptional regulator D4GZR6 10.40 1.75 7 competence damage-inducible protein A D4GPZ1 10.39 1 1 UspA domain protein D4GSX3 10.38 4.75 19 metalloprotease D4GQL7 10.34 1.5 3 PIN domain nuclease D4GP22 10.33 2.5 5 peptide ABC transporter substrate-binding protein D4GSN6 10.31 6.25 25 histidine kinase D4GZW5 10.29 1 1 ArsR family transcriptional regulator D4GX93 10.27 1 2 hypothetical protein D4GZN9 10.24 2 4 magnesium and cobalt transport protein CorA D4GXJ0 10.24 1 3 N-acetyltransferase D4GXN2 10.24 1 3 transcriptional regulator D4GVM3 10.22 2 6 NADPH:quinone reductase D4GZ16 10.21 1 1 acetyl-CoA synthetase D4GTF5 10.20 1.75 7 hypothetical protein D4GZ90 10.20 1.5 6 phosphatidylserine decarboxylase D4GPG1 10.19 1.5 3 bacterio-opsin activator-like protein D4GTC1 10.19 3.67 11 cell division protein D4GY66 10.18 1 3 amino acid-binding protein D4GUC7 10.15 3 12 tyrosine decarboxylase MfnA D4GRJ6 10.14 1.67 5 hypothetical protein D4GP21 10.14 1 3 bacterio-opsin activator D4GPE9 10.14 1.67 5 DNA-binding protein D4GYD5 10.14 1 1 hypothetical protein D4GWV3 10.13 6.5 26 helicase D4GQR5 10.11 1.33 4 hypothetical protein D4GQC0 10.11 6.25 25 FAD-dependent oxidoreductase D4GSI7 10.10 1.5 6 adenosylcobinamide amidohydrolase D4GVZ4 10.07 4.33 13 conjugal transfer protein D4GUV9 10.02 3.5 14 copper ABC transporter substrate-binding protein D4GRN6 10.00 1.5 3 ABC transporter substrate-binding protein D4GPR4 9.95 2.25 9 X-Pro dipeptidase D4GU91 9.93 1 1 hypothetical protein D4GYJ3 9.93 1 2 hypothetical protein D4GW27 9.93 1 2 hypothetical protein D4H045 9.93 1.5 3 transcriptional regulator 7,8-didemethyl-8-hydroxy-5-deazariboflavin D4GVD1 9.89 3 12 synthase subunit CofH D4GQV3 9.87 2.33 7 carbohydrate kinase

158

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GQ79 9.86 1.75 7 universal stress protein UspA D4GTT8 9.85 1 2 AsnC family transcriptional regulator D4GY29 9.84 1 3 Homolog to pHK2-ORF2 HVO_1433 D4GV50 9.79 1 1 universal stress protein UspA D4GS25 9.77 1 4 GMP synthase D4GT83 9.72 2.25 9 hypothetical protein D4GQG0 9.71 1 2 hypothetical protein D4GRG4 9.70 1.5 6 tellurium resistance protein D4GYE7 9.67 2 6 DeoR family transcriptional regulator D4GT89 9.63 1 3 dihydropyrimidine dehydrogenase D4H029 9.63 1.75 7 glucokinase D4GUA7 9.63 2 8 hypothetical protein D4GVB2 9.62 1.33 4 hypothetical protein D4GRS8 9.61 1.5 6 hypothetical protein D4GSJ3 9.60 1.67 5 hypothetical protein D4GPT0 9.60 1.67 5 transcriptional regulator D4GR19 9.59 2 2 transcriptional regulator D4GYM8 9.59 1 1 universal stress protein UspA D4GQ38 9.59 1 1 hypothetical protein D4GSD1 9.59 1 1 hypothetical protein D4GV36 9.56 2 6 aldolase D4GQL0 9.52 1.67 5 hypothetical protein D4GRZ2 9.52 1 2 hsp20-type molecular chaperone D4GT88 9.52 1.25 5 competence damage-inducible protein A D4GQC8 9.45 1 1 acyl-CoA dehydrogenase D4GYU7 9.43 1 2 phosphoribosyltransferase D4GUP8 9.41 1 4 phosphocarrier protein HPr methylmalonate-semialdehyde dehydrogenase D4GQY3 9.41 3.25 13 (CoA acylating) D4GRR4 9.39 1.75 7 NADH-ubiquinone oxidoreductase D4GU82 9.39 4.75 19 RND transporter D4GWS2 9.37 1.25 5 hypothetical protein D4GQL1 9.36 1 4 hypothetical protein D4GUG5 9.35 1 3 methylmalonyl-CoA mutase D4GX18 9.33 1 2 alkylhydroperoxidase D4GWZ9 9.33 3.75 15 chemotaxis protein D4GPD7 9.31 1 3 alpha/beta hydrolase D4GSV5 9.31 1.67 5 tRNA pseudouridine(38-40) synthase TruA D4GPE3 9.30 1.33 4 hypothetical protein D4GTH6 9.30 1 4 rhodanese-like domain-containing protein D4GUT0 9.28 2.5 10 ATPase AAA D4GWG3 9.27 1 4 peptide N-acetyltransferase D4GP38 9.27 1.25 5 ABC transporter ATP-binding protein D4GQX2 9.27 3.25 13 Zn-dependent hydrolase D4GPB7 9.25 1.5 3 short-chain family oxidoreductase D4GTI7 9.24 1.5 3 pyruvoyl-dependent arginine decarboxylase D4GW16 9.18 1.75 7 N-acetyltransferase D4GZW3 9.14 1.67 5 adenine phosphoribosyltransferase D4GQT0 9.14 1.33 4 MarR family transcriptional regulator D4GPG9 9.14 1 3 molecular chaperone

159

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GTP7 9.14 1.67 5 RNA-binding protein D4GPR1 9.11 2 6 2-hydroxyacid dehydrogenase D4GQY2 9.07 2.5 5 similar to NEQ141 D4GV40 9.06 1 1 hydroxyethylthiazole kinase D4GXK8 9.04 2.33 7 hypothetical protein D4GYL7 8.99 2 8 ABC transporter substrate-binding protein D4GVU8 8.97 1 3 circadian clock protein KaiC D4GW17 8.97 1.5 6 PGF-CTERM sorting domain-containing protein D4GYU8 8.96 2.75 11 zinc metalloprotease HtpX D4GSH0 8.94 1.5 3 XRE family transcriptional regulator D4H0G0 8.92 2.25 9 IS630 family transposase ISHvo8 D4GQ14 8.92 1 1 hypothetical protein D4GP42 8.90 2 6 IclR family transcriptional regulator D4GZM3 8.89 2 2 acetyltransferase D4GR53 8.87 2.75 11 5-oxoprolinase D4GUI9 8.87 1.33 4 transcription factor S D4GVR2 8.86 2.25 9 ABC transporter ATP-binding protein D4GRA4 8.82 1.33 4 hypothetical protein D4GR95 8.82 1.5 3 hypothetical protein D4GXL2 8.80 1.75 7 hypothetical protein D4GSS3 8.76 2 2 alkanonic acid methyltransferase D4GQP0 8.76 2.25 9 subtype I-B CRISPR-assoc. endonuclease Cas1 D4GQT2 8.76 1 1 PadR family transcriptional regulator D4GUR1 8.68 1 1 dihydrodipicolinate synthase family protein D4GWF2 8.68 1 2 Orc1-type DNA replication protein D4GQY5 8.66 1.33 4 AsnC family transcriptional regulator D4GXT7 8.66 2.25 9 hypothetical protein D4GQJ2 8.64 1.5 3 proline racemase D4GZC9 8.64 2 2 preprotein translocase subunit TatC D4GY83 8.61 1.25 5 phosphoribosyl-AMP cyclohydrolase D4GR18 8.59 1.67 5 Zn-dependent hydrolase D4GQ81 8.59 2 8 cobalt transporter D4GUJ2 8.59 1 1 hypothetical protein D4GVP5 8.57 2.5 10 mechanosensitive ion channel protein D4GWC3 8.57 1 1 hypothetical protein D4GQ40 8.56 3.5 14 transposase D4GPD9 8.54 1.75 7 PQQ repeat protein D4GS81 8.53 1 3 N-acetyltransferase D4GWT9 8.51 2.25 9 hypothetical protein D4GX23 8.50 1.75 7 ABC transporter ATP-binding protein D4GX63 8.47 1.33 4 DUF58 domain-containing protein D4GPX2 8.47 1.75 7 glycoside hydrolase family 28 D4GUB0 8.46 1.33 4 hypothetical protein D4GXW7 8.46 2 6 two-component sensor histidine kinase D4GWJ8 8.43 1.75 7 transcriptional regulator D4GP10 8.42 1 2 ring-hydroxylating oxygenase subunit alpha D4H0F0 8.39 1 1 IS5 family transposase ISHvo4 D4GSP3 8.37 1.67 5 DUF58 domain-containing protein D4GZS4 8.37 1 2 hypothetical protein D4GZH3 8.37 1.33 4 cell division inhibitor

160

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GPT2 8.36 0.75 3 transcription initiation factor IIB 2 D4GQQ0 8.31 1 2 hypothetical protein A0A1C9J6Z3 8.28 1 1 Uncharacterized protein HVO_2834A D4GX58 8.27 1 1 hypothetical protein D4GSS5 8.25 1.33 4 ribose 1,5-bisphosphate isomerase D4GUA2 8.21 1 1 transcriptional regulator D4GSE4 8.18 1.5 3 hypothetical protein D4GR25 8.17 1 1 Uncharacterized protein HVO_A0351 D4GV60 8.17 3.75 15 membrane protein D4GUH7 8.16 1 3 hypothetical protein D4GUQ4 8.16 1.25 5 hypothetical protein D4GPA7 8.13 1 4 amidohydrolase D4GY52 8.13 1 1 hypothetical protein D4GPI8 8.12 2 2 ABC transporter substrate-binding protein D4GQD2 8.11 1 4 ISHwa16-type transposase ISHvo16 D4GR69 8.11 1 4 ISHwa16-type transposase ISHvo16 D4GXB7 8.08 1.25 5 haloacid dehalogenase D4GQ26 8.05 3 6 transcriptional regulator D4GWY9 8.03 1 1 ATPase D4GTA1 8.00 1.5 6 phosphohydrolase D4H031 7.99 3.75 15 pseudo D4GQW4 7.99 1.25 5 N-acylamino acid racemase D4GQW3 7.98 1.75 7 hypothetical protein D4GSK2 7.97 1.75 7 dimethylmenaquinone methyltransferase D4GRK3 7.95 2.5 10 iron ABC transporter substrate-binding protein D4GVI4 7.92 2.5 10 PQQ-dependent glucose dehydrogenase D4GZX8 7.91 1 3 transcription elongation factor NusA D4GP66 7.91 1.5 6 hypothetical protein D4GV66 7.89 1.25 5 hypothetical protein D4GS71 7.88 1.5 6 hypothetical protein D4GUM7 7.87 3 9 RND transporter D4GUA1 7.87 1 1 hypothetical protein dipeptides/oligopeptides ABC transporter ATP- D4GS93 7.84 1 3 binding protein D4GTI8 7.82 1 1 sensor histidine kinase D4GU89 7.81 2.25 9 transposase D4GRZ9 7.81 1 2 reactive intermediate/imine deaminase D4GV58 7.81 2 8 hypothetical protein D4GXN4 7.78 1 3 hydrolase D4GQ42 7.78 1 1 hypothetical protein D4GRA1 7.78 1 1 hypothetical protein D4GPW0 7.73 1 1 UDP-N-acetylglucosamine pyrophosphorylase D4GXY7 7.73 1 1 cystathionine beta-lyase D4GPY2 7.73 1 1 MFS transporter D4GQ27 7.69 1 2 thiaminase II D4GUC5 7.65 1.25 5 S26 family signal peptidase D4GPS4 7.63 1 1 IclR family transcriptional regulator D4GPB1 7.63 1 2 sugar ABC transporter ATP-binding protein D4GS94 7.63 1 1 ABC transporter ATP-binding protein D4GPC0 7.61 1.33 4 ArcR family transcriptional regulator

161

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GX69 7.61 1.5 6 hypothetical protein D4GX97 7.59 1 2 transcriptional regulator D4GR00 7.57 1 1 ABC transporter ATP-binding protein D4GQJ8 7.54 2 4 HTR-like protein D4GV24 7.51 2.5 10 signal transduction histidine kinase D4GWY0 7.51 1 2 flagellin D4GRR9 7.49 1.33 4 ABC transporter ATP-binding protein D4GXN0 7.48 1 1 bacterio-opsin activator D4GTB3 7.45 1 3 hypothetical protein D4GPQ9 7.42 1 1 serine/threonine dehydratase D4GX70 7.42 4.33 13 VWA domain-containing protein D4GRW9 7.38 1 4 universal stress protein UspA branched-chain amino acid ABC transporter D4GX20 7.38 2.5 10 substrate-binding protein anaerobic glycerol-3-phosphate D4GQU7 7.37 1.67 5 dehydrogenase subunit B D4GWK8 7.35 1.5 6 LD-carboxypeptidase D4GQI7 7.35 2.25 9 acetate--CoA ligase D4GTM1 7.32 1 2 methyltransferase type 11 D4GQV7 7.31 1 2 transcriptional regulator D4GP03 7.27 1.67 5 acetylornithine deacetylase D4H084 7.27 1.5 6 hypothetical protein D4GP78 7.25 2.25 9 hydantoinase subunit beta D4GX67 7.17 2.33 7 hypothetical protein D4GP99 7.16 1.33 4 dihydrodipicolinate synthase family protein D4GPS9 7.13 1.33 4 MarR family transcriptional regulator D4GYH2 7.12 1.5 6 glycosyl transferase D4GU33 7.12 1.33 4 hypothetical protein D4GT42 7.11 1.75 7 diaminopimelate epimerase D4GQI3 7.10 1 1 cation acetate symporter D4GS54 7.10 1 1 hypothetical protein D4GZD3 7.08 1 1 histidine phosphatase family protein D4GUA3 7.04 1 1 hypothetical protein D4H0D3 7.03 1.5 3 HNH endonuclease D4GQA4 7.02 1.67 5 Orc1-type DNA replication protein D4GZU7 6.99 2.25 9 bacterio-opsin activator D4GRQ3 6.99 1 3 transcriptional regulator D4GP29 6.92 1 2 glucose-fructose oxidoreductase D4GW50 6.90 2 2 hypothetical protein D4GWD1 6.87 1.5 6 mechanosensitive ion channel protein D4GSI8 6.82 2 2 L-threonine-O-3-phosphate decarboxylase D4GR44 6.81 1 1 peptidase D4GUY6 6.79 1.33 4 cox-type terminal oxidase subunit I D4GU86 6.77 1.25 5 LacI family transcriptional regulator D4GP81 6.76 1.33 4 ABC transporter ATP-binding protein A0A1C9J6X0 6.70 1 1 hypothetical protein D4GXC8 6.69 4.33 13 kinase anchor protein D4GV23 6.69 1 1 dehydrogenase D4GYY7 6.62 2.25 9 cytochrome P450 D4GPY6 6.61 0.5 1 hypothetical protein

162

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GPB2 6.59 1.33 4 alcohol dehydrogenase D4GVS8 6.58 1.25 5 glutaredoxin D4GVU4 6.57 1 1 histidinol-phosphatase D4GTH2 6.57 3 6 transglutaminase D4GVZ1 6.57 4.25 17 N-6 adenine-specific DNA methylase D4GZJ1 6.56 1.67 5 transcriptional regulator D4GSS8 6.56 1 2 universal stress protein UspA D4GSK4 6.56 1.75 7 alcohol dehydrogenase D4GQ43 6.51 1 2 hypothetical protein D4GP76 6.47 1 2 hypothetical protein D4GPE0 6.45 1.67 5 PQQ repeat protein D4GYR1 6.43 1 1 PQQ repeat-containing protein D4GUR5 6.40 2 4 sugar ABC transporter ATP-binding protein D4GX48 6.40 1 3 (2Fe-2S)-binding protein D4GXH4 6.38 1 1 peroxiredoxin D4GWB0 6.37 1.5 6 hypothetical protein D4GUU9 6.35 1 1 hypothetical protein D4GRI4 6.33 1.25 5 3-ketoacyl-CoA thiolase D4GVN4 6.33 1 1 potassium transporter Trk D4GXY1 6.32 1 4 hypothetical protein D4GW06 6.32 1 1 hypothetical protein D4GS38 6.31 1 1 hypothetical protein D4GXC7 6.30 1 4 metal-dependent hydrolase D4GYU9 6.30 1 3 hypothetical protein D4GUW4 6.28 1 1 hypothetical protein D4GRP2 6.27 1.33 4 2-methylcitrate dehydratase D4GVS2 6.25 1 1 hypothetical protein D4GR03 6.21 2.5 10 beta-galactosidase D4GUR4 6.21 1 1 sugar ABC transporter permease D4GZ38 6.21 1.5 3 hypothetical protein D4GPP0 6.20 1 1 formaldehyde dehydrogenase D4GUI5 6.20 1 3 hypothetical protein D4GUV8 6.18 1.25 5 copper ABC transporter ATP-binding protein D4GXR3 6.17 1.25 5 hypothetical protein D4GVE4 6.17 1 1 potassium transporter Trk D4GZ87 6.16 1 3 phenazine biosynthesis protein D4GSR5 6.16 1 1 3-beta hydroxysteroid dehydrogenase/isomerase D4GPL4 6.16 1.5 3 myo-inositol-1-phosphate synthase D4GQB4 6.14 1 3 ArcR family transcription regulator D4GR31 6.12 1 1 PQQ repeat protein D4GRD1 6.12 1.67 5 exo-alpha-sialidase D4GPX3 6.10 1 1 hypothetical protein D4GW75 6.10 1 1 hypothetical protein D4GQL9 6.08 1 1 hypothetical protein D4GY65 6.07 1 4 hypothetical protein D4GQ51 6.04 1 1 hypothetical protein FAD-dependent oxidoreductase D4GV46 6.03 4.25 17 (GlcD/DLD_GlcF/GlpC domain fusion protein) phosphonate ABC transporter, permease protein D4GRC6 6.02 1 1 PhnE

163

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GRD4 6.00 1 4 pilus protein D4GVA6 5.99 2 8 membrane protein D4GT93 5.98 1.75 7 2-phospho-L-lactate transferase D4GYI6 5.93 1.33 4 hypothetical protein D4H021 5.92 1 1 hypothetical protein D4GRI7 5.92 1.33 4 3-hydroxybutyryl-CoA dehydratase D4GS51 5.91 1 3 hypothetical protein D4GXC4 5.90 3 12 AbrB family transcriptional regulator D4GPH8 5.87 1 1 cobalt ABC transporter ATP-binding protein D4GSL7 5.86 2.5 10 Sensor box histidine kinase HVO_0621 D4GRN3 5.85 1 1 LLM class flavin-dependent oxidoreductase D4GQ59 5.83 1 3 hypothetical protein D4GQW8 5.79 1 1 Uncharacterized protein HVO_A0291 D4GUD4 5.79 1 1 Crp/Fnr family transcriptional regulator D4GR93 5.77 1 3 N-acyl-D-amino-acid deacylase D4GXL9 5.77 1 3 hypothetical protein D4GQP5 5.76 1 2 transferase D4GVN6 5.75 1.25 5 transcriptional regulator D4GWR5 5.75 2.5 10 PKD domain-containing protein D4GSL6 5.71 2.33 7 secretion system protein D4GYR3 5.70 1 4 2-dehydropantoate 2-reductase D4GV21 5.70 2 8 formate dehydrogenase subunit alpha D4GU45 5.68 2 6 heme ABC transporter ATP-binding protein D4GVQ2 5.67 1.5 3 ArsR family transcriptional regulator D4GUD6 5.65 1 2 metallophosphoesterase D4GZK0 5.63 1.75 7 spermine synthase D4GRB7 5.63 1.25 5 UspA domain protein D4GRJ2 5.63 1 1 UDP-glucose 4-epimerase D4GR51 5.61 1 1 ABC transporter ATP-binding protein D4GT94 5.57 1.5 3 rhomboid family intramembrane serine protease D4GPF9 5.57 1 1 IS4 family transposase D4GR97 5.57 1 1 IS4 family transposase D4GU64 5.57 1 1 IS4 family transposase D4GY06 5.56 1 1 haloacid dehalogenase D4GQM1 5.56 1 1 polysaccharide deacetylase D4GQ39 5.56 1 1 IS4 family transposase ISHvo11 D4GSU1 5.56 1 1 IS4 family transposase D4GRM4 5.56 1 2 transcriptional regulator D4GPD8 5.56 1.33 4 DNA-binding protein D4GY49 5.53 1 2 hypothetical protein D4GX76 5.51 1 1 hypothetical protein D4GUI1 5.51 1 3 cytochrome b D4GPR0 5.50 1 3 amidohydrolase D4GTD6 5.50 1 2 hypothetical protein D4GP39 5.48 0.5 2 ABC transporter ATP-binding protein D4GZK7 5.48 1 2 Uncharacterized protein HVO_0262 D4H075 5.48 2.5 10 DNA repair helicase D4GQ00 5.43 1 4 nitrilase D4GXH9 5.43 1.25 5 AI-2E family transporter

