DOCSLIB.ORG

Role of Wnt11 in Kidney Ontogenesis and Development of Renal Organoid Based Models to Identify Candidate Oncogenes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of Wnt11 in Kidney Ontogenesis and Development of Renal Organoid Based Models to Identify Candidate Oncogenes D 1463 OULU 2018 D 1463 UNIVERSITY OF OULU P.O. Box 8000 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA DMEDICA Qi Xu Qi Xu University Lecturer Tuomo Glumoff ROLE OF WNT11 IN KIDNEY University Lecturer Santeri Palviainen ONTOGENESIS AND DEVELOPMENT OF RENAL Postdoctoral research fellow Sanna Taskila ORGANOID BASED MODELS Professor Olli Vuolteenaho TO IDENTIFY CANDIDATE ONCOGENES University Lecturer Veli-Matti Ulvinen Planning Director Pertti Tikkanen Professor Jari Juga University Lecturer Anu Soikkeli Professor Olli Vuolteenaho UNIVERSITY OF OULU GRADUATE SCHOOL; UNIVERSITY OF OULU, FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE; Publications Editor Kirsti Nurkkala BIOCENTER OULU; INFOTECH OULU ISBN 978-952-62-1910-3 (Paperback) ISBN 978-952-62-1911-0 (PDF) ISSN 0355-3221 (Print) ISSN 1796-2234 (Online) ACTA UNIVERSITATIS OULUENSIS D Medica 1463 QI XU ROLE OF WNT11 IN KIDNEY ONTOGENESIS AND DEVELOPMENT OF RENAL ORGANOID BASED MODELS TO IDENTIFY CANDIDATE ONCOGENES Academic dissertation to be presented with the assent of the Doctoral Training Committee of Health and Biosciences of the University of Oulu for public defence in Auditorium F202 of the Faculty of Medicine (Aapistie 5 B), on 1 June 2018, at 12 noon UNIVERSITY OF OULU, OULU 2018 Copyright © 2018 Acta Univ. Oul. D 1463, 2018 Supervised by Professor Seppo Vainio Reviewed by Professor Panu Mikko Jaakkola Professor Matthias Nees Opponent Professor Jing Zhou ISBN 978-952-62-1910-3 (Paperback) ISBN 978-952-62-1911-0 (PDF) ISSN 0355-3221 (Printed) ISSN 1796-2234 (Online) Cover Design Raimo Ahonen JUVENES PRINT TAMPERE 2018 Xu, Qi, Role of Wnt11 in kidney ontogenesis and development of renal organoid based models to identify candidate oncogenes. University of Oulu Graduate School; University of Oulu, Faculty of Biochemistry and Molecular Medicine; Biocenter Oulu; Infotech Oulu Acta Univ. Oul. D 1463, 2018 University of Oulu, P.O. Box 8000, FI-90014 University of Oulu, Finland Abstract In the kidney, Wnt is involved in ureteric bud branching and nephrogenesis. Wnt mutation may lead to specific developmental dysfunctions and diseases. As part of this thesis, I show that Wnt11 is expressed in the renal tubules, except for the ureteric epitheliums, and I examine the function of Wnt11 in renal tubule organization using the new C57Bl6 Wnt11-/- mouse model. Convoluted and dilated tubules were observed in the Wnt11 mutated kidneys that may cause glomerular cysts and kidney dysfunction. More specifically, a lack of Wnt11 in the kidney reduced Six2, Hoxd1, and Hox10 expression, which may have contributed to the anomalies in the kidney tubular system. Embryogenesis and carcinogenesis share molecular characteristics. Gene expression changes take place during development to meet the demands of the tissue formation, but ectopic expression of embryonic genes by deletion, SNPs, or epigenetic modification in adult may lead to cancer. The research carried out as part of this thesis identified genes that were differentially expressed in both induced metanephric mesenchymes (MM) and human ccRCC. Gene silencing of Bnip3, Gsn, Lgals3, Pax8, Cav1, Egfr, and Itgb2 mediated by siRNA inhibited the migration, viability and invasion capacity of Renca cells (RCC). Furthermore, by using the novel 3D in vitro MM-Renca co-culture setup, the result revealed that downregulation of Bnip3, Cav1 or Gsn in Renca cells partly rescued the RCC-mediated inhibition epithelial tubules