Detection of Mammary Tumor Virus ENV Gene-Like Sequences in Human Breast Cancer'

ICANCER RESEARCH55, 5173-5179, November 15, 19951 Advances in Brief

Detection of Mammary Tumor Virus ENV Gene-like Sequences in Human Breast Cancer'

Yue Wang, James F. Holland, Ira J Bleiweiss, Stella Melana, Xiangjun Liu, LsabellePelisson, Annette Cantarella, Kathleen Stellrecht, Sridhar Mani, and Beatriz G-T. Pogo2

Department of Medicine, Division of Neoplastic Diseases (1'. W., J. F. H., S. M., X. L, I. P., K. S., S. M., B. G-T. P.], Departtnen:s of Pathology (1. J. B.] and Microbiology (A. C., B. G-T. P.], Mount Sinai School ofMedicine, CUNY, New York. New York 10029

Abstract cells in culture (4), human milk (5) in sera of patients (6), in cyst fluid (7), and in particles produced by a human breast carcinoma cell line Mouse mammary tumor virus (MMTV) has been related to human (8). Sequence homology to MMTV has been found in human DNA breast cancer (BC) in previous studies. Although suggestive sequence under low stringency conditions of hybridization (9), and RNA related homology to MMTV has been described in BC DNA, the presence of to MMTV has been detected in human BC cells (10). The presence of human endogenous retroviruses (HERs) confounded these results. We have selected a 660-bp sequence of the MMTV ens' gene with very low MMTV-related sequences in lymphocytes from patients with BC has homology to HER or to any other human or viral gene. We have searched been reported (1 1) as well as detection of reverse transcriptase activity for sequences homologous to it using the polymerase chain reaction. DNA in their monocytes (12). These results have been difficult to interpret was extracted from fresh or frozen tissues using primers and probes because they could not be distinguished from those potentially attrib constructed to detect 660 bp; for paraffin-embedded tissues, we sought uted to endogenous retroviral sequences (13â€”15)and the fact that 250-bp sequences by similar methodology. env-gene-related antigenicity has been detected in epitopes of human The 660-bp sequence was detected in 121 (38.5%) of the 314 unselected proteins (16). Nevertheless, May and Westley (17) have reported the BC samples, In cultured BC cells, In 2 (6.9%) of 29 breast flbroadenomas presence of MMTV-like sequences arranged as tandem repeats only in and In 2 (1.8%) of 107 breast specimens from reduction mammoplastias. DNA from BC cells. The sequence was not found in normal tissues including breast, lympho A large body of information has accumulated about the molecular cytes from BC patients, nor in other human cancers or cell lines. The biology of MMTV (reviewed in Ref. 18). The virus does not carry a 250-bp sequence was detected in 60 (39.7%) ofthe 151 BCs, and in 1 of 27 normal breast samples assayed from paraffin-embedded sections. Oonin@ transforming oncogene, but rather acts as an insertional mutagen with and sequencing of the 660 bp and 250 bp demonstrated that they are several proviral insertion loci designated mt-i or wnt-1 (19) int-2 (20), 95-.99% homologous to MMTV env gene, but not to the known LEERsnor int-3 (21), int-4 (22), and mt-S (23), which encode for growth factors to other viral or human genes (<18%). or other related proteins. These genes are not expressed in normal Southern blot analysis using labeled doned sequences showed that the mammary tissue but become activated after integration of MMTV 660-bp sequences were present in low copy number as a 7â€”8-kbEcoRI provirus into the adjacent chromosomal DNA. fragment only In breast cancer samples and two breast cancer cell lines The human homologue of the int-2 locus has been located on that were positive by PCR. chromosome 11 (24) and has been found amplified (in 15% of the These data indicate that 38â€”40%ofhuman breast cancers contain gene BCs) and also expressed (25â€”28). It may be significant that in tumors sequences homologous to the MMTV env gene that are absent from other from Parsi women, who have a high incidence of breast tumors, the tumors and tissues. These MMTV env gene-like sequences may play a role int-2 locus is amplified in 50% of the cases (29). The amplification of in the etiology of a large proportion of human breast cancer int-2 and other genes in 11q13 is indicative of a poor prognosis (30, 31). Both mouse and human int-2 have been sequenced (32). The gene Introduction encodes a protein of about Mr 27,000, which shows homology to both Studies of animal oncogenic retroviruses have been fundamental in basic and acidic fibroblast growth factors (33). revealing the presence and properties of human cellular proto-onco The evidence discussed above suggests that a MMTV-like agent genes. MMTV,3 an agent associated with a high incidence of BC in might play a role in human BC. In this communication, we report the certain strains of mice (over 90% among females), has been regarded results of a search for unique sequences of the MMTV env gene in a as a potential model for human disease. Efforts to demonstrate the panel of randomly selected human BCs using DNA amplification presence of viruses in human BC through search for viral particles, technology. immunological cross-reactivity, or sequence homology have yielded Materials and Methods contradictory results. Several lines of evidence, however, associate MMTV with human BC. Detectable MMTV env gene-related anti DNA from breast and other human cancers, human placentas, normal genic reactivity has been found in tissue sections of BC (1â€”3),BC human tissues including breast, and from several human cell lines including eight BC lines and two normal breast cell lines was extracted according to the Received 8/3/95; accepted 9/26/95. procedure of Delli Bovi et a!. (34). The DNA was resuspended in a solution The costs of publication of this article were defrayed in part by the payment of page containing 0.05 MTris-HC1 buffer (jH 7.8) and 0.1 mM EDTA, and the amount charges. This article must therefore be hereby marked advertisement in accordance with recovered was determined by microfluorometry using Hoechst 33258 dye (35). 18 U.S.C. Section 1734 solely to indicate this fact. Plasmids containing the cloned genes of MMTV were obtained from the I Supported by the T. J. Martell Foundation for Leukemia, Cancer, and AIDS Re search, The Chemotherapy Foundation, the Charlotte Geyer Foundation, Derald H. American Type Culture Collection, propagated in Escherichia coli cultures, Ruttenberg Fund, Ellen Block Memorial Fund, Faith Price-Rick Kash Fund, and Myra and purified using anion exchange minicolumns (Qiagen) or by precipitation Shaw Cancer Fund. with polyethylene glycol(36). Oligonucleotide primers were synthesized at the 2 To whom requests for reprints should be addressed, at Division of Neoplastic Diseases, Mount Sinai School of Medicine, CUNY, New York, NY 10029. core facilities of the Brookdale Molecular Biology Center at Mount Sinai 3 The abbreviations used are: MMTV, mouse mammary tumor virus; BC, breast School of Medicine. cancer. PCR was performedusing Taq polymerasefollowing the conditions rec 5173

