US 2016/0076021 A1 Stojanovic Et Al

Home , Carnosinemia, Hyperhomocysteinemia, Hyperlysinemia, Hypervalinemia

US 2016.0076021A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0076021 A1 Stojanovic et al. (43) Pub. Date: Mar. 17, 2016

(54) APTAMIER METHODS AND COMPOSITIONS (60) Provisional application No. 61/798,079, filed on Mar. 15, 2013. (71) Applicants: Milan N. Stojanovic, Fort Lee, NJ (US); Tilla S. Worgall, New York, NY (US); Kyung-Ae Yang, New York, NY (US) Publication Classification (51) Int. C. (72) Inventors: Milan N. Stojanovic, Fort Lee, NJ (US); CI2N 5/10 (2006.01) Tilla S. Worgall, New York, NY (US); GOIN33/53 (2006.01) Kyung-Ae Yang, New York, NY (US) CI2N 15/I 15 (2006.01) (73) Assignee: THE TRUSTEES OF COLUMBIA (52) U.S. C. UNIVERSITY IN THE CITY OF CPC ...... CI2N 15/1048 (2013.01); C12N 15/115 NEW YORK, NEW YORK, NY (US) (2013.01); G0IN33/5308 (2013.01); C12N 23 10/16 (2013.01); C12N 2320/13 (2013.01); (21) Appl. No.: 14/855,171 CI2N 2320/10 (2013.01) (22) Filed: Sep.15, 2015 (57) ABSTRACT Related U.S. Application Data Methods of selecting an aptamer that specifically binds to a (63) Continuation-in-part of application No. PCT/US14/ target molecule complexed with a derivatization agent. Also 29281, filed on Mar. 14, 2014. disclosed are specific aptamers and methods of use thereof. Patent Application Publication Mar. 17, 2016 Sheet 1 of 17 US 2016/0076021 A1

FIG. 1A - FIG. 1C

receptor target receptor target

w W, w s

& 8 ww.

---O. “. 8:XXX Y targe Aptamer

eaaceti organometallic receptors (metal, on eft, complexed to organic ligand, on right

8 *-*.s 8 k NY( ) 8 :g 8. 8: f G C & C YC. G1 3. A --- c.s d ( - || /> ciC A (s K d Ali d is C-C-GAG. A G-c G-d c.c.GAGA Gé & d; G-? N->->G G cT cT c-G d --G-G-c-f-c-f-c-de C- YPCR Amplification and Poo Regeneration V --- Patent Application Publication Mar. 17, 2016 Sheet 2 of 17 US 2016/0076021 A1

FIG. 1 D - FIG. 1E

1883$

CiA38isties asci roy: Stegesarakia.

Patent Application Publication Mar. 17, 2016 Sheet 3 of 17 US 2016/0076021 A1

FIG. 2

-"olo s x8. Cp*R*AA Cp*RhAA

isypii....- ... 3: ixitxii: :: *::::::ii Patent Application Publication Mar. 17, 2016 Sheet 4 of 17 US 2016/0076021 A1

FIG. 3A - FIG. 3F A. C. D. A. t-c -T c Sensor Sensitivity & A (tyrosine-Gprh sensor

: 3 800 -1 NH -C *. 600 -g -t 40000 B. -- -é 200 --- - 8 500 1s -6 tyrosine conc. ut

E. F. Sensor Selectivity (Tyrosine-CpRh sensor) 800 *000 x- Tyrosire re. Asis 80030 So exa. “*-. sitesA-2- ArqiAt aga :: - - Cyster,C. 60000 40000: t 3ycits ise - Lysine 4000 26 -- Relhorite x 8 ------Periyalarine 20038 8 tree- -s-- Metitionis:tryptophan ryosine healthy subject serum 0. 29 30 o 00 200 300 400 CpRh conc. (iv) a Dution times

Patent Application Publication Mar. 17, 2016 Sheet 5 of 17 US 2016/0076021 A1

FIG. 4A - FIG. 4F

A. B. C. NH C GC S is G T-c g-A cC-T A HN OH Ag a-G-G-A-d-G-G-A NH2 t cg A. Af G - C D. Sensor Sensitivity (Arginine-Cprh sensor) 100000

80000

s 6000

: 40000

20000

9 29 43 630 Arginine conc. (uN) E. F. Sensor Selectivity (Arginine-CpRh sensor) 0000 10000 r-8- Arginine r-- Cru: 80000 80000 -8-M-8 -- Garine -- Glycine o 60000 r0m. Hisine d 60000 l re- Methions:e : 2 - Ornithine 40000 40000 rar Tryptophar, 20000; -- tyrosipew 20000

0 3 2 40 80 O 100 200 360 400 CpRh conc. (uR) Dilution tinnes Patent Application Publication Mar. 17, 2016 Sheet 6 of 17 US 2016/0076021 A1

FIG. 4G - FIG. 4 G. H.

*: it cofactor

Kid 6 rv 3:N3:388x3:33

. J.

88: S388

88. 883 ic s : w 88: 23:38:

8 8 & 3& 8, 283 8 488 A88 8:38:::::::::3883 : &isio acid concertraict 388 Patent Application Publication Mar. 17, 2016 Sheet 7 of 17 US 2016/0076021 A1

FIG. 5A - FIG. 5F

-8. 3.

88:

& 83 3xxxxix. 888 &cs. 8:8 8. s&

& Enex58 is

3. S. i.e. ii. Patent Application Publication Mar. 17, 2016 Sheet 8 of 17 US 2016/0076021 A1

FIG. 5G - FIG. 5N

Sensor Selectivity Sensor Sensitivity (Giucose-oranic acid sensor) Glucose-Bororic acid sensor) 880 80s ------. ---8 60000- *w8. Wax. ex 60s - f --&--. Gligosa -x^ s 8 -- iticss me - 400 rise toss : 40 -- Scaric acxd only aw (Saactoss --&-- 8sics & Succuse 200 2 000 X - - - 20 3. 4. so 2 49 s Sugar conc. (m) Boronic acid conc. (uM)

- &

8 & s I. M-8

------s 8 4. s: & s Sixx xxx... x8 S&s six. 8 Patent Application Publication Mar. 17, 2016 Sheet 9 of 17 US 2016/0076021 A1

FIG. 6A - FIG. 6B

250 8. -* 2008 ^- *8* Glucose 15000 Y s8-: Goose ran Ficise . -- Ficose order Warfose '40000 g -- Aarose ---. Gaiacose --8e Gaciose

20 4. 6 O 5 53 surga conc. (m) Sugar conc. (ni) Patent Application Publication Mar. 17, 2016 Sheet 10 of 17 US 2016/0076021 A1

FIG. 7A - FIG. 7D

x-Y. Tyr g Y. v A --- grrrrris ; : Corpex-bidingR -. r p motif1 on which& aptamer ---8 - 8. is built &- &

Citruline C s'. Nor-Seitective e k Yx...' Cross-reactive - i rp SY.W --- : 8-- - 8 : : k a a. *k Patent Application Publication Mar. 17, 2016 Sheet 11 of 17 US 2016/0076021 A1

FIG. 7E - FIG. 7H

--- 3 8 8

Patent Application Publication Mar. 17, 2016 Sheet 12 of 17 US 2016/0076021 A1

FIG. 8A - FIG. 8C

sciective:

Patent Application Publication Mar. 17, 2016 Sheet 13 of 17 US 2016/0076021 A1

FIG. 9A - FIG. 9C

A B C

g s A & & s & s &

: AS: 3:38:::::8: $8388:w8 as

::::::&- . . ; as

3. : Patent Application Publication Mar. 17, 2016 Sheet 14 of 17 US 2016/0076021 A1

FIG. 1 OA - FIG. 1 OB

i.e. 8-8 8S 3. Sciectivey 3.fk Y------g-r-g-g-a-S.--- -A- -s -4 overie 'N'

W w

i.e. Seisective ower is:

& 8

: Y------. Patent Application Publication Mar. 17, 2016 Sheet 15 of 17 US 2016/0076021 A1

FIG. 11A - FIG. 11B

x PW

Patent Application Publication Mar. 17, 2016 Sheet 16 of 17 US 2016/0076021 A1

FIG. 12A - FIG. 12B

& &'s *... : A

60000

x Periyaarie rx tyrosie « tryptophare men glycine

& XS.S.S.S.S.S.S.S.SYYYYY."

o 1000 B Amino acid concentraton (u) Patent Application Publication Mar. 17, 2016 Sheet 17 of 17 US 2016/0076021 A1

FIG. 12C - FIG. 12D

" e-o-o: 8. x.

-- Peya are or ryptopian -- tyrosite

soo food * D Arrino acid concentration (iii) US 2016/0076021 A1 Mar. 17, 2016

APTAMER METHODS AND COMPOSITIONS isolating an eluted aptamer having high affinity for the target complex. In some embodiments, the method includes system CROSS-REFERENCE TO RELATED atic evolution of ligands by exponential enrichment APPLICATIONS (SELEX). 0001. The present application is a Continuation in Part of 0009. In some embodiments, the aptamer does not sub International Application No. PCT/US14/29281 filed 14 Mar. stantially bind the non-complexed target molecule. In some 2014, which claims the benefit of U.S. Provisional Applica embodiments, the aptamer does not substantially bind the tion Ser. No. 61/798,079 filed 15 Mar. 2013, each of which is non-complexed derivatization agent. In some embodiments, incorporated herein by reference in its entirety. the method includes counter-selecting an aptamer against the derivatization agent alone or against the target molecule STATEMENT REGARDING FEDERALLY alone. SPONSORED RESEARCH ORDEVELOPMENT 0010. In some embodiments, the oligonucleotide library includes randomly generated oligonucleotide sequences of a 0002 This invention was made with government support fixed length flanked by a constant 5' end and a constant 3' end, under grant numbers CBET-1033288 and CBET-1026592 the constant 5' end and the constant 3' end functioning as a awarded by National Science Foundation. The government primer. has certain rights in the invention. 0011. In some embodiments, the aptamer is a DNA, RNA, or XNA molecule. In some embodiments, the aptamer com MATERIAL INCORPORATED-BY-REFERENCE prises at least about 15 oligonucleotides up to about 100 0003. The Sequence Listing, which is a part of the present oligonucleotides. In some embodiments, the aptamer has an disclosure, includes a computer readable form comprising equilibrium constant (Kd) of about 1 pMup to about 10.0LM: nucleotide and/or amino acid sequences of the present inven about 1 pM up to about 1.0 uM; about 1 pMup to about 100 tion. The Subject matter of the Sequence Listing is incorpo nM; about 100 pM up to about 10.0 uM; about 100 pM up to rated herein by reference in its entirety. about 1.0 uM; about 100 pMup to about 100 nM; or about 1.0 nM up to about 10.0 uM; about 1.0 nM up to about 1.0 uM; BACKGROUND OF THE INVENTION about 1 nMup to about 200 nM; about 1.0 nMup to about 100 nM; about 500 nM up to about 10.0 uM; or about 500 nM up 0004 Systematic evolution of ligands by exponential to about 1.0 uM. enrichment (SELEX) is a combinatorial technique in molecu 0012. In some embodiments, the target molecule com lar biology for producing oligonucleotides of either single prises a small molecule, a protein, or a nucleic acid. In some stranded DNA or RNA that specifically bind to a target ligand embodiments, the target molecule comprises a small mol or ligands. Such conventional procedures can be based on ecule selected from the group consisting of a carbohydrate isolating binders from large libraries of random synthetic molecule, a fatty acid molecule, a steroid molecule, an amino oligonucleotides. This method can produce strong binding acid, a lead-like Small molecule, a drug-like Small molecule, aptamers to a desired ligand, but some ligands (e.g., glucose) and a derivative or a combination thereof. In some embodi have no known aptamers. This may occur because Such mol ments, the target molecule comprises a carbohydrate mol ecule has no chemically functional groups that will bind the ecule selected from the group consisting of glucose, dextrose, nucleotides. For example, there are no suitable aptamers (e.g., fructose, galactose, Sucrose, maltose, lactose, polyol, polyhy Small, practical to synthesize, with high affinity) against Sug dric alcohol, polyalcohol, glycitol, methanol, glycol, glyc arS Such as glucose, fatty acids or related long-chain lipids, or erol, erythritol, threitol, arabitol, xylitol, ribitol, mannitol, amino acids such as glycine or leucine. Sorbitol, galactitol, fucitol, iditol, inositol, Volemitol, isomalt, maltitol, lactitol, maltotriitol, maltotetraitol, and polyglyci SUMMARY OF THE INVENTION tol. 0005 Provided herein are methods and compositions for 0013. In some embodiments, the target molecule com determining amino acids in dilute-and-measure assays prises a fatty acid molecule selected from the group consist directly. ing of caprylic acid, capric acid, lauric acid, myristic acid, 0006 Among the various aspects of the present disclosure palmitic acid, Stearic acid, arachidic acid, behenic acid, ligno is the provision of methods and compositions for determining ceric acid, cerotic acid, myristoleic acid, palmitoleic acid, amino acids in dilute-and-measure assays directly from sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic bodily fluids through aptameric sensor? derivatization, com acid, linoelaidic acid, a-linolenic acid, arachidonic acid, plexation, and host-guest complex formation. eicosapentaenoic acid, erucic acid, and docosahexaenoic 0007. One aspect provides a method for isolating an acid, or derivatives thereof. In some embodiments, the target aptamer. In some embodiments, the method includes provid molecule comprises a steroid molecule selected from the ing a target molecule; providing a derivatization agent; con group consisting of a cholestane, a cholane, a pregnane, an tacting the target molecule and the derivatization agent to androstane, a gonane, an estrane, cholesterol, estradiol, test form a target complex; providing an oligonucleotide library osterone, progesterone, medrogestone, B-sitosterol, and dex comprising a plurality of aptamer candidates; contacting the amethasone. In some embodiment, the target molecule com target complex and the oligonucleotide library; and isolating prises a sphingolipid. Such as sphinganine, Sphingosine, an aptamer that binds to the target complex. phosphorylated sphingosine (e.g., sphingosine-1-phosphate), 0008. In some embodiments, isolating the aptamer that or methylated sphingosine, or a ceramide or sphingomyelin binds to the target complex comprises removal of aptamer or ganglioside or phosphosphingolipid. candidates that do not bind to the target complex. In some 0014. In some embodiments, the target molecule com embodiments, the method includes eluting the aptamer from prises an amino acid selected from the group consisting of the bound target complex under increasing stringency, and histidine, isoleucine, leucine, lysine, methionine, phenylala US 2016/0076021 A1 Mar. 17, 2016

nine, threonine, tryptophan, Valine, alanine, arginine, aspar lacBA06), or a sequence at least 80% (e.g., at least 85%, 90%, agine, aspartic acid, cysteine, glutamic acid, glutamine, gly 95%, 99%) identical thereto and binding galactose com cine, proline, serine, tyrosine, selenocysteine, pyrrolysine, plexed with a bis-boronic derivatization agent. lanthionine, 2-aminoisobutyric acid, dehydroalanine, 0021. In some embodiments, the aptamer has a nucleic N-formylmethionine, gamma-amino-butyric acid (GABA), acid sequence that includes SEQID NO: 29 (BAOnly01); or hydroxyproline, carnitine, ornithine, S-adenosylmethionine, SEQID NO:30 (BAOnly03), or a sequence at least 80% (e.g., citrulline, betaalanine (3-aminopropanoic acid), canavanine, at least 85%, 90%. 95%, 99%) identical thereto and binding mimosine, aspartame, 5-hydroxytryptophan, L-dihydrox boronic acid. yphenylalanine, and eflornithine. 0022. In some embodiments, the aptamer has a nucleic 0015. In some embodiments, the derivatization agent acid sequence that includes SEQID NO:31: SEQID NO:32 comprises a metal ion complex, a cyclic oligosaccharide, a (Arginine-Cp*Rh 02); SEQ ID NO:33 (Arginine-Cp*Rh boronic acid, or a resorcinol cyclic tetramer. In some embodi 03); SEQID NO:34 (Arginine-Cp*Rh 04); SEQID NO:35 ments, the target molecule comprises an amino acid and the (Arginine-Cp*Rh 05); or SEQID NO:36 (ARG01 Cp), or a derivatization agent comprises a metal ion complex. In some sequence at least 80% (e.g., at least 85%, 90%, 95%, 99%) embodiments, the target molecule comprises a fatty acid, a identical thereto and binding arginine complexed with a steroid, a hydrophobic lead-like compound, or a hydrophobic Cp*Rh(III) derivatization agent. drug-like compound and the derivatization agent comprises a 0023. In some embodiments, the aptamer has a nucleic cyclic oligosaccharide. In some embodiments, the target mol acid sequence that includes SEQ ID NO: 37 (AspaCp01); ecule comprises a carbohydrate and the derivatization agent SEQID NO:38 (AspaCp03); or SEQIDNO:39 (AspaCp04), comprises a boronic acid. or a sequence at least 80% (e.g., at least 85%, 90%. 95%, 0016. In some embodiments, the derivatization agent 99%) identical thereto and binding asparagine complexed comprises Cp*Rh(III) or a metal ion complex selected from with a Cp*Rh(III) derivatization agent. Ni(II), Cu(II), Zn(II), or Co(III) bound to a bidentate, triden 0024. In some embodiments, the aptamer has a nucleic tate, or tetradentate ligand. In some embodiments, the deriva acid sequence that includes SEQ ID NO: 40 (CIT30NO2 tization agent comprises a cyclic oligosaccharide, the cyclic Cp*Rh), or a sequence at least 80% (e.g., at least 85%, 90%, oligosaccharide comprising a cyclodextrin derivative. In 95%.99%) identical thereto and binding citrulline complexed Some embodiments, the derivatization agent comprises a with a Cp*Rh(III) derivatization agent. boronic acid, the boronic acid comprising a bis-boronic acid, 0025. In some embodiments, the aptamer has a nucleic an aromatic boronic acid, an amino boronic acid, or an aro acid sequence that includes SEQID NO. 41 (GlutaCp02); or matic amino boronic acid. SEQID NO: 42 (GlutaCp 15), or a sequence at least 80% (e.g., 0017. In some embodiments, the method includes isolat at least 85%, 90%. 95%, 99%) identical thereto and binding ing an aptamer that binds to the target complex and has a glutamine complexed with a Cp*Rh(III) derivatization agent. nucleic acid sequence comprising one or more unpaired 0026. In some embodiments, the aptamer has a nucleic nucleic acid bases when the aptamer is folded into a double acid sequence that includes SEQID NO:43: SEQID NO:44 Stranded configuration, wherein the one or more unpaired (Glycine-Cp*Rh 01); SEQ ID NO: 45 (Gly-Cp); SEQ ID nucleic acid bases form a binding pocket Such that the NO: 46 (Gly-Cp+1 bp); or SEQ ID NO: 47 (GLYHW aptamer can bind the derivatization agent and the target mol Cp*Rh()6), or a sequence at least 80% (e.g., at least 85%, ecule. 90%. 95%, 99%) identical thereto and binding glycine com 0018. Another aspect provides an aptamer. In some plexed with a Cp*Rh(III) derivatization agent. embodiments, the aptamer has a nucleic acid sequence that 0027. In some embodiments, the aptamer has a nucleic includes SEQ ID NO:3: SEQ ID NO: 4 (Glucose-BA 01): acid sequence that includes SEQID NO: 48 (Leucp01); SEQ SEQ ID NO: 5 (Glucose-BA 07); SEQID NO: 6 (Glucose ID NO: 49 (Leucp04); or SEQ ID NO: 50 (Leucp17), or a BA 08); SEQ ID NO: 7 (Glucose-BA 09): SEQ ID NO: 8 sequence at least 80% (e.g., at least 85%, 90%, 95%, 99%) (Glucose-BA 10); SEQIDNO: 9 (Glucose-BA 11); SEQID identical thereto and binding leucine complexed with a NO: 10 (Glucose-BA 12); SEQ ID NO: 11 (Glucose-BA Cp*Rh(III) derivatization agent. 13); SEQ ID NO: 12 (Glucose-BA14); SEQ ID NO: 13 0028. In some embodiments, the aptamer has a nucleic (Glucose-BA 15); SEQID NO: 14 (Glucose-BA 16); SEQ acid sequence that includes SEQ ID NO: 51 (LysCp05); or ID NO: 15 (Glucose-BA 17); SEQID NO: 16 (GLUBAO2); SEQ ID NO: 52 (LysCp*Rh18), or a sequence at least 80% SEQID NO: 17 (GLUBA09); SEQID NO: 18 (GLUBAO9 (e.g., at least 85%, 90%. 95%, 99%) identical thereto and M1); SEQ ID NO: 19 (GLUBA 17); SEQ ID NO: 20 binding lysine complexed with a Cp*Rh(III) derivatization (GLUBAN3W10); SEQ ID NO: 21 (GLUBAN3W11); or agent SEQID NO: 22 (GLUBAN3W19), or a sequence at least 80% 0029. In some embodiments, the aptamer has a nucleic (e.g., at least 85%, 90%. 95%, 99%) identical thereto and acid sequence that includes SEQ ID NO: 53 (PACp*Rh()1): binding glucose complexed with a bis-boronic derivatization SEQ ID NO. 54 (PACp*Rho2); SEQ ID NO. 55 agent. (PACp*RhO3); or SEQID NO:56 (HPheA104), or a sequence 0019. In some embodiments, the aptamer has a nucleic at least 80% (e.g., at least 85%, 90%. 95%, 99%) identical acid sequence that includes SEQ ID NO: 23 (FrucBAO2); thereto and binding phenylalanine complexed with a Cp*Rh SEQ ID NO: 24 (FrucBA02 M1); or SEQ ID NO: 25 (III) derivatization agent (Fruch3A05), or a sequence at least 80% (e.g., at least 85%, 0030. In some embodiments, the aptamer has a nucleic 90%. 95%, 99%) identical thereto and binding fructose com acid sequence that includes SEQID NO: 73 (Cu(II) Phe01): plexed with a bis-boronic derivatization agent. SEQID NO: 74 (Cu(II)-Phel0); or SEQID NO: 75 (Cu(II)- 0020. In some embodiments, the aptamer has a nucleic Phe 10 49 nt), or a sequence at least 80% (e.g., at least 85%, acid sequence that includes SEQ ID NO: 26 (GalacEA05); 90%. 95%, 99%) identical thereto and binding phenylalanine SEQ ID NO: 27 (GalacBA01); or SEQ ID NO: 28 (Ga complexed with a Cu(II) derivatization agent. US 2016/0076021 A1 Mar. 17, 2016

