Understanding Prototype Foamy Virus Integrase Site Selection, Activity, and Stability

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

By

Randi Michelle Mackler, BS

Biomedical Sciences Graduate Program

The Ohio State University

2018

Dissertation Committee

Dr. Kristine Yoder, PhD, Advisor

Dr. Michael Freitas, PhD

Dr. Jesse Kwiek, PhD

Dr. Li Wu, PhD

Copyrighted by

Randi Michelle Mackler

2018

Abstract

HIV is a worldwide pandemic that remains incurable. Recent statistics show that in the United States alone, ~15 out of every 100,000 people were newly infected with HIV-1 in one year. The barrier to a cure is a reservoir of cells with viral DNA stably integrated into their genome, yet are not killed by the immune system. The integration step of the retroviral life cycle is crucial in formation of this reservoir. Viral DNA integration is catalyzed by the protein integrase (IN). We study HIV-1 IN as well as prototype foamy virus (PFV) IN. PFV IN is used as a model for HIV-1 integration, as HIV-1 IN inhibitors also block PFV IN activity. This implies that the two proteins have similar catalytic mechanisms.

However, we have found some differences between PFV IN and HIV-1 IN function. We determined that PFV IN could utilize Ca2+ for strand transfer, unlike HIV-1

IN. In addition, though HIV-1 IN has been reported to rapidly commit to its target DNA,

PFV IN does not commit within an hour. Therefore, there are likely differences in searching and target capture mechanisms between the two INs.

A benefit to using PFV IN is that it can be readily assembled with oligomers that mimic viral cDNA ends to form a complex termed an intasome. The PFV intasome contains a tetramer of PFV IN and two oligomer DNAs. Interestingly, we found in vitro that these intasomes aggregate at 37°C. Full-length intasomes aggregate more than those containing

ii truncated PFV IN outer subunits, particularly deleting the carboxyl terminal domain

(CTD). Aggregation can be prevented by using high non-physiological salt concentrations or with the addition of small molecule protocatechuic acid (PCA). This finding is useful for future experiments that require longer lifetimes of PFV intasomes.

PFV intasomes with full-length or truncated outer subunits were also used to understand integration into nucleosomes. Integration into chromatin is still not well understood. Chromatin, which condenses genomic DNA to fit into a cell’s nucleus, is comprised of basic units called nucleosomes. Our goal is to understand how IN chooses its site when integrating into nucleosomes. We altered either nucleosomes or PFV IN to understand how changes impact integration activity and site specificity. Perturbations include using nucleosomes with specific histone posttranslational modifications (PTMs), altering salt concentration, and utilizing PFV IN truncation mutants. We hypothesize that major grooves with highly bent DNA that are not occluded by histone proteins are the most favored sites for integration. However, our studies showed that not every distorted and exposed major groove is favorable for integration, suggesting that there is more to PFV IN site selection.

Interestingly, deleting the CTDs of the outer subunits of the IN tetramer greatly increases integration efficiency to linear DNA, but this effect is largely lost with integration into nucleosomes. These truncated mutant complexes are the most impacted by increasing salt concentrations, and affinity purification experiments showed that the PFV IN ΔCTD intasome interacts weakly with nucleosomes compared to wild type. Thus, our data supports the hypothesis that the CTDs of PFV IN directly bind to nucleosomes. In particular, the interaction is at least partially mediated by the histone tails. Results of these iii studies will expand the knowledge in the field and will be crucial to development of novel therapeutics to combat HIV-1 at the integration step. This work can also inform design of novel retroviral gene therapy vectors.

iv Dedication

To Nick for loving me and taking care of me physically and emotionally.

To my parents for their love, support, and advice through all of my ups and downs.

Without their support, I would not be where I am today.

v Acknowledgments

I am very appreciative of my support system of family, friends, peers, and mentors.

To my advisor Dr. Kristine Yoder, and committee members Drs. Jesse Kwiek, Michael

Freitas, and Li Wu – thank you for helping me think deeply about my science and teaching me to think critically. Thank you program directors Drs. Joanna Groden and Jeffrey Parvin for guiding me through my graduate career and making sure I am prepared for my future.

I would also like to acknowledge Drs. Richard Fishel and John Gunn for being additional mentors to me.

Thank you to my colleagues in the Yoder and Fishel labs for the friendship, advice, and mentorship. I would particularly like to thank Miguel Lopez and Dr. Gayan

Senavirathne for their endless support and patience, long brainstorming sessions and making a great lab environment. Thank you to everyone in the Center for Retrovirus

Research for their insightful questions and ideas and making a great community of retrovirologists at OSU.

I would also like to thank the scientists who have helped me get to graduate school to begin with. Thank you Dr. William Jacobs for truly sparking my interest in science research and Dr. Oren Mayer for making sure I had a great foundation of pipetting, aseptic technique, and experimentation. Thank you to Drs. William Coleman and Ashley

Rivenbark for guiding me through graduate school applications and being great mentors.

vi I would like to acknowledge my family and friends who have stood by me as I have gone on this crazy journey of graduate school. Christina – who knew meeting at another graduate school interview we would become best friends? We have been through it all together and I don’t think I would have made it through without you as my constant support, soundboard, and cheerleader. To my sister Hayley – you were the first one to say

I would grow up to be a scientist and look where I am now! I have always been appreciative of your support. To my fiancé Nick – you really deserve an honorary PhD for how much you have supported me throughout this process; I love you very much. Lastly, I would like to thank my incredible parents Karen and Mark Mackler. You have always believed in me when I didn’t believe in myself and have been a constant source of love and wisdom. I could not have done this without you.

vii Vita

2009…………………………………………John F. Kennedy High School, NY

2013………………………………………....B.S. Chemistry – Biochemistry Track,

University of North Carolina at Chapel Hill,

NC

2013 – Present………………………………Ph.D. Candidate, Biomedical Sciences, The

Ohio State University, OH

Publications

Mackler RM, Jones ND, Gardner AM, Senavirathne GS, Lopez MA Jr, Altman MP, Fishel

R, Yoder KE. Prototype foamy virus integrase carboxyl terminal domains dictate site selection into nucleosomes. J Biol Chem. In preparation.

Mackler RM, Jones ND, Baltierra Jasso LE, Messer RK, Yoder KE. Retroviral integrase drug resistant mutant displays a novel mechanism of reduced viral fitness. Virology. In preparation.

Jones ND*, Mackler RM*, Lopez MA Jr*, Baltierra Jasso L, Altman MP, Senavirathne

GS, Yoder KE. Prototype foamy virus intasome aggregation is mediated by outer protein

viii domains and prevented by protocatechuic acid. Sci Rep. Accepted upon minor revisions. *

Indicates equal contribution

Mackler RM, Jones ND, Lopez MA Jr, Howard CJ, Fishel R, Yoder KE. Nucleosome

DNA unwrapping does not affect prototype foamy virus integration efficiency or site selection. PLOS ONE. Under Revision.

Mackler RM, Lopez MA, Osterhage MJ, Yoder KE. Prototype foamy virus integrase is promiscuous for target choice. Biochem Biophys Res Commun. 2018 Sep 10;503(3):1241-

1246. PMID: 30017200; PMCID: PMC6119477.

Mackler RM, Lopez MA Jr, Yoder KE. Assembly and Purification of Prototype Foamy

Virus Intasomes. J Vis Exp. 2018 Mar 19;(133). PMID: 29608167; PMCID: PMC5933227.

Lopez MA Jr, Mackler RM, Altman MP, Yoder KE. Detection and Removal of Nuclease

Contamination During Purification of Recombinant Prototype Foamy Virus Integrase. J

Vis Exp. 2017 Dec 8;(130). PMID: 29286489; PMCID: PMC5755535.

Lopez MA Jr, Mackler RM, Yoder KE. Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase. J Virol Methods. 2016

Sep;235:134-138. PMID: 27269588; PMCID: PMC4992616.

Field of Study

Major Field: Biomedical Sciences Graduate Program

Emphasis: Microbial Pathogenesis (Virology)

ix Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments...... vi Vita ...... viii List of Tables ...... xiv List of Figures ...... xv Chapter 1. Introduction ...... 1 1.1 Overview of Retroviruses ...... 1 1.2 Spumavirus Infection ...... 2 1.3 Retrovirus Genomic Structure ...... 3 1.4 Retroviral Life Cycle ...... 4 1.4.1 Entry ...... 5 1.4.2 Reverse Transcription ...... 5 1.4.3 Preintegration Complex (PIC) Formation, Uncoating, and Nuclear Entry ...... 7 1.4.4 Integration ...... 9 1.4.5 Transcription and Translation ...... 10 1.4.6 Virus Assembly and Budding ...... 11 1.4.7 Maturation ...... 13 1.4.8 Latency ...... 14 1.5 Retroviral Integrase Structure and Function ...... 15 1.5.1 Integrase Protein Characteristics...... 15 1.5.2 Integrase Catalysis ...... 18 1.6 Integration Site Selection ...... 22 1.6.1 Proximity to Nuclear Envelope ...... 22 1.6.2 Genomic Regions ...... 23 1.6.3 Histone Posttranslational Modifications ...... 24 1.6.4 Sequence Specificity ...... 25 x 1.6.5 DNA Structural Features...... 26 1.6.6 Nucleosomes ...... 27 1.7 Applications of Knowledge Gleaned from the Retroviral Integration Field ...... 28 1.7.1 Integrase Inhibitors ...... 28 1.7.2 Retroviral Gene Therapy...... 30 1.8 Conclusions and Dissertation Overview ...... 32 Chapter 2. Prototype foamy virus integrase is promiscuous for target choice ...... 34 2.1 Abstract ...... 34 2.2 Introduction ...... 35 2.3 Materials and Methods ...... 37 2.3.1 Purification of PFV IN ...... 37 2.3.2 PFV integration reactions ...... 37 2.3.3 PFV preferred integration site sequence ...... 38 2.4 Results ...... 39 2.4.1 Divalent cation preference of PFV IN ...... 39 2.4.2 Target commitment ...... 42 2.4.3 Integration site sequence preference effects on integration ...... 43 2.5 Discussion ...... 46 Chapter 3. Prototype foamy virus intasome aggregation is mediated by outer protein domains and prevented by protocatechuic acid ...... 49 3.1 Abstract ...... 49 3.2 Introduction ...... 50 3.3 Methods...... 51 3.3.1 Subcloning PFV IN truncation mutants ...... 51 3.3.2 Purification of PFV integrase...... 53 3.3.3 Annealing of vDNA ...... 53 3.3.4 Intasome Assembly and Purification ...... 54 3.3.5 Integration reactions...... 55 3.3.6 Single molecule magnetic tweezers (smMT) ...... 56 3.3.7 Binding experiments ...... 57 3.3.8 Aggregation experiments ...... 58 3.4 Results ...... 58 3.4.1 Intasome outer CTDs reduce integration product accumulation ...... 58

xi 3.4.2 Catalytic activity of intasomes ...... 61 3.4.3 PFV intasome affinity for target DNA...... 63 3.4.4 PFV intasome stability ...... 63 3.4.5 Non-physiological high salt concentration ...... 71 3.5 Discussion ...... 73 Chapter 4. Retroviral integrase drug resistant mutant displays a novel mechanism of reduced viral fitness ...... 76 4.1 Abstract ...... 76 4.2 Introduction ...... 77 4.3 Materials and Methods ...... 78 4.3.1 Purification of PFV integrase and intasomes ...... 78 4.3.2 Single molecule magnetic tweezers (smMT) ...... 78 4.3.3 Integration reactions...... 78 4.4 Results ...... 79 4.4.1 Strand transfer timing of mutant PFV IN N224H ...... 79 4.4.2 Integration activity of mutant PFV IN N224H ...... 81 4.4.3 Stability of PFV IN N224H intasomes ...... 83 4.4.4 Neurotransmitters stabilize intasomes ...... 84 4.5 Conclusions ...... 86 Chapter 5. Prototype foamy virus integrase carboxyl terminal domains dictate site selection into nucleosomes ...... 88 5.1 Abstract ...... 88 5.2 Introduction ...... 89 5.3 Materials and Methods ...... 91 5.3.1 DNA substrates ...... 91 5.3.2 Nucleosomes ...... 92 5.3.3 PFV integration ...... 92 5.3.4 Affinity precipitation ...... 93 5.3.5 Trypsinization ...... 94 5.4 Results ...... 94 5.4.1 PFV integration into nucleosomes occurs in clusters ...... 94 5.4.2 Effects of increasing salt concentration on PFV integration ...... 98 5.4.3 Integration activity of truncation mutants of PFV IN ...... 101 5.4.4 Binding of truncation mutants of PFV IN to nucleosomes ...... 105 xii 5.4.5 PFV intasome interaction with trypsinized nucleosomes ...... 106 5.5 Discussion ...... 109 Chapter 6. Nucleosome DNA unwrapping does not affect prototype foamy virus integration efficiency or site selection ...... 114 6.1 Abstract ...... 114 6.2 Introduction ...... 115 6.3 Materials and Methods ...... 117 6.3.1 DNA substrates ...... 117 6.3.2 Nucleosomes ...... 117 6.3.3 PFV integration ...... 119 6.4 Results ...... 121 6.4.1 PFV integration into unmodified mononucleosomes ...... 121 6.4.2 Generation of nucleosomes with modified histones ...... 124 6.4.3 PFV integration into modified mononucleosomes ...... 124 6.5 Discussion ...... 127 Chapter 7. Summary and future directions ...... 131 7.1 Summary ...... 131 7.2 Future Directions ...... 135 References ...... 140 Appendix A. List of abbreviations in alphabetical order ...... 186 Appendix B. Empirical findings of prototype foamy virus intasome assembly ...... 192 Appendix C. Supplemental Figures ...... 197

xiii List of Tables

Table 3.1. PFV integration kinetics ...... 62

xiv List of Figures

Figure 1.1. Overview of retrovirus life cycle ...... 4

Figure 1.2. PFV IN domain structure...... 16

Figure 1.3. PFV intasome crystal structure ...... 17

Figure 1.4. Schematic of integration reaction steps ...... 18

Figure 1.5. Schematic of supercoiled DNA strand transfer assay ...... 20

Figure 1.6. Outline of PFV integration into a linear NPS target DNA ...... 21

Figure 2.1. Integration steps using blunt or preprocessed donor DNA ...... 38

Figure 2.2. PFV IN requirements for divalent cations ...... 40

Figure 2.3. PFV IN commitment to target DNA ...... 43

Figure 2.4. PFV integration into plasmids encoding the preferred integration site ...... 44

Figure 2.5. PFV integration in the presence of DNA oligomers encoding the preferred . 46

Figure 3.1. Cartoons of PFV IN and integration reaction products ...... 52

Figure 3.2. Time courses of integration by FL and truncation mutant PFV intasomes .... 60

Figure 3.3. PFV intasome activity following preincubation ...... 65

Figure 3.4. PFV intasome autointegration activity ...... 66

Figure 3.5. Rescue of PFV intasome activity by additives present during preincubation 67

Figure 3.6. PFV intasome activity following preincubation in the presence of PCA ...... 69

Figure 3.7. PFV intasome aggregation ...... 72 xv

Figure 4.1. smMT comparison of PFV WT and N224H intasomes ...... 80

Figure 4.2. PFV IN N224H integration efficiency ...... 82

Figure 4.3. N224H intasome stability ...... 84

Figure 4.4. Integration with neurotransmitters ...... 85

Figure 5.1. PFV integration into 601 nucleosomes...... 95

Figure 5.2. Increasing salt concentration decreases PFV integration into nucleosomes 100

Figure 5.3. Truncations of the outer PFV IN domains alter integration site choice ...... 102

Figure 5.4. Increasing salt concentration effects with PFV ΔCTD intasomes ...... 104

Figure 5.5. PFV ΔCTD intasomes have reduced affinity for nucleosomes ...... 106

Figure 5.6. Loss of histone tails alters integration site selection ...... 107

Figure 5.7. PFV intasomes have reduced binding to tailless nucleosomes ...... 108

Figure 6.1. Mass spectrometry of acetylated histones ...... 118

Figure 6.2. Native PAGE analysis of sucrose gradient fractions after nucleosome reconstitution...... 119

Figure 6.3. Illustration of PFV integration into a linear NPS target DNA ...... 120

Figure 6.4. PFV integration into nucleosomes with histone PTMs affecting unwrapping and stability ...... 123

Figure 6.5. Quantitation of PFV integration into nucleosomes with core histone acetylations ...... 125

Figure B.1. Size exclusion chromatogram of PFV intasome assembly ...... 192

Figure B.2. Integration assay of SEC fractions...... 193

xvi

Figure B.3. Quantitation of integration assay ...... 194

Figure B.4. Effect of freeze/thawing on intasome activity ...... 195

Figure B.5. Label molecule and position impacts intasome assembly...... 196

Figure C.1. Purification of FL and Truncated Hybrid PFV intasomes ...... 197

Figure C.2. Initial kinetics of PFV integration ...... 198

Figure C.3. Interaction of PFV intasomes with supercoiled plasmid DNA ...... 199

Figure C.4. Integration into recombinant nucleosomes is almost completely concerted 200

Figure C.5. B-Cy5 NPS reaffirms increasing salt concentration decreases integration into nucleosomes ...... 201

Figure C.6. PFV intasomes are active at high salt concentrations ...... 202

Figure C.7. Nucleosomes remain intact at 300 mM NaCl ...... 203

Figure C.8. Truncation mutations of the outer PFV IN monomers alter integration site choice ...... 204

Figure C.9. Increasing salt concentration decreases ΔNEDΔNTD PFV integration into nucleosomes ...... 205

Figure C.10. Complete trypsin digestion of recombinant nucleosomes ...... 206

xvii

Chapter 1. Introduction

1.1 Overview of Retroviruses

Retroviruses infect a wide range of hosts and cell types. They are unique in that they reverse transcribe their single stranded RNA (ssRNA) genome into complementary

DNA (cDNA), which is then stably integrated into the genome. These two processes are performed by virally encoded proteins reverse transcriptase (RT) and integrase (IN).

There are seven genera of retroviruses: alpha, beta, gamma, delta, epsilon, lenti, and spuma [1]. Alpha, beta, gamma, delta, and epsilon retroviruses are oncogenic, either directly through insertion of an oncogene as part of the viral genome, or indirectly through insertional oncogenesis or trans-activation [2]. Insertional oncogenesis is the development of cancer from dysregulation of gene expression caused by the location of viral genome integration. Trans-activation occurs when retroviruses encode a factor that indirectly causes oncogenesis. Lentiviruses cause immunodeficiency, leading to acquired immunodeficiency syndrome (AIDS) if left untreated. Interestingly, spumaviruses have not been shown to be associated with any disease or symptoms.

The two retroviruses that are known to cause human disease are lentivirus human immunodeficiency virus (HIV-1 and HIV-2) and delta retrovirus human T-lymphotropic virus (HTLV-1) [3]. Neither virus has a cure due to retroviruses’ ability to stably integrate

1 the viral genome into the genome of cells. In HIV-1 infected individuals, integration is an obstacle due to the formation of latently-infected populations that reactivate when antiretroviral therapy (ART) is removed. HTLV-1 integration has been shown to cause adult T cell leukemia/lymphoma (ATLL) or HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) in select individuals after a long latency period [4].

Interestingly, although spumaviruses can infect humans, they have not been shown to have any associated pathology [5, 6].

1.2 Spumavirus Infection

Spumaviruses were discovered and isolated in the mid-1950s from cultured monkey cells [7, 8]. They are more commonly known as foamy viruses (FVs), named for the cytopathic effect infection causes in vitro. Upon FV infection, syncytia form to create large multinucleated cells that contain vacuoles of virions, giving a characteristic “foamy” appearance [5].

A wide variety of animals are naturally infected with FV such as nonhuman primates, cats, and cows [9-11]. In addition, FV can infect humans via zoonotic transmission. The laboratory strain prototype foamy virus (PFV) was first isolated from a

Kenyan patient in 1971 and was found to likely originate from chimpanzees by sequence analysis [6, 12]. Originally named human foamy virus, sequence analysis caused a nomenclature change to SFVcpz(hu). Interestingly, there have been no clear associations between FV infection and manifestations of disease, meaning that infected animals and individuals have been asymptomatic.

2

FV has a slightly different life cycle compared to other retroviruses, which will be explained in subsequent sections.

1.3 Retrovirus Genomic Structure

Retroviruses contain two copies of their ssRNA genome, which is copied into one dsDNA. Once integrated into the host genome, the integrated DNA is termed a provirus.

PFV and HIV-1 proviruses are ~13 kilo-base pairs (kb) and ~10 kb long, respectively [12,

13]. The provirus contains two long terminal repeats (LTRs) on either end of the coding region and the 5’ LTR contains the promoter used to express viral genes [3].

Retroviral genomes are divided into two classes: simple and complex [14]. Both simple and complex retroviruses contain gag, pol, and env genes [3]. These genes encode polyproteins, which are later cleaved by virally encoded protease (PR). The Gag protein consists of structural proteins matrix (MA), capsid (CA), and nucleocapsid (NC). Pol is comprised of enzymatic proteins reverse transcriptase/ribonuclease H (RT/RNaseH), PR, and integrase (IN). Env is cleaved into proteins that coat the virus particle and are important for cell receptor recognition and virus-cell fusion. Complex retroviruses contain additional genes called accessory genes [14]. These genes are involved in transcription regulation

(e.g., HIV-1 tat, FV tas), RNA export (e.g., HIV-1 rev), and antagonism of host restriction factors (e.g., HIV-1 vif, HIV-1 vpu, HIV-2 vpx, HIV-1 vpr, HIV-1 nef).

3

1.4 Retroviral Life Cycle

Maturation

Particle Attachment + RT + PIC Release Fusion Formation Translation

Assembly + Nuclear Budding Entry Nuclear Export

Integration

Transcription

Figure 1.1. Overview of retrovirus life cycle A schematic of the retrovirus life cycle. First, the virion approaches and binds to the cell by interacting with its cellular receptor via envelope. The virion and cell plasma membranes (PMs) fuse, releasing the capsid core into the cytoplasm. Inside the core, RT converts the genomic viral RNA into double-stranded cDNA. The viral cDNA assembles with IN and other proteins to form a preintegration complex (PIC). The PIC enters the nucleus, which for HIV-1 occurs through the nuclear pore complex (NPC). Once the PIC enters into the nucleus, the viral cDNA gets integrated into the host genome. Genomic RNA and viral mRNA are transcribed along with host genes and then exported out of the nucleus. In the cytoplasm, mRNA is translated into proteins. The genomic RNA and viral proteins are assembled at the PM of the cell. Part of the PM then buds from the cell and pinches off to form an immature virus particle. The virus then matures by protease cleaving the polyproteins, forming the capsid core. This virion is now infectious and can repeat the cycle.

4

1.4.1 Entry

Retroviruses enter the cell through envelope protein recognition of cellular receptors. For HIV-1, envelope protein gp120 binds cellular receptor CD4 and either co- receptor CCR5 or CXCR4 [15-17]. This allows HIV-1 to infect mostly CD4+ T cells but also macrophages and other myeloid cells. Although both CCR5 and CXCR4 can be co- receptors for HIV-1 infection, nearly all transmitted virus utilizes the CCR5 co-receptor

[18]. CXCR4 use is associated with advanced stages of infection, as this tropism emerges later [18]. After co-receptor binding, structural rearrangement occurs, which allows gp41 to promote fusion of viral and cell membranes [19].

Interestingly, details of PFV entry are not as clear. FVs are known to infect a wide variety of cells, with only a few cell lines identified as refractory to infection [20].

Therefore, the cellular receptor for PFV is yet to be uncovered. However, it is known that the central surface of PFV Env is important for receptor recognition [21]. Fusion of FVs was shown to be pH-dependent, suggesting that the virus particle uptake is through the endosome [22].

Both types of fusion result in capsid core release into the cytoplasm of the cell to continue its infection and replication.

1.4.2 Reverse Transcription

Retroviruses have an ssRNA genome that is converted in the cytoplasm to dsDNA via reverse transcription, catalyzed by the viral protein reverse transcriptase (RT). RT both transcribes RNA into DNA and degrades the RNA template inside the viral capsid core.

Due to this dual role RT has two catalytic domains: an RNA-dependent DNA polymerase 5 and an RNase H domain. Discovery of this protein was revolutionary, as it challenged the central dogma of biology that there is only a forward linear progression of DNA transcribed into RNA that is then translated into protein [23, 24]. RT is extremely error-prone, incorporating the incorrect nucleotide once every 1700 nucleotides for HIV-1 [25]. This high error rate causes a high mutation rate or diversity of the retroviral genome.

Reverse transcription in retroviruses is primed by a cellular transfer RNA (tRNA), which binds to the RNA genome at the primer binding site (PBS). The tRNA primer for

HIV-1 is tRNALys3 whereas PFV uses tRNALys1,2 [26, 27]. This tRNA is then extended by

RT to the 5’ end of the genome, a limiting step in the process termed the minus-strand strong-stop DNA [28]. RNase H removes the viral RNA from the newly-created

RNA/DNA hybrid, causing the nascent ssDNA to dissociate and anneal at the 3’ redundant

(R) region of the viral RNA genome. This R region is at both ends of the genome, which is how the ssDNA can base pair to this other R region. The disassociation and association is known as strand transfer and can occur on the same template or the other ssRNA genomic template [29-31]. As the rest of the minus-strand is synthesized, RNase H simultaneously digests the template. However, sections of RNA that have a long string of purines are refractory to degradation and are known as polypurine tracts (PPTs). These regions are primers for plus-strand synthesis and are able to be digested once a few nucleotides are added to the end of them. HIV-1 and PFV both contain additional PPTs known as central

PPTs (cPPTs), which increase RT efficiency [32-34]. Plus-strand synthesis stops at an intermediate known as plus-strand strong stop DNA until the tRNA is digested by RNase

H [35]. The plus-strand now has an exposed PBS that will strand transfer to the 3’ end of

6 the complete minus-strand ssDNA. In addition, this strand displacement allows for the extension of the cPPT-primed DNA to extend to the end of the genome. This synthesis results in a full-length dsDNA genome that contains central flap(s) [36, 37]. The flap(s) may be resolved by host endonucleases and ligases before or after integration, as the flap- containing dsDNA is integration-competent [38].

Interestingly, it has been shown that reverse transcription for PFV occurs during viral assembly and budding of the virion. Thus, incoming virus particles actually contain

DNA rather than RNA [39-41].

1.4.3 Preintegration Complex (PIC) Formation, Uncoating, and Nuclear Entry

After reverse transcription is complete, viral protein integrase (IN) binds the viral cDNA ends and forms a complex termed the preintegration complex (PIC). This complex also contains additional viral and host proteins that have not been completely elucidated.

Several members of the PIC have been proposed including viral proteins NC, MA, RT, and viral protein R (Vpr), and host proteins lens epithelium growth factor (LEDGF), barrier- to-autointegration factor (BAF), high-mobility group proteins (HMGs), Ku, integrase interactor 1 (INI1) and lamina-associated polypeptide 2α (LAP2α) [42-55]. The capsid core protects the PIC, evading the host immune system.

However, there is a fine balance concerning dissolution of the capsid core or uncoating. Uncoating too early results in detection by host defenses, whereas late uncoating prevents nuclear entry of the PIC. Uncoating kinetics had long been unclear. However, recent evidence uncovered that the mechanical force exerted by synthesis of the viral cDNA, which is much more rigid than the ssRNA genome, triggers disassembly of the 7 capsid core [56]. Mutations in the capsid protein can alter the stability and timing of this dissolution, which changes the fate of the viral infection [57].

The HIV-1 PIC is unique in that it can enter the intact nucleus of nonproliferating cells, whereas other retroviruses require cell division for nuclear entry [58, 59]. The virus does this by passing through the nuclear pore complex (NPC) [60]. Several viral and host factors have been shown to be involved in this process. Host protein cyclophillin A binds to viral capsid and is thought to direct HIV-1 to the cytoplasmic side of the NPC [61, 62].

Viral protein Vpr has also been implicated in helping the PIC dock on the NPC and transporting the viral DNA [63-66]. RANBP2, which was first identified in siRNA screens for host factors required for HIV-1 infection, serves as an attachment site on the cytoplasmic side of the NPC and likely binds the viral DNA [62, 67-70]. Attachment on the nuclear side of the NPC involves other nucleoporins (Nups) such as NUP153. NUP153 was also identified in the siRNA screens and interacts with capsid and possibly viral DNA

[67-69, 71, 72].

Two other host factors have been suggested to be involved in nuclear import.

Transportin 3 (TNPO3), another protein identified in a siRNA screen, is thought to promote

PIC nuclear entry [62, 67, 70, 73]. Cleavage and polyadenylation specificity factor 6

(CPSF6) was shown to have the same role as TNPO3; it interacts with the capsid before nuclear entry [74-77]. Both proteins shuttle between the nucleus and cytoplasm and have a role in splicing [78, 79]. Studies have proposed that CPSF6 acts as a licensing factor to allow HIV-1 to utilize NPC passage via RANBP2, NUP153, and TNPO3 [80]. The

8 consequences of utilizing the NPC for nuclear entry as well as the influence of host factors in integration site selection will be discussed later.

Initially the PFV PIC was thought to only pass through the nuclear membrane upon cell division. However, it has been shown that the PFV PIC can enter the nucleus during

G1/S phase in addition to actively dividing cells but is blocked in G0 [58, 81, 82].

Interestingly, although the PIC can enter the nucleus during G1/S phase, the genomic DNA remains unintegrated [83]. Upon reentering the cell cycle, the DNA is then able to integrate in continuation of the replication cycle. Although Gag has a nuclear localization signal

(NLS) and was shown to be important for PIC nuclear import, another group showed that functional IN is required for this process [83, 84]. Upon further examination of PFV Gag nuclear import, it was found that Gag does not have a functional NLS and enters the nucleus by interacting with chromatin during mitosis [85]. The contents of the PFV PIC besides

IN, viral DNA, and Gag are currently unknown.

1.4.4 Integration

Upon nuclear entry, the preintegration complex inserts the viral cDNA into the host genome. The location of this integration is based on numerous factors including proximity to nuclear entry, host factors and integrase identity. Since retroviral integration is the focus of this work, how these factors influence integration will be introduced more in depth in subsequent introductory sections as well as in the body of work.

A majority of viral cDNA does not get integrated post nuclear entry [86-91].

Cellular enzymes may act on this cDNA to create circular forms. If non-homologous end joining occurs, the viral LTRs are joined together to form a 2-LTR circle [49, 86, 92-94]. 9

Alternatively, 1-LTR circles are generated via homologous recombination of the LTRs [91,

95, 96]. Incomplete RT products can also form 1-LTR circles [38]. These circles are dead end products that can no longer be integrated [97-101]. Thus measure of these circles, typically assayed by measuring 2-LTR circles, is a surrogate measure of a block at the integration step [102, 103]. Accumulation of 2-LTR circles indicates that the cDNA entered the nucleus but did not integrate.

1.4.5 Transcription and Translation

After integration occurs, viral RNA and proteins are made and processed along with host mRNA and proteins. However, accessory proteins aid in these processes. HIV-1 transactivator of transcription (Tat) and FV transactivator of spumavirus (Tas) enhance transcription and HIV-1 Rev shuttles incompletely spliced RNAs to the cytoplasm, promoting the production of viral proteins.

Transcription begins from the unique 3 (U3) promoter at R in the 5’ LTR. Tat and

Tas bind U3 promoter elements to increase viral transcription [104-106]. For HIV-1 Tat, this element is called the trans-activation response (TAR) stem loop. FVs have an additional internal promoter (IP) that is just upstream of the accessory genes [107]. Tas initially binds this promoter, increasing tas and bet expression and then switches to the

LTR promoter as a negative feedback mechanism [108].

Like cellular mRNAs, retroviral mRNAs are capped and polyadenylated. HIV-1

Tat promotes capping by binding to host capping protein MceI, phosphorylating RNA polymerase II, and acting as a DNA folding chaperone [109-112]. Both HIV-1 and PFV have polyadenylation sites in the R region, which is present at either end of the full-length 10 viral mRNA [113, 114]. Therefore, there must be a regulation mechanism to polyadenylate transcripts only at the 3’ end. For both HIV-1 and PFV, U1 small nuclear ribonucleoprotein

(U1snRNP) binds to the major splice donor (MSD) site, which suppresses polyadenylation at the 5′ LTR [113, 115, 116].

After transcription, both HIV-1 and PFV viral mRNA exhibit alternative splicing to aid in efficient production of viral proteins [117-120]. HIV-1 Rev binds to partially spliced viral RNAs at the Rev response element (RRE) stem loop and transports them out of the nucleus [121-124]. PFV does not encode a nuclear export factor, so it is thought to contain a sequence that is recognized by cellular mRNA nuclear export factors, which has been shown with Mason-Pfizer monkey virus [125].

Once viral mRNAs are exported to the cytoplasm they are translated like cellular mRNAs, starting with cap recognition by the cap binding complex. Unlike HIV-1, PFV translation results in separate Gag and Pol proteins [126, 127]. In HIV-1 translation, Gag is made by itself as well as in a Gag-Pol fusion. This translation is controlled by frameshifting, where the ribosome slides back to the -1 frame in order to translate Pol along with Gag [128, 129].

1.4.6 Virus Assembly and Budding

Once viral proteins are translated, they must be translocated to the assembly site.

For HIV-1, Gag and Gag-Pol first bind to the plasma membrane (PM) in monomers or dimers [130]. Gag is targeted to the plasma membrane via myristoylation [131]. These proteins specifically reorganize to be concentrated in lipid-rich regions of the PM called lipid rafts [132, 133]. Through cooperative binding MA – PM, NC – RNA, and Gag – Gag 11 interactions occur [134-137]. HIV-1 genomic RNA dimerizes at its dimerization initiation signal (DIS) stem loop. This dimerization exposes the psi (Ψ) packaging signal stem loop recognized by NC. Both dimerization and NC binding are required for efficient packaging

[138-145]. Env proteins are recruited by interaction with MA through its long tail [146-

149]. Accessory proteins Vpr, viral infectivity factor (Vif), and negative factor (Nef) are also present in the virus particle [150, 151]. Vpr is incorporated via interaction with the

Gag carboxyl terminal domain (CTD) [150, 152-154]. Additional proteins from the host are encapsidated in the virus particle due to unknown mechanisms that may include interactions with Gag or the PM [155]. Importantly to the context of this work, LEDGF is one of the host proteins incorporated in the virion due to its IN binding capabilities [156].

Through an endosomal sorting complexes required for transport (ESCRT) protein- mediated pathway, particles are pinched off of the PM to form immature virus particles

[151, 157-162]. Gag p6 contains motifs that directly bind ESCRT factors tumor susceptibility gene 101 (TSG101) and ALIX [157-159, 161, 163-167]. Then charged multivesicular body protein (CHMP) family members are recruited to oligomerize in a way that closes the neck of the PM [168, 169]. Finally, vacuolar protein sorting-associated protein 4 (VPS4) cleaves the membranes, separating the cell from the nascent viral particle

[168, 170]. These immature particles are noninfectious [171].

FVs deviate from these typical assembly and budding pathways. PFV particles mostly assemble at intracellular membranes such as the endoplasmic reticulum (ER) instead of the PM [172, 173]. PFV Gag is not myristoylated, suggesting a different recruitment mechanism [174]. PFV Gag first polymerizes at the centrosome and then

12 traffics to intracellular membranes for budding [175]. Because Pol is not fused to Gag, it must be incorporated in a different way than in other retroviruses. The exact mechanism is still unknown. However, it is thought to involve Pol encapsidation sequences binding to a complex containing Gag and genomic RNA. These sequences were shown to be necessary for Pol incorporation [176, 177]. Budding is initiated after specific interaction of Gag with the amino terminus of Env [178, 179]. Like HIV-1, budding of PFV particles is also assisted by ESCRT and VPS but at the ER and other intracellular membranes instead of the PM [180, 181]. Since budding occurs from the ER, most virus is intracellular.

Intriguingly, PFV particles that bud from the PM have lower infectivity compared to those from the ER [172].

1.4.7 Maturation

For the virus particles to become infectious PR must cleave polyproteins. PR autocleaves to dimerize and then cleaves five sites in Gag and six sites in Gag-Pol to produce individual MA, CA, NC, p6, PR, RT, and IN proteins as well as 1 site in Nef [182-

185]. Cleavage into individual proteins allows them to rearrange to create the electron- dense conical capsid core, the morphological mark of a mature virus particle [186-189].

PFV is unique at this step in the viral life cycle as well. Gag is only cleaved into p68 and p3 components by viral PR, which occurs early in the retroviral life cycle instead of shortly after budding [173, 190-193]. This cleavage is thought to drive reverse transcription inside the viral particle [191, 194]. Due to incomplete cleavage of Gag compared to HIV-1 and other retroviruses, PFV has an “immature” morphology by

13 comparison [174, 193]. In addition, protease cleaves Pol to separate IN from PR-RT, but the PR and RT remain fused [195, 196].

After maturation, the virus can now infect a new cell, beginning the retroviral life cycle again.

1.4.8 Latency

The development of ART was instrumental in changing HIV-1 from a deadly disease to a chronic manageable infection. ART treatment brings viral load down to undetectable levels in the blood. However, upon cessation of treatment, the virus quickly rebounds [197, 198]. This occurs due to a population of cells that harbor integrated proviral

DNA that is replication competent, yet the cells remain quiescent. Upon halting ART, these cells are reactivated and produce virus. This population is termed the latent reservoir.

The size and constituents of the latent reservoir are still not fully elucidated. The latent reservoir is thought to consist mostly of long-lived memory CD4+ T cells [87, 199-

202]. However, it is estimated that there are only 0.03-3 infectious units per million resting

CD4+ T cells in latently infected individuals [203]. This low frequency is likely due to infection of activated CD4+ T cells that are in the middle of transitioning towards a resting memory state [204]. In addition, >93% of integrated proviruses in the quiescent CD4+ T cells of an ART-treated patient are replication-incompetent [205-208]. The latent reservoir is established very early on in infection, within days to weeks [87, 209, 210]. Once established, the reservoir has a calculated half-life of ~3.5 years; this means that it would theoretically take almost 75 years on ART for the reservoir to be depleted [203, 211].

14

There are multiple proposed mechanisms to explain why the infected cells of the reservoir contain a transcriptionally silent provirus [212]. Some studies suggest that latency is caused by a heterochromatic state due to nucleosome steric hindrance, DNA methylation, or histone deacetylation [213-218]. Others show that defects in transcription from low levels of transcription factors, transcriptional interference, or dysfunctional RNA splicing and export contribute to the latency phenotype [219-222]. Latency is likely a consequence of many, if not all, of these mechanisms.

FVs cause persistent infection, though they have not been seen in a true latent state

[223]. Mutant virus lacking Tas, which only expresses Bet protein and nothing from the

LTR, has been found both in vitro and in infected African green monkeys [224, 225]. So, although LTR expression is abrogated, there is still basal expression from the IP. Because infection does not kill or promote syncytia formation in many cells in vivo, the virus is able to persist in its host.

1.5 Retroviral Integrase Structure and Function

The focus of this work is virally encoded IN from PFV. The structure and function of this protein will be discussed in further detail below.

1.5.1 Integrase Protein Characteristics

1.5.1.1 Integrase Domains

Retroviral INs generally contain three domains: amino terminal domain (NTD), catalytic core domain (CCD), and CTD connected by unstructured linker regions. HIV-1

IN is 32 kDa, whereas PFV IN is 44 kDa and contains an additional amino terminal 15 extension domain (NED) (Figure 1.2) [226]. The NED has been shown to increase solubility in vitro, but its function in vivo is still unknown [227]. The NTD contains an

HHCC motif that requires zinc ions to maintain its structure [228-230]. IN activity is carried out by the invariant DDE residues in the CCD [230]. CTD is a SRC Homology 3

(SH3)-like domain rich in positively charged residues [231, 232]. The NTD and CTD make

Figure 1.2. PFV IN domain structure PFV IN contains four domains: amino terminal extension domain (NED), amino terminal domain (NTD), catalytic core domain (CCD) and carboxyl terminal domain (CTD). Numbers indicate amino acid positions. Lines are unstructured linker regions. important contacts for both IN multimerization and DNA interactions [226, 228, 231-234].

1.5.1.2 Integrase Complex

In vivo, IN forms a complex with the viral cDNA ends and other viral and host proteins to form a PIC. Integration can be modeled in vitro using purified recombinant IN and short oligomers that mimic U5 viral DNA ends (vDNA) [235-237]. The complex formed is termed an intasome. Crystal and solution structures of PFV intasomes have been solved, giving much insight into the mechanisms of retroviral integration (Figure 1.3)

[234, 238]. The PFV intasome is comprised of a tetramer of PFV IN and two vDNAs. Two

PFV IN monomers, termed the inner subunits, perform catalysis, while the remaining PFV

IN proteins appear to stabilize the complex and have been termed outer subunits.

Crystallography was unable to resolve the NED, NTD, and CTD of the outer PFV

IN subunits due to their flexible nature. The solution structure of the PFV intasome

16 revealed that the inner and outer PFV IN subunits adopt different conformations and that the linkers between the CCD and NTD or CTD are extremely flexible [238, 239]. The functions of the outer PFV IN NED, NTD and CTD are yet to be determined. Recently, a point mutation system to selectively target a PFV IN monomer to an inner (K120E) or outer

(D273K) conformation has allowed the study of the outer domains in particular [240]. Part of this work aims to understand the role of these outer domains in integration into both supercoiled plasmid (Chapter 3) and mononucleosome (Chapter 5) target DNAs.

Figure 1.3. PFV intasome crystal structure PFV intasomes contain a tetramer of PFV IN. Inner monomers that perform catalysis are shown in blue and green. Flanking outer monomers in orange stabilize the complex. Oligomers mimicking the viral DNA ends (vDNA) are indicated. Amino terminal extension domain (NED), catalytic core domain (CCD). Outer monomer domains besides CCDs were unable to be resolved in the crystal structure of the complex. PDB 3L2R. Figure made in Pymol with help of GS.

After the elucidation of the PFV intasome structure, it took many years to characterize the structure of other retroviral intasomes. Although it was assumed that other retroviral intasomes contained tetramers like the PFV intasome, these newer structures revealed higher order multimers. Mouse mammary tumor virus (MMTV) and Rous sarcoma virus (RSV) intasomes were found to be octamers [241, 242]. Lentivirus maedi-

17 visna virus (MVV) intasome was solved as a hexadecamer comprised of sixteen INs [243].

Structural analysis of HIV-1 intasomes, using HIV-1 IN fused to a small peptide Sso7d to enhance solubility, resulted in resolution of various multimeric structures including tetramers, octamers, and hexadecamers [244]. All of the retroviral intasome structures have a PFV intasome-like core that carries out catalysis with flanking multimers to stabilize the complex [245]. It is hypothesized that the length of the linker between CCD and CTD of an IN monomer determines the multimeric state of the intasome [243, 245]. PFV IN has the longest linker, which allows inner CTDs to stabilize the tetramer. Other INs do not have long enough linkers, so multimerization allows other monomers to donate their CTDs.

1.5.2 Integrase Catalysis

Integrase activity is similar to that of DNA transposases [246]. Like transposases, the reaction proceeds without forming an intermediate that links the DNA and protein covalently [237, 247, 248]. Integration steps are detailed below and in Figure 1.4.

3’ processing

Strand transfer

Host DNA repair

Figure 1.4. Schematic of integration reaction steps Integration begins by IN recognizing the ends of the viral cDNA (red) and cleaving two nucleotides off each 3’ end, exposing the hydroxyls. The 5’ ends of the viral cDNA are shown as circles. After 3’ processing, the exposed hydroxyls can now attack the host DNA (black). The strand transfer events occur 4-6 bp apart depending on the IN. Resulting flaps and nicks are repaired by host mechanisms, resulting in duplications of host DNA (blue rectangles). This integrated viral cDNA is known as a provirus. 18

1.5.2.1 3’ Processing

IN recognizes sequences in the viral cDNA in the U3 and U5 regions of the 5’ and

3’ LTRs, respectively, and multimerize to form a PIC or intasome [249]. Upon formation of the complex, IN processes the viral cDNA ends via dinucleotide excision of the 3’ ends, leaving hydroxyl groups neighboring conserved CA dinucleotides [98, 236, 249-252]. This reaction requires a divalent cation such as Mg2+ or Mn2+ [233]. Mg2+ is likely used in vivo due to its abundance in the cell [253, 254]. Interestingly PFV IN only processes its U5 end, likely due to the invariable CA already positioned at the end of U3 [255, 256]. It was found that 3’ processing can occur in the cytoplasm, which is an issue because viral autointegration can occur [53, 257-259]. Several proteins were found to prevent this autointegration including BAF, the SET complex, and SIV CA [48, 258, 260].

