DOCSLIB.ORG

Sarcotoxin II from the Flesh Fly Sarcophaga Crassipalpis (Diptera

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sarcotoxin II from the Flesh Fly Sarcophaga Crassipalpis (Diptera Eur. J. Entorno?. 100: 251-254, 2003 ISSN 1210-5759 Sarcotoxin //from the flesh flySarcophaga crassipalpis (Díptera): A comparison of transcript expression in diapausing and nondiapausing pupae Joseph P. RINEHART1*, Steven J. DIAKOFF2 and David L. DENLINGER1 'Department ofEntomology, Ohio State University, 1735 Neil Avenue, Columbus, OH 43210, USA department ofNatural Sciences, Malone College, 515 25th Street N. W., Canton, OH 44709, USA Key words. Diapause,sarcotoxin II, injury, stress response, immuneSarcophaga response, crassipalpis Abstract. Many stress-induced genes, including those related to the insect humoral immune response, are upregulated during dia­ pause even in the absence of stress. We further test the relationship between stress genesSarcophaga and diapause crassipalpis in by cloningsarcotoxin II,a member of the attacin family, and examining its expression pattern in relation to pupal diapause. Unlike sev­ eral other stress-related genes,sarcotoxin IIis not developmentally upregulated during diapause, but it remains fully responsive to immune challenge. Interestingly, the ofelevation sarcotoxin IImRNA in response to body wall injury, but not immune challenge, is initiated more slowly and persists longer in diapausing pupae than in nondiapausing individuals. INTRODUCTION flies we isolated a partial clone that encodessarcotoxin II Entry into diapause is accompanied both inbyS. acrassipalpis shut and examined its expression in relation down in the expression of many genes asto well diapause as the and in response to physical injury or an injec­ upregulation of a select group of genes tion(Joplin of lipopolysaccharides. et al., Our results indicate that this 1990; Flannagan et al., 1998). Among the genesgene that are is not developmentally upregulated during diapause upregulated in the pupal diapause of Sar­the fleshbut fly, can be quickly upregulated in diapausing pupae in cophaga crassipalpis, are genes that encode two ofresponse the to stress. Interestingly, the elevated levels of heat shock proteins, hsp23 (Yocum et al., 1998)sarcotoxin and mRNAII in response to physical injury persist hsp70 (Rinehart et al., 2000), and an AP endonucleaselonger in diapausing pupae than in pupae that are not in that is most likely involved in DNA repair (Craigdiapause. & Den- linger, 2000). This pattern is not unique to fleshMATERIALS flies: the AND METHODS stress protein hsp70 is upregulated in the Colorado potato beetle as well (Yocum, 2001). In addition, recent Insectsdata All flies used in these experiments were from a laboratory indicates that coupling of diapause with stress-relatedcolony Sarcophaga of crassipalpis Macquart. Nondiapausing proteins extends to stress of an immunologicalflies were nature. reared under long daylength(15:9 light : dark) at Defensin is upregulated during larval diapause25°C, in while the diapause was induced by rearing the parental adults spruce budwormChoristoneura fumiferana (Palli et al., in short daylength (12L : 12D) at 25°C, with the resulting larvae 2001), drosomycin is upregulated during the adultand dia­ diapausing pupae reared in short daylength conditions at pause ofDrosophila triauraria (Diabo et al., 2001), a 20°C as previously described (Denlinger, 1972). When con­ peptide with potential anti-fungal activity is uniquelyducting experiments pre­ that compared diapausing and nondia­ sent during diapause in adults of the leafGastro- beetle pausing individuals, both groups were held at 20°C while main­ physa atrocyanea (Tanaka et al., 1998), antimicrobialtaining respective light regimes. peptides are present in diapausing larvae of theImmune