164

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description dolichyl-phosphate-mannose--protein D4GYB8 5.42 2 6 mannosyltransferase D4GQ48 5.42 1 1 IS110 family transposase ISHvo10 D4GX24 5.40 1.5 3 ABC transporter ATP-binding protein D4GZR5 5.38 2 8 metalloprotease D4GRR8 5.38 1 1 pseudo D4GRT5 5.37 1.33 4 hypothetical protein D4GRA6 5.37 1 4 hypothetical protein D4GQK6 5.35 1.5 3 ABC transporter ATP-binding protein D4GUL8 5.34 1 1 hypothetical protein D4GWC7 5.34 4.5 18 secretion system protein E D4GXY4 5.31 1 1 Uncharacterized protein HVO_2944 D4GRF7 5.30 1.5 3 sugar ABC transporter substrate-binding protein D4GPW6 5.30 1 4 transcriptional regulator D4GR41 5.26 2.25 9 metallo-beta-lactamase domain protein D4GP79 5.23 1 3 hypothetical protein D4GPA9 5.19 1 1 sugar ABC transporter permease D4GR63 5.19 1 2 hypothetical protein D4GXV6 5.18 1.33 4 hypothetical protein D4GW48 5.14 2.5 10 cell division protein D4GP75 5.11 1 2 transcriptional regulator D4GRN0 5.11 1.5 6 CoA transferase D4GT69 5.11 1 2 glucose 1-dehydrogenase D4GZD0 5.10 1.5 6 preprotein translocase subunit TatC D4GV81 5.09 1 3 hypothetical protein D4GX30 5.06 1 2 GNAT family N-acetyltransferase D4GUE2 5.05 1 3 DtxR family transcriptional regulator D4GWK0 5.03 1.75 7 membrane protein FxsA D4GT53 5.02 3 12 hypothetical protein D4GWH1 5.02 2 6 membrane protein D4GQH3 5.01 1 2 IS4 family transposase D4GX95 5.00 2 2 hypothetical protein D4GRP1 4.98 1 1 2-methylcitrate dehydratase D4GX78 4.96 1 4 hypothetical protein D4GY75 4.94 0.67 2 hybrid sensor histidine kinase/response regulator D4GY16 4.92 1 1 hypothetical protein D4GZA6 4.92 1 1 hypothetical protein D4GUN8 4.91 1 3 aspartate aminotransferase family protein D4GP06 4.90 1.5 6 threonine ammonia-lyase D4GRE5 4.89 1 2 phosphate ABC transporter ATP-binding protein D4GXA9 4.83 1 4 glycosyl transferase D4GUC2 4.82 1 1 cation transporter D4GYH0 4.81 1 1 hypothetical protein D4GWE1 4.81 1 1 hypothetical protein D4GZY2 4.78 1 1 hypothetical protein D4GVI2 4.78 1 1 ABC transporter permease D4GXR5 4.74 1 1 hypothetical protein D4GRF8 4.72 1 2 bacterio-opsin activator-like protein D4GUQ6 4.66 1.33 4 xylulose kinase D4GR52 4.63 1 1 ABC transporter ATP-binding protein

165

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GW60 4.62 1 3 halocyanin D4GRT0 4.61 1 1 hypothetical protein D4GTL2 4.56 1.25 5 malate synthase D4GZV7 4.56 1.25 5 UDP-glucose 4-epimerase D4GUN2 4.54 2 8 ABC transporter permease D4GX25 4.52 1.5 3 cryptochrome/photolyase family protein D4GVZ7 4.51 1.5 3 transfer complex protein D4GR07 4.48 1 2 glucose-fructose oxidoreductase D4GTD0 4.47 1 1 hypothetical protein D4GRG2 4.46 1 2 hypothetical protein D4GV94 4.46 1 4 Uncharacterized protein HVO_2161 D4GXC6 4.44 1.5 3 hypothetical protein D4GPP4 4.42 1 2 cobalamin synthesis protein CobW D4GRH1 4.41 1 1 phenylacetic acid degradation protein PaaC D4GUM0 4.40 1 1 hypothetical protein D4GW12 4.40 1 2 ribonuclease P D4GQL5 4.40 1 2 hypothetical protein D4GSQ8 4.40 2 2 membrane protein D4GPW3 4.36 2 2 glucose ABC transporter ATP-binding protein D4GPA0 4.36 1.33 4 hypothetical protein D4GVH3 4.36 1 2 inosine-5-monophosphate dehydrogenase D4GSA7 4.35 1 3 peptidase M20 D4GX56 4.34 1.33 4 3-hydroxyacyl-CoA dehydrogenase D4GUQ7 4.33 1 3 ArcR family transcription regulator D4GW98 4.28 1 1 mechanosensitive ion channel protein MscS D4GZ25 4.27 1.33 4 hypothetical protein D4GS43 4.26 1 2 multidrug ABC transporter ATP-binding protein D4GTU1 4.25 1 3 light- and oxygen-sensing transcription regulator D4GSH1 4.25 1 1 epimerase D4H088 4.23 1 2 hypothetical protein D4GV19 4.22 2.75 11 haloacid dehalogenase D4GWH2 4.21 1 1 sodium:solute symporter D4GRT7 4.20 1.67 5 histidine kinase 4-hydroxythreonine-4-phosphate dehydrogenase D4GUQ8 4.17 1 2 PdxA D4GP28 4.15 1 1 fumarylacetoacetate hydrolase D4GRC9 4.15 1 2 hypothetical protein D4GS35 4.15 1 1 hypothetical protein geranylgeranyl-diphosphate D4GTV6 4.13 1 2 geranylgeranyltransferase D4GP31 4.12 1 1 gluconolaconase D4GQB7 4.12 1 1 hypothetical protein D4GUN5 4.11 2.25 9 glycosyl hydrolase D4GVT6 4.10 2 4 chemotaxis protein D4GZG0 4.07 1.33 4 Fe-S oxidoreductase D4GWG2 4.05 1 4 Nif3-like dinuclear metal center hexameric protein D4GTV3 4.01 0.5 1 inosine-5-monophosphate dehydrogenase D4GRJ7 4.01 1 3 CAAX amino terminal protease, transmembrane D4GP88 4.00 1 2 choline-sulfatase

166

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GR94 3.99 1 1 mandelate racemase D4GTN4 3.98 2 4 PGF-CTERM sorting domain-containing protein D4GPN7 3.96 1 2 NADH dehydrogenase D4GUZ4 3.96 1 1 archaeosortase A D4GUN4 3.94 1 2 Sensor box histidine kinase D4GUA0 3.93 2.5 10 glycosyl transferase D4GWB9 3.91 1 1 hypothetical protein D4GT21 3.90 1 3 hypothetical protein D4GUN6 3.89 1 3 beta-glucosidase D4GPN5 3.87 1 2 IS4 family transposase D4GR85 3.87 1 2 IS4 family transposase D4H0C7 3.87 1 2 IS4 family transposase D4GR33 3.87 1 2 ISH3 family transposase ISHvo20 D4GZK8 3.87 1 2 ISH3 family transposase ISH51 D4GR36 3.87 1 2 IS4 family transposase D4GRB5 3.87 1 2 IS4 family transposase D4GYG9 3.87 1 2 IS4 family transposase D4GR84 3.87 1 2 IS4 family transposase D4GT65 3.87 1 2 IS4 family transposase D4GQF6 3.87 1 2 IS4 family transposase D4H0F3 3.87 1 2 IS4 family transposase D4GTR2 3.87 1 2 sarcosine oxidase D4GQU1 3.87 1 2 IS4 family transposase D4GQE2 3.87 1 2 IS4 family transposase D4GS62 3.87 1 2 IS4 family transposase D4GQB3 3.87 1 2 IS4 family transposase D4GQC5 3.86 0.5 1 ArcR family transcription regulator D4GQI0 3.86 1 2 IS4 family transposase D4GSU9 3.86 1 2 IS4 family transposase D4H0C5 3.86 1 2 ISH3 family transposase ISHvo21 D4GX66 3.86 1 2 IS4 family transposase D4GWD9 3.83 1 2 hypothetical protein D4GW37 3.80 1 1 hypothetical protein D4GRE6 3.78 1 1 transcriptional regulator D4GT12 3.76 1 4 pseudo D4GPT6 3.69 1 1 biotin synthase BioB D4GPA8 3.69 1 1 sugar ABC transporter substrate-binding protein D4GPV3 3.64 1 1 Zn-dependent hydrolase D4GXJ1 3.63 1 1 type 11 methyltransferase D4GUS5 3.59 1 3 Zn-dependent hydrolase D4GQX4 3.59 1 1 short-chain family oxidoreductase geranylgeranylglyceryl/heptaprenylglyceryl D4GW01 3.59 1 1 phosphate synthase D4GSD2 3.57 1 4 hypothetical protein D4GTH1 3.51 1 1 DUF58 domain-containing protein D4GV76 3.46 1 1 methyl-accepting chemotaxis protein D4GYR8 3.44 1 2 polyphosphate kinase 2 D4GXA3 3.42 1.33 4 histidine kinase D4GQ52 3.42 1 1 hypothetical protein D4GXF4 3.41 1 1 hypothetical protein

167

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4GS34 3.41 1 4 hypothetical protein D4GV32 3.41 1 1 hypothetical protein D4GQH8 3.40 1.5 6 glucan 1,4-alpha-glucosidase D4GUQ9 3.40 1 1 ygbK domain-containing protein D4GPS0 3.39 1.75 7 histidine kinase D4GPP5 3.37 1.25 5 aldehyde ferredoxin oxidoreductase D4H0F4 3.37 1 4 ABC transporter permease D4GTC5 3.33 1 1 type II/IV secretion system ATPase D4GPZ6 3.31 1 2 hypothetical protein D4GQ67 3.30 1 1 cell division protein FtsZ D4GWW7 3.29 1 2 hypothetical protein D4GQ16 3.28 1 1 ABC transporter substrate-binding protein D4GQP6 3.27 1 1 aminotransferase DegT D4GQJ7 3.25 1 4 transcriptional regulator D4GTE1 3.25 2 8 nitrate reductase D4GVB9 3.25 1 1 hypothetical protein D4H0C3 3.22 1.33 4 transfer complex protein D4GVA5 3.21 1.5 6 Uncharacterized protein D4GR28 3.18 1 1 hypothetical protein D4GV51 3.17 1 1 manganese transporter D4GSD0 3.16 1 2 hypothetical protein D4GTK4 3.14 1 1 preprotein translocase subunit SecF D4GVF2 3.13 1.75 7 TIGR03663 family protein D4GU58 3.13 1 1 endonuclease I-EndH D4GP15 3.11 1.33 4 glycine cleavage system protein T D4GWB7 3.08 1 2 hypothetical protein D4GX75 3.07 1 1 HNH endonuclease D4GQP3 3.06 1 3 hypothetical protein two-component system sensor histidine D4H058 3.03 1 1 kinase/response regulator D4GYY3 3.03 1 4 conjugal transfer protein TraB D4GT10 3.03 1 1 ABC transporter ATP-binding protein spermidine/putrescine ABC transporter substrate- D4GQX7 2.99 1 4 binding protein D4GSF1 2.95 1 2 chemotaxis protein D4GPF7 2.95 1 1 ISNCY family transposase ISHvo14 D4H039 2.93 1.33 4 hypothetical protein D4GTR6 2.91 1.5 6 amino acid transporter D4GSZ7 2.87 1 1 ATP-NAD kinase D4H0A2 2.86 1 1 hypothetical protein D4GPM2 2.83 1 3 ABC transporter ATP-binding protein D4GRW1 2.76 1 4 transducer protein MpcT D4GVE7 2.76 1 1 transducer protein Htr36 D4GSN7 2.74 1.25 5 recombinase RecA D4GUR0 2.74 1 3 sugar ABC transporter substrate-binding protein D4GUQ3 2.71 1 1 fructose-bisphosphate aldolase D4GVT7 2.68 1 1 hypothetical protein D4GQU6 2.66 1 1 FAD/NAD(P)-binding oxidoreductase D4GVG3 2.65 1 2 NADH-quinone oxidoreductase subunit L D4GQ04 2.63 1 1 spermidine synthase

168

Table A-1. Continued Mean Mean Sum Coverage Unique Unique Accession (%) Peptides Peptides Description D4H053 2.62 1 4 membrane protein D4GPX5 2.58 1 2 peptide ABC transporter substrate-binding protein D4GPW5 2.56 1 2 glucose ABC transporter substrate-binding protein D4GQR9 2.54 1 3 IS5 family transposase ISHvo3 D4GPZ0 2.52 1 1 glycoside hydrolase family 4 hydroxymethylpyrimidine/phosphomethylpyrimidine D4GV38 2.51 1 2 kinase D4GPJ7 2.51 1 2 signal transduction histidine kinase D4GSM5 2.51 0.5 1 peptide ABC transporter permease D4H0C4 2.51 1.33 4 hypothetical protein D4GSA3 2.49 1 1 transducer protein Htr8 D4GW68 2.46 1 1 acetyltransferase D4GRI3 2.45 1 4 phenylacetyl-CoA ligase D4GQM9 2.45 1 3 asparagine synthase D4GW91 2.42 1 3 metal transporter D4GU46 2.39 1 1 ABC transporter permease D4GPE2 2.39 1 3 PQQ repeat protein D4GSW5 2.37 1 3 site-2 protease family protein D4GTB9 2.37 0.25 1 glutamate--cysteine ligase D4GQB0 2.32 1 2 helicase SNF2/RAD54 family protein D4GYQ5 2.30 1 1 peptide ABC transporter permease D4GPE1 2.29 1 1 PQQ repeat protein D4GRH4 2.28 1 1 aldehyde dehydrogenase Q977V3 2.25 1 2 preprotein translocase subunit SecY D4GWV4 2.24 1 4 ABC transporter ATP-binding protein D4GQ01 2.22 1 2 hypothetical protein D4GWI8 2.15 1 4 two-component system sensor histidine kinase D4GQP8 2.11 1 1 nucleotide sugar dehydrogenase D4GPI5 2.10 1 3 peptide ABC transporter substrate-binding protein D4GTM7 1.99 1 1 methyl-accepting chemotaxis protein D4GR90 1.94 1 4 peptide ABC transporter permease D4GY27 1.93 1 1 Homolog to virus structural protein HRPV1-VP4 D4GPR2 1.86 0.25 1 FAD-dependent oxidoreductase D4GWZ0 1.81 1 1 hypothetical protein D4GQ23 1.77 1 1 hypothetical protein D4GXZ6 1.76 1 1 signal transduction histidine kinase D4GYQ6 1.72 1 2 peptide ABC transporter permease D4GU65 1.71 1 4 hypothetical protein D4GWN4 1.69 1 1 type IV pilus biogenesis complex membrane subunit D4GPH6 1.67 1 1 ATP-binding protein D4GQU8 1.67 1 3 sn-glycerol-3-phosphate dehydrogenase subunit C D4GQK3 1.64 1 1 preprotein translocase subunit SecY arsenite transport protein N-terminal domain- D4GRV3 1.63 1 1 containing protein D4H083 1.53 1 1 ATP-dependent helicase D4GY30 1.42 1 1 hypothetical protein D4GQU2 1.20 1 1 PGF-CTERM sorting domain-containing protein D4GZQ9 1.04 1 1 winged helix-turn-helix domain-containing protein Proteins identified with FDR<1%

169

Table A-2. Differentially expressed proteins Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GXX9 HVO_RS11475, HVO_1405 hypothetical protein 10.54 1.5 2.59E-05 2.60 D4GXP0 HVO_RS11230, HVO_1355 hypothetical protein 12.00 1 2.34E-02 2.53 D4GUK2 HVO_RS08795, HVO_0855 hypothetical protein 14.25 1.67 2.41E-06 2.30 D4GYZ2 HVO_RS12205, HVO_1563 hypothetical protein 16.80 2 8.98E-03 2.26 D4GXA9 HVO_RS10860, HVO_1281 glycosyl transferase 4.83 1 4.12E-02 2.16 D4GZG0 HVO_RS05750, HVO_0215 Fe-S oxidoreductase 4.07 1.33 1.91E-02 2.03 D4GRP8 HVO_RS04480, HVO_A0588 transcriptional regulator 21.09 2.25 1.74E-04 2.02 D4GRM4 HVO_RS04365, HVO_A0563 transcriptional regulator 5.56 1 3.12E-03 1.98 D4GZR8 HVO_RS06095, HVO_0289 ATP-dependent DNA helicase 12.20 1.33 3.76E-03 1.76 D4GZI5 HVO_RS05875, HVO_0240 AsnC family transcriptional regulator 25.49 2 3.79E-02 1.66 D4GY41 HVO_RS19070, HVO_2970 transcriptional regulator 41.67 3.25 3.42E-09 1.55 D4GVA9 HVO_RS15170, HVO_2176 hypothetical protein 34.85 1 1.13E-05 1.52 D4GUB4 HVO_RS08560, HVO_0805 hypothetical protein 28.05 1 1.57E-03 1.48 D4GYR9 HVO_RS05055, HVO_0073 recombinase RecJ 19.80 4.75 2.65E-05 1.38 D4GRQ3 HVO_RS04505, HVO_A0593 transcriptional regulator 6.99 1 1.65E-03 1.35 D4GTL7 HVO_RS14245, HVO_1988 hypothetical protein 12.82 1.75 4.47E-02 1.32 D4GY39 HVO_RS11645, HVO_1439 cysteine synthase 19.63 2.75 1.27E-02 1.26 D4GYG2 HVO_RS12010, HVO_1516 hypothetical protein 12.96 1 1.06E-02 1.26 D4GZE1 HVO_RS05660, HVO_0197 cytochrome c 20.75 4 1.62E-08 1.20 D4GSA7 HVO_RS13275, HVO_1784 peptidase M20 4.35 1 1.70E-03 1.16 D4GYG0 HVO_RS12000, HVO_1514 hypothetical protein 16.29 2.5 9.31E-04 1.11 D4GQU9 HVO_RS03050, HVO_A0272 DNA polymerase III subunit delta' 53.74 3.5 2.38E-05 1.10 D4GPT8 HVO_RS01410, HVO_B0291 glycerophosphodiester phosphodiesterase 15.70 2 1.37E-03 1.10 D4GPE0 HVO_RS00675, HVO_B0139 PQQ repeat protein 6.45 1.67 2.90E-02 1.08 D4GR62 HVO_RS03620, HVO_A0396 SWIM zinc finger domain protein 15.07 3.25 1.90E-05 1.07 D4GX63 HVO_RS10740, HVO_1256 DUF58 domain-containing protein 8.47 1.33 3.63E-03 1.05 D4GZ94 HVO_RS05435, HVO_0150 urease accessory protein UreG 23.07 2.75 3.46E-04 1.03 D4GUQ7 HVO_RS14840, HVO_2110 ArcR family transcription regulator 4.33 1 4.88E-03 1.02 D4GPD7 HVO_RS00660, HVO_B0136 alpha/beta hydrolase 9.31 1 1.88E-02 0.99 D4GXY3 HVO_RS11485, HVO_1407 transcriptional regulator 17.11 2.75 3.56E-04 0.99 D4GSI1 HVO_RS07520, HVO_0586 haloacid dehalogenase 36.73 3.5 3.95E-05 0.99 D4GZY4 HVO_RS06425, HVO_0357 hypothetical protein 30.95 4.75 4.57E-06 0.98 D4GUC7 HVO_RS08590, HVO_0811 tyrosine decarboxylase MfnA 10.15 3 1.07E-03 0.97 D4GRW9 HVO_RS06755, HVO_0428 universal stress protein UspA 7.38 1 7.76E-03 0.97 D4GUN9 HVO_RS14760, HVO_2092 transcriptional regulator 10.67 2 3.11E-03 0.96