0031. In some embodiments, the aptamer has a nucleic 0038 FIG. 1A is an illustration of a generic scheme of acid sequence that includes SEQID NO: 57 (HTrp03), or a complexation between a receptor (e.g., organometallic or sequence at least 80% (e.g., at least 85%, 90%, 95%, 99%) synthetic receptor) and its target (e.g., Small molecules tar identical thereto and binding tryptophan complexed with a get). FIG. 1B is an illustration of a generic Scheme of com Cp*Rh(III) derivatization agent; plexation between a receptor (e.g., organometallic receptor 0032. In some embodiments, the aptamer has a nucleic including metal and organic ligand) and its target (e.g., DNA), acid sequence that includes SEQID NO: 57 (HTrp03), or a with further binding of enhanced aptamer. FIG. 1C is an sequence at least 80% (e.g., at least 85%, 90%, 95%, 99%) illustration of the selection, where the targeting receptor is in identical thereto and binding tryptophan complexed with a the presence of a large excess of target. FIG. 1D is similar to Cp*Rh(III) derivatization agent; or FIG. 1A with 30N. FIG. 1E shows equilibrium relationship 0033. In some embodiments, the aptamer has a nucleic between receptor and target. acid sequence that includes SEQID NO:58: SEQID NO:59 0039 FIG. 2 is an illustration of the mechanism for a (Tyrosine-Cp*Rh 02); SEQ ID NO: 60 (Tyrosine-Cp*Rh Cp*Rh(III) complex used to in situ derivatize all bi- and 03); SEQID NO: 61 (Tyrosine-Cp*Rh 04); SEQID NO: 62 tri-dentate ligands. Such as amino acids, amino Sugars, pep (Tyrosine-Cp*Rh 05); SEQ ID NO: 63 (Tyrosine-Cp*Rh tides, diols. Also illustrated is Cp*Rh(III) complex binding to 06); SEQID NO: 64 (Tyrosine-Cp*Rh 07); SEQID NO: 65 arginine. (Tyrosine-Cp*Rh 08); SEQ ID NO: 66 (Tyrosine-Cp*Rh 0040 FIG. 3A-FIG. 3F is a series of chemical structures 09); SEQID NO: 67 (Tyrosine-Cp*Rh 10); SEQID NO: 68 and line and scatter plots showing the detection of tyrosine in (Tyrosine-Cp*Rh 11); SEQ ID NO: 69 (Tyrosine-Cp*Rh dilute-and-measure assay at clinically relevant concentra 12); SEQID NO: 70 (Tyrosine-Cp*Rh 13): SEQID NO: 71 tions. FIG. 3A is a chemical structure of tyrosine. FIG. 3B is (Tyr-Cp*Rh (38nt)); or SEQ ID NO: 72 (HTyrs07), or a an illustration of a motif isolated that binds to Cp*Rh(III) sequence at least 80% (e.g., at least 85%, 90%, 95%, 99%) *Tyr, with conserved bases in bold. FIG. 3C is an illustration identical thereto and binding tyrosine complexed with a of the structure of sensors (where F represents fluoresceinand Cp*Rh(III) derivatization agent. Drepresents dabcyl) used to obtain results in FIG. 3D-F. FIG. 0034. In some embodiments, the aptamer has a nucleic 3D is a line and scatter plot of a sensor responding to concen acid sequence that includes one or more unpaired nucleic acid trations of tyrosine in the presence of Cp*Rh(III) at constant bases when the aptamer is folded into a double stranded 10 uM concentration. FIG.3E is a line and scatter plot show configuration. In some embodiments, the one or more ing a sensor is selective for tyrosine over various other amino unpaired nucleic acid bases form a binding pocket such that acids in the presence of 50 uMCp*Rh(III) and aptamersen the aptamer can bind a derivatization agent and a target mol sors. FIG.3F is a line and scatter plot of the sensor in serially ecule. In some embodiments, the aptamer has a nucleic acid diluted 1 mM tyrosine solution (blue), serum spiked with 1 sequence that includes SEQID NO: 71 (Tyr-Cp*Rh(38nt)); mM tyrosine, then diluted (red), and healthy, fasting subject SEQID NO:53 (PACp*Rho1); SEQIDNO:40 (CIT30NO2 serum (black). A 10 uM concentration of Cp*Rh(III) was Cp*Rh); SEQ ID NO: 41 (GlutaCp02); SEQ ID NO: 52 added to all samples to derivatize all bi- and tri-dentate (LysCp*Rh18); SEQID NO: 51 (LysCp05); SEQID NO: 75 ligands. At certain dilutions the difference between spiked (Cu(II)-Phel0 49 nt): SEQ ID NO:36 (ARG01 Cp); SEQ and non-spiked serums were observed, despite presence of all ID NO: 57 (HTrp03 aptamer); SEQ ID NO: 45 (Gly-Cp); interferences. The data shows that tyrosine can be detected in SEQ ID NO: 38 (AspaCp03); SEQ ID NO: 47 (GLYHW a dilute-and-measure assay. Cp*Rho6); SEQ ID NO: 50 (Leucp17); SEQ ID NO: 53 0041 FIG. 4A-FIG. 4J is a series of chemical structures (PACp*RhO1): SEQID NO: 73 (Cu(II) Phe01); or SEQ ID and line and scatter plots showing the detection of arginine in NO: 56 (HPheA104); or a sequence at least 80% (e.g., at least dilute-and-measure assay at clinically relevant concentra 85%.90%, 95%.99%) identical thereto and binding the target tions. FIG. 4A is a chemical structure of arginine. FIG. 4B is molecule complexed with the derivatization agent. an illustration of a motif isolated that binds to Cp*Rh(III) 0035 Another aspect provides a method of detecting a * Arg, with conserved bases in bold. FIG. 4C is an illustration target molecule in a sample. In some embodiments, the of the structure of sensors (where F represents fluoresceinand method includes (a) providing a sample; (b) contacting the Drepresents dabcyl) used to obtain results in FIG. 4D-F. FIG. biological sample and a derivatization agent to form a target 4D is a line and scatter plot of a sensor responding to concen complex comprising the derivatization agent and a target trations of arginine in the presence of Cp*Rh(III) at constant molecule when the target molecule is present in the sample: 50 uM concentration. FIG. 4E is a line and scatter plot show (c) contacting the biological sample and (i) an aptamer ing a sensor is selective for arginine over various other amino selected according to methods described above or (ii) an acids in the presence of 50 uM Cp(Rh(III) and aptameric aptamer described above to form an aptamer target complex sensor. FIG. 4F is a line and scatter plot of the sensor in when the target complex is present in the sample; and (d) serially diluted 1 mMarginine solution (blue), serum spiked detecting the aptamer target complex when present in the with 1 mMarginine, then diluted (red), and healthy, fasting sample. subject serum (black). A 10 uM concentration of Cp*Rh(III) 0036. Other objects and features will be in part apparent was added to all samples to derivatize all bi- and tri-dentate and in part pointed out hereinafter. ligands. At certain dilutions the difference between spiked and non-spiked serums were observed, despite presence of all DESCRIPTION OF THE DRAWINGS interferences. The data shows that arginine can be detected in a dilute-and-measure assay at clinically relevant concentra 0037 Those of skill in the art will understand that the tions. FIG. 4G shows a motif isolated that binds to Cp*Rh drawings, described below, are for illustrative purposes only. (III)*Phe with Kd of about 60 nm. FIG. 4H shows a motif that The drawings are not intended to limit the scope of the present binds Phe (i.e., without cofactor) with Kd of about 6 uM. FIG. teachings in any way. 4I shows RFU as a function of amino acid (Phe, Trp, Tyr) US 2016/0076021 A1 Mar. 17, 2016

concentration for the motif of FIG. 4G. FIG. 4J shows RFU as target molecule. A Cp*Rh(III) can bind more than one site, a function of amino acid (Phe) concentration for the motif of Such as additional Gs that can be targeted. FIG 4H. 0048 FIG. 11A-FIG. 11B is a chemical structure of 0.042 FIG. 5A is an illustration of the mechanism of the PACp*Rho1 aptamer (SEQID NO: 53) reactive for Phe and complexation of Shinkai's sensor, an example of boronic cross-reactive for Trp and a scatter and line plot showing use acid-based sensing of glucose (or other Sugars), with glucose thereof. FIG. 11A depicts the structure of an aptamer reactive (presented as a sphere). FIG. 5B is an illustration of an for Phe and cross-reactive for Trp. FIG. 11B is a scatter and example of anaptamer that binds only to glucose. FIG.5C is line plot showingaptamer detected Phe concentration (LM) as an illustration of the structure of sensor based on the aptamer a function of time (hr) in serum samples from capillary blood in FIG. 5B (where F represents fluorescein and D represents of a female subject (TPW) and a male subject (MNS) having dabcyl). FIG.5D is a line and scatterplot showing response of an oral load of 100 mg/kg at time Zero. the sensor of FIG.5C to BA only or BA-Glu. FIG.5E is a line 0049 FIG. 12A-FIG. 12D is a series of aptamer structures and scatter plot showing response of the sensor of FIG.5C to and scatter and line plots showing use thereof. FIG. 12A Glu only or BA-Glu FIG.5F is a plot showing the response of shows Cu(II) Phe01 aptamer (SEQ ID NO: 73) reactive for the sensor of FIG. 5C binding to glucose at 520 correlated Phe. FIG. 12B shows a scatter and line plot for RFU as a with the response of the same sensor binding to glucose at 427 function of amino acid concentration (LM) for phenylanine, nm. FIG.5G is a line and scatter plot showing the response of tyrosine, tryptophan, and glycine using the aptamer of FIG. the sensor from FIG. 5C to glucose and other sugars, in the 12A, where Phe specificity is demonstrated. FIG. 12C shows presence of 50 LM Shinkai's sensor. FIG. 5H is a line and HPheA104 aptamer (SEQ ID NO. 56) reactive for Phe. FIG. scatter plot showing the response to boronic acid sensor 12D shows a scatter and line plot for RFU as a function of (Shinkai's) in the presence and absence of 40 mM glucose. amino acid concentration (LM) for phenylanine, tryptophan, FIG.5I illustrates an aptamer sensor, which is shown specific and tyrosine, using the aptamer of FIG. 12C, where Phe for glucose in FIG. 5L. FIG.5J illustrates an aptamer sensor, specificity is demonstrated. which is shown specific for fructose in FIG.5M. FIG. 5K illustrates an aptamer sensor, which is shown specific for DETAILED DESCRIPTION OF THE INVENTION galactose in FIG. 5.N. 0050. The present disclosure is based, at least in part, on 0043 FIG. 6A-FIG. 6B are line and scatter plot compari the discovery of aptamers against boronic acid-Sugar com sons of selectivity and sensitivity of a (Shinka's) boronic acid plexes and amino acid-Cp*Rh(III) complexes. Described sensor with and without aptamer. herein is in situ derivatization SELEX for isolation of high 0044 FIG. 7A-FIG.7H are a series of chemical structures affinity and high-specificity, low complexity aptameric sen showing aptamers having at least one unpaired base forming sors (see Examples). Thus is provided an ability to detect in a pocket that binds a metal complex or an amino acid target Solution-phase difficult to measure analytes. molecule. FIG. 7A shows a metal complex/ion binding motif 0051. According to approaches described herein, one can for an aptamer that binds nucleic acids. FIG. 7B shows Tyr perform in situ derivatization of challenging targets with selective aptamer Tyr-Cp*Rh(38nt) (SEQID NO: 71). FIG. known organic receptors (e.g., a metal ion complex, Such as 7C shows Phe cross-reactive Trpaptamer PACp*Rho1 (SEQ Cp*Rh(III), for amino acids; cyclodextrin derivatives for ID NO:53). FIG. 7D shows citrulline non-selective aptamer fatty acids; boronic acids for glucose or other Sugars) and CIT30NO2. Cp*Rh (SEQ ID NO: 40). FIG. 7E shows Gln perform selection that can target specifically complexes with selective aptamer GlutaCp02 (SEQ ID NO: 41). FIG. 7F these receptors, yielding high-affinity aptamers. shows Lys non-selective aptamer LysCp*Rh18 (SEQID NO: 0.052 For example, a mixture of nucleic acid molecules 52). FIG.7G shows Lys selective aptamer LysCp05 (SEQID (e.g., candidate aptamers, such as a library of DNA mol NO: 51). FIG. 7H shows Phe cross-reactive Trp aptamer ecules) are allowed to bind a target molecule (e.g., a protein, Cu(II)-Phel0 49 nt (SEQID NO: 75). peptide, or Small molecule displaying nucleophilic groups) in 004.5 FIG. 8A-FIG. 8C is a series of chemical structures the presence of a derivatization agent, such as an organome showingaptamers having at least two unpaired bases forming tallic reagent (e.g., modified Cp*Rh or Pt complexes), where the derivatization agent binds both a nucleic acid molecule a pocket that binds a metal complex or an amino acid target and the target molecule. Tight multicomponent complexes molecule. FIG. 8A shows the binding motif for a plurality of can be isolated and amplified through standard protocols unpaired bases. FIG. 8B shows Arg selective ARG01 Cp (e.g., SELEX). The identified aptamer can be useful as a aptamer (SEQ ID NO:36). FIG. 8C shows Trp selective tightly binding analytical reagent. HTrp03 aptamer (SEQ ID NO:57). 0053 Accordingly, both derivatization agents or targets 0046 FIG.9A-FIG.9C is a series of chemical structures themselves can be selected against during selection of the showing aptamers having a plurality of unpaired bases form complex. These procedures can yield aptamers against chal ing a pocket that binds a metal complex or an amino acid lenging targets where conventional approaches would likely target molecule. FIG. 9A shows Gly selective aptamer Gly fail. Cp sensor (SEQ ID NO: 45). FIG. 9B shows Asn selective 0054 Conventional approaches, such as systematic evo aptamer AspaCp03 (SEQ ID NO:38). FIG. 9C shows Gly lution of ligands by exponential enrichment (SELEX), are not non-specific aptamer GLYHW-Cp*Rh()6 (SEQID NO: 47). always effective against challenging targets having no chemi 0047 FIG. 10A-FIG. 10B is a series of chemical struc cally functional groups that will bind nucleotides. The present tures showing multiple folding configurations of LeuCp17 disclosure can provide for functional aptamers for challeng aptamer (SEQID NO: 50) selective for Leu over Ile having a ing targets. Aptamers selected according to the present dis plurality of unpaired bases forming a plurality of pockets closure can be obtained by complexing in situa target ligand (compare FIG. 10A and FIG. 10B), one of more of which with various metal ions, Sugars, or acids. Such an approach pockets can bind a metal complex and also an amino acid allows for Successful production of aptamers for challenging US 2016/0076021 A1 Mar. 17, 2016 targets, e.g., glucose or amino acids, as described herein. tization agent (e.g., Cp*Rh(III)) can be complexed with gly Compositions and methods described herein can be useful, cine to select anaptamerthereto. As another example, a metal for example, in clinical chemistry or for control of nucleic ion complex derivatization agent (e.g., Cp*Rh(III)) can be acid-based nanostructures. complexed with tyrosine to select an aptamer thereto. As 0055. In some embodiments, a nucleic acid molecule (e.g., another example, a metal ion derivatization agent (e.g., DNA) in the presence of organometallic compound is coor Cu(II)) can be complexed with phenylalanine to select an dinated by metal, while organic components stick out. If a aptamer thereto. library of DNA molecules is present, members will form 0064. For example, a derivatization agent can include or many complexes in equilibrium. Organic components of be Ni(II), Cu(II), Zn(II), Co(III), Pt or most any other metal, organometallic complex, remaining Valences (coordination optionally with a bidentate, tridentate, or tetradentate ligand sites) on metal, and nucleic acid molecule (e.g., DNA) all can binding to it (e.g., Co(II) with tetradentate ligand) (see gen then form a complex with target. Such a complex can be erally, Chinet al. 1999 Nature 401(6750), 254-257; Job et al. isolated in conventional ways (e.g., traditional or solution 1974 J. Am. Chem. Soc. 96, 809–819: Yamaguchi et al. 1980 phase SELEX). A result can be a nucleic acid aptamer (e.g., Inorg. Chem. 19, 2010-2016; Fenton et al. 1995 Inorg. Chim. DNA) that is enhanced in binding by organometallic compo Acta 236, 109-115; Greenstein et al. 1996 Chemistry of the nents. Two or more organometallic components can bind in Amino Acids Vol. 1, 594, Wiley and Sons, New York). For an aptamer, and many different complexes can be used at the example, a derivatization agent can be Ni(II), Cu(II), Zn(II), same time in mixtures. Co(III), or most any other metal, with a bidentate, tridentate, 0056 Aptamers, or oligonucleotide-based receptors as or tetradentate ligand binding to it. As another example, a described herein, provide unique advantages as analytical metal ion derivatization agent can be Cu(II). As another tools. For example, anaptamer can be incorporated in simple example, a derivatization agent can include a metalion com and rapid mix-and-measure assays or readily attached to a plex comprising an alkali metal (e.g., lithium, Sodium, potas Surface e.g., Suitable for integration in biosensors. sium, rubidium, cesium, or francium), an alkaline earth metal 0057 The present disclosure provides the ability to deter (e.g., beryllium, magnesium, calcium, strontium, barium, or mine amino acids in dilute-and-measure assay directly from radium), a transition metal (e.g., Zinc, molybdenum, cad bodily fluids through aptameric sensortin-situ derivatization mium, Scandium, titanium, Vanadium, chromium, manga protocol. Some embodiments provide methods for determi nese, iron, cobalt, nickel, copper, yttrium, Zirconium, nio nation of amino acids or other bi- and tri-dentate analytes in bium, technetium, ruthenium, rhodium, palladium, silver, dilute-and-measure assays using in situ derivatization with hafnium, tantalum, tungsten, rhenium, osmium, iridium, organometallic reagents and aptameric sensors specific for platinum, gold, mercury, rutherfordium, dubnium, particular derivatives. Prior to the present disclosure, there seaborgium, bohrium, hassium, or copernicium), a post-tran was thought to be no generally available and easy to use sition metal (e.g., aluminum, gallium, indium, tin, thallium, specific, quantitatively Suitable assay. Conventionally, amino lead, bismuth, or polonium), a lanthanide metal (e.g., lantha acids were determined in complex multi-step procedures num, cerium, praseodymium, neodymium, promethium, requiring specialized instrumentation. The present disclosure Samarium, europium, gadolinium, terbium, dysprosium, hol can overcome these limitations and others, such as interfer mium, erbium, thulium, ytterbium, or lutetium), an actinide ences, associated with conventional approaches. metal (e.g., actinium, thorium, protactinium, uranium, nep 0058 Approaches described herein can introduce com tunium, plutonium, americium, curium, berkelium, cali plexity to a target molecule and specifically target the result fornium, einsteinium, fermium, mendelevium, nobelium, or ing derivatized target to select a small to medium aptamer, as lawrencium), or another type of metal (e.g., meitnerium, opposed to selecting a large, complex aptamer against a darmstadtium, roentgenium, ununtrium, flerovium, ununpen simple target or pre-incorporating (i.e., co-opting) a cofactor tium, livermorium, germanium, arsenic, antimony, or asta (e.g., an organic receptor) inside the aptamer (which may not tine). The metalion can be bound to abidentate, tridentate, or yield increase, and would likely lead to a decrease, of sensi tetradentate ligand to form a derivatization agent. Ligands tivity of original receptor because binding of aptamer to Suitable for binding a metal are known in the art. An exem receptor might compete with binding of ligand to receptor). plary ligand is a cyclopentadienyl or a pentamethylcyclopen 0059) Derivatization Agent tadienyl. 0060. As described herein, a derivatization agent can be 0065 Organic or Organometallic Component. combined with a target molecule to form in situ a complex 0066. A derivatization agent can include an organic or capable of binding an aptamer. In some embodiments, an organometallic component. The metal ion can be bound to a aptamer can bind two or more derivatization agents (see e.g., bidentate, tridentate, or tetradentate ligand to form a deriva FIG. 1F). In some embodiments, two or more derivatization tization agent. Ligands Suitable forbinding a metal are known agents and resulting complexes can be included in a mixture. in the art. An exemplary ligand is a cyclopentadienyl (Cp) or The complex can be stable or in equilibrium with free deriva a pentamethylcyclopentadienyl (Cp*). The pentamethylcy tization agent and target analyte. clopentadienyl ligand (Cp) is a ligand in organometallic 0061. A derivatization agent can be a metallic, organic, or compounds arising from the binding of the five ring-carbon an organometallic receptor. For example, a derivatization atoms in CMes-, or Cp*-, to metals. agent can be a metalion, metalion complex, a cyclic oligosac 0067 For example, a metal ion complex derivatization charide, or a boronic acid. agent can be Cp*-X, where X is a metal (e.g., Rh). For 0062 Metal ion or metal ion complex. example, a metal ion complex derivatization agent can be 0063 A derivatization agent can include a metal ion or Cp*Rh(III) (see e.g., Example 2: Example 3). metalion complex. A metalion or metalion complex deriva 0068. As another example, a metal ion complex derivati tization agent can be complexed with an amino acid to select zation agent can be Cp-X, where X is a metal and CP is anaptamer thereto. For example, a metalion complex deriva cyclopentadienyl or a Cp derivative. US 2016/0076021 A1 Mar. 17, 2016