Downloaded from cancerres.aacrjournals.org on October 5, 2021. © 1995 American Association for Cancer Research. HUMAN BREAST CANCER AND RETROVIRAL SEQUENCES ommended by the manufacturer (Perkin Elmer/Cetus) with regard to buffer, sequences of the env gene of MMTV (43) were aligned with se Mg2@,andnucleotide concentrations. Thermocycling was performed in a DNA quences of the env gene of the human endogenous retrovirus HERV cycler by denaturation at 94Â°Cfor3 mm followed by either 35 or 50 cycles of K10 (14) using the IBI/Pustell Sequence Analysis Program. A region 94Â°Cfor1.5 mm, 50Â°Cfor2 mm, and 72Â°Cfor3 mm. The ability of the PCR of 660 bp of low homology (16%) was localized between MMTV env to amplify the selected regions of the MMTV env gene was tested by using as gene sequences 976 and 1640 (43). This internal domain of the outer positive templates the cloned MMTV env gene and the genomic DNA of the membrane of the env gene has only one glycosylation site and is MCF-7 cell line, since it was shown to express gp52 immunological determi nants (37). Optimal Mg2@,primer concentrations, and requirements for the highly conserved between strains. Two primers comprising 15-bp different cycling temperatures were determined with these templates. The sequences at positions 976â€”990(primer 1) and 1626â€”1640(primer 3) master mix as recommended by the manufacturer was used. To detect possible were first synthesized. Later, longer primers were synthesized (iN contamination of the master mix components, a reaction without template was and 3N). An 18-mer sequence in the middle ofthe 660-bp MMTV env routinely tested. A DNA and control primers provided by the manufacturer region (1388â€”1405 primer 2) was used as a probe to identify the were used as control for polymerase activity. As an internal control, amplifi 660-bp sequence. A second oligomer probe was synthesized compris cation of a 120-bp sequence estrogen receptor gene was assayed using primers ing the sequence 1554â€”1568(primer 2a) to be used for hybridization designed and generously provided by Dr. Beth Schachter (Mount Sinai School when a sequence of around 250 bp (between positions 1388 and 1640) of Medicine, New York, NY). In addition, primers for actin 5 gene amplifi was amplified. For nested PCR reactions (44), another primer corn cation were also used. prising sequences 1647â€”1661(primer 4) was synthesized to be used The product of the PCR was analyzed by electrophoresis in a 2% agarose gel. A 1-kb DNA ladder (GIBCO-BRL) was used to identify the size of the with primer 1 in the first reaction and primers 2 and 3 in the second. PCR product. To determine whether the amplified sequences of the middle Modified primers with GC clamps and extra sequences were also region of the 660 bp faithfully reproduced the sequences of the env gene of synthesized and used in the PCR (primers la and 3a). Another set of MMTV, an 18-mer sequence within the env gene was used as a probe for the primers comprising sequences 974â€”1003 (5L) and 1558â€”i577 (3L) 660-bp amplified sequence. The 18-mer probe was 5' end labeled with [32P1 were subsequently developed because their Tm's matched and pro ATP using T4 polynucleotide kinase and purified by the NENSORB nucleic vided better amplification than the original primers. The sequences are acid purification cartridge (New England Nuclear). Southern blot hybridization represented in Table 1. All of them were able to amplify the expected was performed using the conditions described by Saiki et aL (38). sequences. The product of the PCR (660 bp or 250 bp) was cloned directly from the Detection of MMTV-like env Gene Sequences in Human Breast reaction mixture into the TA cloning vector (Invitrogen) using the TA cloning Tumor DNA. PCR was performed on DNA extracted from BCs, kit and following the conditions recommended by the supplier. Direct cloning of the fragment isolated from the gel was also performed. Plasmid DNA was normal breast, and the plasmid containing the env gene of MMTV purified by CsCl density gradient centrifugation or by