formation during nephrogenesis. Altogether, the data demonstrates that renal ontogenesis control genes play a role both in normal kidney development and in kidney cancer. The 3D RCC-MM chimera organoids developed as part of the research may also serve as a novel model for kidney cancer study. Keywords: caveolin, gene expression, nephrogenesis, renal cell carcinoma, Wnt Xu, Qi, Wnt11-signaalin tehtävä munuaisen kehityksessä ja uusien munuais- syöpään osallistuvien geenien identifiointi kudosteknologisten mallien avulla. Oulun yliopiston tutkijakoulu; Oulun yliopisto, Biokemian ja molekyylilääketieteen tiedekunta; Biocenter Oulu; Infotech Oulu Acta Univ. Oul. D 1463, 2018 Oulun yliopisto, PL 8000, 90014 Oulun yliopisto Tiivistelmä Wnt-viestit ohjaavat munuaisen kehityksen yhteydessä sekä virtsanjohtimen että munuaiskerä- sen kasvua. Virhe Wnt-proteiinia tuottavassa geenissä johtaa puolestaan vakavaan kehityshäiri- öön ja syöpään, jos geeni aktivoituu aikuisvaiheessa. Tässä väitöskirjassa osoitetaan, että Wnt11- geeni osallistuu alkion munuaisen epiteeliputkiston kehityksen säätelyyn. Wnt11-signaalin tehtä- vää tutkittiin munuaisen putkiston rakenteen synnyssä poistogeenisen C57Bl6-hiirimallin avul- la. Wnt11-puutos häiritsi virtsan kokoojatiehyiden rakenteiden kehitystä. Tämä on mahdollinen syy siihen, että Wnt11-poistogeenisen hiiren munuaiseen kehittyy hiusverisuonikerästen laajen- tumia. Munuaisen toiminta on myös heikentynyt verrokkiin verrattuna. Munuaisen epiteeliputki- en kehitykseen osallistuvien geenien Six1, Hoxd1 ja Hox10 aktiivisuus oli niin ikään heikenty- nyt Wnt11-signaloinnin puutoksen vuoksi. Nämä seikat voivat olla puutoksen aiheuttamien kudosrakenteellisten muutosten taustalla. Solun kasvusäätely on keskeinen tekijä sekä alkion että syövän kehityksessä. Prosessien taus- talla ovat myös samankaltaiset molekyylit. Wnt-solusignaalit esimerkiksi säätelevät normaalin kehityksen aikana solujen itsesäätelyä, solujen jakautumista, solujen vaeltamista ja solujen invaasiota kudoksiin ja osallistuvat syövän syntyyn niiden viestinnän häiriintyessä. Kehitystä säätelevien geenien tuotteet ohjaavat solujen jakautumista, mikä on edellytys kudosrakenteen synnylle. Jos nämä geenit syystä tai toisesta aktivoituvat uudelleen aikuisvaiheen aikana, se voi johtaa syöpäkasvaimen syntyyn. Tässä työssä verrattiin keskenään munuaisen elinkehitykseen ja ihmisen syövän kasvuun osallistuvia geenejä. siRNA-välitteinen hiljennys geeneille Bnip3, Gsn, Lgals3, Pax8, Cav1, Egfr ja Itgb2 inhiboi Renca-solujen migraatiota, elinkykyä ja invaasiota. Lisäksi tulokset paljas- tivat, että käytettäessä uutta 3D in vitro MM Renca -kasvatusmenetelmää Bnip3-, Cav1- tai Gsn- geenien hiljennys Renca-soluissa osittain pelastaa RCC-välitteisen inhibition epiteeliputkissa nefrogeneesin aikana. Kaiken kaikkiaan työssä seulottiin uusin tavoin sekä ihmisen munuaissyöpään liittyviä gee- nejä että kehitettiin lisäksi uusia niin kutsuttuja kokeellisia funktionaalisia organoidimenetel- miä. Työn tulokset tarjoavat uuden strategian, jolla geenien osuutta munuaissyöpään voidaan tut- kia seikkaperäisesti yhdessä 3D-kasvatusmenetelmien kanssa Asiasanat: munuaissyöpä, nefrogeneesi, siRNA, tubulusmorfogeneesi, Wnt To my family 8 Acknowledgements This work was carried out at Biocenter Oulu, Faculty of Medical Biochemistry and Molecular Biology, University of Oulu. It was financially supported by the Biocenter Oulu Doctoral Programme and the Academy of Finland. I sincerely express my gratitude to my supervisor, Professor Seppo Vainio for providing me the opportunity to start my scientific career in his research group, and for introducing me to the beautiful world of developmental biology and cancer research. I am also very grateful for my other