0069. As another example, a metal ion complex derivati clodextrin, a B-cyclodextrin, or a Y-cyclodextrin. For Zation agent can be an Fp2 or Fp2-X (e.g., where Fp2 is a fip example, a derivatization agent can be an O-cyclodextrin, a dimer, cyclopentadienyliron dicarbonyl dimer, CpFe(CO) B-cyclodextrin, or a Y-cyclodextrin having on either or both 4). rims one or hydroxyl groups displayed. Availability of mul 0070 Linker. tiple reactive hydroxyl groups can increase functionality of a 0071. A derivatization agent can have a linker between the cyclodextrin. Functional groups used to derivatize hydroxyl metal ion and the organic component. A linker can be, for groups can contain basic groups, such as imidazoles, example, an organic molecule with at least one end having a pyridines, metal ion complexes, acidic groups, such as car functional group. Various linker groups are known in the art; boxylic acids, Sulfates, or photoreactive groups. A cyclic oli except as otherwise specified, compositions described herein gosaccharide derivatization agent can be complexed with, for can include state of the art linker groups. For example, a state example, a fatty acid, steroid, or hydrophobic drug to select an of the art linker molecule can be any such molecule capable of coupling a metal ion and an organic component. A linker aptamerthereto. In some embodiments, a cyclic oligosaccha group can include one or more of the following exemplary ride derivatization agent can be complexed with a fatty acid to functional groups: carboxylic acid or carboxylate groups select an aptamer thereto. (e.g., Fmoc-protected-2,3-diaminopropanoic acid, ascorbic 0.077 Organoborane. acid), silane linkers (e.g., aminopropyltrimethoxysilane (APTMS)), or dopamine. A linker group, such as carboxylic 0078. A derivatization agent can be an organoborane. A acid, dopamine, or silane (or another state of the art linker derivatization agent can be a boronic acid. Aboronic acid is group), can provide missing coordination sites (e.g., two oxy understood to be an alkyl or aryl substituted boric acid con gen coordination sites) for binding. Exemplary linking taining a carbon-boron bond and is understood to belong to groups include, but are not limited to, carboxylic acid or the larger class of organoboranes. In some embodiments, a carboxylate groups, Fmoc-protected-2,3-diaminopropanoic boronic acid can form reversible covalent complexes with acid, ascorbic acid, silane linkers, aminopropyltrimethoxysi molecules Such as Sugars, amino acids, hydroxamic acids, lane (APTMS), or dopamine. Other linkers can include etc., or molecules with Lewis base donor functional groups alkane, alkene, or alkyne linkers of various size (e.g., n=2,3, Such as alcohol, amine, or carboxylate. The chemistry 4, 5, 6, 7, 8, 9, or 10, or more). A linker can include chemical involved in binding a boronic acid to a target molecule. Such motifs such as disulfides, hydrazones, or peptides (e.g., cleav as a saccharide, is understood in the art and can be adapted able), or thioethers (e.g., noncleavable). A linker can include accordingly for use described herein (see generally, Fang et maleimide, or Sulfhydryl reactive groups, or Succinimidyl al. 2004J Fluorescence 14(5), 481-489). esterS. 0072 For example, a metal ion complex derivatization 0079 Exemplary boronic acids suitable as a derivatization agent can be Cp*-CH2X, where X is a metal (e.g., a metal agent include, but are not limited to an aromatic boronic acid described above) and n is at least 1 (e.g., 2, 3, 4, 5, 6, 7, 8, 9. oramino boronic acid. An aromatic boronic acid can includes 10, or more). —CH2 linkers of various lengths can be used. As phenyl, naphty, anthrylboronic acids, pyrenyl, or any other another example, a metal ion complex derivatization agent aromatic group. Aboronic acid or an aromatic boronic acid can be Cp*-CH2CH2X, where X is a metal (e.g., a metal can further include an amino group. For example, an aromatic described above). boronic acid can have an amino group is positioned in a 0073 Cyclic Oligosaccharide. 1.5-relationship with the boronic acid. 0.074. A derivatization agent can be a cyclic oligosaccha ride. A derivatization agent can be a cyclodextrin or cyclo B(OH)2 dextrin derivative. A derivatization agent can be a cyclic oligosaccharide with hydrophobic cavities. For example, a B(OH)2 derivatization agent can be an O-cyclodextrin (i.e., a six membered Sugar ring molecule), a B-cyclodextrin (i.e., a seven-membered Sugar ring molecule), or a Y-cyclodextrin R O (i.e., an eight-membered Sugar ring molecule), or a derivative N thereof. A derivatization agent can be a cyclodextrin deriva /:B tive. For example, a derivatization agent can be an O-cyclo R O dextrin, a B-cyclodextrin, or a Y-cyclodextrin having on either NN or both rims one or hydroxyl groups derivatized with other groups. Availability of multiple reactive hydroxyl groups can be used to increase functionality of a cyclodextrin by substi tuting them (i.e., derivatizing them). A 0075. A cyclodextrin or cyclodextrin derivative can have hy at least 5 glucopyranoside (e.g., C.-D-glucopyranoside) units hy linked 1, 4. For example, a cyclodextrin or cyclodextrin derivative can have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, A derivatization agent comprising a boronic acid can include 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or more than one boronic acid group or an aromatic boronic acid more, glucopyranoside units. can include more than one boronic acid group or more than 0076 A derivatization agent can be a cyclodextrin deriva one aromatic group. For example, two aromatic acids can be tive. A cyclodextrin derivative can be, for example, an O-cy connected via a linker or boronic, e.g., as depicted below. US 2016/0076021 A1 Mar. 17, 2016

another example, a bis-boronic receptor can be a derivatiza tion agent complexed with glucose to select an aptamer thereto (see e.g., Example 4, FIG. 5). 0083 Target Molecule I0084 As disclosed herein, a target molecule can be com bined with a derivatization agent to form a complex, and an aptamer can be raised against Such complex. A target mol ecule can be, for example, a small molecule, a protein, or a nucleic acid, or structures or compositions containing any of these. For example, a target molecule can be a protein, pep tide, or Small molecule displaying one or more nucleophilic groups. As another example, a target molecule can be a small molecule selected from a carbohydrate molecule, a fatty acid molecule, an amino acid, or a derivative or a combination thereof. 0080. An exemplary boronic acid derivatization agent can I0085. A target molecule can occur in solution or attached be: to a Substrate. For example, a target molecule can be a Sugar molecule on the surface of a cell. I0086 Amino Acid Target Molecule. OH I0087. A target molecule can be an amino acid oran analog B or derivative thereof. Shown herein is analysis of specific HO1 amino acids (e.g., tyrosine and arginine) by in situ derivati zation with Cp*Rh(III) and an aptamer measuring the com plex formation (see e.g., Example 2: Example 3). For example, an amino acid target molecule can be complexed N with a metalion derivatization agent (e.g., Cp*Rh(III)) and an 1. aptamer can be selected against Such complex. Results showed an unexpected extremely high affinity selection. Such high affinity is sufficient for serum analysis and demonstrates a novel and unexpected dilute-and-measure assay of amino acids. 0088 An amino acid is understood as an organic com pound having amine (-NH2) and carboxylic acid N1 (—COOH) functional groups, along with a side-chain spe cific to each amino acid. A target molecule can be any of the about 500 known amino acids (see generally, Wet al. 1983 Chem. Int. Ed. Engl. 22(22), 816-828). A target molecule can OH be an alpha- (Cl-), beta- (B-), gamma- (Y-) or delta- (Ö-) amino acid. A target molecule can be an aliphatic, acyclic, aromatic, r hydroxyl-containing, or Sulfur-containing amino acid. An OH amino acid analog or derivative can be, for example, an amino alcohol or an aminophosphonic acid. 0081. The above exemplary boronic acid derivatization I0089. A target molecule can be a proteinogenic amino agent can interact with a Sugar, such as glucose, as follows: acid. For example, a target molecule can be an amino acid selected from histidine, isoleucine, leucine, lysine, methion ine, phenylalanine, threonine, tryptophan, valine, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, selenocysteine, or pyrrolysine. As another example, a target molecule can be tyrosine (see e.g., Example 2). As another example, a target molecule can be arginine (see e.g., Example 3). 0090. A target molecule can be an essential amino acid, Such as histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, or valine. 0091 Atarget molecule can be a non-essential amino acid, Such as alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, ornithine, proline, serine, or tyrosine. 0092 Atarget molecule can be a non-proteinogenic amino 0082. As described herein, a boronic acid derivatization acid. For example, a target molecule can be an amino acid agent can be complexed with a Sugar to select an aptamer selected from lanthionine, 2-aminoisobutyric acid, dehy thereto. For example, a boronic acid derivatization agent can droalanine, N-formylmethionine, gamma-amino-butyric be complexed with glucose to select an aptamer thereto. As acid (GABA), hydroxyproline, carnitine, ornithine, S-adeno US 2016/0076021 A1 Mar. 17, 2016

Sylmethionine, citrulline, beta alanine (3-aminopropanoic aptamer raised against a complex of erythritol complexed acid), canavanine, mimosine, or aspartame. with a derivatization agent can be used to detect erythritol 0093. A target molecule can be an amino acid derivative, excreted in urine of a Subject. Such as 5-hydroxytryptophan, L-dihydroxyphenylalanine, or 0100 Lipid Target Molecule. eflornithine. 0101. As described herein, an aptamer can be raised 0094. In some embodiments, the target molecule can bean against a lipid target molecule. Such as fatty acids, Steroids, amino acid and the corresponding binding aptamer has a sphingolipids, or phospholipids complexed with a derivati nucleic acid sequence with one or more unpaired bases Such Zation agent. that a metal complex can bind a pocket formed by the one or 0102 For example, anaptamer can be raised againstafatty more unpaired bases and also binds the targetamino acid. For acid molecule complexed with a cyclodextrin derivative example, the following formulas depict a binding site formed derivatization agent. A fatty acid is understood as a carboxylic by the G-A mismatch Surrounded by binding base pairs (e.g., acid with a longaliphatic tail (chain), which is either Saturated G-C, G-T, A-T, A-U or analogs). or unsaturated. A target molecule can be a naturally-occurring fatty acid molecule. A target molecule can be a naturally occurring fatty acid molecule having at least about 4 up to about 28 carbon atoms. A target molecule can be a fatty acid molecule derived from a monoglyceride, diglyceride, triglyc eride, phospholipid, Sphingolipid, or ganglioside. A target molecule can be a free fatty acid molecule. M---N n 1 0103) A target molecule can be a short-chain fatty acid (e.g., fatty acid with aliphatic tails of fewer than six carbons, X---YI (S N M > -o M e H S Such as butyric acid); a medium-chain fatty acid (e.g., a fatty acid with aliphatic tails of 6-12 carbons, which can form medium-chain triglycerides); a long-chain fatty acid (e.g., fatty acids with aliphatic tails 13 to 21 carbons); or very long chain fatty acids (e.g., fatty acids with aliphatic tails longer than 22 carbons). 0104. A target molecule can be a saturated fatty acid mol 0.095 An unbound nucleic acid pocket can appear in a ecule. For example, a target molecule can be a saturated fatty folding program (see e.g., FIG. 7B-FIG. 7E). An unbound acid molecule selected from caprylic acid, capric acid, lauric nucleic acid pocket does not have to appear in a folding acid, myristic acid, palmitic acid, Stearic acid, arachidic acid, program but can be recognized by its sequences (compare behenic acid, lignoceric acid, or cerotic acid, or derivatives FIG.7F-G). An unbound nucleic acid pocket can bind Cp*Rh thereof. (compare FIG. 7B-G), but can also bind other metals (com 0105. A target molecule can be an unsaturated fatty acid pare Cu2+ in FIG. 7H). molecule. For example, a target molecule can be an unsatur ated fatty acid molecule selected from myristoleic acid, 0.096 Sugar Target Molecule. palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vac 0097. Shown herein is highly specific glucose sensing by a cenic acid, linoleic acid, linoelaidic acid, a-linolenic acid, nucleic acidaptamer (see e.g., Example 4). Results showedan arachidonic acid, eicosapentaenoic acid, erucic acid, or unexpected high affinity of selected aptamers. This is in con docosahexaenoic acid, or derivatives thereof. As another trast to prior conventional approaches which have been example, a target molecule can be an unsaturated fatty acid unable to select an aptamer that recognized glucose. molecule selected from linolenic acid (LA), a-linolenic acid 0098. A target molecule can be a sugar. A target molecule (ALA), eicosapentaenoic acid (EPA), or docosahexaenoic can be a carbohydrate. A target molecule can be a saccharide. acid (DHA). A target molecule can be a monosaccharide, including but not 0106. A target molecule can be a steroid molecule. A ste limited to glucose, dextrose, fructose, or galactose. For roid is understood as a type of organic compound containing example, a target molecule can be glucose (see e.g., Example a characteristic arrangement of four cycloalkane rings joined 4). As another example, a glucose target molecule can be to each other. A target molecule can be, for example, a steroid complexed with a boronic acid derivatization agent (e.g., molecule selected from a cholestane, a cholane, a pregnane, bis-boronic acid) and anaptamer can be selected against Such an androstane, a gonane, or an estrane. A target molecule can complex. be, for example, a steroid molecule selected from cholesterol, 0099. A target molecule can be a disaccharide, including estradiol, testosterone, progesterone, medrogestone, B-sito but not limited to Sucrose (glucose and fructose), maltose sterol, or dexamethasone. (glucose and glucose), or lactose (galactose and glucose). A 0107. A target molecule can be a sphingolipid or a phos target molecule can be a hydrogenated form of carbohydrate, pholipid. For example, a target molecule can be a sphin whose carbonyl group (aldehyde or ketone, reducing Sugar) gosine-phosphate, Sphingomyeline, ganglioside, or phos has been reduced to a primary or secondary hydroxyl group. phatidyl-choline. A target molecule can be a Sugar alcohol. Such as a polyol. 0108. Other Small Molecules. polyhydric alcohol, polyalcohol, or glycitol. A target mol 0109. A target molecule can be a small molecule. As ecule can be a Sugar alcohol. Such as methanol, glycol, glyc described herein, an aptamer can be raised against a small erol, erythritol, threitol, arabitol, xylitol, ribitol, mannitol, molecule complexed with a derivatization agent. A small Sorbitol, galactitol, fucitol, iditol, inositol, Volemitol, isomalt, molecule target having relatively few native features that maltitol, lactitol, maltotriitol, maltotetraitol, or polyglycitol, would otherwise raise a large or complex aptamer can be or disaccharide combinations thereof. For example, an especially suited for the approach described herein. For US 2016/0076021 A1 Mar. 17, 2016 example, a target molecule can be a catechol (e.g., dopamine 0120 Aptamer selection processes against unmodified and L-DOPA (L-3,4-dihydroxyphenylalanine)). target molecules are well known (see generally, Oliphant et 0110. A target molecule can be a lead-like small molecule al. 1989 Mol. Cell Biol. 9, 2944-2949; Tuerk and Gold 1990 or a drug-like Small molecule. For example, a target molecule Science 249, 505-510; Ellington and Szostak 1990 Nature can be a hydrophobic lead-like or a hydrophobic drug-like 346, 818-822). Such conventional processes include system molecule. A lead-like Small molecule is generally understood atic evolution of ligands by exponential enrichment to have a relatively smaller scaffold-like structure (e.g., (SELEX); selected and amplified binding site (SAAB) or molecular weight of about 150 to about 350 kD) with rela cyclic amplification and selection of targets (CASTing). tively fewer features (e.g., less than about 3 hydrogen donors Except as otherwise noted herein, therefore, the process of the and/or less than about 6 hydrogen acceptors; hydrophobicity present disclosure can be carried out in accordance with Such character XlogP of about -2 to about 4) (see e.g., Angewante processes. For example, conventional aptamer selection tech (1999) Chemie Int. ed. Engl. 24, 3943-3948). In contrast, a nique may be used against the novel complex of a derivatiza drug-like Small molecule is generally understood to have a tion agent and a target molecule (as described herein) rather relatively larger scaffold (e.g., molecular weight of about 150 than against merely the conventional non-modified target. For to about 500 kD) with relatively more numerous features example, kinetic capillary electrophoresis can be used for the (e.g., less than about 10 hydrogen acceptors and/or less than selection of aptamers (e.g., Smart aptamers). about 8 rotatable bonds; hydrophobicity character xlogP of I0121 The present disclosure provides a viable alternative less than about 5) (see e.g., Lipinski (2000) J. Pharm. Tox. to a conventional approach of pursuing high affinity, high Methods 44, 235-249). complexity receptors for simple Small molecules. Rather, as 0111 Formation of Complex described herein, it can be advantageous for isolation of Suit 0112. As described herein, formation of a complex able aptamers to increase the complexity of targets via in situ, between a target molecule and a derivatization agent allows dynamic, or reversible complexation of the target with a selection of a specific, high affinity aptamer to the complex. derivatization agent (e.g., a reversible derivatization agent). 0113 A target molecule and a derivatization agent can be Such complexation can provide additional epitopes for inter combined in any suitable fashion (e.g., in solution) to allow actions with potential aptamers and these aptamers can be the derivatization agent to derivatize (e.g., non-specifically) a less structurally complex given the added complexity of the functional group present. For example, a target molecule and target. a derivatization agent can be combined in Solution to allow 0.122 Furthermore, aptamers specifically binding to the the derivatization agent to derivatize (e.g., non-specifically complex can be isolated rather than those binding individual derivatize) a functional group present (e.g., any functional components of the complex. Thus is provided, in various group present). embodiments, methods for identifying Small to medium sized 0114. An aptamer can bind at high affinity to the complex aptamers against simple Small molecules with otherwise few of target molecule and derivatization agent. In some embodi epitopes by turning Such simple Small molecules into high ments, an aptamer does not bind to target molecule or deriva affinity ligands through derivatization. tization agent alone. 0123 Aptamer selection can include providing a large 0115. In some embodiments an aptamer can bind to a oligonucleotide library, e.g., of randomly generated derivatization agent with lesser affinity than to the complex of sequences of fixed length flanked by constant 5' and 3' ends target molecule and derivatization agent. In some embodi that can serve as primers. Sequences in the library can be ments an aptamer can bind to a target molecule with lesser exposed to a complex of a derivatization agent and a target affinity than to the complex of target molecule and derivati molecule, and those sequences that do not bind the target can Zation agent. In some embodiments an aptamer can bind to a be removed (e.g., by affinity chromatography). Sequences derivatization agent or target molecule with lesser affinity can be eluted and amplified by PCR to prepare for subsequent than to the complex of target molecule and derivatization rounds of selection in which the stringency of elution condi agent. In some embodiment, an aptamer does not Substan tions can be increased to identify desirable (e.g., tightest tially bind to a target molecule and can bind to derivatization binding) sequences. agent in a different conformation than with the complex. 0.124. In some embodiments, an RNA library can be used 0116. In some embodiments, an aptamer may not form a to omit the constant primer regions (which may stabilize stable stem in the presence of derivatization agent, but can secondary structures that are unstable when formed by the form a stable stem upon addition of complex. random region alone), thereby increasing ease of removal 0117 Thus is provided a novel and unexpected ability to after the selection process because they stabilize secondary dilute-and-measure analyte. structures that are unstable when formed by the random 0118 Selection of Aptamer region alone (see generally, Jarosch et al. 2006 Nucleic Acids 0119 Described herein is a direct protocol for isolation of Res34(12), e86). high-affinity oligonucleotide-based sensors (e.g., aptameric) 0.125. In some embodiments, explicit counter-selection of reporting Small molecules complexed in situ with their syn aptamers against derivatization agent alone or against target thetic receptors. Various embodiments of the protocol can molecule alone can be performed. allow isolation of oligonucleotides responsive to targets that 0.126 Selections can be performed in a media containing a have previously resisted attempts to identify aptamers against desired sample type (e.g., urine, serum, etc.) for both selec them (see e.g., Example 1). For example, using methods tion and counter-selection, which can minimize the variabil described herein, oligonucleotides responding to either high ity of these matrices and account for interferences. Selection or low concentrations of glucose were selected, a result not conditions and added cofactors can increase the affinity of previously achieved under conventional approaches (see e.g., aptamers (e.g., for amino acids without side-chains that dis Example 4). play strong epitopes). US 2016/0076021 A1 Mar. 17, 2016