1.5.2.2 Strand Transfer

These 3’-processed cDNA ends are then joined to the target DNA through two SN2 transesterification reactions termed strand transfer reactions [97, 98, 235, 237, 250-252,

261]. Strand transfer also requires Mg2+ (or Mn2+) as cofactors [254]. Divalent cation use for both 3’ processing and strand transfer is explored further in Chapter 2 [262].The strand transfer reactions occur 4-6 base pairs (bp) apart, depending on the IN [263]. For PFV IN this is 4 bp and for HIV-1 IN the stagger is 5 bp [255, 264-267]. Extrinsic energy is not required for integration activity, suggesting that the energy for this reaction comes from breaking the phosphodiester bond of target DNA [99]. Originally, it was thought that there is significant time between the first and second strand transfers, and that half-site events are intermediates for concerted events [268]. However this was disproved by measuring 19

PFV IN strand transfer timing using a single molecule magnetic tweezers (smMT) platform

[269]. The smMT experiments showed that the time between strand transfer events is ~0.5 s and that half-site products do not progress to concerted products.

Once joined, the resulting integrated product (provirus) is repaired in vivo by host

DNA repair machinery. Repair results in duplications of the host sequence flanking the provirus, determined by the distance between the two strand transfers [255, 264-267].

1.5.2.2.1 Supercoiled DNA Strand Transfer Assay

Strand transfer activity can be monitored in an assay with supercoiled plasmid DNA as a target [227, 240, 269-271]. When using viral oligomer DNAs, the complete or concerted integration reaction causes a double-strand break resulting in linearization of the plasmid DNA. If only one strand transfers, this is termed half-site integration that results in a tagged nicked circular product. Agarose gel electrophoresis allows for the separation of the unreacted supercoiled DNA from both half-site and concerted integration products.

This assay is outlined in Figure 1.5 and is used in Chapters 2 - 4.

Concerted integration: linear product + U5 +

PFV Cy5- labeled Intasome IN viral oligomer 3 kb supercoiled plasmid Half-site integration: Tagged circle product

Figure 1.5. Schematic of supercoiled DNA strand transfer assay Intasomes are assembled with recombinant purified PFV IN and oligomers that mimic the U5 region of PFV viral cDNA, which may be labeled with Cy5 to track integration products. Once formed, intasomes are incubated with a 3 kb supercoiled plasmid. Resulting products are shown. 20

1.5.2.2.2 Integration into Nucleosomes Assay

We developed a high resolution technique to map integration sites into recombinant nucleosomes, used in Chapters 5 and 6. As described above, integration products contain flaps and gaps that are repaired in vivo but not in vitro. We use this to our advantage by labeling the 5’ end of either strand of the nucleosome DNA with a Cy5 fluorophore. Figure

1.6 outlines how we can use denaturing conditions and Cy5 fluorescence to visualize integration sites from one 5’ end to the induced nick from an integration event.

Figure 1.6. Outline of PFV integration into a linear NPS target DNA (A) The PFV viral DNA is added to nucleosomes. The 601 nucleosome positioning sequence (NPS) DNA is 147 bp DNA numbered from the dyad (0) to ±73. Black circles indicate 5’ ends. Asterisk indicates a Cy5 fluorescent moiety. During integration the viral DNA 3’ end is covalently joined to the target DNA. Two viral DNAs are joined separated by 4 bp during concerted integration. The NPS DNA is broken by the integration event. Denaturation of integration products liberates a fluorescently labeled fragment that indicates one site of viral DNA joining. (B) Mock denaturing polyacrylamide gel electrophoresis (PAGE). Integration products are the fluorescent NPS fragments as shown in (A). All integration products run smaller than the full length NPS. L, ladder; -, without PFV intasome; +, with PFV intasome.

21

1.6 Integration Site Selection

Single molecule total internal reflection fluorescence (smTIRF) experiments showed that PFV intasomes can search a linear DNA target for about 2 sec or ~1600 bp before dissociating [269]. This study also found that PFV intasomes move along linear

DNA by 1-dimensional (D) rotation-coupled diffusion. However, on chromatin, 1D diffusion is limited because much of the DNA is obstructed by histone proteins.

Interestingly, PFV IN does not commit to a target readily, as described in Chapter 2 [262].

Therefore, more needs to be elucidated to fully understand intasome search mechanics. In cells, several other factors also impact site selection besides the DNA target itself; all of these levels of site selection are explained in this section and in the body of this dissertation.

1.6.1 Proximity to Nuclear Envelope

As explained earlier, HIV-1 PIC uses NPC channels to enter the nucleus. Utilizing

DNA fluorescence in situ hybridization and IN fusion proteins, studies showed that HIV-

1 prefers to integrate in the peripheral nuclear compartment [272-275]. This region is within 1 μm of the nuclear membrane, lies below the NPC, and contains open chromatin

[274, 276]. Because HIV-1 prefers open chromatin, lamin-associated domains that are also near the nuclear membrane but contain heterochromatin are disfavored [277]. In addition, integration site sequencing revealed that recurrent integration genes (RIGs) map to the nuclear periphery, aligning with the imaging studies [274]. From these data, it is likely that the HIV-1 PIC enters through the NPC and integrates into the nearest euchromatin in the nuclear periphery. This selection would indicate that where IN enters the nucleus

22 influences integration site selection. In further support of this, NPC protein Tpr stabilizes

HIV-1 cofactor LEDGF in the nuclear periphery, suggesting synergism between the two host proteins to direct integration [278, 279].

PFV integration patterns in terms of spatial preference within the nucleus are not as well studied as those for HIV-1. It has been suggested that PFV Gag binds H2A/H2B during mitosis, tethering the PIC to mitotic chromatin [84, 280, 281]. More recent work has shown that PFV integration is mostly localized to heterochromatin near the nuclear lamina just inside the nuclear membrane [240].

1.6.2 Genomic Regions

After entering the nucleus, IN must find a preferable region in the nuclear periphery to integrate. Early work involved sequencing large numbers of integration sites from mainly HIV-1 infected cells to understand where integration occurs [282-284]. These studies uncovered that HIV-1 prefers to integrate into transcriptionally active genes [282,

284, 285]. In contrast, simian FV (SFV) IN and MLV IN prefer promoters and CpG islands, with SFV IN biased against active genes [283, 285-292]. Avian sarcoma leucosis virus

(ASLV) IN has the least selectivity of the retroviruses tested [285, 293]. Additionally, HIV-

1 IN prefers euchromatin, whereas PFV IN prefers heterochromatin [240, 284, 294, 295].

Later studies attributed each genomic region preference to a host cofactor that directs integration to the region of interest. LEDGF was found to be responsible for directing HIV-

1 integration into gene bodies [52, 296-300]. Bromodomain and extraterminal domain

(BET) proteins direct MLV integration to promoters [286-288, 301, 302]. However, a host cofactor for FVs has not been discovered. 23

More recent work has further dissected HIV-1 integration site selection.

Knockdown (KD) of LEDGF and several other host proteins, such as CPSF6, TNPO3, and

NUPs NUP153 and RanBP2, alter HIV-1 IN site selection. LEDGF, NUP153, TNPO3, and

RanBP2 KDs all individually result in a decrease in gene-specific integration [71, 285, 299,

303-306]. CPSF6 KD alone or in combination with LEDGF revealed that CPSF6 targets integration to euchromatin, whereas LEDGF is responsible for HIV-1 integration being in gene bodies [307]. In addition, LEDGF is associated with splicing factors, which causes integration to be directed to highly spliced genes [308, 309].

1.6.3 Histone Posttranslational Modifications

With sequencing technology getting increasingly more powerful, Wang et al. were able to analyze HIV-1 integration sites by pyrosequencing [310]. They compared their mapped integration sites to annotated ENCODE regions, which revealed that integration sites are in regions that typically have posttranslational modifications (PTMs) associated with transcriptionally active chromatin. In particular, integration sites were favored in regions rich in H3 acetylation, H4 acetylation, H3(K4) methylation and disfavored in regions rich in H3(K27) trimethylation and DNA CpG methylation.

Retroviral integration host cofactors have been shown to interact with particular histone PTMs. LEDGF has been shown to specifically bind to H3 K36 trimethylated residues via its PWWP domain [311]. BET proteins contain bromodomains that bind to acetylated lysines of H3 and H4 tails [312]. ASLV IN has a recently discovered cofactors of the FACT complex, comprised of SSRP1 and Spt16 [313]. SSRP1 is known to bind nucleosomal DNA and Spt16 has been shown to bind H3 and H4 tails [314, 315]. 24

Understanding histone PTMs and integration is still in its infancy. Much more work is needed to discern which histone PTMs are favored by retroviral INs. Due to differences in genomic region preference, histone PTMs favored by retroviral INs are likely unique to each IN. Chapter 6 discusses PFV integration into nucleosomes with histone PTMs.

1.6.4 Sequence Specificity

The degree of integration site sequence specificity is contentious. Many groups sequenced large numbers of integration sites from ASLV, HTLV-1, simian immunodeficiency virus (SIV), foamy virus (FV), HIV-1 (both in vivo and in vitro), and

MLV to find that each IN has its own subtle palindromic sequence preference [282, 316,

317]. Kirk et al. argues otherwise, that retroviruses have the same nonpalindromic sequence preference, contrary to the previous reports [318]. They found that past studies did not distinguish between sequences from top and bottom strands, causing an averaging effect that resulted in the overall consensus sequence appearing palindromic.

Another publication suggested that the particular sequence itself does not render high integration efficiency, but rather the presence of pyrimidine/purine (YR) dinucleotides at the center of the integration site that offer flexibility [263]. This group and others also found that the distal bases of the sequence preference are important due to their interaction with particular IN residues.

Work from other groups suggest that retroviral INs do not possess sequence specificity. A 1994 study showed that HIV-1 integration patterns changed when DNA was incorporated into a nucleosome, which was also recently confirmed with PFV intasomes

[319]. Single molecule analysis of PFV integration revealed that though several PFV IN 25 consensus sequences were present in the target DNA, these sequences were not preferred over other sites [269]. In addition, data in Chapter 2 also suggests that this sequence may not be crucial in site selection [262].

1.6.5 DNA Structural Features

Pruss et al. found that HIV-1 IN prefers integration into nucleosome-bound DNA compared to free DNA, as explained in more detail below. This group then sought to further tease out how DNA structure impacts integration efficiency with and without histone octamers [319]. Using synthetic DNAs that intrinsically have differing degrees of flexibility and curvature, they showed that HIV-1 IN prefers DNA substrates with a natural curvature rather than flexible and rigid structures. However, once part of a nucleosome, site preferences changed and integration efficiency increased.

Bor, Bushman and Orgel further investigated the effect of DNA distortion on HIV-

1 integration efficiency in vitro [320]. They studied DNAs bound by well-characterized

DNA bending proteins E. coli integration host factor (IHF) and human lymphoid enhancer factor (LEF). Upon binding, these proteins induce a sharp bend in DNA between 140° and

180°. IHF binds the minor groove, leaving the major groove exposed; whereas LEF binds the major groove, leaving minor grooves accessible. Consistent with earlier chromatin studies, IHF binding enhanced integration and LEF binding hindered integration due to the fact that integration occurs in highly distorted regions of the major groove. These studies agree with the crystal structure of the PFV intasome, where the target DNA appears to have a sharp bend [234]. A cryo-EM structure of a PFV intasome docked on a mononucleosome also shows that the DNA in the intasome catalytic site is extremely distorted [240]. 26

Analysis of thousands of integration sites of a variety of retroviruses found that the number of bp between strand transfer events determines how distorted target DNA has to be to favor integration. For example, PFV having a 4 bp span of strand transfer events necessitates a more bent substrate compared to retroviruses with 6 bp between strand transfer events such as HTLV-1 [263].

1.6.6 Nucleosomes

Pruss et al. used denaturing gel electrophoresis with radiolabeled viral donor DNA to compare HIV-1 integration efficiency and site selection between DNA alone (naked

DNA) and DNA wrapped in a nucleosome [321]. This study showed that HIV-1 IN favors nucleosomal DNA as its target. In particular, HIV-1 IN prefers outward-facing positions in the major groove, exhibiting a 10 bp periodicity of integration sites. The most favored sites clustered at ±15 and ±35 from the central dyad, which are the most distorted regions of the nucleosome [322]. Integration sites did not correlate with DNase I sites, indicating that integration preference is not solely based on exposure. Due to the technological advances at the time, the + and – halves of nucleosomal DNA were indistinguishable. In addition, the nucleosomes used in this study contained a mixed pool of DNA, so if there were differences in integration site selection and efficiency with different nucleosomal

DNA sequences they would be masked. Another caveat is that this study was done before the discovery of LEDGF as the host cofactor for HIV-1 IN, which targets integration to transcription units, as described above. Though this study had some pitfalls, the work by

Pruss et al. offered a high-resolution way of determining integration site positioning in vitro and provided the foundation for later nucleosome integration studies. 27

About 20 years later, Maskell et al. published a cryo-EM structure depicting a PFV intasome docked on a mononucleosome [240]. This group found integration sites only at

±35 bp, positioning that is consistent with some of the sites found with HIV-1 IN by Pruss et al [321]. This structure suggests that the CTD of PFV IN interacts with the amino terminal tail of histone H2A. In addition, it suggested that the intasome pulls DNA ~8 Å away from the histone core to fit into its active site. More work must be done with integration into mononucleosomes and higher order chromatin structures to fully understand the interactions of PFV intasomes and nucleosomes. Integration into mononucleosomes is the main focus of this dissertation, discussed in Chapters 5 and 6.

1.7 Applications of Knowledge Gleaned from the Retroviral Integration Field

1.7.1 Integrase Inhibitors

Integrase inhibitors transformed HIV-1 infection from a death sentence to a chronic controlled infection. This class of inhibitors was the third class to be FDA approved, and showed that the combination of three antiretroviral therapeutics was necessary to combat viral replication. The first integrase inhibitors to be discovered were integrase strand transfer inhibitors (INSTIs), which block the catalysis of the preintegration complex. A second group of inhibitors, allosteric integrase inhibitors (ALLINIs), bind outside the catalytic pocket and block integration by interfering with the LEDGF-IN interaction or cause aberrant aggregation of IN. This second group has not yet been FDA approved.

28

1.7.1.1 Integrase Strand Transfer Inhibitors (INSTIs)

Researchers at Merck developed a screen to search for a compound that would block integration at the strand transfer step. They discovered that diketo acids blocked this step specifically [323]. However, initial compounds had poor pharmacokinetics, making them unrealistic for clinical use. After optimizing both antiviral activity and bioavailability,

MK-0518 or raltegravir (RAL) was discovered [324]. Since both HIV-1 and PFV INs are inhibited by RAL, subsequent crystal structures of the PFV intasome with and without

RAL provided information regarding the drug mechanism of action [226]. As predicted, the diketo acid moiety of RAL blocks strand transfer activity by chelating magnesium ions that are essential for catalysis. Additionally, RAL inhibits integration by displacing the reactive 3’ hydroxyl of the viral cDNA ends.

Based on structure of the PFV intasome with RAL, newer generations of drugs were developed to optimize its antiviral activity. Elvitegravir (EVG) was the second approved

INSTI, which was formulated in a combination pill with two RT inhibitors and a pharmaco- enhancer cobicistat [325]. Cobicistat boosts the concentration of EVG in the blood, reducing the required dose compared to RAL. Unfortunately, a majority of clinical RAL resistance mutants, with the exception of Y143R, are also resistant to EVG [326].

Therefore, EVG is not potent as a second line therapy after RAL treatment. Dolutegravir

(DTG), an even newer INSTI, has a better resistance profile than both RAL and EVG, with no known resistance mutations clinically thus far [327, 328]. This decreased likelihood of resistance may be because of the fitness cost associated with mutagenesis [329, 330].

29

1.7.1.2 Allosteric Integrase Inhibitors (ALLINIs)

Due to the overlap of resistance profiles of INSTIs, novel drug targets must be explored to combat resistance. Another class of IN inhibitors, allosteric integrase inhibitors

(ALLINIs) bind to IN at sites outside the catalytic site. The original ALLINIs were designed to disrupt IN binding to its host cofactor LEDGF. Hence, these drugs were also known as LEDGINs, as they were confirmed by crystal structures to bind in the IN dimer-

LEDGF binding pocket [331]. Interestingly, this class of drugs also causes aberrant multimerization of IN, resulting in two modes of inhibition [332-334]. However, single point mutations render the virus resistant to this class of IN inhibitors [331, 332]. Further optimization of this drug class is needed to make it to clinical use.

1.7.2 Retroviral Gene Therapy

Gene therapy is the delivery of a functional gene to cells. This therapy is used to treat genetic disorders, caused by either gene deficiency or mutation. Gene therapy delivery vectors are typically viral-based. Viral vectors that are commonly used for treatment of monogenetic diseases are adeno-associated virus (AAV)-based and retroviral-based.

Although there are numerous clinical trials utilizing these vectors, the first vector for a genetic disorder was just FDA approved in late 2017 to treat retinal dystrophy [335].

An AAV vector was used in the currently FDA approved therapy. However, this type of therapy has several shortcomings. One such pitfall is that the expression of the gene of interest is not permanent; gene expression is dependent on the lifetime of the target cells

[336, 337]. Therefore, AAV-based gene therapy is not ideal for targeting a cell type that is not long-lived or for delivery of a gene that needs to be expressed for the lifetime of an 30 individual. An additional disadvantage of an AAV-based therapy is that a majority of people get infected with AAVs at a young age, causing immune rejection of the therapy

[338]. Furthermore, any gene therapy requiring more than one-time treatment would have to change AAV subtype in order to avoid immune clearance of the second round of therapy.

According to The Journal of Gene Medicine, about a quarter of the gene therapy clinical trials to date involve the use of retroviral vectors [339]. In contrast to AAV vectors, retroviral vectors offer permanent expression of a gene of interest [340]. Retroviral vectors integrate the gene into the host genome, allowing the delivered gene to be replicated along with the cellular DNA. Though integration is a great advantage for gene therapies aimed to deliver a gene for stable lifetime expression, integration is also a drawback.

Gene therapy vectors that can integrate became a major concern in the field in the early 2000s when a clinical trial with retroviral vectors went awry. The study involved testing a MLV-based vector carrying the interleukin 2 receptor subunit gamma (IL2RG) gene as a cure for X-linked severe combined immunodeficiency (X-SCID). Researchers treated ten boys in the trial and nine of them were cured. However, four of the nine boys developed leukemia because the IL2RG gene integrated into promoter regions of proto- oncogenes such as LIM domain-only 2 (LMO2) [341-343]. This result was a major setback, even though the therapy was curative. This outcome is not particularly surprising, as it was discovered a few years after the start of the trial that MLV integrase prefers integration at promoters, as described earlier [285, 288]. Additionally, other γ retroviral vectors used to treat genetic disorders have caused insertional mutagenesis [344, 345].

31

HIV-1 and PFV INs do not prefer promoters, making them intrinsically safer gene therapy candidates. This preference makes them safer because they are less likely to integrate into promoters of proto-oncogenes [282, 285]. Trials involving lentiviral gene therapy vectors to treat Wiscott-Aldrich syndrome and Metachromatic leukodystrophy reported that they saw the benefits of these therapies without potential to dysregulate proto- oncogenes [346, 347]. However, there is no guarantee that integration will not dysregulate gene expression, as integration is not controlled. Therefore, more details of retroviral IN site selection must be elucidated to design the safest retroviral gene therapy vectors.

1.8 Conclusions and Dissertation Overview

Retroviral integration is an obligate step of the virus life cycle. This step establishes the latent reservoir, which is a barrier to a cure. Although ART suppresses viral replication so that HIV-1 is a chronic but manageable disease, treatment is lifelong due to the presence of the latent reservoir that will reactivate upon drug cessation. Therefore, more needs to be understood about HIV-1 and the integration step. PFV IN is an ideal model for HIV-1 integration because INSTIs also inhibit PFV IN and PFV intasomes can be easily assembled and purified. Additionally, understanding retroviral integration is important in development of retroviral-based gene therapy vectors.

Much is still unknown about the integration step. How PFV IN selects a target remains elusive. Unresolved domains in the PFV intasome crystal structure are still of unknown function. Integration into nucleosomes, which make up chromatin, is not fully understood. Previously published data suggests that PFV integration only occurs at one

32 location in the nucleosome, whereas HIV-1 integration occurs at multiple regions of the nucleosome that are the most distorted.

This dissertation aims to understand integration site selection and search mechanism(s) that result in site selection. Chapter 2 details PFV IN cation use in catalysis and commitment to target DNA. It also supports the hypothesis that the PFV IN sequence preference is not crucial for integration. Chapter 3 seeks to understand the roles of the

PFV IN outer subunit domains that were unresolved in the crystal structure. It additionally discusses intasome aggregation and how to prevent this phenomenon in vitro. Chapter 4 seeks to understand INSTI resistance mutant PFV IN N224H, which has deficient activity and viral fitness. This point mutant has diminished stability, elucidating a novel mechanism of reduced viral fitness.

Chapters 5 and 6 seek to further understand PFV integration into nucleosomes.

Chapter 5 describes mapping PFV integration sites in mononucleosomes at higher resolution than has been previously shown. In addition, we aim to understand part of the

PFV intasome search mechanism through utilization of PFV IN truncation mutants.

Chapter 6 presents negative data that rules out nucleosome unwrapping as a necessary step in the PFV IN search. Finally, Chapter 7 summarizes our findings and suggests future directions for this work.

33

Chapter 2. Prototype foamy virus integrase is promiscuous for target choice

This chapter is based on work published in Biochemical and Biophysical Research

Communications [262]:

Mackler RM, Lopez MA, Osterhage MJ, Yoder KE. Prototype foamy virus integrase is promiscuous for target choice. Biochem Biophys Res Commun. 2018 Sep 10;503(3):1241-

1246. PMID: 30017200; PMCID: PMC6119477.

2.1 Abstract

Retroviruses have two distinctive activities: reverse transcription of viral RNA into

DNA and integration of that DNA into the genome. Incorporation of the viral DNA into the host DNA is catalyzed by viral protein integrase (IN). IN from prototype foamy virus

(PFV) has been thoroughly structurally characterized in a complex termed an intasome, which contains a tetramer of PFV IN and two DNA ends. This has been a model for retroviral intasome structure. However, recent data of other intasome structures has suggested that PFV IN does not behave exactly like every retroviral IN. Here we seek to understand divalent cation use and target commitment of PFV IN, which is significantly different than HIV-1 IN based on previously published data. Unlike HIV-1 IN, PFV IN can use calcium during strand transfer and does not readily commit to a target DNA. These

34 results suggest that PFV IN is more promiscuous compared to HIV-1 IN in terms of divalent cation and target commitment.

2.2 Introduction

Retroviral integration is an obligate step of the viral life cycle that stably incorporates the viral cDNA genome into the host genome [340]. This step is catalyzed by virally encoded protein integrase (IN). Once reverse transcription is complete, IN recognizes the cDNA ends at U3 and U5 regions of the long terminal repeats (LTRs). Upon recognition, IN catalyzes a dinucleotide cleavage at each end, exposing 3’ hydroxyls. This process is termed 3’ processing. The 3’ hydroxyls can then attack the host DNA in transesterification reactions, covalently linking the viral DNA. Each covalent joining is termed a strand transfer. The viral DNA ends are joined to the host 4-6 base pairs apart, depending on the IN. Following strand transfer events, host proteins repair the DNA, resulting in host DNA duplications at viral-host junctions [348].

IN from prototype foamy virus (PFV) is used as a model, as it was the first IN to be crystallized as a full length protein and in complex with DNA oligomers mimicking viral DNA ends, termed an intasome [226, 234]. These structures provided a wealth of information about what contacts the proteins and DNA make to form a complex, but lacks insight into dynamics including intasome search mechanism. A study using single molecule techniques determined that PFV intasomes move along naked linear DNA by 1- dimensional (D) rotation-coupled diffusion [269]. This study could not eliminate the possibility that intasomes also search via 3D collision or intersegmental transfer (IT). Since

35 in vivo DNA is wrapped into nucleosomes, PFV intasomes cannot search long spans of

DNA using 1D diffusion alone. Thus, it is highly plausible that PFV intasomes use both

3D and 1D mechanisms to find an integration site.

Each IN has its own preference at both regional and local levels. HIV-1 integration is enriched at active transcription units (TUs) [285]. Conversely, PFV integration is favored at promoters and CpG islands [285]. HIV-1 integration at TUs is attributed to host cofactor lens epithelial growth factor (LEDGF), which is a transcription factor [156, 285, 296, 298,

299, 349, 350]. LEDGF binds to HIV-1 IN via its integrase binding domain and tethers this complex to chromatin via histone posttranslational modification H3(K36me3) [311]. There is no known host cofactor for PFV IN. Each IN was also found to have a unique subtle sequence preference, though this has been more recently contested [317, 318].

Although it was originally assumed that all IN form tetramers like PFV IN, recent structures disproved this assumption. HIV-1 IN was found to form a variety of multimeric structures [244]. It is thought that HIV-1 IN likely forms a hexadecamers because another lentiviral intasome was found to adopt this structure [243]. This difference in structure and site preference may mean that the search mechanism of different INs are divergent. HIV-1

IN commits to its target early, as addition of a secondary target at any time point after the start of the reaction did not yield integration into this target [351]. This study was performed without LEDGF, showing that HIV-1 IN alone likely does not search using IT or 3D collision. LEDGF alone may search chromatin in vivo by 1D and 3D diffusion [350].

Thus, LEDGF binding to HIV-1 IN may impact its search mechanism.

36

Here was seek to elucidate details of PFV IN search mechanism. We find that PFV

IN can utilize a wider variety of divalent cations for catalysis compared to HIV-1 IN. Also in contrast to HIV-1 IN, PFV IN does not commit to a target early in the reaction. Third, we find that the PFV IN subtle sequence preference does not impact integration efficiency.

2.3 Materials and Methods

2.3.1 Purification of PFV IN

All chemicals were of the highest grade (Sigma Aldrich). Recombinant PFV IN was purified as described [352, 353].

2.3.2 PFV integration reactions

DNA oligomers were purchased from Integrated DNA Technologies. Preprocessed

PFV viral donor DNA was KEY616 5’

ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3’ annealed to

KEY675 5’ CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3’. Blunt

PFV viral donor DNA was KEY616 annealed to KEY623 5’

CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACAAT 3’. Cy5 fluorophore labeling was at the 5’ end of KEY675 or KEY623. Blunt and preprocessed viral donor

DNAs mimic different steps of the integration reaction (Figure 2.1).

PFV integration reactions were performed in 10 mM HEPES, pH 7.5, 110 mM

NaCl, 4 μM ZnCl2, 5 mM MgSO4, and 10 mM DTT, 0.5 μM PFV IN, 1 μM viral donor

DNA, 50 ng target DNA plasmid in a final volume of 15 μL. Where indicated 5 mM MgCl2,

5 mM MnCl2, or 5 mM CaCl2 were substituted for MgSO4. Blunt viral donor DNA was

37 used except when indicated. All reagents except target DNA were combined in 14 μL volume and incubated on ice for 15 min. Target DNA was added, reactions were incubated at 37°C for 90 min, and stopped by the addition of 0.5% sodium dodecyl sulfate (SDS), 1 mg/mL proteinase K. Reactions were incubated at 37°C for an additional 60 min. Reaction products were separated by 1% agarose in TAE with 0.1 μg/mL ethidium bromide (EtBr).

Gels were scanned by Typhoon 9410 variable mode fluorescent imager (GE Healthcare) for EtBr and Cy5. Images were analyzed by ImageQuant TL (GE Healthcare). Data was analyzed by paired t test (GraphPad Prism).

Figure 2.1. Integration steps using blunt or preprocessed donor DNA Integration begins by IN recognizing the ends of the viral cDNA (red) and cleaving two nucleotides off each 3’ end, exposing the hydroxyls. Blunt donor mimics this substrate. The 5’ ends of the viral cDNA are shown as circles. After 3’ processing, the exposed hydroxyls can now attack the host DNA (black). The strand transfer events occur 4-6 bp apart depending on the IN. Preprocessed donor DNA mimics skipping the 3’ processing step (first step), assessing only strand transfer activity.

2.3.3 PFV preferred integration site sequence

The PFV preferred integration site GTGCTAGCAC was subcloned into pMP2 between SacI and SphI sites and into pcDNA3.1 between KpnI and XbaI sites [4]. DNA oligomers KEY709 5’ CGTGCTAGCACTCGCGAGCATG 3’ and KEY710 5’

38

CTCGCGAGTGCTAGCACGAGCT 3’ were annealed and subcloned into pMP2. DNA oligomers KEY725 5’ CGTGCTAGCACATCGATT 3’ and KEY726 5’

CTAGAATCGATGTGCTAGCACGGTAC 3’ were annealed and subcloned into pcDNA

3.1. Plasmids were confirmed by sequencing (Genewiz). Plasmids were relaxed by incubation with Nt.BspQI (NEB) at 50°C for 1 hr. Nt.BspQI nicks pMP2 once and pcDNA3.1 three times, on the minus strand at 2582 and 2792 and the plus strand at 3461.

Annealed DNA oligomers KEY725 and KEY726 were added to integration reactions.

2.4 Results

2.4.1 Divalent cation preference of PFV IN

All retroviral INs require divalent cations at the active site to assemble and perform both 3’ end processing and strand transfer reactions [340]. Several previous studies of HIV-

1 IN evaluated the enzymatic preference for divalent cation [354-357]. HIV-1 IN appears to show a strong preference for manganese during assembly onto the viral DNA ends [357].

In contrast, calcium allows assembly of HIV-1 IN with viral DNA, but does not allow catalysis [355]. Recombinant HIV-1 IN is markedly more enzymatically active in manganese compared to magnesium [354]. HIV-1 IN was reported to be incapable of 3’ processing in the presence of magnesium [351]. The effects of different divalent cations have not been reported for PFV IN.

PFV IN activity was assayed with supercoiled plasmid target DNA [227].

Recombinant PFV IN is added to a Cy5 fluorescently labeled DNA oligomer mimicking the end of the viral cDNA (Figure 2.2A). After incubation on ice to allow intasome

39 assembly, target plasmid is added and reactions are incubated at 37°C. Reaction products are separated by agarose gel stained with EtBr. The PFV IN integration products are largely concerted integration (CI) of two viral donor DNA oligomers into the plasmid (Figure

2.2A). The CI products have the mobility of linearized plasmid. A second integration product occurs when only one viral DNA donor is joined to the target plasmid. In this half- site integration (HSI) reaction, a nick is introduced at the site of strand transfer relaxing the supercoils. The HSI products have the mobility of relaxed circular plasmid. The agarose gels are imaged for EtBr and Cy5 fluorescence allowing for identification and quantitation of all DNA forms, including unreacted and reaction products.

Figure 2.2. PFV IN requirements for divalent cations (A) PFV IN with a donor DNA oligomer mimicking the ends of the viral cDNA is added to a supercoiled plasmid DNA to assay integration in vitro. The products may be half-site integration (HSI) events where only one donor DNA is covalently joined to target DNA. Integration introduces a nick in the plasmid and relaxes it. Concerted integration (CI) is joining of two donor DNAs to the plasmid. The product is linear. (B) Agarose gel analysis of integration products generated in the presence of MgSO4, MgCl2, MnCl2, or CaCl2. Integration reactions employed Cy5 fluorescently labeled blunt donor DNA (B) or preprocessed donor DNA (PP). Target DNA is 2.86 kb plasmid pMP2. Top, Cy5 image. Bottom, EtBr image. Relaxed circles (RC) and supercoiled (SC) plasmids are indicated. (C) CI and HSI products were quantified from Cy5 fluorescent images and expressed as relative to CI product in MgSO4. Error bars indicate standard deviation between at least three independent experiments. DNA marker is in kb.

40

We compared PFV IN integration into a supercoiled plasmid DNA in the presence of magnesium, manganese, or calcium (Figure 2.2). Published protocols for HIV-1 IN assays often employ MgCl2, but PFV IN assays utilize MgSO4 [227, 351]. Both divalent cations were assayed. Using a preprocessed viral DNA donor with recessed 3’ ends (Figure

2.1), this integration assay does not distinguish between assembly and strand transfer.

There was little difference in the accumulation of CI products when either magnesium or manganese was present (p > 0.05). However, CI products in the presence of calcium were reduced to 22% of products observed in the presence of MgSO4 (p = 0.013). HSI products were also assayed but showed little difference between the divalent cations assayed. The activity of PFV IN in the presence of calcium suggests that this enzyme is more permissive than HIV-1 IN, which has no enzymatic activity in calcium [24]. PFV IN favored CI to

HSI in magnesium or manganese, but was more prone to HSI in calcium (HSI MgSO4 compared to CaCl2 p = 0.036).

PFV integration was also assayed with a blunt viral donor DNA (Figure 2.1). This donor DNA requires PFV IN to perform 3’ end processing prior to strand transfer. Results showed greater differences between the divalent cations than preprocessed viral donor

DNA (Figure 2.2). HSI products were similar in the presence of MgSO4 or MgCl2 (p =

0.059), but CI products increased by 30% in the presence of MgCl2 (p = 0.036). PFV IN was more active in the presence of manganese showing a 2.1 fold and 3.2 fold increase of

CI (p = 0.017) or HSI (p = 0.006) products, respectively, compared to MgSO4. PFV IN had no activity in the presence of calcium suggesting that 3’ end processing could not occur.

Thus PFV IN may utilize calcium for assembly and strand transfer, but not 3’ end

41 processing. Since PFV IN is active in magnesium and this cation is more physiologically relevant than manganese, subsequent experiments were performed with magnesium.

2.4.2 Target commitment

Real time single molecule experiments show that PFV intasomes may search over

1 kb of linear DNA [269]. It is unknown if a PFV intasome can switch targets by 3D diffusion following an unproductive search. Previous studies of HIV-1 IN suggested that this enzyme commits to a target DNA early in vitro [351]. We tested the commitment of

PFV IN to target DNA (Figure 2.3). Integration reactions included two supercoiled plasmids, pMP2 and pcDNA3.1, readily distinguished by gel mobility. Integration reactions were initiated with one plasmid at 37°C. At variable times, a second plasmid was added. Reciprocal reactions were performed, switching the order of the plasmids added.

PFV integration reactions revealed that simultaneous addition of two plasmids results in integration into both (Figure 2.3). CI to the first plasmid in the reaction increased slightly throughout the time course. This observation was true whether 2858 bp pMP2 or

5397 bp pcDNA3.1 was the first plasmid added, but this difference was not statistically significant for either plasmid. CI to the second plasmid added to the reaction steadily decreased as the time of addition increased (simultaneous addition compared to 60 min pcDNA added second p = 0.025, pMP2 added second p = 0.039). HSI products were also quantified in these reactions and displayed similar trends to the CI products (simultaneous addition compared to 60 min pcDNA added second p = 0.012, pMP2 added second p =

0.016). Even when reactions had been incubated for 60 min, integration into the second

42 plasmid is still readily detected. This suggests that a significant fraction of PFV IN does not commit to a target DNA within 60 min in stark contrast to HIV-1 IN.

Figure 2.3. PFV IN commitment to target DNA (A) PFV IN and Cy5 donor DNA were added to pMP2 or pcDNA, indicated by + symbols. The second plasmid was added 5-60 minutes after the start of the reaction, indicated by numbers. Simultaneous addition of both plasmids at the start is indicated by 0. Integration reactions were a total of 90 min from the addition of the first plasmid. Reaction products were separated by agarose gel, stained with EtBr, and scanned for Cy5 (top) and EtBr (bottom). (B) CI and (C) HSI integration products were quantified and expressed relative to total integration observed in the single plasmid reaction. Error bars indicate the standard deviation between at least three independent experiments. DNA marker is in kb. 2.4.3 Integration site sequence preference effects on integration

A unique yet subtle sequence preference for integration sites has been reported for each retrovirus [317]. Since PFV intasomes interact with naked DNA by 1D rotation coupled diffusion similar to lac repressor search for a sequence specific site, we tested the effect of the adding the PFV IN preferred integration site GTGCTAGCAC into target DNA

[234, 358]. The preferred integration site was subcloned into two different plasmids 43 yielding pMP2-PFV or pcDNA3.1-PFV. PFV integration was compared between parent plasmids and preferred site plasmids (Figure 2.4). Both blunt and preprocessed viral oligomer donors were tested. There were no apparent differences in the accumulation of integration products with the presence of the preferred sequence (p > 0.05).

Figure 2.4. PFV integration into plasmids encoding the preferred integration site PFV IN and Cy5-labeled viral donor DNA were added to pMP2, pcDNA, and the parent plasmids with the 11 bp PFV IN preferred sequence, pMP2-PFV and pcDNA-PFV, indicated by P. The viral donor DNA was either blunt (B) or preprocessed (PP). The integration reaction products were analyzed by agarose gel. The Cy5 (top) and EtBr (bottom) gel images are shown. The accumulation of integration products with pMP2-PFV and pcDNA-PFV are shown relative to pMP2 and pcDNA, respectively. (A) PFV integration into supercoiled plasmids. (B) PFV integration into relaxed plasmids. Error bars indicate the standard deviation between at least three independent experiments. DNA marker is kb. Retroviral INs may have greater preference for structural features, particularly bent

DNA, than sequence [359]. IN is known to favor the bent structure of supercoiled DNA compared to nicked, relaxed circles or linear DNA [5, 269]. To evaluate integration efficiency with the sequence preference in the absence of supercoils, the plasmids were

44 relaxed with a nicking endonuclease. In this context, there was no change in integration efficiency to the plasmids with the preferred sequence. These data suggest that the PFV IN preferred integration site does not enhance PFV integration.

Although the integration sequence preference did not enhance integration efficiency in target DNAs, excess small double stranded DNA oligomers were tested as competitors of integration. Double stranded DNA oligomers encoding the PFV preferred integration site sequence were titrated into integration assays (Figure 2.5). The concentration of PFV IN is 500 nM, suggesting that the maximal concentration of tetrameric PFV intasomes in these reactions is 125 nM. The dsDNA oligomers were added at 5, 50, 500, or 5000 molar excess to monomeric PFV IN. PFV CI and HSI were unaffected by the addition of dsDNA oligomers at any concentration (p > 0.05). Taken together, the preferred sequence of PFV IN does not enhance or inhibit integration. It seems that structural elements are more important than sequence for integration targeting.

45

Figure 2.5. PFV integration in the presence of DNA oligomers encoding the preferred PFV integration into plasmid pMP2 was performed in the presence of increasing concentrations of double stranded DNA oligomers encoding the PFV preferred integration site (PBS). Cy5 (top) and EtBr gel images (bottom) are shown. Quantitation of CI and HSI integration products are shown relative to the absence of PBS. Error bars indicate standard deviation between at least two independent experiments. DNA marker is in kb.

2.5 Discussion

Extensive mapping of integration sites has revealed that retroviral INs have unique preferences for sequence and chromatin features [282, 285, 292]. Bulk biochemical assays indicate that integrases prefer bent DNA [359]. Genomic DNA in the context of chromatin is the natural substrate for retroviral INs making bent DNA an obvious target. However,

46 even in the context of nucleosomes, integration does not appear to be random. A cryo-EM structure of the PFV intasome bound to a stable nucleosome revealed a single binding site

[240]. Previous studies of IN with nucleosome substrates suggest that not all exposed DNA major grooves serve as targets for integrases [321].

Here we explore the dynamics of retroviral integrase interaction with target DNA.

Intasomes may search for a target site by a variety of mechanisms including 1D diffusion

(sliding), 3D diffusion (jumping), or IT. We have previously shown that PFV intasomes readily slide on DNA, but could not discern 3D diffusion or IT [269]. In this study, PFV

IN is able to integrate into a second target DNA plasmid after an hour. While this data does not prove PFV IN performs 3D diffusion or IT, it is suggestive of these mechanisms. PFV

IN observations are in contrast to HIV-1 IN which did not integrate into a second DNA after one minute and also appeared incapable of sliding on target DNA [351]. The HIV-1

IN data argues that this protein does not search by 3D diffusion nor IT. During HIV-1 infection, the movement of HIV-1 integration complexes may be dictated by LEDGF/p75, which has been shown to search chromatin by 3D diffusion and likely IT [350]. PFV IN does not have a host cofactor and displays far greater mobility than reported for HIV-1 IN.

Further experiments will be necessary to prove PFV IN 3D diffusion and/or IT. More sophisticated analysis, such as single molecule TIRF, may reveal that HIV-1 intasomes are capable of a more comprehensive search of target DNA than previously reported.

Each retrovirus has a subtle sequence preference at the integration site, only revealed after sequencing hundreds of integration sites [317]. Throughout the integration sequence preference, each base preference is independent of the preference for surrounding

47 bases. Thus there is no interdependent relationships between base choices throughout the integration site preference. We explored the ability of the PFV preferred integration site sequence to either enhance or hinder integration. Adding the PFV integration site preference to two different plasmids did not increase the accumulation of integration products. Considering that DNA structure might be more important than sequence preference, the plasmids were relaxed with a nicking endonuclease to remove the preferred supercoils. Presence of the integration sequence preference in relaxed plasmids also did not increase integration product accumulation. These data suggest that the preferred sequence at PFV integration sites does not enhance integration into a naked DNA target plasmid in vitro.

Double stranded DNA oligomers encoding the PFV integration sequence preference were added to integration reactions to possibly inhibit integration. Such DNA oligomers were bound by the PFV intasome in a structure [234]. Even at large molar excess of the DNA oligomers, the accumulation of CI and HSI products were unaffected. The importance of retroviral integration site sequence preference appears to be minimal during integration in vitro.

48

Chapter 3. Prototype foamy virus intasome aggregation is mediated by outer

protein domains and prevented by protocatechuic acid

This chapter is based on work under revision in Scientific Reports:

Jones ND*, Mackler RM*, Lopez Jr. MA*, Baltierra Jasso LE, Altman MP, Senavirathne

GS, and Yoder KE. Prototype foamy virus intasome aggregation is mediated by outer protein domains and prevented by protocatechuic acid. Sci Rep (2018). Accepted upon minor revisions. *Indicates equal contribution.

3.1 Abstract

Retroviruses encode protein integrase (IN) that is responsible for incorporating the viral cDNA into the host genome. IN from prototype foamy virus (PFV) forms a tetramer in complex with two viral DNA ends known as an intasome. Within the intasome, two monomers perform catalysis termed inner monomers. The other two monomers are known to stabilize the intasome and are termed outer monomers. In the crystal structure of an intasome, only the catalytic core domain (CCD) of the outer monomers was able to be resolved; the structure of amino terminal extension domain (NED), amino terminal domain

(NTD) and carboxyl terminal domain (CTD) of outer IN subunits in the context of the intasome are not known. Interestingly, deletion of the CTD of outer subunits enhanced integration into a supercoiled DNA target. These intasomes were more stable than wild 49 type (WT). WT intasomes may be stabilized by the addition of small molecule protocatechuic acid (PCA) or high salt concentrations. Thus, outer CTDs promote PFV intasome aggregation that can be disrupted by small molecules or increased ionic strength.

3.2 Introduction

Retroviruses must incorporate their viral cDNA genome into the host genome in order to perpetuate infection [360]. This incorporation is catalyzed by the viral protein integrase (IN). PFV IN contains four domains: amino terminal extension domain (NED), amino terminal domain (NTD), catalytic core domain (CCD) and carboxyl terminal domain (CTD) (Figure 3.1a). IN forms a complex with viral cDNA ends and other viral and host proteins to form a preintegration complex (PIC) [53]. In vitro, recombinant IN and oligomers mimicking viral cDNA ends form a complex termed an intasome.

The most characterized retroviral intasome is from prototype foamy virus (PFV), as it was the first to be structurally resolved [226, 234, 238]. The PFV intasome is a tetramer of IN with two viral cDNA ends. In this complex two monomers catalyze the reaction termed inner monomers, and the other two subunits are thought to simply stabilize the complex termed outer monomers. Only the CCD of the outer monomers was resolved in the intasome crystal structure, leaving the NED, NTD and CTD without known structure. The function of these domains in the outer subunits is unknown. Structural studies revealed that point mutations PFV IN(K120E) and PFV IN(D273K) can direct monomers to the inner and outer subunits of the intasome, respectively [240]. This allows the direct study of either inner or outer monomers individually.