precipitation with using primers 1 and 3. Photographs of the ethidium bromide-stained polyethylene glycol (36), restricted with Hindlll and EcoRI, electrophoresed in gels of the PCR product reveal the presence of an approximately 2% agarose gels, and transferred to nitrocellulose filters. Southern blot hybrid 660-bp sequence in some of the tumors (Fig. 1A Lanes 1 and 3), but ization was carried out using a 5 â€˜-terminal-labeled internal probe as described not in the normal tissue samples (Fig. 1A, Lanes 2 and 4). As a above. Cloning procedures were performed in laboratories totally separate positive control the MMTV env gene was also amplified (Fig. 1A, from those where PCR was carried out. Automated DNA sequencing (using Lane if). Similar results were obtained with modified primers la, 3a, Applied Technology Sequencer model 373A) was performed in the Brookdale 3L, and 5L (data not shown). Southern blot hybridization of the gel Molecular Biology Center. Sequence homology was determined using the IBI with 32P-labeled 18-mer oligonucleotide indicated that this internal MacVector GenBank and GCG programs. To prevent contamination of the sequence was present in the amplified material (Fig. 1B) and that the samples, processing of human tissues was performed in a laminar flow hood. DNA extractions were done in a chemical hood located in a different room bands in the gel were not artifactual. from that where PCR was performed. PCR assays were assembled in a Our initial effort was to analyze a representative sample of BC biological hood provided with UV. Aerosol-resistant tips and dedicated posi specimens as well as normal tissues and other tumors. To date, 343 tive-displacement pipettes were used throughout. All equipment used for PCR breast tumors have been processed, DNA extracted, and PCR per (microcentrifuge, electrophoresis apparatus, micropipettes) was cleaned each formed. Of these 343 tumors, 314 were carcinomas and 29 were time with 10% sodium hypochlorite to assure DNA decontamination (39). fibroadenomas. Amplification of sequences of 660 bp was observed in After the initial experiments were performed, the plasmid containing the 121 (38.5%) of the carcinomas and in 2 (6.9%) of the 29 fibroade MMTV env gene was frozen and never used again to avoid contamination. nomas. These sequences were confirmed to be MMTV env gene-like However, to detect plasmid contamination from our own env gene clones, sequences by hybridization with the labeled specific probe containing primers were designed to amplify plasmid sequences. All of the MMTV the internal sequences. These sequences were not detected in the env-positive samples were then tested for plasmid contamination. Southern blotting and hybridization were performed as described (40) using DNAS extracted from 20 normal organs, 23 cancers from other or the 660-bp cloned sequences labeled by the random primer procedure (41). gans, and 26 samples of blood lymphocytes including 7 from BC Prehybridization and hybridization were performed in a solution containing patients whose breast specimens were positive. From 107 samples of 6 X saline-sodium phosphate-EDTA, 5% Denhardt's solution, 0.5% SDS, 50% normal breast obtained from reduction mammoplasties, 2 (1.8%) were formamide, and 100 @g/mldenaturated salmon testis DNA, incubated for 18 h at 42Â°C,followed by washings with 2 X SSC and 0.5% SDS at room geneDesignationSequenceTable 1 Primer and probe sequences and location in the MMTV env temperature and at 37Â°C,andfinally in 0.1 X SSC with 0.5% SDS at 68Â°Cfor 30 mm (36). For paraffin-embedded tissue sections, the conditions described (5â€”3')Location1CCFCACFGCCAGATC976-990laGGGAA1TCCFCACfGCCAGATC976-990iNCCTCACTGCCAGATCGCCT976-9932TACATCFGCCTGTGTrAC1388-14052NCCFACATCFGCCFGTGTrAC1386-14052aCCGCCATACGTGCTG1554-15683ATCI'GTGQCATACCI'1640-16263aGGGAATFCATCFGTGGCATACCI@1640-16263NATCFGTGGCATACCTAAAGG1640-16214GAATCGCflGGCFCG1661-16475LCCAGATCGCCITfAAGAAGG984-10033LTACAGGTAGCAGCACGTATG1558-1577 by Wright and Manos (42) were followed using primers designed to detect a 250-bp sequence.