blow fly challenges Calliphora vicina (Chernysh et al., 2000), andhemolin is All immune challenges were conducted on nondiapausing upregulated in the midgut of diapausing pharatepupae larvae or of pupae that had been in diapause for 20 days. Prior to the gypsy mothLymantria dispar (Lee et al., 2002). Thus, challenge, the head capsule, consisting of the first three seg­ diverse genes encoding proteins associated withments stress of the puparium, was carefully removed to expose the and immune responses appear to be upregulatedpupal during head. In the first set of experiments, challenge consisted solely of body wall injury, which has been shownsar­ to elicit diapause. This prompted us to investigate the expressioncotoxin II expression S. peregrinain (Kanai & Natori, 1990). In of another immune responsesarcotoxin gene, II, during our experiments, body wall injury consisted of piercing the pupal diapause in flesh flies. pupal head with a sterile 26 gauge hypodermic needle. After Proteins of the Sarcotoxin II group are injury,antibacterial samples were harvested at regular intervals for RNA iso­ proteins in the attacin family that have been welllation. charac­ Our second set of experiments consisted of injection of terized fromSarcophaga peregrina (Natori et al., 1999). the pyrogen lipopolysaccharide (LPS) (Sigma, Inc.), an agent To test the possibility that this defense molecule mightthat dramaticallybe increases the induction of immune responses among those that are upregulated during diapause(Nanbu in flesh et al., 1988). In our studies, 0.5 pg of LPS in 1 pl of * Corresponding [email protected] E-mail: 251 S. c. 1 tctttcgtattctttgctgcctgtatggcaatcgtagcattgagctctttggcgcaggcc I I I I I I I I I i I I 1 I I I I II I I I I I I ! I I I I I I I I I I I II I I I I I I I I I I I I I I I I S.p. 68 tctttcgtattctttgctgcctgtatggcaatcattgcattaagctctttggtgcaagcc S.c. 61 tatccacaaaagttgccagttccaattcctctaccaactaaagcaccagtagcggcattc II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I S.p. 128 tatccacaaaagttgcccgttccaattcctccaccaactaatccaccagtagctgcattc S.c. 121 cataattcagttgccacaaatcccaaaggaggccaggatgtttctgtaaaacttgccgcc II I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I S.p. 188 cacaattctgttgcaacaaattccaaaggaggtcaggatgtgtctgtgaaactagccgcc S.c. 181 accaatttgggaaataagcatgtccagccaattgctgaggtatttgcaaaaggtaatacc I I II I I I II I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I S.p. 248 accaacttgggtaataagcatgttcagccgattgctgaagtatttgcagaaggcaatact S.c. 241 caaggcggtaatgtcgttcgaggagcaacagtaggcgtgcaaggtcatggtttaagcgcc I I I I I I I I I I I I I I I I I I I I I I II I I I I I 1 I I I I I I I I I I I I I I I I II I I I II I S.p. 308 aaaggcggtaatgttctcagaggagcaacagtaggcgtgcaaggtcatggtttaggcgcc S.c. 301 gctgtaactaaaacccagaacggtatagaagagtcttttcgtaaacaagccgaagccaat II I I I I I I I I I III I I I I II I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I S.p. 368 tctgtaaccaaaagccaagacggtatagccgagtcttttcgtaagcaagccgaagccaat S.c. 361 ttgatgttggataagaaaagtgccatagttggaacgatttcccagactgatggcaaaata I I II I II I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I S.p. 428 ttgagattgggtgactctgcaagcttaattggaaaagtttcccagactgataccaaaata S.c. 421 aagggcatcgactttaaacctcaactaaccagcagcagcttggcatataaaggcgataga II II I I I I I I I I I I I I I I I I I I I I II I I I I I I i I I I I I I I I I I I I I I I I I S.p. 488 aaaggaatcgactttaaaccccaactatccagtagcagtttggctttgcaaggcgataga S.c. 481 ttaggcgcctctattagccgtgacattgaacgtggcgttagtgaaactttaaccaaatct I I II I I I I I I II I I I I I I I I I I II I I I I I I I I I I I I I I I I I II I I I I I I I I S.p. 548 ttaggcgcttctattagccgtgatgttaatcgtggtgttagtgatactttaactaaatcc S.c. 541 gtctca 546 II III S.p. 608 gtttca 613 Fig. 1. Comparision of sequencessarcotoxin of IIfrom S. crassipalpis (S.c.) andS. peregrina (S.p.) insect saline was injected into pupae using a sterileviduals 