170

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GZK1 HVO_RS05945, HVO_0256 hypothetical protein 17.02 1 3.82E-02 0.96 D4GTN8 HVO_RS14355, HVO_2010 hypothetical protein 23.86 2 4.38E-05 0.95 D4GWP4 HVO_RS16245, HVO_2397 adhesin 34.78 8 5.33E-04 0.95 D4GQ58 HVO_RS01985, HVO_A0025 hypothetical protein 10.49 1 1.45E-02 0.94 D4GT50 HVO_RS08070, HVO_0701 50S ribosomal protein L44e 24.73 2.5 5.52E-04 0.93 D4GTT7 HVO_RS08450, HVO_0782 nicotinamide-nucleotide adenylyltransferase 35.50 4 2.97E-06 0.93 D4H0B7 HVO_C0029 PIN domain protein 18.25 2.25 3.55E-04 0.92 D4GPE6 HVO_RS00705, HVO_B0145 creatininase 23.38 2.67 5.47E-03 0.92 peptide ABC transporter substrate-binding D4GPI5 HVO_RS00905, HVO_B0184 2.10 1 8.54E-03 0.91 protein D4GWP5 HVO_RS16250, HVO_2398 ABC transporter ATP-binding protein 11.25 2.5 4.37E-02 0.91 D4GRL6 HVO_RS04325, HVO_A0555 lactate utilization protein 11.35 1.25 1.95E-03 0.91 D4GTR6 HVO_RS16760, HVO_2500 amino acid transporter 2.91 1.5 1.05E-02 0.90 D4GTE3 HVO_RS13875, HVO_1914 acetyl-CoA acetyltransferase 22.15 3.5 5.50E-03 0.89 D4H036 HVO_RS12830, HVO_1691 photosystem reaction center subunit H 24.40 2 4.58E-02 0.88 D4GPT0 HVO_RS01370, HVO_B0283 transcriptional regulator 9.60 1.67 5.09E-03 0.87 D4GWA8 HVO_RS10210, HVO_1146 hypothetical protein 37.50 1.5 7.38E-03 0.87 D4GUF6 HVO_RS17345, HVO_2619 molybdopterin synthase sulfur carrier subunit 44.25 2 2.25E-03 0.87 D4GP32 HVO_RS00145, HVO_B0031 short-chain dehydrogenase 16.21 2.5 4.32E-05 0.87 D4H084 HVO_RS13100, HVO_1745 hypothetical protein 7.27 1.5 2.03E-02 0.87 D4GT93 HVO_RS16655, HVO_2479 2-phospho-L-lactate transferase 5.98 1.75 3.01E-02 0.86 D4GVK0 HVO_RS09610, HVO_1023 hypothetical protein 18.63 3 3.44E-02 0.86 D4GSS9 HVO_RS13445, HVO_1821 HAT (histone acetyltransferase) family protein 15.22 1.75 9.33E-03 0.84 D4GSJ0 HVO_RS07560, HVO_0595 chromosome partitioning protein ParA 23.25 3.5 1.48E-03 0.83 D4GZA7 HVO_RS05500, HVO_0163 transcriptional regulator 44.71 6 3.93E-05 0.83 D4GRE9 HVO_RS04010, HVO_A0486 hydrogenase expression protein 10.62 2 8.08E-04 0.82 D4GQE7 HVO_RS02390, HVO_A0115 hypothetical protein 51.72 1.75 4.91E-03 0.80 D4GW18 HVO_RS09965, HVO_1096 succinyl-diaminopimelate desuccinylase 27.74 3.25 4.93E-02 0.79 D4GTW1 HVO_RS16905, HVO_2529 short-chain dehydrogenase 42.93 7.25 1.12E-06 0.78 D4GTP0 HVO_RS14365, HVO_2012 sensor histidine kinase 13.23 1.33 4.49E-02 0.78 D4GRD0 HVO_RS03910, HVO_A0465 transcription regulator 25.95 4.5 1.60E-04 0.77 D4GZI2 HVO_RS05860, HVO_0237 Ribonuclease 10.96 4 1.29E-03 0.77 D4GU30 HVO_RS14390, HVO_2017 hypothetical protein 10.84 2.75 1.91E-02 0.76 D4GUS7 HVO_RS14935, HVO_2130 transcriptional regulator 38.33 8.25 2.13E-06 0.76 D4GUG5 HVO_RS08685, HVO_0830 methylmalonyl-CoA mutase 9.35 1 3.02E-03 0.76

171

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GQJ9 HVO_RS02625, HVO_A0170 hypothetical protein 35.17 2.5 2.76E-04 0.76 D4GW51 HVO_RS17865, HVO_2725 phosphoesterase 38.07 12 1.43E-08 0.76 D4GVT6 HVO_RS15370, HVO_2220 chemotaxis protein 4.10 2 4.99E-03 0.75 D4GQ02 HVO_RS01715, HVO_B0355 hypothetical protein 12.77 1.75 2.72E-03 0.75 D4GRU3 HVO_RS04695, HVO_A0635 cysteine desulfurase 18.73 4.25 8.66E-03 0.74 D4GXD2 HVO_RS18485, HVO_2850 hypothetical protein 31.94 2.5 2.68E-04 0.74 D4GXS4 HVO_RS18795, HVO_2914 hypothetical protein 16.96 2 8.29E-03 0.74 D4GSK8 HVO_RS07645, HVO_0612 universal stress protein UspA 17.48 1 2.54E-03 0.73 D4GYU8 HVO_RS05185, HVO_0102 zinc metalloprotease HtpX 8.96 2.75 2.38E-03 0.73 D4GXS5 HVO_RS11315, HVO_1373 acyl-CoA dehydrogenase 14.27 3 2.92E-03 0.73 D4GZG8 HVO_RS05790, HVO_0223 hypothetical protein 17.36 4.33 5.97E-04 0.73 D4GR79 HVO_RS03695, HVO_A0415 cyclase 45.48 3.75 3.34E-05 0.72 D4GV78 HVO_RS09350, HVO_0971 DEAD/DEAH box helicase 13.30 4.25 7.73E-03 0.72 D4GXN5 HVO_RS11215, HVO_1352 hypothetical protein 17.74 1.5 1.62E-02 0.71 D4GYN8 HVO_RS04910, HVO_0043 acetylornithine aminotransferase 11.90 3.25 2.55E-04 0.71 D4GYW3 HVO_RS05260, HVO_0117 translation initiation factor IF-6 36.54 4.75 5.27E-05 0.70 D4GYA5 HVO_RS11800, HVO_1471 sulfite oxidase 15.23 2.25 1.87E-02 0.70 imidazole glycerol phosphate synthase cyclase D4GVM0 HVO_RS09715, HVO_1044 37.04 7.25 1.23E-07 0.69 subunit D4H097 HVO_RS19315, HVO_C0006 UPF0395 family protein 26.54 2.25 1.35E-04 0.69 D4GVS6 HVO_RS09885, HVO_1080 hypothetical protein 66.76 9 3.50E-07 0.69 D4GZN3 HVO_RS12725, HVO_1669 fibrillarin-like rRNA methylase 16.78 2.5 1.14E-03 0.68 D4GSI5 HVO_RS07540, HVO_0590 UPF0284 protein 42.68 6.75 2.05E-03 0.68 D4GZ90 HVO_RS05415, HVO_0146 phosphatidylserine decarboxylase 10.20 1.5 2.10E-02 0.67 D4GV89 HVO_RS15065, HVO_2156 universal stress protein UspA 27.24 5.5 5.84E-04 0.67 D4GSH2 HVO_RS07470, HVO_0576 transcriptional regulator 10.43 1.25 2.44E-02 0.66 D4GZ62 HVO_RS12540, HVO_1633 hypothetical protein 41.73 5 8.00E-04 0.66 D4GVM6 HVO_RS09735, HVO_1050 asparagine synthase 26.58 6.75 2.17E-05 0.65 D4GPI4 HVO_RS00900, HVO_B0183 racemase 14.29 2.5 1.93E-02 0.65 D4GYT9 HVO_0094 Uncharacterized protein 53.88 1.75 3.63E-02 0.64 P18304 HVO_RS08475, HVO_0787 indole-3-glycerol-phosphate synthase 39.34 6.5 1.86E-02 0.63 D4GRT9 HVO_RS04675, HVO_A0631 hypothetical protein 19.40 1.67 2.31E-02 0.63 D4GRJ6 HVO_RS04230, HVO_A0534 EthD domain protein 10.14 1.67 2.27E-02 0.63 NAD(P)-dependent glycerol-1-phosphate D4GUF0 HVO_RS08645, HVO_0822 29.17 4.25 1.72E-03 0.63 dehydrogenase

172

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GSW4 HVO_RS13630, HVO_1861 thiamine-phosphate kinase 16.16 3.67 2.14E-02 0.63 D4GR09 HVO_RS03340, HVO_A0332 ArcR family transcription regulator 18.75 3.25 4.45E-02 0.63 D4GT42 HVO_RS08045, HVO_0696 diaminopimelate epimerase 7.11 1.75 2.64E-02 0.62 D4GY67 HVO_RS11710, HVO_1452 CoA ester lyase 25.54 5 9.28E-03 0.62 D4GXY2 HVO_RS18935, HVO_2943 dihydroorotate dehydrogenase (quinone) 32.76 6.25 5.58E-03 0.62 D4GUK9 HVO_RS08830, HVO_0862 hypothetical protein 23.77 3.25 3.24E-03 0.62 D4GPF2 HVO_RS00730, HVO_B0151 nickel-responsive transcriptional regulator NikR 14.79 2 6.51E-03 0.61 D4GTY8 HVO_RS17040, HVO_2556 ribonuclease P 36.71 4 2.75E-03 0.61 D4GW28 HVO_RS09990, HVO_1101 4-hydroxy-tetrahydrodipicolinate synthase 50.08 11.25 2.75E-07 0.61 D4GWL9 HVO_RS16115, HVO_2371 hypothetical protein 19.03 1.5 1.30E-03 0.61 D4GTH0 HVO_RS14010, HVO_1941 magnesium chelatase 15.09 2.75 4.74E-03 0.61 D4GYT2 HVO_RS05120, HVO_0087 delta-aminolevulinic acid dehydratase 37.84 8.5 1.17E-08 0.61 D4GRI9 HVO_RS04195, HVO_A0527 transcriptional regulator 14.51 2.75 4.37E-03 0.60 D4GZ81 HVO_RS05370, HVO_0137 lipase/esterase 16.18 2 7.64E-04 0.60 D4GUL2 HVO_RS08850, HVO_0865 SAM-dependent methyltransferase 15.38 2.75 3.72E-04 0.60 D4GW93 HVO_RS10175, HVO_1139 farnesyl-diphosphate farnesyltransferase 28.70 4.5 2.79E-06 0.60 D4GQY0 HVO_RS03205, HVO_A0302 L-asparaginase 21.60 4.5 4.13E-03 0.59 D4GTQ7 HVO_RS08355, HVO_0762 coenzyme A pyrophosphatase 28.03 4 3.89E-03 0.58 D4GYJ8 HVO_RS04715, HVO_0002 S26 family signal peptidase 22.04 5 1.30E-03 0.58 D4GXH9 HVO_RS18575, HVO_2870 AI-2E family transporter 5.43 1.25 7.21E-03 0.57 D4GQH4 HVO_RS02505, HVO_A0145 sugar ABC transporter ATP-binding protein 10.59 1.75 5.59E-03 0.57 D4GZD9 HVO_RS05650, HVO_0195 ribose-5-phosphate isomerase 19.78 3.75 1.54E-02 0.57 D4GWY1 HVO_RS18130, HVO_2778 50S ribosomal protein L13 47.93 5.5 4.07E-04 0.57 D4GQU3 HVO_RS03020, HVO_A0266 ArcR family transcription regulator 36.57 7.75 7.44E-03 0.56 D4GXR0 HVO_RS18760, HVO_2907 hypothetical protein 38.08 5.25 3.17E-02 0.56 D4GTS7 HVO_RS08400, HVO_0772 ArsR family transcriptional regulator 16.67 1 8.03E-04 0.56 D4GTU6 HVO_RS16830, HVO_2514 transcriptional regulator 41.36 6.25 3.74E-04 0.55 D4GY35 HVO_RS11635, HVO_1437 hypothetical protein 17.49 3.25 4.14E-02 0.55 D4GVS8 HVO_RS09890, HVO_1081 glutaredoxin 6.58 1.25 9.47E-04 0.54 D4GPZ4 HVO_RS01675, HVO_B0347 oxidoreductase 15.93 3 3.50E-03 0.54 D4GRV0 HVO_RS06670, HVO_0409 riboflavin synthase 32.51 4.33 6.00E-04 0.54 D4GQA6 HVO_RS02210, HVO_A0074 AAA-type ATPase domain protein 13.27 9 3.13E-03 0.54 D4GXI3 HVO_RS11070, HVO_1323 shikimate kinase 18.17 3.75 7.07E-03 0.54 D4GS23 HVO_RS07040, HVO_0483 alpha-L-glutamate ligase 25.43 5.25 1.55E-02 0.53 D4GRG1 HVO_RS04070, HVO_A0498 Iron transport protein 40.96 13.75 1.44E-11 0.53

173

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GXR7 HVO_RS18780, HVO_2911 deoxyribodipyrimidine photo-lyase 30.84 9.75 3.54E-05 0.53 D4GT07 HVO_RS07945, HVO_0675 sugar kinase 11.55 2 4.59E-04 0.53 D4GY62 HVO_RS19125, HVO_2981 uracil phosphoribosyltransferase 43.36 7.5 6.00E-05 0.52 D4GYG3 HVO_RS12015, HVO_1517 glycosyl transferase 26.98 4.5 4.03E-03 0.52 D4GX90 HVO_RS10815, HVO_1272 TrmB family transcriptional regulator 12.29 4 2.21E-02 0.51 D4GXE4 HVO_RS10960, HVO_1300 triose-phosphate isomerase 45.21 6.75 5.41E-07 0.50 D4GZI8 HVO_RS05885, HVO_0243 threonine aldolase 20.16 5 5.17E-03 0.50 D4GXE6 HVO_RS10970, HVO_1302 DNA polymerase IV 21.45 4.5 4.93E-02 0.50 D4GSI7 HVO_RS07550, HVO_0592 adenosylcobinamide amidohydrolase 10.10 1.5 1.27E-02 0.50 D4GW12 HVO_RS09945, HVO_1092 Ribonuclease P protein 4.40 1 9.85E-03 0.49 D4GV47 HVO_RS17600, HVO_2671 alanine--glyoxylate aminotransferase 31.84 5.75 6.50E-04 0.49 D4GWI7 HVO_RS15955, HVO_2338 homoserine kinase 38.40 6.25 1.40E-03 0.49 D4GVY3 HVO_RS15595, HVO_2267 hypothetical protein 19.35 5.5 2.40E-05 0.48 D4GXZ5 HVO_RS11515, HVO_1413 NADH dehydrogenase 12.73 3 1.68E-02 0.48 D4GTR7 HVO_RS16765, HVO_2501 alpha/beta hydrolase 23.10 5 2.79E-02 0.48 D4GU04 HVO_RS17130, HVO_2574 hypothetical protein 28.22 4.25 6.54E-03 0.47 D4GZP5 HVO_RS12780, HVO_1681 8-oxoguanine DNA glycosylase 34.95 7 1.57E-02 0.47 D4GW29 HVO_RS17815, HVO_2715 phosphoglycolate phosphatase 34.65 3.5 7.28E-03 0.47 D4GVI4 HVO_RS09525, HVO_1007 PQQ-dependent glucose dehydrogenase 7.92 2.5 3.74E-02 0.47 D4GZA0 HVO_RS05465, HVO_0156 RNA methylase 35.12 8 1.92E-03 0.47 D4GP51 HVO_RS00235, HVO_B0049 precorrin isomerase 44.36 8.5 1.49E-03 0.46 D4GT52 HVO_RS08075, HVO_0703 hypothetical protein 67.15 7 2.98E-04 0.46 D4GTW3 HVO_RS16915, HVO_2530 phosphoribosylamine--glycine ligase 13.12 4 5.67E-03 0.46 D4GZW6 HVO_RS06325, HVO_0337 glutaredoxin 17.26 2.75 2.46E-02 0.46 D4GPB5 HVO_RS00550, HVO_B0114 IclR family transcriptional regulator 15.08 3 4.38E-02 0.46 D4GPS6 HVO_RS01355, HVO_B0279 SAM-dependent methyltransferase 24.15 3 8.31E-03 0.45 D4GYH5 HVO_RS12055, HVO_1531 UDP-glucose 6-dehydrogenase 28.84 10.75 1.31E-04 0.45 D4GUM3 HVO_RS08900, HVO_0876 methylglyoxal synthase 67.72 8.25 2.51E-04 0.45 D4GVL7 HVO_RS09700, HVO_1041 MBL fold hydrolase 55.65 12.75 1.71E-04 0.45 D4GZV9 HVO_RS06290, HVO_0330 DUF502 family 11.92 1.25 4.47E-04 0.44 Q977V2 HVO_RS05290, HVO_0123 signal recognition particle 57.42 20.5 3.57E-09 0.44 D4GXB0 HVO_RS10865, HVO_1282 6-pyruvoyltetrahydropterin synthase 30.00 2.25 6.69E-03 0.44 D4GZD4 HVO_RS05625, HVO_0190 alpha hydrolase 42.03 9 5.37E-06 0.44 D4GYF9 HVO_RS11995, HVO_1513 hypothetical protein 48.25 7.5 1.11E-05 0.44 D4GTB4 HVO_RS08255, HVO_0741 DNA polymerase/3'-5' exonuclease PolX 34.54 10.75 3.39E-03 0.43