Results

Selection of Specific MMTV env Gene Sequences. A computer search for MMTV env gene homologous sequences was first per formed, since sequence homology between the human endogenous retroviral sequences and MMTV had been described. The prototype of this group of human endogenous retroviruses is HERV-K10 (14). The 5174

A B

Fig. 1. Amplification of 660 bp of MMTV-like env gene. DNA was extracted from frozen tissues. PCR was performed using primers 1 and 3. A, 2% agarose gel electrophoresis; B, Southern blot hy bridization using 5' 32P end-labeled probe 2. Lanes 1 and 3, BC; Lanes 2 and 4, normal breast; Lanes 5, controlreaction(no DNA); lanesE, MM1'V env gene. M, molecular weight marker. Arrow, 510-bp band.

M12345 E 12345 E

Table 2 Detection of MMTVenv gene-like sequencesfromMMTV in human DN extracted shown in Fig. 3B. Using this procedure, we have analyzed 151 BC freshorfrozentissuesA samples and found that 60 (39.7%) possess the 250-bp sequence. Of geneSamplen env the 27 normal breast samples obtained from reduction mammoplasties PositiveBreast sequences% assayed using this procedure, one was positive (3.7%). These results, 12138.5Breastcarcinomas314 in conjunction with those obtained from lymphocytes and normal 26.9Normalfibroadenomas29 breast tissue of patients whose breast cancer was PCR positive, 21.8Normalbreasts107 negativeTumorsbreastsâ€•4 indicate that MM@1V-likesequences are present in a significant nurn negativeNormalother than breast23 ber of human BC DNA which cannot be explained by DNA poly negativeLymphocytestissues20 morphism. negative Lymphocytesâ€•26 7 negative Cloning and Sequencing of the MMTV-like env Gene Sc. a Histologically normal tissue from same breast as positive cancer. quences. To find out whether there was homology to MMTV env b Lymphocytes from BC patients who were positive for MMTV env gene sequences in gene throughout the whole 660-bp stretch, the product of the PCR the tumor. from eight different tumors was cloned and sequenced. In Fig. 4 the sequence of different clones comprising around 600 bp are repre sented, as aligned to the MMTV env gene sequence of the GR and positive. In addition to DNA from lymphocytes from seven positive BR6 strains (45). This domain of the env gene in the OR strain is patients, DNA from their normal homolateral breast tissue was tested 100% homologous to the C3H strain and 98% to the BR6 strain (43, in four cases. All were negative (Table 2). Finally, DNA ofthe MCF-7 46). Evaluation of the clones indicated that homology to MMTV env @ and ED breast cancer cell lines were shown to contain the 660-bp gene varied from 95 to 99%. Another seven clones comprising only MMTV env gene-like sequences (Table 3), while four other breast 250 bp were also sequenced. Homology to the MMTV env gene cancer cell lines were positive only for the 250-bp sequence (T47-D, varied from 95 to 99% (data not shown). When compared to the BT-474, BT-20, and MDA-MB-231). human endogenous provirus HERV-KiO, the homology of all of the The nested PCR was used in several instances to increase sensitiv clones was <15%. When compared against all known viral and human ity and specificity, thus reducing the probability of false positives. In genes using the IBI MacVector GenBank and GCG programs, the Fig. 2, results of a representative nested reaction are shown using highest homology recorded was 18%. primers 1 and 4 in the first reaction (Fig. 14) and primers 2 and 3 for the second reaction. The specificity of the reaction can be seen in the Table 3 Detection of MMTVenv gene-like sequences in DNAfrom human cell lines second amplification (Fig. 2B). in culture To study a large number of samples and to be able to perform sequenceMCF-7(breastHuman cell linesMMTV env gene archival studies, PCR of paraffin-embedded tissue sections was also carcinoma)PositiveT47-D(breast carried out. Primers 2 and 3 were used to amplify a 250-bp sequence carcinoma)NegativeBT-20(breast carcinoma)NegativeMDA-MB-231(breast within the 660-bp stretch when DNA was extracted from paraffin carcinoma)NegativeZR-75-1(breast embedded tissue sections, since larger size sequences are difficult to carcinoma)NegativeSK-BR amplify after fixation. Tumor DNA was amplified (Fig. 3A, Lanes carcinoma)NegativeBT474(breast3(breast carcinoma)NegativeED(breast 2â€”5),whereas normal breast DNA was not (Fig. 3A, Lane 1). The carcinoma)PositiveMCF-10(normal identification of this 250-bp sequence with the MMTV-like env gene breast)NegativeHB-447(normal was confirmed by hybridization with an internal probe (primer 2a) as breast)NegativeHL-60(promyelocytic leukemia)Negative1(562(erythroleukemia)NegativeJurkat(T-cell

leukemia)NegativeHep 4 ED is a cell line developed in our laboratory from the pleural effusion of a patient with an env-positive tumor. 6-2(hepatoma)Negative 5175

A B

Fig. 2. Nested PCR. A, 2% agarose gel electro phoresis. 1, amplification of686 bp of MMTV-like env gene sequences from BC DNA using primers 1 @t'.@ and 4. 2, amplification of 250 bp of MMTV-like env gene sequences using primers 2 and 3 and the product of reaction A 1 as template. B 1 and 2, Southern blot hybridization of the amplified prod ucts using probe 5' 32P end-labeled probe 2a.