supervisor, Dr. Jingdong Shan, who has especially guided me the molecular biology technics during the thesis work. I would like to thank Docent Anatoliy Samoylenko, another co-supervisor, with whom we discussed and started the kidney cancer studied together, and his excellent experience in cancer inspired me in the thesis work. I would like to thank the members of my PhD follow-up group Prof. Johanna Myllyharju, Docent Aki Manninen, and Dr. Joni Mäki. They spent precious time reviewing my doctoral training plan and annual report. Their inspiring and guiding during the study made it moving smoothly. Professor Matthias Nees and Panu Jaakkola are acknowledged for their careful revision and valuable comments on this thesis. I would like to acknowledge the former head of the Center of Excellence in Cell-EMC Research Professor Taina Pihlajaniemi, head of Biocenter Oulu Professor Johanna Myllyharju, the former dean of faculty Professor Kalervo Hiltunen and the present dean of faculty Professor Peppi Karppinen, and all the other group leaders in faculty and Biocenter Oulu for providing an excellent research infrastructure and encouraging atmosphere. I wish to express my special compliments to BCO Doctoral Programme Coordinator Docent Ritva Saastamoinen for helping and encouraging me from beginning to the end. I would like to express my gratitude to all my co-authors for their valuable contribution to my research projects. I would also want to express thanks to my colleagues, former and present SV-group members for the warm and fruitful working environment during these years. Special thanks to Paula Haipus, Hannele Härkman and Johanna Kekolahti-Liias for their technical assistance in the practical lab work of the thesis. I would like to express my gratefulness to all the members of the core facility and Dr. Veli-Pekka Ponkainen for his help with the imaging, Dr. Jarkko Koivunen for his help with Incucyte and Docent Virpi Glumoff for her help with FACS. 9 I am sincerely grateful to my friends in Oulu. You bring me warmness for the long darkness winter. I wish to thanks my parents for their supporting. Finally, thanks for my husband Yongfeng and our lovely son Hang, you bring me lots of happiness. Oulu, April 2018 Qi Xu 10 Abbreviations ADPDK Autosomal dominant polycystic kidney disease AKT Protein
Load more

Recommended publications
  • Six3 Overexpression Initiates the Formation of Ectopic Retina
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION in the developing eye and ventral forebrain. Recently, in Six3 overexpression initiates Drosophila a member of the Six subclass of homeobox the formation of ectopic retina genes, optix, has been isolated, which by sequence com- parison of the homeobox appears to be the ortholog of Felix Loosli, Sylke Winkler, Six3 (Toy et al. 1998). Functional analysis of optix, how- 1 and Joachim Wittbrodt ever, has not yet been reported. In medaka fish (Oryzias latipes) Six3 is expressed in Sonderforschungsbereich (SFB) Junior Group, Institute for Human Genetics, University of Go¨ ttingen, c/o the anterior-most neuroectoderm at gastrula stages and Max-Planck-Institute (MPI) for Biophysical Chemistry, Am later in the developing retina (Loosli et al. 1998). Mosaic Fassberg, 37077 Go¨ttingen, Germany misexpression of mouse Six3 in small clones, in response to injected plasmid DNA, resulted in the formation of The homeobox gene sine oculis (so) is essential for visual ectopic lenses in the region of the otic vesicle, suggesting system formation in Drosophila. A vertebrate member a decisive role for Six3 during vertebrate lens develop- of the so/Six gene family, Six3, is expressed in the devel- ment (Oliver et al. 1996). Considering the expression of oping eye and forebrain. Injection of Six3 RNA into Six3 in the retinal primordia and the essential role of a medaka fish embryos causes ectopic Pax6 and Rx2 ex- Drosophila homolog, so,inDrosophila eye develop- pression in midbrain and cerebellum, resulting in the ment, we investigated a potential role of Six3 in early formation of ectopic retinal primordia.