174

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GYT6 HVO_RS05130, HVO_0091 histidinol-phosphatase 21.31 3.5 5.00E-02 0.43 D4GXZ2 HVO_RS18960, HVO_2948 phenylalanyl--tRNA ligase subunit alpha 35.47 9 2.74E-03 0.43 D4GQN8 HVO_RS02775, HVO_A0209 helicase 13.07 9 1.91E-03 0.43 D4GPX1 HVO_RS01555, HVO_B0324 DUF362 domain-containing protein 25.56 7.5 3.08E-02 0.43 D4GX52 HVO_RS10710, HVO_1249 DUF54 family protein 35.56 3.75 1.79E-03 0.43 D4GPA4 HVO_RS00495, HVO_B0102 glycosyl hydrolase family 88 28.31 6 2.28E-02 0.43 D4GTP8 HVO_RS16725, HVO_2493 tRNA pseudouridine(55) synthase TruB 25.78 5.75 5.99E-04 0.43 D4GYB4 HVO_RS19250, HVO_3006 excinuclease ABC subunit C 21.68 8.75 4.31E-03 0.42 D4GYG7 HVO_1523A glycosyltransferase AglE 26.23 4.25 1.32E-02 0.42 D4GP19 HVO_RS00080, HVO_B0018 chromosome partitioning protein ParA 42.51 8.5 9.67E-03 0.42 D4GS68 HVO_RS07285, HVO_0536 DNA starvation/stationary phase protection 84.38 7.75 6.62E-05 0.41 D4GTA4 HVO_RS08220, HVO_0733 transcription initiation factor IIB 2 31.37 4.5 1.30E-02 0.41 D4GYE9 HVO_RS11955, HVO_1503 3-isopropylmalate dehydratase small subunit 36.76 5.75 1.07E-03 0.41 D4GSG9 HVO_RS07460, HVO_0574 SAM-dependent methyltransferase 15.51 3.25 3.59E-02 0.41 D4GWJ9 HVO_RS16015, HVO_2350 YyaL family protein 36.68 14 2.91E-05 0.41 D4GW20 HVO_RS09970, HVO_1097 diaminopimelate epimerase 49.65 11.75 1.33E-06 0.41 D4GQ18 HVO_RS01795, HVO_B0371 aldehyde dehydrogenase 50.55 14.5 7.24E-07 0.41 D4GUW6 HVO_RS17435, HVO_2638 dipeptide epimerase 38.12 9 2.44E-03 0.40 D4GZ60 HVO_RS12530, HVO_1631 diphthamide biosynthesis enzyme Dph2 40.33 14.75 4.17E-05 0.40 D4GZ24 HVO_RS12370, HVO_1595 hypothetical protein 43.26 4.75 8.47E-04 0.40 proteasome assembly chaperone family D4GT44 HVO_RS08050, HVO_0697 30.00 3.5 4.83E-02 0.39 protein D4GW78 HVO_RS17930, HVO_2738 30S ribosomal protein S28e 29.05 3 1.07E-02 0.39 D4H0D2 HVO_RS19460, HVO_C0044 phospholipase D Active site motif domain 20.50 4 4.47E-02 0.39 D4GUI0 HVO_RS17390, HVO_2628 GHMP kinase 19.77 4 8.52E-03 0.39 D4GTP7 HVO_RS08330, HVO_0756 RNA-binding protein 9.14 1.67 2.77E-02 0.39 D4GUH4 HVO_RS08705, HVO_0835 3-ketoacyl-CoA thiolase 30.35 7 2.01E-03 0.39 D4GW84 HVO_RS17940, HVO_2740 nucleoside-diphosphate kinase 40.75 6.5 6.55E-05 0.39 D4GZ23 HVO_RS12365, HVO_1594 SAM-dependent methyltransferase 29.79 7 6.28E-04 0.38 D4GX82 HVO_RS18370, HVO_2827 exonuclease V subunit beta 13.82 10.25 4.55E-02 0.38 D4GWZ1 HVO_RS18150, HVO_2782 30S ribosomal protein S11 54.62 6.5 2.36E-03 0.37 D4GZJ8 HVO_RS05930, HVO_0253 threonylcarbamoyl-AMP synthase 50.50 6 1.61E-02 0.37 branched-chain amino acid ABC transporter D4GPL8 HVO_RS01070, HVO_B0217 12.87 4 4.55E-02 0.37 substrate-binding protein D4GZI7 HVO_RS05880, HVO_0242 aminopeptidase 31.94 9 1.17E-04 0.37

175

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GZX8 HVO_RS06395, HVO_0351 NusA 7.91 1 2.37E-02 0.37 D4GWR4 HVO_RS16340, HVO_2417 DUF2150 family protein 29.36 4 1.35E-02 0.37 precorrin-6Y C5,15-methyltransferase D4GP64 HVO_RS00300, HVO_B0062 49.86 7 2.83E-03 0.37 (decarboxylating) subunit CbiT D4GSC5 HVO_RS13345, HVO_1801 hypothetical protein 22.33 1 1.64E-02 0.37 D4H091 HVO_RS13130, HVO_1752 transcriptional regulator 55.78 8.5 5.99E-04 0.37 D4GYY9 HVO_RS12195, HVO_1560 UPF0212 protein 23.74 2.25 4.66E-02 0.36 D4GS24 HVO_RS07045, HVO_0484 50S ribosomal protein L16 47.44 8.25 1.01E-03 0.36 D4GWG6 HVO_RS15770, HVO_2300 translation initiation factor IF-5A 64.92 6.25 2.48E-02 0.36 D4GY69 HVO_RS11715, HVO_1453 glutamate dehydrogenase 43.23 13.5 1.98E-04 0.36 D4GWQ9 HVO_RS16315, HVO_2412 transcriptional regulator 21.74 3.25 1.36E-02 0.36 D4GZY7 HVO_RS06440, HVO_0360 30S ribosomal protein S10 78.19 8.25 7.49E-04 0.36 D4GUR9 HVO_RS14900, HVO_2122 ABC transporter ATP-binding protein 24.66 5.5 3.87E-02 0.36 D4GSR6 HVO_RS07855, HVO_0656 DUF2103 family protein 27.39 5.5 1.13E-02 0.36 D4GXR1 HVO_RS18765, HVO_2908 dihydropteroate synthase 35.95 8.5 2.07E-02 0.35 D4GQT3 HVO_RS02975, HVO_A0254 ATPase 17.41 5 9.70E-03 0.35 D4GS04 HVO_RS06940, HVO_0464 threonine ammonia-lyase 17.25 4.5 4.34E-02 0.35 D4GPZ2 HVO_RS01665, HVO_B0345 mandelate racemase 19.64 5.5 2.65E-02 0.35 D4GZW0 HVO_RS06295, HVO_0331 proline dehydrogenase 16.97 4.33 9.68E-03 0.35 D4GR60 HVO_RS03610, HVO_A0394 transcriptional regulator 41.62 3.75 4.16E-02 0.35 D4GYS1 HVO_RS05065, HVO_0076 uroporphyrinogen-III synthase 31.07 5 1.28E-02 0.34 D4GZS5 HVO_RS06130, HVO_0296 oxidoreductase 35.44 6.25 7.75E-03 0.34 D4GXT9 HVO_RS11350, HVO_1380 methylmalonyl-CoA mutase 21.86 8 1.18E-02 0.34 D4H069 HVO_RS13000, HVO_1725 cell division control protein Cdc6 32.54 10 2.62E-03 0.34 D4GPX5 HVO_RS01575, HVO_B0328 peptide ABC transporter substrate-binding 2.58 1 3.85E-02 0.34 D4GYS3 HVO_RS05075, HVO_0078 hydroxymethylbilane synthase 53.37 19 1.23E-05 0.34 D4H0F9 HVO_RS19595, HVO_C0077 N-methyltryptophan oxidase 42.38 10 8.62E-03 0.33 N-acetyl-gamma-glutamyl-phosphate D4GYP0 HVO_RS04920, HVO_0045 33.07 8.25 3.51E-03 0.33 reductase D4GZ88 HVO_RS05405, HVO_0144 ribonuclease Z 35.79 7.5 2.82E-02 0.33 D4GXI2 HVO_RS18585, HVO_2872 hypothetical protein 22.76 7 2.31E-02 0.33 D4GTQ4 HVO_RS08345, HVO_0760 hypothetical protein 32.00 8.25 1.16E-03 0.33 D4GRG5 HVO_RS04090, HVO_A0503 amidohydrolase 44.57 7.25 2.07E-02 0.33 D4GYS8 HVO_RS05100, HVO_0083 nitrogen regulatory protein P-II 62.40 5 2.26E-03 0.32 D4GW30 HVO_RS09995, HVO_1102 NYN domain-containing protein 19.85 2 1.69E-02 0.32

176

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GS15 HVO_RS06995, HVO_0475 hypothetical protein 29.17 6.75 1.17E-02 0.32 glycine dehydrogenase (aminomethyl- D4GWP9 HVO_RS16265, HVO_2402 28.69 10.5 1.30E-03 0.32 transferring) pyridoxal 5'-phosphate synthase lyase subunit D4GWI5 HVO_RS15945, HVO_2336 60.43 15.25 8.34E-06 0.32 PdxS 3-methyl-2-oxobutanoate D4GW03 HVO_RS17755, HVO_2703 47.86 6.25 3.45E-02 0.32 hydroxymethyltransferase D4GVP3 HVO_RS09790, HVO_1061 thioredoxin reductase 65.64 13 6.54E-04 0.32 D4GTZ2 HVO_RS17060, HVO_2560 30S ribosomal protein S19 45.89 4.25 1.81E-03 0.32 D4GQG9 HVO_RS02480, HVO_A0140 phosphohydrolase 13.67 2 3.92E-02 0.31 D4GR89 HVO_A0426 peptide ABC transporter ATP-binding protein 25.89 5 3.89E-02 0.31 D4GR88 HVO_A0425 peptide ABC transporter ATP-binding protein 16.11 4 1.11E-02 0.31 D4GWN1 HVO_RS16175, HVO_2383 DNA repair protein RadB 38.43 6.75 6.84E-03 0.31 D4GX17 HVO_RS18220, HVO_2796 hypothetical protein 79.48 7 4.36E-03 0.31 D4GS89 HVO_RS13190, HVO_1764 hypothetical protein 22.58 5 4.69E-02 0.30 D4GQ53 HVO_RS01960, HVO_A0021 hypothetical protein 68.51 9.25 1.65E-03 0.30 D4GU35 HVO_RS14420, HVO_2022 hypothetical protein 25.37 4 1.51E-02 0.30 D4GSW5 HVO_RS13635, HVO_1862 site-2 protease family protein 2.37 1 6.04E-04 0.30 Tat (twin-arginine translocation) pathway signal D4GQG3 HVO_RS02455, HVO_A0133 39.73 8.5 3.44E-02 0.30 sequence domain protein D4GZD2 HVO_RS05615, HVO_0188 polyketide cyclase 33.44 4.75 1.10E-02 0.29 D4GS06 HVO_RS06950, HVO_0466 citrate (Si)-synthase 34.70 11 4.12E-04 0.29 D4GUL5 HVO_RS08865, HVO_0868 epimerase 47.95 12 1.34E-03 0.29 D4GYK7 HVO_RS04755, HVO_0011 IMP cyclohydrolase 72.37 11 2.73E-02 0.29 O07118 HVO_RS18980, HVO_2952 tRNA splicing endonuclease 33.70 9 2.74E-02 0.29 D4GUC8 HVO_RS17280, HVO_2605 tRNA modifying enzyme 31.06 11 2.27E-03 0.29 D4H031 HVO_RS06650, HVO_0405 pseudo 7.99 3.75 8.45E-03 0.29 D4GYP1 HVO_RS04925, HVO_0046 lysine biosynthesis enzyme LysX 42.78 8.25 2.49E-02 0.29 D4GU60 HVO_RS14545, HVO_2046 N-acetylgalactosamine-6-sulfatase 55.06 13.75 2.07E-02 0.29 D4GTS9 HVO_RS08410, HVO_0774 glycosyl transferase family 2 19.58 3.75 4.56E-02 0.29 D4GVH7 HVO_RS09490, HVO_1000 acetyl-CoA synthetase 35.19 21 5.24E-05 0.29 ABC-type transport system periplasmic D4GP95 HVO_RS00450, HVO_B0093 31.03 11.5 2.29E-03 0.28 substrate-binding protein D4GSC8 HVO_RS13360, HVO_1804 nicotinate phosphoribosyltransferase 46.07 11.75 4.61E-03 0.28

177

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) bifunctional 5,10-methylene-tetrahydrofolate D4GXG9 HVO_RS18555, HVO_2865 dehydrogenase/5,10-methylene- 39.81 11.25 6.37E-03 0.28 tetrahydrofolate cyclohydrolase D4GZB9 HVO_RS05560, HVO_0175 DNA polymerase sliding clamp 46.76 7.75 3.16E-02 0.28 D4GXM5 HVO_RS18690, HVO_2892A NADPH-dependent oxidoreductase 43.62 4.75 1.30E-02 0.28 Q7ZAG7 HVO_RS11960, HVO_1504 3-isopropylmalate dehydratase large subunit 49.74 22.75 1.62E-06 0.28 D4GVV8 HVO_RS15480, HVO_2242 translation initiation factor IF-2 58.04 11 8.31E-03 0.28 D4GTG9 HVO_RS14005, HVO_1940 DNA mismatch repair protein MutS 25.65 16 8.11E-04 0.28 D4GZN1 HVO_RS12715, HVO_1667 transcriptional regulator 63.64 8.75 1.07E-02 0.27 D4GY38 HVO_RS19065, HVO_2969 threonine synthase 59.49 21.25 1.05E-03 0.27 D4GWJ6 HVO_RS16000, HVO_2347 hypothetical protein 41.07 4.5 1.63E-02 0.27 D4GZD5 HVO_RS05630, HVO_0191 DNA mismatch repair protein MutS 21.01 10.25 3.66E-02 0.27 D4GRF0 HVO_RS04015, HVO_A0487 cobyrinic acid a,c-diamide synthase 50.28 14.75 2.73E-03 0.27 D4GS20 HVO_RS07025, HVO_0480 phosphoglycerate kinase 65.71 19.75 3.46E-04 0.26 D4GU72 HVO_RS14600, HVO_2059 dTDP-glucose 4,6-dehydratase 57.90 12.75 3.16E-04 0.26 D4GV72 HVO_RS09320, HVO_0965 AMP phosphorylase 15.80 6.75 1.83E-02 0.26 D4GZI1 HVO_RS05855, HVO_0236 tRNA (guanine(10)-N(2))-dimethyltransferase 34.84 9.25 3.24E-02 0.26 D4GQC9 HVO_RS02320, HVO_A0097 3-hydroxybutyryl-CoA dehydrogenase 22.27 9.5 3.32E-02 0.26 D4GXF5 HVO_RS11005, HVO_1308 3-phosphoshikimate 1-carboxyvinyltransferase 30.52 9.5 6.13E-03 0.26 D4H037 HVO_RS12835, HVO_1692 4Fe-4S binding protein 43.86 24.75 8.41E-05 0.26 D4GV80 HVO_RS09360, HVO_0973 aspartate aminotransferase 59.83 18.25 6.03E-04 0.26 D4GTX0 HVO_RS16950, HVO_2538 alpha/beta hydrolase 37.14 7.75 2.95E-02 0.26 D4H082 HVO_RS13090, HVO_1743 hypothetical protein 22.45 6.5 3.15E-02 0.26 D4GZN0 HVO_RS12710, HVO_1666 phosphopantetheine adenylyltransferase 50.45 7.5 4.33E-02 0.25 D4GTW8 HVO_RS16940, HVO_2536 TIGR00300 family protein 56.31 12.5 6.55E-03 0.25 D4GXM1 HVO_RS11175, HVO_1344 rRNA metabolism protein 72.37 15.25 3.58E-02 0.25 D4GSA8 HVO_RS13280, HVO_1783 hypothetical protein 46.54 8.5 2.33E-02 0.25 D4GYL9 HVO_RS04820, HVO_0024 thiosulfate sulfurtransferase 47.77 9 2.24E-02 0.25 D4GY81 HVO_RS11740, HVO_1459 trehalose utilization protein ThuA 54.52 9 3.81E-02 0.25 ribosome biogenesis/translation initiation D4GRW5 HVO_RS06735, HVO_0424 49.21 23.75 1.08E-03 0.25 ATPase RLI Q9C4M3 HVO_RS14310, HVO_2001 tRNA-guanine(15) transglycosylase 48.84 18.75 5.32E-03 0.25 D4GUE0 HVO_RS08625, HVO_0818 threonine synthase 36.12 10 2.74E-02 0.24 D4GVM3 HVO_RS09720, HVO_1047 NADPH:quinone reductase 10.22 2 2.12E-02 0.24 D4GWG7 HVO_RS15790, HVO_2304 molybdopterin molybdenumtransferase MoeA 49.14 12.75 1.85E-02 0.24

178

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GWW0 HVO_RS10460, HVO_1198 universal stress protein UspA 47.41 5.25 9.46E-03 0.24 D4GUW0 HVO_RS08980, HVO_0893 methylmalonyl-CoA mutase 27.47 7.5 1.61E-02 0.23 D4GT46 HVO_RS08060, HVO_0699 translation initiation factor IF-2 subunit alpha 55.83 12 1.29E-02 0.23 D4GV96 HVO_RS15105, HVO_2163 ABC transporter ATP-binding protein 29.22 4.75 1.57E-02 0.23 5-(carboxyamino)imidazole ribonucleotide D4GVF3 HVO_RS09375, HVO_0976 41.73 14 1.11E-02 0.23 synthase D4GSI0 HVO_RS07515, HVO_0585 aldo/keto reductase 46.56 13.25 7.67E-03 0.23 D4GW26 HVO_RS09985, HVO_1100 4-hydroxy-tetrahydrodipicolinate reductase 55.24 11.25 9.04E-03 0.23 D4GTS8 HVO_RS08405, HVO_0773 N-methyltransferase-like protein 46.12 9.25 2.70E-02 0.23 sn-glycerol-3-phosphate dehydrogenase D4GYI4 HVO_RS12095, HVO_1540 44.15 16.5 1.07E-03 0.23 subunit C D4GWT4 HVO_RS10375, HVO_1181 histidine kinase 38.12 9.25 1.72E-02 0.22 D4GWM8 HVO_RS16160, HVO_2380 ATPase 69.89 45.5 5.83E-06 0.22 D4GYD4 HVO_RS11885, HVO_1488 mandelate racemase 51.82 16.5 6.82E-04 0.22 D4GSQ2 HVO_RS07800, HVO_0644 citramalate synthase 63.18 21.25 3.98E-03 0.22 D4H071 HVO_RS13010, HVO_1727 transcription factor 25.13 5 3.06E-02 0.22 D4GZB1 HVO_RS05520, HVO_0167 adenosylhomocysteinase 56.19 19.25 2.03E-04 0.22 D4GWS4 HVO_RS10340, HVO_1173 tRNA (cytidine(56)-2'-O)-methyltransferase 42.22 6 9.97E-03 0.21 2-ketoglutarate ferredoxin oxidoreductase D4GXE9 HVO_RS10980, HVO_1304 75.32 16.5 2.48E-03 0.21 subunit beta D4GS16 HVO_RS07000, HVO_0476 hypothetical protein 29.82 5.75 2.43E-02 0.21 D4GU26 HVO_RS14370, HVO_2013 cell division protein FtsZ 70.88 17.25 1.32E-02 0.21 D4GV02 HVO_RS17485, HVO_2648 2-hydroxyacid dehydrogenase 47.41 9.25 4.39E-02 0.21 glutamyl-tRNA(Gln) amidotransferase subunit D4GTU3 HVO_RS16815, HVO_2511 36.87 12 1.09E-02 0.20 D D4H0F7 HVO_RS19585, HVO_C0075 peptide ABC transporter substrate-binding 46.73 13.75 3.43E-02 0.20 D4GTA2 HVO_RS08215, HVO_0732 ribonuclease H 43.53 7.5 3.77E-02 0.20 D4GV98 HVO_RS15115, HVO_2165 ABC transporter permease 13.11 4 4.68E-02 0.20 Q5UT56 HVO_RS14090, HVO_1957 peptidase 49.33 16.25 7.00E-03 0.20 D4GWU2 HVO_RS10405, HVO_1187 polyketide cyclase 85.31 13.75 6.07E-03 0.19 D4GP02 HVO_RS00005, HVO_B0001 cell division control protein Cdc6 35.24 10 4.82E-02 0.19 D4GSH6 HVO_RS07490, HVO_0580 arginosuccinate synthase 49.38 14.5 9.14E-03 0.19 D4GRV8 HVO_RS06700, HVO_0417 carboxypeptidase M32 42.48 17.25 1.69E-02 0.19 D4GYP4 HVO_RS04940, HVO_0049 argininosuccinate synthase 39.38 14.5 2.38E-02 0.18 D4GWY4 HVO_RS18145, HVO_2781 DNA-directed RNA polymerase subunit D 45.37 9.25 2.49E-02 0.18