.- 1 2 1 2

Genomic Southern Blot Analysis Using Cloned Sequences. To experiments were stringent to avoid interference with endogenous investigate whether the env gene-like sequences were present in sequences that might interact with the probes. human DNA, Southern blot hybridization was performed using the cloned sequence as a probe. DNAS from normal breast normal tissues, Discussion env positive- or -negative breast tumors, tumors other than breast, and breast cancer cell lines were restricted with EcoRI and in some The search for virus-related sequences in human breast cancer has instances with PstI, BgIII, or KpnI. EcoRI is a frequent cutter restric been hampered by great variation reported in previous studies, by the tion enzyme that digests MMTV proviral DNA between env and poi presence of endogenous retroviral sequences in human DNA, and by genes. Four different cloned 660-bp sequences were used as probes the lack of sensitivity of the methods used. The studies reported herein after labeling with 32P by random prime labeling. Results of some of circumvent these deficiencies by focusing on sequences with low the Southern blot hybridization experiments are shown in Figs. 5 and homology to human endogenous retroviruses, by investigating a large 6. They reveal the presence of a labeled restriction fragment migrating number of tumors and several types of controls, and by using the most at approximately 7â€”8kb in BC DNA, ED, and two fragments in sensitive technology presently available. MCF-7 cells. Different restriction patterns were observed with the The results indicate that unique MMTV env gene sequences are other three enzymes. The 660-bp sequence was absent in 10 normal present in 38.5% of the BC samples analyzed and 39.7% of archival tissues, 10 fibroadenomas, and 10 tumors from other tissues (data not samples of BC, and that these sequences are absent in normal tissues, shown). including lymphocytes from patients with positive BC and in cancers It is important to emphasize that hybridization conditions for these other than breast. Normal breast tissue and fibroadenomas have a low

A B

Fig. 3. Amplification of 250 bp of MMTV-like env gene. DNA was extracted from paraffin-em bedded tissue sections. PCR was performed using primers 2 and 3. A, 2% agarose gel electrophoresis; B, Southern blot hybridization using 5' 32P-labeled probe 2a. Lane 1, normal breast; Lanes 2â€”5,BC; Lanes E: MMTV env gene. M, molecular weight marker.

12345 E

5176

* 0 100 200 300 400500600I II II II MMTENVBR IIIIIII

Clonel 66 I I I I

CIone33O I I I

CIone332 I I Iâ€¢III 11111 II

CIone49O I II I

CIone6Ol I II I

CIone6O8 II III II

CloneT6 I I II

CloneED I Ill II Fig. 4. Nucleotide sequence of the cloned MMTV env gene-like sequences as compared to the env sequences of the GR and BR6 strains of MMTV using the GCG program. , potential gly * cosylation site; I, mismatch to MMTV. 0 100 200 300 400 500 600 MMTENVGR I I I I I I I I I I 1 I I I I I I I I I I I I I I

CIonel66 â€¢ I I I I I I 1 Ill I

CIone33O â€¢ I II I

@ C1one332 I UII I@I 1 I I

CIone49O I III II II I@ I I @I

CIone6O 1

Clone6O8

CloneT6 I I I I I IIâ€¢I @II I

CloneED I I IU I I I II

M A B C D E F 6 1â€”1 Furthermore, experiments in which the cloned amplified sequences were used for hybridization with DNA from BCs or normal tissues

@@ *@, i revealed that homologous DNA was only present in BC DNA.

. The detection of MMTV env gene sequences in 2 fibroadenomas of

@@ ,. 29 and in 2 normal breasts from 107 samples is of uncertain signifi

@@ cance. Although extreme precautions were taken during extraction of

- DNA, performance of the PCR and cloning procedures, the possibility of cross-contamination with positive samples cannot entirely be cx . cluded. Alternatively, the sequences may represent histologically un @ . recognized cells that were or will be neoplastic.

j BCs were 90% invasive ductal carcinomas, which reflects the prevalence of this type of neoplasm. Most patients were node positive, . Fig. 5. Southern blot hybridization of genomic DNA. DNA was extracted from frozen which is probably artifactual since it was necessary that tumor size be tissues or cell lines, digested with EcoRI, and transferred to nitrocellulose paper. Hybrid- . .. ization with 32P-labeled clone 166. DNA from A, B, and G, env gene-positive BC, C and sufficiently large to provide an aliquot for research, and tumor size D, env-negative BC, E and F, normal breast; H, MCF-7 cells. M, molecular weight correlates with node positivity. Clinical characteristics of patients with marker, Arrowhead, 9-kb band. .. . or without viral sequences will be published elsewhere. It is unlikely that differences in homology between the MMTV env frequency (1 .8â€”6.9%) of positive results. When cloned and se- gene and the cloned human sequences are generated by errors corn quenced, the sequences were found to be highly homologous to the milled by the Taq polymerase. It has been estimated that the rate of MMTV env gene, but not to the endogenous retroviral sequences (14). nucleotide misincorporation is 1 X i05/cycle (47), and, therefore, 5177

clinical disease status, may provide another potential molecular marker, and may distinguish a subset of human breast cancer for ABCDEFGH which viral etiology is tenable. This has implications for epidemiol ogy and potentially for therapy and prevention.