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Transient Activation of Meox1 Is an Early Component of the Gene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Access to Research and Communications Annals 1 Transient activation of Meox1 is an early component of the gene 2 regulatory network downstream of Hoxa2. 3 4 Pavel Kirilenko1, Guiyuan He1, Baljinder Mankoo2, Moises Mallo3, Richard Jones4, 5 5 and Nicoletta Bobola1,* 6 7 (1) School of Dentistry, Faculty of Medical and Human Sciences, University of 8 Manchester, Manchester, UK. 9 (2) Randall Division of Cell and Molecular Biophysics, King's College London, UK. 10 (3) Instituto Gulbenkian de Ciência, Oeiras, Portugal. 11 (4) Genetic Medicine, Manchester Academic Health Science Centre, Central 12 Manchester University Hospitals NHS Foundation Trust, Manchester, UK. 13 (5) Present address: Department of Biology, University of York, York, UK. 14 15 Running title: Hoxa2 activates Meox1 expression. 16 Keywords: Meox1, Hoxa2, homeodomain, development, mouse 17 *Words Count: Material and Methods: 344; Introduction, Results and Discussion: 18 3679 19 19 * Author for correspondence at: AV Hill Building The University of Manchester Manchester M13 9PT United Kingdom Phone: (+44) 161 3060642 E-mail: [email protected] 1 Abstract 2 Hox genes encode transcription factors that regulate morphogenesis in all animals 3 with bilateral symmetry. Although Hox genes have been extensively studied, their 4 molecular function is not clear in vertebrates, and only a limited number of genes 5 regulated by Hox transcription factors have been identified. Hoxa2 is required for 6 correct development of the second branchial arch, its major domain of expression. 7 We now show that Meox1 is genetically downstream from Hoxa2 and is a direct 8 target.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Supplementary Material
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Page 1 / 45 SUPPLEMENTARY MATERIAL Appendix A1: Neuropsychological protocol. Appendix A2: Description of the four cases at the transitional stage. Table A1: Clinical status and center proportion in each batch. Table A2: Complete output from EdgeR. Table A3: List of the putative target genes. Table A4: Complete output from DIANA-miRPath v.3. Table A5: Comparison of studies investigating miRNAs from brain samples. Figure A1: Stratified nested cross-validation. Figure A2: Expression heatmap of miRNA signature. Figure A3: Bootstrapped ROC AUC scores. Figure A4: ROC AUC scores with 100 different fold splits. Figure A5: Presymptomatic subjects probability scores. Figure A6: Heatmap of the level of enrichment in KEGG pathways. Kmetzsch V, et al. J Neurol Neurosurg Psychiatry 2021; 92:485–493. doi: 10.1136/jnnp-2020-324647 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Appendix A1. Neuropsychological protocol The PREV-DEMALS cognitive evaluation included standardized neuropsychological tests to investigate all cognitive domains, and in particular frontal lobe functions. The scores were provided previously (Bertrand et al., 2018). Briefly, global cognitive efficiency was evaluated by means of Mini-Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS). Frontal executive functions were assessed with Frontal Assessment Battery (FAB), forward and backward digit spans, Trail Making Test part A and B (TMT-A and TMT-B), Wisconsin Card Sorting Test (WCST), and Symbol-Digit Modalities test.