179

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GZV3 HVO_RS06265, HVO_0324 arginine--tRNA ligase 46.68 25.75 1.01E-03 0.18 D4GUB6 HVO_RS08565, HVO_0806 pyruvate kinase 49.15 22.25 6.89E-03 0.18 D4GW43 HVO_RS17850, HVO_2721 amidophosphoribosyltransferase 66.28 18.5 3.12E-02 0.18 bifunctional malic enzyme D4GSQ3 HVO_RS16435, HVO_2436 54.16 28 4.81E-03 0.17 oxidoreductase/phosphotransacetylase D4GTI4 HVO_RS14080, HVO_1955 aconitate hydratase 58.98 30.75 1.96E-03 0.17 D4GXI7 HVO_RS11090, HVO_1327 ATPase AAA 54.52 26.5 1.51E-02 0.17 anaerobic glycerol-3-phosphate D4GYI3 HVO_RS12090, HVO_1539 80.75 21 2.66E-02 0.17 dehydrogenase subunit B D4GZ07 HVO_RS12285, HVO_1578 NADH dehydrogenase 55.35 18.75 3.10E-02 0.17 D4GVT3 HVO_RS09905, HVO_1084 adenylosuccinate lyase 58.26 18.25 4.67E-02 0.17 D4GWL5 HVO_RS16095, HVO_2367 ATPase AAA 44.45 20.25 3.78E-02 0.17 D4GZC4 HVO_RS05580, HVO_0180 23S rRNA methyltransferase 66.12 11 3.25E-02 0.16 D4GWA5 HVO_RS10205, HVO_1145 30S ribosomal protein S3ae 75.34 18.75 3.03E-03 0.16 D4GYH1 HVO_RS12035, HVO_1527 UTP--glucose-1-phosphate uridylyltransferase 46.50 9.5 4.82E-02 0.16 D4GTZ3 HVO_RS17065, HVO_2561 50S ribosomal protein L2 39.32 11.5 2.71E-02 0.16 D4GZS1 HVO_RS06110, HVO_0292 Replication factor A 69.94 18.25 3.61E-02 0.16 D4GUS4 HVO_RS14925, HVO_2127 indole-3-acetyl-L-aspartic acid hydrolase 48.99 14.5 3.94E-02 0.16 D4GYS6 HVO_RS05090, HVO_0081 aspartate aminotransferase family protein 62.92 17.25 1.29E-02 0.16 D4GU92 HVO_RS17200, HVO_2588 isocitrate dehydrogenase (NADP(+)) 56.03 23.5 8.99E-03 0.15 D4H042 HVO_RS12860, HVO_1697 FAD-dependent oxidoreductase 35.87 30 1.33E-02 0.15 D4GW05 HVO_RS09925, HVO_1088 dihydropteroate synthase 38.42 21.5 4.06E-02 0.14 D4GU24 HVO_RS08500, HVO_0792 3-dehydroquinate synthase II 59.12 16.75 4.13E-02 0.13 D4GUG6 HVO_RS17370, HVO_2624 CTP synthetase 61.11 26.5 1.98E-02 0.13 D4GW47 HVO_RS17855, HVO_2723 snRNP-like protein 11.84 1 1.12E-02 0.13 D4GWR6 HVO_RS16350, HVO_2419 hydroxymethylglutaryl-CoA synthase 67.58 26 4.80E-02 0.13 D4GVJ5 HVO_RS09585, HVO_1018 DHH/RecJ family phosphoesterase 64.89 36 1.82E-02 0.12 O30561 HVO_RS05345, HVO_0133 thermosome subunit 1 71.87 31.25 2.05E-02 0.11 D4GX92 HVO_RS10820, HVO_1273 IMP dehydrogenase 67.37 25 2.76E-02 0.11 D4GUG0 HVO_RS17355, HVO_2621 phosphoenolpyruvate carboxylase 58.11 52 1.85E-02 0.10 D4GTY1 HVO_RS17005, HVO_2549 30S ribosomal protein S8 62.50 8.75 1.59E-02 0.10 D4GZX5 HVO_RS06380, HVO_0348 DNA-directed RNA polymerase subunit B 60.71 35.5 2.40E-02 0.10 D4GZX4 HVO_RS06375, HVO_0347 DNA-directed RNA polymerase subunit B'' 61.90 34.5 3.79E-02 0.09 D4GP52 HVO_RS00240, HVO_B0050 cobaltochelatase subunit CobN 55.24 53.25 2.47E-02 0.08 D4GYI5 HVO_RS12100, HVO_1541 glycerol kinase 62.50 33 4.27E-02 -0.08

180

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GVX2 HVO_RS15545, HVO_2256 hypothetical protein 64.45 32.25 3.70E-02 -0.08 D4H0D3 HVO_RS19465, HVO_C0045 HNH endonuclease 7.03 1.5 2.21E-02 -0.09 D4GZ00 HVO_RS12245, HVO_1571 DNA topoisomerase VI subunit B 64.66 45.75 2.21E-02 -0.09 D4GPB9 HVO_RS00570, HVO_B0118 SMC-like protein Sph2 57.30 39 7.30E-04 -0.11 Q9HHA2 HVO_RS08430, HVO_0778 thermosome subunit 3 70.61 31.5 2.02E-02 -0.12 D4GUW2 HVO_RS17425, HVO_2636 phage shock protein A 68.30 19.25 2.47E-02 -0.12 D4GUU7 HVO_RS08920, HVO_0880 phosphoserine phosphatase 76.38 36.75 2.83E-04 -0.12 D4GTF0 HVO_RS13905, HVO_1921 serine--tRNA ligase 78.37 38 7.58E-03 -0.13 D4GZX6 HVO_RS06385, HVO_0349 DNA-directed RNA polymerase subunit A' 56.25 47 1.28E-03 -0.13 D4GYV5 HVO_RS05220, HVO_0109 cysteine desulfurase 35.38 13.5 2.68E-02 -0.13 D4GW69 HVO_RS10095, HVO_1123 thioredoxin reductase 58.24 15 3.98E-02 -0.13 D4GS55 HVO_RS07215, HVO_0519 replication protein A 49.64 21.5 7.78E-03 -0.13 D4GZP8 HVO_RS12795, HVO_1684 threonine--tRNA ligase 60.96 37.25 1.44E-02 -0.14 D4GZS9 HVO_RS06150, HVO_0300 radical SAM protein 24.55 6.75 4.21E-02 -0.14 D4GTX5 HVO_RS16975, HVO_2543 50S ribosomal protein L30 66.56 8 1.53E-02 -0.15 type I restriction-modification system restriction D4GVY5 HVO_RS15605, HVO_2269 41.05 28.75 8.45E-03 -0.15 subunit D4GQK9 HVO_RS02675, HVO_A0180 hypothetical protein 34.87 15.75 3.50E-02 -0.16 D4GZ02 HVO_RS12255, HVO_1573 DNA gyrase subunit A 44.20 36.25 3.63E-04 -0.16 D4H080 HVO_RS13080, HVO_1741 hypothetical protein 43.75 12.5 1.51E-02 -0.17 Q1XBW3 HVO_RS12355, HVO_1592 nucleotide exchange factor GrpE 59.63 15 5.47E-03 -0.17 D4GPF6 HVO_RS00760, HVO_B0154 11-domain light and oxygen sensing his kinase 37.59 32.5 5.92E-03 -0.17 D4H049 HVO_RS12895, HVO_1704 hypothetical protein 34.16 10.25 4.94E-03 -0.17 D4GWT5 HVO_RS18045, HVO_2761 mevalonate kinase 57.97 13 4.11E-02 -0.17 D4GSX4 HVO_RS13680, HVO_1871 Chlorite dismutase 34.23 17 5.17E-03 -0.17 2,3-bisphosphoglycerate-independent D4GTU8 HVO_RS16840, HVO_2516 43.82 17.75 2.82E-04 -0.18 phosphoglycerate mutase D4GW86 HVO_RS10150, HVO_1134 hypothetical protein 48.05 27.25 3.26E-03 -0.19 D4GXN9 HVO_RS11225, HVO_1354 DNA mismatch repair protein 30.04 11.75 2.52E-02 -0.19 Q9P9L2 HVO_RS19255, HVO_3007 malate dehydrogenase 58.39 15 7.50E-03 -0.19 HVO_RS02320, 3-hydroxybutyryl-CoA dehydrogenase / Acyl- L9UXM8 34.81 14.5 1.92E-02 -0.20 HVO_A0097A CoA synthetase D4H048 HVO_RS12890, HVO_1703 ATP-dependent helicase 20.40 11.5 2.68E-02 -0.20 Q48329 HVO_RS06215, HVO_0313 ATP synthase subunit E 79.12 15.75 3.06E-04 -0.20 D4GXS1 HVO_RS11305, HVO_1371 glutamate 5-kinase 35.55 7.5 3.80E-02 -0.20

181

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GY90 HVO_RS11765, HVO_1464 iron ABC transporter substrate-binding protein 40.56 13.75 1.07E-02 -0.20 D4GS73 HVO_RS07305, HVO_0541 aconitate hydratase 43.36 24.5 3.15E-03 -0.20 D4GUK1 HVO_RS08790, HVO_0854 chromosome segregation protein SMC 60.53 55 5.08E-09 -0.21 D4GTH8 HVO_RS14050, HVO_1949 hypothetical protein 38.15 4.25 2.20E-02 -0.21 D4GWS1 HVO_RS10325, HVO_1170 hypothetical protein 21.83 4.75 2.56E-02 -0.21 P25062 HVO_RS14660, HVO_2072 major cell surface glycoprotein 12.06 4.5 5.15E-03 -0.21 D4GXL0 HVO_RS11145, HVO_1338 replication protein A 67.56 20.25 3.25E-03 -0.21 D4GY45 HVO_RS19080, HVO_2972 hypothetical protein 67.28 15.75 3.77E-03 -0.21 D4GQN6 HVO_RS02765, HVO_A0207 type I-B CRISPR-associated Cas7/Csh2 80.96 21.25 3.64E-05 -0.21 D4GXX8 HVO_RS18925, HVO_2941 nonhistone chromosomal protein 71.87 10.75 3.22E-02 -0.22 D4GS45 HVO_RS07160, HVO_0508 hypothetical protein 38.68 4.75 4.15E-02 -0.22 D4GV52 HVO_RS17620, HVO_2675 histidinol dehydrogenase 29.32 6.75 2.03E-02 -0.22 D4GSN2 HVO_RS16395, HVO_2428 alcohol dehydrogenase 26.13 7 2.35E-02 -0.22 D4H018 HVO_RS06590, HVO_0392 hypothetical protein 80.51 7 2.77E-03 -0.22 D4GU97 HVO_RS17205, HVO_2589 asparaginase 55.56 9.75 2.16E-02 -0.22 D4GPH4 HVO_RS00850, HVO_B0173 hypothetical protein 21.45 11.75 1.02E-02 -0.22 D4GUZ3 HVO_RS09080, HVO_0914 glyoxalase 64.00 14.5 2.25E-03 -0.23 D4GZM2 HVO_RS12665, HVO_1657 phosphoribosylamine--glycine ligase 31.19 10.75 2.17E-02 -0.23 D4GT00 HVO_RS07925, HVO_0670 glutathione-dependent reductase 36.73 9.5 3.07E-02 -0.23 D4GZ54 HVO_RS12505, HVO_1625 hypothetical protein 49.66 26 1.38E-03 -0.23 D4GVD8 HVO_RS15310, HVO_2205 NADH dehydrogenase 55.65 10.5 1.23E-02 -0.23 D4GWG4 HVO_RS15765, HVO_2299 agmatinase 33.39 6 3.67E-02 -0.23 D4GWY5 HVO_RS10525, HVO_1212 circadian clock protein KaiC 25.41 5.5 3.14E-02 -0.23 D4GUZ0 HVO_RS09065, HVO_0911 small GTP-binding protein 40.45 12.25 7.61E-03 -0.24 D4GXL3 HVO_RS11155, HVO_1340 glycosyltransferase type 1 41.40 12.25 2.39E-03 -0.24 D4GT30 HVO_RS08015, HVO_0689 chromosome segregation protein SMC 47.76 56.25 1.22E-10 -0.24 D4GS85 HVO_RS13170, HVO_1760 ferrichrome ABC transporter ATP-binding 66.38 14.5 9.79E-04 -0.25 D4H0D0 HVO_RS19450, HVO_C0042 helicase 42.29 43.75 1.95E-06 -0.25 D4GR24 HVO_A0350 Hypothetical protein 39.55 8 2.63E-02 -0.25 D4GSV2 HVO_RS13575, HVO_1849 aminopeptidase 29.62 8.5 6.16E-03 -0.26 D4GU13 HVO_RS17160, HVO_2580 aspartate oxidase 65.50 24.5 2.72E-04 -0.26 D4GYR2 HVO_RS05020, HVO_0067 hypothetical protein 32.63 2.5 1.93E-02 -0.26 D4GV53 HVO_RS17625, HVO_2676 iron-sulfur cluster assembly accessory protein 14.88 1 9.23E-03 -0.27 D4GWU7 HVO_RS10415, HVO_1189 hypothetical protein 57.28 25.5 4.97E-06 -0.27 D4GSG1 HVO_RS07420, HVO_0566 hypothetical protein 24.78 11.75 2.98E-04 -0.27

182

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GPP7 HVO_RS01215, HVO_B0248 oxidoreductase 39.27 7.75 9.10E-03 -0.27 D4GVT1 HVO_RS17750, HVO_2702 carboxylesterase 55.48 9.75 1.11E-02 -0.27 D4GZ43 HVO_RS12460, HVO_1614 hypothetical protein 32.91 2.75 2.25E-02 -0.28 D4GZ13 HVO_RS12315, HVO_1584 N-acetyltransferase 31.61 5 8.16E-04 -0.28 D4H0B6 HVO_RS19400, HVO_C0028 hypothetical protein 20.91 5.25 5.19E-03 -0.28 D4GXS8 HVO_RS18805, HVO_2916 short-chain dehydrogenase 35.62 6.5 8.34E-03 -0.28 D4GVA7 HVO_RS15160, HVO_2174 hypothetical protein 22.91 2.5 3.18E-02 -0.28 D4GY33 HVO_RS19045, HVO_2966 hypothetical protein 28.74 2 4.45E-02 -0.28 D4GU15 HVO_RS17165, HVO_2581 quinolinate synthetase 32.53 11.75 6.98E-04 -0.28 D4GP49 HVO_RS00225, HVO_B0047 iron ABC transporter substrate-binding protein 52.63 18.5 2.38E-06 -0.29 D4GPY0 HVO_RS01600, HVO_B0333 oxidoreductase 17.88 4.75 1.86E-02 -0.29 D4GZE0 HVO_RS05655, HVO_0196 DUF1931 domain-containing protein 48.18 4 1.24E-02 -0.29 D4GVU5 HVO_RS15415, HVO_2229 NAD/FAD-dependent oxidoreductase 41.28 11.75 9.46E-04 -0.29 D4GYC2 HVO_RS19270, HVO_3010 Hef nuclease 37.50 25 1.77E-06 -0.29 two-component system sensor histidine D4GSD5 HVO_RS13395, HVO_1811 20.05 12.75 5.40E-03 -0.29 kinase/response regulator D4GW94 HVO_RS10180, HVO_1140 acyl-CoA dehydrogenase 30.13 7.25 4.43E-02 -0.29 phosphate ABC transporter substrate-binding D4GWM3 HVO_RS16135, HVO_2375 18.04 3.75 2.62E-03 -0.29 protein D4GYW4 HVO_RS05265, HVO_0118 50S ribosomal protein L18a 62.07 3.75 1.01E-02 -0.30 D4GPQ6 HVO_RS01260, HVO_B0259 hypothetical protein 25.69 3.5 3.99E-02 -0.30 D4GUP8 HVO_RS14795, HVO_2101 phosphocarrier protein HPr 9.41 1 1.01E-02 -0.30 Q48330 HVO_RS06220, HVO_0314 ATP synthase subunit C 20.47 5.5 7.29E-05 -0.31 acetoin:2,6-dichlorophenolindophenol D4GSZ9 HVO_RS07920, HVO_0669 20.20 5.5 1.11E-02 -0.31 oxidoreductase subunit alpha twin-arginine translocase TatA/TatE family D4GVK4 HVO_RS09630, HVO_1027 57.50 6.5 1.42E-04 -0.31 subunit D4GYN4 HVO_RS04890, HVO_0039 helicase 21.63 9.75 2.51E-03 -0.31 D4GV58 HVO_RS09255, HVO_0951 hypothetical protein 7.81 2 3.03E-02 -0.32 D4GRN1 HVO_RS04400, HVO_A0570 amidohydrolase 15.08 4.25 1.32E-02 -0.32 D4GXH1 HVO_RS18560, HVO_2866 hypothetical protein 34.09 2.25 2.76E-02 -0.33 D4GWV3 HVO_RS18070, HVO_2766 helicase 10.13 6.5 8.13E-03 -0.33 D4GPE5 HVO_RS00700, HVO_B0144 iron ABC transporter substrate-binding protein 38.53 8.5 1.19E-03 -0.34 D4GX08 HVO_RS10605, HVO_1228 cytochrome Fbr 36.08 18.75 7.98E-09 -0.34

183

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) methylmalonyl Co-A mutase-associated D4GUG7 HVO_RS08690, HVO_0831 22.24 5.25 8.15E-03 -0.34 GTPase MeaB D4GSQ7 HVO_RS07815, HVO_0647 GMP synthase 47.95 4.5 1.03E-03 -0.34 D4GTZ4 HVO_RS17070, HVO_2562 50S ribosomal protein L23 61.04 5 1.27E-04 -0.34 D4GZC8 HVO_RS05595, HVO_0184 CopG family transcriptional regulator 65.09 4 3.15E-02 -0.34 D4GVS3 HVO_RS17730, HVO_2698 hypothetical protein 23.19 6.5 1.27E-04 -0.35 D4GRW6 HVO_RS06740, HVO_0425 glyoxalase 43.37 7.5 1.07E-03 -0.35 D4GV46 HVO_RS17595, HVO_2670 FAD-dependent oxidoreductase 6.03 4.25 4.93E-02 -0.36 A0A1C9J HVO_0379B Uncharacterized protein OS=Haloferax volcanii 31.28 5.25 2.86E-02 -0.36 6T3 D4GXC9 HVO_RS18480, HVO_2849 serine protein kinase PrkA 11.30 5 2.76E-02 -0.37 D4GRZ1 HVO_RS06865, HVO_0450 molecular chaperone Hsp20 50.56 7 1.15E-04 -0.37 D4GZF4 HVO_RS05720, HVO_0209 acyl-CoA dehydrogenase 23.39 5.75 2.86E-03 -0.37 D4GYL2 HVO_RS04785, HVO_0017 hypothetical protein 23.05 4.75 4.80E-03 -0.38 D4GYK5 HVO_RS04745, HVO_0009 L-cysteine desulfhydrase 13.67 4.25 1.52E-02 -0.38 D4GU79 HVO_RS14630, HVO_2066 hypothetical protein 44.78 11 1.76E-04 -0.38 D4GYC1 HVO_RS11850, HVO_1481 universal stress protein UspA 36.66 4 3.71E-04 -0.38 D4GRX2 HVO_RS06770, HVO_0431 haloacid dehalogenase 26.14 4 3.97E-02 -0.38 D4GWE2 HVO_RS15815, HVO_2309 4a-hydroxytetrahydrobiopterin dehydratase 18.41 2 1.04E-03 -0.39 D4GV79 HVO_RS09355, HVO_0972 hypothetical protein 21.53 2.25 6.54E-05 -0.39 D4GYJ9 HVO_RS04720, HVO_0003 DNA polymerase II 21.44 6.5 2.01E-02 -0.40 D4GRL8 HVO_RS04330, HVO_A0557 iron ABC transporter substrate-binding protein 13.42 4 3.08E-02 -0.42 D4GXI1 HVO_RS18580, HVO_2871 aspartate aminotransferase family protein 12.94 3.75 4.64E-03 -0.43 D4GP47 HVO_RS00215, HVO_B0045 2,4-diaminobutyrate decarboxylase 49.18 21.75 3.58E-08 -0.43 D4GXR6 HVO_RS11290, HVO_1368 MBL fold metallo-hydrolase 12.45 2.5 7.98E-06 -0.45 D4GUG2 HVO_RS17360, HVO_2622 aldehyde oxidoreductase 32.71 5.5 2.79E-02 -0.45 D4GP48 HVO_RS00220, HVO_B0046 diaminobutyrate--2-oxoglutarate transaminase 57.79 15.25 1.05E-07 -0.45 D4GQF0 HVO_RS02405, HVO_A0118 PadR family transcriptional regulator 32.98 1.5 3.54E-02 -0.45 Q1XBW0 HVO_RS12335, HVO_1588 cupin 16.04 1 3.02E-05 -0.45 D4GP44 HVO_RS00200, HVO_B0042 lysine 6-monooxygenase 47.48 15.5 5.28E-06 -0.46 D4GUX0 HVO_RS17445, HVO_2640 hypothetical protein 21.28 6.25 2.86E-07 -0.46 D4GX51 HVO_RS10705, HVO_1248 hypothetical protein 16.67 1.5 3.94E-02 -0.46 D4GSC1 HVO_RS13330, HVO_1797 MBL fold metallo-hydrolase 14.15 4.75 2.57E-04 -0.47 D4GQT5 HVO_RS02980, HVO_A0256 hypothetical protein 32.01 3 2.86E-02 -0.48 D4GXM9 HVO_RS18695, HVO_2893 hypothetical protein 19.47 1.5 2.74E-02 -0.49