Acknowledgments

14 We are indebted to Drs. Beth Schacter, James Strauchen, Thomas Fasy, Swan Thung, Michael Shafir, Rafael Mira Lopez, and Micsunica Platica, all from Mount Sinai School of Medicine, for their generosity in providing us with valuable materials and to Dolores Klaft for excellent secretarial help. Fig. 6. Southern blot hybridization of genomic DNA. Experimental conditions as in Fig. 5. DNA from A and B; env-negative BC; C and D, env-positive breast cancer; E, References molecular weight marker (nonlabeled), Fâ€”H,normal breast. Arrowhead, position of 9-kb marker. 1. Mesa-Tejada, R., Keydar, I., Ramanarayanan, M., Ohno, T., Fenogiio, C., and Spiegelman, S. Detection in human breast carcinomas of an antigen immunologically related to a group-specific antigen of mouse mammary tumor virus. Proc. NatI. Aced. only a total of 0.32 nucleotides misincorporated should be expected in Sci.USA, 75:1529â€”1533,1978. 660 bp after 50 cycles.The differencesin homologybetweenclones 2. Levine, P., Mourali, N., Tabbave, F., Costa, J., Mesa-Tejada, R., Spiegelman, S., from different patients is likely to represent heterogeneicity of the env Muenz, R., and Bekesi, Y. G. Immunopathologic features of rapidly progressing breast cancer (RPBC) in Tunisia. Proc. Am. Assoc. Cancer Res, 21: 170, 1980. gene. 3. lloyd, R., Rosen, P. P., Sarkar, N. H., Jimenez, D., Kinne, D. W., Menendez-Botet, Our results are in agreement with earlier less stringent studies C., and Schwartz, M. K. Murine mammary tumor virus related antigen in human male that suggested the involvement of the MMTV env gene in human mammary carcinoma. Cancer (Phila.), 51: 654â€”661, 1983. 4. Litvinov, S. V., and Golovkina, T. V. Expression of proteins immunologically related BC (1â€”8).Preliminaryexperiments also indicated that these se to murine mammary tumour virus (MMTV) core proteins in the cells of breast cancer quences are expressed in some of the breast tumors and in BC cells continuous lines MCF-7, T47D, MDA-231 and cells from human milk. Ada Virol., 33: 137â€”142,1989. in culture5. We were unable to confirm reports, however, that 5. Zofler, S., Kemmer, C., Lossnitzer, A., Grossmann, H., and Johannsen, B. A. Mouse indicated that, as in the mouse, MMTV-like sequences were found mammary tumour virus-related antigens in core-like density fractions from large in lymphocytes from two patients with BC (11). The absence of samples of women's milk. Eur. J. Cancer, 16: 455â€”467, 1980. 6. Day, N. K., Witkin, S. S., Sarkar, N. H., Kinne, D., Jussawalla, D. J., et a!. Antibodies MMTV env-like sequences in lymphocytes could reflect the fate a reactive with murine mammary tumor virus in sera of patients with breast cancer: unique lymphocyte subset over decades between initial encounter Geographic and family studies. Proc. NatI. Aced. Sci. USA, 78: 2483â€”2487, 1981. and the appearance of clinical breast cancer; contrawise, the human 7. Witkin, S. S., Sarkar, N. H., Kinne, D. W., Breed, C. N., Good, R. A., and Day, N. K. Antigens and antibodies cross-reactive to the murine mammary tumor virus in human disease may differ from the mouse model. Attempts to identify breast cyst fluids. J. Clin. Invest., 67: 216â€”222, 1981. unique MMTV-like pol gene sequences in human BC samples have 8. Keydar, I., Ohno, T., Nayak, R., Sweet, R., Simoni, F., Weiss, F., Karby, S., Mesa-Tejada, R., and Spiegelman, S. Properties of retrovirus-like particles produced been unsuccessful, because MMTV-pol gene sequences cannot be by a human breast carcinoma cell line: immunological relationship with mouse distinguished from endogenous reverse transcriptase sequences mammary tumor virus proteins. Proc. Natl. Acad. Sci. USA, 81: 4188â€”4192, 1984. (48). 