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • Rapid Evolution of Mammalian X-Linked Testis-Expressed Homeobox Genes
    Copyright 2004 by the Genetics Society of America DOI: 10.1534/genetics.103.025072 Rapid Evolution of Mammalian X-Linked Testis-Expressed Homeobox Genes Xiaoxia Wang and Jianzhi Zhang1 Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, Michigan 48109 Manuscript received November 26, 2003 Accepted for publication February 11, 2004 ABSTRACT Homeobox genes encode transcription factors that function in various developmental processes and are usually evolutionarily conserved in their sequences. However, two X-chromosome-linked testis-expressed homeobox genes, one from rodents and the other from fruit flies, are known to evolve rapidly under positive Darwinian selection. Here we report yet another case, from primates. TGIFLX is an X-linked homeobox gene that originated by retroposition of the autosomal gene TGIF2, most likely in a common ancestor of rodents and primates. While TGIF2 is ubiquitously expressed, TGIFLX is exclusively expressed in adult testis. A comparison of the TGIFLX sequences among 16 anthropoid primates revealed a signifi- cantly higher rate of nonsynonymous nucleotide substitution (dN) than synonymous substitution (dS), strongly suggesting the action of positive selection. Although the high dN/dS ratio is most evident outside ف the homeobox, the homeobox has a dN/dS of 0.89 and includes two codons that are likely under selection. Furthermore, the rate of radical amino acid substitutions that alter amino acid charge is significantly greater than that of conservative substitutions, suggesting that the selection promotes diversity of the protein charge profile. More interestingly, an analysis of 64 orthologous homeobox genes from humans and mice shows substantially higher rates of amino acid substitution in X-linked testis-expressed genes than in other genes.
    [Show full text]
  • Figure S1. Basic Information of RNA-Seq Results. (A) Bar Plot of Reads Component for Each Sample
    Figure S1. Basic information of RNA-seq results. (A) Bar plot of reads component for each sample. (B) Dot plot shows the principal component analysis (PCA) of each sample. (C) Venn diagram of DEGs for three time points, the overlap part of the circles represents common differentially expressed genes between combinations. Figure S2. Scatter plot of DEGs for each time point. The X and Y axes represent the logarithmic value of gene expression. Red represents up-regulated DEG, blue represents down-regulated DEG, and gray represents non-DEG. Table S1. Primers used for quantitative real-time PCR analysis of DEGs. Gene Primer Sequence Forward 5’-CTACGAGTGGATGGTCAAGAGC-3’ FOXO1 Reverse 5’-CCAGTTCCTTCATTCTGCACACG-3’ Forward 5’-GACGTCCGGCATCAGAGAAA-3’ IRS2 Reverse 5’-TCCACGGCTAATCGTCACAG-3’ Forward 5’-CACAACCAGGACCTCACACC-3’ IRS1 Reverse 5’-CTTGGCACGATAGAGAGCGT-3’ Forward 5’-AGGATACCACTCCCAACAGACCT-3’ IL6 Reverse 5’-CAAGTGCATCATCGTTGTTCATAC-3’ Forward 5’-TCACGTTGTACGCAGCTACC-3’ CCL5 Reverse 5’-CAGTCCTCTTACAGCCTTTGG-3’ Forward 5’-CTGTGCAGCCGCAGTGCCTACC-3’ BMP7 Reverse 5’-ATCCCTCCCCACCCCACCATCT-3’ Forward 5’-CTCTCCCCCTCGACTTCTGA-3’ BCL2 Reverse 5’-AGTCACGCGGAACACTTGAT-3’ Forward 5’-CTGTCGAACACAGTGGTACCTG-3’ FGF7 Reverse 5’-CCAACTGCCACTGTCCTGATTTC-3’ Forward 5’-GGGAGCCAAAAGGGTCATCA-3’ GAPDH Reverse 5’-CGTGGACTGTGGTCATGAGT-3’ Supplementary material: Differentially expressed genes log2(SADS-CoV_12h/ Qvalue (SADS-CoV _12h/ Gene Symbol Control_12h) Control_12h) PTGER4 -1.03693 6.79E-04 TMEM72 -3.08132 3.66E-04 IFIT2 -1.02918 2.11E-07 FRAT2 -1.09282 4.66E-05
    [Show full text]
  • Efficient in Vitro Development of Photoreceptors from Human Pluripotent Stem Cells