184

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4H057 HVO_RS12935, HVO_1712 cyclase 36.34 3.25 1.43E-02 -0.50 D4GQY6 HVO_A0308 hypothetical protein 29.80 2.75 3.05E-03 -0.50 D4GP46 HVO_RS00210, HVO_B0044 iron transporter 57.00 22.5 1.41E-12 -0.51 D4GVV5 HVO_RS15465, HVO_2239 universal stress protein UspA 12.68 1 2.98E-05 -0.51 D4GP43 HVO_RS00195, HVO_B0041 iron transporter 63.03 38.25 1.28E-18 -0.52 D4GPF1 HVO_RS00725, HVO_B0150 ABC transporter substrate-binding protein 23.21 5.25 2.51E-03 -0.52 D4GSR1 HVO_RS07830, HVO_0651 prefoldin subunit beta 29.72 2 5.08E-03 -0.52 D4GRS0 HVO_RS04590, HVO_A0611 ABC transporter substrate-binding protein 25.07 4.5 5.95E-03 -0.53 D4GQ77 HVO_RS02075, HVO_A0045 HtpX-like protease 11.86 2 1.54E-02 -0.54 D4GX80 HVO_RS10785, HVO_1265 AsnC family transcriptional regulator 31.83 3.75 3.54E-04 -0.54 D4GVF1 HVO_RS09365, HVO_0974 6,7-dimethyl-8-ribityllumazine synthase 36.38 2.5 6.58E-03 -0.55 D4GU27 HVO_RS14375, HVO_2014 hypothetical protein 20.91 1.5 3.19E-02 -0.55 D4GX70 HVO_RS10760, HVO_1260 VWA domain-containing protein 7.42 4.33 1.89E-02 -0.55 D4GX23 HVO_RS18240, HVO_2800 ABC transporter ATP-binding protein 8.50 1.75 1.56E-02 -0.55 D4GRD5 HVO_RS03935, HVO_A0470 diguanylate cyclase 19.69 3.75 1.87E-03 -0.56 D4GP45 HVO_RS00205, HVO_B0043 N-acetyltransferase 44.01 6.5 9.11E-04 -0.56 D4GVB6 HVO_RS15205, HVO_2183 aldehyde ferredoxin oxidoreductase 14.70 6.25 4.29E-06 -0.57 D4GX56 HVO_RS18315, HVO_2815 3-hydroxyacyl-CoA dehydrogenase 4.34 1.33 3.59E-02 -0.58 D4GRP3 HVO_RS04460, HVO_A0583 IclR family transcriptional regulator 29.98 5.5 2.73E-04 -0.58 D4GYV1 HVO_RS05200, HVO_0105 pyridine nucleotide-disulfide oxidoreductase 26.64 7.5 6.23E-03 -0.59 D4GWU6 HVO_RS10410, HVO_1188 hypothetical protein 18.57 1.25 9.30E-04 -0.59 D4GRU1 HVO_RS04685, HVO_A0633 flagellin 10.96 1 1.52E-04 -0.60 D4GTQ1 HVO_0758 hypothetical protein 51.34 4.5 6.01E-03 -0.60 D4GXN8 HVO_RS18715, HVO_2897 hypothetical protein 17.99 1.75 3.23E-02 -0.61 D4GXW7 HVO_RS11430, HVO_1397 two-component sensor histidine kinase 8.46 2 8.55E-04 -0.61 D4GPE1 HVO_RS00680, HVO_B0140 PQQ repeat protein 2.29 1 3.61E-02 -0.61 D4GXH3 HVO_RS11050, HVO_1318 AAC(3) family N-acetyltransferase 14.68 1.33 2.81E-02 -0.63 D4GU20 HVO_RS17180, HVO_2584 hypothetical protein 48.88 8.5 3.67E-05 -0.64 D4GTG4 HVO_RS13975, HVO_1935 phosphoesterase 27.03 2.33 1.81E-02 -0.67 D4GS70 HVO_RS07290, HVO_0538 iron-dependent repressor 28.13 2.5 3.97E-02 -0.67 D4H090 HVO_RS13125, HVO_1751 copper-translocating P-type ATPase 14.95 10.25 8.29E-06 -0.68 D4GR81 HVO_RS03705, HVO_A0417 hypothetical protein 49.51 1.5 1.93E-03 -0.68 nicotinate-nucleotide diphosphorylase D4GU12 HVO_RS17155, HVO_2579 23.51 4.5 5.52E-06 -0.71 (carboxylating) D4GVI8 HVO_RS09550, HVO_1011 hypothetical protein 33.77 2 5.97E-05 -0.71

185

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GQ40 HVO_RS01900, HVO_A0008 transposase 8.56 3.5 4.78E-06 -0.71 D4GPU7 HVO_RS01450, HVO_B0300 urate oxidase 14.77 2.75 4.39E-02 -0.71 D4GWD1 HVO_RS10300, HVO_1165 mechanosensitive ion channel protein 6.87 1.5 4.45E-02 -0.73 D4GY48 HVO_RS19090, HVO_2974 cupin 26.19 3.25 1.30E-03 -0.73 D4GXJ8 HVO_RS11110, HVO_1331 transcriptional regulator 13.53 1 5.06E-03 -0.75 D4GW91 HVO_RS10165, HVO_1137 metal transporter 2.42 1 1.16E-02 -0.76 D4GST3 HVO_RS13465, HVO_1825 hypothetical protein 53.52 3.5 6.66E-05 -0.76 D4GTH4 HVO_RS14030, HVO_1945 Uncharacterized protein 11.96 2.67 2.39E-02 -0.77 D4GXX5 HVO_RS11465, HVO_1403 acylphosphatase 17.55 1.5 1.19E-02 -0.78 D4GXJ9 HVO_RS11115, HVO_1332 hypothetical protein 28.29 2.5 9.49E-04 -0.79 D4GU33 HVO_RS14410, HVO_2020 hypothetical protein 7.12 1.33 3.41E-02 -0.79 D4GY64 HVO_RS19130, HVO_2982 hypothetical protein 46.27 2.25 1.16E-03 -0.80 D4GUF9 HVO_RS08670, HVO_0827 hypothetical protein 27.94 1.25 9.95E-03 -0.80 D4GVV0 HVO_RS15440, HVO_2234 peptide-methionine (R)-S-oxide reductase 17.11 2.75 2.12E-02 -0.81 D4GRX6 HVO_RS06790, HVO_0435 phosphoribosyl-ATP diphosphatase 16.50 1.25 4.00E-02 -0.84 D4GS78 HVO_RS13135, HVO_1753 heavy metal transporter 52.31 2.75 4.45E-05 -0.87 D4H0A3 HVO_RS19345, HVO_C0012 hypothetical protein 11.32 1 3.80E-05 -0.88 D4GZ26 HVO_RS12380, HVO_1597 hypothetical protein 20.00 2.25 5.40E-06 -0.90 D4GT84 HVO_RS08160, HVO_0720 hypothetical protein 30.00 2 7.97E-07 -0.93 D4GSP0 HVO_RS07760, HVO_0635 hypothetical protein 14.45 2.25 2.70E-02 -0.93 D4GSD2 HVO_RS13380, HVO_1808 hypothetical protein 3.57 1 4.16E-03 -0.99 D4H0F8 HVO_RS19590, HVO_C0076 ArcR family transcriptional regulator 12.36 2.5 6.05E-05 -1.01 L9V9K4 HVO_RS14590 hypothetical protein 29.24 1.25 9.99E-03 -1.02 D4GXB9 HVO_RS10890, HVO_1287 protease 29.55 2.75 4.80E-03 -1.03 D4GWK8 HVO_RS16060, HVO_2360 LD-carboxypeptidase 7.35 1.5 4.34E-02 -1.11 D4GTM0 HVO_RS14265, HVO_1992 cold shock protein 10.94 1 1.08E-02 -1.12 D4GY43 HVO_RS19075, HVO_2971 hypothetical protein 32.05 1.5 3.66E-02 -1.13 D4H005 HVO_RS06525, HVO_0379 integrase 28.35 2 5.81E-03 -1.14 D4GRE2 HVO_RS03970, HVO_A0477 phosphate ABC transporter substrate-binding 14.20 3 1.10E-02 -1.18 D4GU98 HVO_RS17210, HVO_2590 short-chain dehydrogenase 21.54 3.33 3.25E-02 -1.19 light- and oxygen-sensing transcription D4GTU1 HVO_RS16805, HVO_2509 4.25 1 2.80E-02 -1.20 regulator D4GQ08 HVO_RS01745, HVO_B0361 transcriptional regulator 12.68 1.75 1.55E-06 -1.26 D4GUR5 HVO_RS14880, HVO_2118 sugar ABC transporter ATP-binding protein 6.40 2 1.86E-03 -1.27 D4GQW3 HVO_RS03120, HVO_A0286 hypothetical protein 7.98 1.75 9.63E-03 -1.28

186

Table A-2. Continued Mean Mean Log2 Accession Gene Numbers Description Coverage Unique P-value (treatment (%) Peptides /control) D4GYF8 HVO_RS11990, HVO_1512 hypothetical protein 12.11 1 1.63E-02 -1.34 D4GYQ6 HVO_RS04995, HVO_0061 peptide ABC transporter permease 1.72 1 2.42E-02 -1.43 D4GS81 HVO_RS13150, HVO_1756 N-acetyltransferase 8.53 1 6.73E-03 -1.63 D4GXP8 HVO_RS11250, HVO_1359 hypothetical protein 22.55 1.67 2.05E-10 -2.42 Differentially expressed proteins (p <0.05) was represented by at least 2 unique peptides

187

LIST OF REFERENCES

1. Allers T, Ngo HP, Mevarech M, Lloyd RG. 2004. Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl Environ Microbiol 70:943-53.

2. Wendoloski D, Ferrer C, Dyall-Smith ML. 2001. A new simvastatin (mevinolin)- resistance marker from Haloarcula hispanica and a new Haloferax volcanii strain cured of plasmid pHV2. Microbiology 147:959-64.

3. Oren A. 2002. Halophilic microorganisms and their environments. Kluwer Academic, Dordrecht ; Boston.

4. Stan-Lotter H, Fendrihan S. 2015. Halophilic archaea: Life with desiccation, radiation and oligotrophy over geological times. Life 5:1487-1496.

5. Oren A. 2002. Molecular ecology of extremely halophilic Archaea and Bacteria. FEMS Microbiol Ecol 39:1-7.

6. Oren A. 2010. Industrial and environmental applications of halophilic microorganisms. Environ Technol 31:825-34.

7. Oren A. 2005. A hundred years of Dunaliella research: 1905-2005. Saline Syst 1:2.

8. Tsai CF, Lu FJ, Hsu YW. 2012. Protective effects of Dunaliella salina – a carotenoids-rich alga – against ultraviolet B-induced corneal oxidative damage in mice, p 1540-7, Mol Vis, vol 18.

9. Anton J, Oren A, Benlloch S, Rodriguez-Valera F, Amann R, Rossello-Mora R. 2002. Salinibacter ruber gen. nov., sp. nov., a novel, extremely halophilic member of the Bacteria from saltern crystallizer ponds. Int J Syst Evol Microbiol 52:485-91.

10. DeMaere MZ, Williams TJ, Allen MA, Brown MV, Gibson JAE, Rich J, Lauro FM, Dyall-Smith M, Davenport KW, Woyke T, Kyrpides NC, Tringe SG, Cavicchioli R. 2013. High level of intergenera gene exchange shapes the evolution of haloarchaea in an isolated Antarctic lake. Proc Natl Aca Sci U S A 110:16939- 16944.

11. Leigh JA, Albers SV, Atomi H, Allers T. 2011. Model organisms for genetics in the domain Archaea: methanogens, halophiles, Thermococcales and Sulfolobales. FEMS Microbiol Rev 35:577-608.

12. Lopez-Garcia P, St Jean A, Amils R, Charlebois RL. 1995. Genomic stability in the archaeae Haloferax volcanii and Haloferax mediterranei. J Bacteriol 177:1405-8.

188

13. Oren A. 2008. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. Saline Syst 4:2-2.

14. Pérez-Fillol M, Rodríguez-Valera F. 1986. Potassium ion accumulation in cells of different halobacteria. Microbiologica SEM 2:73-80.

15. Hartman AL, Norais C, Badger JH, Delmas S, Haldenby S, Madupu R, Robinson J, Khouri H, Ren Q, Lowe TM, Maupin-Furlow J, Pohlschroder M, Daniels C, Pfeiffer F, Allers T, Eisen JA. 2010. The complete genome sequence of Haloferax volcanii DS2, a model archaeon. PLoS One 5:e9605.

16. Kozlowski L. 2017. Proteome-pI: proteome isoelectric point database. Nucleic Acids Res 45:D1112-D1116.

17. Mevarech M, Frolow F, Gloss LM. 2000. Halophilic enzymes: proteins with a grain of salt. Biophys Chem 86:155-64.

18. Li X, Yu HY. 2014. Characterization of an organic solvent-tolerant lipase from Haloarcula sp. G41 and its application for biodiesel production. Folia Microbiol (Praha) 59:455-63.

19. McMillan LJ, Hepowit NL, Maupin-Furlow JA. 2015. Archaeal inorganic pyrophosphatase displays robust activity under high-salt conditions and in organic solvents. Appl Environ Microbiol 82:538-48.

20. Zerulla K, Chimileski S, Nather D, Gophna U, Papke RT, Soppa J. 2014. DNA as a phosphate storage polymer and the alternative advantages of polyploidy for growth or survival. PLoS One 9:e94819.

21. Breuert S, Allers T, Spohn G, Soppa J. 2006. Regulated polyploidy in halophilic archaea. PLoS One 1:e92.

22. Oren A. 1991. Anaerobic growth of halophilic archaeobacteria by reduction of fumarate. J Gen Microbiol 137:1387-90.

23. Hattori T, Shiba H, Ashiki K, Araki T, Nagashima Y, Yoshimatsu K, Fujiwara T. 2016. Anaerobic growth of haloarchaeon Haloferax volcanii by denitrification is controlled by the transcription regulator NarO. J Bacteriol 198:1077-86.

24. Trigui H, Masmoudi S, Brochier-Armanet C, Maalej S, Dukan S. 2011. Survival of extremely and moderately halophilic isolates of Tunisian solar salterns after UV-B or oxidative stress. Can J Microbiol 57:923-933.

25. Riley PA. 1994. Free radicals in biology: oxidative stress and the effects of ionizing radiation. Int J Radiat Biol 65:27-33.

189

26. Cooper W, Zika R, Petasne R, Plane J. 1988. Photochemical formation of hydrogen peroxide in natural waters exposed to sunlight. Environ S & T 22:1156- 1160.

27. Baliga NS, Bjork SJ, Bonneau R, Pan M, Iloanusi C, Kottemann MCH, Hood L, DiRuggiero J. 2004. Systems level insights into the stress response to UV radiation in the halophilic archaeon Halobacterium NRC-1. Genome Res 14:1025-35.

28. Mohan, A, Pohlman F, Hunt M. 2011. Inactivation of E. coli cells at low dose rates of gamma radiation. Department of Animal Science, University of Arkansas, Fayetteville, AR.

29. Kaur A, Van PT, Busch CR, Robinson CK, Pan M, Pang WL, Reiss DJ, DiRuggiero J, Baliga NS. 2010. Coordination of frontline defense mechanisms under severe oxidative stress. Mol Syst Biol 6:393.

30. Nelson DL, Lehninger AL, Cox MM. 2013. Lehninger Principles of Biochemistry, 6th ed. W.H. Freeman, New York.

31. Gribaldo S PA, Daubin V, Forterre P, Brochier-Armanet C. 2010. The origin of eukaryotes and their relationship with the Archaea: are we at a phylogenomic impasse? Nat Rev Microbiol 8:743-752.

32. Humbard MA, Miranda HV, Lim JM, Krause DJ, Pritz JR, Zhou G, Chen S, Wells L, Maupin-Furlow JA. 2010. Ubiquitin-like small archaeal modifier proteins (SAMPs) in Haloferax volcanii. Nature 463:54-60.

33. Miranda HV, Antelmann H, Hepowit N, Chavarria NE, Krause DJ, Pritz JR, Basell K, Becher D, Humbard MA, Brocchieri L, Maupin-Furlow JA. 2014. Archaeal ubiquitin-like SAMP3 is isopeptide-linked to proteins via a UbaA-dependent mechanism. Mol Cell Proteomics 13:220-39.

34. Hepowit NL, Uthandi S, Miranda HV, Toniutti M, Prunetti L, Olivarez O, De Vera IM, Fanucci GE, Chen S, Maupin-Furlow JA. 2012. Archaeal JAB1/MPN/MOV34 metalloenzyme (HvJAMM1) cleaves ubiquitin-like small archaeal modifier proteins (SAMPs) from protein-conjugates. Mol Microbiol 86:971-87.

35. Miranda HV, Nembhard N, Su D, Hepowit N, Krause DJ, Pritz JR, Phillips C, Soll D, Maupin-Furlow JA. 2011. E1- and ubiquitin-like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proc Natl Acad Sci U S A 108:4417-22.

36. Dantuluri S, Wu Y, Hepowit NL, Chen H, Chen S, Maupin-Furlow JA. 2016. Proteome targets of ubiquitin-like samp1ylation are associated with sulfur metabolism and oxidative stress in Haloferax volcanii. Proteomics 16:1100-1110.

190

37. Fu X, Liu R, Sanchez I, Silva-Sanchez C, Hepowit NL, Cao S, Chen S, Maupin- Furlow J. 2016. Ubiquitin-like proteasome system represents a eukaryotic-like pathway for targeted proteolysis in archaea. MBio 7:e00379-16.

38. Ezraty B, Gennaris A, Barras F, Collet JF. 2017. Oxidative stress, protein damage and repair in bacteria. Nat Rev Microbiol. in press.

39. Augusto O, Miyamoto S. 2011. Oxygen Radicals and Related Species, p 19-42. In Pantopoulos K, Schipper HM (ed), Principles of Free Radical Biomedicine, vol 1. Nova Science Publishers, Inc.

40. Flannagan RS, Heit B, Heinrichs DE. 2015. Antimicrobial Mechanisms of Macrophages and the Immune Evasion Strategies of Staphylococcus aureus. Pathogens 4:826-68.

41. Hebrard M, Viala JP, Meresse S, Barras F, Aussel L. 2009. Redundant hydrogen peroxide scavengers contribute to Salmonella virulence and oxidative stress resistance. J Bacteriol 191:4605-14.

42. Cabiscol E, Tamarit J, Ros J. 2000. Oxidative stress in bacteria and protein damage by reactive oxygen species. Int Microbiol 3:3-8.

43. Pratt DA, Tallman KA, Porter NA. 2011. Free radical oxidation of polyunsaturated lipids: new mechanistic insights and the development of peroxyl radical clocks. Acc Chem Res 44:458-67.