0127. The present disclosure overcomes various problems even at very low concentration. Thus, in the presence of an with conventional aptamer selection. One obstacle to broad excess of receptor, aptamer can detect and stabilize very low conventional use of aptamers in bioanalysis is that various concentrations of ligands (i.e., target molecules complexed Small molecule targets are missing epitopes that can effec with derivatization agent). tively interact with nucleic acids (e.g., hydrophobic Surfaces (0132. In some embodiments, elution from a solid-state and positively charged functionalities), and this in turn leads bound target is not performed during selection. Rather, affin to the need for highly complex aptamers, inaccessible ity elution can be performed from a library attached to a solid through conventional SELEX protocols. For example, glu state with a target molecule, not via a displacement of target cose is a small molecule for which no aptamers have ever molecule with a non-target from a complex of target molecule been reported in peer-reviewed literature, despite its signifi and derivatization agent. This change can avoid selection cance and commercial value. pressure against high-affinity interactions with a complex of 0128. Even where a small molecule target has some moi target molecule and derivatization agent or can lead to an ety against which, at least in principle, an aptamer can be increase in affinity. raised (e.g., naturally occurring oligonucleotide receptors (0.133 Aptamer against minimalist targets poor with epitopes, such as fluoride I0134. As described herein, an aptamer can be identified anion and glycine, see generally Mandal et al. 2004 Science against a complex of a derivatization agent and a target mol 306, 275-279; Baker et al. 2012 Science 335(6065), 233 ecule. Anaptamer, as the term is used herein, is understood as 235), such natural receptors have substantial informational a nucleic acid species engineered through repeated rounds of complexity, measured by a number of bases needed to define selection (e.g., in vitro selection) to bind to a target molecule, their highly structured binding sites. Conventional Such as Small molecules, proteins, nucleic acids, cells, tissues, approaches, such as in vitro selection and amplification or organisms. (SELEX) methods used to select aptamers from random oli 0.135 For those small molecules for which aptamer have gonucleotide libraries, are not well suited for isolation of been previously successfully isolated, such as amino acids, structurally complexaptamers. And, even when a convention various embodiments of the method described herein can ally selected aptamer against a difficult Small molecule target provide significantly Superior affinity or reduced aptamer is available, its affinity can be too low to be analytically size, or both. useful. Furthermore, conventional tools to optimize aptamer 0.136 Before, during, or after recognition of a target mol affinity are lacking (cf. affinity-maturation process for anti ecule, an aptamer can bind by complementary nucleic acid bodies). base pairing, which can create a secondary structure, such as 0129. Various approaches described herein are distin a shorthelical arm or a single stranded loop. A combination of guished from conventional protocols. Prior work involved use these secondary structures can result in the formation of a of organic synthetic receptors as cofactors for aptamers, in tertiary structures, which can allow an aptamer to bind to a which a tartarate-citrate receptor based on boronic acid was target molecule via Van der Waals forces, hydrogen bonding, incorporated in aptamers with a goal of impacting its selec or electrostatic interaction (similar to an antibody binding to tivity (see e.g., Manimala et al. 2004.J. Am. Chem. Soc. 126, an antigen). When such tertiary structure forms, some, most, 16515-16519). But a resulting aptamer-receptor complex in or all of the aptamer can fold into a complex (e.g., a stable this prior study had lesser affinity to tartarate and citrate than complex) with the target molecule forming an aptamer-target the receptor itself, while its selectivity indeed changed due to complex. This three-dimensional structure can allow an these different drops in affinity. Furthermore, in that prior aptamer to function like an antibody, which contrasts to con study, both receptor and receptor target complexes induced ventional thinking which held that polynucleic acids were similar conformational changes inaptamer at the equally low merely linear, information holding structures. concentrations (20 uM), indicating similar binding affinities. 0.137 An aptamer can be a nucleic acid aptamer. An 0130 Embodiments of the present disclosure differ from aptamer can be a DNA aptamer. A DNA aptamer can be prior studies in at least several ways. relatively more stable, cheaper, and easier to produce than an 0131. In some embodiments, counter-selection of aptam RNAaptamer. An aptamer can be an RNA aptamer. An RNA ers against a derivatization agent alone or against a target aptamer can have a relatively more diverse three-dimensional molecule alone can be used in, with, or after the process of structure than a DNA aptamer. An aptamer can be an XNA aptamer selection for the complex of derivatization agent and aptamer. An aptamer can be a Smartaptamer, selected with a target molecule (see e.g., FIG. 1). A counter-selection step pre-defined equilibrium constants (K.), rate constants (k. can disfavor incorporation of a receptor (e.g., of the derivati k), and thermodynamic (AH, AS) parameters of aptamer Zation agent alone or the target molecule alone) into an target interaction. aptameric sensor on its own or can lead to an increase of 0.138. An aptamer described herein can be modified, e.g., analytical sensitivity or can lead to a different mode of sens to resist degradation in a sample. For example, Sugar modifi ing with cofactor alone. Reasoning Supporting Such as cations of nucleoside triphosphates can render a resulting approach is at least as follows. If an aptamer incorporates a aptamer resistant to nucleases found in serum. As another derivatization agent prior to its binding to the target molecule, example, changing a 2'OH group of ribose to a 2F or 2NH there may be no reason to assume that functionalities in the group can yield an aptamer having increased stability or a derivatization agent that are binding to the aptamer will not be longer half-life. Such as in blood-containing sample or in an in binding to the target molecule as well. In other words, binding vitro or in vivo environment (see e.g., Brody and Gold 2000 to the derivatization agent alone may be competing with Rev Molec Biol 74(1), 5-13). As another example, conjugat binding to the target molecule, which may result in decreased ing an aptamer to a higher molecular weight vehicle can affinity. Ifanaptamer binds substantially only to the complex increase stability or half-life in an in vitro or in vivo environ of derivatization agent and target molecule after Such com ment. As another example, an aptamer can be conjugated to a plex is formed, and if it binds tightly, it can stabilize formation nanomaterial. US 2016/0076021 A1 Mar. 17, 2016

0139 Anaptameras described herein can be at least about nM, about 110 nM, about 120 nM, about 130 nM, about 140 15 oligonucleotides. An aptameras described herein can be nM, about 150 nM, about 160 nM, about 170 nM, about 180 up to about 100 oligonucleotides. For example, anaptameras nM, about 190 nM, about 200 nM, about 250 nM, about 300 described herein can be at least about 15 oligonucleotides up nM, about 350 nM, about 400 nM, about 450 nM, about 500 to about 100 oligonucleotides. As another example, an nM, about 550 nM, about 600 nM, about 650 nM, about 700 aptameras described herein can be at least about 15, at least nM, about 750 nM, about 800 nM, about 850 nM, about 900 about 20, at least about 25, at least about 30, at least about 35, nM, about 950 nM, about 1 uM, about 10 uM, about 20 uM, at least about 40, at least about 45, at least about 50, at least about 30 uM, about 40M, about 50 uM, about 60 uM, about about 55, at least about 60, at least about 65, at least about 70, 70 uM, about 80 uM, about 90 uM, or about 100 uM. It is at least about 75, at least about 80, at least about 85, at least understood that ranges between different combinations of Kd about 90, at least about 95, at least about 100, or more oligo listed above are contemplated. nucleotides. It is understood that recitation of each of these 0.143 Unpaired Bases. individual values includes ranges there between. 0144. An aptameras described herein can have a nucleic 0140 Nucleic acid sequences for exemplary aptamers are acid sequence with one or more unpaired nucleic acid bases. provided herein. It is understood that an aptamer can have a Anaptamer with one or more unpaired nucleic acid bases can nucleic acid sequence according to the discrete exemplary form a binding pocket providing for binding of the target sequence provided, or a sequence at least 80% identical molecule and the derivatization agent. For example, an thereto (e.g., at least 85%, at least 90%, at least 91%, at least aptamer with one or more unpaired nucleic acid bases can 92%, at least 93%, at least 94%, at least 95%, at least 96%, at binda derivatization agentandanamino acid target molecule. least 97%, at least 98% or at least 99%) and binding (e.g., As another example, an aptamer with one or more unpaired selective or non-selective) a target molecule complexed with nucleic acid bases can bind a metal ion complex derivatiza a derivatization agent. One of ordinary skill will understand tion agent (e.g., Cp*Rh(III)) and an amino acid target mol that certain regions of the aptamer are more robust with ecule. An example of a metal-complex binding motif of an respect to nucleic acid Substitution. For example, stem aptamer with one or more unpaired nucleic acid bases and regions of a secondary or tertiary structure of an aptamer may binding of Cp*Rh(III) and an amino acid is as follows: have reduced impact on target molecule binding, and So, nucleic acid substitutions in these regions can be more freely made. In contrast, secondary or tertiary structure regions of an aptamer associated with binding to target molecules may be more sensitive, and So, may require more conservative Sub stitutions or fewer Substitutions. Similarly, regions of an aptamer important or critical to certain secondary or tertiary structural features may be more sensitive, and So, may require more conservative substitutions or fewer substitutions. In Some embodiments, nucleic acid sequence identity can be lower in stem regions (e.g., at least about 80%, at least about 85%, or at least about 90%) compared to regions associated with binding a target molecule or regions important or critical to secondary or tertiary structural features (e.g., at least about 90%, at least about 95%, or at least about 99%). 0141 An aptamer as described herein can have an equi 0145. In the above motif, the binding site formed by the librium constant Kd of about 1 pM up to about 100 LM. An G-A mismatch Surrounded by binding base pairs (e.g., G-C, aptamer having a Kd as low as about 1 pM to about 100 pM G-T, A-T, A-U or analogs). can be with respect to a target molecule, such as a Sugar, 0146. Other examples of an aptamer with one or more natively on a surface. Such as a cell Surface. An aptamer as unpaired nucleic acid bases are: Tyr selective aptamer Tyr described herein can have an equilibrium constant Kd of Cp*Rh(38nt) (SEQ ID NO: 71) as shown in FIG. 7B: Phe about 1 pM up to about 10.0 uM. As another example, an cross-reactive Trpaptamer PACp*Rh()1 (SEQID NO: 53) as aptameras described herein can have an equilibrium constant shown in FIG. 7C; citrulline non-selective aptamer Kd of about 1 pMup to about 10.0 uM; about 1 pMup to about CIT30N02 Cp*Rh (SEQID NO: 40) as shown in FIG. 7D; 1.0 uM; about 1 pMup to about 100 nM; about 100 pMup to Gln selective aptamer GlutaCp02 (SEQID NO: 41) as shown about 10.0 uM; about 100 pMup to about 1.0 uM; about 100 in FIG.7E; Lys non-selective aptamer LysCp*Rh18 (SEQID pMup to about 100 nM; or about 1.0 nMup to about 10.0 uM; NO:52) as shown in FIG.7F: Lys selective aptamer LysCp05 about 1.0 nM up to about 1.0LM; about 1 nMup to about 200 (SEQID NO:51) as shown in FIG.7G: Phe cross-reactive Trp nM; about 1.0 nM up to about 100 nM; about 500 nM up to aptamer Cu(II)-Phel0 49 nt (SEQ ID NO: 75) as shown in about 10.0 uM; or about 500 nM up to about 1.0 uM. FIG.7H: Arg selective ARG01 Cpaptamer (SEQID NO:36) 0142. As another example, anaptameras described herein as shown in FIG. 8B; Trp selective HTrp03 aptamer (SEQID can have an equilibrium constant Kd of about 1 pM, about 50 NO:57) as shown in FIG. 8C: Gly selective aptamer Gly-Cp pM, about 100 pM, about 150 pM, about 200 pM, about 250 sensor (SEQID NO: 45) as shown in FIG.9A. Asn selective pM, about 300 pM, about 350 pM, about 400 pM, about 450 aptamer AspaCp03 (SEQ ID NO:38) as shown in FIG.9B; pM, about 500 pM, about 550 pM, about 600 pM, about 650 Gly non-specific aptamer GLYHW-Cp*RhO6 (SEQ ID NO: pM, about 700 pM, about 750 pM, about 800 pM, about 850 47) as shown in FIG.9C: Leucp17 aptamer selective for Leu pM, about 900 pM, about 950 pM, about 1 nM, about 10 nM, over Ile (SEQID NO: 50) as shown in FIG. 10; PACp*Rho1 about 20 nM, about 30 nM, about 40 nM, about 50 nM, about aptamer reactive for Phe and cross-reactive for Trp (SEQID 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 NO: 53) as shown in FIG. 11A; Phe reactive Cu(II) Phe01 US 2016/0076021 A1 Mar. 17, 2016

aptamer (SEQ ID NO: 73) as shown in FIG. 12A; or Phe (III) derivatization agent. An aptameras described herein can reactive HPheA104 aptamer (SEQ ID NO: 56) as shown in have a nucleic acid sequence comprising SEQID NO:31. An FIG. 12C. aptamer comprising SEQ ID NO: 13 can bind the target 0147 An unbound nucleic acid pocket can appear in a molecule arginine complexed with a Cp*Rh(III) derivatiza folding program (see e.g., FIG. 7B-E). An unbound nucleic tion agent. An aptamer binding to an arginine-Cp*Rh(III) acid pocket does not have to appear in a folding program but complex can have a nucleic acid sequence comprising: SEQ can be recognized by its sequences (compare FIG.7F-G). An IDNO:32 (Arginine-Cp*Rh 02); SEQID NO:33 (Arginine unbound nucleic acid pocket can bind Cp*Rh (compare FIG. Cp*Rh 03); SEQID NO:34 (Arginine-Cp*Rh 04); SEQID 7B-G), but can also bind other metals (compare Cu" in FIG. NO:35 (Arginine-Cp*Rh 05); or SEQID NO:36 (ARG01 7H). Cp), or a sequence at least 80% identical thereto (e.g., at least 0148 Aptamers Specific for Monosaccharide-Derivatiza 85%, at least 90%, at least 91%, at least 92%, at least 93%, at tion Complex. least 94%, at least 95%, at least 96%, at least 97%, at least 0149. An aptameras described herein can have a nucleic 98% or at least 99%) and binding (e.g., selective or non acid sequence comprising SEQID NO. 3. An aptamer com selective) arginine complexed with a Cp*Rh(III) derivatiza prising SEQID NO: 3 can bind the target molecule glucose tion agent. complexed with a bis-boronic derivatization agent. Aptamers 0156 Anaptameras described herein can bind (e.g., selec specific for the glucose-boronic acid complex can have a tively or non-selectively) asparagine complexed with a nucleic acid sequence comprising: SEQID NO: 4 (Glucose Cp*Rh(III) derivatization agent. An aptamer binding to an BA 01); SEQ ID NO: 5 (Glucose-BA 07); SEQ ID NO: 6 asparagine -Cp*Rh(III) complex can have a nucleic acid (Glucose-BA 08); SEQIDNO: 7 (Glucose-BA 09): SEQID sequence comprising: SEQID NO:37 (AspaCp01); SEQID NO: 8 (Glucose-BA 10); SEQID NO: 9 (Glucose-BA 11): NO:38 (AspaCp03); or SEQ ID NO: 39 (AspaCp04), or a SEQ ID NO: 10 (Glucose-BA 12); SEQ ID NO: 11 (Glu sequence at least 80% identical thereto (e.g., at least 85%, at cose-BA 13): SEQ ID NO: 12 (Glucose-BA 14); SEQ ID least 90%, at least 91%, at least 92%, at least 93%, at least NO: 13 (Glucose-BA 15); SEQ ID NO: 14 (Glucose-BA 94%, at least 95%, at least 96%, at least 97%, at least 98% or 16); SEQ ID NO: 15 (Glucose-BA 17); SEQ ID NO: 16 at least 99%) and binding (e.g., selective or non-selective) (GLUBAO2); SEQID NO: 17 (GLUBA09); SEQID NO: 18 asparagine complexed with a Cp*Rh(III) derivatization (GLUBAO9 M1); SEQ ID NO: 19 (GLUBA 17); SEQ ID agent. NO: 20 (GLUBAN3W10); SEQ ID NO: 21 0157 Anaptameras described herein can bind (e.g., selec (GLUBAN3W11); or SEQID NO: 22 (GLUBAN3W19), or tively or non-selectively) citrulline complexed with a Cp*Rh a sequence at least 80% identical thereto (e.g., at least 85%, at (III) derivatization agent. An aptamer binding to a citrulline least 90%, at least 91%, at least 92%, at least 93%, at least Cp*Rh(III) complex can have a nucleic acid sequence 94%, at least 95%, at least 96%, at least 97%, at least 98% or comprising SEQ ID NO: 40 (CIT30NO2. Cp*Rh), or a at least 99%) and binding (e.g., selective or non-selective) sequence at least 80% identical thereto (e.g., at least 85%, at glucose complexed with a bis-boronic derivatization agent. least 90%, at least 91%, at least 92%, at least 93%, at least 0150. Aptamers specific for the fructose-boronic acid 94%, at least 95%, at least 96%, at least 97%, at least 98% or complex can have a nucleic acid sequence comprising: SEQ at least 99%) and binding (e.g., selective or non-selective) ID NO:23 (FrucBA02); SEQID NO: 24 (FrucBAO2 M1); or citrulline complexed with a Cp*Rh(III) derivatization agent. SEQ ID NO: 25 (FrucBAO5), or a sequence at least 80% 0158 Anaptameras described herein can bind (e.g., selec identical thereto (e.g., at least 85%, at least 90%, at least 91%, tively or non-selectively)glutamine complexed with a Cp*Rh at least 92%, at least 93%, at least 94%, at least 95%, at least (III) derivatization agent. An aptamer binding to a glutamine 96%, at least 97%, at least 98% or at least 99%) and binding Cp*Rh(III) complex can have a nucleic acid sequence (e.g., selective or non-selective) fructose complexed with a comprising SEQID NO: 41 (GlutaCp02); or SEQID NO: 42 bis-boronic derivatization agent. (GlutaCp15), or a sequence at least 80% identical thereto 0151 Aptamers specific for the galactose-boronic acid (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at complex can have a nucleic acid sequence comprising: SEQ least 93%, at least 94%, at least 95%, at least 96%, at least ID NO:26 (GalacBA 05); SEQID NO:27 (GalacBA 01); or 97%, at least 98% or at least 99%) and binding (e.g., selective SEQ ID NO: 28 (GalacBA 06), or a sequence at least 80% or non-selective) glutamine complexed with a Cp*Rh(III) identical thereto (e.g., at least 85%, at least 90%, at least 91%, derivatization agent. at least 92%, at least 93%, at least 94%, at least 95%, at least 0159 Anaptameras described herein can bind (e.g., selec 96%, at least 97%, at least 98% or at least 99%) and binding tively or non-selectively) glycine complexed with a Cp*Rh (e.g., selective or non-selective) galactose complexed with a (III) derivatization agent. An aptameras described herein can bis-boronic derivatization agent. have a nucleic acid sequence comprising SEQID NO: 43. An 0152 Aptamers Binding to Boronic Acid. aptamer comprising SEQ ID NO: 43 can bind the target 0153 Aptamers specific for boronic acid (e.g., a shinkai molecule glycine complexed with a Cp*Rh(III) derivatiza sensor) can have a nucleic acid sequence comprising: SEQID tion agent. An aptamer binding to an glycine-Cp*Rh(III) NO: 29 (BAOnly01); or SEQID NO:30 (BAOnly03), or a complex can have a nucleic acid sequence comprising: SEQ sequence at least 80% identical thereto (e.g., at least 85%, at ID NO: 44 (Glycine-Cp*Rh 01); SEQID NO: 45 (Gly-Cp): least 90%, at least 91%, at least 92%, at least 93%, at least SEQ ID NO: 46 (Gly-Cp+1 bp); or SEQ ID NO: 47 94%, at least 95%, at least 96%, at least 97%, at least 98% or (GLYHW-Cp*Rh 06), or a sequence at least 80% identical at least 99%) and binding (e.g., selective or non-selective) thereto (e.g., at least 85%, at least 90%, at least 91%, at least boronic acid. 92%, at least 93%, at least 94%, at least 95%, at least 96%, at 0154 Aptamers Binding to Amino Acids. least 97%, at least 98% or at least 99%) and binding (e.g., 0155 Anaptameras described herein can bind (e.g., selec selective or non-selective) glycine complexed with a Cp*Rh tively or non-selectively) arginine complexed with a Cp*Rh (III) derivatization agent. US 2016/0076021 A1 Mar. 17, 2016