26 gauge but absent in unchallenged controls. The product was needle. excised from the gel, ligated into a PcR2.1 vector, which was then used to transform cells with a TA cloning kit (Invitrogen, Clone development Inc.). Sequencing was conducted at the University of Georgia The partial cloneS. of crassipalpis sarcotoxin was Ila devel­ using an Applied Biosystems 373A automatic sequencer. oped via rt-PCR conducted on RNA from immunologically challenged individuals, with unchallenged individuals servingRNA isolation as and northern blot hybridization controls. Primers were constructed from conserved regionsTo isolate of RNA for rt-PCR and northern blot hybridization, the gene as determined by analysis of sequencesS. pere­ fromwhole pupae were ground in TRIzol Reagent (Invitrogen, Inc.), grina, resulting in a 5’ primer withof total RNA being isolated using standard protocol. Three TCTTTCGTATTCTTTGCTGC and a 3’ primer ofsamples from each treatment group and time point were then ACTGTGACCCACCAGCATTG. PCR was conducted for 40pooled, and 20 pg of this total RNA were loaded onto a 1.5% cycles, with denaturing at 94°C for 30 secs, annealing agarose,at 55°C 0.41M formaldehyde gel for separation by electropho­ for 30 secs, and extension at 72°C for 1 min, using standardresis. Following pro­ electrophoresis, a turboblotter apparatus tocol (Rinehart et al., 2000). Resolution of PCR products(Schleicher on and a Schull, Inc.) was used to transfer the samples to 1.5% agarose, ethidium bromide stained gel revealed a singlea Magnacharge + nylon membrane (Micon Separations, Inc.) via band of approximately 550bp present in the challenged indi­ 252 Fig. 2. Sarcotoxin transcriptionII in response to bodyFig. wall3. Sarcotoxin transcriptionII in response to LPS injec­ injury. In nondiapausing individuals, upregulationtion.
Load more

Recommended publications
  • Diptera: Calyptratae)
    Systematic Entomology (2020), DOI: 10.1111/syen.12443 Protein-encoding ultraconserved elements provide a new phylogenomic perspective of Oestroidea flies (Diptera: Calyptratae) ELIANA BUENAVENTURA1,2 , MICHAEL W. LLOYD2,3,JUAN MANUEL PERILLALÓPEZ4, VANESSA L. GONZÁLEZ2, ARIANNA THOMAS-CABIANCA5 andTORSTEN DIKOW2 1Museum für Naturkunde, Leibniz Institute for Evolution and Biodiversity Science, Berlin, Germany, 2National Museum of Natural History, Smithsonian Institution, Washington, DC, U.S.A., 3The Jackson Laboratory, Bar Harbor, ME, U.S.A., 4Department of Biological Sciences, Wright State University, Dayton, OH, U.S.A. and 5Department of Environmental Science and Natural Resources, University of Alicante, Alicante, Spain Abstract. The diverse superfamily Oestroidea with more than 15 000 known species includes among others blow flies, flesh flies, bot flies and the diverse tachinid flies. Oestroidea exhibit strikingly divergent morphological and ecological traits, but even with a variety of data sources and inferences there is no consensus on the relationships among major Oestroidea lineages. Phylogenomic inferences derived from targeted enrichment of ultraconserved elements or UCEs have emerged as a promising method for resolving difficult phylogenetic problems at varying timescales. To reconstruct phylogenetic relationships among families of Oestroidea, we obtained UCE loci exclusively derived from the transcribed portion of the genome, making them suitable for larger and more integrative phylogenomic studies using other genomic and transcriptomic resources. We analysed datasets containing 37–2077 UCE loci from 98 representatives of all oestroid families (except Ulurumyiidae and Mystacinobiidae) and seven calyptrate outgroups, with a total concatenated aligned length between 10 and 550 Mb. About 35% of the sampled taxa consisted of museum specimens (2–92 years old), of which 85% resulted in successful UCE enrichment.