44. Hidalgo E, Ding H, Demple B. 1997. Redox signal transduction via iron-sulfur clusters in the SoxR transcription activator. Trends Biochem Sci 22:207-10.

45. Greenberg JT, Monach P, Chou JH, Josephy PD, Demple B. 1990. Positive control of a global antioxidant defense regulon activated by superoxide- generating agents in Escherichia coli. Proc Natl Acad Sci U S A 87:6181-5.

46. Malki L, Yanku M, Borovok I, Cohen G, Mevarech M, Aharonowitz Y. 2009. Identification and characterization of gshA, a gene encoding the glutamate- cysteine ligase in the halophilic archaeon Haloferax volcanii, p 5196-204, J Bacteriol, vol 191.

47. Collet JF, Messens J. 2010. Structure, function, and mechanism of thioredoxin proteins. Antioxid Redox Signal 13:1205-16.

48. McCord JM, Fridovich I. 1969. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem 244:6049-55.

49. Flint DH, Tuminello JF, Emptage MH. 1993. The inactivation of Fe-S cluster containing hydro-lyases by superoxide. J Biol Chem 268:22369-76.

191

50. Alfonso-Prieto M, Biarnes X, Vidossich P, Rovira C. 2009. The molecular mechanism of the catalase reaction. J Am Chem Soc 131:11751-61.

51. Jia B, Liu J, Van Duyet L, Sun Y, Xuan YH, Cheong GW. 2015. Proteome profiling of heat, oxidative, and salt stress responses in Thermococcus kodakarensis KOD1. Front Microbiol 6:605.

52. Whitehead K, Kish A, Pan M, Kaur A, Reiss DJ, King N, Hohmann L, DiRuggiero J, Baliga NS. 2006. An integrated systems approach for understanding cellular responses to gamma radiation. Mol Syst Biol 2:47.

53. Williams E, Lowe TM, Savas J, DiRuggiero J. 2007. Microarray analysis of the hyperthermophilic archaeon Pyrococcus furiosus exposed to gamma irradiation. Extremophiles 11:19-29.

54. Maaty WS, Wiedenheft B, Tarlykov P, Schaff N, Heinemann J, Robison-Cox J, Valenzuela J, Dougherty A, Blum P, Lawrence CM, Douglas T, Young MJ, Bothner B. 2009. Something old, something new, something borrowed; how the thermoacidophilic archaeon Sulfolobus solfataricus responds to oxidative stress. PLoS One 4:e6964.

55. Cox J, Mann M. 2011. Quantitative, high-resolution proteomics for data-driven systems biology. Annu Rev Biochem 80:273-99.

56. Lindemann C, Thomanek N, Hundt F, Lerari T, Meyer H, Wolters D, Marcus K. 2017. Strategies in relative and absolute quantitative mass spectrometry based proteomics. Biol Chem 398:687-699.

57. Gundry RL, White MY, Murray CI, Kane LA, Fu Q, Stanley BA, Van Eyk JE. 2009. Preparation of Proteins and Peptides for Mass Spectrometry Analysis in a Bottom-Up Proteomics Workflow. Curr Protoc Mol Biol Chapter 10.25.

58. Chandramouli K, Qian PY. 2009. Proteomics: Challenges, techniques and possibilities to overcome biological sample complexity. Hum Genomics Proteomics 2009:1-22.

59. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-5.

60. Rabilloud T, Lelong C. 2011. Two-dimensional gel electrophoresis in proteomics: A tutorial - ScienceDirect. Journal of Proteomics 74:1829-1841.

61. Wingfield PT. 2001. Protein Precipitation Using Ammonium Sulfate. Current protocols in protein science. Appendix-3F.

62. Olsen JV, Ong SE, Mann M. 2004. Trypsin cleaves exclusively C-terminal to arginine and lysine residues. Mol Cell Proteomics 3:608-14.

192

63. Jiang X, Shamshurin D, Spicer V, Krokhin OV. 2013. The effect of various S- alkylating agents on the chromatographic behavior of cysteine-containing peptides in reversed-phase chromatography. J Chromatogr B Analyt Technol Biomed Life Sci 915-916:57-63.

64. Armentrout PB, Bohme DK, M.T. B, Bronstrup M, Junker T, Petrie S, Plattner DA, Siuzdak D, Schroder D, Schwarz H, Trauger SA, Turecek F, Uggerud E, T. W. 2003. Topics in Current Chemistry: Modern Mass Spectrometry. Springer, Berlin.

65. Banerjee S, Mazumdar S. 2012. Electrospray ionization mass spectrometry: a technique to access the information beyond the molecular weight of the analyte. Int J Anal Chem 2012:282574.

66. Wong SF, Meng CK, Fenn JB. 1988. Multiple charging in electrospray ionization of poly(ethylene glycols). J Phys Chem 92:546-550.

67. Meng CK, Mann M, Fenn JB. 1988. Of protons or proteins. Z Phys D At: Mol Clusters 10:361-368.

68. Tanaka K, Waki H, Ido Y, Akita S, Yoshida Y, Yoshida T, Matsuo T. 1988. Protein and polymer analyses up to m/z 100 000 by laser ionization time‐of‐flight mass spectrometry. Rapid Comm Mass Spectrom 2:151-153.

69. Karas M, Glückmann M, Schäfer J. 2000. Ionization in matrix-assisted laser desorption/ionization: singly charged molecular ions are the lucky survivors. J Mass Spectrom 35:1-12.

70. Vidova V, Spacil Z. 2017. A review on mass spectrometry-based quantitative proteomics: Targeted and data independent acquisition. Anal Chim Acta 964:7- 23.

71. Boesl U. 2017. Time‐of‐flight mass spectrometry: Introduction to the basics. Mass Spectrom Rev 36:86-109.

72. Hu Q, Noll RJ, Li H, Makarov A, Hardman M, Graham Cooks R. 2005. The Orbitrap: a new mass spectrometer. J Mass Spectrom 40:430-43.

73. Makarov A. 2000. Electrostatic axially harmonic orbital trapping: A high- performance technique of mass analysis. Anal Chem 72:1156-1162.

74. Makarov A, Denisov E, Lange O, Horning S. 2006. Dynamic range of mass accuracy in LTQ Orbitrap hybrid mass spectrometer. J Am Soc Mass Spectrom 17:977-82.

75. Keifer DZ, Jarrold MF. 2016. Single‐molecule mass spectrometry. Mass Spectrom Rev. in press.

193

76. Li Q, Xia Q, Wang T, Meila M, Hackett M. 2006. Analysis of the stochastic variation in LTQ single scan mass spectra. Rapid Commun Mass Spectrom 20:1551-7.

77. Medzihradszky KF, Chalkley RJ. 2013. Lessons in de novo peptide sequencing by tandem mass spectrometry. Mass Spectrom Rev 34:43-63.

78. Wells JM, McLuckey SA. 2005. Collision-induced dissociation (CID) of peptides and proteins. Methods Enzymol 402:148-85.

79. Nesvizhskii AI. 2007. Protein identification by tandem mass spectrometry and sequence database searching. Methods Mol Biol 367:87-119.

80. Bantscheff M, Lemeer S, Savitski MM, Kuster B. 2012. Quantitative mass spectrometry in proteomics: critical review update from 2007 to the present. Anal Bioanal Chem 404:939-65.

81. Asara JM, Christofk HR, Freimark LM, Cantley LC. 2008. A label‐free quantification method by MS/MS TIC compared to SILAC and spectral counting in a proteomics screen. Proteomics 8:994-999.

82. Sun W, Wu S, Wang X, Zheng D, Gao Y. 2005. An analysis of protein abundance suppression in data dependent liquid chromatography and tandem mass spectrometry with tryptic peptide mixtures of five known proteins. Eur J Mass Spectrom 11:575-580.

83. Ong SE, Blagoev B, Kratchmarova I, Kristensen DB, Steen H, Pandey A, Mann M. 2002. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol Cell Proteomics 1:376-86.

84. Scott L, Lamb J, Smith S, Wheatley DN. 2000. Single amino acid (arginine) deprivation: rapid and selective death of cultured transformed and malignant cells. Br J Cancer 83:800-10.

85. Butter F, Bucerius F, Michel M, Cicova Z, Mann M, Janzen CJ. 2013. Comparative proteomics of two life cycle stages of stable isotope-labeled Trypanosoma brucei reveals novel components of the parasite's host adaptation machinery. Mol Cell Proteomics 12:172-179.

86. Ong S-E, Kratchmarova I, Mann M. 2003. Properties of 13C-Substituted Arginine in Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC). J Proteome Res 2:173-181.

87. Bicho CC, de Lima Alves F, Chen ZA, Rappsilber J, Sawin KE. 2010. A genetic engineering solution to the "arginine conversion problem" in stable isotope labeling by amino acids in cell culture (SILAC). Mol Cell Proteomics 9:1567-77.

194

88. Ong SE, Mann M. 2006. A practical recipe for stable isotope labeling by amino acids in cell culture (SILAC). Nat Protoc 1:2650-60.

89. Iyer S, Zhang Z, Kellogg G, Karnes H. 2004. Evaluation of deuterium isotope effects in normal-phase LC-MS-MS separations using a molecular modeling approach. J Chromatog Sci 42:383-7.

90. Geiger T, Cox J, Ostasiewicz P, Wisniewski JR, Mann M. 2010. Super-SILAC mix for quantitative proteomics of human tumor tissue. Nat Meth 7:383-385.

91. Zieske LR. 2006. A perspective on the use of iTRAQ reagent technology for protein complex and profiling studies. J Exp Bot 57:1501-1508.

92. Rauniyar N, Yates JR. 2014. Isobaric labeling-based relative quantification in shotgun proteomics. J Proteome Res 13:5293-309.

93. Gerber S RJ, Stemman O, Kirschner M, Gygi S. 2003. Absolute quantification of proteins and phosphoproteins from cell lysates by tandem MS. Proc Nat Aca Sci U S A 100:6940-5.

94. Picotti P BB, Aebersold R. 2012. Proteomics meets the scientific method. Nat Meth 10:24-27.

95. Bisson N, James DA, Ivosev G, Tate SA, Bonner R, Taylor L, Pawson T. 2011. Selected reaction monitoring mass spectrometry reveals the dynamics of signaling through the GRB2 adaptor. Nat Biotechnol 29:653-8.

96. Addona TA, Abbatiello SE, Schilling B, Skates SJ, Mani DR, Bunk DM, Spiegelman CH, Zimmerman LJ, Ham AJ, Keshishian H, Hall SC, Allen S, Blackman RK, Borchers CH, Buck C, Cardasis HL, Cusack MP, Dodder NG, Gibson BW, Held JM, Hiltke T, Jackson A, Johansen EB, Kinsinger CR, Li J, Mesri M, Neubert TA, Niles RK, Pulsipher TC, Ransohoff D, Rodriguez H, Rudnick PA, Smith D, Tabb DL, Tegeler TJ, Variyath AM, Vega-Montoto LJ, Wahlander A, Waldemarson S, Wang M, Whiteaker JR, Zhao L, Anderson NL, Fisher SJ, Liebler DC, Paulovich AG, Regnier FE, Tempst P, Carr SA. 2009. Multi-site assessment of the precision and reproducibility of multiple reaction monitoring-based measurements of proteins in plasma. Nat Biotechnol 27:633- 41.

97. Picotti P, Bodenmiller B, Mueller LN, Domon B, Aebersold R. 2009. Full dynamic range proteome analysis of S. cerevisiae by targeted proteomics. Cell 138:795- 806.

98. MacGillivray AJ, Rickwood D. 1974. The heterogeneity of mouse-chromatin nonhistone proteins as evidenced by two-dimensional polyacrylamide-gel electrophoresis and ion-exchange chromatography. Eur J Biochem 41:181-90.

195

99. O'Farrell PH. 1975. High resolution two-dimensional electrophoresis of proteins. J Biol Chem 250:4007-21.

100. Gronow M, Griffiths G. 1971. Rapid isolation and separation of the non-histone proteins of rat liver nuclei. FEBS Lett 15:340-344.

101. Unlu M, Morgan ME, Minden JS. 1997. Difference gel electrophoresis: a single gel method for detecting changes in protein extracts. Electrophoresis 18:2071-7.

102. Kirkland PA, Humbard MA, Daniels CJ, Maupin-Furlow JA. 2008. Shotgun proteomics of the haloarchaeon Haloferax volcanii. J Proteome Res 7:5033-9.

103. Burg D, Ng C, Ting L, Cavicchioli R. 2011. Proteomics of extremophiles. Environ Microbiol 13:1934-55.

104. Pikuta EV, Hoover RB, Tang J. 2007. Microbial extremophiles at the limits of life. Crit Rev Microbiol 33:183-209.

105. Lee HS, Cho, Yona, Kim, Yun‐Jae, Lho, Tae‐Ok, Cha, Sun‐Shin, Lee, Jung‐ Hyun, Kang, Sung Gyun. 2009. A novel inorganic pyrophosphatase in Thermococcus onnurineus NA1. FEMS Microbiol Lett 300:68-74.

106. Tokunaga H, Arakawa T, Tokunaga M. 2008. Engineering of halophilic enzymes: Two acidic amino acid residues at the carboxy-terminal region confer halophilic characteristics to Halomonas and Pseudomonas nucleoside diphosphate kinases, p 1603-10, Protein Sci, vol 17.

107. Madern D, Ebel C, Zaccai G. 2000. Halophilic adaptation of enzymes. Extremophiles 4:91-8.

108. Su M, Ling Y, Yu J, Wu J, Xiao J. 2013. Small proteins: untapped area of potential biological importance. Front Genet 4:286.

109. Klein C, Aivaliotis M, Olsen JV, Falb M, Besir H, Scheffer B, Bisle B, Tebbe A, Konstantinidis K, Siedler F, Pfeiffer F, Mann M, Oesterhelt D. 2007. The low molecular weight proteome of Halobacterium salinarum. J Proteome Res 6:1510- 8.

110. Koonin EV, Wolf YI. 2008. Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world. Nucleic Acids Res 36:6688-719.

111. Qiu W, Pham TK, Zou X, Ow SY, Wright PC. 2017. Natural mutagenesis-enabled global proteomic study of metabolic and carbon source implications in mutant thermoacidophillic archaeon Sulfolobus solfataricus PBL2025. J Proteome Res. in press.

196

112. Cerletti M, Paggi RA, Guevara CR, Poetsch A, De Castro RE. 2015. Global role of the membrane protease LonB in Archaea: Potential protease targets revealed by quantitative proteome analysis of a lonB mutant in Haloferax volcanii. J Proteomics 121:1-14.

113. Williams TJ, Liao Y, Ye J, Kuchel RP, Poljak A, Raftery MJ, Cavicchioli R. 2017. Cold adaptation of the Antarctic haloarchaea Halohasta litchfieldiae and Halorubrum lacusprofundi. Environ Microbiol. in press.

114. Kornberg A. 1962. On the Metabolic Significance of Phosphorolytic and Pyrophosphorolytic Reactions. Horizons in Biochemistry:251-264.

115. Liu B, Bartlam M, Gao R, Zhou W, Pang H, Liu Y, Feng Y, Rao Z. 2004. Crystal structure of the hyperthermophilic inorganic pyrophosphatase from the archaeon Pyrococcus horikoshii. Biophys J 86:420-7.

116. Hughes RC, Coates L, Blakeley MP, Tomanicek SJ, Langan P, Kovalevsky AY, García-Ruiz JM, Ng JD. 2012. Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction. Acta Crystallogr Sect F Struct Biol Cryst Commun 68:1482-7.

117. Leppänen VM, Nummelin H, Hansen T, Lahti R, Schäfer G, Goldman A. 1999. Sulfolobus acidocaldarius inorganic pyrophosphatase: structure, thermostability, and effect of metal ion in an archael pyrophosphatase. Protein Sci 8:1218-31.

118. Oganessyan V, Kurilova SA, Vorobyeva NN, Nazarova TI, Popov AN, Lebedev AA, Avaeva SM, Harutyunyan EH. 1994. X-ray crystallographic studies of recombinant inorganic pyrophosphatase from Escherichia coli. FEBS Lett 348:301-4.

119. Lennox T SB, Sears L, New England Biolabs, Inc. 1999-1-19 1999. Purified thermostable inorganic pyprophosphatase obtainable from thermococcus litoralis patent US 5861296 A.

120. Cunningham PR, Ofengand J. 1990. Use of inorganic pyrophosphatase to improve the yield of in vitro transcription reactions catalyzed by T7 RNA polymerase. Biotechniques 9:713-4.

121. Xiao M, Phong A, Lum KL, Greene RA, Buzby PR, Kwok PY. 2004. Role of excess inorganic pyrophosphate in primer-extension genotyping assays. Genome Res 14:1749-55.

122. Mengeling BJ, Turco SJ. 1999. A high-yield, enzymatic synthesis of GDP-D- [3H]arabinose and GDP-L-[3H]fucose. Anal Biochem 267:227-33.

123. Li L, Liu Y, Wan Y, Li Y, Chen X, Zhao W, Wang PG. 2013. Efficient enzymatic synthesis of guanosine 5'-diphosphate-sugars and derivatives. Org Lett 15:5528- 30.

197

124. Gonzalez-y-Merchand JA, Colston MJ, Cox RA. 1999. Effects of growth conditions on expression of mycobacterial murA and tyrS genes and contributions of their transcripts to precursor rRNA synthesis. J Bacteriol 181:4617-27.

125. Istvan ES, Dharia NV, Bopp SE, Gluzman I, Winzeler EA, Goldberg DE. 2011. Validation of isoleucine utilization targets in Plasmodium falciparum. Proc Natl Acad Sci U S A 108:1627-32.

126. Pedro-Rosa L, Buckner FS, Ranade RM, Eberhart C, Madoux F, Gillespie JR, Koh CY, Brown S, Lohse J, Verlinde CL, Fan E, Bannister T, Scampavia L, Hol WG, Spicer T, Hodder P. 2015. Identification of potent inhibitors of the Trypanosoma brucei methionyl-tRNA synthetase via high-throughput orthogonal screening. J Biomol Screen 20:122-30.

127. Cestari I, Stuart K. 2013. A spectrophotometric assay for quantitative measurement of aminoacyl-tRNA synthetase activity. J Biomol Screen 18:490-7.

128. Francklyn CS, First EA, Perona JJ, Hou YM. 2008. Methods for kinetic and thermodynamic analysis of aminoacyl-tRNA synthetases. Methods 44:100-18.

129. Vander Horn PB, Davis MC, Cunniff JJ, Ruan C, McArdle BF, Samols SB, Szasz J, Hu G, Hujer KM, Domke ST, Brummet SR, Moffett RB, Fuller CW. 1997. Thermo Sequenase DNA polymerase and T. acidophilum pyrophosphatase: new thermostable enzymes for DNA sequencing. Biotechniques 22:758-65.

130. Richter OM, Schäfer G. 1992. Purification and enzymic characterization of the cytoplasmic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum. Eur J Biochem 209:343-9.

131. Park SY, Lee B, Park KS, Chong Y, Yoon MY, Jeon SJ, Kim DE. 2010. Facilitation of polymerase chain reaction with thermostable inorganic pyrophosphatase from hyperthermophilic archaeon Pyrococcus horikoshii. Appl Microbiol Biotechnol 85:807-12.

132. Hansen T, Urbanke C, Leppänen VM, Goldman A, Brandenburg K, Schäfer G. 1999. The extreme thermostable pyrophosphatase from Sulfolobus acidocaldarius: enzymatic and comparative biophysical characterization. Arch Biochem Biophys 363:135-47.

133. Wakagi T, Oshima T, Imamura H, Matsuzawa H. 1998. Cloning of the gene for inorganic pyrophosphatase from a thermoacidophilic archaeon, Sulfolobus sp. strain 7, and overproduction of the enzyme by coexpression of tRNA for arginine rare codon. Biosci Biotechnol Biochem 62:2408-14.

134. van Alebeek GJ, Keltjens JT, van der Drift C. 1994. Purification and characterization of inorganic pyrophosphatase from Methanobacterium thermoautotrophicum (strain delta H). Biochim Biophys Acta 1206:231-9.