50

Here we characterize the impact of deleting outer PFV IN subunit domains on integration efficiency. Intasomes with full length (FL) PFV IN are only stable for a short timeframe at 37°C. PFV intasomes lacking the CTD of their outer subunits are more active and stable than FL intasomes. Addition of high non-physiological salt concentrations or protocatechuic acid (PCA) also enhanced FL intasome stability. Precipitation experiments reveal that reduced stability is due to aggregation. Thus, high salt concentration or PCA inhibits PFV intasome aggregation. This aggregation is mediated via outer PFV IN CTDs.

3.3 Methods

3.3.1 Subcloning PFV IN truncation mutants

Point mutations for inner PFV IN(K120E) and outer PFV IN(D273K) were expressed as previously described for wild type PFV IN [352, 353]. Truncation mutants, shown in Figure 3.1a, were engineered into the intasome outer monomers with point mutation PFV IN(D273K). The amino terminal 103 amino acids were deleted to generate

PFV IN(∆NED, ∆NTD, D273K). This construct includes the unstructured linker region between PFV IN NTD and CCD, including residue K120. Primers KEY900 5’

GGGACCCGGGGCTTCCAACAAAGCCTCTGGTCCTATTC 3’ and KEY620 5’

TTCCAAATGATCCATTGTTGCAG 3’ amplified the PFV IN truncation. The PCR product was subcloned into XmaI and AflII sites. The carboxyl terminal 73 amino acids were deleted to make PFV IN(∆CTD, D273K). This truncation mutant includes the linker region with an alpha helix between CCD and CTD. The PFV IN(D273K) mutation is preserved. Primers KEY674 5’ GGATCGAGATCTCGATCCCGCG 3’ and KEY899 5’

51

GCCGGATCCTCAAACAACAGGAGACCAGGAACGAGAGG 3’ amplified this fragment of PFV IN. The PCR product was subcloned into XbaI and BamHI sites.

Figure 3.1. Cartoons of PFV IN and integration reaction products (a) FL PFV IN is 392 amino acids. The truncation of NED (magenta) and NTD (red) domains has the first 103 amino acids removed to generate ΔNTD. Truncation of the CTD (teal) deleted 73 amino acids. These truncation mutants preserved the PFV IN(K120E) and PFV IN(D273K) residues that direct monomers to the inner or outer positions of the intasome. (b) PFV intasomes catalyze covalent joining of viral donor DNA oligomers into a supercoiled plasmid target DNA. Half-site integration (HSI) is the joining of a single viral donor to the plasmid, generating a tagged circle. This integration product has a nick at the point of joining that releases the supercoils. HSI products with fluorescently labeled viral donors include a single fluorophore. Concerted integration (CI) is the joining of two viral donors to the plasmid. This integration product relaxes to a linear product with the viral donor DNAs at the ends. There are two fluorophores present in CI products. Figure made by NDJ.

52

3.3.2 Purification of PFV integrase

PFV IN was purified as previously described [352, 361]. Proteins purified include full length (FL) PFV IN, PFV IN(K120E), PFV IN(∆NED, ∆NTD, D273K), and PFV

IN(∆CTD, D273K). Point mutations and truncation mutants of PFV IN were purified with the same method as full length PFV IN.

3.3.3 Annealing of vDNA

To make vDNA, 10 μM KEY616 5’

ATTGTCATGGAAT*TTTGTATATTGAGTGGCGCCCGAACAG 3’ and 10 μM

KEY675 5’ CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3’ were combined in 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA in a final volume of

1.5 mL. These DNA oligomers yield a donor DNA mimicking a 3’ preprocessed viral DNA end (vDNA). The Cy5 fluorophore was added to KEY616 at T13 (*), an internal amino-T.

To generate biotinylated intasomes, biotin was added to the 5’ end of KEY675. Modified oligomers were purified by high-performance liquid chromatography (HPLC) before annealing. Annealing was performed using a thermocycler with the following times and temperatures: 1 cycle at 94.0°C 3 min, 99 cycles at (94.0°C 1 min, 93.6°C 1 min) decreasing both temperatures by 0.8°C per cycle (the last cycle is 14.8°C 1 min, 14.4°C 1 min), and store at 4.0°C. Resulting vDNA was concentrated using 3 kDa molecular weight cutoff (MWCO) ultracentrifugal filter concentration units (Amicon).

53

3.3.4 Intasome Assembly and Purification

Purified recombinant PFV IN without contaminating nuclease activity [352, 353]

(120 μM) and vDNA (50 μM) were dialyzed in the presence of 50 mM Bis-Tris propane, pH 7.5 and 500 mM NaCl against 20 mM Bis-Tris propane, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 μM ZnCl2 at 18-22°C for 16-20 hours.

Intasomes precipitate out during dialysis. Sample was removed from dialysis and placed on ice. To resolubilize, NaCl concentration was increased to a final concentration of 320 mM NaCl. The sample was resuspended regularly for 1 hour. Using Cy5 end labeled vDNA, the precipitate was reduced by only ~20%; most of the precipitate with fluorophore end labeled vDNA did not solubilize.

Intasome samples were centrifuged at 4°C to pellet any remaining precipitate.

Different species in the resulting supernatant were separated via fast protein liquid chromatography (FPLC) using a Superose 6 size exclusion column (GE Healthcare).

Species were eluted in 20 mM Bis-Tris propane, pH 7.5, 320 mM NaCl, and 10% glycerol

(Appendix B, Figure B.1). Biotin end labeled DNA-containing intasomes reduce intasome yield compared to internal Cy5 labeled DNA (Appendix B, Figure B.5).

To test for integration activity, 2 μL of each intasome peak fraction and 50 ng 3 kb supercoiled plasmid DNA were incubated at 37°C for 5 min in the presence of 10 mM Bis-

Tris propane, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 μM ZnCl2, and 10 mM DTT in a final reaction volume of 15 μL. Reactions were stopped and proteins were digested with proteinase K, sodium dodecyl sulfate (SDS) and EDTA for l hour at 55°C. Resulting DNA products were resolved via 1% agarose gel electrophoresis with 0.1 μg/mL ethidium

54 bromide (EtBr) (Appendix B, Figure B.2). The agarose gel was scanned to detect EtBr with a Typhoon 9410 variable mode imager (GE Healthcare Life Sciences). If fluorophore labeled vDNAs were used, the gel was additionally scanned to detect Cy5. DNA bands were quantified using ImageQuant TL software [352]. Integration efficiency, or the fraction of supercoiled (SC) converted to a linear product, was calculated by dividing the pixel volume of concerted integration products (CI) by the total pixel volume of half-site integration (HSI), CI and SC bands (HSI+CI+SC) (Appendix B, Figure B.3). Since intasomes are fluorophore labeled, the HSI and CI products were also quantitated by fluorescence.

Fractions with the highest integration activity, which also corresponded to the peak concentration fractions, were flash frozen in 5 μL aliquots and stored at -80°C. Intasomes that undergo one freeze/thaw cycle maintain activity (Appendix B, Figure B.4). For simplicity the intasomes are referred to only by the outer monomer identity, such as PFV

FL, PFV (∆NED, ∆NTD) or PFV (∆CTD).

3.3.5 Integration reactions

PFV intasome integration reactions were performed as described in 3.3.4 and

Figure 1b with the following modifications. Time course reactions were in a total volume of 67.5 µL with 15 µL removed at each time point. Preincubation experiments were incubated at 37°C for 5 min before the addition of target DNA. Small molecules added to stabilize intasomes were 5 mM or 25 mM protocatechuic acid (PCA, MP Biochemicals or

3,4 dihydroxybenzoic acid, Sigma Aldrich), 0.1 mg/mL acetylated BSA (Promega), 5%

DMSO (Sigma Aldrich), 10% glycerol (Sigma Aldrich), 10% sucrose (>99.9%, Fisher 55

Scientific), 10% polyethylene glycol 6000 (Sigma Aldrich) in 15 µL reaction volume.

Reactions with PCA included 30 mM Bis-Tris propane, pH 7.5 (Sigma Aldrich). Reactions were performed with two independent preparations of all intasomes. Experiments were performed at least three times, unless noted. Agarose gels were scanned for Cy5 and EtBr fluorescence by a Typhoon 9410 variable mode fluorescent imager (GE Healthcare). Lane intensities were analyzed using GelAnalyzer software (Lazar Software). Smear signal was quantified as cumulative signal above the gel background. The differential rate equation for the initial change in concentration of supercoiled plasmid [SC] can be written as:

푑[푆퐶] ( ) = 푘푐푎푡 [푆퐶]0[퐼푁]0 Eq.1 푑푡 푖푛푖푡푖푎푙

In the experiment [IN]0 and [SC]0 are constant. The kcat is calculated with Eq. 1 and the decay curves of SC from EtBr stained gels. The left term can be calculated by the first derivative of the initial decay of [SC]. The [SC] decay curves were fit with exponential decay trend lines. kcat is in units of (1/(nM*min)). The rate of instability was determined by fitting an exponential decay function to Cy5 vDNA intensity over time: Y = A(1 - e-kt), where k is the value of the rate of instability.

3.3.6 Single molecule magnetic tweezers (smMT)

Experiments were performed as previously described [269]. Briefly, flow cells were engineered with glass cover slides attached to an aluminum chip. Prior to attachment the glass slides were treated with (3-Aminopropyl) triethoxysilane followed by a 1:100 mixture of Biotin-PEG SVA to mPEG-SVA (Invitrogen). Plasmid pET-29a was digested with EcoRI and SphI yielding a 4967 bp linear fragment, where biotin and digoxigenin-

56 labeled ends were added. NeutrAvidin (500 mm, Invitrogen) was injected in the flow cell at a rate of 8 µL/min, followed by the digested product. Tosylactivated M-280 SPM

Dynabeads (ThermoFisher Scientific) were coated with anti-digoxigenin antibodies and injected into the flow cell. The bound DNA was washed extensively with integration buffer. Introduction of supercoils used two 1 cm3 rare earth magnets (Neodynium,

Magcraft). For PFV integration experiments, the DNA was wound clockwise with 10 complete turns of the magnets to induce negative supercoils. The SPM beads were imaged using a 530 nm LED lamp (Thorlabs), a 40X Olympus oil immersion objective and images collected on a 1024 x 1024 pixel charge coupled device (CCD) camera (Grasshopper

Express 1.0 MP Mono FireWire 1394b) at a frame rate of 100 ms for at least 1800 s. The time measured between the two strand transfer events is defined as ΤST.

3.3.7 Binding experiments

PFV intasomes with biotinylated viral donor DNA were added to supercoiled plasmid pMP2 in 50 mM HEPES, pH 7.5, 110 mM NaCl, 1 mM DTT, 10% glycerol, 0.1%

Tween-20, 1 µg/mL acetylated BSA, and 0.03 mM EDTA in a total volume of 35 µL.

Reactions were incubated on ice for 20 min and then at ambient temperature for 30 min.

Streptavidin conjugated magnetic beads (Dynabeads M-280 streptavidin, Thermo Fisher) were added and reactions were incubated at ambient temperature for 1 hour with rotating.

Beads were washed three times with reaction buffer. Following the final wash, beads were resuspended in PBS and boiled for 10 min. Half of the reaction was analyzed by 12% SDS- polyacrylamide gel electrophoresis (PAGE) and half was analyzed by 1% agarose gel stained with EtBr. Reactions were performed twice with two independent preparations of 57 intasomes. Agarose gels were scanned for EtBr fluorescence by a Typhoon 9410 variable mode fluorescent imager (GE Healthcare). Coomassie blue stained PAGE gels were imaged with an Epson Perfection V37 scanner. Lane intensities were analyzed with

GelAnalyzer software (Lazar Software).

3.3.8 Aggregation experiments

25 nM PFV FL intasomes in 10 mM Bis-Tris propane, pH 7.5, 5 mM MgSO4, 4

µM ZnCl2, and 10 mM DTT in a final volume of 100 µL were incubated at 37°C for 5 min.

Samples included the indicated amount of NaCl or PCA. Samples with PCA were in the presence of 110 mM NaCl and 30 mM Bis-Tris propane. Following incubation, the samples were centrifuged at 18,000 g for 30 min at 4°C. Pellets were resuspended in 1X Laemmli buffer, boiled, and analyzed by 12% SDS-PAGE. Gels were stained with Coomassie brilliant blue and scanned with a Sapphire biomolecular imager (Azure). The experiment was repeated three times with at least two independent intasome preparations. Lane intensities were analyzed with GelAnalyzer software (Lazar Software).

3.4 Results

3.4.1 Intasome outer CTDs reduce integration product accumulation

The PFV IN NED, NTD, and CTD of the outer intasome monomers were assayed for their roles during integration into a supercoiled plasmid. Recombinant PFV intasomes were assembled with Cy5 fluorescently labeled DNA oligomers mimicking the viral cDNA ends and purified by size exclusion chromatography (Figure C.1) [271]. When added to a supercoiled plasmid target DNA, PFV intasomes readily perform integration. The major

58 product of PFV intasome integration is the joining of two viral DNA donors to the plasmid resulting in a linearized product, termed concerted integration (Figure 3.1b, CI). A minor product is the integration of only one viral DNA donor yielding a tagged circle, called half- site integration (Figure 3.1b, HSI). The significance of HSI during infection is unclear. A third product may occur when the viral donor DNA is used as a target of integration, termed autointegration (AI). The products of integration assays in vitro may be resolved by agarose gel electrophoresis. Unreacted target DNA has the mobility of supercoiled plasmid, CI products appear as linear plasmid, and HSI products appear as nicked relaxed circles. More than one CI event to a single plasmid results in DNA fragments that are shorter than the linear plasmid and produce a smear of CI products. Unreacted viral donor DNA and AI products have the fastest mobility. EtBr analysis reveals all DNA forms while fluorescent image analysis quantifies unreacted viral donor and integration products (Figure 3.2a).

PFV intasomes assembled from FL inner and outer monomers were assayed for integration over time (Figure 3.2). The EtBr image indicates that the decrease in band intensity of the supercoiled plasmid is complete by 5 min of incubation (Figure 3.2b, SC plasmid is 21% of the signal intensity within the lane). After 5 min, there is no further reduction of supercoiled plasmid. Similarly, the accumulation of EtBr stained linear and smear CI products (L-CI and S-CI, respectively) reaches a maximum (76%) after 5 min.

Cy5 fluorescence quantitation reveals that the major integration products for FL intasomes are CI visible as linear DNA and a smear (Figure 3.2c). HSI products are minimal with

PFV FL intasomes. Linear CI products are maximal at 1 min of incubation (8% of the fluorescent signal within the lane), while the smear CI products accumulate until 5 min

59

(19%), indicating multiple integration events to a single plasmid. The fluorescent unreacted viral donor decreased until 5 min (72% of signal) inversely correlating with the accumulation of integration products, indicating that integration events lead to the smear

CI products (Figure 3.2c).

Figure 3.2. Time courses of integration by FL and truncation mutant PFV intasomes PFV intasomes, including FL, ∆NTD, and ∆CTD, with Cy5 fluorescently labeled viral DNA were assayed for integration into a supercoiled plasmid over time. PFV FL intasomes were also assayed in the presence of 300 mM NaCl. (a) Integration products were separated by agarose gel electrophoresis and imaged for EtBr (top) and Cy5 (bottom) fluorescence. (b) The EtBr intensity of supercoiled plasmid is shown as the fraction of signal within each lane. The fraction of signal that is CI is the sum of the intensities of the linear band, the smear between linear and supercoiled bands, and the smear below the supercoiled band. (c) The relative Cy5 intensity within each lane is shown for the viral donor band (donor), the linear CI product band (L-CI), the HSI nicked circle band, and the smear of concerted integration products between the linear band and the viral donor (S-CI). Experiments were performed at least three times with at least two independent intasome preparations. Error bars indicate standard deviation. All experiments designed and performed by RMM. Figure and analysis by NDJ.

60

Integration kinetics of truncation mutants of the outer intasome subunits were compared to the FL intasomes (Figure 3.2). Intasomes were assembled from full length

PFV IN(K120E) as the inner monomers and truncation mutants of PFV IN(D273K) as the outer monomers. Deletion of the outer NED and NTD domains (for simplicity referred to as ∆NTD) resulted in CI kinetics similar to FL intasomes. The supercoiled plasmid decreased until 5 min (23%, Figure 3.2b). Similarly, the accumulation of Cy5 fluorescent

HSI (1%) and linear CI products (10%) were nearly equivalent to FL intasomes and complete at 5 min. However, the accumulation of smear CI products increased from 16% at 5 min to 21% at 10 min (p = 0.0041). Thus the PFV ∆NTD intasomes display nearly equal accumulation of integration products but are active longer compared to FL intasomes.

More dramatic differences were observed with deletion of the outer CTD domains

(∆CTD) compared to FL intasomes. EtBr stained gel images suggest a complete disappearance of the supercoiled plasmid target by 5 min incubation (Figure 3.2a).

However, quantitation of the EtBr stained supercoiled plasmid could be spurious due to smear CI products at the same mobility. The Cy5 fluorescent image revealed that significantly more PFV ∆CTD smear CI products (30%) accumulated at 5 min compared to FL (19%, p = 0.027). These data suggest that the presence of the outer intasome monomer CTDs reduces or inhibits integration. The data also suggest that deletion of either the NTD or CTD on the outer monomers alters yield of integration products.

3.4.2 Catalytic activity of intasomes

The majority of PFV intasome products are CI with nearly undetectable HSI.

However, all of the intasomes tested displayed fluorescent HSI products at 1 min of 61 incubation (Figure 3.2). This minor product disappeared by 5 min. It is possible that the

HSI products were the substrate for a subsequent CI event. Alternatively, the data could suggest that HSI products captured at 1 min were an intermediate of a CI reaction. To test this second hypothesis, the time between strand transfer events was measured by magnetic tweezers. Previous measurement of the time between PFV FL intasome strand transfer events was 0.47 sec [269]. Quantitation of the time between strand transfers for PFV FL intasomes for this study indicated 0.49 sec and was not significantly different from the previous report (Table 3.1). The time between strand transfers for PFV ∆NTD intasomes was 0.55 sec and PFV ∆CTD intasomes was 0.61 sec. Compared to FL intasomes these times are not significantly different (∆NTD p = 0.74, ∆CTD p = 0.49). This data argues against a model that the HSI events observed at 1 min are an intermediate of CI. It seems more likely that HSI events captured at 1 min are used as a target for CI events.

ΤST ΤRE FL 0.49 ± 0.10 sec N=38 0.26 ± 0.09 sec N=33 ΔNTD 0.55 ± 0.12 sec N=15 0.21 ± 0.09 sec N=12 ΔCTD 0.61 ± 0.10 sec N=47 0.23 ± 0.11 sec N=29 PCA 0.46 ± 0.14 sec N=20 0.22 ± 0.06 sec N=26

Table 3.1. PFV integration kinetics Using smMT the time it takes for the supercoiled DNA to relax after the first strand transfer (ΤRE) and the time between first and second strand transfers (ΤST) were calculated. FL, full-length PFV IN; PCA, FL PFV IN + PCA; N, number of events. Experiments and analysis by NDJ and LEBJ.

The catalytic activity of the intasomes appeared to diminish after 5 min (Figure

3.2). However, the intasomes showed differing amounts of CI products after 30 min

(Figure 3.2c). One explanation could be the catalytic rate differs between FL intasomes and truncation mutants. Early time points and a differential rate equation were used to determine and compare the initial catalytic activity (kcat) of the intasomes (Figure C.2).

62

The initial kcat was a function of rate of supercoiled plasmid loss at one minute and concentration of both intasome and plasmid (Figure C.2, Methods). The kcat of FL and truncated intasomes were similar suggesting that deletion of the outer monomer domains did not affect the catalytic efficiencies of the complexes (Figure C.2b).

3.4.3 PFV intasome affinity for target DNA

The increased integration product yield observed with PFV ∆CTD intasomes could be due to a greater affinity for supercoiled plasmid DNA. In this scenario the outer PFV

IN CTDs may block target DNA binding or access to the active sites of the inner monomers. To test affinity for supercoiled plasmids, PFV intasomes were assembled with biotinylated viral donor DNA. The intasomes were added to supercoiled plasmid DNA and precipitated with streptavidin conjugated magnetic beads. DNA and proteins associated with the beads were evaluated by agarose electrophoresis and SDS-PAGE, respectively

(Figure C.3). Control reactions indicated that intasomes effectively associated with the beads, but plasmid DNA alone did not (not shown). There was no significant difference between the amount of plasmid associated with FL, ∆NTD, or ∆CTD intasomes (∆NTD p

= 1.0, ∆CTD p = 0.83). This data suggests that altered affinity for target DNA does not account for the observed differences in integration product accumulation.

3.4.4 PFV intasome stability

The PFV FL intasomes appeared to have little or no activity following incubation for 5 min (Figure 3.2). In contrast, both truncation mutant intasomes displayed some increase of CI products after 5 min. The loss of FL intasome activity could be due to a loss

63 of stability, either through disassembly or aggregation. To test for stability effects on integration activity, fluorescently labeled intasomes were incubated at 37°C for variable time without target DNA. After this preincubation, target DNA was added and the accumulation of integration products in 5 min was assayed (Figure 3.3a). Without preincubation, FL intasomes display detectable CI events as linear and smear products.

However, these products are not apparent after 5 min preincubation. Similarly, the viral donor DNA is reduced to 80% of the total fluorescent signal without preincubation, but is nearly 100% at all preincubation times (Figure 3.3b).

In contrast, PFV ∆NTD intasomes were more resistant to preincubation. The accumulation of PFV ∆NTD intasome integration products was approximately equal to FL intasomes without preincubation. However, PFV ∆NTD intasomes retained 2% linear CI products after a 5 min preincubation and maintained the ability to generate a small amount of smear CI products (5%) even after a 30 min preincubation (Figure 3.3b). The concomitant 95% lane intensity of viral donor suggests that the smear is due to CI events.

PFV ∆CTD intasomes appeared to retain more linear CI over time compared to FL or ∆NTD intasomes (Figure 3.3b). ∆CTD intasome linear CI products continued to accumulate after 10 min preincubation. Smear CI products reached a plateau (3%) after 10 min preincubation, but remained constant through 30 min preincubation, similar to ∆NTD intasomes (Figure 3.3b). Together this data suggests that FL intasomes are the most sensitive to preincubation at 37°C, while truncation mutant intasomes retain integration activity even after 30 min preincubation.

64

Figure 3.3. PFV intasome activity following preincubation PFV intasomes with Cy5 labeled viral donor were incubated for variable time at 37°C without target DNA. Following the preincubation, supercoiled plasmid target DNA was added to the reaction and incubated for a further 5 min. (a) Reaction products were separated by agarose gel electrophoresis stained with EtBr (top) and imaged for Cy5 fluorescence (bottom). (b) Fluorescent products were analyzed and expressed as the fraction of fluorescent signal in each lane. Experiments were performed at least three times with at least two independent intasome preparations. Error bars indicate standard deviation. NC, nicked circle. L-CI, linear CI products. SC, supercoiled plasmid. S-CI, smear CI products. Donor, viral donor. All experiments designed and performed by RMM. Figure and analysis by NDJ.

HSI and CI products appeared to be absent when FL intasomes were subjected to a preincubation. However, the intasomes could still retain undetected AI activity. The AI activity of FL intasomes was evaluated by incubation at 37°C without added target DNA

(Figure 3.4). Similar to results seen with added supercoiled plasmid target DNA, the AI activity of FL intasomes was static after 5 min (Figures 3.2 and 3.4).

65

Figure 3.4. PFV intasome autointegration activity PFV intasomes with Cy5 labeled viral donor DNA were incubated for variable time at 37°C in the absence or presence of 5 mM PCA. (a) Reaction products were separated by agarose gel electrophoresis and imaged for Cy5 fluorescence. (b) Fluorescent products were analyzed as a fraction of total fluorescent signal in each lane. There appears to be similar AI product accumulation regardless of PCA addition. All experiments designed and performed by RMM. Gels run by MAL. Figure and analysis by NDJ.

Historically, additives have been added to retroviral integration reactions to enhance activity. These additives include BSA, DMSO, glycerol, or PEG 6000 [270, 362-

365]. Their ability to enhance the stability of PFV FL intasomes was assayed (Figure 3.5).

66

PFV FL intasomes were preincubated for 5 min in the presence of the additives. PCA, commonly used in oxygen scavenging systems, and sucrose were included in addition to the previously reported additives. Following the preincubation, target DNA was added and the reactions were incubated for an additional 5 min.

Figure 3.5. Rescue of PFV intasome activity by additives present during preincubation PFV FL intasomes were incubated at 37°C for 5 min. Following the preincubation, target DNA was added and reactions were incubated for an additional 5 min at 37°C. Additives included in the reactions were: 5 mM PCA (PCA), 0.1 mg/mL acetylated BSA (BSA), 5% DMSO (DMSO), 10% glycerol (Gly), 10% sucrose (Suc), and 10% PEG 6000 (PEG). Control reactions include no preincubation (No Preinc) or no addition of an additive (-). Fluorescent products were analyzed and expressed as the fraction of signal in each lane (bottom). Experiments were performed at least three times with at least two independent intasome preparations. Error bars indicate standard deviation. All experiments designed and performed by RMM. Figure and analysis by NDJ. 67

Preincubation of PFV FL intasomes for 5 min significantly reduced the yield of CI products (Figure 3.5). Smear CI products were reduced from 15% of the fluorescent signal to 10.5%, the linear CI products were reduced > 5 fold from 9.4% to 1.6% (Figure 3.5, bottom). Addition of 5% DMSO had no effect on the accumulation of integration products.

The other additives displayed a greater effect on the accumulation of linear CI products compared to smear CI products. The presence of 10% glycerol, 10% sucrose, or 10% PEG

6000 increased the observed linear CI products to a similar extent (4.6%, 4.3%, and 4.6%, respectively). Inclusion of 0.1 mg/mL acetylated BSA was better able enhance linear CI following a preincubation (6.4%). However, the small molecule that showed the greatest ability to rescue linear CI products following preincubation was 5 mM PCA (8.8%). PCA showed no effect on the average time between strand transfer reactions of FL intasomes when tested with magnetic tweezers (Table 3.1). This small molecule has not previously been reported as a crowding agent or a stabilizing agent for protein complexes.

The effects of PCA were assayed with FL and truncation mutant intasomes (Figure

3.6). Intasomes were incubated at 37°C for variable time in the presence of PCA without target DNA. Following preincubation, target DNA was added and reactions were incubated for an additional 5 min (Figure 3.6a). All intasomes show greater CI activity in the presence of PCA. HSI products were negligible (< 1%) for all intasomes. Viral donor DNA intensity curves show a marked difference between with and without PCA (compare

Figure 3.3b to Figure 3.6b). PFV FL intasomes were inactive after 5 min preincubation in the absence of PCA, but retained CI activity after 15 min preincubation in the presence

68 of PCA. The FL intasome smear CI products were the most affected without preincubation, accumulating 10% and 28% in the absence or presence of PCA, respectively.

Figure 3.6. PFV intasome activity following preincubation in the presence of PCA PFV intasomes with Cy5 labeled donor DNA were incubated for variable time at 37°C with PCA but without target DNA. Following preincubation, supercoiled plasmid target DNA was added to the reaction and incubated for another 5 min. (a) Reaction products were separated by agarose gel electrophoresis stained with EtBr (top) and imaged for Cy5 fluorescence (bottom). (b) Cy5 fluorescent products were analyzed and expressed as the fraction of signal in each lane. (c) Rate of increase in Cy5 donor with and without PCA (rate of instability). Addition of PCA correlates with a decrease in the rate of donor accumulation. Reactions were performed in the presence of 5 mM PCA. Experiments were performed at least three times with at least two independent intasome preparations. Error bars indicate standard deviation. NC, nicked circle. L-CI, linear CI products. SC, supercoiled plasmid. S-CI, smear CI products. Donor, viral donor. All experiments designed and performed by RMM. Figure and analysis by NDJ. 69

PCA was also able to enhance the stability of truncation mutant intasomes. PFV

∆NTD intasomes were minimally active displaying only smear CI products (5%) after 10-

30 min preincubation (Figure 3.6b). In the presence of PCA, linear CI products (3%) continued to accumulate after 30 min preincubation and smear CI products steadily decreased from 13% to 5% between 0 and 15 min preincubation. The smear CI products remained constant between 15 and 30 min preincubation. PFV ∆CTD intasome linear CI products were also affected by the addition of PCA during preincubation. The linear CI products were 9% of the lane intensity after 30 min preincubation, but were not present at this time point without PCA. Smear CI products were increased between 0 and 30 min preincubation when PCA was added.

In order to evaluate the effect of PCA on intasome stability, the fluorescent viral donor DNA data were fit to an exponential curve to obtain k, the rate of unreacted viral donor accumulation over time (Figure 3.6c, rate of instability). Unreacted viral donor DNA is a measure of intasomes that do not participate in integration. This inactivity may be due to instability, either disassembly or aggregation. This analysis revealed that FL intasomes are 3 fold less active than ∆CTD intasomes in the absence of PCA. The addition of PCA increased FL intasome activity 3 fold. Interestingly, PCA was able to stabilize or increase the activity of ∆CTD intasomes (5.3 fold) to a greater extent than the increase of FL intasome activity. This data suggests that the mechanism of ∆CTD intasome stability and activity is at least partially distinct from PCA mediated effects.

70

3.4.5 Non-physiological high salt concentration

Previous studies of PFV intasomes have included buffers with salt concentrations higher than physiologically relevant [240]. PFV intasomes appear to be relatively stable in conditions of higher ionic strength and are purified in the presence of 320 mM NaCl [271].

The activity of FL intasomes over time was measured in the presence of 300 mM NaCl

(Figure 3.2). The increased ionic strength of the buffer led to altered integration kinetics.

The band of supercoiled plasmid was slower to decrease in intensity and did not decrease to the same extent (26%) seen under more physiological conditions (18%) (Figure 3.2b).

The fluorescent linear CI products were slightly increased and reached saturation at 5 min in 300 mM NaCl (Figure 3.2c). However, the fluorescent smear CI products continued to accumulate throughout the 30 min incubation. FL intasome rate of integration was dramatically altered with higher salt conditions (Figure 3.3). After 1 min incubation, the rate of integration was 8.75 fold faster in the presence of 110 mM NaCl compared to 300 mM NaCl. However, at subsequent times FL intasomes displayed a slower rate of integration in physiological ionic conditions. These data suggested that high salt concentration alters FL intasome activity kinetics, but allows for longer intasome lifetime.

Instability of PFV FL intasomes could be due to disassembly or aggregation. To test the propensity to aggregate, FL intasomes were incubated for 5 min at 37°C and immediately centrifuged at 4°C for 30 min. Pellets were analyzed by SDS-PAGE for precipitated IN (Figure 3.7). Comparison of FL intasome aggregation at variable salt concentration reveals 5.6 fold less IN precipitation at 300 mM NaCl. The addition of 5 mM

PCA was able to prevent some aggregation, reducing the precipitate to 76%. The effect of

71

PCA was concentration dependent with 25 mM PCA reducing precipitated protein to 24%.

The ability of zinc ions to participate in intasome aggregation was also evaluated. FL intasomes in the presence of 110 mM NaCl with or without ZnCl2 were found to display no difference in aggregation (Figure 3.7b). These data suggest that incubation at 37°C promotes aggregation of PFV FL intasomes. Aggregation may be prevented by conditions of increased ionic strength or addition of small molecule PCA.

Figure 3.7. PFV intasome aggregation PFV FL intasomes were incubated at 37°C for 5 min. Reactions were then centrifuged to pellet aggregates. Pellets were analyzed by SDS-PAGE stained with Coomassie blue. (a) Reactions included 110 mM NaCl with no PCA, 300 mM NaCl with no PCA, 110 mM NaCl with 5 mM PCA, or 110 mM NaCl with 25 mM PCA. Precipitated PFV IN is expressed relative to reactions with 110 mM NaCl and no PCA. (b) FL intasomes were incubated in the presence or absence of ZnCl2. Precipitated PFV IN is expressed relative to reactions with ZnCl2 present. Experiments were performed at least three times with at least two independent intasome preparations. Error bars indicate standard deviation. All experiments designed and performed by RMM. Figure and analysis by NDJ.

72

3.5 Discussion

Outer domains of the PFV intasome were not visualized in a crystal or cryo-EM structure [234, 240]. This observation could suggest that these domains play no role in catalysis. A previous study of PFV intasomes compared FL IN to CCD only outer monomers [366]. This study was performed without use of PFV IN(K120E) and

IN(D273K) point mutations [240]. Instead authors employed an elegant purification scheme [366]. The study concluded that outer amino and carboxyl terminal domains are not necessary for intasome assembly or integration. Using point mutations to target truncation mutants to the outer intasome monomers, we were able to confirm and extend the previous report.

PFV IN NED and NTD domains from the outer monomers displayed minimal effects on intasome activity compared to FL intasomes. Deletions of the outer PFV IN

CTDs had more dramatic effects on accumulation of integration products. CTDs of retroviral INs have been implicated in tethering intasomes to targets, although it has not been possible in most cases to assign this interaction to inner or outer monomers. The murine leukemia virus IN CTD interacts with the host BET proteins and avian leukosis virus IN CTD similarly interacts with the FACT complex to tether intasomes to chromatin

[286, 288, 367]. PFV IN CTDs of both inner and outer monomers appear able to bind the amino terminus of the host H2A histone protein [240]. In addition to protein binding, retroviral IN CTDs have DNA binding activity [368]. We found that outer monomer CTDs or NTDs have no effect on intasomes binding to supercoiled plasmid DNA.

73

Deletion of outer domains seems to enhance the stability of PFV intasomes at 37°C.

The relatively low stability of FL intasomes appears due to aggregation. It has previously been shown that protein interface regions contribute to aggregation more than other protein surfaces [369]. IN amino and carboxyl terminal domains play multiple roles in binding viral and cellular DNA, other IN monomers, and host proteins [234, 240, 286, 288, 296,

367, 368]. The surfaces of outer monomers may play a significant role in aggregation of

FL intasomes. This type of aggregation would not be predicted to occur in vivo since cellular infection includes a single intasome as opposed to the nM concentrations in biochemical reactions.

Since outer monomer amino and carboxyl terminal domains appear dispensable for catalysis, more stable retroviral intasomes assembled with truncation mutants may advance studies of these complexes. To date point mutations that direct IN to the inner or outer subunits have only been described for PFV [240]. The purification method previously described for PFV intasomes with only CCD outer monomers may be an alternative for other retroviral intasomes [366]. Alternatively, small molecule PCA may prevent aggregation of FL retroviral intasomes at physiologically relevant ionic strength.

Although increased concentration of NaCl was also able to prevent aggregation of

PFV FL intasomes, study of intasome activity with supercoiled plasmid DNA is not likely to produce physiologically relevant data. The kinetics of CI product accumulation with FL intasomes at 110 mM or 300 mM NaCl were exceptionally different. Increased NaCl concentration increases DNA twist by 0.03°/bp, compacting the supercoiled DNA, and possibly generating a less favored target for PFV IN [370, 371]. Physiologically relevant

74 salt concentration allows loose dynamic configurations of circular DNA [370]. Although retroviral INs may retain catalytic activity at higher salt concentrations, the effects of ions on target DNA conformation should be considered. Increased ionic concentration allows for closer interactions between segments of a negatively charged target DNA molecule, possibly limiting interfaces for PFV integration. In contrast, truncation mutants or PCA do not alter the target DNA conformation at physiologically relevant conditions suggesting that these approaches will yield more relevant data than studies performed under non- physiologic conditions.

75

Chapter 4. Retroviral integrase drug resistant mutant displays a novel mechanism

of reduced viral fitness

This chapter is based on work in preparation for Virology:

Mackler RM, Jones ND, Lopez Jr. MA, Messer RK, Yoder KE. Retroviral integrase drug resistance mutant displays a novel mechanism of reduced viral fitness. Virology. In preparation.

4.1 Abstract

Retroviral integrase (IN) is responsible for incorporating viral DNA into the host genome. IN strand transfer inhibitors (INSTIs) are quite effective, but drug resistance mutations such as HIV-1 IN N155H have arisen. Infection of cells with HIV-1 IN N155H leads to decreased infectivity and increased aberrant integrations with large insertions and deletions. This phenotype with HIV-1 IN N155H or its corresponding mutation in prototype foamy virus (PFV) IN N224H is not understood. Integration kinetics and activity were evaluated comparing wildtype PFV IN and PFV IN N224H. The point mutant had severely reduced integration, which was due to its instability. Stability was enhanced by small molecule PCA or neurotransmitters dopamine, norepinephrine, and adrenaline. Virus carrying drug resistance mutant PFV IN N224H (HIV-1 IN N155H) has reduced fitness

76 due to complex instability. This instability can be rescued by neurotransmitters, suggesting that this may enhance infection in the brain.

4.2 Introduction

Retroviruses have two unique processes compared to other viruses: reverse transcription of their single-stranded RNA genome into complementary DNA (cDNA) and integration of the cDNA into the host genome. Incorporation of the viral genome into the host genome is catalyzed by virally encoded protein integrase (IN).

A crucial landmark in retrovirus HIV-1 treatment was the development of an IN strand transfer inhibitor (INSTI) raltegravir, which turned HIV-1 into a chronic manageable infection from a deadly disease [323, 324]. Drug resistance has developed to raltegravir including HIV-1 IN N155H. This drug resistance mutant has been reported to be 14 fold less susceptible to raltegravir but has only 12% activity compared to wild type

(WT) [323]. This conserved residue corresponds to prototype foamy virus (PFV) IN N224.

PFV IN N224H has 10% activity in vitro and a two-fold reduction in raltegravir susceptibility [372]. In cells, HIV-1 IN N155H virus exhibited a 30% reduction in replication competency [373].

Interestingly, sequencing integration sites from HIV-1 IN N155H virus infection showed that infection with this virus resulted in “aberrant” integration sites containing large insertions and deletions [374]. The hypothesized mechanism for this phenotype was that HIV-1 IN N155H incorporates only one end of the cDNA. This single-end integration product was previously only seen in vitro, known as half-site integration. Half-site

77 integration products in vivo would then be resolved by DNA repair mechanisms, resulting in large insertions and deletions.

Here we sought to elucidate the mechanism leading to aberrant integration using

PFV IN N224H. We also tested the effects of small molecule protocatechuic acid (PCA) and neurotransmitters dopamine, norepinephrine, and adrenaline on WT PFV IN and PFV

IN N224H activity.

4.3 Materials and Methods

4.3.1 Purification of PFV integrase and intasomes

PFV IN was expressed purified as previously described [352, 361]. Point mutant

PFV IN(N224H) was expressed and purified in the same manner as WT.

Intasomes were assembled as described previously and in Chapter 3 using unlabeled or fluorescently labeled oligomer DNA that mimic 3’ preprocessed viral cDNA ends (vDNA) [271].

4.3.2 Single molecule magnetic tweezers (smMT)

Experiments were performed as previously described and in 3.3.6 [269].

4.3.3 Integration reactions

PFV integration reactions were performed as described and in 3.3.5 with some adjustments [271]. Some samples included 25 mM of protocatechuic acid (PCA, MP

Biochemicals or 3,4 dihydroxybenzoic acid, Sigma Aldrich), dopamine (dopamine hydrochloride, Direct Resource Inc.), norepinephrine (DL-norepinephrine hydrochloride,

78

Sigma Aldrich), or adrenaline ((±) epinephrine hydrochloride, Sigma Aldrich), as indicated. Experiments were performed at least three times, unless noted. Agarose gels were scanned for Cy5 and ethidium bromide (EtBr) fluorescence by a Typhoon 9410 variable mode fluorescent imager or Amersham Typhoon RGB biomolecular imager (GE

Healthcare). Band intensities from the Cy5 or EtBr image of each gel were analyzed using

AzureSpot 2.0 (Azure Biosystems). Smear concerted integration was quantified as the intensity above gel background between concerted linear and excess vDNA bands, excluding the supercoiled DNA band in the EtBr image.

4.4 Results

4.4.1 Strand transfer timing of mutant PFV IN N224H

To test the hypothesis that PFV IN N224H has slower strand transfer kinetics leading to more half-site integration, timing between the first and second strand transfers was measured using smMT. It was previously shown that the timing is ~0.5 s for wild-type

(WT) PFV IN [269]. However, there were initially no detectable integration events for PFV

IN N224H (Figure 4.1A). Upon addition of small molecule protocatechuic acid (PCA), which has been shown to stabilize intasomes (Chapter 3), integration events were able to be detected for both WT PFV IN and PFV IN N224H (Figure 4.1A). Interestingly, although the average strand transfer timing (ΤST) is not significantly different with and without PCA, the distributions are different. Using the Kolmogorov-Smirnov test, ΤST values for WT with and without PCA have statistically different distributions (p = 0.019).

In the presence of PCA point mutant PFV IN N224H does not significantly alter strand

79 transfer kinetics compared to WT with PCA (Figure 4.1A, p = 0.06). In addition, the distribution of ΤST values have the same distribution for WT and PFV IN N224H in the presence of PCA (p = 0.332). All 3 sets of ΤST values are not normally distributed according to the Shapiro test (p < 0.01). We also observed that none of these conditions alter the proportion of events that are half-site (Figure 4.1B).

Figure 4.1. smMT comparison of PFV WT and N224H intasomes (A) smMT were used to measure the timing between strand transfer events (ΤST) for WT and N224H PFV intasomes ± PCA. No events were detected for N224H PFV intasomes without PCA. N, number of events. (B) The percentage of half-site integration (HSI) events during smMT experiments.

80

4.4.2 Integration activity of mutant PFV IN N224H

smMT can provide useful, real-time information about enzyme kinetics. However, it has some limitations that may have masked differences between WT PFV IN and PFV

IN N224H. Thus, integration assays comparing the activities of these two intasomes were evaluated to complement the smMT data. Integration assays utilize a 3 kilo-base (kb) supercoiled plasmid. If half-site integration occurs, the nick introduced releases the supercoils and the product runs as a relaxed circle (Figure 4.2A). Concerted integration causes a double-strand break, resulting in a linear product. If concerted integration occurs in the already linearized DNA, this results in a smear. These species are able to be separated on a 1% agarose gel (Figure 4.2B).

In comparing the two intasomes, PFV IN N224H has significantly reduced integration efficiency, explaining why no events were recovered in smMT assays (Figure

4.2C, p < 1 x 10-4). Addition of PCA partially rescued this PFV IN N224H integration deficiency, increasing relative integration from 8% compared to WT to 74% (- PCA vs. +

PCA, p = 0.002). PFV IN N224H also exhibited a significantly larger proportion of half- site integration products, which was also rescued by PCA (Figure 4.2; WT vs. N224H, p

= 0.02; N224H - PCA vs. + PCA, p = 0.03). Production of more half-site products is consistent with data in cells that saw more aberrant integrations with the corresponding

HIV-1 IN N155H [374].

81

Figure 4.2. PFV IN N224H integration efficiency (A) PFV intasomes containing viral DNA oligomers mimicking the U5 end of viral cDNA (vDNA) are incubated with a supercoiled DNA (SC). This in vitro assay results in two products: half-site integration (HSI) product with only one vDNA covalently joined and concerted integration (CI) product with both vDNAs joined. Integration induces a nick, relaxing the supercoils so that the HSI product runs as a relaxed circle. Joining of both ends in the CI product results in linearization of the DNA. (B) Integration reactions were performed using PFV IN WT and PFV IN N224H intasomes containing Cy5 vDNAs in the absence or presence of 25 mM PCA. Samples with PCA also contained 30 mM Bis-Tris propane to maintain pH. Resulting products were resolved on a 1% agarose gel. The gel was scanned to detect Cy5 (top) and EtBr (bottom). Size markers in kb are shown. CI and HSI products were quantified for Cy5 fluorescence. (C) CI was expressed relative to WT - PCA. (D) Percentage HSI contributes to the total integration products was determined. Error bars indicate the standard deviation between at least three independent experiments.