9. Callahan, R., Drohan, W., Tronick, S., and Schlom, J. Detection and cloning of human DNA sequences related to the mouse mammary tumor virus genome. Proc. The origin of the MMTV env gene-like sequences found in tumor NatI. Aced. Sci. USA, 79: 5503â€”5507, 1982. DNA could be the result of integrated MMTV-like sequences from a 10. Axel, R., Schiom, J., and Spiegelman, S. Presence in human breast cancer of RNA human mammary tumor virus. Polymorphism of endogenous retrovi homologous to mouse mammary tumor virus RNA. Nature (Land.), 235: 32â€”36, 1972. ral sequences is conceivable but can be ruled out because these 11. Crepin, M., Lidereau, R., Chermann, J. C., Pouillart, P., Magdamenat, H., and sequences were not detected in lymphocytes from the positive pa Montagnier, L. Sequences related to mouse mammary tumor virus genome in tumor cells and lymphocytes from patients with breast cancer. Biochem. Biophys. Res. tients, in sections of breast with tumors in which abnormal cells were Commun., 118: 324â€”331, 1984. absent, nor in normal breast tissue. Recombination during tumorigen 12. Ai-Sumidaie, A. M., Hart, C. A., Leinster, S. J., and Green, C. D. Particles with esis between endogenous sequences to resemble the MMTV env gene properties of retroviruses in monocytes from patients with breast cancer. Lancet, 1: 5â€”8,1988. seems highly unlikely since no known human or viral sequence is 13. Westley, B., and May, F. E. B. The human genome contains multiple sequences more than 18% homologous to the 660-bp sequence. Thus, the most of varying homology to mouse mammary tumour virus DNA. Gene, 28: 221â€”227, conservative interpretation is that our findings represent exogenous 1984. 14. Ono, M., Yasunaga, T., Miyata, T., and Ushikubo, H. Nucleotide sequence of human sequences from an agent similar to MMTV. Recombination between endogenous retrovirus genome related to the mouse mammary tumor virus genome. endogenous and exogenous env gene sequences are known to accel J. ViM., 60: 589â€”598, 1986. 15. Fail, 0., Murray, A. B., Schmidt, J., Leib-Mosch, C., Erfie, V., and Hehlmann, R. crate the development of malignancies in mice (49). Whether the Retrovirus-like particles from the human T47D cell line are related to mouse 660-bp sequences belong to an entire acquired provirus or to an mammary tumor virus and are of endogenous origin. J. Gen. Virol., 73: 1087â€” exogenous fragment integrated into the endogenous sequences is 1097, 1992. 16. Hareuveni, M., and Lathe, R. Breast cancer sequences identified by mouse mammary presently not known. Experiments are in progress to distinguish tumor virus (MMTV) antiserum are unrelated to MMTV. mt. j. Cancer, 46: 1134â€” between these possibilities. 1135, 1990. 17. May, F. E. B., and Westley, B. R. Characterization of sequences related to the mouse Several genetic alterations have been identified in human BC that mammary tumor virus that are specific to MCF-7 breast cancer cells. Cancer Rca.,49: can be useful as markers for prevention, detection, or prognosis 3879â€”3883, 1989. (reviewed in Ref. 50). BRCa-1 and -2 genes have recently been 18. Slagle, B. L., and Butel, J. S. Exogenous and endogenous mouse mammary tumor viruses: replication and cell transformation. In: D. Medina, W. Kidwell, G. Heppner, described. They account for 5% of the BC and are related to familial and E. Anderson (eds.), Cellular and Molecular Biology of Mammary Cancer, pp. BC (51, 52). We have preliminaryevidence thatfamilial clusteringof 275â€”306.NewYork: Plenum Press, 1987. the MMTV env gene-like sequences occurs, accounting for an even 19. Nusse, R., and Varmus, H. E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell, 31: higher percentage of cancers in affected families (53). The presence of 99â€”109,1982. MMTV env gene-like sequences may be correlated with special 20. Peters, G., Brookes, S., Smith, R., and Dickson, C. Tumorigenesis by mouse mam mary tumor virus: evidence for a common region for provirus integration in mammary tumors. Cell, 33: 369â€”377, 1983. 5 V. Go, Y. Wang, J. F. Holland, and B. G-T. Pogo. Detection of MMTV env gene-like 21. Gallahan, D., Kozak, C., and Callahan, R. A new common integration region (int-3) sequences expression by RT-PCR in human breast cancer and cell lines, manuscript in for mouse mammary tumor virus on mouse chromosome 17. J. Virol., 61: 218â€”220, preparation. 1987. 5178