0160 Anaptameras described herein can bind (e.g., selec ID NO:59 (Tyrosine-Cp*Rh 02); SEQID NO: 60 (Tyrosine tively or non-selectively) leucine complexed with a Cp*Rh Cp*Rh 03); SEQID NO: 61 (Tyrosine-Cp*Rh 04); SEQID (III) derivatization agent. An aptamer binding to a leucine NO: 62 (Tyrosine-Cp*Rh 05); SEQ ID NO: 63 (Tyrosine Cp*Rh(III) complex can have a nucleic acid sequence Cp*Rh_06); SEQID NO: 64 (Tyrosine-Cp*Rh 07); SEQID comprising: SEQ ID NO: 48 (Leucp01); SEQ ID NO: 49 NO: 65 (Tyrosine-Cp*Rh 08); SEQ ID NO: 66 (Tyrosine (Leucp04); or SEQID NO: 50 (Leucp17), or a sequence at Cp*Rh 09): SEQID NO: 67 (Tyrosine-Cp*Rh 10); SEQID least 80% identical thereto (e.g., at least 85%, at least 90%, at NO: 68 (Tyrosine-Cp*Rh 11); SEQ ID NO: 69 (Tyrosine least 91%, at least 92%, at least 93%, at least 94%, at least Cp*Rh 12); SEQID NO: 70 (Tyrosine-Cp*Rh 13); SEQID 95%, at least 96%, at least 97%, at least 98% or at least 99%) NO: 71 (Tyr-Cp*Rh(38nt)); or SEQID NO: 72 (HTyrs07), or and binding (e.g., selective or non-selective) leucine com a sequence at least 80% identical thereto (e.g., at least 85%, at plexed with a Cp*Rh(III) derivatization agent. least 90%, at least 91%, at least 92%, at least 93%, at least 0161 Anaptameras described herein can bind (e.g., selec 94%, at least 95%, at least 96%, at least 97%, at least 98% or tively or non-selectively) lysine complexed with a Cp*Rh(III) at least 99%) and binding (e.g., selective or non-selective) derivatization agent. An aptamer binding to a lysine-Cp*Rh tyrosine complexed with a Cp*Rh(III) derivatization agent. (III) complex can have a nucleic acid sequence comprising: 0166 Diagnostics SEQ ID NO: 51 (LysCp05); or SEQ ID NO: 52 0.167 Aptamers described herein can be used in diagnostic (LysCp*Rh18), or a sequence at least 80% identical thereto applications. (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at (0168 Various embodiments of the method can address least 93%, at least 94%, at least 95%, at least 96%, at least specific bioanalytical needs. Such as mix-and-measure assays 97%, at least 98% or at least 99%) and binding (e.g., selective of diagnostic increases in Small molecules in challenging or non-selective) lysine complexed with a Cp*Rh(III) deriva biological matrices. The simplicity and general applicability tization agent. of methods described herein or broad availability of synthetic 0162 Anaptameras described herein can bind (e.g., selec receptors for Small molecules provide applications of aptam tively or non-selectively) phenylalanine complexed with a ers in clinical chemistry that have not been previously pos Cp*Rh(III) derivatization agent. An aptamer binding to a sible. phenylalanine-Cp*Rh(III) complex can have a nucleic acid 0169 Conventional aptamer diagnostic protocols can be sequence comprising: SEQ ID NO: 53 (PACp*Rh(01); SEQ adapted by an artisan of ordinary skill for use with aptamers ID NO:54 (PACp*RhO2); SEQID NO:55 (PACp*Rho3); or disclosed herein. Generally, an additional step includes mix SEQ ID NO: 56 (HPheA104), or a sequence at least 80% ing a sample containing or Suspected of containing a target identical thereto (e.g., at least 85%, at least 90%, at least 91%, molecule with a derivatization agent so as to form a complex. at least 92%, at least 93%, at least 94%, at least 95%, at least Such complex can then be detected with anaptamer disclosed 96%, at least 97%, at least 98% or at least 99%) and binding herein according to a conventional assay. Thus is provided a (e.g., selective or non-selective) phenylalanine complexed mix-and-measure modification that can be made to assays for with a Cp*Rh(III) derivatization agent. detection of Small molecule targets in challenging biological 0163 Anaptameras described herein can bind (e.g., selec matrices. tively or non-selectively) phenylalanine complexed with a 0170 Aptamer usage in diagnostics is well known (see Cu(II) derivatization agent. An aptamer binding to a pheny generally, Jayasena 1999 Clin Chem 45(9), 1628-1650; Mas lalanine-Cu(II) complex can have a nucleic acid sequence cini 2009 Aptamers in Bioanalysis, Wiley-Interscience, 1 comprising: SEQID NO: 73 (Cu(II) Phe01); SEQID NO: 74 Ed., ISBN-10: 0470148306). Except as otherwise noted (Cu(II)-Phel0); or SEQID NO: 75 (Cu(II)-Phel0 49 nt), or herein, therefore, the process of the present disclosure can be a sequence at least 80% identical thereto (e.g., at least 85%, at carried out in accordance with Such processes. least 90%, at least 91%, at least 92%, at least 93%, at least 0171 Anaptamer described herein can be immobilized on 94%, at least 95%, at least 96%, at least 97%, at least 98% or a Surface Suitable for diagnostic applications, such as gold at least 99%) and binding (e.g., selective or non-selective) films, gold particles, silicates, silicon oxides, polymers, phenylalanine complexed with a Cu(II) derivatization agent. metallic Substrates, biocoatings including avidin or avidin 0164 Anaptameras described herein can bind (e.g., selec derivatives, quantum dots, carbon nanotubes, Superparamag tively or non-selectively) tryptophan complexed with a netic iron oxide nanoparticles, or carbohydrates (see gener Cp*Rh(III) derivatization agent. An aptamer binding to a ally, Balamurugan et al. 2008 Anal Bioanal Chem390, 1009 tryptophan-Cp*Rh(III) complex can have a nucleic acid 1021: Famulok et al. 2007 Chemical Reviews 107(9), 3715 sequence comprising: SEQ ID NO: 57 (HTrp03), or a 3743; see generally, Lee et al. 2010 Advanced Drug Delivery sequence at least 80% identical thereto (e.g., at least 85%, at Systems 62(6), 592-605). Chemical protocols for covalent least 90%, at least 91%, at least 92%, at least 93%, at least attachment of aptamers to functionalized surfaces is under 94%, at least 95%, at least 96%, at least 97%, at least 98% or stood in the art and Such protocols can be adapted for aptam at least 99%) and binding (e.g., selective or non-selective) ers disclosed herein. For example, an aptamer of the present tryptophan complexed with a Cp*Rh(III) derivatization disclosure can be attached to a solid Surface array. agent. 0172 An aptamer described herein can be used in con 0.165 Anaptameras described herein can bind (e.g., selec junction with a fluorescent, colorimetric, magnetic resonance tively or non-selectively) tyrosine complexed with a Cp*Rh imaging, or electrochemical sensor or protocol (see generally, (III) derivatization agent. An aptameras described hereincan Lee et al. 2010 Advanced Drug Delivery Systems 62(6), have a nucleic acid sequence comprising SEQID NO: 58. An 592-605). aptamer comprising SEQ ID NO: 58 can bind the target 0173 Anaptamer described herein can be used to detect a molecule tyrosine complexed with a Cp*Rh(III) derivatiza target molecule in a sample. A sample can be a biological tion agent. An aptamer binding to an tyrosine-Cp*Rh(III) sample. A sample can be a biological sample from a Subject. complex can have a nucleic acid sequence comprising: SEQ The Subject can be an animal Subject, including a mammal, US 2016/0076021 A1 Mar. 17, 2016

Such as horses, cows, dogs, cats, sheep, pigs, mice, rats, profiles and there are no methods or tools that allow monitor monkeys, hamsters, guinea pigs, and chickens, and humans. ing individual amino acids on a daily basis (cf. glucose pro For example, the Subject can be a human Subject. files in diabetes). Aptamers described herein and sensitive to 0.174. A biological sample can be a fluid sample or a solid the amino acid associated with Such inborn errors of amino sample. A biological sample can be a urine sample, a saliva acid metabolism can be used to monitoring individual amino sample, a blood sample, a serum sample, a plasma sample, an acids on an hourly, daily, weekly, monthly, or yearly basis. amniotic fluid sample, a cerebrospinal fluid sample, a Sweat Exemplary inborn errors of amino acid metabolism are pro sample, an exhaled breath condensate sample, or a solid tissue vided in the TABLE 1. sample. For example, the sample can be a blood sample, Such as a peripheral blood sample. As another example, a sample can be a urine sample. Change to Small Molecule 0175 For example, an aptamer described herein can be Disease Indicative of Diagnosis used as an amino acid marker. Such amino-acid specific Phenylketonuria, (several types) Phenylalanine, tyrosine aptamer can be used to detect an amino acid in a biological Tyrosinemia - (several types, newborn Tyrosine, Succinylacetone, immaturity and inborn errors methionine sample (e.g., a urine sample). Hawksinuria 0176 Anaptamer described herein can be used to detect a Glycine cleavage system deficiency Glycine target molecule associated with a disease or condition. Diag 3-Phosphoglycerat dehydrogenase deficiency Glycine Proprionicacidemia Glycine nostic methods using an aptamer described herein can be Methylmalonicacidemia Glycine/methionine performed on a Subject having, diagnosed with, Suspected of Histidinemia Histidine having, or at risk for developing a disease or condition asso MSUD (Maple syrup urine disease) several Leucine, valine, isoleucine ciated with a target molecule. A determination of the need for OS alloisoleucine, Sovaleric academia Leucine, glycine diagnosis can be assessed by a history and physical exam Homocystinuria (CyStathionine beta-synthase Homocysteine, methionine consistent with the disease or conditionatissue. Conventional deficiency, folate and B12 metabolism) diagnostic protocols of a disease or disorder associated with a Urea cycle defects (several types) Citrulline, arginine, target molecule can be adapted accordingly to use aptamers as Argininosuccinate, Orotic disclosed herein. acid, Ammonia 0177 Amino acids that are diagnostic or contribute to Citrullinemia type 2 (citrindefency) Citrulline, galactose diagnosis for specific disorders are known in the art (see generally, Blau 2004 Physicians Guide to the Laboratory 0181. A method based on aptamers developed as Diagnosis of Metabolic Diseases, 2d Ed., Springer, ISBN-10: described herein can improve current diagnostic approaches 354042542X). Methods described herein for isolating an in clinically relevant conditions, extend diagnostic capacity aptamer specific for an amino acid can be directed towards an to low-prevalence conditions that remain undiagnosed due to amino acid known to be diagnostic or contribute to diagnosis economic and technical reasons, uncover yet unrecognized for specific disorders. An aptamer isolated according the alterations in metabolism, or be used in monitoring the gen approach described herein can be used to detectanamino acid eral health of populations. Such methods can be effective in a sample, thereby providing or contributing to a diagnosis when a health issue is characterized through a truly gross shift for the associated disease or disorder. in patterns of metabolite families, typical for serious meta 0.178 For example, an aptamer described herein can be bolic problems, such as metabolic disorders due to genetic used as a diagnostic of a congenital disease associated with polymorphisms (inborn errors). Gross shifts of dominant the target molecule. As another example, a tyrosine-specific components in the range of micro-to-millimolar concentra aptamer can be used to diagnose tyrosinemia in a subject. As tions can be well suited for analysis as described herein, another example, an aptamer specific for the amino acid cit including urinalysis for metabolic errors. Furthermore, analy rulline can be used to diagnose or aid in the assessment of sis described herein (e.g., via arrays) can be useful in other Small intestinal function (e.g., transplant recipients, including biological fluids. Such as serum, saliva, amniotic fluid, and graft-vs-host disease). As another example, an aptamer spe CSF. cific for the carbohydrate galactose can be used to diagnose or 0182. Over 98% of newborns in the US participate in a aid in the diagnosis of several forms of galactosemia. comprehensive program for mass screening for inborn errors 0179. Furthermore, an aptamer developed as described of metabolism on blood spots; this process, made relatively herein can be used to monitor an amino acid associated with fast and inexpensive by tandem mass spectroscopy coupled a disease or disorder and to measure compliance. For with computer analysis, covers 30+ inborn errors of metabo example, severalamino aciddisorders are known to be treated lism, treatable if caught at early stages, and 20+ untreatable by specific diets and aptamers described herein can provide a conditions. While newborn Screening is an undeniable Suc tools allowing a Subject or caregiver to monitor the efficacy of cess in developed countries, serious problems remain. For a specific diet. As another example, aptamers specific for example, the rate of false positives can be as high as 1.3%, Valine, leucine, or isoleucine (branched chain amino acids) with the positive predictive value of the test ranging from 3% can be used for evaluation of nutritional status (e.g., dietary (meaning 97% of positives are false) to 50%, depending on Supplement used by athletes). individual states (overall leading to estimated 200,000 false 0180. Several inborn errors of amino acid metabolism can positives each year in the US). be treated by special diets that either restrict protein intake 0183) Approaches described herein can diagnose or moni (e.g., urea cycle defects, phenylketonuria, tryosinemia, gly tor inborn errors that interfere with metabolic processes cine cleavage deficiency and others) or Supplement amino involving amino acids. If identified early, the most serious acids (e.g., 3-phosphoglycerate dehydrogenase deficiency, consequences of these errors, such as mental retardation, can MELAS syndrome and others). Conventional treatment be prevented, e.g., by careful changes in diet and by providing involves weekly or monthly determination of amino acid supplements/drugs. The National Academy of Clinical Bio US 2016/0076021 A1 Mar. 17, 2016 15 chemistry stresses in its “Practice Guidelines to Follow-up known that in primary aminoacidopathies: (i) in tyrosinemia Testing for Metabolic Diseases Identified in Newborn type 1, changes in concentrations of tyrosine in urine were Screening that a comprehensive amino-acid analysis pro >20-fold (2000 umol/g creatinine); branched chain amino vides relevant and timely contribution to the differential diag acids change only minimally; (ii) in homocystinuria (e.g., nosis, with most tests for amino acids performed in serum. cyStathionine beta synthase deficiency), it is known that The current analytical standard for amino acid analysis in homocystine becomes detectable in urine (from ~0 to about urine is post-derivatization cation exchange chromatography 100 umol/g creatinine); (iii) in urea cycle disorders, e.g., with photometric detection of ninhydrin adducts; iTRAQ(R)- citrullinemia (ASD) and argininosuccinicaciduria (ALD) (of LC-MS/MS, and post-derivatization GC-MS are being stud interest for late onset as well), it is known that citrulline in ied as alternatives. urine increases more than 50-fold from <200 to >10,000 0184. In some embodiments, diagnostic methods dis umol/g creatinine) and argininosuccinicate from ND to closed herein may not fully eliminate the need for chroma >1000 umol/g creatinine; (iv) in MSUD at day 3, it is known tography and other diagnostic steps (e.g., genetic). But Such that leucine (also other branched-chain amino acids) increases >10-fold in serum (e.g., from <200 to -2000 uM) diagnostic methods can give a rapid single-step option for with expected spillage into urine; any detection of allo-iso sorting out cases identified initially as low-to-moderate risk; leucine in either urine or serum (ND to av. 200 uM) is known thus, as a fast second-tier confirmatory test, it can allow early to be indicative of the diagnosis. In each of these cases, an focus on correct diagnosis, and, iffalse positive is established, aptamer can be developed, as described herein, to be sensitive it can provide important relief to a subject. to a metabolite above and thus contribute to diagnosis of the 0185. In post-prandial periods in patients with metabolic associated disease or disorder. disorders that interfere with utilization of amino acids, there 0187 Provided below is a list of specific diseases and can be a transient strong elevation above the renal reabsorp conditions associated with a disruption of levels of an amino tion threshold of relevant metabolites in plasma. This can acid. Methods described herein for isolating an aptamer spe result in spillage into urine, useful to confirm the initial diag cific for an amino acid can be directed towards an amino acid nosis or result in analysis of acidic components in urine as known to be diagnostic or contribute to diagnosis for a spe part of a differential diagnosis. To preserve homeostasis, cific disease or disorder appearing in the table below. An unnecessary or toxic compounds are rapidly excreted, thus, aptamer isolated according the approach described hereincan increases in urine can be more dramatic than in blood. be used to detect an amino acid in a sample, thereby providing 0186. In metabolic errors, the shifts in patterns of amino or contributing to a diagnosis for the associated disease or acids can be gross for screened diseases. For example, it is disorder appearing in TABLE 2. TABLE 2 Pathological values differential diagnosis of inborn eOS

Amino acid Source Value Value Disorder(s) All amino acids U A Classic galactosemia All amino acids U A Fanconi syndrome All amino acids U A Fumarylacetoacetase deficiency (Tyrosinemia I) All amino acids U A Glutamylcysteine synthetase deficiency All amino acids U A Hereditary fructose intolerance All amino acids U A Lowe syndrome All amino acids U A Vitamin D-dependent rickets Neutral amino acids U A Hartnup disorder Alanine B A Hyperammonemic syndromes Alanine B A Mitochondrial disorders Alanine B A Pyruvate/lactate disorders 3-alanine B, U A 3-Alaninemia 3-alanine CSF A GABA-transaminase deficiency 3-alanine U A Methylmalonate semialdehyde dehydrogenase deficiency 3-alanine U A Pyrimidine disorders Allo-isoleucine B, U A E. Lipoamide dehydrogenase deficiency Allo-isoleucine U A Ethylmalonic aciduria Allo-isoleucine B, U A Maple syrup urine disease C-aminoadipic acid U A C.-Aminoadipicio-ketoadipic aciduria C-aminoadipic acid U A Kearns-Sayre syndrome 3-aminoisobutyric U A 3-Alaninemia acid 3-aminoisobutyric U A 3-Aminoisobutyric acid aminotransferase deficiency acid (benign genetic marker) ô-Aminolevulinic acid U A Hereditary tyrosinemia I Argnine B w Creatine deficiency Arginine U A Cystinuria Arginine U A Dibasic aminoaciduria Arginine B w HHH syndrome Arginine B A Hyperargininemia Arginine U A Lysinuric protein intolerance Arginine B w Ornithine aminotransferase deficiency (gyrate atrophy) US 2016/0076021 A1 Mar. 17, 2016 16

TABLE 2-continued Pathological values differential diagnosis of inborn eOS

Amino acid Source Value Value Disorder(s) Argininosuccinate B, U, AF Argininosuccinic aciduria (argininosuccinate lyase deficiency) Aspartic acid U A Dicarboxylic aminoaciduria Aspartylglucosamine B, U A Aspartylglucosamidase deficiency Carnosine U A Carnosinemia Citrulline B A Argininosuccinic aciduria (argininosuccinate lyase deficiency) Citrulline B A Citrullinemia Citrulline B w 8-Pyrroline-5-carboxylate synthase deficiency Citrulline B w Lysinuric protein intolerance Citrulline B w NAGS, CPS, OTC deficiencies Citrulline B A Pyruvate carboxylase deficiency type B Citrulline B w Respiratory chain disorders Citrulline B, U A Saccharopinuria Cystathionine B, U A Cobalamin disorder Cystathionine B, U A CyStathionase deficiency Cystathionine B, U A CyStathionine 3-synthase deficiency Cystathionine B, U A Methylene tetrahydrofolate reductase deficiency Cystine U A Cystinuria Cystine U A Hyperlysinemia Cystine U A Hyperornithinemia Cystine U A Lysinuric protein intolerance Cystine B w Molybdenum cofactor deficiency Cystine B w Sulfite oxidase deficiency Ethanolamine U A Ethanolaminosis Formiminoglutamic U A Formiminoglutamic aciduria acid GABA B, U A 3-Alaninemia GABA CSF, B, U GABA transaminase deficiency Glutamic acid U A Dicarboxylic aminoaciduria Glutamic acid C A Glutamic acidemia Glutamine CSF A Adenosine deaminase deficiency Glutamine B, U A CPS & OTC deficiencies Glutamine B, U, CSF Hyperammonemic syndromes Glutamine B w Maple syrup urine disease Glutathionine U A Y-Glutamyl transpeptidase deficiency Glycine U, B, CSF Cobalamin disorders Glycine U, B, CSF D-Glyceric aciduria Glycine U A Familial renal iminoglycinuria Glycine U A Hyperprolinemia I & II Glycine U, B, CSF Methylmalonic acidemia Glycine U, B, CSF Nonketotic hyperglycinemia Glycine U, B, CSF Propionic acidemia Glycine B, CSF w Serine deficiency disorders Glycylproline U A Prolidase deficiency Hawkinsin U A Hawkinsinuria Histidine B, U A Histidinemia Homoarginine B, U A Hyperlysinemia Homocarnosine CSF A Homocarnosinosis Homocitrulline U A HHH syndrome Homocitrulline B, U A Saccharopinuria Homocyst(e)ine U A Adenosine deaminase deficiency Homocyst(e)ine B, U A Cobalamin disorders Homocyst(e)ine B, U A CyStathionine 3-synthase deficiency Homocyst(e)ine B, U A Folate disorders Homocyst(e)ine B A Methionine adenosyltransferase deficiency Homocyst(e)ine B A Nonketotic hyperglycinemia Homocysteine-cysteine B A CyStathionine 3-synthase deficiency disulfide Homocysteine-cysteine U A Cystinuria disulfide Homocysteine-cysteine B A Hyperhomocysteinemia disulfide Hydroxylysine U A Hydroxylysinuria Hydroxyproline U A Familial renal iminoglycinuria Hydroxyproline U A Hydroxyprolinuria Hydroxyproline U A Hyperprolinemia I & II midodipeptides U A Prolidase deficiency soleucine B, U A E. Lipoamide dehydrogenase deficiency soleucine B, U A Maple syrup urine disease Leucine B, U A E. Lipoamide dehydrogenase deficiency Leucine B, U A Maple syrup urine disease US 2016/0076021 A1 Mar. 17, 2016 17