82

4.4.3 Stability of PFV IN N224H intasomes

Since PCA stabilizes WT PFV intasomes, it is likely that this small molecule also stabilizes PFV IN N224H intasomes. To test this, WT or N224H intasomes were incubated at 37°C for varying lengths of time before adding the target supercoiled plasmid and further incubating for 5 min to allow the reaction to occur (Figure 4.3A,B). This reaction was done in the absence or presence of PCA. Both WT and N224H intasomes lost almost all activity by 5 min at 37°C without target (Figure 4.3C). Addition of PCA enhanced stability of both intasomes, with WT PFV intasomes being more stable particularly past 15 min.

This data suggest that the N224H point mutation destabilizes intasomes, as PCA cannot rescue stability as much with N224H compared to WT. The smMT data eliminates the possibility that PCA stabilizes both intasomes equally but N224H is slower to catalyze integration. Therefore, PFV IN N224H is less stable than WT, leading to significantly reduced viral infectivity, reduced integration activity and increased aberrant or half-site integration. Protein complex instability is a novel mechanism of reduced viral fitness.

83

Figure 4.3. N224H intasome stability Integration reactions were performed using (A) PFV IN WT and (B) PFV IN N224H intasomes containing Cy5 vDNAs in the absence or presence of 25 mM PCA. Intasomes were preincubated at 37°C for 0 - 60 min before adding target DNA and further incubation at 37°C for 5 min. Resulting products were resolved on a 1% agarose gel. Gels were scanned to detect Cy5 (top) and EtBr (bottom). Size markers in kb are shown. CI and HSI products were quantified for Cy5 fluorescence. (C) Concerted integration (CI) is expressed relative to 0 min. Error bars indicate the standard deviation between at least two independent experiments.

4.4.4 Neurotransmitters stabilize intasomes

Stabilizing small molecule PCA contains a benzene ring with two hydroxyls and another side chain (Figure 4.4A). It shares much structural similarity to neurotransmitters 84 dopamine, norepinephrine and adrenaline. HIV-1 infection in the brain is still poorly understood, but it has been shown that HIV-1 can infect astrocytes, brain macrophages and microglia [375, 376]. In addition, some AIDS patients exhibit neurological symptoms associated with infection, which has decreased in frequency after introduction of effective antiretroviral therapy (ART) [377, 378].

Figure 4.4. Integration with neurotransmitters (A) Structures of protocatechuic acid (PCA, P) and neurotransmitters dopamine (D), norepinephrine (N), and adrenaline (A) (ChemDraw, PerkinElmer). (B) Integration reactions were performed using WT and N224H intasomes containing unlabeled vDNAs in 30 mM Bis-Tris propane and in the absence or presence of 25 mM PCA or neurotransmitter, as indicated by the letters (P, D, N, A). Resulting products were resolved on a 1% agarose gel. Gels were scanned to detect EtBr. Size markers in kb are shown. CI and HSI products were quantified for EtBr fluorescence. (C) Half-site integration (HSI) and concerted integration (CI) are expressed relative to WT with no additive (-, black bar). Error bars indicate the standard deviation between at least three independent experiments. 85

Therefore, we tested the effect of neurotransmitters on WT PFV IN and PFV IN

N224H activity. These experiments were done in the presence of 30 mM Bis-Tris propane, which alone enhances integration activity. There was not much effect of PCA and neurotransmitters on WT integration activity with the exception of norepinephrine, which has slightly decreased integration (Figure 4.4B,C, p > 0.13 except norepinephrine p =

0.03). However, with less stable N224H intasomes, PCA and all three neurotransmitters enhanced concerted integration (p ≤ 0.05 except norepinephrine p = 0.08). Interestingly, neurotransmitters also significantly increased half-site integration with PFV IN N224H intasomes (p < 0.05).

4.5 Conclusions

We found that raltegravir resistance mutant PFV IN N224H is less fit and active due to its instability. This instability can be rescued using small molecule PCA or neurotransmitters dopamine, norepinephrine, and adrenaline. However, neurotransmitter treatment of PFV IN N224H leads to increased half-site integration.

Thus, the presence of neurotransmitters may be stabilizing preintegration complexes in vivo, allowing for increased infection in the brain. Due to the increase of half- site integration in vitro with PFV IN N224H treated with neurotransmitters, the corresponding drug resistant mutant HIV-1 IN N155H may exhibit more half-site or aberrant integration in the brain. Since the blood-brain barrier prevents the brain from being exposed to high levels of ART, drug resistance can more likely develop [379-381].

Therefore, a high proportion of infected cells in the brain would have defective viruses,

86 which may still cause neuroinflammation [382]. Consistent with our model, others have reported that a majority of viral DNA found in the brain is not replication competent [259].

These findings elucidated a novel pathway to diminished viral fitness wherein PFV

IN N224H intasomes are less stable than WT complexes. This explains the defect in both in vitro integration activity and viral replication assays seen with PFV IN N224H. Further, the phenotypes with neurotransmitters may be important for understanding HIV-1 infection in the brain and should be explored further.

87

Chapter 5. Prototype foamy virus integrase carboxyl terminal domains dictate site

selection into nucleosomes

This chapter is based on work in preparation for Journal of Biological Chemistry:

Mackler RM, Jones ND, Gardner AM, Senavirathne G, Lopez Jr. MA, Altman MP, Fishel

R, Yoder KE. Prototype foamy virus integrase carboxyl terminal domains dictate site selection into. J Biol Chem. In preparation.

5.1 Abstract

Retroviral integrase (IN) is responsible for incorporating the viral cDNA into the host genome. Therefore, IN must access the host DNA in the context of chromatin. For decades retroviral integration has been known to favor distorted regions of nucleosomes, which are the simplest units of chromatin. However, the dynamic search that IN must perform to find an integration site in the context of chromatin remains unclear. Here we have examined at base pair resolution the nucleosome preference of prototype foamy virus

(PFV) intasomes comprised of a tetramer of IN with two oligomers mimicking the viral

DNA ends. Our results suggest two determinants of integration site selection into a mononucleosome: the distortion of the DNA and direct interactions of the intasome and histone octamer. We find that PFV intasome performs local searches on exposed gyres of

88 distorted DNA. Integration site selection is guided by interactions of the IN carboxyl terminal domains (CTDs) with histone tails and with the DNA itself. This study specifically elucidates a role for outer PFV IN CTD in site selection on a nucleosome. Without this domain site selection is significantly altered, showing that this domain alone influences integration search mechanism.

5.2 Introduction

Proteins such as transcription factors, DNA repair enzymes, and others that interact with DNA must do so in the context of chromatin. Chromatin is made of basic units termed nucleosomes, which consist of ~147 base pairs (bp) of DNA wrapped ~1.7 times around a histone octamer with two of each H2A, H2B, H3, and H4. Thus, histone proteins or another gyre of DNA may sterically hinder access to DNA. There are several mechanisms as to how proteins access nucleosomal DNA. Some transcription factors take advantage of transient unwrapping and rewrapping of DNA around the histone core to gain access [383-

387]. DNase I cleaves at exposed gyres of the nucleosome, avoiding buried sites [388].

Retroviral integrases bind to chromatinized DNA to incorporate their viral cDNA into the host genome. The mechanism of how integrase (IN) searches nucleosome DNA is not fully elucidated. Prototype foamy virus (PFV) IN searches linear DNA by 1- dimensional (1D) diffusion [269]. However, 1D diffusion would be limited on a nucleosome, as the histones would block this movement. A cryo-electron microscopy

(cryo-EM) structure shows the PFV IN complex bound at a single site on a mononucleosome [240]. Previous studies showed HIV-1 integration occurred at this

89 nucleosome site, as well as many other positions around the nucleosome [321]. An important question is how the PFV IN complex selects this single site on a nucleosome rather than any other possible exposed region of nucleosome DNA.

PFV IN forms a tetramer in complex with viral cDNA ends, termed an intasome

[234]. The inner two monomers are responsible for catalysis, while the outer monomers are thought to simply stabilize the complex. In the PFV intasome crystal structure, only the catalytic core domains (CCDs) of the outer subunits were able to be resolved. Therefore the roles of these outer domains are not known. In fact, it has been shown that the outer domains other than the CCDs are dispensable for PFV intasome activity in vitro [366].

However, it is not known if these domains have roles in vivo.

Here we seek to understand how PFV intasomes search a recombinant nucleosome.

The most well-studied nucleosome positioning sequence (NPS) is 601. This NPS was derived by the Widom group with systematic evolution of ligands by exponential enrichment (SELEX), selecting a DNA sequence with the highest affinity for the histone octamer [389]. The highest affinity site in the DNA is at the center known as the dyad. The

NPS is numbered 5’ to 3’ from -73 through 0 to +73, where 0 is the dyad central bp. This

NPS has been extremely well-characterized with a wealth of both structural and biophysical data [383-385, 390-394]. Therefore, this body of knowledge will aid in understanding PFV intasome site selection.

Our aim in this study was to utilize 601 mononucleosomes reconstituted with recombinant human histones to evaluate the influence of nucleosome dynamics on PFV integration efficiency and site selection. We found that PFV integration was affected by

90 increasing ionic strength. We determined that the PFV IN carboxyl terminal domains

(CTDs) of the flanking monomers of the intasome complex form important interactions with nucleosomes to determine integration site selection. Finally, we found that integration site selection is also influenced by removal of histone tails, suggesting that these are the sites of interaction for the nucleosome with PFV IN CTDs.

5.3 Materials and Methods

5.3.1 DNA substrates

DNA oligonucleotides containing internal amino modified thymine at the fourth base from the 5’ end (Integrated DNA Technologies) were labeled with Cy5-NHS ester

(GE Healthcare). Labeled oligonucleotides were purified by reverse phase HPLC with a

C18 Poroshella 120 column (Agilent Technologies). The 147 base pair Cy5-labeled 601 nucleosome positioning sequence (NPS) was generated by PCR from pDrive-601 NPS.

The oligonucleotide primer sequences for the 601 NPS are 5’-

CTGTAGAATCCCGGTGCCGAGGCCGCT-3’ and 5’-

ACAGGATGTATATATCTGACACGTGCCTGGA-3’. The DNA constructs were purified by ion-exchange HPLC with a Gen-Pak Fax column (Waters).

DNA oligomers mimicking the 3’ processed PFV U5 end (vDNA) were made as described in 3.3.3.

91

5.3.2 Nucleosomes

Unmodified, recombinant human histones H2A or H2A(K119C), H2B, H3, and H4 were expressed and purified as described [322]. Purified histone H2A(K119C) was labeled with Cy3-maleimide (GE Healthcare). Octamers were refolded at equimolar histone concentrations and purified by gel filtration with Superose 12 10/300 (GE Healthcare).

Nucleosomes were reconstituted with 147 bp 601 DNA and octamer by double dialysis.

The products were separated by sucrose gradient velocity centrifugation. Gradient fractions were analyzed by separation on a native polyacrylamide gel electrophoresis (PAGE) and imaged using a Typhoon 9410 variable mode fluorescent imager (GE Healthcare) (Figure

C.4A). Fractions with fluorescent NPS DNA bound by nucleosomes were combined, concentrated with Amicon Ultra centrifugal filters (EMD Millipore), and stored at 4°C. All experiments were performed with at least two independent nucleosome preparations, derived from independent octamer refoldings.

5.3.3 PFV integration

PFV intasomes were assembled and purified as previously described and in 3.3.4

[269, 271]. All experiments were performed with at least two independent PFV intasome purifications. Integration reactions were performed as described in 3.3.5 but with 15 ng of

NPS DNA in nucleosomes, either full length (FL) or trypsinized (TL) as indicated [271].

Products were ethanol precipitated and then separated by native or denaturing PAGE and scanned with a Typhoon 9410 variable mode fluorescent imager (GE Healthcare) or

Sapphire Biomolecular Imager (Azure). Samples for denaturing gels were resuspended in

80% formamide and 2 mM EDTA, heated for ≥ 15 min at 95°C, and placed directly on ice. 92

PAGE gel analysis was performed using BioNumerics 7.6 (Applied Maths).

Molecular weight calibrations were performed by first fitting the migration of molecular weight standards (GeneScan 120 LIZ Size Standard, ThermoFisher Scientific) to an exponential decay curve. This standard curve was then used to determine the molecular weight of each band (± 3 nucleotides (nt)) depending on pixel position. To quantify the relative amount of DNA represented in each band, the intensity profile along the entire length of a lane was first generated by BioNumerics. Then the integrated area under each band peak was calculated as a fraction of the total signal using MATLAB (MathWorks); referred to as integration efficiency. Individual peaks in a band cluster could not be integrated individually as a result of overlapping pixel density. The data are presented as averages ± standard deviation (s.d.) of at least three independent experiments. P-values were determined using a two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. Total integration efficiency was determined by subtracting the fraction of unreacted NPS from the normalized total signal.

5.3.4 Affinity precipitation

Samples contained 10 μg 601 nucleosomes (EpiCypher) FL or TL, 10 μg PFV intasomes, either wild-type or truncation mutant with biotinylated vDNA, brought to a total of 350 μL in wash buffer (50 mM HEPES, pH 7.5, indicated NaCl concentration, 10% glycerol, 1 mM DTT, 0.1% Tween and 1 μg/mL BSA). Samples were incubated on ice for

20 min followed by room temperature for 30 min. Then 333.5 μL of each sample was combined with 70 μL of prewashed streptavidin-conjugated magnetic beads (Dynabeads

M-280 streptavidin, Invitrogen) that were resuspended in 17.5 μL wash buffer. Samples 93 were allowed to incubate at room temperature for one hour while rotating. The beads were washed 3X with wash buffer. After washing, samples were resuspended in phosphate buffered saline (PBS) and SDS-PAGE dye and were boiled for 10 min. Subsequently, samples were separated on SDS-PAGE. Resulting gels were stained with Coomassie blue, imaged and then quantitated using ImageJ.

The data are presented as averages ± standard deviation (s.d.) of at least two independent experiments. P-values were determined using a two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 2.

5.3.5 Trypsinization

Nucleosomes were trypsinized (Sigma Aldrich) and quenched with soybean trypsin inhibitor (Sigma Aldrich) as described [395]. Trypsinized nucleosomes were confirmed via two methods. FL and TL nucleosomes and free DNA were compared for electrophoretic mobility on a 5% 59:1 native PAGE. FL and TL nucleosomes (400 fmol) were also nonspecifically labeled on the histones in 10 mM Tris, pH 7.5, and 25 mM NaCl with Cy5

NHS Ester (Lumiprobe) for 1 hour at room temperature. Resulting samples were run on

16.5% SDS-PAGE for 1 h at 170 V and 21 h at 230 V. Both types of gels were scanned with the Sapphire Biomolecular Imager (Azure).

5.4 Results

5.4.1 PFV integration into nucleosomes occurs in clusters

Recombinant PFV IN and DNA oligomers mimicking the viral cDNA ends can be assembled into intasome complexes and purified [226, 271]. PFV integration entails two

94 transesterification strand transfer events that covalently join the viral DNA to the target

DNA. These strand transfer events occur 4 bp apart. Integration using PFV intasomes with

DNA oligomers results in a double strand break (Figure 5.1A).

Figure 5.1. PFV integration into 601 nucleosomes (A) Illustration of PFV integration intermediate. Thick lines indicate target DNA. Thin lines indicate short oligomers mimicking PFV viral DNA ends (vDNA). Circles indicate 5’ ends. The two PFV strand transfer events are separated by 4 bp of target DNA, indicated by numbers 0-3. The points of joining introduce nicks in the target DNA. (B) Denaturing PAGE analysis of PFV integration into 601 mononucleosomes with a 5’ Cy5 label on the top strand (T-Cy5 NPS) (left) or bottom strand (B-Cy5 NPS) (right). Cy5 labeled marker is expressed as the nucleosome positions relative to the dyad (+47 to - 58 for T-Cy5 NPS, -47 to +58 for B-Cy5 NPS). Naked 601 DNA without (-, Lane 1) or with (+, Lane 2 and 8) 26 nM PFV intasomes. 601 nucleosomes without PFV intasomes (-, Lane 3 and 9) or with a titration of PFV intasomes (black triangles). The PFV intasome concentrations were 7 nM (Lanes 4 and 10), 13 nM (Lanes 5 and 11), 20 nM (Lanes 6 and 12), and 26 nM (Lanes 7 and 13). (C) Electropherograms of 26 nM PFV intasome gel lanes from T-Cy5 NPS (blue) and B-Cy5 NPS (red) substrates were adjusted to a linear scale and overlaid. The B-Cy5 NPS (red) electropherogram was moved to the left to account for the 4 bp between the points of joining. Naked DNA target (left). Nucleosome target (right). (D) Integration activity at the four major integration clusters observed over a titration of PFV intasomes. T-Cy5 NPS (top) and B-Cy5 NPS (bottom) nucleosome substrates display similar profiles. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations.

95

Previous structural and functional analysis revealed that PFV intasomes integrate to one site on a recombinant nucleosome [240]. However, these studies were performed at non-physiological salt concentrations. To determine integration site selection at physiological ionic strength, PFV intasomes were incubated with recombinant mononucleosomes reconstituted from recombinant histone octamer and 601 NPS DNA labeled at the 5’-end with a Cy5 fluorophore. Integration products separated by native

PAGE contain 40 bp of vDNA plus a portion of the 147 bp 601 NPS DNA separated by a

4 base gap (Figure C.4B). Integration products were almost exclusively resultant of two strand transfer events or concerted integration, consistent with PFV integration into a supercoiled target [271]. Although native gels can evaluate overall integration activity, they are not ideal for determining site selection. Integration products contain DNA gaps, which may significantly alter mobility on a native gel [396]. Additionally, native gels do not provide high resolution. Therefore, integration products were run on DNA denaturing gels.

Each strand transfer event introduces a single strand break in the target DNA. Positions 3’ to these strand scissions where the vDNA is joined to the nucleosome target DNA are designated as integration position 0 (top strand) and integration position 3 (bottom strand)

(Figure 5.1A).

Integration was evaluated into 601 NPS DNA labeled at the 5’-end of the top (T-

Cy5 NPS) or bottom (B-Cy5 NPS) strand with a Cy5 fluorophore wrapped into nucleosomes (Figure 5.1B). The same DNA without histone octamer (naked DNA) was used as a control. We observed fewer products with naked DNA compared to nucleosomes.

These results are consistent with a well-established retroviral integrase preference for

96 nucleosome-bound DNA compared to naked linear DNA [319, 321, 364, 397]. Integration bands were quantitated and mapped in relation to the nucleosome. The NPS is numbered relative to the dyad central axis (position 0) from -73 to +73.

Denaturing gels have higher resolution towards the bottom, revealing that integration sites actually cluster into small groups of sites that map to the same gyre of

DNA (Figure 5.1B) (PDB 3LZ0). The T-Cy5 NPS substrate has better resolution in the left (negative) half and B-Cy5 NPS in the right (positive) half. Electropherograms of gel lanes for T-Cy5 and B-Cy5 target DNAs were converted to a linear scale (Figure 5.1C).

The electropherograms were then overlaid and shifted to account for the 4 bp difference between strand transfer events on the two strands. The positions of the peaks were strikingly similar for both the T-Cy5 and B-Cy5 nucleosome targets consistent with concerted integration events (Figure 5.1C). In contrast, similar analysis of integration into naked 601 NPS DNA exhibited mismatched peak positions, suggestive of a single strand transfer event termed half-site integration.

Integration efficiency for each cluster was derived from the area under the curve of each peak in the electropherograms (Figure 5.1C). Quantitative analysis revealed four clusters of integration sites at -59, -37, +36, and +47 were consistently observed and are identified by the major observed integration position 0. Each of these clusters accounted for > 2% of the total 601 DNA at the highest concentration of PFV intasome (Figure 5.1D).

There was a hierarchy of PFV integration preference where the -59 cluster was the least favored and the +47 cluster was the most favored. This preference hierarchy was similar when either the top or bottom strand was labeled with a Cy5 fluorophore (Figure 5.1D top

97 vs. bottom). As previously reported, integration into the dyad region of the nucleosome substrates was disfavored [319, 321].

The higher resolution low molecular weight PAGE regions revealed clusters of two to five bands. Clusters observed for T-Cy5 NPS correlated well with thickened bands observed for B-Cy5 NPS in the lower resolution high molecular weight PAGE region. For example, we observed two bands at NPS +49 and +50 with the B-Cy5 NPS substrate while the T-Cy5 NPS image has a low resolution band at +46 ±3 nt (Figure 5.1B). Strand scissions at +46 (± 3 nt) and +49, +50 are consistent with concerted integration events separated by 4 bp of target sequence. Since the B-Cy5 NPS +50 band was slightly more intense than the +49 band, this cluster was termed +47 for inferred integration position 0.

While the two observed bands at the +47 integration cluster displayed little difference in intensity, the integration sites at the +36 cluster in B-Cy5 NPS showed obvious variability in intensity (Figure 5.1B). Integration position 3 was observed at four sites with greater preference for +39 and +40 and lower preference for +38 and +41

(integration position 0 at +36 ± 3 nt). Mapping the strand scissions for each cluster to the

601 nucleosome structure (PDB 3LZ0) suggests that these DNA sites are located on the outer DNA surface that is not occluded by the histone octamer or the adjacent DNA gyre.

Although each exposed DNA helical turn has five potentially available sites, the integration efficiency is not equivalent for all positions.

5.4.2 Effects of increasing salt concentration on PFV integration

PFV intasomes appear to favor the positive 3’ half of the 601 NPS. The 601 NPS sequence is nonpalindromic and single molecule unzipping studies have indicated that the 98

5’ half is more tightly bound to the histone octamer than the 3’ half [398]. The correlation between enhanced integration efficiency and reduced histone octamer binding affinity to the NPS DNA suggested that breathing or unwrapping of nucleosome DNA might influence the PFV integration site selection.

DNA unwrapping increases with increased ionic strength or with specific histone

PTMs. We examined the effect of increased ionic strength on PFV integration. PFV integration efficiency into the T-Cy5 NPS nucleosomes increases slightly and then dramatically decreases as the salt concentration is increased (Figure 5.2A,B). Although integration at three of the clusters diminished as the salt concentration increased, the +36 integration cluster appeared relatively resistant to elevated salt concentration (Figure

5.2A). Quantitative analysis revealed that the integration efficiency at the +36 cluster does not decrease as dramatically compared to the other clusters (Figure 5.2C). Moreover, evaluation of the total integration products in the presence of 300 mM NaCl suggested that the +36 cluster becomes the major site of integration (Figure 5.2D). B-Cy5 NPS substrates showed four bands in the +36 cluster (Figure 5.1B, Figure C.5). This nucleosome integration cluster collapses to only the +40 and +39 sites at 300 mM NaCl, with disappearance of the +38 and +41 sites (Figure C.5). Comparing the relative abundance of integration clusters suggests that the -59 and -37 clusters display little change, but proportion of integration at the +47 cluster is dramatically reduced (Figure 5.2D). These observations demonstrate that the total integration efficiency decreases and the PFV integration site preference appears to be dramatically altered with elevated ionic strength.

However, the decrease in overall integration efficiency suggests that enhanced DNA

99 unwrapping within nucleosomes does not augment PFV integration efficiency.

Additionally, integration into recombinant nucleosomes with engineered histone PTMs does not alter integration efficiency and site selection (Chapter 6).

Figure 5.2. Increasing salt concentration decreases PFV integration into nucleosomes (A) PFV intasomes were added to T-Cy5 NPS naked DNA (left) or nucleosomes (right) in the presence of increasing concentrations of NaCl (black triangle, 100-300 mM NaCl). Substrate only (-). (B) The total PFV integration activity with naked DNA (filled squares) or nucleosomes (open circles). P-values were determined using a two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05; **, p < 0.01. (C) Integration activity at each of the major clusters associated with the 601 nucleosome. (D) Relative integration frequency at each of the major clusters. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations.

Thus, increasing ionic strength impacts integration efficiency and site selection in a way unrelated to nucleosome DNA unwrapping. Integration into supercoiled DNA shows that increasing salt concentration does not dramatically decrease PFV intasome activity

(Figure C.6). In addition, nucleosomes are stable at 300 mM NaCl after 5 min incubation at 37°C (Figure C.7). Therefore, we postulated that increased ionic strength may disrupt binding between intasomes and nucleosomes.

100

5.4.3 Integration activity of truncation mutants of PFV IN

PFV IN has been suggested to directly bind histones within a nucleosome [240]. A

PFV IN monomer has 4 domains: an amino terminal extension domain (NED), amino terminal domain (NTD), catalytic core domain (CCD), and carboxyl terminal domain

(CTD). Structures of the PFV intasome tetramer show that two monomers perform catalysis and have been termed the “inner” monomers. All of the protein domains of the inner PFV INs have been crystallized and contact the viral DNA. The CTD of one inner

PFV IN monomer also contacts the amino terminal tail of H2A [240]. In contrast, only the

CCDs of the outer PFV IN monomers are resolved in structural studies. The outer PFV IN

CCDs appear structurally important for tetramer formation but do not contact viral or target

DNAs [226, 240]. A combination of point mutations directs PFV IN(K120E) to the inner monomers and PFV IN(D273K) to the outer monomers [240]. This strategy allows analysis of directed mutations at the outer monomers with wild type (WT) catalytically active inner monomers. Although one inner PFV IN CTD contacts one H2A, deletion of the outer PFV

IN CTDs impaired interaction between PFV intasomes and nucleosomes in previous studies [240]. In contrast, deletion of NED and NTD of the outer PFV IN monomers had no apparent effect on this interaction.

We generated PFV intasomes with truncations of the outer PFV IN(D273K) monomers at the amino (ΔNEDΔNTD) or carboxyl (ΔCTD) terminus (Figure 5.3A). The truncation mutants were assembled with full length inner PFV IN(K120E) to form catalytically-active PFV intasomes. The intasomes were added to unmodified T-Cy5 NPS nucleosomes or naked DNA to determine the effect of these truncation mutants on PFV

101 integration efficiency (Figure C.8). Integration with PFV IN(D273K, ΔNEDΔNTD) intasomes were not significantly different from WT intasomes with 601 NPS nucleosomes

(60% and 67% total integration, respectively, p > 0.15; Figure 5.3B). However, PFV

IN(D273K, ΔNEDΔNTD) intasome integration into the 601 NPS naked DNA was considerably reduced compared to WT intasomes (18% and 40% total integration, respectively, p = 0.03) (Figure C.8B). In contrast, PFV IN(D273K, ΔCTD) intasomes displayed higher integration efficiency than WT intasomes into either naked 601 NPS DNA

(54% total integration, p = 0.07) or 601 NPS nucleosomes (76% total integration, p > 0.08)

(Figure C.8B, 5.3B).

Figure 5.3. Truncations of the outer PFV IN domains alter integration site choice PFV intasomes were generated with full length PFV IN(K120E) at the inner subunits and truncations of PFV IN(D273K) at the outer subunits. (A) Block diagrams of WT PFV IN (top), PFV IN ΔNEDΔNTD (middle), and PFV IN ΔCTD (bottom). Numbers indicate amino acid positions (B) Total integration activity for WT and truncated PFV intasomes. Integration efficiencies are shown for T-Cy5 NPS nucleosomes. (C-F) Integration activities of WT and truncation mutants at each cluster (C) +47, (D) +36, (E) -37, and (F) -59. Outer PFV IN truncation intasomes were compared to full length PFV IN intasomes. Error bars indicate standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations. P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval and minimum sample size of n = 3. *, p < 0.05; **, p < 0.01.

102

PFV IN outer monomer truncation mutants were also evaluated for their integration site preference. Comparison of integration clusters indicates there is no significant difference between WT and PFV IN(D273K, ΔNEDΔNTD) intasome integration efficiency at any of the four major clusters (Figure 5.3C-F). The WT and outer monomer truncation intasomes displayed similar integration activity at +36 and -59 clusters (Figure

5.3D,F). However, integration efficiency of PFV IN(D273K, ΔCTD) intasomes increased at the +47 cluster compared to WT intasomes (31% and 20%, respectively, p = 0.01) and decreased at the -37 cluster (5% and 10%, respectively, p = 0.01). This result suggests that the outer PFV IN CTDs enhance integration at the 601 NPS -37 cluster but decreases integration at the 601 NPS +47 cluster.

Interestingly, deletion of the outer monomer CTDs did not affect integration efficiency at the 601 NPS +36 cluster (Figure 5.3C). The +36 integration site appears to be the most stable with increasing ionic strength; if the outer PFV IN CTDs help stabilize the interaction between intasomes and nucleosomes, then the +36 cluster might be expected to decrease with outer PFV IN(D273K, ΔCTD) intasomes. Since this was not the case empirically, the integration efficiency of PFV IN(D273K, ΔCTD) intasomes were evaluated in the presence of increasing salt concentrations (Figure 5.4A). While WT intasome integration efficiencies into naked DNA and nucleosomes are differentially affected by increasing salt concentration (Figure 5.2B), PFV IN(D273K, ΔCTD) intasomes displayed a similarly reduced integration efficiency with both substrates (Figure

5.4B). WT and PFV IN(D273K, ΔNEDΔNTD) intasomes (Figure C.9) retained

103 integration activity at 601 NPS +36 at the highest salt concentration, but PFV IN(D273K,

ΔCTD) intasomes appeared to lose integration activity at all sites (Figure 5.4A).

Figure 5.4. Increasing salt concentration effects with PFV ΔCTD intasomes (A) PFV IN(D273K) ΔCTD intasomes were added to T-Cy5 NPS naked DNA (left) or nucleosomes (right) in the presence of increasing concentrations of NaCl (black triangle, 100-300 mM NaCl). Substrate only (-). (B) The total PFV integration activity with naked DNA (filled squares) or nucleosomes (open circles). P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05. (C) The percent difference between 100 mM and 300 mM (% Maintained) at each cluster was calculated for WT PFV intasomes and PFV IN(D273K) ΔCTD intasomes. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations. P-values were determined using two-tailed Student’s T-tests at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05. The relative maintenance of PFV integration from 100 mM to 300 mM NaCl was calculated for each integration site cluster (Figure 5.4C). Integration efficiencies at three sites were reduced to a similar percentage with either WT or PFV IN(D273K, ΔCTD) intasomes. Integration at the +36 cluster was much less impacted at higher salt concentrations for both intasomes, but WT intasomes were significantly less affected by salt at this integration site compared to PFV IN(D273K, ΔCTD) intasomes (p < 0.05).

These results are consistent with the hypothesis that the outer PFV IN CTDs play a role in

104 stabilizing interaction with nucleosomes. In addition, at physiologically relevant ionic conditions interaction between the outer PFV IN CTDs with a nucleosome appear to influence the integration site choice.

5.4.4 Binding of truncation mutants of PFV IN to nucleosomes

To test the hypothesis that the outer PFV IN CTDs interact with the nucleosomes, affinity precipitation experiments were performed. WT, PFV IN(D273K, ΔNEDΔNTD) or

PFV IN(D273K, ΔCTD) intasomes assembled with biotinylated vDNA were incubated with unmodified 601 NPS nucleosomes and streptavidin-conjugated magnetic beads. PFV

IN(D273K, ΔCTD) intasomes had significantly reduced recovery of nucleosomes compared to WT (Figure 5.5A,C; p = 0.04). At 300 mM NaCl, the decrease in binding affinity of PFV IN(D273K, ΔCTD) intasomes to nucleosomes was so great that there was no detectable recovery of nucleosomes (Figure 5.5B,C). In contrast, supercoiled plasmid

DNA is similarly recovered with WT and mutant intasomes (Figure C.3). Therefore, the interaction between outer PFV IN CTD and nucleosomes is likely mediated by protein- protein interactions with histones.

105

Figure 5.5. PFV ΔCTD intasomes have reduced affinity for nucleosomes Nucleosome precipitation efficiency was assessed using PFV IN WT, PFV IN(D273K ΔNEDΔNTD), and PFV IN(D273K ΔCTD) intasomes containing biotinylated vDNA in the presence of (A) 110 mM or (B) 300 mM NaCl. I, 5% input; PD, pulldown. (C) Quantitation of precipitation efficiency at both NaCl concentrations. P-values were determined using two-tailed Student’s T-tests at a 95% confidence interval with a minimum sample size of n = 3. Asterisks (*) compared to WT at given NaCl concentration. Pound sign (#) compared to same intasome at 110 mM NaCl. * or #, p < 0.05; ** or ##, p < 0.01.

5.4.5 PFV intasome interaction with trypsinized nucleosomes

Based on structural studies, the inner PFV IN CTD is proposed to interact with the

H2A N-terminal tail [240]. Since PFV IN(D273K, ΔCTD) intasomes have reduced affinity for nucleosomes, it is probable that outer CTDs also bind histone tails. To probe this, nucleosomes were trypsinized to remove all histone tails (Figure C.10). Trypsin removes

N terminal tails from all four histones as well as the C terminal tail of H2A [399]. Then, integration with WT PFV IN and PFV IN(D273K, ΔCTD) intasomes was performed into

106 both full length (FL) and trypsinized (TL) T-Cy5 NPS nucleosomes (Figure 5.6A). Of note, the resulting gels were scanned with the Sapphire Biomolecular Imager that did not pick up lighter intensity bands as well, altering integration efficiency values but not the trends. Interestingly, trypsinization only slightly decreased integration efficiency (Figure

5.6B, 45% vs. 32% p = 0.05). However, trypsinization significantly altered site selection.

Integration into TL nucleosomes decreased integration at +47 and -37 (p = 0.005 and p =

0.02, respectively). In addition, -59 was slightly increased (p = 0.02) and +36 remained unchanged. The combination of PFV IN(D273K, ΔCTD) intasomes and TL nucleosomes had an additive effect, enhancing the same phenotype as WT PFV intasomes with TL nucleosomes.

Figure 5.6. Loss of histone tails alters integration site selection (A) PFV intasomes were added to T-Cy5 NPS full length or trypsinized nucleosomes in the presence of WT PFV IN or PFV IN(D273K, ΔCTD) intasomes. (B) Overall PFV integration activity. P-values were determined using a two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. +, p = 0.05; *, p < 0.05. (C) Integration activity at each major cluster. Error bars indicate standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations. P-values were determined using a paired two-tailed Student’s T-test comparing samples to FL + WT at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05; **, p < 0.01. 107

Affinity precipitation experiments were also performed to probe the physical interaction of the WT PFV IN and PFV IN(D273K, ΔCTD) intasomes with trypsinized nucleosomes compared to FL (Figure 5.7A). Trypsinized nucleosome recovery was significantly reduced, comparable to recovery of FL nucleosomes with PFV IN(D273K,

ΔCTD) intasomes (Figure 5.7B). Combination of PFV IN(D273K, ΔCTD) intasomes and

TL nucleosomes was additive, as recovery was already low individually.

Figure 5.7. PFV intasomes have reduced binding to tailless nucleosomes (A) Nucleosome precipitation efficiency was assessed using PFV IN WT and PFV IN(D273K ΔCTD) intasomes containing biotinylated vDNA with either full length (FL) or tailless (TL) nucleosomes. I, 5% input; PD, pulldown. (B) Quantitation of precipitation efficiency. P-values were determined using two- tailed Student’s T-tests at a 95% confidence interval with a minimum sample size of n = 3. +, p = 0.05. 108

5.5 Discussion

PFV IN must search host DNA packaged into nucleosomes. How this dynamic search occurs has not been elucidated. Here we used recombinant human nucleosomes and purified PFV intasomes to elucidate details of this search mechanism. Integration into nucleosomes revealed four major clusters consisting of 2-5 sites per cluster. These clusters are on exposed major grooves, consistent with previous studies [319, 321]. Clusters also suggest a limited search on these favored gyres of DNA.

The 601 nucleosome integration clusters at -37 and +47 were also observed with naked T/B-Cy5 NPS DNA, suggestive of intrinsically preferred DNA sequences for concerted integration. PFV integration site sequencing studies indicated that PFV IN has a subtle sequence preference containing flexible YR dinucleotides at the center [263, 291,

316, 317]. Interestingly, when the 601 NPS -37 is placed at integration position 0, it has three nucleotides in common with the reported subtle sequence preference and a YR motif at the center. However, when NPS +47 is placed at integration position 0, there are only two bases in common with the PFV integration sequence preference and no YR motif at the center. The -51 integration site is the only one containing the PFV IN sequence preference in an exposed region of the nucleosome. Yet, there is little integration at that site compared to the major integration clusters. These results underline the subtle role of sequence preference as suggested by others [318]. This role likely involves the ability of these sequences to adopt distorted structures rather than the identity of the sequence bases themselves. Further, the efficiency of integration into naked 601 NPS DNA is at least 1.5 fold less efficient than with nucleosomes. Together, these data suggest that the biophysical 109 qualities of nucleosome-bound DNA appear to be more important in determining integration site preference than DNA sequence.

Although PFV integration most strongly favored nucleosome position +47, there was no preference for -47, which displays the same DNA distortions. Single molecule unzipping studies have demonstrated that histone octamer binding to each half of the 601

NPS DNA are not equivalent [391, 398]. In these studies force induced unwrapping of the

5’-half of the 601 NPS DNA appears more flexible but tightly bound to the nucleosome core; the 3’-half of the 601 NPS DNA appears more rigid but less tightly bound. A lack of

DNA flexibility likely decreases the ability of the histone octamer to form multiple contacts required for tight NPS binding. HIV-1 IN has been shown to favor target DNA with

“intrinsic curvature” rather than flexibility further supporting the idea that retroviral integrases may recognize inherent and/or induced DNA structures during integration [319].

At physiological ionic strength conditions, PFV intasomes prefer the 601 NPS site

+47. However, integration at this site decreases with increasing ionic strength. Because integration activity is not significantly affected by increased ionic strength this altered preference is not a result of decreased PFV intasome function. Furthermore, the nucleosome structure or DNA binding is not dramatically altered until salt concentrations are greater than 500 mM NaCl (Figure C.7) [400]. This suggests that the change in integration preference with increasing ionic strength is a result of decreased interactions between the intasome and the nucleosome. PFV integration at the +36 cluster appears to be the only site that is largely unaffected by increased ionic strength.

110

We found that interactions between the inner PFV IN CTD domain and the histone octamer were not uniquely responsible for integration into a nucleosome. While the outer

PFV IN NTD had no effect on integration into nucleosomes, deletion of the outer PFV IN

CTD significantly altered the integration site choice. PFV IN(D273K ΔCTD) intasomes strongly favored the +47 integration site cluster and disfavored the -37 cluster. Other integration clusters were not affected by the truncation mutation. This data suggests the outer PFV IN CTD plays a role in targeting integration into the -37 cluster. Yet, this observation raises the question of why the +36 cluster was unaffected by the deletion of this domain. Integration by PFV IN(D273K ΔCTD) intasomes into all of the cluster sites decreased with increasing ionic strength. This included the +36 cluster that was largely resistant to increasing ionic strength when the WT PFV IN was examined. These observations combined with the reduction of integration at the -37 cluster suggest that the outer PFV IN CTD is at least partially responsible for stably targeting integration to these regions. Additionally, PFV IN(D273K ΔCTD) intasomes had reduced binding affinity for nucleosomes, further supporting that the outer PFV IN CTD interacts with nucleosomes. It has been shown that WT PFV IN intasomes and mutants do not have differing affinity for supercoiled DNA, suggesting that this outer PFV IN CTD-nucleosome interaction is mediated by protein-protein interactions (Figure C.3).

Removal of histone tails resulted in ~4-fold reduction in recovery of nucleosomes by affinity precipitation, similar to the reduction seen with full length nucleosomes and

PFV IN(D273K ΔCTD) intasomes. Binding of PFV IN(D273K ΔCTD) intasomes to TL nucleosomes was even further reduced. In addition, integration into TL nucleosomes

111 significantly reduced integration at +47 and -37 and slightly increased integration at -59.

Integration of PFV IN(D273K ΔCTD) intasomes into TL nucleosomes had a similar phenotype but additionally slightly increased +36 integration.

These data and data of others suggest a complex model of PFV integration into nucleosomes. We propose that one inner CTD and one outer CTD of PFV intasomes have the ability bind histone tails [240, 401]. HIV-1 IN has also been shown to directly bind histone tails, suggesting that this mechanism is not specific to PFV IN [402]. The cryo-EM structure of the PFV intasome docked on a nucleosome also suggests an additional interaction between an inner-outer CCD dimer and nucleosome DNA. These three interactions determine integration site selection and may compete, as altering the reaction conditions can re-direct integration between common sites, but not to novel sites. The inner

CTD binds H2A at the minor groove between +36 and +47 clusters. Correspondingly, the outer CTD could bind the other H2A near -37. The CCD-CCD-DNA interaction is proximal to +36.

Thus loss of the outer CTD-H2A tether would propel integration into sites neighboring the other two interactions, namely +47. This would also explain the reduction of integration at -37. Removal of histone tails abrogates interaction at both CTD tethers, decreasing integration at both +47 and -37. Integration at +36 increases, as the driving interaction remaining is at this CCD-CCD-DNA interface. Additionally, integration increases at distal sites such as -59 and a new major site +14 due to the intasome search being less specific without protein-protein contacts. In this model, the +36 site is a result of the CCD-CCD-DNA interaction. PFV intasome search on linear DNA shows that the

112 complex is in constant contact with the DNA, as its diffusion coefficient is irrespective to changes in ionic strength [269]. This would explain why +36 is refractory to increases in salt concentration.

The proposed mechanism suggests that protein-protein and protein-DNA interactions dictate integration site selection. PFV intasomes would therefore conduct a local tethered search after interacting with one or both H2As and the nucleosome DNA, resulting in clusters of sites. Interestingly, PFV Gag has also been shown to bind histones

[403]. Gag binds in the H2A-H2B acidic patch, which does not overlap with PFV IN CTD binding to the H2A tail as shown in the cryo-EM [240, 403].

PFV intasomes use a 1D search with rotation-coupled diffusion on linear DNA

[269]. However, the search mechanics of the PFV intasome on nucleosome DNA is unknown. One possibility is that PFV intasomes search nucleosomes by intersegmental transfer and then perform a limited search along an exposed helix of DNA by rotation- coupled diffusion until a distorted region is located or a PFV IN CTD binds H2A. Further elucidation of PFV intasome search mechanism will likely require single molecule analytical resolution. In addition, future experiments will be required to fully elucidate the role of inner and outer PFV IN CTD in integration site selection and interaction with histone tail residues. However, these studies have begun to uncover the previously elusive roles of the outer PFV IN domains. Our findings further elucidate mechanisms underlying integration into mononucleosomes by high resolution mapping of PFV integration sites.

This mechanism may apply to other integrases or DNA-interacting proteins.

113

Chapter 6. Nucleosome DNA unwrapping does not affect prototype foamy virus

integration efficiency or site selection

This chapter is based on work under revision in PLOS ONE:

Mackler RM, Jones ND, Lopez Jr. MA, Howard CJ, Fishel R, Yoder KE. Nucleosome

DNA unwrapping does not affect prototype foamy virus integration efficiency or site selection. PLOS ONE. Under revision.

6.1 Abstract

Retroviruses are characterized by their ability to stably integrate their genome into the host genome. This reaction is catalyzed by the virally encoded protein integrase.

Integrase prefers major grooves of highly distorted DNA like that of a nucleosome.

Nucleosomes are the basic unit of chromatin comprised of an octamer of histone proteins wrapped by ~147 base pairs of DNA. Nucleosomes are highly dynamic due to the addition and removal of histone posttranslational modifications, which alter nucleosome stability.

We used engineered or mimetic histone posttranslational modifications to understand how these perturbations impact integration efficiency and site selection. Integration into nucleosomes with histones containing acetylation or acetylation mimetics were minimally altered compared to unmodified histones. These studies suggest PFV intasomes do not

114 utilize nucleosome unwrapping, but are more likely to employ intersegmental transfer to search nucleosome targets.

6.2 Introduction

DNA-interacting proteins, such as retroviral integrase (IN), have been extensively characterized. However, due to technical difficulties, many have not been studied in the physiologically-relevant context of chromatin. Studying integration in the context of chromatin is critical, as chromatinized DNA has different structural and biophysical characteristics compared to nonchromatinized, or “naked”, DNA. Chromatin is comprised of basic units called nucleosomes. Nucleosomes consist of an octamer of two of each histone protein H2A, H2B, H3, and H4 wrapped ~1.7 times by DNA [322]. Nucleosome

DNA is bent differently than circular or supercoiled DNA. In addition, histone octamers frequently occlude binding of DNA-interacting proteins [404, 405]. Therefore, searching and binding of DNA-interacting proteins likely differ depending on the DNA target.