22. Roelink, H., Wagenaar, E., Lopes da Silva, S., and Nusse, R. Wn:-3, a gene activated 37. Yang, N. S., McGrath, C. M., and Furmanski, P. Presence of a mouse mammary by proviral insertion in mouse mammary tumors, is homolous to int-i/Wnt-1 and is tumor virus-related antigen in human breast carcinoma cells and its absence from normally expressed in mouse embryos and adult brain. Proc. Nati. Acad. Sci. USA, normal epithelial cells. J. Nati. Cancer Inst., 61: 1205â€”1208,1975. 87:4519â€”4523,1990. 38. Saiki, R. K., Scarf, S., Faloona, F., et al. Enzymatic amplification of @-globin 23. Morris, V. L, Rao, 1. R., Kozak, C. A., Gray, D. A., Lee Chan, E. C. M., Cornell, genomic sequence and restriction site analysis for diagnosis of sickle cell anaemia. 1. J., Taylor, C. B., Jones, R. F., and McGrath, C. M. Characterization of Int-5, a Science (Washington DC), 230: 1350â€”1354, 1985. locus associated with early events in mammary carcinogenesis. Oncogene Res., 6: 39. Prince, A. M., and Andrus, L. PCR: how to kill unwanted DNA. Biotechniques, 12: 53â€”63,1991. 358â€”360, 1992. 24. Casey, G., Smith, R., McGillivray, D., Peters, G., and Dickson, C. Characterization 40. Southern, E. M. Detection of specific sequences among DNA fragments separated by and chromosome assignment of the human homolog of int-2, a potential proto gel electrophoresis. J. Mol. Biol., 98: 503â€”517,1975. oncogene. Mol. Cell Biol., 6: 502â€”510,1986. 41. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restriction 25. Lidereau, R., Callahan, R., Dickson, C., Peters, G., Escot, C.. and Au, i. U. Ampli endonuclease fragments to high specific activity. Anal. Biochem., 132: 6â€”13,1983. fication of the int.2 gene in primary human breast tumors. Oncogene Res., 2: 42. Wright, D. K., and Manos, M. M. Sample preparation from paraffin-embedded tissues 285â€”291,1988. in PCR protocols, pp. 153â€”158.In: A. M. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. 26. Zhou, D. J., Casey, G., and Cline, M. J. Amplification of human int-2 in breast White (eds.), PCR Protocols: A Guide to Methods and Applications. New York: cancers and squamous carcinomas. Oncogene, 2: 279â€”282, 1988. Academic Press, 1990. 27. Liscia, D. S., Merlo, 0. R., Garrett, C., French, D., Marini-Constantini, R., and 43. Majors, J. E., and Varmus, H. E. Nucleotide sequencing of an apparent proviral copy Callahan, R. Expression of int-2 mRNA in human tumors amplified at the int-2 locus. of env mRNA defines determinants of expression of the mouse mammary tumor virus Oncogene,4:1219â€”1224,1989. env gene. J. Virol., 47: 495â€”504,1983. 28. Meyers, S. L., O'Brien, M. 1., Smith, T., and Dudley, J. P. Analysis ofthe mt-I, int-2, 44. Mullis, K. B., and Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase c-myc, and neu oncogenes in human breast carcinomas. Cancer Res., 50: 5911â€”5918, catalysed chain reaction. Methods Enzymol., 155: 335â€”350,1987. 1990. 45. Redmon, S. M. S., and Dickson, C. Sequence and expression of the mouse mammary 29. Bamabas-Sohi, N., Simha, M. R., Parikh, V. A., Feiulhade, F., Kurkure, A., Kouy tumor virus env gene. EMBO J, 2: 125â€”131,1983. oumdjian, J. C., Jussawalla, D. J., Doctor. V. M., and Therwath, A. Breast carcinoma 46. Moore, R., Dixon, M., Smith, R., Peters, G., and Dickson, C. Complete nucleotide in a high-risk population: structural alterations in neu, int@2and p53 genes. Breast sequence of a milk transmitted mouse mammary tumor virus: two frameshift sup Dis., 6: 13-26, 1993. pression events are required for translation of gag and pol. J. Virol., 61: 480â€”490, 30. Schuwring, E., Verhoeven, E., van Tinteren, H., Peterse, L., Nunnink, B., Thunnissen, 1987. F. B. J. M., Devilee, P., Cornelisse, C. J., van de Vijver, M. J., and Mooi, W. J. 47. Ehrlich, H. A.. Gelfand, D, and Sninsky, J. J. Recent advances in the polymerase Amplification of genes within chromosome 11q13 region is indicative of poor chain reaction. Science (Washington DC), 252: 1643â€”1651,1991. prognosis with operable breast cancer. Cancer Res., 52: 5229â€”5234, 1992. 48. Deen, K. C., and Sweet, R. W. Murine mammary tumor virus pol-related sequences 31. Champeme, M-H., Bieche, I., Lizard, S., and Lidereau, R. ilql3 amplification in in human DNA: characterization and sequence comparison with the complete mmmc local recurrence of human primary breast cancer. Genes Chromosomes & Cancer, 12: mammary tumor virus pol gene. J. Virol., 57: 422â€”432, 1986. 128â€”133,1995. 49. DiFronzo, N. L., and Holland, C. A. A direct demonstration of recombination 32. Moore, R., Casey, G., Brookes, S., Dixon, M., Peters, 0., and Dickson, C. Sequence, between an injected virus and endogenous viral sequences, resulting in the generation topography and protein coding potential of mouse int-2: a putative oncogene activated of mink cell focus inducing viruses in AKR mice. J. Viral., 67: 3763â€”3770, 1993. by mouse mammary tumor virus. EMBO J., 5: 919â€”924, 1986. 50. Runnenbaum, I. R., Nagarajan, M., Bowman, M., Soto, D., and Sukumar, S. Muta 33. Dickson, C., and Peters, G. Potential oncogene product related to growth factors. tions in p53 as potential molecular markers for human breast cancer. Proc. Nail. Aced. Nature (Land.), 326: 833, 1987. Sci. USA, 88: 10657â€”10661,1991. 34. Delli Bovi, P., Donti, E., Knowles, D. M., II, Friedman-Kien, A., Luciw, P. A., Dma, 51. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A.. Harshman, IC, et al. A D., Dalla-Favera, R., and Basilico, C. Presence of chromosomal abnormalities and strong candidate for the breast and ovarian cancer susceptibility gene BRCAI. Science lack of AIDS retrovirus DNA sequences in AIDS-associated Kaposi's sarcoma. (Washington DC), 266: 66â€”71,1994. Cancer Res., 46: 6333â€”6338, 1986. 52. Wooster, R., Neuhausen, S. L, Mangion, J., Quirk, Y., Ford, D., et al. Localization 35. Cesarone, C., Bolognesi, C., and Santi, L. Improved microfluorometric DNA deter of a breast cancer susceptibility gene BRCA2, chromosome 13q12â€”13.Science mination in biological material using 33258 Hoechst. Anal. Biochem., 100: 188â€”197, (Washington DC), 265: 2088â€”2090, 1994. 1979. 53. Holland, J. F., Pogo, B. G-T., Wang, Y., Bleiweiss, I., Shafir, M., Strauchen, J., 36. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning/A Laboratory Melana, S., and Invernale, A. Human familial breast cancers contain MMTV env Manual. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1989. gene-like sequences. Proc. Am. Assoc. Cancer Res., 35: 218, 1994.

5179

Yue Wang, James F. Holland, Ira J. Bleiweiss, et al.

Cancer Res 1995;55:5173-5179.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/55/22/5173

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/55/22/5173. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.