    Dominican Scholar Graduate Master's Theses, Capstones, and Culminating Projects Student Scholarship 5-2015 Efficient In Vitro Development of Photoreceptors from Human Pluripotent Stem Cells Joseph C. Reynolds Dominican University of California https://doi.org/10.33015/dominican.edu/2015.bio.02 Survey: Let us know how this paper benefits you. Recommended Citation Reynolds, Joseph C., "Efficient Initr V o Development of Photoreceptors from Human Pluripotent Stem Cells" (2015). Graduate Master's Theses, Capstones, and Culminating Projects. 169. https://doi.org/10.33015/dominican.edu/2015.bio.02 This Master's Thesis is brought to you for free and open access by the Student Scholarship at Dominican Scholar. It has been accepted for inclusion in Graduate Master's Theses, Capstones, and Culminating Projects by an authorized administrator of Dominican Scholar. For more information, please contact [email protected]. Efficient In Vitro Development of Photoreceptors from Human Pluripotent Stem Cells A thesis submitted to the faculty of Dominican University of California & The Buck Institute of Aging in partial fulfillment of the requirements for the degree Master of Science in Biology By Joseph Reynolds San Rafael, California May, 2015 i Copyright by Joseph Reynolds 2015 ii CERTIFICATION OF APPROVAL I certify that I have read Efficient In Vitro Development of Photoreceptors from Human Pluripotent Stem Cells by Joseph Reynolds, and I approved this thesis to be submitted in partial fulfillment of the requirements for the degree: Master of Sciences in Biology at Dominican University of California and The Buck Institute for Research on Aging. Dr. Deepak Lamba Graduate Research Advisor Dr.
    [Show full text]
  • Eye Development in Sepia Officinalis Embryo: What the Uncommon Gene
    ORIGINAL RESEARCH published: 24 August 2017 doi: 10.3389/fphys.2017.00613 Eye Development in Sepia officinalis Embryo: What the Uncommon Gene Expression Profiles Tell Us about Eye Evolution Boudjema Imarazene 1, Aude Andouche 1, Yann Bassaglia 1, 2, Pascal-Jean Lopez 1 and Laure Bonnaud-Ponticelli 1* 1 UMR Biologie des Organismes et Ecosystèmes Aquatiques, Museum National d’Histoire Naturelle, Sorbonne Universités, Centre National de la Recherche Scientifique (CNRS 7208), Université Pierre et Marie Curie (UPMC), Université de Caen Normandie, Institut de Recherche Pour le Développement (IRD207), Université des Antilles, Paris, France, 2 Université Paris Est Créteil-Val de Marne, Paris, France In metazoans, there is a remarkable diversity of photosensitive structures; their shapes, physiology, optical properties, and development are different. To approach the evolution of photosensitive structures and visual function, cephalopods are particularly interesting organisms due to their most highly centralized nervous system and their camerular Edited by: eyes which constitute a convergence with those of vertebrates. The eye morphogenesis Frederike Diana Hanke, in numerous metazoans is controlled mainly by a conserved Retinal Determination University of Rostock, Germany Gene Network (RDGN) including pax, six, eya, and dac playing also key developmental Reviewed by: Shuichi Shigeno, roles in non-retinal structures and tissues of vertebrates and Drosophila. Here we have Stazione Zoologica Anton Dohrn, Italy identified and explored the role of Sof-dac, Sof-six1/2, Sof-eya in eye morphogenesis, Oleg Simakov, University of Vienna, Austria and nervous structures controlling the visual function in Sepia officinalis. We compare *Correspondence: that with the already shown expressions in eye development of Sof-otx and Sof-pax Laure Bonnaud-Ponticelli genes.
    [Show full text]