Retroviruses encode protein IN that is responsible for insertion of viral DNA into the host genome. Integration studies have extensively shown that INs prefer highly distorted DNA, such as that in a nucleosome [240, 319, 321, 397]. Additionally, it has been known that integration occurs in nucleosome-occupied regions of the genome rather than the linker regions between nucleosomes [406]. Biophysical studies have elucidated the search characteristics of IN from prototype foamy virus (PFV) on a naked linear DNA target [269]. On this DNA the PFV IN complex moves along using rotation-coupled diffusion, covering an area of ~1600 base pairs (bp) before dissociating. This search is

115 unrealistic in the context of chromatin, as each nucleosome contains 147 bp with linker regions of ~40-60 bp in primary human cells [407]. Therefore, the PFV IN complex in vivo would encounter several nucleosomes that would require resolution during its search in order to move solely by rotation-coupled diffusion. Thus, much still needs to be understood about how the IN complex interacts with nucleosomes.

In cells, integration only proceeds in a forward manner. However, in vitro disintegration, or the reverse reaction, is possible [408]. We hypothesized that this is due to the dynamic nature of nucleosomes in cells. If the histone octamer either is moved or removed post-integration so that the DNA region is no longer bent, then disintegration could no longer occur. Therefore we aimed to test how altering nucleosome stability impacts PFV IN activity.

Specific histone post-translational modifications (PTMs) have been shown, using the nucleosome positioning sequence (NPS) 601, to change nucleosome stability by varying the interaction of the nucleosome DNA with the histone octamer. For example, acetylation of H3(K56) has been shown to increase DNA unwrapping at the entry-exit region, acetylation of H4(K77, K79) has been shown to increase DNA unwrapping at the loss of rDNA silencing (LRS) region, and acetylation of H3(K115, K122) located near the dyad region reduces the overall stability of nucleosomes [384, 385, 390, 393, 409-412].

We engineered histones with PTM mimetics or expressed protein ligation (EPL) and incorporated them into nucleosomes.

Here we examined the integration of PFV intasomes at physiological ionic conditions into 601 mononucleosomes reconstituted with recombinant human histones. We

116 observed four major integration sites, including the site identified by cryo-EM studies

[240]. Integration sites on these unmodified nucleosomes were proximal to known core histone acetylation sites that increase the NPS DNA unwrapping rate. We engineered these histone acetyl mimetics or acetylations to evaluate the role of increased unwrapping on

PFV integration efficiency and site selection. We determined that nucleosome unwrapping or instability does not alter PFV integration. These results suggest that PFV intasomes do not search chromatin by sliding on transiently unwrapped DNA, but more likely by intersegmental transfer with limited rotation coupled diffusion on exposed helices.

6.3 Materials and Methods

6.3.1 DNA substrates

The 147 base pair Cy5-labeled 601 nucleosome positioning sequence (NPS) was generated as described in 5.3.1.

DNA oligomers mimicking the 3’ processed PFV U5 end (vDNA) were made as described in 3.3.3.

6.3.2 Nucleosomes

Unmodified, recombinant human histones H2A or H2A(K119C), H2B, H3,

H3(K56Q), and H4 were expressed and purified as described [322]. Histones H3(K115ac,

K122ac) and H4(K77ac, K79ac) were produced by Expressed Protein Ligation as described [269, 404, 410]. The synthetic acetylations were confirmed by mass spectrometry analysis (Figure 6.1). Nucleosomes were made as described in 5.3.2. Sucrose gradient velocity centrifugation fractions were analyzed by separation on a native

117 polyacrylamide gel electrophoresis (PAGE) and imaged using a Typhoon 9410 variable mode fluorescent imager (GE Healthcare) (Figure 6.2). All experiments were performed with at least two independent nucleosome preparations, derived from independent octamer refoldings and modified histone purifications.

Figure 6.1. Mass spectrometry of acetylated histones Acetylation of histones generated by EPL was confirmed by mass spectrometry. (A) Representative mass spectra for H3(K115ac,K122ac). Expected m/z 15356, observed m/z 15355. (B) Representative mass spectra for H4(K77ac,K79ac). Expected m/z 11321, observed m/z 11324. 118

Figure 6.2. Native PAGE analysis of sucrose gradient fractions after nucleosome reconstitution Histone octamers were reconstituted with Cy5 labeled 601 NPS DNA and subjected to sucrose gradient velocity centrifugation. Sucrose gradient fractions were analyzed by native PAGE. Fractions containing mononucleosomes without contaminating free DNA or excess histone proteins were combined and concentrated, red boxes. (A) Unmodified nucleosomes, (B) H3(K56Q) nucleosomes, (C) H4(K77ac,79ac) nucleosomes, and (D) H3(K115ac,122ac) nucleosomes. 6.3.3 PFV integration

PFV intasomes were assembled and purified as previously described and in 3.3.4

[352, 361, 413]. All experiments were performed with at least two independent PFV intasome purifications. Integration reactions were performed as described in 5.3.3.

119

Products were separated by denaturing PAGE and scanned with a Typhoon 9410 variable mode fluorescent imager (Figure 6.3) (GE Healthcare).

Figure 6.3. Illustration of PFV integration into a linear NPS target DNA The PFV viral DNA is added to nucleosomes. The 601 NPS DNA is 147 bp DNA numbered from the dyad (0) to ±73. Black circles indicate 5’ ends. Asterisk indicates a Cy5 fluorescent moiety. During integration the viral DNA 3’ end is covalently joined to the target DNA. Two viral DNAs are joined separated by 4 bp during concerted integration. The NPS DNA is broken by the integration event. Denaturation of integration products liberates a fluorescently labeled fragment that indicates one site of viral DNA joining. Denaturing PAGE gel analysis was performed as described in 5.3.3. The data are presented as averages with error bars indicating the standard deviation (s.d.) of at least three independent experiments. Data was analyzed by paired t test and ANOVA.

120

6.4 Results

6.4.1 PFV integration into unmodified mononucleosomes

Mononucleosomes were reconstituted from recombinant histone octamer and 601

NPS DNA. The 147 bp 601 DNA was labeled with a Cy5 fluorophore (Figure 6.3).

Nucleosomes were purified by sucrose gradient velocity ultracentrifugation and analyzed by native gels (Figure 6.2A). Nucleosomes displayed reduced mobility and were readily distinguishable compared to free NPS DNA. Nucleosome assembly in vitro may also result in spurious products that include excess histones. These higher molecular nucleosomes appeared as a secondary peak of slightly higher molecular weight compared to the correct octamer (most apparent in Figure 6.2B). Sucrose fractions that were free of naked NPS

DNA and higher molecular weight contaminants were combined and used for integration.

A tetramer of recombinant PFV integrase (IN) and two retroviral donor DNA oligomers mimicking the viral DNA ends (vDNA) may be assembled and purified as a functional intasome complex [226, 413]. PFV intasomes covalently join the vDNA ends to a target DNA in two kinetically distinct strand transfer reactions separated by 4 bp of target

DNA, termed concerted integration (Figure 6.3). PFV intasome concerted integration into a circular target DNA results in a linear product with vDNA at the termini [227]. Concerted integration into a linear target DNA generates two fragments, each covalently joined to one of the vDNAs. In some cases, intasomes will only join one vDNA end to the target DNA, termed half-site integration. Recombinant PFV intasomes have been shown to readily perform concerted integration with relatively few half-site integration events [227, 269].

121

PFV intasomes were added to unmodified nucleosomes. Concerted integration into the 601 NPS DNA will generate two fragments, each with a 4 base gap at the junction of vDNA and 601 DNA. DNA gaps may significantly alter mobility on a native gel precluding accurate determination of integration sites [396]. In order to more accurately determine the sites of integration on a nucleosome, the reaction products were analyzed by denaturing

PAGE (Figure 6.4). Integration into the Cy5 labeled nucleosome DNA will generate a break on the labeled strand (Figure 6.3). The length of this band indicates the site of a strand transfer event. This method measures total integration activity, including both concerted and half-site integration events. Multiple fragments were observed near nucleosome positions -59 and -36. Bands were also seen at +36 and +47, which may similarly be composed of several fragments but not resolved in this region of the gel.

Mapping the observed strand scissions to the 601 nucleosome structure (PDB 3LZ0) indicates integration sites are located on the outer DNA surface that is not occluded by the histone octamer or the adjacent DNA gyre.

The central base pair (bp) of a 147 bp nucleosome positioning sequence (NPS) is numbered 0 and termed the dyad (Figure 6.3). Left (5') and right (3') flanking sequences are numbered outward from the dyad, negative and positive, respectively. As previously reported, integration into the dyad region of the nucleosome substrates was disfavored

[319, 321]. Denaturing PAGE shows that PFV integration occurred as clusters of sites

(Figure 6.4). Four clusters of integration sites near NPS -59, -36, +36, and +47, relative to the dyad, were consistently observed. The nucleotide on the 3’ side of the integration strand scission is designated as integration position 0 (Figure 6.3). We subsequently refer to the

122 clusters by the major observed integration position 0. The higher resolution PAGE regions revealed two to five bands in each cluster, consistent with the exposed nucleotides of a

DNA gyre. Although each exposed DNA helical turn has five potentially available sites, the integration efficiency is not equivalent for all positions.

Figure 6.4. PFV integration into nucleosomes with histone PTMs affecting unwrapping and stability PFV intasomes were added to Cy5 labeled 601 NPS nucleosomes with unmodified histones, H3(K56Q), H4(K77ac,K79ac), or H3(K115ac,K122ac). Integration products were resolved by denaturing PAGE and imaged for Cy5 fluorescence. The PFV intasome concentrations were 7nM, 13 nM, 20 nM, and 26 nM, black triangles. Nucleosomes without PFV intasomes (0). Marker sizes are shown as nucleosome position numbers, left side. Integration sites, right side. Representative gels of at least three independent experiments with at least two independent preparations of PFV intasomes and nucleosomes are shown. The major integration sites are proximal to known core histone acetylation post- translational modifications (PTMs) that increase the unwrapping rate of the NPS.

Specifically, the -59 cluster is in the entry-exit region of the nucleosome and near H3(K56). 123

The +36 and -36 integration sites in the LRS region are near H4(K77,K79). We investigated the hypothesis that increased unwrapping of the NPS via engineered histone

PTMs could increase PFV integration at these sites.

6.4.2 Generation of nucleosomes with modified histones

Recombinant human histone proteins expressed in bacteria have no PTMs.

Modified histones were engineered and incorporated into nucleosomes. H3(K56Q) is a mimetic of acetylated lysine known to increase NPS DNA unwrapping at both entry-exit regions of a 601 nucleosome [411]. At other nucleosome locations, a glutamine substitution does not faithfully recapitulate acetylated lysine [410]. For example, substitution of glutamine at H4(K77) and H4(K79) does not imitate acetylations at these sites [abbreviated as H4(K77ac, K79ac)]. H4(K77ac, K79ac) enhances the unwrapping of the NPS DNA at the LRS regions [393]. Similarly, glutamine substitutions at H3(K115) and H3(K122) does not imitate acetylation at these sites [abbreviated as H3(K115ac, K122ac)]. H3(K115ac,

K122ac) is located at the nucleosome dyad, a region of the nucleosome where only one

DNA gyre is present and has the highest affinity for the histone octamer. Acetylated histones were engineered by expressed protein ligation (EPL) and confirmed by mass spectrometry (Figure 6.1). The modified histone proteins were assembled into nucleosomes with Cy5 labeled 601 DNA and purified (Figure 6.2).

6.4.3 PFV integration into modified mononucleosomes

PFV intasomes were added to Cy5 labeled 601 nucleosomes containing three different histone acetylation sites (Figures 6.4, 6.5B). The addition of PFV intasomes

124 decreased the apparent amount of full length 601 DNA. This reduction was interpreted as the total integration efficiency. Total integration into H3(K56Q), H4(K77ac, K79ac), or

H3(K115ac, K122ac) nucleosomes was not significantly different than unmodified nucleosomes when analyzed by either t test or ANOVA (all p values > 0.01, Figure 6.5A).

Figure 6.5. Quantitation of PFV integration into nucleosomes with core histone acetylations (A) Total integration activity of PFV intasome titrations added to Cy5 labeled nucleosomes with unmodified histones, H3(K56Q), H4(K77ac,K79ac), or H3(K115ac,K122ac). (B) Nucleosome cartoon indicating the relative locations of histone PTMs and integration sites. Integration activity at each cluster: (C) +47, (D) +36, (E) -36, and (F) -59. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome preparations and two nucleosome preparations. Paired t test and ANOVA analysis indicate no significant differences. 125

Although the total integration into nucleosomes was not affected by PTMs, the integration site choice could be altered. Integration site -59 in the nucleosome entry-exit region is in close proximity to H3(K56Q) (Figure 6.5B). It has been previously shown that

H3(K56Q) increases the unwrapping rate of the NPS DNA 2.6 fold in the presence of 130 mM NaCl without affecting the rewrapping rate [385]. Thus these nucleosomes are partially unwrapped at the entry-exit region. H3(K56Q) increased LexA binding to a site in the 601 NPS entry-exit region 3 fold compared to unmodified nucleosomes [385].

Increased unwrapping associated with this histone PTM extends from NPS ±73 DNA ends to ±47 [414]. We predicted that H3(K56Q) could affect PFV integration at the -59 cluster and possibly display minor effects on the +47 cluster. However, there was no change of integration efficiency at any site with H3(K56Q) nucleosomes (Figures 6.4, 6.5).

PFV integration at ±36 was first reported by a cryo-EM structure [240]. These integration sites were also observed with the 601 NPS unmodified nucleosome (Figure

6.4). The ±36 integration sites are in the LRS region near H4(K77ac, K79ac) (Figure

6.5B). H4(K77ac, K79ac) has been shown to enhance unwrapping [393]. This unwrapping extends further from the ends of the NPS DNA than H3(K56Q), to approximately ±24

[414]. If histone unwrapping is important for PFV integration, then it should impact integration at -36, +36, and to a greater extent +47. However, analysis of PFV integration into H4(K77ac, K79ac) nucleosomes showed no difference in integration efficiency at any site (Figures 6.4, 6.5).

We also utilized nucleosomes with H3(K115ac, K122ac) to evaluate the effect of nucleosome stability on PFV integration (Figure 6.4). This histone modification reduces

126 the overall stability of nucleosomes without affecting unwrapping of the NPS DNA [410].

Thus this histone PTM does not alter DNA accessibility at the dyad. However, this histone

PTM is associated with increased histone dissociation [393]. We considered this histone

PTM could affect overall PFV integration efficiency or alter the integration site choice.

However, PFV integration into H3(K115ac, K122ac) nucleosomes was not different from unmodified nucleosomes (Figures 6.4, 6.5).

Integration showed no significant difference between any of the modified nucleosomes and unmodified nucleosomes (p > 0.01). Paired t tests indicated that two individual points were significantly different from unmodified nucleosomes: integration site +47 at 26 nM PFV intasome with H3(K115ac,K122ac) (p = 0.004) and integration site

-59 at 13 nM PFV intasome with H4(K77ac,K79ac) (p = 0.003). The total integration and site specific integration efficiency data was further analyzed by ANOVA to thoroughly test the null hypothesis. This analysis determined all p values as > 0.05, confirming that there is no significant difference between any of the modified nucleosomes and unmodified nucleosomes. Together, these integration studies into nucleosomes with specific histone

PTMs suggests that the integration preference 601 nucleosomes is not due to increased unwrapping kinetics. These observations appear to significantly limit the possible mechanisms for PFV intasome interrogation of a nucleosome target.

6.5 Discussion

We have used recombinant human histones with specific PTMs that increase NPS unwrapping to dissect the mechanism of PFV intasome target search. As previously shown

127 with other retroviral INs, PFV intasomes showed a preference for exposed DNA helices and significantly distorted regions of the NPS DNA. We identified four major sites in 601 nucleosomes that exhibited a cluster of 2-5 integration events. These observations suggest a limited search that is associated with integration events at these particular exposed helices of nucleosome DNA. The use of specific histone acetylation PTMs or mimetics here suggests that increased unwrapping rate or decreased nucleosome stability have no effect on PFV integration efficiency or target site selection.

An obvious question is why integration occurs at the symmetric sites ±36, but not

±59 or ±47. In addition, though there is integration at both ±36, but +36 is favored compared to -36. Extensive biophysical data available for the 601 NPS offers some insights

[392, 398]. The 601 NPS sequence is not symmetric and there are significant observed differences between the left and right halves. The left half of 601 DNA is more flexible than the right half [392]. This flexibility allows for stronger binding to the histone octamer.

The right half, which includes the +36 and +47 sites, is a more rigid sequence and has weaker binding to the histone octamer. More force is required to disrupt the left half of the

601 nucleosome compared to the right half [398]. The cryo-EM image of the PFV intasome bound to a previously uncharacterized NPS nucleosome suggested that the NPS DNA must pull away from the histone octamer [240]. The strong binding of the left half of the 601

NPS might prevent the dissociation of NPS DNA from the octamer and prevent integration at -47 and reduce integration at -36 relative to +36. The more weakly bound right half of the 601 NPS DNA empirically appears to readily allow integration at +47 and enhanced integration at +36.

128

These biophysical observations concerning the strength of NPS binding to the histone octamer did not apply to the entry-exit regions, extending from ±73 to approximately ±50 [392, 398]. It is notable that there is relatively little integration into -59 in the entry-exit region. In this case the sequence preference of integrase may offer an explanation [263, 316]. Integration strand scissions were apparent at -59 and -60. Both of these integration sites have a favored nucleotide at both strand transfer junctions. However, sequences at +59 and +60 do not display similarity to the PFV integrase sequence preference. The +60 sequence has no similarity and the +59 sequence would only have one base in common with the IN preference. The lack of differences in the strength NPS binding at ±59 suggests that integration preference for -59 relative to +59 is due to DNA sequence preference.

The mechanism that PFV intasomes use to search DNA wrapped into nucleosomes appears to be distinct from that used by several transcription factors or DNA damage- sensing proteins. Because the wrapped DNA is partially occluded by the histone octamer,

PFV intasomes cannot take advantage of their ability to search long distances of DNA by

1D rotation coupled diffusion [269]. Our results with acetylated histones suggest that the

PFV intasome does not take advantage of transiently unwrapped nucleosome DNA, which is more common in euchromatin. This data is in agreement with previous reports that PFV integration favors heterochromatin [240, 401]. The observation that other retroviruses, such as HIV-1, favor euchromatin may suggest that the intasome search mechanism is variable [307]. Further experiments with other retroviral intasomes will be necessary to determine the conservation of nucleosome search mechanism.

129

PFV intasome search of nucleosomes has some features in common with several base excision repair glycosylases. Similar to PFV intasomes, uracil DNA glycosylase

(UDG) has been shown to favor exposed regions of NPS DNA [415-417]. UDG prefers entry-exit regions and disfavors the dyad. This glycosylase is known to perform a 1D search with rotation coupled diffusion mediated search as well as intersegmental transfer which allows crosswise movement between exposed helices of the nucleosome bound

DNA [417-420]. PFV intasomes also use a 1D search with rotation coupled diffusion on linear DNA [269]. However, the search mechanics of the PFV intasome on nucleosome

DNA is unknown. One possibility is that PFV intasomes search the nucleosome similarly to UDG by intersegmental transfer along the exposed helix of the NPS DNA until a distorted region is located or until PFV IN binds H2A. Further elucidation of the PFV and other retroviral intasome search mechanisms will likely require single molecule analytical resolution. However, our studies have begun to uncover the mechanisms underlying IN searching of mononucleosome targets.

130

Chapter 7. Summary and future directions

7.1 Summary

Although HIV-1 is now a chronic disease rather than a deadly virus, it remains incurable. Additionally, there is no vaccine and people continue to get infected. In 2016,

14.7 people per 100,000 in the United States were newly infected with HIV-1 [421]. ART treatment is lifelong due to a latent reservoir that is not killed by drugs or the immune system. Once treatment is halted the virus rebounds. The latent reservoir continues to persist because the virus integrates into the host genome. Therefore, understanding integration is crucial in preventing the viral reservoir from forming in the first place and developing novel therapeutics to better treat HIV-1.

Integration is performed by the virally encoded protein IN. PFV IN is an ideal model for retroviral integration, as it is highly soluble and easily forms intasomes in vitro.

In addition, the PFV intasome was the first intasome to be structurally characterized, providing a wealth of information about how the complex forms as well as integration mechanism [226, 234]. HIV-1 INSTIs also block PFV integration, suggesting conservation of the catalytic site architecture [226]. Understanding PFV integration is also crucial in developing safe retroviral gene therapy vectors.

131

Although PFV IN and HIV-1 IN have similar catalytic activity, we found differences in cation use and target capture between the two proteins. As explained in

Chapter 2, PFV IN can use Mg2+ and Mn2+ for both 3’ processing and strand transfer.

Unlike HIV-1 IN, PFV IN can also utilize Ca2+ to catalyze strand transfer. PFV IN differs in its ability to exchange its target DNA even after 60 mins of incubation, whereas HIV-1

IN commits to its target DNA by one minute of incubation [351]. This suggests that search mechanisms of the two INs differ. Our data from Chapter 2 also indicates that the PFV IN sequence preference is not selected for, supporting other works that have claimed that the

DNA sequence itself is not a major factor for site selection.

The cleanest way to study PFV IN in vitro is in the context of intasomes. Chapters

3-6 utilize PFV intasomes to study their function under various conditions. The intasome assembly process is detailed in Chapter 3 and Appendix B. These intasomes were able to be frozen and thawed without losing activity, allowing for long-term storage. Interestingly, we found that vDNA label position and identity impacted intasome assembly efficiency.

While internal Cy5 labeling of the vDNA did not significantly alter intasome assembly, end labeling using Cy5 or biotin reduced the peak concentration by 10-fold and ~1.8-fold, respectively. This protocol can also be used to incorporate truncated forms of PFV IN as outer monomers. Obtaining purified PFV intasomes was crucial for subsequent experiments.

In Chapter 3 we explored the properties of PFV intasomes without their target. At

37°C WT intasomes aggregate within 5 min, abrogating activity. Interestingly, deleting domains of the PFV intasome outer subunits, particularly the CTDs, sustained integration

132 activity after 5 min 37°C incubation. In addition, high non-physiological salt concentrations and small molecule PCA can enhance activity by reducing aggregation.

This suggests that aggregation is mediated by the outer PFV IN CTDs, which can be disrupted by salt or PCA.

Chapter 4 explored similar intasome properties but in the context of INSTI resistance mutant PFV IN N224H. This mutant was already reported to have lower infectivity and integration activity. We report that this mutant exhibits lower stability compared to WT and a higher proportion of half-site integration. While PCA rescued both phenotypes, neurotransmitters dopamine, norepinephrine and adrenaline could restore integration activity close to WT but severely increased half-site integration. Thus, virus carrying the PFV IN N224H mutation is less fit due to reduced intasome stability, which is a novel mechanism for reduced viral infectivity. In addition, the phenotypes seen with neurotransmitters may have implications for infection in the brain.

PFV integration in vivo must be completed in the context of chromatin, which is comprised of basic units called nucleosomes. Prior studies with PFV intasomes suggested that there is only one integration site on the nucleosome and that there is an interaction between PFV IN CTD and the tail of H2A [240]. Contrary to this previous work, we show in Chapter 5 that at physiological salt concentrations there are multiple integration sites.

However, at the salt concentration used in the other work, we recapitulated their results.

Using high resolution DNA denaturing gels, we were able to show that these sites are actually clusters, suggestive of a local 1D search along the exposed gyre of DNA. However,

133 integration did not occur at every exposed highly distorted DNA gyre, suggesting that there is more to site selection.

Due to the possibility of a 1D search along the DNA from this work and previous work from our lab, in Chapter 6 we hypothesized that increasing DNA unwrapping in the nucleosome would increase integration. Increasing unwrapping allows more accessibility to the DNA that would typically be occluded by the histone octamer. We generated nucleosomes that were either unmodified or acetylated at core lysines that have been previously shown to increase DNA unwrapping rate. Contrary to our hypothesis, altering

DNA unwrapping with histone PTMs did not significantly alter integration efficiency.

However, as shown in Chapter 5, increasing salt concentration did impact integration by decreasing integration efficiency and altering site selection. Since intasomes and nucleosomes are both fairly stable at high salt concentrations, we hypothesized that changes in integration efficiency and site selection were due to disruptions in intasome- nucleosome interactions. To probe this, we utilized PFV intasomes that had truncated outer monomers.

PFV IN ΔCTD intasomes had altered site selection with increased +47 and decreased -37 clusters. Additionally, PFV IN ΔCTD intasomes were more sensitive to high salt concentrations. This suggested that outer CTDs interact with the nucleosome. We determined that PFV IN ΔCTD intasomes had decreased binding affinity for the nucleosome compared to WT and PFV IN ΔNEDΔNTD intasomes. This interaction was not mediated by nucleosome DNA. A structure of a PFV intasome docked on a nucleosome suggested interaction of an inner CTD with an H2A amino terminal tail [240]. Therefore,

134 we proposed that the outer CTDs interact with the other H2A tail. We trypsinized nucleosomes to remove the histone tails and determined that PFV IN ΔCTD intasomes were had lower binding affinity to TL histones. In addition, integration into TL nucleosomes altered site selection for WT and PFV IN ΔCTD intasomes. This supports that PFV IN CTD interacts with histone tails and, with previous work, suggests interactions between an inner CTD and one H2A tail and one outer CTD with the other H2A tail [240].

Therefore, our model for PFV integration into nucleosomes is as follows: PFV intasomes search via 3D collision or IT until the intasome finds a distorted region of DNA or a CTD binds to an H2A amino terminal tail. This latter option tethers the intasome to the nucleosome, allowing another CTD to possibly bind the second H2A amino terminal tail. With one or two tethers, the PFV intasome can perform a local 1D search along a gyre of DNA to select a site that is exposed and highly distorted.

7.2 Future Directions

To continue the intasome aggregation studies, it would be interesting to understand what parts of the PFV IN outer subunit domains are responsible for intasome aggregation at 37°C. This could be done by making smaller truncations, which would help elucidate the particular regions involved in aggregating and deactivating the complex. In addition, understanding how PCA works to stabilize PFV intasomes would be useful. This knowledge could be used to aid in other PFV intasome in vitro studies and may prove valuable for studying INs from other viruses such as HIV-1. Further, if the PCA mechanism

135 is nonspecific, this small molecule may be utilized with other proteins to minimize aggregation.

In terms of understanding PFV intasomes in vitro, more work can be done in understanding assembly as well. We empirically have shown that particular labels and their placement severely decrease intasome yield. Testing more labels at various positions may reveals a pattern that could suggest a reasoning as to why some labels and positions are more tolerated. In addition, testing similar DNA oligomers with HIV-1 intasomes may provide insight into differences in assembly efficiency and into assembly mechanism.

There is more that needs to be understood about the outer monomer PFV IN CTD interaction with nucleosome tails. In the future, we could map this interaction on both ends.

We could use various truncation mutants to delete small portions of the outer CTD to determine which part of this domain is responsible for binding. On the nucleosome side we could perform binding affinity purification experiments using either (1) biotinylated histone tails (EpiCypher) to recover intasomes, or (2) biotinylated intasomes to recover reconstituted nucleosomes with tailless histones, selectively using one tailless histone at a time. Both of these experiments would uncover the histone tail(s) that is important in intasome-nucleosome interactions.

Since we know that the outer CTDs are dispensable for integration and are involved in site selection, replacing this domain with a specific DNA binding domain may target integration to a particular DNA sequence. An example of such a DNA binding domain is a zinc finger, which can be designed to bind any DNA sequence of interest. This would reveal to what extent the outer CTDs influence integration site selection. In addition, if this

136 novel fusion protein efficiently targets integration to a particular sequence, it would be an attractive protein to be incorporated into a gene therapy. As discussed in Chapter 1, retroviral gene therapy has safety issues due to insertional mutagenesis. If integration was able to be targeted to a particular sequence that is known to be safe, retroviral gene therapy would be much safer and, therefore, ideal for gene therapy that requires lifelong expression of a particular gene.

Another avenue to explore PFV integration into nucleosomes would be to use single molecule platforms. These platforms would be useful in understanding integration kinetics and test our hypothesis of search mechanism. smTIRF could be used by fluorescently labeling the nucleosome and intasome and track them in real time by colocalization and fluorescence resonance energy transfer (FRET). Changes in FRET would allow tracking of subtle changes in movement such as a conformational change. In addition, single molecule studies could give insight into what happens to the nucleosome when integration occurs: does it roll away or disassemble? This can be tested by labeling the nucleosome on both the DNA and histone H2A in a way that allows them to FRET. If the nucleosome rolls, then FRET will decrease, but fluorophores may remain colocalized. This same pattern could occur if the nucleosome DNA is pulled up by the intasome as was suggested by the structure of the PFV intasome docked on a nucleosome [240]. However, the degree to which FRET is lost as well as the timing may allow us to discern between these two mechanisms. By contrast, if the nucleosome disassembles, both FRET and the histone fluorophore itself will be lost.

137

Alternatively, it is also possible that in our in vitro setup none of these models fit the results. That could mean that there are other factors that are missing in our in vitro setup that are involved in this process. The fact that we could be missing components that would be present in cells is a limitation to all of our work. However, our experiments allow us to simplify the cellular environment to look at how the proteins we study work in isolation.

A final future direction is to repeat all of these experiments with HIV-1 IN. Recent work has found that fusing a small peptide Sso7d to the amino terminus of HIV-1 IN significantly increases its solubility [422]. This has allowed more functional and structural studies to be performed, with the ability to assemble and purify HIV-1 intasomes [244].

HIV-1 IN experiments are more complicated for several reasons. First, HIV-1 intasomes were found to be various multimeric sizes from tetramers to possibly hexadecamers [244].

Currently, it is not known which species is/are active and physiologically relevant. In addition, it is known that HIV-1 IN has host cofactor LEDGF to tether the intasome to chromatin [52, 296-300]. Since LEDGF binds to H3(K36) trimethylated residues, it would be particularly interesting to compare integration sites and dynamics with unmodified and

H3(K36me3) nucleosomes [311].

However, another caveat to studying HIV-1 IN in the context of the high resolution

DNA denaturing gels is that HIV-1 integration results in a higher proportion of half-site integration compared to PFV integration. DNA denaturing gels cannot distinguish between half-site and concerted integration, which would complicate analysis for HIV-1 integration experiments. In addition, truncation mutants cannot be studied due to the lack of knowledge of the intasome size and the fact that the point mutations used for PFV IN to selectively

138 position monomers as inner or outer subunits do not exist for HIV-1 IN. However, comparing HIV-1 integration into unmodified and modified nucleosomes and performing

HIV-1 intasome single molecule studies would provide some insight into search mechanics.

139

References

1. Lefkowitz EJ, Dempsey DM, Hendrickson RC, Orton RJ, Siddell SG, Smith DB. Virus taxonomy: the database of the International Committee on Taxonomy of Viruses (ICTV). Nucleic Acids Res. 2018;46(D1):D708-D17. Epub 2017/10/19. doi: 10.1093/nar/gkx932. PubMed PMID: 29040670; PubMed Central PMCID: PMCPMC5753373.

2. Coffin JM, Hughes SH, Varmus HE. Oncogenesis. In: Coffin JM, Hughes SH, Varmus HE, editors. Retroviruses. Cold Spring Harbor (NY)1997.

3. Coffin JM, Hughes SH, Varmus HE. Genetic Organization. In: Coffin JM, Hughes SH, Varmus HE, editors. Retroviruses. Cold Spring Harbor (NY)1997.

4. Bangham CR, Ratner L. How does HTLV-1 cause adult T-cell leukaemia/lymphoma (ATL)? Curr Opin Virol. 2015;14:93-100. Epub 2015/09/29. doi: 10.1016/j.coviro.2015.09.004. PubMed PMID: 26414684; PubMed Central PMCID: PMCPMC4772697.

5. Meiering CD, Linial ML. Historical perspective of foamy virus epidemiology and infection. Clin Microbiol Rev. 2001;14(1):165-76. Epub 2001/01/09. doi: 10.1128/CMR.14.1.165-176.2001. PubMed PMID: 11148008; PubMed Central PMCID: PMCPMC88968.

6. Achong BG, Mansell PW, Epstein MA, Clifford P. An unusual virus in cultures from a human nasopharyngeal carcinoma. J Natl Cancer Inst. 1971;46(2):299-307. Epub 1971/02/01. PubMed PMID: 4329955.

7. Enders JF, Peebles TC. Propagation in tissue cultures of cytopathogenic agents from patients with measles. Proc Soc Exp Biol Med. 1954;86(2):277-86. Epub 1954/06/01. PubMed PMID: 13177653.

8. Rustigian R, Johnston P, Reihart H. Infection of monkey kidney tissue cultures with virus-like agents. Proc Soc Exp Biol Med. 1955;88(1):8-16. Epub 1955/01/01. PubMed PMID: 14357329.

9. Broussard SR, Comuzzie AG, Leighton KL, Leland MM, Whitehead EM, Allan JS. Characterization of new simian foamy viruses from African nonhuman primates. 140

Virology. 1997;237(2):349-59. Epub 1997/11/14. doi: 10.1006/viro.1997.8797. PubMed PMID: 9356346.

10. Daniels MJ, Golder MC, Jarrett O, MacDonald DW. Feline viruses in wildcats from Scotland. J Wildl Dis. 1999;35(1):121-4. Epub 1999/03/12. doi: 10.7589/0090-3558- 35.1.121. PubMed PMID: 10073361.

11. Johnson RH, de la Rosa J, Abher I, Kertayadnya IG, Entwistle KW, Fordyce G, et al. Epidemiological studies of bovine spumavirus. Vet Microbiol. 1988;16(1):25-33. Epub 1988/01/01. PubMed PMID: 2833003.

12. Herchenroder O, Renne R, Loncar D, Cobb EK, Murthy KK, Schneider J, et al. Isolation, cloning, and sequencing of simian foamy viruses from chimpanzees (SFVcpz): high homology to human foamy virus (HFV). Virology. 1994;201(2):187-99. Epub 1994/06/01. doi: 10.1006/viro.1994.1285. PubMed PMID: 8184531.

13. Salminen MO, Koch C, Sanders-Buell E, Ehrenberg PK, Michael NL, Carr JK, et al. Recovery of virtually full-length HIV-1 provirus of diverse subtypes from primary virus cultures using the polymerase chain reaction. Virology. 1995;213(1):80-6. Epub 1995/10/20. doi: 10.1006/viro.1995.1548. PubMed PMID: 7483282.

14. Coffin JM, Hughes SH, Varmus HE. Retroviral “Lifestyles”: Simple versus Complex. In: Coffin JM, Hughes SH, Varmus HE, editors. Retroviruses. Cold Spring Harbor (NY)1997.

15. Klatzmann D, Champagne E, Chamaret S, Gruest J, Guetard D, Hercend T, et al. T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature. 1984;312(5996):767-8. Epub 1984/12/20. PubMed PMID: 6083454.

16. Maddon PJ, Dalgleish AG, McDougal JS, Clapham PR, Weiss RA, Axel R. The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell. 1986;47(3):333-48. Epub 1986/11/07. PubMed PMID: 3094962.

17. Rizzuto CD, Wyatt R, Hernandez-Ramos N, Sun Y, Kwong PD, Hendrickson WA, et al. A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding. Science. 1998;280(5371):1949-53. Epub 1998/06/25. PubMed PMID: 9632396.

18. Connor RI, Sheridan KE, Ceradini D, Choe S, Landau NR. Change in coreceptor use correlates with disease progression in HIV-1--infected individuals. J Exp Med. 1997;185(4):621-8. Epub 1997/02/17. PubMed PMID: 9034141; PubMed Central PMCID: PMCPMC2196142.

19. Furuta RA, Wild CT, Weng Y, Weiss CD. Capture of an early fusion-active conformation of HIV-1 gp41. Nat Struct Biol. 1998;5(4):276-9. Epub 1998/04/18. PubMed PMID: 9546217. 141

20. Stirnnagel K, Luftenegger D, Stange A, Swiersy A, Mullers E, Reh J, et al. Analysis of prototype foamy virus particle-host cell interaction with autofluorescent retroviral particles. Retrovirology. 2010;7:45. Epub 2010/05/19. doi: 10.1186/1742-4690-7-45. PubMed PMID: 20478027; PubMed Central PMCID: PMCPMC2887381.

21. Duda A, Luftenegger D, Pietschmann T, Lindemann D. Characterization of the prototype foamy virus envelope glycoprotein receptor-binding domain. J Virol. 2006;80(16):8158-67. Epub 2006/07/29. doi: 10.1128/JVI.00460-06. PubMed PMID: 16873272; PubMed Central PMCID: PMCPMC1563792.

22. Picard-Maureau M, Jarmy G, Berg A, Rethwilm A, Lindemann D. Foamy virus envelope glycoprotein-mediated entry involves a pH-dependent fusion process. J Virol. 2003;77(8):4722-30. Epub 2003/03/29. PubMed PMID: 12663779; PubMed Central PMCID: PMCPMC152125.

23. Baltimore D. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature. 1970;226(5252):1209-11. Epub 1970/06/27. PubMed PMID: 4316300.

24. Temin HM, Mizutani S. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature. 1970;226(5252):1211-3. Epub 1970/06/27. PubMed PMID: 4316301.

25. Roberts JD, Bebenek K, Kunkel TA. The accuracy of reverse transcriptase from HIV-1. Science. 1988;242(4882):1171-3. Epub 1988/11/25. PubMed PMID: 2460925.

26. Mak J, Kleiman L. Primer tRNAs for reverse transcription. J Virol. 1997;71(11):8087-95. Epub 1997/10/29. PubMed PMID: 9343157; PubMed Central PMCID: PMCPMC192263.

27. Marquet R, Isel C, Ehresmann C, Ehresmann B. tRNAs as primer of reverse transcriptases. Biochimie. 1995;77(1-2):113-24. Epub 1995/01/01. PubMed PMID: 7541250.

28. Isel C, Lanchy JM, Le Grice SF, Ehresmann C, Ehresmann B, Marquet R. Specific initiation and switch to elongation of human immunodeficiency virus type 1 reverse transcription require the post-transcriptional modifications of primer tRNA3Lys. The EMBO journal. 1996;15(4):917-24. Epub 1996/02/15. PubMed PMID: 8631312; PubMed Central PMCID: PMCPMC450289.

29. Hu WS, Temin HM. Retroviral recombination and reverse transcription. Science. 1990;250(4985):1227-33. Epub 1990/11/30. PubMed PMID: 1700865.

30. Panganiban AT, Fiore D. Ordered interstrand and intrastrand DNA transfer during reverse transcription. Science. 1988;241(4869):1064-9. Epub 1988/08/26. PubMed PMID: 2457948. 142

31. Wilhelm M, Boutabout M, Heyman T, Wilhelm FX. Reverse transcription of the yeast Ty1 retrotransposon: the mode of first strand transfer is either intermolecular or intramolecular. Journal of molecular biology. 1999;288(4):505-10. Epub 1999/05/18. doi: 10.1006/jmbi.1999.2723. PubMed PMID: 10329158.

32. Chen D, Song J, Sun Y, Li Z, Wen D, Liu Q, et al. The fourth central polypurine tract guides the synthesis of prototype foamy virus plus-strand DNA. Virus Genes. 2017;53(2):259-65. Epub 2017/02/12. doi: 10.1007/s11262-016-1425-8. PubMed PMID: 28185138.

33. Wain-Hobson S, Sonigo P, Danos O, Cole S, Alizon M. Nucleotide sequence of the AIDS virus, LAV. Cell. 1985;40(1):9-17. Epub 1985/01/01. PubMed PMID: 2981635.

34. Ratner L, Haseltine W, Patarca R, Livak KJ, Starcich B, Josephs SF, et al. Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature. 1985;313(6000):277-84. Epub 1985/01/24. PubMed PMID: 2578615.

35. Swanstrom R, Varmus HE, Bishop JM. The terminal redundancy of the retrovirus genome facilitates chain elongation by reverse transcriptase. J Biol Chem. 1981;256(3):1115-21. Epub 1981/02/10. PubMed PMID: 6161131.

36. Charneau P, Clavel F. A single-stranded gap in human immunodeficiency virus unintegrated linear DNA defined by a central copy of the polypurine tract. J Virol. 1991;65(5):2415-21. Epub 1991/05/01. PubMed PMID: 2016765; PubMed Central PMCID: PMCPMC240594.

37. Hungnes O, Tjotta E, Grinde B. The plus strand is discontinuous in a subpopulation of unintegrated HIV-1 DNA. Arch Virol. 1991;116(1-4):133-41. Epub 1991/01/01. PubMed PMID: 2001174.

38. Miller MD, Wang B, Bushman FD. Human immunodeficiency virus type 1 preintegration complexes containing discontinuous plus strands are competent to integrate in vitro. J Virol. 1995;69(6):3938-44. Epub 1995/06/01. PubMed PMID: 7745750; PubMed Central PMCID: PMCPMC189122.

39. Baldwin DN, Linial ML. The roles of Pol and Env in the assembly pathway of human foamy virus. J Virol. 1998;72(5):3658-65. Epub 1998/04/29. PubMed PMID: 9557646; PubMed Central PMCID: PMCPMC109586.

40. Moebes A, Enssle J, Bieniasz PD, Heinkelein M, Lindemann D, Bock M, et al. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J Virol. 1997;71(10):7305-11. Epub 1997/10/06. PubMed PMID: 9311807; PubMed Central PMCID: PMCPMC192074.

143

41. Yu SF, Sullivan MD, Linial ML. Evidence that the human foamy virus genome is DNA. J Virol. 1999;73(2):1565-72. Epub 1999/01/09. PubMed PMID: 9882362; PubMed Central PMCID: PMCPMC103981.

42. Bukrinsky MI, Sharova N, McDonald TL, Pushkarskaya T, Tarpley WG, Stevenson M. Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection. Proc Natl Acad Sci U S A. 1993;90(13):6125-9. Epub 1993/07/01. PubMed PMID: 7687060; PubMed Central PMCID: PMCPMC46880.

43. Farnet CM, Bushman FD. HIV-1 cDNA integration: requirement of HMG I(Y) protein for function of preintegration complexes in vitro. Cell. 1997;88(4):483-92. Epub 1997/02/21. PubMed PMID: 9038339.

44. Farnet CM, Haseltine WA. Determination of viral proteins present in the human immunodeficiency virus type 1 preintegration complex. J Virol. 1991;65(4):1910-5. Epub 1991/04/01. PubMed PMID: 2002549; PubMed Central PMCID: PMCPMC240011.

45. Gallay P, Swingler S, Song J, Bushman F, Trono D. HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase. Cell. 1995;83(4):569-76. Epub 1995/11/17. PubMed PMID: 7585960.

46. Iordanskiy S, Berro R, Altieri M, Kashanchi F, Bukrinsky M. Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin. Retrovirology. 2006;3:4. Epub 2006/01/18. doi: 10.1186/1742-4690-3-4. PubMed PMID: 16409631; PubMed Central PMCID: PMCPMC1360674.

47. Karageorgos L, Li P, Burrell C. Characterization of HIV replication complexes early after cell-to-cell infection. AIDS Res Hum Retroviruses. 1993;9(9):817-23. Epub 1993/09/01. doi: 10.1089/aid.1993.9.817. PubMed PMID: 7504934.

48. Lee MS, Craigie R. A previously unidentified host protein protects retroviral DNA from autointegration. Proc Natl Acad Sci U S A. 1998;95(4):1528-33. Epub 1998/03/21. PubMed PMID: 9465049; PubMed Central PMCID: PMCPMC19075.

49. Li L, Olvera JM, Yoder KE, Mitchell RS, Butler SL, Lieber M, et al. Role of the non-homologous DNA end joining pathway in the early steps of retroviral infection. The EMBO journal. 2001;20(12):3272-81. Epub 2001/06/19. doi: 10.1093/emboj/20.12.3272. PubMed PMID: 11406603; PubMed Central PMCID: PMCPMC150207.

50. Li L, Yoder K, Hansen MS, Olvera J, Miller MD, Bushman FD. Retroviral cDNA integration: stimulation by HMG I family proteins. J Virol. 2000;74(23):10965-74. Epub 2000/11/09. PubMed PMID: 11069991; PubMed Central PMCID: PMCPMC113176.