    [Show full text]
  • Genus Sarcophaga
    Genus Sarcophaga Key to UK species adapted and updated from van Emden (1954) Handbooks for the Identification of British Insects Vol X, Part 4(a), Diptera Cyclorrhapha Calyptrata (1) Since the publication, various species have changed their names and three further species have been added to the British list. Sarcophaga compactilobata Wyatt and Sarcophaga portschinskyi (Rohdendorf) were both added by Wyatt (1991). Sarcophaga discifera has been added to the British list but is only recorded from Ireland. Sarcophaga carnaria has been revised and split into two species. Note on the nomenclature of the tergites. The tergites are parts of the segments of the abdomen visible from above. The first and second tergites are fused together. In the original paper this first segment was referred to as the “first tergite”. This has been changed here to T1+2 and subsequent tergites becoming a number one more than they were in the original. The four large tergites are thus T1+2, T3, T4 and T5. In females T6 which appears to protrude a little below T5 is actually two tergites fused together and is referred to here as T6+7. In males there are two small segments visible beyond T5 and these are called the first and second genital segments. 1 Vein r1 usually setulose on the dorsal surface, sometimes with 1-2 setulae only. T3 with marginals. Three almost equal strong postsutural dorsocentrals, the first of them closer to the suture than to the second. Prescutellars present. Presutural acrostichals rarely distinct. ...............................................2 Marginals are bristles towards the middle of the segment on the hind edge.
    [Show full text]
  • Association of Myianoetus Muscarum (Acari: Histiostomatidae) with Synthesiomyia Nudiseta (Wulp) (Diptera: Muscidae) on Human Remains
    Journal of Medical Entomology Advance Access published January 6, 2016 Journal of Medical Entomology, 2016, 1–6 doi: 10.1093/jme/tjv203 Direct Injury, Myiasis, Forensics Research article Association of Myianoetus muscarum (Acari: Histiostomatidae) With Synthesiomyia nudiseta (Wulp) (Diptera: Muscidae) on Human Remains M. L. Pimsler,1,2,3 C. G. Owings,1,4 M. R. Sanford,5 B. M. OConnor,6 P. D. Teel,1 R. M. Mohr,1,7 and J. K. Tomberlin1 1Department of Entomology, Texas A&M University, 2475 TAMU, College Station, TX 77843 ([email protected]; cgowings@- iupui.edu; [email protected]; [email protected]; [email protected]), 2Department of Biological Sciences, University of Alabama, Tuscaloosa, AL 35405, 3Corresponding author, e-mail: [email protected], 4Department of Biology, Indiana University-Purdue University Indianapolis, 723 W. Michigan St., SL 306, Indianapolis, IN 46202, 5Harris County Institute of 6 Forensic Sciences, Houston, TX 77054 ([email protected]), Department of Ecology and Evolutionary Biology/ Downloaded from Museum of Zoology, The University of Michigan, Ann Arbor, MI 48109 ([email protected]), and 7Department of Forensic and Investigative Science, West Virginia University, 1600 University Ave., Morgantown, WV 26506 Received 26 August 2015; Accepted 24 November 2015 Abstract http://jme.oxfordjournals.org/ Synthesiomyia nudiseta (Wulp) (Diptera: Muscidae) was identified during the course of three indoor medicole- gal forensic entomology investigations in the state of Texas, one in 2011 from Hayes County, TX, and two in 2015 from Harris County, TX. In all cases, mites were found in association with the sample and subsequently identified as Myianoetus muscarum (L., 1758) (Acariformes: Histiostomatidae).