TABLE 2-continued Pathological values differential diagnosis of inborn eOS

Amino acid Source Value Value Disorder(s) Lysine B w Creatine deficiency Lysine U A Cystinuria Lysine U A Dibasic aminoaciduria Lysine B w HHH syndrome Lysine B, U A Hyperlysinemia Lysine U A Lysinuric protein intolerance Lysine B w Ornithine aminotransferase deficiency (gyrate atrophy) Lysine B A Pyruvate carboxylase deficiency type B Lysine B, U A Saccharopinuria B-Mercaptolactate- U A 3-mercaptolactate-cysteine disulfiduria cysteine disulfide Methionine P, CSF A Adenosine deaminase deficiency Methionine B w Cobalamin disorders Methionine B, U A CyStathionine 3-synthase deficiency Methionine B A Hypermethioninemias Methionine CSF w Methylenetetrahydrofolate reductase deficiency Methionine sulfoxide B A CyStathionine 3-synthase deficiency Methionine sulfoxide B A Hypermethioninemias Ornithine B A Creatine deficiency Ornithine U A Cystinuria Ornithine B w A-Pyrroline-5-carboxylate synthase deficiency Ornithine U A Dibasic aminoaciduria Ornithine B A HHH syndrome Ornithine U A Hyperlysinemia Ornithine U A Lysinuric protein intolerance Ornithine B A Ornithine aminotransferase deficiency (gyrate atrophy) Phenylalanine B A Hereditary tyrosinemia I Phenylalanine B, U A Hyperphenyalaninemia Phenylalanine B A Neonatal transient tyrusinemia Phenylalanine B, U A PKU Phenylalanine B, U A Pterin disorders Phosphoethanolamine U A Hypophosphatasia (rickets) o-Phosphohydroxylysine U A o-Phosphohydroxylysinuria Pipecolic acid B A Hyperlysinemia Pipecolic acid U A Hyperprolinemia II Pipecolic acid B, U A Peroxisomal disorders Proline B w A-Pyrroline-5-carboxylate synthase deficiency Proline U A Familial renal iminoglycinuria Proline B, U A Hyperprolinemia I & II Proline B A Pyruvate carboxylase deficiency type B Saccharopine B, U A Saccharopinuria Sarcosine B, U A Glutaric acidemia II Sarcosine B, U A Mitochondrial disorders Sarcosine B, U A Sarcosinemia Serine B w CyStathionine 3-synthase deficiency Serine B, CSF w Serine deficiency disorders S-Sulfocysteine B, U A Molybdenum cofactor deficiency S-Sulfocysteine B, U A Sulfite oxidase deficiency Taurine U A 3-Alaninemia Taurine U A Molybdenum cofactor deficiency Taurine U A Sulfite oxidase deficiency Tryptophan U A Tryptophanuria Tyrosine B, U A 4-Hydroxyphenylpyruvate dioxygenase deficiency (Tyrosinemia III) Tyrosine B, U A 4-Hydroxyphenylpyruvate oxidase deficiency Tyrosine B, U A Fumarylacctoaectase deficiency (Tyrosinemia I) Tyrosine B, U A Neonatal transient tyrosinemia Tyrosine B w PKU Tyrosine B w Pterin disorders Tyrosine B, U A Tyrosine aminotransferase deficiency (Tyrosinemia II) Valine B, U A E3 Lipoamide dehydrogenase deficiency Valine B, U A Hypervalinemia Valine B, U A Maple syrup urine disease B, blood; U, urine; CSF, cerebrospinal fluid; H, high; L, low, US 2016/0076021 A1 Mar. 17, 2016

0188 Diagnostic methods discussed above can be useful sequence identity=X/Y100, where X is the number of resi for urine samples. Urine is presently understood to be a com dues scored as identical matches by the sequence alignment plex matrix for analysis, dependent on kidney filtration and program's or algorithms alignment of A and B and Y is the reabsorption efficacy, often requiring collection of 24-hour total number of residues in B. If the length of sequence A is urines, often under professional Supervision in metabolic not equal to the length of sequence B, the percent sequence wards. Aside from Standardization against creatinine, many identity of A to B will not equal the percent sequence identity analytes require deconjugation procedures, derivatizations, of B to A. extraction, or solid state isolation steps. Methods described 0194 Generally, conservative substitutions can be made at herein can replace traditionally challenging procedures, typi any position so long as the required activity is retained. Dele cally used for confirmatory second-tier assays, with simple tion is the replacement of a nucleic acid by a direct bond. and rapid protocols suitable for routine use “next-to-subject’. Positions for deletions include the termini and linkage posi 0189 In the context of newborn screening, urinalysis has tions. Insertions are introductions of nucleic acids into the been validated based on post-derivatization GC-MS with chain, a direct bond formally being replaced by one or more standard additions for more than 130 different inborn meta nucleic acids. Nucleic acid sequence can be modulated with bolic inflictions (see Matsumoto 1996 Mass Spectrometry the help of art-known computer simulation programs. Reviews 15, 43-57). Methods described herein can avoid the (0195 Kits more laborious and complicated GC-MS analysis. Such a 0196. Also provided are kits. Such kits can include an break through is provided by aptameric sensors, with their agent or composition described hereinand, in certain embodi ability to transduce adaptive binding into a signal, described ments, instructions for administration. Such kits can facilitate herein. performance of the methods described herein. When supplied 0190. In healthy urine, sets of two specific or optimized as a kit, the different components of the composition can be differentially responsive aptameric sensors can have very packaged in separate containers and admixed immediately similar ratios of responses; in urines with gross shifts, these before use. Components include, but are not limited to target ratios can change dramatically, regardless of renal filtration. molecule, derivatization agent, aptamer, or materials or For example, aside from the detection of allo-isoleucine, the reagents for identification or isolation of an aptamer. Such diagnosis of MSUD is conventionally made based on the ratio packaging of the components separately can, if desired, be of leucine and isoleucine to phenylalanine in chromatographs presented in a pack or dispenser device which may contain of derivatives. According to compositions and methods one or more unit dosage forms containing the composition. described herein, the same effect can be achieved in a single The pack may, for example, comprise metal or plastic foil step measurement. Such as a blister pack. Such packaging of the components (0191 Molecular Biology separately can also, in certain instances, permit long-term 0192 Design, generation, and testing of the variant nucle storage without losing activity of the components. otides having the above required percent identities and retain 0.197 Kits may also include reagents in separate contain ing a required aptameric activity is within the skill of the art. ers such as, for example, sterile water or saline to be added to For example, directed evolution and rapid isolation of a lyophilized active component packaged separately. For mutants can be according to methods described in references example, sealed glass ampules may contain a lyophilized including, but not limited to, Link et al. (2007) Nature component and in a separate ampule, sterile water, sterile Reviews 5(9), 680-688; Sanger et al. (1991) Gene 97(1), saline or sterile each of which has been packaged under a 119-123; Ghadessy et al. (2001) Proc Natl Acad Sci USA neutral non-reacting gas, such as nitrogen. Ampules may 98(8) 4552-4557. Thus, one skilled in the art could generate consist of any Suitable material, such as glass, organic poly a large number of nucleotide variants having, for example, at mers, such as polycarbonate, polystyrene, ceramic, metal or least 90–99% identity (e.g., 95%) to a reference sequence any other material typically employed to hold reagents. Other described herein and screen such for desired phenotypes examples of suitable containers include bottles that may be according to methods routine in the art. fabricated from similar Substances as ampules, and envelopes 0193 Nucleotide and/or amino acid sequence identity per that may consist of foil-lined interiors. Such as aluminum or cent (%) is understood as the percentage of nucleotide or an alloy. Other containers include test tubes, vials, flasks, amino acid residues that are identical with nucleotide or bottles, Syringes, and the like. Containers may have a sterile amino acid residues in a candidate sequence in comparison to access port, such as a bottle having a stopper that can be a reference sequence when the two sequences are aligned. To pierced by a hypodermic injection needle. Other containers determine percent identity, sequences are aligned and if nec may have two compartments that are separated by a readily essary, gaps are introduced to achieve the maximum percent removable membrane that upon removal permits the compo sequence identity. Sequence alignment procedures to deter nents to mix. Removable membranes may be glass, plastic, mine percent identity are well known to those of skill in the rubber, and the like. art. Often publicly available computer software such as 0.198. In certain embodiments, kits can be supplied with BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR) soft instructional materials. Instructions may be printed on paper ware is used to align sequences. Those skilled in the art can or other Substrate, and/or may be Supplied as an electronic determine appropriate parameters for measuring alignment, readable medium, such as a floppy disc, mini-CD-ROM, CD including any algorithms needed to achieve maximal align ROM, DVD-ROM, Zip disc, videotape, audio tape, and the ment over the full-length of the sequences being compared. like. Detailed instructions may not be physically associated When sequences are aligned, the percent sequence identity of with the kit; instead, a user may be directed to an Internet web a given sequence A to, with, or against a given sequence B site specified by the manufacturer or distributor of the kit. (which can alternatively be phrased as a given sequence A that 0199 Compositions and methods described herein utiliz has or comprises a certain percent sequence identity to, with, ing molecular biology protocols can be according to a variety or against a given sequence B) can be calculated as: percent of standard techniques known to the art (see, e.g., Sambrook US 2016/0076021 A1 Mar. 17, 2016

and Russel (2006) Condensed Protocols from Molecular “includes one or more steps is not limited to possessing only Cloning: A Laboratory Manual, Cold Spring Harbor Labora those one or more steps and can also cover other unlisted tory Press, ISBN-10; 0879697717: Ausubel et al. (2002) steps. Similarly, any composition or device that “comprises.” Short Protocols in Molecular Biology, 5th ed., Current Pro “has' or “includes one or more features is not limited to tocols, ISBN-10: 0471250929; Sambrook and Russel (2001) possessing only those one or more features and can cover Molecular Cloning: A Laboratory Manual, 3d ed., Cold other unlisted features. Spring Harbor Laboratory Press, ISBN-10: 0879695773: 0204 All methods described herein can be performed in Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, any suitable order unless otherwise indicated herein or oth 747-754; Studier (2005) Protein Expr Purif. 41(1), 207-234: erwise clearly contradicted by context. The use of any and all Gellissen, ed. (2005) Production of Recombinant Proteins: examples, or exemplary language (e.g. "Such as') provided Novel Microbial and Eukaryotic Expression Systems, Wiley with respect to certain embodiments herein is intended VCH, ISBN-10: 35273 10363; Baneyx (2004) Protein merely to better illuminate the present disclosure and does not Expression Technologies, Taylor & Francis, ISBN-10: pose a limitation on the scope of the present disclosure oth 0.954523253). erwise claimed. No language in the specification should be 0200 Definitions and methods described herein are pro construed as indicating any non-claimed element essential to vided to better define the present disclosure and to guide those the practice of the present disclosure. of ordinary skill in the art in the practice of the present 0205 Groupings of alternative elements or embodiments disclosure. Unless otherwise noted, terms are to be under of the present disclosure disclosed herein are not to be con stood according to conventional usage by those of ordinary Strued as limitations. Each group member can be referred to skill in the relevant art. and claimed individually or in any combination with other 0201 In some embodiments, numbers expressing quanti members of the group or other elements found herein. One or ties of ingredients, properties Such as molecular weight, reac more members of a group can be included in, or deleted from, tion conditions, and so forth, used to describe and claim a group for reasons of convenience or patentability. When any certain embodiments of the present disclosure are to be under Such inclusion or deletion occurs, the specification is herein stood as being modified in Some instances by the term deemed to contain the group as modified thus fulfilling the “about.” In some embodiments, the term “about is used to written description of all Markush groups used in the indicate that a value includes the standard deviation of the appended claims. mean for the device or method being employed to determine 0206 Citation of a reference herein shall not be construed the value. In some embodiments, the numerical parameters as an admission that such is prior art to the present disclosure. set forth in the written description and attached claims are 0207 Having described the present disclosure in detail, it approximations that can vary depending upon the desired will be apparent that modifications, variations, and equivalent properties sought to be obtained by a particular embodiment. embodiments are possible without departing the scope of the In some embodiments, the numerical parameters should be present disclosure defined in the appended claims. Further construed in light of the number of reported significant digits more, it should be appreciated that all examples in the present and by applying ordinary rounding techniques. Notwith disclosure are provided as non-limiting examples. standing that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present EXAMPLES disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as practi 0208. The following non-limiting examples are provided cable. The numerical values presented in Some embodiments to further illustrate the present disclosure. It should be appre of the present disclosure may contain certain errors necessar ciated by those of skill in the art that the techniques disclosed ily resulting from the standard deviation found in their respec in the examples that follow represent approaches the inven tive testing measurements. The recitation of ranges of values tors have found function well in the practice of the present herein serves as a shorthand method of referring individually disclosure, and thus can be considered to constitute examples to each separate value falling within the range. Unless other of modes for its practice. However, those of skill in the art wise indicated herein, each individual value is incorporated should, in light of the present disclosure, appreciate that many into the specification as if it were individually recited herein. changes can be made in the specific embodiments that are Similarly, it is understood that recitation of ranges of values disclosed and still obtain a like or similar result without herein serves as a shorthand method of referring to ranges departing from the spirit and scope of the present disclosure. between each of the recited values. Example 1 0202. In some embodiments, the terms “a” and “an and “the and similar references used in the context of describing a particular embodiment (especially in the context of certain Selection Principles of the following claims) can be construed to cover both the 0209. The following example describes the selection pro singular and the plural, unless specifically noted otherwise. In tocol. A solution-phase protocol was used as the starting point Some embodiments, the term 'or' as used herein, including for selection to identify aptameric sensors for steroids Suit the claims, is used to mean “and/or unless explicitly indi able for cross-reactive arrays 12-14. A receptor*target com cated to refer to alternatives only or the alternatives are mutu plex is used to selectively interact with the aptamer (see e.g., ally exclusive. FIG. 1B). 0203 The terms “comprise.” “have” and “include” are 0210. A capture oligonucleotide, complementary to the open-ended linking verbs. Any forms or tenses of one or more part of the primer of a library of random oligonucleotides is of these verbs, such as “comprises.” “comprising.” “has.” displayed within the affinity matrix in a chromatography col “having.”99 “includes”& and “including.” are also open-ended. umn. A capture oligonucleotide is shown in FIG. 1B, where C For example, any method that “comprises.” “has or is attached to streptavidin column viabiotin B at 3' end. A US 2016/0076021 A1 Mar. 17, 2016 20 library of random oligonucleotides is shown in FIG. 1B, association constants of amino acids with the receptor. where N(m) represents a random region of m bases, with m Counter-selection was performed by adding the receptor in being any number between 1 and 100. Bases shown in FIG. the absence of tyrosine to the elution buffer. These conditions 1B are primer regions used for PCR. reduced opportunities for favoring aptamers in selection that 0211. The capture strand is used to immobilize the library would bind to the receptor in the absence of target. members and Solution-phase target(s) is applied during the 0218 Intermittent counter selections with tyrosine were affinity elution step. Aptameric structures within this library also introduced to maximize binding to complex itself. After that interact with target molecule(s) in a way that promotes eleven rounds of selection, the cloned pool was analyzed and the formation of a stem competing with the capture oligo significant convergence was observed, with nucleotide (i.e., displacing the capture oligonucleotide) will 0219 Cp*Rh(III)*Tyr binding motif (see e.g., FIG. 3B). be preferably eluted from the column and, thus, favored dur The selection directly led to an aptamer in the form that was ing the selection process. The method is very convenient as it Suitable for a competitive assay with oligonucleotide (see directly yields aptamers in an easy-to-test sensor form at the e.g., FIG. 3C). The sensor showed near-absolute selectivity end of the selection 15,16. for the complex over its individual components and over 0212 Here, synthetic receptors are added to the affinity tested examples of natural amino acids, but for the Small elution step in the presence of an excess of target molecule response to phenylalanine (see e.g., FIG.3E). The half-satu itself, to push the equilibrium towards the formation of com ration point in the selection buffer for a sensor in a competi plex between receptor and target, while also counter-select tive assay was between 250-300 nM, which allowed the deter ing against target and receptor individually. This procedure mination of calculated K for the complex of 22-25 nM. This results in favoring the elution of aptamers that interact (form value is approximately an order of magnitude higher than the the stem) selectively with the complex (see e.g., FIG. 1A-B). tightest binding aptamer against any amino acid (cf., argin ine) 19. In parallel, SELEX was performed in the absence of Example 2 a receptor, but under otherwise identical conditions and no sensors capable of sensing tyrosine were isolated according Aptameric Sensor with Tyrosine as Target to this conventional approach. 0213. The following example describes the high-affinity 0220 Because Cp*Rh(III) is a non-specific receptor, other and high-specificity, low complexity aptameric sensors, tar amino acids and potential ligands could compete in mixtures. geting tyrosine. But the high affinity of a sensor can enable detection of small 0214. The first target was chosen based on the desire to changes of concentration of target in complex mixtures at compare results of a standard SELEX protocol without addi high dilutions (500-1000). tion of any receptor, for a target that can be representative of 0221) To demonstrate this principle, tyrosine was added to a “typical Small organic molecule. The amino acid, tyrosine, healthy sera at concentrations that would be characteristic for was selected based on characteristics Such as electron rich tyrosinemia. Upon dilution of serum 1:100-200 in detection aromatic group, only one positive charge, and a mediocre buffer, the sensor was clearly able to distinguish spiked from ability to form highly organized hydrogen bonding networks. non-spiked samples. Similar results were obtained with urine. These characteristics can be representative of typical targets 0222. The approach as described herein specifically tar (e.g., dopamine, cocaine) that are expected to bind to aptam gets the complexes of synthetic receptors and their ligands ers in a low-to-mid micromolar range, as it is indeed the case rather than individual components of the complex, rendering with a reported 63-mer receptor with K-35 uM 17. the approach different from more traditional incorporation of Tyrosine (see e.g., FIG. 3A) can also be an interesting target modified bases or cofactors into aptamers. This approach can from the clinical chemistry perspective. Increase in tyrosine provide for detection of Small concentrations of amino acids levels can indicate inborn metabolic errors (e.g., different in the presence of an excess of ligand (e.g., a highly diluted types of tyrosinemia). sample of a biological fluid containing an amino acid). 0215 Cp*Rh(III) was selected as a synthetic receptor for 0223 Human serum, which contains numerous com tyrosine (see e.g., FIG. 2, ref. 18 in the context of cross pounds forming complexes with a receptor, was obtained and reactive arrays for classification of amino acids, peptides, and serial diluted (before and after spiking it with 1 mM tyrosine). amino Sugars). This complex would add to the existing func The samples mimic dilutions of healthy serum and serum tionalities within tyrosine: a metal-ion coordination site, an characteristic of tyrosinemia. The two at dilutions of 1:80 and additional hydrophobic surface, and would eliminate several 1:160 were clearly distinguishable (see e.g., FIG. 3F). The rotational freedoms present in free tyrosine as well as the data indicates that an increase in tyrosine concentration char negative charge of carboxylate. A parallel selection was per acteristic for a disease at 1:100 dilution can be detected in the formed, as a control, without the addition of Cp*Rh(III). presence of an excess Cp*Rh(III), without any derivatization N(30) library was used to ensure full coverage of receptor and in the presence of numerous agents that would otherwise space in both selections. Because the complex should not be interfere. selective for amino acids, the selectivity should originate 0224. The protocols described in this example can also be from the aptamer. used for an array of aptamers to read compositions of amino 0216 Further, as other amino acids would compete for acids in highly diluted urine samples. The assay, as described binding, in a typical application an excess of complex would herein is the first of its kind in clinical chemistry that target convert all amino acids in highly diluted bodily fluids into complexes with high-specificity. complexes, with the aptamer picking up only one of them. 0225. In situ derivatization, with completely non-specific 0217. During selection, the Cp*Rh(III) was added at a organometallic receptors, such as Cp*Rh(III), can be used in concentration of 50 pM at the affinity elution step in the selection of aptamers to shift their selectivity and sensitivity presence of 1 mM tyrosine. These conditions ensured that the into practically useful ranges, by a combination of a solution receptor was over 90% in the complex based on an estimated phase SELEX and counter selection against individual com US 2016/0076021 A1 Mar. 17, 2016