144

51. Lin CW, Engelman A. The barrier-to-autointegration factor is a component of functional human immunodeficiency virus type 1 preintegration complexes. J Virol. 2003;77(8):5030-6. Epub 2003/03/29. PubMed PMID: 12663813; PubMed Central PMCID: PMCPMC152146.

52. Llano M, Vanegas M, Fregoso O, Saenz D, Chung S, Peretz M, et al. LEDGF/p75 determines cellular trafficking of diverse lentiviral but not murine oncoretroviral integrase proteins and is a component of functional lentiviral preintegration complexes. J Virol. 2004;78(17):9524-37. Epub 2004/08/17. doi: 10.1128/JVI.78.17.9524-9537.2004. PubMed PMID: 15308744; PubMed Central PMCID: PMCPMC506940.

53. Miller MD, Farnet CM, Bushman FD. Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition. J Virol. 1997;71(7):5382-90. Epub 1997/07/01. PubMed PMID: 9188609; PubMed Central PMCID: PMCPMC191777.

54. Vandegraaff N, Devroe E, Turlure F, Silver PA, Engelman A. Biochemical and genetic analyses of integrase-interacting proteins lens epithelium-derived growth factor (LEDGF)/p75 and hepatoma-derived growth factor related protein 2 (HRP2) in preintegration complex function and HIV-1 replication. Virology. 2006;346(2):415-26. Epub 2005/12/13. doi: 10.1016/j.virol.2005.11.022. PubMed PMID: 16337983.

55. Lesbats P, Botbol Y, Chevereau G, Vaillant C, Calmels C, Arneodo A, et al. Functional coupling between HIV-1 integrase and the SWI/SNF chromatin remodeling complex for efficient in vitro integration into stable nucleosomes. PLoS Pathog. 2011;7(2):e1001280. doi: 10.1371/journal.ppat.1001280. PubMed PMID: 21347347; PubMed Central PMCID: PMCPMC3037357.

56. Rankovic S, Varadarajan J, Ramalho R, Aiken C, Rousso I. Reverse Transcription Mechanically Initiates HIV-1 Capsid Disassembly. J Virol. 2017;91(12). Epub 2017/04/07. doi: 10.1128/JVI.00289-17. PubMed PMID: 28381579; PubMed Central PMCID: PMCPMC5446659.

57. Forshey BM, von Schwedler U, Sundquist WI, Aiken C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. J Virol. 2002;76(11):5667-77. Epub 2002/05/07. PubMed PMID: 11991995; PubMed Central PMCID: PMCPMC137032.

58. Patton GS, Erlwein O, McClure MO. Cell-cycle dependence of foamy virus vectors. J Gen Virol. 2004;85(Pt 10):2925-30. Epub 2004/09/28. doi: 10.1099/vir.0.80210- 0. PubMed PMID: 15448354.

59. Weinberg JB, Matthews TJ, Cullen BR, Malim MH. Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes. J

145

Exp Med. 1991;174(6):1477-82. Epub 1991/12/01. PubMed PMID: 1720811; PubMed Central PMCID: PMCPMC2119042.

60. Suzuki Y, Craigie R. The road to chromatin - nuclear entry of retroviruses. Nat Rev Microbiol. 2007;5(3):187-96. Epub 2007/02/17. doi: 10.1038/nrmicro1579. PubMed PMID: 17304248.

61. Gamble TR, Vajdos FF, Yoo S, Worthylake DK, Houseweart M, Sundquist WI, et al. Crystal structure of human cyclophilin A bound to the amino-terminal domain of HIV- 1 capsid. Cell. 1996;87(7):1285-94. Epub 1996/12/27. PubMed PMID: 8980234.

62. Schaller T, Ocwieja KE, Rasaiyaah J, Price AJ, Brady TL, Roth SL, et al. HIV-1 capsid-cyclophilin interactions determine nuclear import pathway, integration targeting and replication efficiency. PLoS Pathog. 2011;7(12):e1002439. Epub 2011/12/17. doi: 10.1371/journal.ppat.1002439. PubMed PMID: 22174692; PubMed Central PMCID: PMCPMC3234246.

63. Fouchier RA, Meyer BE, Simon JH, Fischer U, Albright AV, Gonzalez-Scarano F, et al. Interaction of the human immunodeficiency virus type 1 Vpr protein with the nuclear pore complex. J Virol. 1998;72(7):6004-13. Epub 1998/06/17. PubMed PMID: 9621063; PubMed Central PMCID: PMCPMC110405.

64. Guenzel CA, Herate C, Benichou S. HIV-1 Vpr-a still "enigmatic multitasker". Front Microbiol. 2014;5:127. Epub 2014/04/20. doi: 10.3389/fmicb.2014.00127. PubMed PMID: 24744753; PubMed Central PMCID: PMCPMC3978352.

65. Popov S, Rexach M, Ratner L, Blobel G, Bukrinsky M. Viral protein R regulates docking of the HIV-1 preintegration complex to the nuclear pore complex. J Biol Chem. 1998;273(21):13347-52. Epub 1998/05/28. PubMed PMID: 9582382.

66. Popov S, Rexach M, Zybarth G, Reiling N, Lee MA, Ratner L, et al. Viral protein R regulates nuclear import of the HIV-1 pre-integration complex. The EMBO journal. 1998;17(4):909-17. Epub 1998/03/28. doi: 10.1093/emboj/17.4.909. PubMed PMID: 9463369; PubMed Central PMCID: PMCPMC1170440.

67. Brass AL, Dykxhoorn DM, Benita Y, Yan N, Engelman A, Xavier RJ, et al. Identification of host proteins required for HIV infection through a functional genomic screen. Science. 2008;319(5865):921-6. Epub 2008/01/12. doi: 10.1126/science.1152725. PubMed PMID: 18187620.

68. Bushman FD, Malani N, Fernandes J, D'Orso I, Cagney G, Diamond TL, et al. Host cell factors in HIV replication: meta-analysis of genome-wide studies. PLoS Pathog. 2009;5(5):e1000437. Epub 2009/05/30. doi: 10.1371/journal.ppat.1000437. PubMed PMID: 19478882; PubMed Central PMCID: PMCPMC2682202.

146

69. Konig R, Zhou Y, Elleder D, Diamond TL, Bonamy GM, Irelan JT, et al. Global analysis of host-pathogen interactions that regulate early-stage HIV-1 replication. Cell. 2008;135(1):49-60. Epub 2008/10/16. doi: 10.1016/j.cell.2008.07.032. PubMed PMID: 18854154; PubMed Central PMCID: PMCPMC2628946.

70. Lee K, Ambrose Z, Martin TD, Oztop I, Mulky A, Julias JG, et al. Flexible use of nuclear import pathways by HIV-1. Cell Host Microbe. 2010;7(3):221-33. Epub 2010/03/17. doi: 10.1016/j.chom.2010.02.007. PubMed PMID: 20227665; PubMed Central PMCID: PMCPMC2841689.

71. Di Nunzio F, Fricke T, Miccio A, Valle-Casuso JC, Perez P, Souque P, et al. Nup153 and Nup98 bind the HIV-1 core and contribute to the early steps of HIV-1 replication. Virology. 2013;440(1):8-18. Epub 2013/03/26. doi: 10.1016/j.virol.2013.02.008. PubMed PMID: 23523133; PubMed Central PMCID: PMCPMC3860269.

72. Matreyek KA, Yucel SS, Li X, Engelman A. Nucleoporin NUP153 phenylalanine- glycine motifs engage a common binding pocket within the HIV-1 capsid protein to mediate lentiviral infectivity. PLoS Pathog. 2013;9(10):e1003693. Epub 2013/10/17. doi: 10.1371/journal.ppat.1003693. PubMed PMID: 24130490; PubMed Central PMCID: PMCPMC3795039.

73. Christ F, Thys W, De Rijck J, Gijsbers R, Albanese A, Arosio D, et al. Transportin- SR2 imports HIV into the nucleus. Curr Biol. 2008;18(16):1192-202. Epub 2008/08/30. doi: 10.1016/j.cub.2008.07.079. PubMed PMID: 18722123.

74. Bhattacharya A, Alam SL, Fricke T, Zadrozny K, Sedzicki J, Taylor AB, et al. Structural basis of HIV-1 capsid recognition by PF74 and CPSF6. Proc Natl Acad Sci U S A. 2014;111(52):18625-30. Epub 2014/12/19. doi: 10.1073/pnas.1419945112. PubMed PMID: 25518861; PubMed Central PMCID: PMCPMC4284599.

75. Chin CR, Perreira JM, Savidis G, Portmann JM, Aker AM, Feeley EM, et al. Direct Visualization of HIV-1 Replication Intermediates Shows that Capsid and CPSF6 Modulate HIV-1 Intra-nuclear Invasion and Integration. Cell reports. 2015;13(8):1717-31. Epub 2015/11/21. doi: 10.1016/j.celrep.2015.10.036. PubMed PMID: 26586435; PubMed Central PMCID: PMCPMC5026322.

76. Lee K, Mulky A, Yuen W, Martin TD, Meyerson NR, Choi L, et al. HIV-1 capsid- targeting domain of cleavage and polyadenylation specificity factor 6. J Virol. 2012;86(7):3851-60. Epub 2012/02/04. doi: 10.1128/JVI.06607-11. PubMed PMID: 22301135; PubMed Central PMCID: PMCPMC3302544.

77. Rasheedi S, Shun MC, Serrao E, Sowd GA, Qian J, Hao C, et al. The Cleavage and Polyadenylation Specificity Factor 6 (CPSF6) Subunit of the Capsid-recruited Pre- messenger RNA Cleavage Factor I (CFIm) Complex Mediates HIV-1 Integration into 147

Genes. J Biol Chem. 2016;291(22):11809-19. doi: 10.1074/jbc.M116.721647. PubMed PMID: 26994143; PubMed Central PMCID: PMCPMC4882448.

78. Kataoka N, Bachorik JL, Dreyfuss G. Transportin-SR, a nuclear import receptor for SR proteins. J Cell Biol. 1999;145(6):1145-52. Epub 1999/06/15. PubMed PMID: 10366588; PubMed Central PMCID: PMCPMC2133142.

79. Ruegsegger U, Blank D, Keller W. Human pre-mRNA cleavage factor Im is related to spliceosomal SR proteins and can be reconstituted in vitro from recombinant subunits. Mol Cell. 1998;1(2):243-53. Epub 1998/07/11. PubMed PMID: 9659921.

80. Hilditch L, Towers GJ. A model for cofactor use during HIV-1 reverse transcription and nuclear entry. Curr Opin Virol. 2014;4:32-6. Epub 2014/02/15. doi: 10.1016/j.coviro.2013.11.003. PubMed PMID: 24525292; PubMed Central PMCID: PMCPMC3969716.

81. Saib A, Puvion-Dutilleul F, Schmid M, Peries J, de The H. Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step. J Virol. 1997;71(2):1155-61. Epub 1997/02/01. PubMed PMID: 8995637; PubMed Central PMCID: PMCPMC191168.

82. Trobridge G, Russell DW. Cell cycle requirements for transduction by foamy virus vectors compared to those of oncovirus and lentivirus vectors. J Virol. 2004;78(5):2327- 35. Epub 2004/02/14. PubMed PMID: 14963129; PubMed Central PMCID: PMCPMC369213.

83. Lo YT, Tian T, Nadeau PE, Park J, Mergia A. The foamy virus genome remains unintegrated in the nuclei of G1/S phase-arrested cells, and integrase is critical for preintegration complex transport into the nucleus. J Virol. 2010;84(6):2832-42. Epub 2009/12/25. doi: 10.1128/JVI.02435-09. PubMed PMID: 20032182; PubMed Central PMCID: PMCPMC2826029.

84. Tobaly-Tapiero J, Bittoun P, Lehmann-Che J, Delelis O, Giron ML, de The H, et al. Chromatin tethering of incoming foamy virus by the structural Gag protein. Traffic. 2008;9(10):1717-27. Epub 2008/07/17. doi: 10.1111/j.1600-0854.2008.00792.x. PubMed PMID: 18627573.

85. Mullers E, Stirnnagel K, Kaulfuss S, Lindemann D. Prototype foamy virus gag nuclear localization: a novel pathway among retroviruses. J Virol. 2011;85(18):9276-85. Epub 2011/07/01. doi: 10.1128/JVI.00663-11. PubMed PMID: 21715475; PubMed Central PMCID: PMCPMC3165767.

86. Bukrinsky MI, Stanwick TL, Dempsey MP, Stevenson M. Quiescent T lymphocytes as an inducible virus reservoir in HIV-1 infection. Science. 1991;254(5030):423-7. Epub 1991/10/18. PubMed PMID: 1925601. 148

87. Chun TW, Carruth L, Finzi D, Shen X, DiGiuseppe JA, Taylor H, et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature. 1997;387(6629):183-8. doi: 10.1038/387183a0. PubMed PMID: 9144289.

88. Pang S, Koyanagi Y, Miles S, Wiley C, Vinters HV, Chen IS. High levels of unintegrated HIV-1 DNA in brain tissue of AIDS dementia patients. Nature. 1990;343(6253):85-9. Epub 1990/01/04. doi: 10.1038/343085a0. PubMed PMID: 2296295.

89. Sharkey ME, Teo I, Greenough T, Sharova N, Luzuriaga K, Sullivan JL, et al. Persistence of episomal HIV-1 infection intermediates in patients on highly active anti- retroviral therapy. Nat Med. 2000;6(1):76-81. Epub 1999/12/29. doi: 10.1038/71569. PubMed PMID: 10613828.

90. Teo I, Veryard C, Barnes H, An SF, Jones M, Lantos PL, et al. Circular forms of unintegrated human immunodeficiency virus type 1 DNA and high levels of viral protein expression: association with dementia and multinucleated giant cells in the brains of patients with AIDS. J Virol. 1997;71(4):2928-33. Epub 1997/04/01. PubMed PMID: 9060651; PubMed Central PMCID: PMCPMC191420.

91. Deyle DR, Li Y, Olson EM, Russell DW. Nonintegrating foamy virus vectors. J Virol. 2010;84(18):9341-9. Epub 2010/07/02. doi: 10.1128/JVI.00394-10. PubMed PMID: 20592072; PubMed Central PMCID: PMCPMC2937610.

92. Shoemaker C, Goff S, Gilboa E, Paskind M, Mitra SW, Baltimore D. Structure of a cloned circular Moloney murine leukemia virus DNA molecule containing an inverted segment: implications for retrovirus integration. Proc Natl Acad Sci U S A. 1980;77(7):3932-6. Epub 1980/07/01. PubMed PMID: 6449003; PubMed Central PMCID: PMCPMC349741.

93. Zheng Y, Ao Z, Wang B, Jayappa KD, Yao X. Host protein Ku70 binds and protects HIV-1 integrase from proteasomal degradation and is required for HIV replication. J Biol Chem. 2011;286(20):17722-35. Epub 2011/04/02. doi: 10.1074/jbc.M110.184739. PubMed PMID: 21454661; PubMed Central PMCID: PMCPMC3093848.

94. Jeanson L, Subra F, Vaganay S, Hervy M, Marangoni E, Bourhis J, et al. Effect of Ku80 depletion on the preintegrative steps of HIV-1 replication in human cells. Virology. 2002;300(1):100-8. Epub 2002/08/31. PubMed PMID: 12202210.

95. Farnet CM, Haseltine WA. Circularization of human immunodeficiency virus type 1 DNA in vitro. J Virol. 1991;65(12):6942-52. Epub 1991/12/01. PubMed PMID: 1834863; PubMed Central PMCID: PMCPMC250802.

149

96. Kilzer JM, Stracker T, Beitzel B, Meek K, Weitzman M, Bushman FD. Roles of host cell factors in circularization of retroviral dna. Virology. 2003;314(1):460-7. Epub 2003/10/01. PubMed PMID: 14517098.

97. Fujiwara T, Mizuuchi K. Retroviral DNA integration: structure of an integration intermediate. Cell. 1988;54(4):497-504. Epub 1988/08/12. PubMed PMID: 3401925.

98. Brown PO, Bowerman B, Varmus HE, Bishop JM. Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein. Proc Natl Acad Sci U S A. 1989;86(8):2525-9. Epub 1989/04/01. PubMed PMID: 2539592; PubMed Central PMCID: PMCPMC286949.

99. Brown PO, Bowerman B, Varmus HE, Bishop JM. Correct integration of retroviral DNA in vitro. Cell. 1987;49(3):347-56. Epub 1987/05/08. PubMed PMID: 3032450.

100. Englund G, Theodore TS, Freed EO, Engelman A, Martin MA. Integration is required for productive infection of monocyte-derived macrophages by human immunodeficiency virus type 1. J Virol. 1995;69(5):3216-9. Epub 1995/05/01. PubMed PMID: 7707554; PubMed Central PMCID: PMCPMC189028.

101. Wiskerchen M, Muesing MA. Human immunodeficiency virus type 1 integrase: effects of mutations on viral ability to integrate, direct viral gene expression from unintegrated viral DNA templates, and sustain viral propagation in primary cells. J Virol. 1995;69(1):376-86. Epub 1995/01/01. PubMed PMID: 7983732; PubMed Central PMCID: PMCPMC188585.

102. Bukrinsky MI, Sharova N, Dempsey MP, Stanwick TL, Bukrinskaya AG, Haggerty S, et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci U S A. 1992;89(14):6580-4. Epub 1992/07/15. PubMed PMID: 1631159; PubMed Central PMCID: PMCPMC49545.

103. Butler SL, Hansen MS, Bushman FD. A quantitative assay for HIV DNA integration in vivo. Nat Med. 2001;7(5):631-4. Epub 2001/05/01. doi: 10.1038/87979. PubMed PMID: 11329067.

104. He F, Blair WS, Fukushima J, Cullen BR. The human foamy virus Bel-1 transcription factor is a sequence-specific DNA binding protein. J Virol. 1996;70(6):3902- 8. Epub 1996/06/01. PubMed PMID: 8648727; PubMed Central PMCID: PMCPMC190268.

105. Sodroski J, Patarca R, Rosen C, Wong-Staal F, Haseltine W. Location of the trans- activating region on the genome of human T-cell lymphotropic virus type III. Science. 1985;229(4708):74-7. Epub 1985/07/05. PubMed PMID: 2990041.

150

106. Sodroski J, Rosen C, Wong-Staal F, Salahuddin SZ, Popovic M, Arya S, et al. Trans-acting transcriptional regulation of human T-cell leukemia virus type III long terminal repeat. Science. 1985;227(4683):171-3. Epub 1985/01/11. PubMed PMID: 2981427.

107. Lochelt M, Muranyi W, Flugel RM. Human foamy virus genome possesses an internal, Bel-1-dependent and functional promoter. Proc Natl Acad Sci U S A. 1993;90(15):7317-21. Epub 1993/08/01. PubMed PMID: 8394017; PubMed Central PMCID: PMCPMC47128.

108. Kang Y, Blair WS, Cullen BR. Identification and functional characterization of a high-affinity Bel-1 DNA binding site located in the human foamy virus internal promoter. J Virol. 1998;72(1):504-11. Epub 1998/01/07. PubMed PMID: 9420252; PubMed Central PMCID: PMCPMC109401.

109. Chiu YL, Coronel E, Ho CK, Shuman S, Rana TM. HIV-1 Tat protein interacts with mammalian capping enzyme and stimulates capping of TAR RNA. J Biol Chem. 2001;276(16):12959-66. Epub 2001/03/30. doi: 10.1074/jbc.M007901200. PubMed PMID: 11278368.

110. Chiu YL, Ho CK, Saha N, Schwer B, Shuman S, Rana TM. Tat stimulates cotranscriptional capping of HIV mRNA. Mol Cell. 2002;10(3):585-97. Epub 2002/11/01. PubMed PMID: 12408826.

111. Kuciak M, Gabus C, Ivanyi-Nagy R, Semrad K, Storchak R, Chaloin O, et al. The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro. Nucleic Acids Res. 2008;36(10):3389-400. Epub 2008/04/30. doi: 10.1093/nar/gkn177. PubMed PMID: 18442994; PubMed Central PMCID: PMCPMC2425468.

112. Zhou M, Deng L, Kashanchi F, Brady JN, Shatkin AJ, Kumar A. The Tat/TAR- dependent phosphorylation of RNA polymerase II C-terminal domain stimulates cotranscriptional capping of HIV-1 mRNA. Proc Natl Acad Sci U S A. 2003;100(22):12666-71. Epub 2003/10/22. doi: 10.1073/pnas.1835726100. PubMed PMID: 14569024; PubMed Central PMCID: PMCPMC240675.

113. Schrom EM, Moschall R, Hartl MJ, Weitner H, Fecher D, Langemeier J, et al. U1snRNP-mediated suppression of polyadenylation in conjunction with the RNA structure controls poly (A) site selection in foamy viruses. Retrovirology. 2013;10:55. Epub 2013/05/31. doi: 10.1186/1742-4690-10-55. PubMed PMID: 23718736; PubMed Central PMCID: PMCPMC3694450.

114. Schrom EM, Moschall R, Schuch A, Bodem J. Regulation of retroviral polyadenylation. Adv Virus Res. 2013;85:1-24. Epub 2013/02/27. doi: 10.1016/B978-0- 12-408116-1.00001-X. PubMed PMID: 23439022.

151

115. Ashe MP, Griffin P, James W, Proudfoot NJ. Poly(A) site selection in the HIV-1 provirus: inhibition of promoter-proximal polyadenylation by the downstream major splice donor site. Genes Dev. 1995;9(23):3008-25. Epub 1995/12/01. PubMed PMID: 7498796.

116. Ashe MP, Pearson LH, Proudfoot NJ. The HIV-1 5' LTR poly(A) site is inactivated by U1 snRNP interaction with the downstream major splice donor site. The EMBO journal. 1997;16(18):5752-63. Epub 1997/10/06. doi: 10.1093/emboj/16.18.5752. PubMed PMID: 9312033; PubMed Central PMCID: PMCPMC1170206.

117. Muranyi W, Flugel RM. Analysis of splicing patterns of human spumaretrovirus by polymerase chain reaction reveals complex RNA structures. J Virol. 1991;65(2):727- 35. Epub 1991/02/01. PubMed PMID: 1846194; PubMed Central PMCID: PMCPMC239812.

118. Guatelli JC, Gingeras TR, Richman DD. Alternative splice acceptor utilization during human immunodeficiency virus type 1 infection of cultured cells. J Virol. 1990;64(9):4093-8. Epub 1990/09/01. PubMed PMID: 2384914; PubMed Central PMCID: PMCPMC247871.

119. Purcell DF, Martin MA. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity. J Virol. 1993;67(11):6365-78. Epub 1993/11/01. PubMed PMID: 8411338; PubMed Central PMCID: PMCPMC238071.

120. Schwartz S, Felber BK, Benko DM, Fenyo EM, Pavlakis GN. Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1. J Virol. 1990;64(6):2519-29. Epub 1990/06/01. PubMed PMID: 2335812; PubMed Central PMCID: PMCPMC249427.

121. Charpentier B, Stutz F, Rosbash M. A dynamic in vivo view of the HIV-I Rev-RRE interaction. Journal of molecular biology. 1997;266(5):950-62. Epub 1997/03/14. doi: 10.1006/jmbi.1996.0858. PubMed PMID: 9086273.

122. Emerman M, Vazeux R, Peden K. The rev gene product of the human immunodeficiency virus affects envelope-specific RNA localization. Cell. 1989;57(7):1155-65. Epub 1989/06/30. PubMed PMID: 2736624.

123. Felber BK, Hadzopoulou-Cladaras M, Cladaras C, Copeland T, Pavlakis GN. rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA. Proc Natl Acad Sci U S A. 1989;86(5):1495-9. Epub 1989/03/01. PubMed PMID: 2784208; PubMed Central PMCID: PMCPMC286723.

124. Malim MH, Hauber J, Le SY, Maizel JV, Cullen BR. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral

152 mRNA. Nature. 1989;338(6212):254-7. Epub 1989/03/16. doi: 10.1038/338254a0. PubMed PMID: 2784194.

125. Bray M, Prasad S, Dubay JW, Hunter E, Jeang KT, Rekosh D, et al. A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc Natl Acad Sci U S A. 1994;91(4):1256-60. Epub 1994/02/15. PubMed PMID: 8108397; PubMed Central PMCID: PMCPMC43136.

126. Lochelt M, Flugel RM. The human foamy virus pol gene is expressed as a Pro-Pol polyprotein and not as a Gag-Pol fusion protein. J Virol. 1996;70(2):1033-40. Epub 1996/02/01. PubMed PMID: 8551561; PubMed Central PMCID: PMCPMC189909.

127. Jordan I, Enssle J, Guttler E, Mauer B, Rethwilm A. Expression of human foamy virus reverse transcriptase involves a spliced pol mRNA. Virology. 1996;224(1):314-9. Epub 1996/10/01. doi: 10.1006/viro.1996.0534. PubMed PMID: 8862427.

128. Jacks T, Power MD, Masiarz FR, Luciw PA, Barr PJ, Varmus HE. Characterization of ribosomal frameshifting in HIV-1 gag-pol expression. Nature. 1988;331(6153):280-3. Epub 1988/01/21. doi: 10.1038/331280a0. PubMed PMID: 2447506.

129. Wilson W, Braddock M, Adams SE, Rathjen PD, Kingsman SM, Kingsman AJ. HIV expression strategies: ribosomal frameshifting is directed by a short sequence in both mammalian and yeast systems. Cell. 1988;55(6):1159-69. Epub 1988/12/23. PubMed PMID: 3060262.

130. Kutluay SB, Bieniasz PD. Analysis of the initiating events in HIV-1 particle assembly and genome packaging. PLoS Pathog. 2010;6(11):e1001200. Epub 2010/12/03. doi: 10.1371/journal.ppat.1001200. PubMed PMID: 21124996; PubMed Central PMCID: PMCPMC2987827.

131. Saad JS, Loeliger E, Luncsford P, Liriano M, Tai J, Kim A, et al. Point mutations in the HIV-1 matrix protein turn off the myristyl switch. Journal of molecular biology. 2007;366(2):574-85. Epub 2006/12/26. doi: 10.1016/j.jmb.2006.11.068. PubMed PMID: 17188710; PubMed Central PMCID: PMCPMC1853300.

132. Ono A. HIV-1 Assembly at the Plasma Membrane: Gag Trafficking and Localization. Future Virol. 2009;4(3):241-57. Epub 2009/10/06. doi: 10.2217/fvl.09.4. PubMed PMID: 19802344; PubMed Central PMCID: PMCPMC2676728.

133. Ono A, Freed EO. Plasma membrane rafts play a critical role in HIV-1 assembly and release. Proc Natl Acad Sci U S A. 2001;98(24):13925-30. Epub 2001/11/22. doi: 10.1073/pnas.241320298. PubMed PMID: 11717449; PubMed Central PMCID: PMCPMC61143.

153

134. Chukkapalli V, Oh SJ, Ono A. Opposing mechanisms involving RNA and lipids regulate HIV-1 Gag membrane binding through the highly basic region of the matrix domain. Proc Natl Acad Sci U S A. 2010;107(4):1600-5. Epub 2010/01/19. doi: 10.1073/pnas.0908661107. PubMed PMID: 20080620; PubMed Central PMCID: PMCPMC2824378.

135. Datta SA, Heinrich F, Raghunandan S, Krueger S, Curtis JE, Rein A, et al. HIV-1 Gag extension: conformational changes require simultaneous interaction with membrane and nucleic acid. Journal of molecular biology. 2011;406(2):205-14. Epub 2010/12/08. doi: 10.1016/j.jmb.2010.11.051. PubMed PMID: 21134384; PubMed Central PMCID: PMCPMC3046808.

136. Jones CP, Datta SA, Rein A, Rouzina I, Musier-Forsyth K. Matrix domain modulates HIV-1 Gag's nucleic acid chaperone activity via inositol phosphate binding. J Virol. 2011;85(4):1594-603. Epub 2010/12/03. doi: 10.1128/JVI.01809-10. PubMed PMID: 21123373; PubMed Central PMCID: PMCPMC3028911.

137. Jouvenet N, Simon SM, Bieniasz PD. Imaging the interaction of HIV-1 genomes and Gag during assembly of individual viral particles. Proc Natl Acad Sci U S A. 2009;106(45):19114-9. Epub 2009/10/29. doi: 10.1073/pnas.0907364106. PubMed PMID: 19861549; PubMed Central PMCID: PMCPMC2776408.

138. Moore MD, Hu WS. HIV-1 RNA dimerization: It takes two to tango. AIDS Rev. 2009;11(2):91-102. Epub 2009/06/17. PubMed PMID: 19529749; PubMed Central PMCID: PMCPMC3056336.

139. Aldovini A, Young RA. Mutations of RNA and protein sequences involved in human immunodeficiency virus type 1 packaging result in production of noninfectious virus. J Virol. 1990;64(5):1920-6. Epub 1990/05/01. PubMed PMID: 2109098; PubMed Central PMCID: PMCPMC249345.

140. Clavel F, Orenstein JM. A mutant of human immunodeficiency virus with reduced RNA packaging and abnormal particle morphology. J Virol. 1990;64(10):5230-4. Epub 1990/10/01. PubMed PMID: 2204725; PubMed Central PMCID: PMCPMC248025.

141. Harrison GP, Miele G, Hunter E, Lever AM. Functional analysis of the core human immunodeficiency virus type 1 packaging signal in a permissive cell line. J Virol. 1998;72(7):5886-96. Epub 1998/06/17. PubMed PMID: 9621050; PubMed Central PMCID: PMCPMC110392.

142. Kim HJ, Lee K, O'Rear JJ. A short sequence upstream of the 5' major splice site is important for encapsidation of HIV-1 genomic RNA. Virology. 1994;198(1):336-40. Epub 1994/01/01. doi: 10.1006/viro.1994.1037. PubMed PMID: 8259668.

154

143. McBride MS, Panganiban AT. The human immunodeficiency virus type 1 encapsidation site is a multipartite RNA element composed of functional hairpin structures. J Virol. 1996;70(5):2963-73. Epub 1996/05/01. PubMed PMID: 8627772; PubMed Central PMCID: PMCPMC190155.

144. McBride MS, Panganiban AT. Position dependence of functional hairpins important for human immunodeficiency virus type 1 RNA encapsidation in vivo. J Virol. 1997;71(3):2050-8. Epub 1997/03/01. PubMed PMID: 9032337; PubMed Central PMCID: PMCPMC191293.

145. McBride MS, Schwartz MD, Panganiban AT. Efficient encapsidation of human immunodeficiency virus type 1 vectors and further characterization of cis elements required for encapsidation. J Virol. 1997;71(6):4544-54. Epub 1997/06/01. PubMed PMID: 9151848; PubMed Central PMCID: PMCPMC191676.

146. Cosson P. Direct interaction between the envelope and matrix proteins of HIV-1. The EMBO journal. 1996;15(21):5783-8. Epub 1996/11/01. PubMed PMID: 8918455; PubMed Central PMCID: PMCPMC452325.

147. Murakami T, Freed EO. The long cytoplasmic tail of gp41 is required in a cell type- dependent manner for HIV-1 envelope glycoprotein incorporation into virions. Proc Natl Acad Sci U S A. 2000;97(1):343-8. Epub 2000/01/05. PubMed PMID: 10618420; PubMed Central PMCID: PMCPMC26665.

148. Wyma DJ, Kotov A, Aiken C. Evidence for a stable interaction of gp41 with Pr55(Gag) in immature human immunodeficiency virus type 1 particles. J Virol. 2000;74(20):9381-7. Epub 2000/09/23. PubMed PMID: 11000206; PubMed Central PMCID: PMCPMC112366.

149. Yu X, Yuan X, McLane MF, Lee TH, Essex M. Mutations in the cytoplasmic domain of human immunodeficiency virus type 1 transmembrane protein impair the incorporation of Env proteins into mature virions. J Virol. 1993;67(1):213-21. Epub 1993/01/01. PubMed PMID: 8416370; PubMed Central PMCID: PMCPMC237354.

150. Kondo E, Mammano F, Cohen EA, Gottlinger HG. The p6gag domain of human immunodeficiency virus type 1 is sufficient for the incorporation of Vpr into heterologous viral particles. J Virol. 1995;69(5):2759-64. Epub 1995/05/01. PubMed PMID: 7707498; PubMed Central PMCID: PMCPMC188969.

151. Sundquist WI, Krausslich HG. HIV-1 assembly, budding, and maturation. Cold Spring Harb Perspect Med. 2012;2(7):a006924. Epub 2012/07/05. doi: 10.1101/cshperspect.a006924. PubMed PMID: 22762019; PubMed Central PMCID: PMCPMC3385941.

155

152. Lavallee C, Yao XJ, Ladha A, Gottlinger H, Haseltine WA, Cohen EA. Requirement of the Pr55gag precursor for incorporation of the Vpr product into human immunodeficiency virus type 1 viral particles. J Virol. 1994;68(3):1926-34. Epub 1994/03/01. PubMed PMID: 8107252; PubMed Central PMCID: PMCPMC236654.

153. Lu YL, Spearman P, Ratner L. Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. J Virol. 1993;67(11):6542-50. Epub 1993/11/01. PubMed PMID: 8411357; PubMed Central PMCID: PMCPMC238091.

154. Paxton W, Connor RI, Landau NR. Incorporation of Vpr into human immunodeficiency virus type 1 virions: requirement for the p6 region of gag and mutational analysis. J Virol. 1993;67(12):7229-37. Epub 1993/12/01. PubMed PMID: 8230445; PubMed Central PMCID: PMCPMC238185.

155. Ott DE. Cellular proteins detected in HIV-1. Rev Med Virol. 2008;18(3):159-75. Epub 2008/02/12. doi: 10.1002/rmv.570. PubMed PMID: 18265424.

156. Cherepanov P, Maertens G, Proost P, Devreese B, Van Beeumen J, Engelborghs Y, et al. HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 protein in human cells. J Biol Chem. 2003;278(1):372-81. doi: 10.1074/jbc.M209278200. PubMed PMID: 12407101.

157. Bieniasz PD. The cell biology of HIV-1 virion genesis. Cell Host Microbe. 2009;5(6):550-8. Epub 2009/06/17. doi: 10.1016/j.chom.2009.05.015. PubMed PMID: 19527882; PubMed Central PMCID: PMCPMC3736989.

158. Carlton JG, Martin-Serrano J. The ESCRT machinery: new functions in viral and cellular biology. Biochem Soc Trans. 2009;37(Pt 1):195-9. Epub 2009/01/16. doi: 10.1042/BST0370195. PubMed PMID: 19143630.

159. Morita E, Sundquist WI. Retrovirus budding. Annu Rev Cell Dev Biol. 2004;20:395-425. Epub 2004/10/12. doi: 10.1146/annurev.cellbio.20.010403.102350. PubMed PMID: 15473846.

160. Peel S, Macheboeuf P, Martinelli N, Weissenhorn W. Divergent pathways lead to ESCRT-III-catalyzed membrane fission. Trends Biochem Sci. 2011;36(4):199-210. Epub 2010/10/30. doi: 10.1016/j.tibs.2010.09.004. PubMed PMID: 21030261.

161. Usami Y, Popov S, Popova E, Inoue M, Weissenhorn W, H GG. The ESCRT pathway and HIV-1 budding. Biochem Soc Trans. 2009;37(Pt 1):181-4. Epub 2009/01/16. doi: 10.1042/BST0370181. PubMed PMID: 19143627.

162. Hurley JH, Hanson PI. Membrane budding and scission by the ESCRT machinery: it's all in the neck. Nat Rev Mol Cell Biol. 2010;11(8):556-66. Epub 2010/07/01. doi:

156

10.1038/nrm2937. PubMed PMID: 20588296; PubMed Central PMCID: PMCPMC2922035.

163. Demirov DG, Ono A, Orenstein JM, Freed EO. Overexpression of the N-terminal domain of TSG101 inhibits HIV-1 budding by blocking late domain function. Proc Natl Acad Sci U S A. 2002;99(2):955-60. Epub 2002/01/24. doi: 10.1073/pnas.032511899. PubMed PMID: 11805336; PubMed Central PMCID: PMCPMC117412.

164. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH, Wang HE, et al. Tsg101 and the vacuolar protein sorting pathway are essential for HIV-1 budding. Cell. 2001;107(1):55-65. Epub 2001/10/12. PubMed PMID: 11595185.

165. Martin-Serrano J, Zang T, Bieniasz PD. HIV-1 and Ebola virus encode small peptide motifs that recruit Tsg101 to sites of particle assembly to facilitate egress. Nat Med. 2001;7(12):1313-9. Epub 2001/12/01. doi: 10.1038/nm1201-1313. PubMed PMID: 11726971.

166. VerPlank L, Bouamr F, LaGrassa TJ, Agresta B, Kikonyogo A, Leis J, et al. Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55(Gag). Proc Natl Acad Sci U S A. 2001;98(14):7724-9. Epub 2001/06/28. doi: 10.1073/pnas.131059198. PubMed PMID: 11427703; PubMed Central PMCID: PMCPMC35409.

167. Strack B, Calistri A, Craig S, Popova E, Gottlinger HG. AIP1/ALIX is a binding partner for HIV-1 p6 and EIAV p9 functioning in virus budding. Cell. 2003;114(6):689- 99. Epub 2003/09/25. PubMed PMID: 14505569.

168. Jouvenet N, Zhadina M, Bieniasz PD, Simon SM. Dynamics of ESCRT protein recruitment during retroviral assembly. Nat Cell Biol. 2011;13(4):394-401. Epub 2011/03/12. doi: 10.1038/ncb2207. PubMed PMID: 21394083; PubMed Central PMCID: PMCPMC3245320.

169. Morita E, Sandrin V, McCullough J, Katsuyama A, Baci Hamilton I, Sundquist WI. ESCRT-III protein requirements for HIV-1 budding. Cell Host Microbe. 2011;9(3):235- 42. Epub 2011/03/15. doi: 10.1016/j.chom.2011.02.004. PubMed PMID: 21396898; PubMed Central PMCID: PMCPMC3070458.

170. Baumgartel V, Ivanchenko S, Dupont A, Sergeev M, Wiseman PW, Krausslich HG, et al. Live-cell visualization of dynamics of HIV budding site interactions with an ESCRT component. Nat Cell Biol. 2011;13(4):469-74. Epub 2011/03/12. doi: 10.1038/ncb2215. PubMed PMID: 21394086.

171. Ashorn P, McQuade TJ, Thaisrivongs S, Tomasselli AG, Tarpley WG, Moss B. An inhibitor of the protease blocks maturation of human and simian immunodeficiency viruses

157 and spread of infection. Proc Natl Acad Sci U S A. 1990;87(19):7472-6. Epub 1990/10/01. PubMed PMID: 2217178; PubMed Central PMCID: PMCPMC54769.

172. Goepfert PA, Shaw KL, Ritter GD, Jr., Mulligan MJ. A sorting motif localizes the foamy virus glycoprotein to the endoplasmic reticulum. J Virol. 1997;71(1):778-84. Epub 1997/01/01. PubMed PMID: 8985416; PubMed Central PMCID: PMCPMC191117.

173. Zemba M, Wilk T, Rutten T, Wagner A, Flugel RM, Lochelt M. The carboxy- terminal p3Gag domain of the human foamy virus Gag precursor is required for efficient virus infectivity. Virology. 1998;247(1):7-13. Epub 1998/07/31. doi: 10.1006/viro.1998.9234. PubMed PMID: 9683566.

174. Morozov VA, Copeland TD, Nagashima K, Gonda MA, Oroszlan S. Protein composition and morphology of human foamy virus intracellular cores and extracellular particles. Virology. 1997;228(2):307-17. Epub 1997/02/17. doi: 10.1006/viro.1996.8379. PubMed PMID: 9123838.

175. Fischer N, Heinkelein M, Lindemann D, Enssle J, Baum C, Werder E, et al. Foamy virus particle formation. J Virol. 1998;72(2):1610-5. Epub 1998/01/28. PubMed PMID: 9445065; PubMed Central PMCID: PMCPMC124643.

176. Heinkelein M, Leurs C, Rammling M, Peters K, Hanenberg H, Rethwilm A. Pregenomic RNA is required for efficient incorporation of pol polyprotein into foamy virus capsids. J Virol. 2002;76(19):10069-73. Epub 2002/09/05. PubMed PMID: 12208988; PubMed Central PMCID: PMCPMC136505.

177. Peters K, Wiktorowicz T, Heinkelein M, Rethwilm A. RNA and protein requirements for incorporation of the Pol protein into foamy virus particles. J Virol. 2005;79(11):7005-13. Epub 2005/05/14. doi: 10.1128/JVI.79.11.7005-7013.2005. PubMed PMID: 15890940; PubMed Central PMCID: PMCPMC1112116.

178. Lindemann D, Pietschmann T, Picard-Maureau M, Berg A, Heinkelein M, Thurow J, et al. A particle-associated glycoprotein signal peptide essential for virus maturation and infectivity. J Virol. 2001;75(13):5762-71. Epub 2001/06/08. doi: 10.1128/JVI.75.13.5762- 5771.2001. PubMed PMID: 11390578; PubMed Central PMCID: PMCPMC114292.

179. Wilk T, Geiselhart V, Frech M, Fuller SD, Flugel RM, Lochelt M. Specific interaction of a novel foamy virus Env leader protein with the N-terminal Gag domain. J Virol. 2001;75(17):7995-8007. Epub 2001/08/03. PubMed PMID: 11483744; PubMed Central PMCID: PMCPMC115043.

180. Patton GS, Morris SA, Chung W, Bieniasz PD, McClure MO. Identification of domains in gag important for prototypic foamy virus egress. J Virol. 2005;79(10):6392-9. Epub 2005/04/29. doi: 10.1128/JVI.79.10.6392-6399.2005. PubMed PMID: 15858022; PubMed Central PMCID: PMCPMC1091687. 158

181. Stange A, Mannigel I, Peters K, Heinkelein M, Stanke N, Cartellieri M, et al. Characterization of prototype foamy virus gag late assembly domain motifs and their role in particle egress and infectivity. J Virol. 2005;79(9):5466-76. Epub 2005/04/14. doi: 10.1128/JVI.79.9.5466-5476.2005. PubMed PMID: 15827161; PubMed Central PMCID: PMCPMC1082757.

182. Prabu-Jeyabalan M, Nalivaika E, Schiffer CA. Substrate shape determines specificity of recognition for HIV-1 protease: analysis of crystal structures of six substrate complexes. Structure. 2002;10(3):369-81. Epub 2002/05/15. PubMed PMID: 12005435.

183. Prabu-Jeyabalan M, Nalivaika EA, King NM, Schiffer CA. Structural basis for coevolution of a human immunodeficiency virus type 1 nucleocapsid-p1 cleavage site with a V82A drug-resistant mutation in viral protease. J Virol. 2004;78(22):12446-54. Epub 2004/10/28. doi: 10.1128/JVI.78.22.12446-12454.2004. PubMed PMID: 15507631; PubMed Central PMCID: PMCPMC525094.

184. Tang C, Louis JM, Aniana A, Suh JY, Clore GM. Visualizing transient events in amino-terminal autoprocessing of HIV-1 protease. Nature. 2008;455(7213):693-6. Epub 2008/10/04. doi: 10.1038/nature07342. PubMed PMID: 18833280; PubMed Central PMCID: PMCPMC2798589.

185. Hill M, Tachedjian G, Mak J. The packaging and maturation of the HIV-1 Pol proteins. Curr HIV Res. 2005;3(1):73-85. Epub 2005/01/11. PubMed PMID: 15638725.

186. Ganser BK, Li S, Klishko VY, Finch JT, Sundquist WI. Assembly and analysis of conical models for the HIV-1 core. Science. 1999;283(5398):80-3. Epub 1999/01/05. PubMed PMID: 9872746.

187. Ganser-Pornillos BK, Yeager M, Sundquist WI. The structural biology of HIV assembly. Curr Opin Struct Biol. 2008;18(2):203-17. Epub 2008/04/15. doi: 10.1016/j.sbi.2008.02.001. PubMed PMID: 18406133; PubMed Central PMCID: PMCPMC2819415.

188. Gottlinger HG, Sodroski JG, Haseltine WA. Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type 1. Proc Natl Acad Sci U S A. 1989;86(15):5781-5. Epub 1989/08/01. PubMed PMID: 2788277; PubMed Central PMCID: PMCPMC297714.

189. Peng C, Ho BK, Chang TW, Chang NT. Role of human immunodeficiency virus type 1-specific protease in core protein maturation and viral infectivity. J Virol. 1989;63(6):2550-6. Epub 1989/06/01. PubMed PMID: 2657099; PubMed Central PMCID: PMCPMC250724.