    [Show full text]
  • Arthropods Associated with Wildlife Carcasses in Lowland Rainforest, Rivers State, Nigeria
    Available online a t www.pelagiaresearchlibra ry.com Pelagia Research Library European Journal of Experimental Biology, 2013, 3(5):111-114 ISSN: 2248 –9215 CODEN (USA): EJEBAU Arthropods associated with wildlife carcasses in Lowland Rainforest, Rivers State, Nigeria Osborne U. Ndueze, Mekeu A. E. Noutcha, Odidika C. Umeozor and Samuel N. Okiwelu* Entomology and Pest Management Unit, Department of Animal and Environmental Biology, University of Port Harcourt, Nigeria _____________________________________________________________________________________________ ABSTRACT Investigations were conducted in the rainy season August-October, 2011, to identify the arthropods associated with carcasses of the Greater Cane Rat, Thryonomys swinderianus; two-spotted Palm Civet, Nandina binotata, Mona monkey, Cercopithecus mona and Maxwell’s duiker, Philantomba maxwelli in lowland rainforest, Nigeria. Collections were made from carcasses in sheltered environment and open vegetation. Carcasses were purchased in pairs at the Omagwa bushmeat market as soon as they were brought in by hunters. They were transported to the Animal House, University of Port Harcourt. Carcasses of each species were placed in cages in sheltered location and open vegetation. Flying insects were collected with hand nets, while crawling insects were trapped in water. Necrophages, predators and transients were collected. The dominant insect orders were: Diptera, Coleoptera and Hymenoptera. The most common species were the dipteran necrophages: Musca domestica (Muscidae), Lucilia serricata
    [Show full text]
  • Flesh Flies (Diptera: Sarcophagidae) of Sandy and Marshy Habitats of the Polish Baltic Coast
    © Entomologica Fennica. 30 March 2009 Flesh flies (Diptera: Sarcophagidae) of sandy and marshy habitats of the Polish Baltic coast Elibieta Kaczorowska Kaczorowska, E. 2009: Flesh flies (Diptera: Sarcophagidae) of sandy and marshy habitats of the Polish Baltic coast. — Entomol. Fennica 20: 61—64. The results ofa seven-year study on flesh flies (Diptera: Sarcophagidae) in sandy and marshy habitats ofthe Polish Baltic coast are presented. During this research, carried out in 20 localities, 25 species of Sarcophagidae were collected, ofwhich 24 were new for the study areas. Based on these results, flesh fly abundance and trophic groups are described. E. Kaczorowska, Department ofInvertebrate Zoology, University ofGdansk, Al. Marszalka Pilsadskiego 46, 81—3 78 Gdynia, Poland; E—mail.‘ saline@ocean. aniv.gda.pl, telephone: 0048 58 5236642 Received 1 1 December 200 7, accepted 19 March 2008 1. Introduction menoptera, while others are predators or para- sitoids on insects and snails (Povolny & Verves Sarcophagidae is a species-rich family, distri- 1997). Therefore, flesh flies occur in various buted worldwide and comprising over 2500 de- kinds of biotopes, including coastal marshy and scribed species. At present more than 150 species sandy habitats. On the Polish Baltic coast, species of flesh flies are known from central Europe of Sarcophagidae have been found in low abun- (Povolny & Verves 1997) and 129 from Poland. dance, and only one species, Sarcophaga (Myo— The Polish fauna of Sarcophagidae is relatively rlzina) nigriventris Meigen, has so far been re- well known, but the state of knowledge about corded (Draber—Monko 1973). Szadziewski these flies is uneven for particular regions of the (1983), carrying out research on Diptera ofthe sa- country.