ponents. More specifically, based on demonstrations with result, after 13 cycles a series of aptamers were isolated, that, tyrosine, a long standing problem has been solved: detection when turned into sensors (see e.g., FIG. 5B, FIG.5C) behaved of a change in an amino acid concentration in serum (or other as predicted and responded to an increase in glucose concen bodily fluids) with a simple dilute-and-measure assay. trations. 0232 A predominant aptameric glucose sensor in shown Example 3 in FIG. 5B, based on YKG-1. The response of this sensor at 520 nm to the addition of glucose in the presence of receptor Aptameric Sensor with Arginine as Target correlated with the response of receptor binding to glucose at 0226. The following example describes high-affinity and 427 nm (see FIG. 5F). The selectivity for glucose was high-specificity, low complexity aptameric sensors targeting improved. The symmetrical structure of the receptor, the arginine using the procedure as described in Examples 1-2. unusual shape of a binding isotherm, and binding of more Arginine was the target molecule, Cp*Rh was used as the than one equivalent of complex at Saturating conditions in receptor, and the sensor was based on AKArg-1. The sensor titration experiments of YKG-1 support the binding of two was highly selective over other amino acids including similar boronic acid-glucose complexes to one aptamer. citrulline (see e.g., FIG. 4). 0227. In situ derivatization, with completely non-specific 0233 Sensors specific for glucose (see e.g., FIG.5I, FIG. organometallic receptors, such as Cp*Rh(III), can be used in 5L), fructose (see e.g., FIG. 5.J. FIG.5M), and galactose (see selection of aptamers to shift their selectivity and sensitivity e.g., FIG. 5K, FIG.5N) were also identified. into practically useful ranges, by a combination of a solution 0234. In situ derivatization with a receptor designed to phase SELEX and counter selection against individual com have some degree of specificity. Such as Shinkai's sensor, can ponents. More specifically, based on demonstrations with be used in the selection of aptamers to shift their selectivity arginine, a long standing problem has been solved: detection and sensitivity into practically useful ranges, by a combina of a change in an amino acid concentration in serum (or other tion of a solution-phase SELEX and counter selection against bodily fluids) with a simple dilute-and-measure assay. individual components. Example 4 Example 5 Aptameric Sensor with Glucose as Target Aptameric Sensors with Unpaired Bases 0228. The following example describes the high-affinity and high-specificity, low complexity aptameric sensors, tar 0235. The following example shows a series of aptamers geting glucose. having a nucleic acid sequence with one or more unpaired 0229. Numerous attempts to isolate glucose binding bases such that a metal complex can bind a pocket formed by aptamers resulted in multiple candidate receptors that were the one or more unpaired bases and also binds the target somewhat responsive to fluorophore derivatized receptors at amino acid. An exemplary binding site is formed by the G-A higher millimolar concentrations (>50 mM), but were diffi mismatch Surrounded by binding base pairs (e.g., G-C. G-T. cult to reproduce. The control experiments, in which fluores A-T, A-U or analogs) as shown below (see FIG. 7A): cein would be attached to a double helical structure, yielded similar magnitudes of responses, leading to the conclusion that the aptamers isolated, even if real, would not have been Suitable analytical and nanotechnology applications. 0230 Interactions between boronic acids and diols can be used as a basis for construction of glucose-responsive sen sors. Here, a glucose-selective bis-boronic receptor (see e.g., FIG. 5A), with K for glucose of ~500 uM, was chosen. The bis-boronic receptor can be selective for glucose over other Sugars. The bis-boronic receptor can operate at physiological conditions. The transduction of a binding event of the Shin kai's receptor to glucose into a fluorescent signal, should provide an important internal control for any isolated HN aptamer. It is expected that fluorescence indicating the for mation of a complex should match any changes inaptameric sensor response. 0236 A series of aptamers were formed having an 0231. The Shinkai's receptor was synthesized from a bis unbound nucleic acid pocket (see e.g., FIG. 7B-G). FIG. aldehyde. During selection, the receptor was added at con 7B-G shows a Cp*Rh(III)-amino acid binding aptamer in centrations of 50 uMattheaffinity elution step in the presence sensor form along with the amino acid for which initial selec of 40 mM glucose: these conditions ensured that the receptor tion was performed (e.g., Tyr for FIG. 7B. Phe for FIG. 7C, was over 90% in the complex. Counter-selection was per Citrulline in FIG. 7D., Gln in FIG. 7E). In some aptamers, a formed by adding the receptor in the absence of glucose to the motif was recognized straight from folding programs, such as elution buffer. Counter-selection for glucose was not per in FIG. 7B-E. In some aptamers, a motif can be recognized formed separately because the response of aptamers to glu from primary sequence (i.e., motif does not necessarily show cose would have been considered beneficial on its own. in folding program, as in two Lys sensors). Such as in FIG. Through these conditions, opportunities for favoring aptam 7F-G. In some aptamers, an unbound nucleic acid pocket ers in selection that would bind to the receptor in the absence binds Cp*Rh (compare FIG. 7B-G), but can also bind other of glucose were minimized (see FIG. 5D: FIG. 5E). As a metals (compare Cu2+ in FIG. 7H). US 2016/0076021 A1 Mar. 17, 2016 22

0237. The following examples show a series of aptamers - Continued having at least two unpaired bases forming a pocket that binds a metal complex or an amino acid target molecule. SEQUENCE LISTING 0238 An exemplary motif having a plurality of unpaired SEQ ID NO: 3 bases forming a pocket that binds a metal complex or an Aptamer against glucose-boronic acid complex amino acid target molecule is shown in FIG. 8A. Exemplary Short binding form aptamers include an Arg selective aptamer (see e.g., FIG. 8B); GACAGCCGAGTGCATTCAACAGCCGAGTC a Trp selective aptamer (see e.g., FIG. 8C); a Gly selective SEQ ID NO: 4 aptamer (see e.g., FIG. 9A); an ASn selective aptamer (see Glucose-BA O1 e.g., FIG. 9C); and a Gly non-specific aptamer (see e.g., FIG. CTCGGGACGACAGCCGAGTTCAGGGATTCCCTAACAGCCGAGTCGTCCC 9C). SEO ID NO: 5 0239. The following examples shows an aptamer having Glucose-BA O7 multiple folding configurations (compare FIG. 10A and FIG. CTCGGGACGACAGCCGAGTTATGACATTCAATAACAGCCGAGTCGTCCC 10B), which is selective for Leu over Ile and has a plurality of SEQ ID NO: 6 unpaired bases forming a plurality of pockets, one of more of Glucose-BA 08 which pockets can bind a metal complex and also an amino CTCGGGACGACCAGCCGAGATTTTGCATAAAAACAGCCGAGGTCGTCCC acid target molecule. A Cp*Rh(III) can bind more than one SEO ID NO: 7 site. Such as additional Gs that can be targeted. Glucose-BA 09 CTCGGGACGACCAGCCGAGATAGGTCGTTCTATCAGCCGAGGTCGTCCC Example 6 SEQ ID NO: 8 Glucose-BA 10 Use of Aptameric Sensors with Unpaired Bases CTCGGGACGACAACCGAGTAGGATACTAAGCATCCAGCGGAGTCGTCCC 0240. The following example shows an aptamer with SEO ID NO: 9 unpaired bases that is reactive for Phe and cross-reactive for Glucose-BA 11 Trp, along with use thereof. CTCGGGACGACAGCCGAGGAAACAAACTTTTTTCCAGCCGAGTCGTCCC 0241 An aptamera plurality of unpaired bases and reac SEQ ID NO: O Glucose-BA 12 tive for Phe and cross-reactive for Trp is shown in FIG. 11A. CTCGGGACGACCGCGGGAGCAATGCGATGACGAAGGACGGGGTCGTCCC This aptamer was used to detected Phe concentration (uM) as a function of time (hr) in serum samples from capillary blood SEQ ID NO: 1. of a female subject (TWP) and a male subject (MNS) that Glucose-BA 13 took 100 mg of phenylanine per kg body weight by mouth at CTCGGGACGACCGGAGCTCCTGCGATTGACTAAAAGGAAGGTCGTCCC time zero (see e.g., FIG. 11B). The phenylalanine concentra SEQ ID NO: 12 tion in blood rises significantly at this dosage (see 1 hr in FIG. Glucose-BA 14 11B). Every hour, blood was measured for the phenylalanine CTCGGGACGACAGCCGAGTCAAAGTTTAACTTGACAGCCGAGTCGTCCC concentration. In a healthy Subject, the enzymes that break SEQ ID NO: 13 down phenylalanine (e.g., phenylalanine hydroxylase (PAH) Glucose-BA 15 or BH4-cofactor, alone or together) are stimulated and break CTCGGGACGACGGGGAACGTTTTCGTGGATGAGCTGGCGACGTCGTCCC down phenylalanine resulting in decreased concentration (see SEQ ID NO: 14 2-5 hr in FIG. 11B). In subjects with PKU this does not Glucose-BA 16 happen, as PKU is caused by mutations in the degrading CTCGGGACGACGGGGGAGAGTATTGGATGACCGCAGGGACCGTCGTCCC enzymes. SEQ ID NO: 5 0242 An aptamera plurality of unpaired bases and reac lucose-BA 17 tive for Phe is shown in FIG. 12A. This aptamer sensor TCGGGACGACGGGGGGAACATTGTGATCTCGTTAGAGCACGTCGTCCC mixture (not including Cp*Rh) was incubated with concen EQ ID NO: 16 trations of amino acids (Phe, Tyr, Trp, Gly) and fluorescence LUBAO2 (RFU) measured (see e.g., FIG. 12B). TCTCGGGACGACGGACCGTTAGGGGAGCCAGTGCGCGATGACGTCGTCC 0243 An aptamera plurality of unpaired bases and reac tive for Phe is shown in FIG. 12C. This aptamer sensor mix SEO ID NO: 17 ture (not including Cp*Rh) was incubated with concentra GLUBAO9 tions of amino acids (Phe, Trp, Tyr) and fluorescence (RFU) CTCTCGGGACGACAGCCGAGTTCAGGGAcTTCCCTAACAGCCGAGTCGTC measured (see e.g., FIG. 12D). CC SEQ ID NO: 18 GLUBA09 M1 SEQUENCE LISTING CTCTCGGGACGACAGCCGAGTTGATTCAACAGCCGAGTCGTCCC SEO ID NO: 1 SEQ ID NO: 19 5' primer end of library oligonucleotides GLUBA17 CTCTCGGGACGAC CTCTCGGGACGACAGCCGAGCACTACATTAGTTGGGCAGCCGAGTCGTCC C SEO ID NO: 2 3' primer end of library oligonucleotides SEQ ID NO: 2O GTCGTCCC GLUBAN3W10 CTCTCGGGACGACGACCGTAGGGGTAGCTGTATATGCGGATGAGTCGTCC C

US 2016/0076021 A1 Mar. 17, 2016 25

- Continued

Ctct cqggac gac 13

<210s, SEQ ID NO 2 &211s LENGTH: 8 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; 3' primer end of library oligonucleotides

<4 OOs, SEQUENCE: 2 gtcgt.ccc

<210s, SEQ ID NO 3 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Aptamer against glucose-boronic acid complex; Short binding form

<4 OOs, SEQUENCE: 3 gacago.cgag to attcaac agc.cgagtic 29

<210s, SEQ ID NO 4 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 01

<4 OOs, SEQUENCE: 4

Ctcgggacga cagc.cgagtt Cagggattico Ctaac agc.cg agt cqtcCC 49

<210s, SEQ ID NO 5 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA O7

<4 OOs, SEQUENCE: 5

Ctcgggacga cagc.cgagtt atgacattca atalacagc.cg agt cqtcCC 49

<210s, SEQ ID NO 6 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 08 <4 OOs, SEQUENCE: 6

Ctcgggacga C cago.cgaga ttittgcataa aaa.ca.gc.cga ggit cqtcCC 49

<210s, SEQ ID NO 7 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 09

<4 OO > SEQUENCE: 7

Ctcgggacga C cago.cgaga taggit cqttic tat cago.cga ggit cqtcCC 49 US 2016/0076021 A1 Mar. 17, 2016 26

- Continued

<210s, SEQ ID NO 8 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 10

<4 OOs, SEQUENCE: 8

Ctcgggacga caa.ccgagta ggatactaag catccagogg agt cqtcCC 49

<210s, SEQ ID NO 9 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 11

<4 OOs, SEQUENCE: 9

Ctcgggacga cagc.cgagga aacaaactitt ttt coagc.cg agt cqtcCC 49

<210s, SEQ ID NO 10 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 12

<4 OOs, SEQUENCE: 10

Ctcgggacga cc.gcgggagc aatgcgatga caaggacgg ggit cqtcCC 49

<210s, SEQ ID NO 11 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 13

<4 OOs, SEQUENCE: 11

Ctcgggacga cc.ggagct co to gattgac taaaaggaag gtcgt.ccc 48

<210s, SEQ ID NO 12 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 14 <4 OOs, SEQUENCE: 12

Ctcgggacga cagc.cgagtic aaagtttaac ttgacagc.cg agt cqtcCC 49

<210s, SEQ ID NO 13 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 15

<4 OOs, SEQUENCE: 13

Ctcgggacga C9gggaacgt titt.cgtggat gagctggcga C9tcgt.ccc 49

<210s, SEQ ID NO 14 &211s LENGTH: 49 &212s. TYPE: DNA US 2016/0076021 A1 Mar. 17, 2016 27

- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 16

<4 OOs, SEQUENCE: 14

Ctcgggacga C9ggggagag tattggatga cc.gcagggac ct cqtcCC 49

<210s, SEQ ID NO 15 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glucose-BA 17

<4 OOs, SEQUENCE: 15

Ctcgggacga C9gggggaac attgttgat ct cqttagagca C9tcgt.ccc 49

<210s, SEQ ID NO 16 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAO2

<4 OOs, SEQUENCE: 16

Ctct cqggac gacggaccgt taggggagcc agtgcgcgat gacgt.cgt.cc C 51

<210 SEQ ID NO 17 &211s LENGTH: 52 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAO9

<4 OOs, SEQUENCE: 17

Ctct cqggac gacagc.cgag titcagggact tcc ctaa.cag ccgagtcgt. C cc 52

<210s, SEQ ID NO 18 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAO9 M1 <4 OOs, SEQUENCE: 18

Ctct cqggac gacagc.cgag ttgattcaac agc.cgagtcg tcc C 44

<210s, SEQ ID NO 19 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBA17

<4 OOs, SEQUENCE: 19

Ctct cqggac gacagc.cgag cactacatta gttgggcagc cagt catcc C 51

<210s, SEQ ID NO 2 O &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAN3W10 US 2016/0076021 A1 Mar. 17, 2016 28

- Continued

<4 OOs, SEQUENCE: 2O

Ctct cqggac gacgaccgta ggggtagctg. tatatgcgga tigagt catcc C 51

<210s, SEQ ID NO 21 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAN3W11

<4 OOs, SEQUENCE: 21

Ctct cqggac gaCagggggt agggggg.ccg gactgttaag ggtgtcgt.cc C 51

<210s, SEQ ID NO 22 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLUBAN3W19

<4 OOs, SEQUENCE: 22

Ctct cqggac gacgggacca accgggatga gcatalagtgc gacgt.cgt.cc C 51

<210s, SEQ ID NO 23 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: synthetic DNA sequence; FrucBAO2

<4 OOs, SEQUENCE: 23

Ctct cqggac gacggctggc acgtttggitt Caagaatgtg ggtgtcgt.cc C 51

<210s, SEQ ID NO 24 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; FrucBAO2 M1

<4 OOs, SEQUENCE: 24

Ctct cqggac gacggctggc acgttgaatg tdggtgtcgt CCC 43

<210s, SEQ ID NO 25 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; FrucBAO5 <4 OOs, SEQUENCE: 25

Ctct cqggac gacggacaga ggttctgagcg togctictag gaagt catcc C 51

<210s, SEQ ID NO 26 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GalacBAO1

<4 OOs, SEQUENCE: 26

Ctct cqggac gacccaggtg tcc tectt ct cagtag tagg ttagt catcc C 51 US 2016/0076021 A1 Mar. 17, 2016 29

- Continued

<210s, SEQ ID NO 27 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GalacBAO4

<4 OOs, SEQUENCE: 27

Ctct cqggac gaccactacg cat agtttct atcgc.cagga agggit catcc C 51

<210s, SEQ ID NO 28 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GalacBAO6

<4 OOs, SEQUENCE: 28

Ctct cqggac gaccgagtag gtgtc.ctgga tigcaggtttg gaggt catcc C 51

<210s, SEQ ID NO 29 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; BAOnly O1

<4 OOs, SEQUENCE: 29

Ctct cqggac gaccaggtgg ggctgcticaa gtggaggttc Ctcgt.cgt.cc C 51

<210s, SEQ ID NO 3 O &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; BAOnly03

<4 OOs, SEQUENCE: 30

Ctct cqggac gaccagaggg gcct caaatg tdgggtgttg Ctcgt.cgt.cc C 51

<210s, SEQ ID NO 31 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Aptamer against Arginine-CpRh complex; Short binding form

<4 OOs, SEQUENCE: 31 gacgacacgg gcgt.ccctta t cacaaggag agtgagtic 38

<210s, SEQ ID NO 32 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Arginine-CpRh O2

<4 OOs, SEQUENCE: 32

Ctct cqggac gacgggtgtc. cctgtggacc ttacat agg agagt catcc C 51

<210s, SEQ ID NO 33 &211s LENGTH: 51 US 2016/0076021 A1 Mar. 17, 2016 30

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Arginine-CpRh 03

<4 OOs, SEQUENCE: 33 Ctct cqggac gacgcgggtg tcc cttggta aaccalaggag agtgtcgt.cc C 51

<210s, SEQ ID NO 34 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Arginine-CpRh 04

<4 OOs, SEQUENCE: 34 Ctct cqggac gacggctagg agaggtgtcc gggtgtc.cca ggtgtcgt.cc C 51

<210s, SEQ ID NO 35 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Arginine-CpRh_05

<4 OOs, SEQUENCE: 35 Ctct cqggac gacccacgag agact coaaa cattgc.cgt CCC 43

<210s, SEQ ID NO 36 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; ARGO1 Cp <4 OOs, SEQUENCE: 36 Ctct cqggac gacgacacgg gcgt.ccct tc acaaggagag tagt catcc C 51

<210s, SEQ ID NO 37 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; AspacpO1

<4 OO > SEQUENCE: 37 Ctct cqggac gacggc actt gttgcgtgaa gog tatgcga at agt catcc C 51

<210s, SEQ ID NO 38 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Aspacp03

<4 OOs, SEQUENCE: 38

Ctct cqggac gacgggccac gttitt coagg tactittctaa ggggt catcc C 51

<210s, SEQ ID NO 39 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Aspacp04 US 2016/0076021 A1 Mar. 17, 2016 31

- Continued

<4 OOs, SEQUENCE: 39

Ctct cqggac gacgggcctt C9gtggctga gcatagdgat ggggt catcc C 51

<210s, SEQ ID NO 4 O &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; CIT3 ONO2. CpRh

<4 OOs, SEQUENCE: 4 O

Ctct cqggac gacggcgggg aaa.ca.gctgc aaaatgtgga gtagt catcc C 51

<210s, SEQ ID NO 41 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GlutaCp O2

<4 OOs, SEQUENCE: 41

Ctct cqggac gacggcgggt gaatgcacac ttagcagaga gtagt catcc C 51

<210s, SEQ ID NO 42 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GlutaCp15

<4 OOs, SEQUENCE: 42

Ctct cqggac gacggcgggg aaaggaccct agttcctggit gtagt catcc C 51

<210s, SEQ ID NO 43 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Aptamer against Glycine-CpRh complex; Short binding form

<4 OOs, SEQUENCE: 43 gacgggctag gC9tgggtgt aaaggcacag gigtc. 35

<210s, SEQ ID NO 44 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Glycine-CpRh O1