190. Enssle J, Fischer N, Moebes A, Mauer B, Smola U, Rethwilm A. Carboxy-terminal cleavage of the human foamy virus Gag precursor molecule is an essential step in the viral 159 life cycle. J Virol. 1997;71(10):7312-7. Epub 1997/10/06. PubMed PMID: 9311808; PubMed Central PMCID: PMCPMC192075.

191. Hutter S, Mullers E, Stanke N, Reh J, Lindemann D. Prototype foamy virus protease activity is essential for intraparticle reverse transcription initiation but not absolutely required for uncoating upon host cell entry. J Virol. 2013;87(6):3163-76. Epub 2013/01/04. doi: 10.1128/JVI.02323-12. PubMed PMID: 23283957; PubMed Central PMCID: PMCPMC3592149.

192. Spannaus R, Bodem J. Determination of the protease cleavage site repertoire--the RNase H but not the RT domain is essential for foamy viral protease activity. Virology. 2014;454-455:145-56. Epub 2014/04/15. doi: 10.1016/j.virol.2014.02.013. PubMed PMID: 24725941.

193. Giron ML, Colas S, Wybier J, Rozain F, Emanoil-Ravier R. Expression and maturation of human foamy virus Gag precursor polypeptides. J Virol. 1997;71(2):1635- 9. Epub 1997/02/01. PubMed PMID: 8995691; PubMed Central PMCID: PMCPMC191222.

194. Spannaus R, Schneider A, Hartl MJ, Wohrl BM, Bodem J. Foamy virus Gag p71- p68 cleavage is required for template switch of the reverse transcriptase. J Virol. 2013;87(13):7774-6. Epub 2013/04/26. doi: 10.1128/JVI.00833-13. PubMed PMID: 23616664; PubMed Central PMCID: PMCPMC3700290.

195. Pfrepper KI, Rackwitz HR, Schnolzer M, Heid H, Lochelt M, Flugel RM. Molecular characterization of proteolytic processing of the Pol proteins of human foamy virus reveals novel features of the viral protease. J Virol. 1998;72(9):7648-52. Epub 1998/08/08. PubMed PMID: 9696869; PubMed Central PMCID: PMCPMC110030.

196. Yu SF, Baldwin DN, Gwynn SR, Yendapalli S, Linial ML. Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science. 1996;271(5255):1579-82. Epub 1996/03/15. PubMed PMID: 8599113.

197. Chun TW, Davey RT, Jr., Engel D, Lane HC, Fauci AS. Re-emergence of HIV after stopping therapy. Nature. 1999;401(6756):874-5. Epub 1999/11/30. doi: 10.1038/44755. PubMed PMID: 10553903.

198. Davey RT, Jr., Bhat N, Yoder C, Chun TW, Metcalf JA, Dewar R, et al. HIV-1 and T cell dynamics after interruption of highly active antiretroviral therapy (HAART) in patients with a history of sustained viral suppression. Proc Natl Acad Sci U S A. 1999;96(26):15109-14. Epub 1999/12/28. PubMed PMID: 10611346; PubMed Central PMCID: PMCPMC24781.

160

199. Chun TW, Finzi D, Margolick J, Chadwick K, Schwartz D, Siliciano RF. In vivo fate of HIV-1-infected T cells: quantitative analysis of the transition to stable latency. Nat Med. 1995;1(12):1284-90. PubMed PMID: 7489410.

200. Chun TW, Stuyver L, Mizell SB, Ehler LA, Mican JA, Baseler M, et al. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc Natl Acad Sci U S A. 1997;94(24):13193-7. PubMed PMID: 9371822; PubMed Central PMCID: PMCPMC24285.

201. Finzi D, Hermankova M, Pierson T, Carruth LM, Buck C, Chaisson RE, et al. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science. 1997;278(5341):1295-300. PubMed PMID: 9360927.

202. Wong JK, Hezareh M, Gunthard HF, Havlir DV, Ignacio CC, Spina CA, et al. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science. 1997;278(5341):1291-5. PubMed PMID: 9360926.

203. Siliciano JD, Kajdas J, Finzi D, Quinn TC, Chadwick K, Margolick JB, et al. Long- term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat Med. 2003;9(6):727-8. Epub 2003/05/20. doi: 10.1038/nm880. PubMed PMID: 12754504.

204. Shan L, Deng K, Gao H, Xing S, Capoferri AA, Durand CM, et al. Transcriptional Reprogramming during Effector-to-Memory Transition Renders CD4(+) T Cells Permissive for Latent HIV-1 Infection. Immunity. 2017;47(4):766-75 e3. Epub 2017/10/19. doi: 10.1016/j.immuni.2017.09.014. PubMed PMID: 29045905; PubMed Central PMCID: PMCPMC5948104.

205. Bruner KM, Murray AJ, Pollack RA, Soliman MG, Laskey SB, Capoferri AA, et al. Defective proviruses rapidly accumulate during acute HIV-1 infection. Nat Med. 2016;22(9):1043-9. Epub 2016/08/09. doi: 10.1038/nm.4156. PubMed PMID: 27500724; PubMed Central PMCID: PMCPMC5014606.

206. Hiener B, Horsburgh BA, Eden JS, Barton K, Schlub TE, Lee E, et al. Identification of Genetically Intact HIV-1 Proviruses in Specific CD4(+) T Cells from Effectively Treated Participants. Cell reports. 2017;21(3):813-22. Epub 2017/10/19. doi: 10.1016/j.celrep.2017.09.081. PubMed PMID: 29045846; PubMed Central PMCID: PMCPMC5960642.

207. Ho YC, Shan L, Hosmane NN, Wang J, Laskey SB, Rosenbloom DI, et al. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell. 2013;155(3):540-51. Epub 2013/11/19. doi: 10.1016/j.cell.2013.09.020. PubMed PMID: 24243014; PubMed Central PMCID: PMCPMC3896327.

161

208. Imamichi H, Dewar RL, Adelsberger JW, Rehm CA, O'Doherty U, Paxinos EE, et al. Defective HIV-1 proviruses produce novel protein-coding RNA species in HIV-infected patients on combination antiretroviral therapy. Proc Natl Acad Sci U S A. 2016;113(31):8783-8. Epub 2016/07/20. doi: 10.1073/pnas.1609057113. PubMed PMID: 27432972; PubMed Central PMCID: PMCPMC4978246.

209. Chun TW, Engel D, Berrey MM, Shea T, Corey L, Fauci AS. Early establishment of a pool of latently infected, resting CD4(+) T cells during primary HIV-1 infection. Proc Natl Acad Sci U S A. 1998;95(15):8869-73. Epub 1998/07/22. PubMed PMID: 9671771; PubMed Central PMCID: PMCPMC21169.

210. Whitney JB, Hill AL, Sanisetty S, Penaloza-MacMaster P, Liu J, Shetty M, et al. Rapid seeding of the viral reservoir prior to SIV viraemia in rhesus monkeys. Nature. 2014;512(7512):74-7. Epub 2014/07/22. doi: 10.1038/nature13594. PubMed PMID: 25042999; PubMed Central PMCID: PMCPMC4126858.

211. Crooks AM, Bateson R, Cope AB, Dahl NP, Griggs MK, Kuruc JD, et al. Precise Quantitation of the Latent HIV-1 Reservoir: Implications for Eradication Strategies. J Infect Dis. 2015;212(9):1361-5. Epub 2015/04/17. doi: 10.1093/infdis/jiv218. PubMed PMID: 25877550; PubMed Central PMCID: PMCPMC4601910.

212. Hermankova M, Siliciano JD, Zhou Y, Monie D, Chadwick K, Margolick JB, et al. Analysis of human immunodeficiency virus type 1 gene expression in latently infected resting CD4+ T lymphocytes in vivo. J Virol. 2003;77(13):7383-92. Epub 2003/06/14. PubMed PMID: 12805437; PubMed Central PMCID: PMCPMC164778.

213. Coull JJ, Romerio F, Sun JM, Volker JL, Galvin KM, Davie JR, et al. The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1. J Virol. 2000;74(15):6790-9. Epub 2000/07/11. PubMed PMID: 10888618; PubMed Central PMCID: PMCPMC112196.

214. Hsia SC, Shi YB. Chromatin disruption and histone acetylation in regulation of the human immunodeficiency virus type 1 long terminal repeat by thyroid hormone receptor. Mol Cell Biol. 2002;22(12):4043-52. Epub 2002/05/25. PubMed PMID: 12024018; PubMed Central PMCID: PMCPMC133859.

215. Kauder SE, Bosque A, Lindqvist A, Planelles V, Verdin E. Epigenetic regulation of HIV-1 latency by cytosine methylation. PLoS Pathog. 2009;5(6):e1000495. Epub 2009/06/27. doi: 10.1371/journal.ppat.1000495. PubMed PMID: 19557157; PubMed Central PMCID: PMCPMC2695767.

216. Van Lint C, Emiliani S, Ott M, Verdin E. Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. The EMBO journal. 1996;15(5):1112-20. Epub 1996/03/01. PubMed PMID: 8605881; PubMed Central PMCID: PMCPMC450009. 162

217. Verdin E, Paras P, Jr., Van Lint C. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. The EMBO journal. 1993;12(8):3249-59. PubMed PMID: 8344262; PubMed Central PMCID: PMC413592.

218. Williams SA, Chen LF, Kwon H, Ruiz-Jarabo CM, Verdin E, Greene WC. NF- kappaB p50 promotes HIV latency through HDAC recruitment and repression of transcriptional initiation. The EMBO journal. 2006;25(1):139-49. Epub 2005/12/02. doi: 10.1038/sj.emboj.7600900. PubMed PMID: 16319923; PubMed Central PMCID: PMCPMC1356344.

219. Coiras M, Lopez-Huertas MR, Perez-Olmeda M, Alcami J. Understanding HIV-1 latency provides clues for the eradication of long-term reservoirs. Nat Rev Microbiol. 2009;7(11):798-812. Epub 2009/10/17. doi: 10.1038/nrmicro2223. PubMed PMID: 19834480.

220. Karn J. The molecular biology of HIV latency: breaking and restoring the Tat- dependent transcriptional circuit. Curr Opin HIV AIDS. 2011;6(1):4-11. Epub 2011/01/19. doi: 10.1097/COH.0b013e328340ffbb. PubMed PMID: 21242887; PubMed Central PMCID: PMCPMC3032057.

221. Lassen KG, Ramyar KX, Bailey JR, Zhou Y, Siliciano RF. Nuclear retention of multiply spliced HIV-1 RNA in resting CD4+ T cells. PLoS Pathog. 2006;2(7):e68. Epub 2006/07/15. doi: 10.1371/journal.ppat.0020068. PubMed PMID: 16839202; PubMed Central PMCID: PMCPMC1487174.

222. Lenasi T, Contreras X, Peterlin BM. Transcriptional interference antagonizes proviral gene expression to promote HIV latency. Cell Host Microbe. 2008;4(2):123-33. Epub 2008/08/12. doi: 10.1016/j.chom.2008.05.016. PubMed PMID: 18692772; PubMed Central PMCID: PMCPMC4217705.

223. Linial M. Why aren't foamy viruses pathogenic? Trends Microbiol. 2000;8(6):284- 9. Epub 2000/06/06. PubMed PMID: 10838587.

224. Falcone V, Leupold J, Clotten J, Urbanyi E, Herchenroder O, Spatz W, et al. Sites of simian foamy virus persistence in naturally infected African green monkeys: latent provirus is ubiquitous, whereas viral replication is restricted to the oral mucosa. Virology. 1999;257(1):7-14. Epub 1999/04/20. doi: 10.1006/viro.1999.9634. PubMed PMID: 10208915.

225. Saib A, Koken MH, van der Spek P, Peries J, de The H. Involvement of a spliced and defective human foamy virus in the establishment of chronic infection. J Virol. 1995;69(9):5261-8. Epub 1995/09/01. PubMed PMID: 7636968; PubMed Central PMCID: PMCPMC189359.

163

226. Hare S, Gupta SS, Valkov E, Engelman A, Cherepanov P. Retroviral intasome assembly and inhibition of DNA strand transfer. Nature. 2010;464(7286):232-6. Epub 2010/02/02. doi: nature08784 [pii]

10.1038/nature08784. PubMed PMID: 20118915.

227. Valkov E, Gupta SS, Hare S, Helander A, Roversi P, McClure M, et al. Functional and structural characterization of the integrase from the prototype foamy virus. Nucleic Acids Res. 2009;37(1):243-55. doi: 10.1093/nar/gkn938. PubMed PMID: 19036793; PubMed Central PMCID: PMCPMC2615609.

228. Cai M, Zheng R, Caffrey M, Craigie R, Clore GM, Gronenborn AM. Solution structure of the N-terminal zinc binding domain of HIV-1 integrase. Nat Struct Biol. 1997;4(7):567-77. Epub 1997/07/01. PubMed PMID: 9228950.

229. Eijkelenboom AP, van den Ent FM, Vos A, Doreleijers JF, Hard K, Tullius TD, et al. The solution structure of the amino-terminal HHCC domain of HIV-2 integrase: a three- helix bundle stabilized by zinc. Curr Biol. 1997;7(10):739-46. Epub 1997/11/22. PubMed PMID: 9368756.

230. Bushman FD, Engelman A, Palmer I, Wingfield P, Craigie R. Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc Natl Acad Sci U S A. 1993;90(8):3428-32. Epub 1993/04/15. PubMed PMID: 8386373; PubMed Central PMCID: PMCPMC46313.

231. Andrake MD, Skalka AM. Multimerization determinants reside in both the catalytic core and C terminus of avian sarcoma virus integrase. J Biol Chem. 1995;270(49):29299- 306. Epub 1995/12/08. PubMed PMID: 7493962.

232. Eijkelenboom AP, Lutzke RA, Boelens R, Plasterk RH, Kaptein R, Hard K. The DNA-binding domain of HIV-1 integrase has an SH3-like fold. Nat Struct Biol. 1995;2(9):807-10. Epub 1995/09/01. PubMed PMID: 7552753.

233. Hare S, Maertens GN, Cherepanov P. 3'-processing and strand transfer catalysed by retroviral integrase in crystallo. The EMBO journal. 2012;31(13):3020-8. Epub 2012/05/15. doi: 10.1038/emboj.2012.118. PubMed PMID: 22580823; PubMed Central PMCID: PMCPMC3395085.

234. Maertens GN, Hare S, Cherepanov P. The mechanism of retroviral integration from X-ray structures of its key intermediates. Nature. 2010;468(7321):326-9. Epub 2010/11/12. doi: 10.1038/nature09517. PubMed PMID: 21068843; PubMed Central PMCID: PMCPMC2999894.

164

235. Bushman FD, Fujiwara T, Craigie R. Retroviral DNA integration directed by HIV integration protein in vitro. Science. 1990;249(4976):1555-8. Epub 1990/09/28. PubMed PMID: 2171144.

236. Sherman PA, Fyfe JA. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci U S A. 1990;87(13):5119-23. Epub 1990/07/01. PubMed PMID: 2164223; PubMed Central PMCID: PMCPMC54273.

237. Engelman A, Mizuuchi K, Craigie R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 1991;67(6):1211-21. Epub 1991/12/20. PubMed PMID: 1760846.

238. Gupta K, Curtis JE, Krueger S, Hwang Y, Cherepanov P, Bushman FD, et al. Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA. Structure. 2012;20(11):1918-28. doi: 10.1016/j.str.2012.08.023. PubMed PMID: 23000384; PubMed Central PMCID: PMCPMC4034761.

239. Peletskaya E, Andrake M, Gustchina A, Merkel G, Alexandratos J, Zhou D, et al. Localization of ASV integrase-DNA contacts by site-directed crosslinking and their structural analysis. PLoS One. 2011;6(12):e27751. doi: 10.1371/journal.pone.0027751. PubMed PMID: 22145019; PubMed Central PMCID: PMCPMC3228729.

240. Maskell DP, Renault L, Serrao E, Lesbats P, Matadeen R, Hare S, et al. Structural basis for retroviral integration into nucleosomes. Nature. 2015;523(7560):366-9. doi: 10.1038/nature14495. PubMed PMID: 26061770; PubMed Central PMCID: PMCPMC4530500.

241. Ballandras-Colas A, Brown M, Cook NJ, Dewdney TG, Demeler B, Cherepanov P, et al. Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function. Nature. 2016;530(7590):358-61. Epub 2016/02/19. doi: 10.1038/nature16955. PubMed PMID: 26887496; PubMed Central PMCID: PMCPMC4908968.

242. Yin Z, Shi K, Banerjee S, Pandey KK, Bera S, Grandgenett DP, et al. Crystal structure of the Rous sarcoma virus intasome. Nature. 2016;530(7590):362-6. Epub 2016/02/19. doi: 10.1038/nature16950. PubMed PMID: 26887497; PubMed Central PMCID: PMCPMC4881392.

243. Ballandras-Colas A, Maskell DP, Serrao E, Locke J, Swuec P, Jonsson SR, et al. A supramolecular assembly mediates lentiviral DNA integration. Science. 2017;355(6320):93-5. doi: 10.1126/science.aah7002. PubMed PMID: 28059770; PubMed Central PMCID: PMCPMC5321526.

165

244. Passos DO, Li M, Yang R, Rebensburg SV, Ghirlando R, Jeon Y, et al. Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome. Science. 2017;355(6320):89-92. doi: 10.1126/science.aah5163. PubMed PMID: 28059769.

245. Engelman AN, Cherepanov P. Retroviral intasomes arising. Curr Opin Struct Biol. 2017;47:23-9. Epub 2017/05/02. doi: 10.1016/j.sbi.2017.04.005. PubMed PMID: 28458055; PubMed Central PMCID: PMCPMC5660667.

246. Dyda F, Chandler M, Hickman AB. The emerging diversity of transpososome architectures. Q Rev Biophys. 2012;45(4):493-521. Epub 2012/12/12. doi: 10.1017/S0033583512000145. PubMed PMID: 23217365.

247. Kennedy AK, Haniford DB, Mizuuchi K. Single active site catalysis of the successive phosphoryl transfer steps by DNA transposases: insights from phosphorothioate stereoselectivity. Cell. 2000;101(3):295-305. Epub 2000/06/10. PubMed PMID: 10847684.

248. Mizuuchi K, Adzuma K. Inversion of the phosphate chirality at the target site of Mu DNA strand transfer: evidence for a one-step transesterification mechanism. Cell. 1991;66(1):129-40. Epub 1991/07/12. PubMed PMID: 1649006.

249. Roth MJ, Schwartzberg PL, Goff SP. Structure of the termini of DNA intermediates in the integration of retroviral DNA: dependence on IN function and terminal DNA sequence. Cell. 1989;58(1):47-54. Epub 1989/07/14. PubMed PMID: 2546673.

250. Bushman FD, Craigie R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci U S A. 1991;88(4):1339-43. Epub 1991/02/15. PubMed PMID: 1847518; PubMed Central PMCID: PMCPMC51013.

251. Craigie R, Fujiwara T, Bushman F. The IN protein of Moloney murine leukemia virus processes the viral DNA ends and accomplishes their integration in vitro. Cell. 1990;62(4):829-37. Epub 1990/08/24. PubMed PMID: 2167180.

252. Roe T, Chow SA, Brown PO. 3'-end processing and kinetics of 5'-end joining during retroviral integration in vivo. J Virol. 1997;71(2):1334-40. Epub 1997/02/01. PubMed PMID: 8995657; PubMed Central PMCID: PMCPMC191188.

253. Engelman A, Craigie R. Efficient magnesium-dependent human immunodeficiency virus type 1 integrase activity. J Virol. 1995;69(9):5908-11. Epub 1995/09/01. PubMed PMID: 7637039; PubMed Central PMCID: PMCPMC189473.

254. Yang W, Lee JY, Nowotny M. Making and breaking nucleic acids: two-Mg2+-ion catalysis and substrate specificity. Mol Cell. 2006;22(1):5-13. Epub 2006/04/08. doi: 10.1016/j.molcel.2006.03.013. PubMed PMID: 16600865. 166

255. Enssle J, Moebes A, Heinkelein M, Panhuysen M, Mauer B, Schweizer M, et al. An active foamy virus integrase is required for virus replication. J Gen Virol. 1999;80 ( Pt 6):1445-52. Epub 1999/06/22. doi: 10.1099/0022-1317-80-6-1445. PubMed PMID: 10374962.

256. Juretzek T, Holm T, Gartner K, Kanzler S, Lindemann D, Herchenroder O, et al. Foamy virus integration. J Virol. 2004;78(5):2472-7. Epub 2004/02/14. PubMed PMID: 14963145; PubMed Central PMCID: PMCPMC369232.

257. Shoemaker C, Hoffman J, Goff SP, Baltimore D. Intramolecular integration within Moloney murine leukemia virus DNA. J Virol. 1981;40(1):164-72. Epub 1981/10/01. PubMed PMID: 6457158; PubMed Central PMCID: PMCPMC256606.

258. Tipper C, Sodroski J. Enhanced autointegration in hyperstable simian immunodeficiency virus capsid mutants blocked after reverse transcription. J Virol. 2013;87(7):3628-39. Epub 2013/01/25. doi: 10.1128/JVI.03239-12. PubMed PMID: 23345510; PubMed Central PMCID: PMCPMC3624228.

259. Li Y, Kappes JC, Conway JA, Price RW, Shaw GM, Hahn BH. Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultured human brain tissue: identification of replication-competent and -defective viral genomes. J Virol. 1991;65(8):3973-85. Epub 1991/08/01. PubMed PMID: 1830110; PubMed Central PMCID: PMCPMC248827.

260. Yan N, Cherepanov P, Daigle JE, Engelman A, Lieberman J. The SET complex acts as a barrier to autointegration of HIV-1. PLoS Pathog. 2009;5(3):e1000327. Epub 2009/03/07. doi: 10.1371/journal.ppat.1000327. PubMed PMID: 19266025; PubMed Central PMCID: PMCPMC2644782.

261. Katz RA, Merkel G, Kulkosky J, Leis J, Skalka AM. The avian retroviral IN protein is both necessary and sufficient for integrative recombination in vitro. Cell. 1990;63(1):87- 95. Epub 1990/10/05. PubMed PMID: 2170022.

262. Mackler RM, Lopez MA, Osterhage MJ, Yoder KE. Prototype foamy virus integrase is promiscuous for target choice. Biochemical and Biophysical Research Communications. 2018. doi: 10.1016/j.bbrc.2018.07.031.

263. Serrao E, Ballandras-Colas A, Cherepanov P, Maertens GN, Engelman AN. Key determinants of target DNA recognition by retroviral intasomes. Retrovirology. 2015;12:39. Epub 2015/05/01. doi: 10.1186/s12977-015-0167-3. PubMed PMID: 25924943; PubMed Central PMCID: PMCPMC4422553.

264. Neves M, Peries J, Saib A. Study of human foamy virus proviral integration in chronically infected murine cells. Res Virol. 1998;149(6):393-401. Epub 1999/01/29. PubMed PMID: 9923015. 167

265. Schweizer M, Fleps U, Jackle A, Renne R, Turek R, Neumann-Haefelin D. Simian foamy virus type 3 (SFV-3) in latently infected Vero cells: reactivation by demethylation of proviral DNA. Virology. 1993;192(2):663-6. Epub 1993/02/01. doi: 10.1006/viro.1993.1084. PubMed PMID: 8380669.

266. Vincent KA, York-Higgins D, Quiroga M, Brown PO. Host sequences flanking the HIV provirus. Nucleic Acids Res. 1990;18(20):6045-7. Epub 1990/10/25. PubMed PMID: 2235486; PubMed Central PMCID: PMCPMC332403.

267. Vink C, Groenink M, Elgersma Y, Fouchier RA, Tersmette M, Plasterk RH. Analysis of the junctions between human immunodeficiency virus type 1 proviral DNA and human DNA. J Virol. 1990;64(11):5626-7. Epub 1990/11/01. PubMed PMID: 2214029; PubMed Central PMCID: PMCPMC248617.

268. Li M, Mizuuchi M, Burke TR, Jr., Craigie R. Retroviral DNA integration: reaction pathway and critical intermediates. The EMBO journal. 2006;25(6):1295-304. Epub 2006/02/17. doi: 10.1038/sj.emboj.7601005. PubMed PMID: 16482214; PubMed Central PMCID: PMCPMC1422164.

269. Jones ND, Lopez MA, Jr., Hanne J, Peake MB, Lee JB, Fishel R, et al. Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration. Nature communications. 2016;7:11409. doi: 10.1038/ncomms11409. PubMed PMID: 27108531; PubMed Central PMCID: PMCPMC4848512.

270. Li M, Craigie R. Nucleoprotein complex intermediates in HIV-1 integration. Methods. 2009;47(4):237-42. Epub 2009/02/24. doi: 10.1016/j.ymeth.2009.02.001. PubMed PMID: 19232539; PubMed Central PMCID: PMCPMC3311468.

271. Mackler RM, Lopez MA, Jr., Yoder KE. Assembly and Purification of Prototype Foamy Virus Intasomes. J Vis Exp. 2018;(133). Epub 2018/04/03. doi: 10.3791/57453. PubMed PMID: 29608167.

272. Albanese A, Arosio D, Terreni M, Cereseto A. HIV-1 pre-integration complexes selectively target decondensed chromatin in the nuclear periphery. PLoS One. 2008;3(6):e2413. Epub 2008/06/12. doi: 10.1371/journal.pone.0002413. PubMed PMID: 18545681; PubMed Central PMCID: PMCPMC2398779.

273. Burdick RC, Hu WS, Pathak VK. Nuclear import of APOBEC3F-labeled HIV-1 preintegration complexes. Proc Natl Acad Sci U S A. 2013;110(49):E4780-9. Epub 2013/11/20. doi: 10.1073/pnas.1315996110. PubMed PMID: 24248339; PubMed Central PMCID: PMCPMC3856795.

274. Marini B, Kertesz-Farkas A, Ali H, Lucic B, Lisek K, Manganaro L, et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 2015;521(7551):227-31. doi: 10.1038/nature14226. PubMed PMID: 25731161. 168

275. Quercioli V, Di Primio C, Casini A, Mulder LCF, Vranckx LS, Borrenberghs D, et al. Comparative Analysis of HIV-1 and Murine Leukemia Virus Three-Dimensional Nuclear Distributions. J Virol. 2016;90(10):5205-9. Epub 2016/03/11. doi: 10.1128/JVI.03188-15. PubMed PMID: 26962222; PubMed Central PMCID: PMCPMC4859700.

276. Ibarra A, Hetzer MW. Nuclear pore proteins and the control of genome functions. Genes Dev. 2015;29(4):337-49. Epub 2015/02/19. doi: 10.1101/gad.256495.114. PubMed PMID: 25691464; PubMed Central PMCID: PMCPMC4335290.

277. Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Talhout W, et al. Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature. 2008;453(7197):948-51. Epub 2008/05/09. doi: 10.1038/nature06947. PubMed PMID: 18463634.

278. Lelek M, Casartelli N, Pellin D, Rizzi E, Souque P, Severgnini M, et al. Chromatin organization at the nuclear pore favours HIV replication. Nature communications. 2015;6:6483. doi: 10.1038/ncomms7483. PubMed PMID: 25744187; PubMed Central PMCID: PMC4366494.

279. Wong RW, Mamede JI, Hope TJ. Impact of Nucleoporin-Mediated Chromatin Localization and Nuclear Architecture on HIV Integration Site Selection. J Virol. 2015;89(19):9702-5. Epub 2015/07/03. doi: 10.1128/JVI.01669-15. PubMed PMID: 26136574; PubMed Central PMCID: PMCPMC4577903.

280. Schliephake AW, Rethwilm A. Nuclear localization of foamy virus Gag precursor protein. J Virol. 1994;68(8):4946-54. Epub 1994/08/01. PubMed PMID: 8035493; PubMed Central PMCID: PMCPMC236435.

281. Yu SF, Edelmann K, Strong RK, Moebes A, Rethwilm A, Linial ML. The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains. J Virol. 1996;70(12):8255-62. Epub 1996/12/01. PubMed PMID: 8970944; PubMed Central PMCID: PMCPMC190912.

282. Mitchell RS, Beitzel BF, Schroder AR, Shinn P, Chen H, Berry CC, et al. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. 2004;2(8):E234. doi: 10.1371/journal.pbio.0020234. PubMed PMID: 15314653; PubMed Central PMCID: PMCPMC509299.

283. Wu X, Li Y, Crise B, Burgess SM. Transcription start regions in the human genome are favored targets for MLV integration. Science. 2003;300(5626):1749-51. Epub 2003/06/14. doi: 10.1126/science.1083413. PubMed PMID: 12805549.

169

284. Schroder AR, Shinn P, Chen H, Berry C, Ecker JR, Bushman F. HIV-1 integration in the human genome favors active genes and local hotspots. Cell. 2002;110(4):521-9. PubMed PMID: 12202041.

285. Shun MC, Raghavendra NK, Vandegraaff N, Daigle JE, Hughes S, Kellam P, et al. LEDGF/p75 functions downstream from preintegration complex formation to effect gene- specific HIV-1 integration. Genes Dev. 2007;21(14):1767-78. Epub 2007/07/20. doi: 21/14/1767 [pii]

10.1101/gad.1565107. PubMed PMID: 17639082.

286. De Rijck J, de Kogel C, Demeulemeester J, Vets S, El Ashkar S, Malani N, et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell reports. 2013;5(4):886-94. doi: 10.1016/j.celrep.2013.09.040. PubMed PMID: 24183673; PubMed Central PMCID: PMC4197836.

287. Gupta SS, Maetzig T, Maertens GN, Sharif A, Rothe M, Weidner-Glunde M, et al. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J Virol. 2013;87(23):12721-36. Epub 2013/09/21. doi: 10.1128/JVI.01942-13. PubMed PMID: 24049186; PubMed Central PMCID: PMCPMC3838128.

288. Sharma A, Larue RC, Plumb MR, Malani N, Male F, Slaughter A, et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc Natl Acad Sci U S A. 2013;110(29):12036-41. doi: 10.1073/pnas.1307157110. PubMed PMID: 23818621; PubMed Central PMCID: PMC3718171.

289. De Ravin SS, Su L, Theobald N, Choi U, Macpherson JL, Poidinger M, et al. Enhancers are major targets for murine leukemia virus vector integration. J Virol. 2014;88(8):4504-13. Epub 2014/02/07. doi: 10.1128/JVI.00011-14. PubMed PMID: 24501411; PubMed Central PMCID: PMCPMC3993722.

290. LaFave MC, Varshney GK, Gildea DE, Wolfsberg TG, Baxevanis AD, Burgess SM. MLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 2014;42(7):4257-69. Epub 2014/01/28. doi: 10.1093/nar/gkt1399. PubMed PMID: 24464997; PubMed Central PMCID: PMCPMC3985626.

291. Nowrouzi A, Dittrich M, Klanke C, Heinkelein M, Rammling M, Dandekar T, et al. Genome-wide mapping of foamy virus vector integrations into a human cell line. J Gen Virol. 2006;87(Pt 5):1339-47. Epub 2006/04/11. doi: 10.1099/vir.0.81554-0. PubMed PMID: 16603537.

292. Trobridge GD, Miller DG, Jacobs MA, Allen JM, Kiem HP, Kaul R, et al. Foamy virus vector integration sites in normal human cells. Proc Natl Acad Sci U S A.

170

2006;103(5):1498-503. Epub 2006/01/24. doi: 10.1073/pnas.0510046103. PubMed PMID: 16428288; PubMed Central PMCID: PMCPMC1360565.

293. Narezkina A, Taganov KD, Litwin S, Stoyanova R, Hayashi J, Seeger C, et al. Genome-wide analyses of avian sarcoma virus integration sites. J Virol. 2004;78(21):11656-63. Epub 2004/10/14. doi: 10.1128/JVI.78.21.11656-11663.2004. PubMed PMID: 15479807; PubMed Central PMCID: PMCPMC523270.

294. Zurnic I, Hutter S, Rzeha U, Stanke N, Reh J, Mullers E, et al. Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration. PLoS Pathog. 2016;12(8):e1005860. Epub 2016/09/01. doi: 10.1371/journal.ppat.1005860. PubMed PMID: 27579920; PubMed Central PMCID: PMCPMC5006980.

295. Han Y, Lassen K, Monie D, Sedaghat AR, Shimoji S, Liu X, et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. J Virol. 2004;78(12):6122-33. Epub 2004/05/28. doi: 10.1128/JVI.78.12.6122-6133.2004. PubMed PMID: 15163705; PubMed Central PMCID: PMCPMC416493.

296. Cherepanov P. LEDGF/p75 interacts with divergent lentiviral integrases and modulates their enzymatic activity in vitro. Nucleic Acids Res. 2007;35(1):113-24. Epub 2006/12/13. doi: gkl885 [pii]

10.1093/nar/gkl885. PubMed PMID: 17158150.

297. Parra MT, Gomez R, Viera A, Llano E, Pendas AM, Rufas JS, et al. Sequential assembly of centromeric proteins in male mouse meiosis. PLoS Genet. 2009;5(3):e1000417. doi: 10.1371/journal.pgen.1000417. PubMed PMID: 19283064; PubMed Central PMCID: PMCPMC2652116.

298. Llano M, Saenz DT, Meehan A, Wongthida P, Peretz M, Walker WH, et al. An essential role for LEDGF/p75 in HIV integration. Science. 2006;314(5798):461-4. Epub 2006/09/09. doi: 1132319 [pii]

10.1126/science.1132319. PubMed PMID: 16959972.

299. Ciuffi A, Llano M, Poeschla E, Hoffmann C, Leipzig J, Shinn P, et al. A role for LEDGF/p75 in targeting HIV DNA integration. Nat Med. 2005;11(12):1287-9. Epub 2005/11/29. doi: 10.1038/nm1329. PubMed PMID: 16311605.

300. Maertens G, Cherepanov P, Pluymers W, Busschots K, De Clercq E, Debyser Z, et al. LEDGF/p75 is essential for nuclear and chromosomal targeting of HIV-1 integrase in human cells. J Biol Chem. 2003;278(35):33528-39. Epub 2003/06/11. doi: 10.1074/jbc.M303594200. PubMed PMID: 12796494. 171

301. Aiyer S, Swapna GV, Malani N, Aramini JM, Schneider WM, Plumb MR, et al. Altering murine leukemia virus integration through disruption of the integrase and BET protein family interaction. Nucleic Acids Res. 2014;42(9):5917-28. doi: 10.1093/nar/gku175. PubMed PMID: 24623816; PubMed Central PMCID: PMCPMC4027182.

302. El Ashkar S, De Rijck J, Demeulemeester J, Vets S, Madlala P, Cermakova K, et al. BET-independent MLV-based Vectors Target Away From Promoters and Regulatory Elements. Mol Ther Nucleic Acids. 2014;3:e179. Epub 2014/07/30. doi: 10.1038/mtna.2014.33. PubMed PMID: 25072693; PubMed Central PMCID: PMCPMC4121521.

303. Marshall HM, Ronen K, Berry C, Llano M, Sutherland H, Saenz D, et al. Role of PSIP1/LEDGF/p75 in lentiviral infectivity and integration targeting. PLoS One. 2007;2(12):e1340. Epub 2007/12/20. doi: 10.1371/journal.pone.0001340. PubMed PMID: 18092005; PubMed Central PMCID: PMCPMC2129110.

304. Schrijvers R, De Rijck J, Demeulemeester J, Adachi N, Vets S, Ronen K, et al. LEDGF/p75-independent HIV-1 replication demonstrates a role for HRP-2 and remains sensitive to inhibition by LEDGINs. PLoS Pathog. 2012;8(3):e1002558. Epub 2012/03/08. doi: 10.1371/journal.ppat.1002558. PubMed PMID: 22396646; PubMed Central PMCID: PMCPMC3291655.

305. Koh Y, Wu X, Ferris AL, Matreyek KA, Smith SJ, Lee K, et al. Differential effects of human immunodeficiency virus type 1 capsid and cellular factors nucleoporin 153 and LEDGF/p75 on the efficiency and specificity of viral DNA integration. J Virol. 2013;87(1):648-58. Epub 2012/10/26. doi: 10.1128/JVI.01148-12. PubMed PMID: 23097450; PubMed Central PMCID: PMCPMC3536403.

306. Ocwieja KE, Brady TL, Ronen K, Huegel A, Roth SL, Schaller T, et al. HIV integration targeting: a pathway involving Transportin-3 and the nuclear pore protein RanBP2. PLoS Pathog. 2011;7(3):e1001313. Epub 2011/03/23. doi: 10.1371/journal.ppat.1001313. PubMed PMID: 21423673; PubMed Central PMCID: PMCPMC3053352.

307. Sowd GA, Serrao E, Wang H, Wang W, Fadel HJ, Poeschla EM, et al. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin. Proceedings of the National Academy of Sciences of the United States of America. 2016;113(8):E1054-63. doi: 10.1073/pnas.1524213113. PubMed PMID: 26858452; PubMed Central PMCID: PMC4776470.

308. Pradeepa MM, Sutherland HG, Ule J, Grimes GR, Bickmore WA. Psip1/Ledgf p52 binds methylated histone H3K36 and splicing factors and contributes to the regulation of alternative splicing. PLoS Genet. 2012;8(5):e1002717. doi:

172

10.1371/journal.pgen.1002717. PubMed PMID: 22615581; PubMed Central PMCID: PMCPMC3355077.

309. Singh PK, Plumb MR, Ferris AL, Iben JR, Wu X, Fadel HJ, et al. LEDGF/p75 interacts with mRNA splicing factors and targets HIV-1 integration to highly spliced genes. Genes Dev. 2015;29(21):2287-97. Epub 2015/11/08. doi: 10.1101/gad.267609.115. PubMed PMID: 26545813; PubMed Central PMCID: PMCPMC4647561.

310. Wang GP, Ciuffi A, Leipzig J, Berry CC, Bushman FD. HIV integration site selection: analysis by massively parallel pyrosequencing reveals association with epigenetic modifications. Genome research. 2007;17(8):1186-94. doi: 10.1101/gr.6286907. PubMed PMID: 17545577; PubMed Central PMCID: PMC1933515.

311. Eidahl JO, Crowe BL, North JA, McKee CJ, Shkriabai N, Feng L, et al. Structural basis for high-affinity binding of LEDGF PWWP to mononucleosomes. Nucleic Acids Res. 2013;41(6):3924-36. doi: 10.1093/nar/gkt074. PubMed PMID: 23396443; PubMed Central PMCID: PMCPMC3616739.

312. Dhalluin C, Carlson JE, Zeng L, He C, Aggarwal AK, Zhou MM. Structure and ligand of a histone acetyltransferase bromodomain. Nature. 1999;399(6735):491-6. doi: 10.1038/20974. PubMed PMID: 10365964.

313. Winans S, Larue RC, Abraham CM, Shkriabai N, Skopp A, Winkler D, et al. The FACT complex promotes avian leukosis virus DNA integration. J Virol. 2017. doi: 10.1128/JVI.00082-17. PubMed PMID: 28122976.

314. Orphanides G, Wu WH, Lane WS, Hampsey M, Reinberg D. The chromatin- specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature. 1999;400(6741):284-8. doi: 10.1038/22350. PubMed PMID: 10421373.

315. Stuwe T, Hothorn M, Lejeune E, Rybin V, Bortfeld M, Scheffzek K, et al. The FACT Spt16 "peptidase" domain is a histone H3-H4 binding module. Proc Natl Acad Sci U S A. 2008;105(26):8884-9. doi: 10.1073/pnas.0712293105. PubMed PMID: 18579787; PubMed Central PMCID: PMCPMC2449335.

316. Derse D, Crise B, Li Y, Princler G, Lum N, Stewart C, et al. Human T-cell leukemia virus type 1 integration target sites in the human genome: comparison with those of other retroviruses. J Virol. 2007;81(12):6731-41. Epub 2007/04/06. doi: 10.1128/JVI.02752-06. PubMed PMID: 17409138; PubMed Central PMCID: PMCPMC1900082.

317. Wu X, Li Y, Crise B, Burgess SM, Munroe DJ. Weak palindromic consensus sequences are a common feature found at the integration target sites of many retroviruses. J Virol. 2005;79(8):5211-4. Epub 2005/03/30. doi: 79/8/5211 [pii]

10.1128/JVI.79.8.5211-5214.2005. PubMed PMID: 15795304. 173

318. Kirk PD, Huvet M, Melamed A, Maertens GN, Bangham CR. Retroviruses integrate into a shared, non-palindromic DNA motif. Nat Microbiol. 2016;2:16212. doi: 10.1038/nmicrobiol.2016.212. PubMed PMID: 27841853.

319. Pruss D, Reeves R, Bushman FD, Wolffe AP. The influence of DNA and nucleosome structure on integration events directed by HIV integrase. J Biol Chem. 1994;269(40):25031-41. PubMed PMID: 7929189.

320. Bor YC, Bushman FD, Orgel LE. In vitro integration of human immunodeficiency virus type 1 cDNA into targets containing protein-induced bends. Proc Natl Acad Sci U S A. 1995;92(22):10334-8. PubMed PMID: 7479779; PubMed Central PMCID: PMCPMC40791.

321. Pruss D, Bushman FD, Wolffe AP. Human immunodeficiency virus integrase directs integration to sites of severe DNA distortion within the nucleosome core. Proc Natl Acad Sci U S A. 1994;91(13):5913-7. PubMed PMID: 8016088; PubMed Central PMCID: PMCPMC44107.

322. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 1997;389(6648):251-60. doi: 10.1038/38444. PubMed PMID: 9305837.

323. Hazuda DJ, Felock P, Witmer M, Wolfe A, Stillmock K, Grobler JA, et al. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science. 2000;287(5453):646-50. Epub 2000/01/29. PubMed PMID: 10649997.

324. Summa V, Petrocchi A, Bonelli F, Crescenzi B, Donghi M, Ferrara M, et al. Discovery of raltegravir, a potent, selective orally bioavailable HIV-integrase inhibitor for the treatment of HIV-AIDS infection. J Med Chem. 2008;51(18):5843-55. Epub 2008/09/04. doi: 10.1021/jm800245z. PubMed PMID: 18763751.

325. Marchand C. The elvitegravir Quad pill: the first once-daily dual-target anti-HIV tablet. Expert Opin Investig Drugs. 2012;21(7):901-4. Epub 2012/05/11. doi: 10.1517/13543784.2012.685653. PubMed PMID: 22571404.

326. Metifiot M, Vandegraaff N, Maddali K, Naumova A, Zhang X, Rhodes D, et al. Elvitegravir overcomes resistance to raltegravir induced by integrase mutation Y143. AIDS. 2011;25(9):1175-8. Epub 2011/04/21. doi: 10.1097/QAD.0b013e3283473599. PubMed PMID: 21505303.

327. Hare S, Smith SJ, Metifiot M, Jaxa-Chamiec A, Pommier Y, Hughes SH, et al. Structural and functional analyses of the second-generation integrase strand transfer inhibitor dolutegravir (S/GSK1349572). Mol Pharmacol. 2011;80(4):565-72. Epub 2011/07/02. doi: 10.1124/mol.111.073189. PubMed PMID: 21719464; PubMed Central PMCID: PMCPMC3187526. 174

328. van Lunzen J, Maggiolo F, Arribas JR, Rakhmanova A, Yeni P, Young B, et al. Once daily dolutegravir (S/GSK1349572) in combination therapy in antiretroviral-naive adults with HIV: planned interim 48 week results from SPRING-1, a dose-ranging, randomised, phase 2b trial. Lancet Infect Dis. 2012;12(2):111-8. Epub 2011/10/25. doi: 10.1016/S1473-3099(11)70290-0. PubMed PMID: 22018760.

329. Brenner BG, Wainberg MA. Clinical benefit of dolutegravir in HIV-1 management related to the high genetic barrier to drug resistance. Virus Res. 2017;239:1-9. Epub 2016/07/17. doi: 10.1016/j.virusres.2016.07.006. PubMed PMID: 27422477.

330. Garrido C, Soriano V, Geretti AM, Zahonero N, Garcia S, Booth C, et al. Resistance associated mutations to dolutegravir (S/GSK1349572) in HIV-infected patients--impact of HIV subtypes and prior raltegravir experience. Antiviral Res. 2011;90(3):164-7. Epub 2011/03/29. doi: 10.1016/j.antiviral.2011.03.178. PubMed PMID: 21439330.