198

135. Zaccai G, Eisenberg H. 1990. Halophilic proteins and the influence of solvent on protein stabilization. Trends Biochem Sci 15:333-7.

136. Wilson HL, Ou MS, Aldrich HC, Maupin-Furlow J. 2000. Biochemical and physical properties of the Methanococcus jannaschii 20S proteasome and PAN, a homolog of the ATPase (Rpt) subunits of the eucaryal 26S proteasome. J Bacteriol 182:1680-92.

137. Wilson HL, Aldrich HC, Maupin-Furlow J. 1999. Halophilic 20S proteasomes of the archaeon Haloferax volcanii: purification, characterization, and gene sequence analysis. J Bacteriol 181:5814-24.

138. Uthandi S, Saad B, Humbard M, Maupin-Furlow J. 2010. LccA, an archaeal laccase secreted as a highly stable glycoprotein into the extracellular medium by Haloferax volcanii. Appl Environ Microbiol 76:733-743.

139. De Castro R, Ruiz D, Gimenez M, Silveyra M, Paggi R, Maupin-Furlow J. 2008. Gene cloning and heterologous synthesis of a haloalkaliphilic extracellular protease of Natrialba magadii (Nep). Extremophiles 12:677-687.

140. Dordick JS. 1991. Non-aqueous enzymology. Curr Opin Biotechnol 2:401-7.

141. Uthandi S, Saad B, Humbard MA, Maupin-Furlow JA. 2010. LccA, an archaeal laccase secreted as a highly stable glycoprotein into the extracellular medium by Haloferax volcanii. Appl Environ Microbiol 76:733-43.

142. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. 2014. Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 13:2513-26.

143. Dyall-Smith M. 2009. The Halohandbook: Protocols for Halobacterial Genetics, vol Version 7.2, http://www.haloarchaea.com/resources/halohandbook/Halohandbook_2009_v7.2 mds.pdf.

144. Jeong JY, Yim HS, Ryu JY, Lee HS, Lee JH, Seen DS, Kang SG. 2012. One- step sequence- and ligation-independent cloning as a rapid and versatile cloning method for functional genomics studies. Appl Environ Microbiol 78:5440-3.

145. Allers T, Ngo HP. 2003. Genetic analysis of homologous recombination in Archaea: Haloferax volcanii as a model organism. Biochem Soc Trans 31:706- 10.

146. Southern EM. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503-17.

199

147. Kirkland PA, Busby J, Stevens S, Jr., Maupin-Furlow JA. 2006. Trizol-based method for sample preparation and isoelectric focusing of halophilic proteins. Anal Biochem 351:254-9.

148. Mostafa I, Zhu N, Yoo MJ, Balmant KM, Misra BB, Dufresne C, Abou-Hashem M, Chen S, El-Domiaty M. 2016. New nodes and edges in the glucosinolate molecular network revealed by proteomics and metabolomics of Arabidopsis myb28/29 and cyp79B2/B3 glucosinolate mutants. J Proteomics 138:1-19.

149. Weist S, Eravci M, Broedel O, Fuxius S, Eravci S, Baumgartner A. 2008. Results and reliability of protein quantification for two-dimensional gel electrophoresis strongly depend on the type of protein sample and the method employed. Proteomics 8:3389-96.

150. Zhu M, Simons B, Zhu N, Oppenheimer DG, Chen S. 2010. Analysis of abscisic acid responsive proteins in Brassica napus guard cells by multiplexed isobaric tagging. J Proteomics 73:790-805.

151. Ishihama Y, Oda Y, Tabata T, Sato T, Nagasu T, Rappsilber J, Mann M. 2005. Exponentially modified protein abundance index (emPAI) for estimation of absolute protein amount in proteomics by the number of sequenced peptides per protein. Mol Cell Proteomics 4:1265-72.

152. Makarova KS, Sorokin AV, Novichkov PS, Wolf YI, Koonin EV. 2007. Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea. Biol Direct 2:33.

153. UniProt: the universal protein knowledgebase, 2017. vol 45, p D158-D169.

154. Hofmann K, Stoffel W. 1993. TMbase - A database of membrane spanning proteins segments. Biol Chem Hoppe-Seyler 374,166.

155. Zhou G, Kowalczyk D, Humbard M, Rohatgi S, Maupin-Furlow J. 2008. Proteasomal components required for cell growth and stress responses in the haloarchaeon Haloferax volcanii. J Bacteriol 190:8096-8105.

156. Geladopoulos TP, Sotiroudis TG, Evangelopoulos AE. 1991. A malachite green colorimetric assay for protein phosphatase activity. Anal Biochem 192:112-6.

157. Itaya K, Ui M. 1966. A new micromethod for the colorimetric determination of inorganic phosphate. Clin Chim Acta 14:361-6.

158. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-54.

159. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725-9.

200

160. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406-25.

161. Nei M, Kumar S. 2000. Molecular Evolution and Phylogenetics. Oxford University Press, New York.

162. Zhou G, Kowalczyk D, Humbard MA, Rohatgi S, Maupin-Furlow JA. 2008. Proteasomal components required for cell growth and stress responses in the haloarchaeon Haloferax volcanii. J Bacteriol 190:8096-105.

163. Megger DA, Pott LL, Ahrens M, Padden J, Bracht T, Kuhlmann K, Eisenacher M, Meyer HE, Sitek B. 2014. Comparison of label-free and label-based strategies for proteome analysis of hepatoma cell lines. Biochim Biophys Acta 1844:967-76.

164. Bidle KA, Kirkland PA, Nannen JL, Maupin-Furlow JA. 2008. Proteomic analysis of Haloferax volcanii reveals salinity-mediated regulation of the stress response protein PspA. Microbiology 154:1436-43.

165. Pedone E, Bartolucci S, Fiorentino G. 2004. Sensing and adapting to environmental stress: the archaeal tactic. Front Biosci 9:2909-26.

166. Kort JC, Esser D, Pham TK, Noirel J, Wright PC, Siebers B. 2013. A cool tool for hot and sour Archaea: proteomics of Sulfolobus solfataricus. Proteomics 13:2831-50.

167. Williams TJ, Lauro FM, Ertan H, Burg DW, Poljak A, Raftery MJ, Cavicchioli R. 2011. Defining the response of a microorganism to temperatures that span its complete growth temperature range (-2 °C to 28 °C) using multiplex quantitative proteomics. Environ Microbiol 13:2186-203.

168. Tebbe A, Schmidt A, Konstantinidis K, Falb M, Bisle B, Klein C, Aivaliotis M, Kellermann J, Siedler F, Pfeiffer F, Lottspeich F, Oesterhelt D. 2009. Life-style changes of a halophilic archaeon analyzed by quantitative proteomics. Proteomics 9:3843-55.

169. Humbard MA, Zhou G, Maupin-Furlow JA. 2009. The N-terminal penultimate residue of 20S proteasome alpha1 influences its Nα acetylation and protein levels as well as growth rate and stress responses of Haloferax volcanii. J Bacteriol 191:3794-803.

170. Kaur A, Pan M, Meislin M, Facciotti MT, El-Gewely R, Baliga NS. 2006. A systems view of haloarchaeal strategies to withstand stress from transition metals. Genome Res 16:841-54.

171. Tonner PD, Pittman AM, Gulli JG, Sharma K, Schmid AK. 2015. A regulatory hierarchy controls the dynamic transcriptional response to extreme oxidative stress in archaea. PLoS Genet 11:e1004912.

201

172. Allers T, Barak S, Liddell S, Wardell K, Mevarech M. 2010. Improved strains and plasmid vectors for conditional overexpression of His-tagged proteins in Haloferax volcanii. Appl Environ Microbiol 76:1759-69.

173. Shang F, Taylor A. 2011. Ubiquitin-proteasome pathway and cellular responses to oxidative stress. Free Radic Biol Med 51:5-16.

174. Winter J, Ilbert M, Graf PC, Ozcelik D, Jakob U. 2008. Bleach activates a redox- regulated chaperone by oxidative protein unfolding. Cell 135:691-701.

175. Hazell LJ, van den Berg JJ, Stocker R. 1994. Oxidation of low-density lipoprotein by hypochlorite causes aggregation that is mediated by modification of lysine residues rather than lipid oxidation. Biochem J 302:297-304.

176. Weiss SJ, Klein R, Slivka A, Wei M. 1982. Chlorination of taurine by human neutrophils: Evidence for hypochlorous acid generation. J Clin Invest 70:598-607.

177. Wyatt AR, Kumita JR, Mifsud RW, Gooden CA, Wilson MR, Dobson CM. 2014. Hypochlorite-induced structural modifications enhance the chaperone activity of human alpha2-macroglobulin. Proc Natl Acad Sci U S A 111:E2081-90.

178. Sips HJ, Hamers MN. 1981. Mechanism of the bactericidal action of myeloperoxidase: increased permeability of the Escherichia coli cell envelope. Infection and Immunity 31:11-16.

179. Dennis WH, Olivieri VP, Krusé CW. 1979. The reaction of nucleotides with aqueous hypochlorous acid. Water Res 13:357-362.

180. Ong SE, Kratchmarova I, Mann M. 2003. Properties of 13C-substituted arginine in stable isotope labeling by amino acids in cell culture (SILAC). J Proteome Res 2:173-81.

181. Bendall SC, Hughes C, Stewart MH, Doble B, Bhatia M, Lajoie GA. 2008. Prevention of amino acid conversion in SILAC experiments with embryonic stem cells. Mol Cell Proteomics 7:1587-97.

182. Van Hoof D, Pinkse MWH, Oostwaard DW-V, Mummery CL, Heck AJR, Krijgsveld J. 2007. An experimental correction for arginine-to-proline conversion artifacts in SILAC-based quantitative proteomics. Nat Meth 4:677-678.

183. Beck M, Schmidt A, Malmstroem J, Claassen M, Ori A, Szymborska A, Herzog F, Rinner O, Ellenberg J, Aebersold R. 2011. The quantitative proteome of a human cell line. Mol Syst Biol 7:549.

184. Schrimpf SP, Weiss M, Reiter L, Ahrens CH, Jovanovic M, Malmstrom J, Brunner E, Mohanty S, Lercher MJ, Hunziker PE, Aebersold R, von Mering C, Hengartner MO. 2009. Comparative functional analysis of the Caenorhabditis elegans and Drosophila melanogaster proteomes. PLoS Biol 7:e48.

202

185. Diez A, Gustavsson N, Nystrom T. 2000. The universal stress protein A of Escherichia coli is required for resistance to DNA damaging agents and is regulated by a RecA/FtsK-dependent regulatory pathway. Mol Microbiol 36:1494- 503.

186. Oliveros JC. 2007-2015. Venny 2.1.0. An interactive tool for comparing lists with Venn's diagrams. http://bioinfogp.cnb.csic.es/tools/venny/. Accessed May 2017.

187. Lahti R. 1983. Microbial inorganic pyrophosphatases. Microbiol Rev 47:169-78.

188. Tabor S, Richardson CC. 1990. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Effect of pyrophosphorolysis and metal ions. J Biol Chem 265:8322-8.

189. Vander Horn PB, Davis MC, Cunniff JJ, Ruan C, McArdle BF, Samols SB, Szasz J, Hu G, Hujer KM, Domke ST, Brummet SR, Moffett RB, Fuller CW. 1997. Thermo Sequenase DNA polymerase and T. acidophilum pyrophosphatase: new thermostable enzymes for DNA sequencingThermo Sequenase DNA polymerase and T. acidophilum pyrophosphatase: new thermostable enzymes for DNA sequencing. Biotechniques 22:758-65.

190. Zhou GH, Shirakura H, Kamahori M, Okano K, Nagai K, Kambara H. 2004. A gel- free SNP genotyping method: bioluminometric assay coupled with modified primer extension reactions (BAMPER) directly from double-stranded PCR products. Hum Mutat 24:155-63.

191. Zhou G, Kamahori M, Okano K, Chuan G, Harada K, Kambara H. 2001. Quantitative detection of single nucleotide polymorphisms for a pooled sample by a bioluminometric assay coupled with modified primer extension reactions (BAMPER). Nucleic Acids Res 29:E93.

192. Ha C, Kwok PY. 2007. The template-directed dye-incorporation assay with fluorescence polarization detection (FP-TDI), vol 2007, p 4844. CSH Protoc.

193. Nguyen HT, Chong Y, Oh DK, Heo YS, Viet PT, Kang LW, Jeon SJ, Kim DE. 2013. An efficient colorimetric assay for RNA synthesis by viral RNA-dependent RNA polymerases, using thermostable pyrophosphatase. Anal Biochem 434:284- 6.

194. Arriagada-Strodthoff P, Karboune S, Neufeld RJ, Kermasha S. 2007. Optimization of chlorophyllase-catalyzed hydrolysis of chlorophyll in monophasic organic solvent media. Appl Biochem Biotechnol 142:263-75.

195. Blinkovsky AM, Martin BD, Dordick JS. 1992. Enzymology in monophasic organic media. Curr Opin Biotechnol 3:124-9.

196. Khmelnitsky YL, Rich JO. 1999. Biocatalysis in nonaqueous solvents. Curr Opin Chem Biol 3:47-53.

203

197. Grazinoli-Garrido R, Sola-Penna M. 2004. Inactivation of yeast inorganic pyrophosphatase by organic solvents. An Acad Bras Cienc 76:699-705.

198. Lopes DH, Meyer-Fernandes JR, Sola-Penna M. 1999. Effects of trehalose and ethanol on yeast cytosolic pyrophosphatase. Z Naturforsch C 54:186-90.

199. Lopes DH, Sola-Penna M. 2001. Urea increases tolerance of yeast inorganic pyrophosphatase activity to ethanol: the other side of urea interaction with proteins. Arch Biochem Biophys 394:61-6.

200. Lednicer D. 2010. Chemistry at a glance: steroid chemistry at a glance. John Wiley & Sons, Hoboken, NJ.

201. Cornish K. 2001. Similarities and differences in rubber biochemistry among plant species. Phytochemistry 57:1123-1134.

202. Vander Horn PB, Davis MC, Cunniff JJ, Ruan C, McArdle BF, Samols SB, Szasz J, Hu G, Hujer KM, Domke ST, Brummet SR, Moffett RB, Fuller CW. 1997. Thermo Sequenase DNA polymerase and T. acidophilum pyrophosphatase: new thermostable enzymes for DNA sequencing. Biotechniques 22:758-62, 764-5.

203. Richter OM, Schäfer G. 1992. Cloning and sequencing of the gene for the cytoplasmic inorganic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum. Eur J Biochem 209:351-5.

204. Jeon SJ, Ishikawa K. 2005. Characterization of the Family I inorganic pyrophosphatase from Pyrococcus horikoshii OT3. Archaea 1:385-9.

205. Lu D, Xie G, Gao R. 2014. Cloning, purification, and characterization of inorganic pyrophosphatase from the hyperthermophilic archaea Pyrococcus horikoshii. Protein Expr Purif 99:94-8.

206. Wakagi T, Lee CH, Oshima T. 1992. An extremely stable inorganic pyrophosphatase purified from the cytosol of a thermoacidophilic archaebacterium, Sulfolobus acidocaldarius strain 7. Biochim Biophys Acta 1120:289-96.

207. Meyer W, Moll R, Kath T, Schäfer G. 1995. Purification, cloning, and sequencing of archaebacterial pyrophosphatase from the extreme thermoacidophile Sulfolobus acidocaldarius. Arch Biochem Biophys 319:149-56.

208. Heikinheimo P, Tuominen V, Ahonen AK, Teplyakov A, Cooperman BS, Baykov AA, Lahti R, Goldman A. 2001. Toward a quantum-mechanical description of metal-assisted phosphoryl transfer in pyrophosphatase. Proc Natl Acad Sci U S A 98:3121-6.

204

209. Oksanen E, Ahonen AK, Tuominen H, Tuominen V, Lahti R, Goldman A, Heikinheimo P. 2007. A complete structural description of the catalytic cycle of yeast pyrophosphatase. Biochemistry 46:1228-39.

210. Kramer RM, Shende VR, Motl N, Pace CN, Scholtz JM. 2012. Toward a molecular understanding of protein solubility: increased negative surface charge correlates with increased solubility. Biophys J 102:1907-15.

211. Peck SC. 2006. Analysis of protein phosphorylation: methods and strategies for studying kinases and substrates. Plant J 45:512-22.

212. Reed CJ, Lewis H, Trejo E, Winston V, Evilia C. 2013. Protein adaptations in archaeal extremophiles. Archaea 2013:373275.

213. Matheson AT, Sprott GD, McDonald IJ, Tessier H. 1976. Some properties of an unidentified halophile: growth characteristics, internal salt concentration, and morphology. Can J Microbiol 22:780-6.

214. Samygina VR, Moiseev VM, Rodina EV, Vorobyeva NN, Popov AN, Kurilova SA, Nazarova TI, Avaeva SM, Bartunik HD. 2007. Reversible inhibition of Escherichia coli inorganic pyrophosphatase by fluoride: trapped catalytic intermediates in cryo-crystallographic studies. J Mol Biol 366:1305-17.

215. Thibodeau EA, Keefe TF. 1990. pH-dependent fluoride inhibition of catalase activity. Oral Microbiol Immunol 5:328-31.

216. Thibodeau EA, Bowen WH, Marquis RE. 1985. pH-dependent fluoride inhibition of peroxidase activity. J Dent Res 64:1211-3.

217. Munawar N, Engel PC. 2013. Prospects for robust biocatalysis: engineering of novel specificity in a halophilic amino acid dehydrogenase. Extremophiles 17:43- 51.

218. De Castro RE, Ruiz DM, Gimenez MI, Silveyra MX, Paggi RA, Maupin-Furlow JA. 2008. Gene cloning and heterologous synthesis of a haloalkaliphilic extracellular protease of Natrialba magadii (Nep). Extremophiles 12:677-87.

219. Kiljunen S, Pajunen MI, Dilks K, Storf S, Pohlschroder M, Savilahti H. 2014. Generation of comprehensive transposon insertion mutant library for the model archaeon, Haloferax volcanii, and its use for gene discovery. BMC Biol 12:1-14.

220. Park L, Zhou P, Pitstick R, Capone C, Anrather J, Norris EH, Younkin L, Younkin S, Carlson G, McEwen BS, Iadecola C. 2008. Nox2-derived radicals contribute to neurovascular and behavioral dysfunction in mice overexpressing the amyloid precursor protein. Proc Natl Acad Sci U S A 105:1347-52.

205

BIOGRAPHICAL SKETCH

Dr. Lana Jeannine McMillan was born in Jefferson City, Missouri to Janice and

James McMillan. After graduating high school in 2007, Lana attended the University of

Missouri in Columbia, Missouri and received her B.S. in biochemistry in 2011. During her undergraduate studies, Lana worked as a dishwasher and undergraduate researcher in a biochemistry lab led by Dr. Judy Wall at the University of Missouri studying new markerless deletion strategies in the anaerobic bacterium Desulfovibrio vulgaris Hildenborough. In her final year at the University of Missouri, Lana worked in a quantitative ecology lab for the United States Geological Survey under Dr. Mark

Wildhaber in Columbia, MO. She studied the metabolism and habitat preferences of endangered freshwater fish, Pallid and Shovelnose Sturgeon and the Neosho Mad

Tom. In her senior year at the University of Missouri, she took a biochemistry laboratory course led by Dr. Brenda Peculis where she first learned how to perform DNA isolation and digestion, PCR, gel electrophoresis, and protein quantitation. In this course Lana fell in love with science from a particular cloning experiment where PCR was used to determine the direction of a gene inserted into a plasmid. It was at this moment she decided to go to graduate school for genetics. Lana was admitted into the 2012 fall cohort of the Genetics and Genomics Graduate Program at the University of Florida in

Gainesville, Florida. She joined the lab of Dr. Julie Maupin-Furlow to study oxidative stress response in the archaeon Haloferax volcanii for her dissertation work. After graduation Lana plans to work in industry in areas of protein engineering or biochemistry or work as a postdoc in a lab which is working toward biofuel production or isolation or engineering of proteins for therapeutics or biotechnology applications.

206