    [Show full text]
  • ARTHROPODA Subphylum Hexapoda Protura, Springtails, Diplura, and Insects
    NINE Phylum ARTHROPODA SUBPHYLUM HEXAPODA Protura, springtails, Diplura, and insects ROD P. MACFARLANE, PETER A. MADDISON, IAN G. ANDREW, JOCELYN A. BERRY, PETER M. JOHNS, ROBERT J. B. HOARE, MARIE-CLAUDE LARIVIÈRE, PENELOPE GREENSLADE, ROSA C. HENDERSON, COURTenaY N. SMITHERS, RicarDO L. PALMA, JOHN B. WARD, ROBERT L. C. PILGRIM, DaVID R. TOWNS, IAN McLELLAN, DAVID A. J. TEULON, TERRY R. HITCHINGS, VICTOR F. EASTOP, NICHOLAS A. MARTIN, MURRAY J. FLETCHER, MARLON A. W. STUFKENS, PAMELA J. DALE, Daniel BURCKHARDT, THOMAS R. BUCKLEY, STEVEN A. TREWICK defining feature of the Hexapoda, as the name suggests, is six legs. Also, the body comprises a head, thorax, and abdomen. The number A of abdominal segments varies, however; there are only six in the Collembola (springtails), 9–12 in the Protura, and 10 in the Diplura, whereas in all other hexapods there are strictly 11. Insects are now regarded as comprising only those hexapods with 11 abdominal segments. Whereas crustaceans are the dominant group of arthropods in the sea, hexapods prevail on land, in numbers and biomass. Altogether, the Hexapoda constitutes the most diverse group of animals – the estimated number of described species worldwide is just over 900,000, with the beetles (order Coleoptera) comprising more than a third of these. Today, the Hexapoda is considered to contain four classes – the Insecta, and the Protura, Collembola, and Diplura. The latter three classes were formerly allied with the insect orders Archaeognatha (jumping bristletails) and Thysanura (silverfish) as the insect subclass Apterygota (‘wingless’). The Apterygota is now regarded as an artificial assemblage (Bitsch & Bitsch 2000).
    [Show full text]
  • Key to the Adults of the Most Common Forensic Species of Diptera in South America
    390 Key to the adults of the most common forensic species ofCarvalho Diptera & Mello-Patiu in South America Claudio José Barros de Carvalho1 & Cátia Antunes de Mello-Patiu2 1Department of Zoology, Universidade Federal do Paraná, C.P. 19020, Curitiba-PR, 81.531–980, Brazil. [email protected] 2Department of Entomology, Museu Nacional do Rio de Janeiro, Rio de Janeiro-RJ, 20940–040, Brazil. [email protected] ABSTRACT. Key to the adults of the most common forensic species of Diptera in South America. Flies (Diptera, blow flies, house flies, flesh flies, horse flies, cattle flies, deer flies, midges and mosquitoes) are among the four megadiverse insect orders. Several species quickly colonize human cadavers and are potentially useful in forensic studies. One of the major problems with carrion fly identification is the lack of taxonomists or available keys that can identify even the most common species sometimes resulting in erroneous identification. Here we present a key to the adults of 12 families of Diptera whose species are found on carrion, including human corpses. Also, a summary for the most common families of forensic importance in South America, along with a key to the most common species of Calliphoridae, Muscidae, and Fanniidae and to the genera of Sarcophagidae are provided. Drawings of the most important characters for identification are also included. KEYWORDS. Carrion flies; forensic entomology; neotropical. RESUMO. Chave de identificação para as espécies comuns de Diptera da América do Sul de interesse forense. Diptera (califorídeos, sarcofagídeos, motucas, moscas comuns e mosquitos) é a uma das quatro ordens megadiversas de insetos. Diversas espécies desta ordem podem rapidamente colonizar cadáveres humanos e são de utilidade potencial para estudos de entomologia forense.