331. Christ F, Voet A, Marchand A, Nicolet S, Desimmie BA, Marchand D, et al. Rational design of small-molecule inhibitors of the LEDGF/p75-integrase interaction and HIV replication. Nat Chem Biol. 2010;6(6):442-8. Epub 2010/05/18. doi: 10.1038/nchembio.370. PubMed PMID: 20473303.

332. Christ F, Shaw S, Demeulemeester J, Desimmie BA, Marchand A, Butler S, et al. Small-molecule inhibitors of the LEDGF/p75 binding site of integrase block HIV replication and modulate integrase multimerization. Antimicrob Agents Chemother. 2012;56(8):4365-74. Epub 2012/06/06. doi: 10.1128/AAC.00717-12. PubMed PMID: 22664975; PubMed Central PMCID: PMCPMC3421592.

333. Kessl JJ, Jena N, Koh Y, Taskent-Sezgin H, Slaughter A, Feng L, et al. Multimode, cooperative mechanism of action of allosteric HIV-1 integrase inhibitors. J Biol Chem. 2012;287(20):16801-11. Epub 2012/03/23. doi: 10.1074/jbc.M112.354373. PubMed PMID: 22437836; PubMed Central PMCID: PMCPMC3351293.

334. Tsiang M, Jones GS, Niedziela-Majka A, Kan E, Lansdon EB, Huang W, et al. New class of HIV-1 integrase (IN) inhibitors with a dual mode of action. J Biol Chem. 2012;287(25):21189-203. Epub 2012/04/27. doi: 10.1074/jbc.M112.347534. PubMed PMID: 22535962; PubMed Central PMCID: PMCPMC3375541.

335. FDA Approves Novel Gene Therapy to Treat Patients with a Rare Form of Inherited Vision Loss [Internet]. US Food and Drug Administration Newsroom Website; 2017; December 19, 2017. Available from: https://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm589467.htm

336. Colella P, Ronzitti G, Mingozzi F. Emerging Issues in AAV-Mediated In Vivo Gene Therapy. Mol Ther Methods Clin Dev. 2018;8:87-104. Epub 2018/01/13. doi: 10.1016/j.omtm.2017.11.007. PubMed PMID: 29326962; PubMed Central PMCID: PMCPMC5758940. 175

337. Giacca M. Gene Therapy. Italy: Springer; 2010.

338. Erles K, Sebokova P, Schlehofer JR. Update on the prevalence of serum antibodies (IgG and IgM) to adeno-associated virus (AAV). J Med Virol. 1999;59(3):406-11. Epub 1999/09/29. PubMed PMID: 10502275.

339. Ginn SL, Amaya AK, Alexander IE, Edelstein M, Abedi MR. Gene therapy clinical trials worldwide to 2017: An update. J Gene Med. 2018;20(5):e3015. Epub 2018/03/27. doi: 10.1002/jgm.3015. PubMed PMID: 29575374.

340. Coffin JM, Hughes SH, Varmus HE. In: Coffin JM, Hughes SH, Varmus HE, editors. Retroviruses. Cold Spring Harbor (NY)1997.

341. Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F, Yvon E, Nusbaum P, et al. Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science. 2000;288(5466):669-72. PubMed PMID: 10784449.

342. Hacein-Bey-Abina S, Garrigue A, Wang GP, Soulier J, Lim A, Morillon E, et al. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest. 2008;118(9):3132-42. doi: 10.1172/JCI35700. PubMed PMID: 18688285; PubMed Central PMCID: PMCPMC2496963.

343. Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science. 2003;302(5644):415-9. doi: 10.1126/science.1088547. PubMed PMID: 14564000.

344. Braun CJ, Boztug K, Paruzynski A, Witzel M, Schwarzer A, Rothe M, et al. Gene therapy for Wiskott-Aldrich syndrome--long-term efficacy and genotoxicity. Sci Transl Med. 2014;6(227):227ra33. Epub 2014/03/14. doi: 10.1126/scitranslmed.3007280. PubMed PMID: 24622513.

345. Ott MG, Schmidt M, Schwarzwaelder K, Stein S, Siler U, Koehl U, et al. Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nat Med. 2006;12(4):401-9. Epub 2006/04/04. doi: 10.1038/nm1393. PubMed PMID: 16582916.

346. Aiuti A, Biasco L, Scaramuzza S, Ferrua F, Cicalese MP, Baricordi C, et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science. 2013;341(6148):1233151. doi: 10.1126/science.1233151. PubMed PMID: 23845947; PubMed Central PMCID: PMCPMC4375961.

347. Biffi A, Montini E, Lorioli L, Cesani M, Fumagalli F, Plati T, et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science. 2013;341(6148):1233158. doi: 10.1126/science.1233158. PubMed PMID: 23845948. 176

348. Yoder KE, Bushman FD. Repair of gaps in retroviral DNA integration intermediates. J Virol. 2000;74(23):11191-200. Epub 2000/11/09. PubMed PMID: 11070016; PubMed Central PMCID: PMCPMC113210.

349. Cherepanov P, Devroe E, Silver PA, Engelman A. Identification of an evolutionarily conserved domain in human lens epithelium-derived growth factor/transcriptional co-activator p75 (LEDGF/p75) that binds HIV-1 integrase. J Biol Chem. 2004;279(47):48883-92. doi: 10.1074/jbc.M406307200. PubMed PMID: 15371438.

350. Hendrix J, Gijsbers R, De Rijck J, Voet A, Hotta J, McNeely M, et al. The transcriptional co-activator LEDGF/p75 displays a dynamic scan-and-lock mechanism for chromatin tethering. Nucleic Acids Res. 2011;39(4):1310-25. Epub 2010/10/27. doi: 10.1093/nar/gkq933. PubMed PMID: 20974633; PubMed Central PMCID: PMCPMC3045605.

351. Miller MD, Bor YC, Bushman F. Target DNA capture by HIV-1 integration complexes. Curr Biol. 1995;5(9):1047-56. Epub 1995/09/01. PubMed PMID: 8542281.

352. Lopez MA, Jr., Mackler RM, Altman MP, Yoder KE. Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase. Journal of visualized experiments : JoVE. 2017;(130). doi: 10.3791/56605. PubMed PMID: 29286489.

353. Lopez MA, Jr., Mackler RM, Yoder KE. Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase. J Virol Methods. 2016;235:134-8. Epub 2016/06/09. doi: 10.1016/j.jviromet.2016.06.002. PubMed PMID: 27269588; PubMed Central PMCID: PMCPMC4992616.

354. Carteau S, Batson SC, Poljak L, Mouscadet JF, de Rocquigny H, Darlix JL, et al. Human immunodeficiency virus type 1 nucleocapsid protein specifically stimulates Mg2+- dependent DNA integration in vitro. J Virol. 1997;71(8):6225-9. Epub 1997/08/01. PubMed PMID: 9223522; PubMed Central PMCID: PMCPMC191888.

355. Hazuda DJ, Felock PJ, Hastings JC, Pramanik B, Wolfe AL. Differential divalent cation requirements uncouple the assembly and catalytic reactions of human immunodeficiency virus type 1 integrase. J Virol. 1997;71(9):7005-11. Epub 1997/09/01. PubMed PMID: 9261430; PubMed Central PMCID: PMCPMC191986.

356. Pemberton IK, Buckle M, Buc H. The metal ion-induced cooperative binding of HIV-1 integrase to DNA exhibits a marked preference for Mn(II) rather than Mg(II). J Biol Chem. 1996;271(3):1498-506. Epub 1996/01/19. PubMed PMID: 8576144.

357. Wolfe AL, Felock PJ, Hastings JC, Blau CU, Hazuda DJ. The role of manganese in promoting multimerization and assembly of human immunodeficiency virus type 1 177 integrase as a catalytically active complex on immobilized long terminal repeat substrates. J Virol. 1996;70(3):1424-32. PubMed PMID: 8627659; PubMed Central PMCID: PMCPMC189962.

358. Wang YM, Austin RH, Cox EC. Single molecule measurements of repressor protein 1D diffusion on DNA. Phys Rev Lett. 2006;97(4):048302. Epub 2006/08/16. doi: 10.1103/PhysRevLett.97.048302. PubMed PMID: 16907618.

359. Muller HP, Varmus HE. DNA bending creates favored sites for retroviral integration: an explanation for preferred insertion sites in nucleosomes. The EMBO journal. 1994;13(19):4704-14. Epub 1994/10/03. PubMed PMID: 7925312.

360. Coffin JM, Hughes SH, Varmus HE. Retroviruses. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1997.

361. Lopez MA, Jr., Mackler RM, Yoder KE. Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase. Journal of virological methods. 2016;235:134-8. doi: 10.1016/j.jviromet.2016.06.002. PubMed PMID: 27269588; PubMed Central PMCID: PMC4992616.

362. Botbol Y, Raghavendra NK, Rahman S, Engelman A, Lavigne M. Chromatinized templates reveal the requirement for the LEDGF/p75 PWWP domain during HIV-1 integration in vitro. Nucleic Acids Res. 2008;36(4):1237-46. doi: 10.1093/nar/gkm1127. PubMed PMID: 18174227; PubMed Central PMCID: PMCPMC2275106.

363. McKee CJ, Kessl JJ, Shkriabai N, Dar MJ, Engelman A, Kvaratskhelia M. Dynamic modulation of HIV-1 integrase structure and function by cellular lens epithelium-derived growth factor (LEDGF) protein. J Biol Chem. 2008;283(46):31802-12. Epub 2008/09/20. doi: 10.1074/jbc.M805843200. PubMed PMID: 18801737; PubMed Central PMCID: PMCPMC2581560.

364. Taganov KD, Cuesta I, Daniel R, Cirillo LA, Katz RA, Zaret KS, et al. Integrase- specific enhancement and suppression of retroviral DNA integration by compacted chromatin structure in vitro. J Virol. 2004;78(11):5848-55. doi: 10.1128/JVI.78.11.5848- 5855.2004. PubMed PMID: 15140982; PubMed Central PMCID: PMCPMC415796.

365. Grandgenett DP, Bera S, Pandey KK, Vora AC, Zahm J, Sinha S. Biochemical and biophysical analyses of concerted (U5/U3) integration. Methods. 2009;47(4):229-36. doi: 10.1016/j.ymeth.2008.11.002. PubMed PMID: 19049878; PubMed Central PMCID: PMC2693883.

366. Li M, Lin S, Craigie R. Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration. Protein Sci. 2016;25(2):472-8. Epub 2015/11/06. doi: 10.1002/pro.2837. PubMed PMID: 26537415; PubMed Central PMCID: PMCPMC4815351. 178

367. Winans S, Larue RC, Abraham CM, Shkriabai N, Skopp A, Winkler D, et al. The FACT Complex Promotes Avian Leukosis Virus DNA Integration. J Virol. 2017;91(7). doi: 10.1128/JVI.00082-17. PubMed PMID: 28122976; PubMed Central PMCID: PMCPMC5355599.

368. Aiyer S, Rossi P, Malani N, Schneider WM, Chandar A, Bushman FD, et al. Structural and sequencing analysis of local target DNA recognition by MLV integrase. Nucleic Acids Res. 2015;43(11):5647-63. doi: 10.1093/nar/gkv410. PubMed PMID: 25969444; PubMed Central PMCID: PMC4477651.

369. Pechmann S, Levy ED, Tartaglia GG, Vendruscolo M. Physicochemical principles that regulate the competition between functional and dysfunctional association of proteins. Proceedings of the National Academy of Sciences of the United States of America. 2009;106(25):10159-64. doi: 10.1073/pnas.0812414106. PubMed PMID: 19502422; PubMed Central PMCID: PMC2700930.

370. Schlick T, Li B, Olson WK. The influence of salt on the structure and energetics of supercoiled DNA. Biophysical journal. 1994;67(6):2146-66. doi: 10.1016/S0006- 3495(94)80732-5. PubMed PMID: 7696459; PubMed Central PMCID: PMC1225601.

371. Noy A, Sutthibutpong T, S AH. Protein/DNA interactions in complex DNA topologies: expect the unexpected. Biophysical reviews. 2016;8(3):233-43. doi: 10.1007/s12551-016-0208-8. PubMed PMID: 27738452; PubMed Central PMCID: PMC5039213.

372. Hare S, Vos AM, Clayton RF, Thuring JW, Cummings MD, Cherepanov P. Molecular mechanisms of retroviral integrase inhibition and the evolution of viral resistance. Proc Natl Acad Sci U S A. 2010;107(46):20057-62. Epub 2010/10/30. doi: 10.1073/pnas.1010246107. PubMed PMID: 21030679; PubMed Central PMCID: PMCPMC2993412.

373. Fransen S, Gupta S, Danovich R, Hazuda D, Miller M, Witmer M, et al. Loss of raltegravir susceptibility by human immunodeficiency virus type 1 is conferred via multiple nonoverlapping genetic pathways. J Virol. 2009;83(22):11440-6. Epub 2009/09/18. doi: 10.1128/JVI.01168-09. PubMed PMID: 19759152; PubMed Central PMCID: PMCPMC2772690.

374. Varadarajan J, McWilliams MJ, Mott BT, Thomas CJ, Smith SJ, Hughes SH. Drug resistant integrase mutants cause aberrant HIV integrations. Retrovirology. 2016;13(1):71. doi: 10.1186/s12977-016-0305-6. PubMed PMID: 27682062; PubMed Central PMCID: PMCPMC5041404.

375. Brack-Werner R. Astrocytes: HIV cellular reservoirs and important participants in neuropathogenesis. AIDS. 1999;13(1):1-22. Epub 1999/04/20. PubMed PMID: 10207540.

179

376. Joseph SB, Arrildt KT, Sturdevant CB, Swanstrom R. HIV-1 target cells in the CNS. J Neurovirol. 2015;21(3):276-89. Epub 2014/09/23. doi: 10.1007/s13365-014-0287- x. PubMed PMID: 25236812; PubMed Central PMCID: PMCPMC4366351.

377. d'Arminio Monforte A, Cinque P, Mocroft A, Goebel FD, Antunes F, Katlama C, et al. Changing incidence of central nervous system diseases in the EuroSIDA cohort. Ann Neurol. 2004;55(3):320-8. Epub 2004/03/03. doi: 10.1002/ana.10827. PubMed PMID: 14991809.

378. Lescure FX, Omland LH, Engsig FN, Roed C, Gerstoft J, Pialoux G, et al. Incidence and impact on mortality of severe neurocognitive disorders in persons with and without HIV infection: a Danish nationwide cohort study. Clin Infect Dis. 2011;52(2):235-43. Epub 2011/02/04. doi: 10.1093/cid/ciq041. PubMed PMID: 21288850.

379. Clements JE, Li M, Gama L, Bullock B, Carruth LM, Mankowski JL, et al. The central nervous system is a viral reservoir in simian immunodeficiency virus--infected macaques on combined antiretroviral therapy: a model for human immunodeficiency virus patients on highly active antiretroviral therapy. J Neurovirol. 2005;11(2):180-9. Epub 2005/07/23. doi: 10.1080/13550280590922748-1. PubMed PMID: 16036796.

380. Muldoon LL, Alvarez JI, Begley DJ, Boado RJ, Del Zoppo GJ, Doolittle ND, et al. Immunologic privilege in the central nervous system and the blood-brain barrier. J Cereb Blood Flow Metab. 2013;33(1):13-21. Epub 2012/10/18. doi: 10.1038/jcbfm.2012.153. PubMed PMID: 23072749; PubMed Central PMCID: PMCPMC3597357.

381. Strazielle N, Ghersi-Egea JF. Factors affecting delivery of antiviral drugs to the brain. Rev Med Virol. 2005;15(2):105-33. Epub 2004/11/17. doi: 10.1002/rmv.454. PubMed PMID: 15546130.

382. Smith DB, Simmonds P, Bell JE. Brain viral burden, neuroinflammation and neurodegeneration in HAART-treated HIV positive injecting drug users. J Neurovirol. 2014;20(1):28-38. Epub 2014/01/15. doi: 10.1007/s13365-013-0225-3. PubMed PMID: 24420447.

383. Brehove M, Wang T, North J, Luo Y, Dreher SJ, Shimko JC, et al. Histone core phosphorylation regulates DNA accessibility. J Biol Chem. 2015;290(37):22612-21. doi: 10.1074/jbc.M115.661363. PubMed PMID: 26175159; PubMed Central PMCID: PMCPMC4566235.

384. Javaid S, Manohar M, Punja N, Mooney A, Ottesen JJ, Poirier MG, et al. Nucleosome remodeling by hMSH2-hMSH6. Mol Cell. 2009;36(6):1086-94. doi: 10.1016/j.molcel.2009.12.010. PubMed PMID: 20064472; PubMed Central PMCID: PMCPMC3010363.

180

385. North JA, Shimko JC, Javaid S, Mooney AM, Shoffner MA, Rose SD, et al. Regulation of the nucleosome unwrapping rate controls DNA accessibility. Nucleic Acids Res. 2012;40(20):10215-27. doi: 10.1093/nar/gks747. PubMed PMID: 22965129; PubMed Central PMCID: PMCPMC3488218.

386. Anderson JD, Thastrom A, Widom J. Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation. Mol Cell Biol. 2002;22(20):7147-57. Epub 2002/09/21. PubMed PMID: 12242292; PubMed Central PMCID: PMCPMC139820.

387. Bucceri A, Kapitza K, Thoma F. Rapid accessibility of nucleosomal DNA in yeast on a second time scale. The EMBO journal. 2006;25(13):3123-32. Epub 2006/06/17. doi: 10.1038/sj.emboj.7601196. PubMed PMID: 16778764; PubMed Central PMCID: PMCPMC1500995.

388. Lutter LC. Kinetic analysis of deoxyribonuclease I cleavages in the nucleosome core: evidence for a DNA superhelix. Journal of molecular biology. 1978;124(2):391-420. Epub 1978/09/15. PubMed PMID: 568667.

389. Lowary PT, Widom J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. Journal of molecular biology. 1998;276(1):19-42. doi: 10.1006/jmbi.1997.1494. PubMed PMID: 9514715.

390. Forties RA, North JA, Javaid S, Tabbaa OP, Fishel R, Poirier MG, et al. A quantitative model of nucleosome dynamics. Nucleic acids research. 2011;39(19):8306- 13. doi: 10.1093/nar/gkr422. PubMed PMID: 21764779; PubMed Central PMCID: PMC3201853.

391. Li M, Wang MD. Unzipping single DNA molecules to study nucleosome structure and dynamics. Methods Enzymol. 2012;513:29-58. doi: 10.1016/B978-0-12-391938- 0.00002-1. PubMed PMID: 22929764.

392. Ngo TT, Zhang Q, Zhou R, Yodh JG, Ha T. Asymmetric unwrapping of nucleosomes under tension directed by DNA local flexibility. Cell. 2015;160(6):1135-44. doi: 10.1016/j.cell.2015.02.001. PubMed PMID: 25768909; PubMed Central PMCID: PMCPMC4409768.

393. Simon M, North JA, Shimko JC, Forties RA, Ferdinand MB, Manohar M, et al. Histone fold modifications control nucleosome unwrapping and disassembly. Proc Natl Acad Sci U S A. 2011;108(31):12711-6. doi: 10.1073/pnas.1106264108. PubMed PMID: 21768347; PubMed Central PMCID: PMCPMC3150920.

394. Vasudevan D, Chua EY, Davey CA. Crystal structures of nucleosome core particles containing the '601' strong positioning sequence. Journal of molecular biology. 2010;403(1):1-10. doi: 10.1016/j.jmb.2010.08.039. PubMed PMID: 20800598. 181

395. Ausio J, Dong F, van Holde KE. Use of selectively trypsinized nucleosome core particles to analyze the role of the histone "tails" in the stabilization of the nucleosome. Journal of molecular biology. 1989;206(3):451-63. Epub 1989/04/05. PubMed PMID: 2716057.

396. Du Q, Vologodskaia M, Kuhn H, Frank-Kamenetskii M, Vologodskii A. Gapped DNA and cyclization of short DNA fragments. Biophysical journal. 2005;88(6):4137-45. doi: 10.1529/biophysj.104.055657. PubMed PMID: 15778443; PubMed Central PMCID: PMC1305644.

397. Pryciak PM, Varmus HE. Nucleosomes, DNA-binding proteins, and DNA sequence modulate retroviral integration target site selection. Cell. 1992;69(5):769-80. Epub 1992/05/29. doi: 0092-8674(92)90289-O [pii]. PubMed PMID: 1317268.

398. Hall MA, Shundrovsky A, Bai L, Fulbright RM, Lis JT, Wang MD. High-resolution dynamic mapping of histone-DNA interactions in a nucleosome. Nature structural & molecular biology. 2009;16(2):124-9. doi: 10.1038/nsmb.1526. PubMed PMID: 19136959; PubMed Central PMCID: PMC2635915.

399. Yang Z, Zheng C, Hayes JJ. The core histone tail domains contribute to sequence- dependent nucleosome positioning. J Biol Chem. 2007;282(11):7930-8. Epub 2007/01/20. doi: 10.1074/jbc.M610584200. PubMed PMID: 17234628.

400. Bohm V, Hieb AR, Andrews AJ, Gansen A, Rocker A, Toth K, et al. Nucleosome accessibility governed by the dimer/tetramer interface. Nucleic Acids Res. 2011;39(8):3093-102. Epub 2010/12/24. doi: 10.1093/nar/gkq1279. PubMed PMID: 21177647; PubMed Central PMCID: PMCPMC3082900.

401. Benleulmi MS, Matysiak J, Henriquez DR, Vaillant C, Lesbats P, Calmels C, et al. Intasome architecture and chromatin density modulate retroviral integration into nucleosome. Retrovirology. 2015;12:13. doi: 10.1186/s12977-015-0145-9. PubMed PMID: 25807893; PubMed Central PMCID: PMCPMC4358916.

402. Benleulmi MS, Matysiak J, Robert X, Miskey C, Mauro E, Lapaillerie D, et al. Modulation of the functional association between the HIV-1 intasome and the nucleosome by histone amino-terminal tails. Retrovirology. 2017;14(1):54. doi: 10.1186/s12977-017- 0378-x. PubMed PMID: 29179726; PubMed Central PMCID: PMCPMC5704366.

403. Lesbats P, Serrao E, Maskell DP, Pye VE, O'Reilly N, Lindemann D, et al. Structural basis for spumavirus GAG tethering to chromatin. Proc Natl Acad Sci U S A. 2017;114(21):5509-14. doi: 10.1073/pnas.1621159114. PubMed PMID: 28490494; PubMed Central PMCID: PMCPMC5448199.

404. Shimko JC, Howard CJ, Poirier MG, Ottesen JJ. Preparing semisynthetic and fully synthetic histones h3 and h4 to modify the nucleosome core. Methods Mol Biol. 182

2013;981:177-92. doi: 10.1007/978-1-62703-305-3_14. PubMed PMID: 23381862; PubMed Central PMCID: PMCPMC3815671.

405. Tims HS, Gurunathan K, Levitus M, Widom J. Dynamics of nucleosome invasion by DNA binding proteins. Journal of molecular biology. 2011;411(2):430-48. Epub 2011/06/15. doi: 10.1016/j.jmb.2011.05.044. PubMed PMID: 21669206; PubMed Central PMCID: PMCPMC3164294.

406. Pryciak PM, Sil A, Varmus HE. Retroviral integration into minichromosomes in vitro. The EMBO journal. 1992;11(1):291-303. PubMed PMID: 1310932; PubMed Central PMCID: PMCPMC556450.

407. Valouev A, Johnson SM, Boyd SD, Smith CL, Fire AZ, Sidow A. Determinants of nucleosome organization in primary human cells. Nature. 2011;474(7352):516-20. Epub 2011/05/24. doi: 10.1038/nature10002. PubMed PMID: 21602827; PubMed Central PMCID: PMCPMC3212987.

408. Chow SA, Vincent KA, Ellison V, Brown PO. Reversal of integration and DNA splicing mediated by integrase of human immunodeficiency virus. Science. 1992;255(5045):723-6. Epub 1992/02/07. PubMed PMID: 1738845.

409. Chatterjee N, North JA, Dechassa ML, Manohar M, Prasad R, Luger K, et al. Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Molecular and cellular biology. 2015;35(23):4083-92. doi: 10.1128/MCB.00441-15. PubMed PMID: 26416878; PubMed Central PMCID: PMC4628061.

410. Manohar M, Mooney AM, North JA, Nakkula RJ, Picking JW, Edon A, et al. Acetylation of histone H3 at the nucleosome dyad alters DNA-histone binding. J Biol Chem. 2009;284(35):23312-21. Epub 2009/06/13. doi: M109.003202 [pii]

10.1074/jbc.M109.003202. PubMed PMID: 19520870.

411. Shimko JC, North JA, Bruns AN, Poirier MG, Ottesen JJ. Preparation of fully synthetic histone H3 reveals that acetyl-lysine 56 facilitates protein binding within nucleosomes. Journal of molecular biology. 2011;408(2):187-204. doi: 10.1016/j.jmb.2011.01.003. PubMed PMID: 21310161; PubMed Central PMCID: PMC3815667.

412. North JA, Simon M, Ferdinand MB, Shoffner MA, Picking JW, Howard CJ, et al. Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure. Nucleic Acids Res. 2014;42(8):4922-33. doi: 10.1093/nar/gku150. PubMed PMID: 24561803; PubMed Central PMCID: PMCPMC4005658.

183

413. Mackler RM, Lopez MA, Jr., Yoder KE. Assembly and Purification of Prototype Foamy Virus Intasomes. Journal of visualized experiments : JoVE. 2018;(135). doi: 10.3791/57453.

414. Bowman GD, Poirier MG. Post-translational modifications of histones that influence nucleosome dynamics. Chem Rev. 2015;115(6):2274-95. doi: 10.1021/cr500350x. PubMed PMID: 25424540; PubMed Central PMCID: PMCPMC4375056.

415. Cole HA, Tabor-Godwin JM, Hayes JJ. Uracil DNA glycosylase activity on nucleosomal DNA depends on rotational orientation of targets. J Biol Chem. 2010;285(4):2876-85. doi: 10.1074/jbc.M109.073544. PubMed PMID: 19933279; PubMed Central PMCID: PMC2807341.

416. Hinz JM, Rodriguez Y, Smerdon MJ. Rotational dynamics of DNA on the nucleosome surface markedly impact accessibility to a DNA repair enzyme. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(10):4646- 51. doi: 10.1073/pnas.0914443107. PubMed PMID: 20176960; PubMed Central PMCID: PMC2842065.

417. Rodriguez Y, Hinz JM, Smerdon MJ. Accessing DNA damage in chromatin: Preparing the chromatin landscape for base excision repair. DNA repair. 2015;32:113-9. doi: 10.1016/j.dnarep.2015.04.021. PubMed PMID: 25957487; PubMed Central PMCID: PMC4522338.

418. Blainey PC, Luo G, Kou SC, Mangel WF, Verdine GL, Bagchi B, et al. Nonspecifically bound proteins spin while diffusing along DNA. Nature structural & molecular biology. 2009;16(12):1224-9. doi: 10.1038/nsmb.1716. PubMed PMID: 19898474; PubMed Central PMCID: PMC2889498.

419. Blainey PC, van Oijen AM, Banerjee A, Verdine GL, Xie XS. A base-excision DNA-repair protein finds intrahelical lesion bases by fast sliding in contact with DNA. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(15):5752-7. doi: 10.1073/pnas.0509723103. PubMed PMID: 16585517; PubMed Central PMCID: PMC1458645.

420. Lee AJ, Warshaw DM, Wallace SS. Insights into the glycosylase search for damage from single-molecule fluorescence microscopy. DNA repair. 2014;20:23-31. doi: 10.1016/j.dnarep.2014.01.007. PubMed PMID: 24560296; PubMed Central PMCID: PMC4112009.

421. Prevention CfDCa. NCHHSTP AtlasPlus. Updated 2017:[Available from: https://www.cdc.gov/nchhstp/atlas/index.htm.

184

422. Li M, Jurado KA, Lin S, Engelman A, Craigie R. Engineered hyperactive integrase for concerted HIV-1 DNA integration. PLoS One. 2014;9(8):e105078. doi: 10.1371/journal.pone.0105078. PubMed PMID: 25119883; PubMed Central PMCID: PMCPMC4132020.

185

Appendix A. List of abbreviations in alphabetical order

AAV Adeno-associated virus

AIDS Acquired immunodeficiency syndrome

ALLINI Allosteric integrase inhibitor

ART Antiretroviral therapy

ASLV Avian sarcoma leukemia virus

ATLL Adult T cell leukemia/lymphoma

BAF Barrier-to-autointegration factor

BET Bromodomain and extraterminal domain bp Base pair

CA Capsid

CCD Catalytic core domain cDNA Complementary DNA

CHMP Charged multivesicular body protein

CI Concerted integration cPPT Central polypurine tract

CPSF6 Cleavage and polyadenylation specificity factor 6

CTD Carboxyl-terminal domain

Cy5 Cyanine 5 fluorophore

186

D Dimensional

DIS Dimerization initiation signal

DTG Dolutegravir

DTT Dithiothreitol

ER Endoplasmic reticulum

ESCRT Endosomal sorting complexes required for transport

EtBr Ethidium bromide

EVG Elvitegravir

FDA Federal drug administration

FL Full-length

FPLC Fast protein liquid chromatography

FRET Fluorescence resonance energy transfer

FV Foamy virus

HAM/TSP HTLV-1-associated myelopathy/tropical spastic paraparesis

HIV-1 Human immunodeficiency virus-1

HMG High-mobility group protein

HSI Half-site integration

HTLV-1 Human T lymphotropic virus-1

IHF Integration host factor

IL2RG Interleukin 2 receptor subunit gamma gene

187

IN Integrase

INI1 Integrase interactor 1

INSTI Integrase strand transfer inhibitor

IP Internal promoter

IT Intersegmental transfer kb Kilo-bases (1,000 base pairs)

KD Knockdown

LAP2α Lamina-associated polypeptide 2α

LEDGF Lens epithelium-derived growth factor

LEF Human lymphoid enhancer factor

LMO2 LIM domain-only 2 gene

LTR Long terminal repeat

Lys Lysine

MA Matrix mAU milli-Absorbance units

MLV Murine leukemia virus

MMTV Mouse mammary tumor virus

MSD Major splice donor

MT Magnetic tweezers

MVV Maedi-visna virus

NC Nucleocapsid

NED Amino-terminal extension domain

188

Nef Negative factor

NLS Nuclear localization signal

NPC Nuclear pore complex nt Nucleotide

NTD Amino-terminal domain

Nups Nucleoporins

OD Optical density

PAGE Polyacrylamide gel electrophoresis

PBS Primer binding site

PCA Protocatechuic acid

PFV Prototype foamy virus

PIC Preintegration complex

PM Plasma membrane

PPT Polypurine tract

PR Protease

PTM Posttranslational modification

R Redundant

RAL Raltegravir

RIG Recurrent integration gene

RNase H Ribonuclease H

RRE Rev response element

RSV Rous sarcoma virus

189

RT Reverse transcriptase

SC Supercoiled DNA

SDS Sodium dodecyl sulfate

SEC Size exclusion chromatography

SELEX Systematic evolution of ligands by exponential enrichment

SFV Simian foamy virus

SFVcpz(hu) Simian foamy virus from chimpanzee in human

SH3 SRC Homology 3

SIV Simian immunodeficiency virus

Sm Single molecule ssRNA Single stranded RNA

TAR Trans-activation response element

Tas Transactivator of spumavirus

Tat Transactivator of transcription

TIRF Total internal reflection fluorescence

TL Tailless

TNPO3 Transportin 3 tRNA Transfer RNA

TSG101 Tumor susceptibility gene 101

TU Transcription unit

U1snRNP U1 small nuclear ribonucleoprotein

U3 Unique 3

190

U5 Unique 5

UDG Uracil DNA glycosylase vDNA Viral DNA

Vif Viral infectivity factor

Vpr Viral protein R

VPS4 Vacuolar protein sorting-associated protein 4

X-SCID X-linked severe combined immunodeficiency

YR Pyridine/Purine

Ψ Psi packaging signal

191

Appendix B. Empirical findings of prototype foamy virus intasome assembly

This appendix is based on work published in Journal of Visualized Experiments [271]:

Mackler RM, Lopez MA Jr, Yoder KE. Assembly and Purification of Prototype Foamy

Virus Intasomes. J Vis Exp. 2018 Mar 19;(133). PMID: 29608167; PMCID: PMC5933227.

PFV intasomes are assembled from purified recombinant IN and vDNA. After assembly and resolubilization, three peaks become apparent: aggregates (peak 1), tetrameric intasomes (peak 2), and free PFV IN and vDNA (peak 3) (Figure B.1).

Figure B.1. Size exclusion chromatogram of PFV intasome assembly A PFV intasome assembly with internal Cy5 fluorophore label vDNA was separated with a Superose 6 column. This column separated aggregate (1), PFV intasome consisting of a tetramer of PFV IN and two vDNA (2), and monomeric PFV IN and vDNA (3). Y-axis denotes optical density (OD) in milli- absorbance units (mAU). 192

Activity of each fraction is assayed with a supercoiled DNA target. Integration results in two products: half-site and concerted. Half-site integration (HSI) is when one vDNA strand transfers, whereas concerted integration (CI) is when both vDNAs strand transfer, resulting in tagged circle and linear DNAs, respectively (Figure B.2). Agarose gel electrophoresis resolves these species and unreacted supercoiled DNA (SC). Using image analysis software, band pixel volumes can be used to calculate the integration efficiency (Figure B.3). Fractions with the highest optical density (OD) in the SEC chromatogram peak 2 also had the most integration activity, as expected. Fractions with the highest integration efficiency are snap frozen for later use.

Figure B.2. Integration assay of SEC fractions (A) Schematic of integration strand transfer reaction. Left, cartoon of a PFV intasome including a tetramer of IN (blue circles) and two vDNA (thick black lines), and target plasmid (thin black lines). The supercoils (SC) of the target plasmid are not drawn. Center, cartoon of a half-site integration (HSI) product when one vDNA has been covalently joined. The joining reaction introduces a nick and relaxes the supercoils. Right, cartoon of a concerted integration (CI) product where two vDNAs have been joined that results in linear DNA with vDNAs at the ends. (B) Supercoiled plasmid DNA was added to each SEC fraction #49-55. Following incubation, integration reactions were deproteinated and separated by 1% agarose gel electrophoresis containing EtBr. Negative control was plasmid DNA with no protein (T). DNA size markers are shown in kb. (C) Agarose gel scanned for the presence of Cy5. Only vDNA, CI, and HSI products are visible. 193

Figure B.3. Quantitation of integration assay The agarose gel from Figure B.2 was scanned and quantified for the presence of both EtBr (left) and Cy5 (right). For the EtBr calculation, HSI, CI, and SC band pixel volumes were obtained using gel analysis software. Integration efficiency was calculated using the equation shown. For example, the pixel values in the EtBr channel for the bands of fraction #49 are: 110565.2 SC, 25152.56 CI, and 6313.04 HSI. The total DNA pixel value for fraction #49 is the sum of these values, 142030.8. The integration efficiency is the CI pixel volume of 25152.56 divided by the total DNA value 142030.8 equaling 0.18. Cy5 CI band pixel volumes are graphed as arbitrary units. Fractions with peak integration activity are individually aliquoted and frozen. In this example, fractions #50-53 were selected. Aliquots are snap frozen with liquid nitrogen and stored at -80°C for future use. Previously, purified intasomes were stored on ice for immediate use [240].

However, these intasomes were purified in the absence of glycerol. With the addition of

10% glycerol, the integration activity of intasomes before and after one freeze/thaw cycle was evaluated. Frozen fractions retain integration activity (Figure B.4), allowing for long- term storage of assembled intasomes.

194

Figure B.4. Effect of freeze/thawing on intasome activity Half of one SEC fraction was flash frozen with liquid nitrogen, stored at -80°C for 1 h, and then slowly thawed on ice. The remaining half was kept on ice in a cold room while the first half was frozen and thawed. Intasomes were tested for activity without (-) and with (+) freeze/thawing. Integration efficiency was measured as described above. (A) EtBr stained agarose gel of integration products. Supercoiled plasmid (SC), concerted integration products (CI), half-site integration products (HSI), and unreacted vDNA are indicated. DNA size markers are shown in kb. (B) Quantitation of the integration efficiency from EtBr image. Calculations are described in Figure B.3. The average integration efficiency is from 5 independent experiments with 2 intasome preparations. Error bars indicate standard deviation. Paired t- test analyses yielded a two-tailed P = 0.011, suggesting that freeze/thaw may have slightly enhanced integration activity. Intasomes were assembled using unmodified or modified vDNAs labeled with fluorophore Cy5 or biotin. It was empirically determined that any label molecule and its position within the vDNA may affect intasome assembly efficiency (Figure B.5).

Assemblies utilizing unmodified or internally Cy5 labeled vDNAs yielded high proportions of PFV intasomes. However, vDNA with 5’ end labels of Cy5 or biotin resulted in strikingly lower intasome yields.

195

Figure B.5. Label molecule and position impacts intasome assembly. PFV intasome assemblies included vDNAs that were unlabeled (red), end labeled on KEY675 with Cy5 (blue), internally labeled on KEY616 with Cy5 (black), or end labeled on KEY675 with biotin (orange). All assemblies were separated with an SEC column. The y-axis denotes OD in mAU. Chromatograms are representative of at least 2 independent assemblies of each intasome type. End labeling reduces the yield of PFV intasomes with Cy5 10-fold and biotin 1.8-fold. End Cy5 and biotin assemblies have noticeably more precipitate remaining after high salt resolubilization, resulting in apparent loss of material on the size exclusion column. Internal labeling of the vDNA with the Cy5 fluorophore leads to an equal yield of intasomes as unlabeled vDNA.

196

Appendix C. Supplemental Figures

Figure C.1. Purification of FL and Truncated Hybrid PFV intasomes (a) FL, (b) ΔNTD and (c) ΔCTD intasomes were purified by size exclusion chromatography (SEC) with a Superose 12 gel filtration column. Two distinct peaks are observed that correspond with intasomes (1), and unassembled protein monomers and viral donor DNA (vDNA) (2). SDS-PAGE gels for (a) WT, (b) ΔNTD and (c) ΔCTD SEC fractions are shown. Sample loaded to the column (L). Molecular weight (MW) standards are in kDa. Insets indicate elution peaks relative to MW SEC standards. Truncated hybrid intasomes (b,c) were confirmed by coelution of FL and truncated proteins in peak (1) compared to asynchronous elution in peak (2). (d) Table of expected and experimental MWs in kDa. Observed MW differences are likely a result of the asymmetrical nature of the PFV intasome. SEC runs and gels by MAL and RMM. Figure made by RMM.

197

Figure C.2. Initial kinetics of PFV integration (a) Data fitting for the loss of supercoiled DNA with FL, ΔNTD and ΔCTD intasomes. Data was fit with exponential decay curves (curve fit line). The first derivative was determined and evaluated at the one minute time point (tangent line). (b) Using Eq. 1 (3.3.5), the initial kcat was solved for each time course. The kcat reveals no significant difference (p > 0.05) between the initial rates of supercoiled DNA decrease between the FL, ΔNTD and ΔCTD intasomes. Error bars indicate standard deviation. Figure and analysis by NDJ based on data collected by RMM.

198

Figure C.3. Interaction of PFV intasomes with supercoiled plasmid DNA PFV intasomes, including FL, ∆NTD, and ∆CTD, were assembled with biotinylated viral oligomers. Intasomes were incubated with supercoiled plasmid DNA and streptavidin conjugated magnetic beads. The plasmid DNA associated with the beads was analyzed by agarose gel electrophoresis. EtBr staining (top). IN protein associated with the beads was analyzed by SDS-PAGE stained with Coomassie blue (center). The supercoiled plasmid precipitated by intasomes and beads was quantified and is expressed relative to PFV FL intasome (bottom). Experiments were performed at least two times with at least two independent intasome preparations. Error bars indicate standard deviation. I, 5% input of supercoiled plasmid or intasomes. B, DNA or protein associated with streptavidin conjugated beads. SC, supercoiled plasmid. Experiments by RMM. Figure and analysis by NDJ.

199

Figure C.4. Integration into recombinant nucleosomes is almost completely concerted (A) After double dialysis, reconstituted nucleosomes were separated via a 5-30% sucrose gradient velocity ultracentrifugation. Fractions were run on a 5% 59:1 PAGE gel. Representative Cy3 image (top) and Cy5 image (bottom). In this reconstitution, fractions 8-14 were combined and concentrated for use. (B) PFV intasomes with a 5’ Cy5 labeled 40 bp viral donor DNA (vDNA) were incubated with 147 bp target DNA (NPS) for 1, 5, 15, and 30 minutes (black triangle). The target DNA was either naked 601 DNA (left half of gel image) or 601 nucleosome wrapped DNA (right half of gel image). Reaction products were separated by native PAGE and scanned for Cy5. Substrate only (-). HS, half-site integration; CI, concerted integration; vDNA, viral DNA.

200

Figure C.5. B-Cy5 NPS reaffirms increasing salt concentration decreases integration into nucleosomes (A) PFV intasomes were added to B-Cy5 NPS naked DNA (left) or nucleosomes (right) in the presence of increasing concentrations of NaCl (black triangle, 100-300 mM NaCl). Substrate only (-). (B) The total PFV integration activity with naked DNA (filled squares) or nucleosomes (open circles). P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05; **, p < 0.01; ***, p < 0.001. (C) Integration activity at each of the major clusters. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations.

201

Figure C.6. PFV intasomes are active at high salt concentrations (A) PFV WT intasomes were incubated with a 3 kb supercoiled DNA in the presence of increasing concentrations of NaCl (black triangle, 100-300 mM NaCl). Reaction products were separated by 1% agarose stained with EtBr. Left, Cy5 image. Right, EtBr image. CI, concerted integration; HS, half-site integration. Substrate only (-). Size markers are indicated on right in kb. (B) Total PFV integration activity. Error bars indicate the standard deviation between at least three independent experiments.

202

Figure C.7. Nucleosomes remain intact at 300 mM NaCl (A) T-Cy5 601 NPS nucleosomes containing Cy3-H2A were analyzed in the presence of 110, 300, or 600 mM NaCl. Samples were incubated for 5 min at 37°C before emission spectra were obtained. Representative spectra at each salt concentration are shown. (B) The apparent relative fluorescence resonance energy transfer (FRET, Erelative). Error bars indicate the standard deviation between at least three independent experiments with at least two nucleosome preparations. P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05; ****, p < 0.0001.

203

Figure C.8. Truncation mutations of the outer PFV IN monomers alter integration site choice (A) PFV IN WT (left), PFV IN(D273K, ∆NED∆NTD) (center), or PFV IN(D273K, ∆CTD) (right) intasomes were added to T-Cy5 NPS nucleosomes. Integration products were separated by denaturing PAGE. PFV intasome concentrations were 7 nM, 13 nM, 20 nM, and 26 nM (black triangles). -, Naked DNA or nucleosomes with no PFV intasome. +, Naked 601 NPS DNA with 26 nM intasome. (B) Quantitation of naked DNA integration efficiency. P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3.*, p < 0.05.

204

Figure C.9. Increasing salt concentration decreases ΔNEDΔNTD PFV integration into nucleosomes (A) ΔNEDΔNTD PFV intasomes were added to T-Cy5 NPS naked DNA (left) or nucleosomes (right) in the presence of increasing concentrations of NaCl (black triangle, 100-300 mM NaCl). Substrate only (-). (B) The total PFV integration activity with naked DNA (filled squares) or nucleosomes (open circles). P-values were determined using a paired two-tailed Student’s T-test at a 95% confidence interval with a minimum sample size of n = 3. *, p < 0.05. (C) Integration activity at each of the major clusters. Error bars indicate the standard deviation between at least three independent experiments with at least two PFV intasome and nucleosome preparations.

205

Figure C.10. Complete trypsin digestion of recombinant nucleosomes Recombinant nucleosomes were digested with trypsin to completely remove histone tails. (A) Native PAGE scanned to detect Cy5 601 NPS DNA shows the whole shift of the nucleosome band to a faster mobility post digest. (B) Histones were non-specifically labeled with Cy5 NHS ester and resolved via SDS-PAGE. FL, full-length. TL, tailless. Gels are representative of at least two independent nucleosome reconstitutions.

206