<4 OOs, SEQUENCE: 44 tCgggacgac giggctagg.cg tdggtgtaaa gCacagggg. tcgtc.ccga 49

<210s, SEQ ID NO 45 &211s LENGTH: 50 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Gly-Cp sensor

<4 OOs, SEQUENCE: 45 US 2016/0076021 A1 Mar. 17, 2016 32

- Continued

Ctct cqggac gacgggctag gcgtgggtgt aaaggcacag gggtcgt.ccc SO

<210s, SEQ ID NO 46 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Gly-Cp sensor--1bp

<4 OOs, SEQUENCE: 46 Ctct cqggac gacgggctag gcgtgggtgt aaaggcacag gggtcgt.ccc g 51

<210s, SEQ ID NO 47 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; GLYHW-CpRh O6

<4 OOs, SEQUENCE: 47 Ctct cqggac gacgggtcag ttaga.ccgtg aggct tccga at agt catcc C 51

<210s, SEQ ID NO 48 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; LeucipO1

<4 OOs, SEQUENCE: 48 Ctct cqggac gacggcgggg gtcc.ca.gc.gt to atggtgt gtagt catcc C 51

<210s, SEQ ID NO 49 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; LeucipO4

<4 OOs, SEQUENCE: 49 Ctct cqggac gacggcgggc gcgtgatcgg agagaaaggt gtagt catcc C 51

<210s, SEQ ID NO 50 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Leucp17

<4 OOs, SEQUENCE: 50 Ctct cqggac gacggcgggc gcg tatgt at at catalaggt gtagt catcc C 51

<210s, SEQ ID NO 51 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; LysCpO5

<4 OOs, SEQUENCE: 51

Ctct cqggac gacgcggtgt ggat.ccct c tagaaggagt agtgtcgt.cc C 51

<210s, SEQ ID NO 52 US 2016/0076021 A1 Mar. 17, 2016 33

- Continued

&211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; LysCpRh18

<4 OOs, SEQUENCE: 52

Ctct cqggac gacgggtggg agcgatt.cga gct acticagg tatgtcgt.cc C 51

<210s, SEQ ID NO 53 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; PACpRho1

<4 OOs, SEQUENCE: 53

Ctct cqggac gacggacgct aatct tacaa gggcgtagtg tatgtcgt.cc C 51

<210s, SEQ ID NO 54 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; PACpRho2

<4 OOs, SEQUENCE: 54

Ctct cqggac gaccgc.cgat aatct cacaa gggcgitatica aaggt catcc C 51

<210s, SEQ ID NO 55 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; PACpRho3

<4 OO > SEQUENCE: 55

Ctct cqggac gacggg tagg gatgtctaat ccc.ggcggga gctgtcgt.cc C 51

<210s, SEQ ID NO 56 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; HPheAlO4

<4 OOs, SEQUENCE: 56

Ctct cqggac gaccgc.gttt CCC aagaaag caagttittgg ttggt catcc C 51

<210s, SEQ ID NO 57 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; HTrp03

<4 OO > SEQUENCE: 57

Ctct cqggac gaccgcggta gtc.ttalacct aaag.cggtgt Caggit catcc C 51

<210s, SEQ ID NO 58 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2016/0076021 A1 Mar. 17, 2016 34

- Continued <223> OTHER INFORMATION: synthetic DNA sequence; Aptamer against Tyrosine-CpRh complex; Short binding form

<4 OOs, SEQUENCE: 58 gacggc.ccga t ct cagagta gtc 23

<210s, SEQ ID NO 59 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh O2 <4 OO > SEQUENCE: 59 tctcgggacg acggc.ccgaa ttgtaagta gtcgt.ccc 38

<210s, SEQ ID NO 60 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh_03

<4 OOs, SEQUENCE: 60 tctcgggacg acggc.ccgat gttccagagt agt catcCC 39

<210s, SEQ ID NO 61 <211 LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh_04

<4 OOs, SEQUENCE: 61 tctcgggacg acggc.ccgat gatgt attcg agtagt catc cc 42

<210s, SEQ ID NO 62 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh O5

<4 OOs, SEQUENCE: 62

Ctcgggacga C9gc.ccgtag at attagtag ticgt.ccc 37

<210s, SEQ ID NO 63 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh O6

<4 OOs, SEQUENCE: 63 tctcgggacg acggc.ccgca ttaattagta gtcgt.ccc 38

<210s, SEQ ID NO 64 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh O7

<4 OOs, SEQUENCE: 64 US 2016/0076021 A1 Mar. 17, 2016 35

- Continued tctcgggacg acggc.ccgaa actgagtagt cqt ccc 36

<210s, SEQ ID NO 65 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh_08

<4 OOs, SEQUENCE: 65 tctcgggacg acggc.ccgag cactaggagt agt catcCC 39

<210s, SEQ ID NO 66 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh 09

<4 OOs, SEQUENCE: 66 tctcgggacg acggc.ccgat agtagagtag ticgt.ccc 37

<210s, SEQ ID NO 67 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh 10

<4 OO > SEQUENCE: 67 Ctct cqggac gacggc.ccga gataatcaag tagt cqt ccc 4 O

<210s, SEQ ID NO 68 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh 11

<4 OOs, SEQUENCE: 68 Ctct cqggac gacggc.ccga acatatgtaa gtagt catcc C 41

<210s, SEQ ID NO 69 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh 12

<4 OOs, SEQUENCE: 69 Ctct cqggac gacggc.ccga tatgtaatta gtagt catcc C 41

<210s, SEQ ID NO 70 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic DNA sequence; Tyrosine-CpRh 13

<4 OO > SEQUENCE: 7 O

Ctct cqggac gacggc.ccga catcatcatC agtatataga gtagt catcc C 51 US 2016/0076021 A1 Mar. 17, 2016 36

- Continued

SEO ID NO 71 LENGTH: 38 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic DNA sequence; Tyr-CpRh (38nt)

< 4 OOs SEQUENCE: 71.

Ctct cqggac gacggc.ccga t ct cagagta gtcgt.ccc 38

SEO ID NO 72 LENGTH: 51 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic DNA sequence; HTyrs O7

< 4 OOs SEQUENCE: 72

Ctct cqggac gaccalagcga gtagtaacac ggc.ccgacac tiggit catcc C 51

SEO ID NO 73 LENGTH: 51 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic DNA sequence; Cu(II) Phe O1

SEQUENCE: 73

Ctct C9ggac gacgaggctg gatgcatt C9 CC9gatgttc gatgtcgt.cc C 51

SEO ID NO 74 LENGTH: 51 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic DNA sequence; Cu (II) -Phel O

<4 OOs, SEQUENCE: 74

Ctct cqggac gaCaaggit co Ctttcgtaga t caggaagt attgtcgt.cc C 51

SEO ID NO 75 LENGTH: 49 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic DNA sequence; Cu (II) -PhelO49nt

<4 OO > SEQUENCE: 75

Ctct cqggac gaCagg tocc titt.cgtagat Caggaagta t t cqtcCC 49

What is claimed is: 2. The method of claim 1, wherein isolating the aptamer 1. A method for isolating anaptamer specific for a complex that binds to the target complex comprises removal of comprising a target molecule, the method comprising: aptamer candidates that do not bind to the target complex. providing a target molecule: 3. The method of claim 2, further comprising: providing a derivatization agent; eluting the aptamer from the bound target complex under contacting the target molecule and the derivatization agent increasing Stringency; and to form a target complex; isolating an eluted aptamer having high affinity for the providing an oligonucleotide library comprising a plurality target complex. of aptamer candidates; 4. The method of claim 1, comprising systematic evolution contacting the target complex and the oligonucleotide of ligands by exponential enrichment (SELEX). library; and 5. The method of claim 1, wherein the aptamer does not isolating an aptamer that binds to the target complex. Substantially bind the non-complexed target molecule. US 2016/0076021 A1 Mar. 17, 2016 37

6. The method of claim 1, wherein the aptamer does not hydroxyproline, carnitine, ornithine, S-adenosylmethionine, Substantially bind the non-complexed derivatization agent. citrulline, beta alanine (3-aminopropanoic acid), canavanine, 7. The method of claim 1, further comprising counter mimosine, aspartame, 5-hydroxytryptophan, L-dihydrox selecting an aptamer against the derivatization agent alone or yphenylalanine, and eflornithine. against the target molecule alone. 18. The method of claim 1, wherein the derivatization agent 8. The method of claim 1, wherein the oligonucleotide comprises a metalion complex, a cyclic oligosaccharide, or a library comprises randomly generated oligonucleotide boronic acid. sequences of a fixed length flanked by a constant 5' end and a 19. The method of claim 1, wherein: constant 3' end, the constant 5' end and the constant 3' end the target molecule comprises an amino acid and the functioning as a primer. derivatization agent comprises a metal ion complex: 9. The method of claim 1, wherein the aptamer is a DNA, the target molecule comprises a fatty acid, a steroid, a RNA, or XNA molecule. hydrophobic lead-like compound, or a hydrophobic 10. The method of claim 1, wherein the aptamer comprises drug-like compound and the derivatization agent com at least about 15 oligonucleotides up to about 100 oligonucle prises a cyclic oligosaccharide; or otides. the target molecule comprises a carbohydrate and the 11. The method of claim 1, wherein the aptamer comprises derivatization agent comprises a boronic acid. equilibrium constant(K) of about 1 pMup to about 10.0LM: 20. The method of claim 1, wherein the derivatization agent about 1 pM up to about 1.0 uM; about 1 pMup to about 100 comprises Cp*Rh(III) or a metal ion complex selected from nM; about 100 pMup to about 10.0 uM; about 100 pMup to Ni(II), Cu(II), Zn(II), or Co(III) bound to a bidentate, triden about 1.0 uM; about 100 pMup to about 100 nM; or about 1.0 tate, or tetradentate ligand. nM up to about 10.0 uM; about 1.0 nM up to about 1.0 uM; 21. The method of claim 1, wherein the derivatization agent about 1 nMup to about 200 nM; about 1.0 nMup to about 100 comprises a cyclic oligosaccharide, the cyclic oligosaccha nM; about 500 nM up to about 10.0 uM; or about 500 nM up ride comprising a cyclodextrin derivative. to about 1.0 uM. 22. The method of claim 1, wherein the derivatization agent 12. The method of claim 1, wherein the target molecule comprises a boronic acid, the boronic acid comprising a bis comprises a small molecule, a protein, or a nucleic acid. boronic acid, an aromatic boronic acid, an amino boronic 13. The method of claim 1, wherein the target molecule acid, or an aromatic amino boronic acid. comprises a small molecule selected from the group consist 23. The method of claim 1, wherein isolating an aptamer ing of a carbohydrate molecule, a fatty acid molecule, a that binds to the target complex comprises: steroid molecule, an amino acid, a lead-like Small molecule, isolating an aptamer that binds to the target complex and a drug-like Small molecule, and a derivative or a combination has a nucleic acid sequence comprising one or more thereof. unpaired nucleic acid bases when the aptamer is folded 14. The method of claim 1, wherein the target molecule into a double stranded configuration, wherein the one or comprises a carbohydrate molecule selected from the group more unpaired nucleic acid bases form a binding pocket consisting of glucose, dextrose, fructose, galactose. Sucrose, Such that the aptamer can bind the derivatization agent maltose, lactose, polyol, polyhydric alcohol, polyalcohol, and the target molecule. glycitol, methanol, glycol, glycerol, erythritol, threitol, ara 24. An aptamer selected from the group consisting of bitol, xylitol, ribitol, mannitol, sorbitol, galactitol, fucitol, (a) anaptamer selected according to the method of claim 1: iditol, inositol, Volemitol, isomalt, maltitol, lactitol, maltot (b) anaptamer comprising SEQID NO:3: SEQID NO: 4 riitol, maltotetraitol, and polyglycitol. (Glucose-BA 01); SEQ ID NO: 5 (Glucose-BA 07): 15. The method of claim 1, wherein the target molecule SEQID NO: 6 (Glucose-BA 08); SEQID NO: 7 (Glu comprises a lipid molecule selected from the group consisting cose-BA 09): SEQ ID NO: 8 (Glucose-BA 10); SEQ of a fatty acid, a steroid, a sphingolipid, or a phospholipid. ID NO: 9 (Glucose-BA 11); SEQID NO: 10 (Glucose 16. The method of claim 1, wherein the target molecule BA 12); SEQ ID NO: 11 (Glucose-BA 13); SEQ ID comprises a steroid molecule selected from the group con NO: 12 (Glucose-BA 14); SEQ ID NO: 13 (Glucose sisting of a caprylic acid, capric acid, lauric acid, myristic BA 15); SEQ ID NO: 14 (Glucose-BA 16); SEQ ID acid, palmitic acid, Stearic acid, arachidic acid, behenic acid, NO: 15 (Glucose-BA 17); SEQ ID NO: 16 lignoceric acid, cerotic acid, myristoleic acid, palmitoleic (GLUBAO2); SEQ ID NO: 17 (GLUBA09); SEQ ID acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, NO: 18 (GLUBA09 M1); SEQ ID NO: 19 linoleic acid, linoelaidic acid, a-linolenic acid, arachidonic (GLUBA17); SEQID NO:20 (GLUBAN3W10); SEQ acid, eicosapentaenoic acid, erucic acid, and docosa ID NO: 21 (GLUBAN3W11); or SEQ ID NO: 22 hexaenoic acid, cholestane, a cholane, a pregnane, an andros (GLUBAN3W19), or a sequence at least 90% identical tane, agonane, an estrane, cholesterol, estradiol, testosterone, thereto and binding glucose complexed with a bis-bo progesterone, medrogestone, B-sitosterol, dexamethasone, ronic derivatization agent; sphingosine-phosphate, Sphingomyeline, ganglioside, and (c) an aptamer comprising SEQ ID NO: 23 (FrucBA02); phosphatidyl-choline, or derivatives thereof. SEQ ID NO: 24 (FrucBA02 M1); or SEQID NO: 25 17. The method of claim 1, wherein the target molecule (Fruch3A05), or a sequence at least 90% identical thereto comprises an amino acid selected from the group consisting and binding fructose complexed with a bis-boronic of histidine, isoleucine, leucine, lysine, methionine, phenyla derivatization agent; lanine, threonine, tryptophan, Valine, alanine, arginine, aspar (d) anaptamer comprising: SEQID NO: 26 (GalacEA05); agine, aspartic acid, cysteine, glutamic acid, glutamine, gly SEQID NO: 27 (GalacBAO1); or SEQID NO: 28 (Ga cine, proline, serine, tyrosine, selenocysteine, pyrrolysine, lacBA06), or a sequence at least 90% identical thereto lanthionine, 2-aminoisobutyric acid, dehydroalanine, and binding galactose complexed with a bis-boronic N-formylmethionine, gamma-amino-butyric acid (GABA), derivatization agent. US 2016/0076021 A1 Mar. 17, 2016

(e)anaptamer comprising SEQID NO: 29 (BAOnly01); or (p) anaptamer comprising SEQID NO: 57 (HTrp03), or a SEQID NO:30 (BAOnly03), or a sequence at least 90% sequence at least 90% identical thereto and binding tryp identical thereto and binding boronic acid; tophan complexed with a Cp*Rh(III) derivatization (f) anaptamer comprising SEQIDNO:31: SEQIDNO:32 agent; or (Arginine-Cp*Rh 02); SEQ ID NO: 33 (Arginine (q) an aptamer comprising SEQID NO:58: SEQID NO: Cp*Rh 03); SEQ ID NO: 34 (Arginine-Cp*Rh 04); 59 (Tyrosine-Cp*Rh 02); SEQ ID NO: 60 (Tyrosine SEQID NO:35 (Arginine-Cp*Rh 05); or SEQID NO: Cp*Rh 03); SEQ ID NO: 61 (Tyrosine-Cp*Rh 04); 36 (ARG01 Cp), or a sequence at least 90% identical SEQID NO: 62 (Tyrosine-Cp*Rh 05); SEQID NO: 63 thereto and binding arginine complexed with a Cp*Rh (Tyrosine-Cp*Rh 06); SEQ ID NO: 64 (Tyrosine (III) derivatization agent; Cp*Rh 07); SEQ ID NO: 65 (Tyrosine-Cp*Rh 08); (g) an aptamer comprising SEQ ID NO:37 (AspaCp01); SEQID NO: 66 (Tyrosine-Cp*Rh 09): SEQID NO: 67 SEQ ID NO: 38 (AspaCp03); or SEQ ID NO: 39 (Tyrosine-Cp*Rh 10); SEQ ID NO: 68 (Tyrosine (AspaCp04), or a sequence at least 90% identical thereto Cp*Rh 11); SEQ ID NO: 69 (Tyrosine-Cp*Rh 12); and binding asparagine complexed with a Cp*Rh(III) SEQID NO: 70 (Tyrosine-Cp*Rh 13); SEQID NO: 71 derivatization agent; (Tyr-Cp*Rh (38nt)); or SEQID NO: 72 (HTyrs07), or a (h) an aptamer comprising SEQID NO: 40 (CIT30NO2 sequence at least 90% identical thereto and binding Cp*Rh), or a sequence at least 90% identical thereto and tyrosine complexed with a Cp*Rh(III) derivatization binding citrulline complexed with a Cp*Rh(III) deriva agent. tization agent; 25. The aptamer of claim 24, wherein: (i) anaptamer comprising SEQID NO: 41 (GlutaCp02); or the aptamer has a nucleic acid sequence comprising one or SEQID NO: 42 (GlutaCp15), or a sequence at least 90% more unpaired nucleic acid bases when the aptamer is identical thereto and binding glutamine complexed with folded into a double stranded configuration; a Cp*Rh(III) derivatization agent; the one or more unpaired nucleic acid bases form a binding () anaptamer comprising SEQID NO:43: SEQID NO:44 pocket Such that the aptamer can bind a derivatization (Glycine-Cp*Rh 01); SEQ ID NO: 45 (Gly-Cp); SEQ agent and a target molecule; and ID NO:46 (Gly-Cp+1 bp); or SEQID NO.47 (GLYHW the aptamer comprises SEQ ID NO: 71 (Tyr-Cp*Rh Cp*Rh 06), or a sequence at least 90% identical thereto (38nt)); SEQID NO: 53 (PACp*Rho1); SEQID NO:40 and binding glycine complexed with a Cp*Rh(III) (CIT30NO2. Cp*Rh); SEQ ID NO: 41 (GlutaCp02); derivatization agent; SEQ ID NO: 52 (LysCp*Rh18); SEQ ID NO: 51 (Ly (k) an aptamer comprising SEQ ID NO: 48 (Leucp01); sCp05); SEQID NO: 75 (Cu(II)-Phel0 49 nt); SEQID SEQ ID NO: 49 (Leucp04); or SEQ ID NO: 50 NO: 36 (ARG01 Cp); SEQ ID NO: 57 (HTrp03 (Leucp17), or a sequence at least 90% identical thereto aptamer); SEQ ID NO: 45 (Gly-Cp); SEQ ID NO: 38 and binding leucine complexed with a Cp*Rh(III) (AspaCp03); SEQ ID NO: 47 (GLYHW-Cp*Rho6); derivatization agent; SEQ ID NO: 50 (Leucp17); SEQ ID NO: 53 (1) an aptamer comprising SEQID NO: 51 (LysCp05); or (PACp*Rho1); SEQID NO: 73 (Cu(II) Phe01); or SEQ SEQ ID NO: 52 (LysCp*Rh18), or a sequence at least ID NO: 56 (HPheA104); or a sequence at least 90% 90% identical thereto and binding lysine complexed identical thereto and binding the target molecule com with a Cp*Rh(III) derivatization agent; plexed with the derivatization agent. (m)anaptamer comprising SEQID NO:53 (PACp*Rh()1): 26. A method of detecting a target molecule in a sample, the SEQ ID NO: 54 (PACp*Rho2); SEQ ID NO. 55 method comprising: (PACp*RhO3); or SEQ ID NO: 56 (HPheal04), or a (a) providing a sample: sequence at least 90% identical thereto and binding phe (b) contacting the biological sample and a derivatization nylalanine complexed with a Cp*Rh(III) derivatization agent to form a target complex comprising the derivati agent, Zation agent and a target molecule when the target mol (n) an aptamer comprising SEQ ID NO: 73 (Cu(II) ecule is present in the sample; Phe01); SEQID NO: 74 (Cu(II)-Phel0); or SEQID NO: (c) contacting the biological sample and (i) an aptamer 75 (Cu(II)-Phel0 49 nt), or a sequence at least 90% Selected according to the method of claim 1 or (ii) an identical thereto and binding phenylalanine complexed aptamer according to claim 24 to form anaptamer-target with a Cu(II) derivatization agent; complex when the target complex is present in the (o) an aptamer comprising SEQID NO: 57 (HTrp03), or a sample; and sequence at least 90% identical thereto and binding tryp (d) detecting the aptamer-target complex when present in tophan complexed with a Cp*Rh(III) derivatization the sample. agent,