    [Show full text]
  • Diptera: Sarcophagidae) of Southern South America
    Zootaxa 3933 (1): 001–088 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Monograph ZOOTAXA Copyright © 2015 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3933.1.1 http://zoobank.org/urn:lsid:zoobank.org:pub:00C6A73B-7821-4A31-A0CA-49E14AC05397 ZOOTAXA 3933 The Sarcophaginae (Diptera: Sarcophagidae) of Southern South America. I. The species of Microcerella Macquart from the Patagonian Region PABLO RICARDO MULIERI1, JUAN CARLOS MARILUIS1, LUCIANO DAMIÁN PATITUCCI1 & MARÍA SOFÍA OLEA1 1Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires, Argentina. Museo Argentino de Ciencias Naturales, Buenos Aires, MACN. E-mails: [email protected]; [email protected]; [email protected]; [email protected] Magnolia Press Auckland, New Zealand Accepted by J. O'Hara: 19 Jan. 2015; published: 17 Mar. 2015 PABLO RICARDO MULIERI, JUAN CARLOS MARILUIS, LUCIANO DAMIÁN PATITUCCI & MARÍA SOFÍA OLEA The Sarcophaginae (Diptera: Sarcophagidae) of Southern South America. I. The species of Microcerella Macquart from the Patagonian Region (Zootaxa 3933) 88 pp.; 30 cm. 17 Mar. 2015 ISBN 978-1-77557-661-7 (paperback) ISBN 978-1-77557-662-4 (Online edition) FIRST PUBLISHED IN 2015 BY Magnolia Press P.O. Box 41-383 Auckland 1346 New Zealand e-mail: [email protected] http://www.mapress.com/zootaxa/ © 2015 Magnolia Press All rights reserved. No part of this publication may be reproduced, stored, transmitted or disseminated, in any form, or by any means, without prior written permission from the publisher, to whom all requests to reproduce copyright material should be directed in writing. This authorization does not extend to any other kind of copying, by any means, in any form, and for any purpose other than private research use.
    [Show full text]
  • Taxonomy and Systematics of the Australian Sarcophaga S.L. (Diptera: Sarcophagidae) Kelly Ann Meiklejohn University of Wollongong
    University of Wollongong Research Online University of Wollongong Thesis Collection University of Wollongong Thesis Collections 2012 Taxonomy and systematics of the Australian Sarcophaga s.l. (Diptera: Sarcophagidae) Kelly Ann Meiklejohn University of Wollongong Recommended Citation Meiklejohn, Kelly Ann, Taxonomy and systematics of the Australian Sarcophaga s.l. (Diptera: Sarcophagidae), Doctor of Philosophy thesis, School of Biological Sciences, University of Wollongong, 2012. http://ro.uow.edu.au/theses/3729 Research Online is the open access institutional repository for the University of Wollongong. For further information contact the UOW Library: [email protected] Taxonomy and systematics of the Australian Sarcophaga s.l. (Diptera: Sarcophagidae) A thesis submitted in fulfillment of the requirements for the award of the degree Doctor of Philosophy from University of Wollongong by Kelly Ann Meiklejohn BBiotech (Adv, Hons) School of Biological Sciences 2012 Thesis Certification I, Kelly Ann Meiklejohn declare that this thesis, submitted in fulfillment of the requirements for the award of Doctor of Philosophy, in the School of Biological Sciences, University of Wollongong, is wholly my own work unless otherwise referenced or acknowledged. The document has not been submitted for qualifications at any other academic institution. Kelly Ann Meiklejohn 31st of August 2012 ii Table of Contents List of Figures ..................................................................................................................................................
    [Show full text]
  • Taxonomic Studies on Ravinia Pernix, Boettcherisca Peregrina and Seniorwhitea Reciproca (Diptera: Sarcophagidae) of Indian Origin
    International Journal of Zoology Studies ISSN: 2455-7269 Impact Factor: RJIF 5.14 www.zoologyjournals.com Volume 2; Issue 5; September 2017; Page No. 81-88 Taxonomic studies on Ravinia pernix, Boettcherisca peregrina and Seniorwhitea reciproca (Diptera: Sarcophagidae) of Indian origin *1 Manish Sharma, 2 Palwinder Singh, 3 Devinder Singh 2, 3 Department of Zoology and Environmental Sciences, Punjabi University, Patiala, Panjab, India 1 PG Department of Agriculture, GSSDGS Khalsa College, Patiala, Panjab, India Abstract The male genitalia of three species Ravinia pernix (Harris), Seniorwhitea reciproca (Walker) and Boettcherisca peregrina (Robineau-Desvoidy) have been studied in detail. The present work includes the descriptions and detailed illustrations of external male genitalic structures which have not been published so far these three species. A key to the studied species is also given. Keywords: diptera, key, male genitalia, oestroidea, Parasarcophaga, sarcophagidae 1. Introduction 2. Materials and Methods Sarcophagidae is one of six recognized families in the Collections and Preservation superfamily Oestroidea, which is generally regarded as sister Adult flies were collected from localities falling in the states to the superfamily Muscoidea (McAlpine, 1989, Yeates et al., comprising the North Indian states i.e., Punjab, Jammu & 2007) [17, 38]. A full revision of the family was given by Aldrich Kashmir, Himachal Pradesh, Uttara Khand and Rajasthan. The (1916), although more restricted revisionary works have been collected specimens were killed by putting them in a killing published recently focusing on particular subgroups and/or jar charged with ethyl acetate. The dead specimens were genera (Pape, 1994; Dahlem and Downes, 1996) [22, 4]. A pinned using standard entomological pins piercing the right recent and authoritative list of names and synonymies has side of the mesothorax.
    [Show full text]
  • Terrestrial Arthropod Surveys on Pagan Island, Northern Marianas
    Terrestrial Arthropod Surveys on Pagan Island, Northern Marianas Neal L. Evenhuis, Lucius G. Eldredge, Keith T. Arakaki, Darcy Oishi, Janis N. Garcia & William P. Haines Pacific Biological Survey, Bishop Museum, Honolulu, Hawaii 96817 Final Report November 2010 Prepared for: U.S. Fish and Wildlife Service, Pacific Islands Fish & Wildlife Office Honolulu, Hawaii Evenhuis et al. — Pagan Island Arthropod Survey 2 BISHOP MUSEUM The State Museum of Natural and Cultural History 1525 Bernice Street Honolulu, Hawai’i 96817–2704, USA Copyright© 2010 Bishop Museum All Rights Reserved Printed in the United States of America Contribution No. 2010-015 to the Pacific Biological Survey Evenhuis et al. — Pagan Island Arthropod Survey 3 TABLE OF CONTENTS Executive Summary ......................................................................................................... 5 Background ..................................................................................................................... 7 General History .............................................................................................................. 10 Previous Expeditions to Pagan Surveying Terrestrial Arthropods ................................ 12 Current Survey and List of Collecting Sites .................................................................. 18 Sampling Methods ......................................................................................................... 25 Survey Results ..............................................................................................................
    [Show full text]
  • INSECTS of MICRONESIA Diptera: Sarcophagidae1
    INSECTS OF MICRONESIA Diptera: Sarcophagidae 1 By H. DE SOUZA LOPES INSTITUTO OSWl\LDO CRUZ, RIO DE JANEIRO INTRODUCTION The United States Office of Naval Research, the Pacific Science Board (National Research Council), the National Science Foundation, Chicago Natural History Museum, and Bernice P. Bishop Museum have made this survey and publication of the results possible. Field research was aided by a contract between the Office of Naval Research, Department of the Navy, and the National Academy of Sciences, NR 160-175. The following symbols indicate the museums in which specimens are stored: US (United States National Museum), HSPA (Hawaiian Sugar Planters' Association), CM (Chicago Museum of Natural History), KU (Kyushu University), and BISHOP (Bernice P. Bishop Museum). Throughout this report, the Bohart referred to as an author of species is George E. Bohart. DISTRIBUTION Among the Micronesian Sarcophagidae, I have found 14 species belonging to eight different genera, which are listed in the table. Six of these species have been recorded formerly from Guam by Hall and Bohart (1948): Phytosar­ cophaga gressitti (Hall and Bohart), Bezziola stricklandi (Hall and Bohart), Boettcherisca karnyi (Hardy), Parasarcophaga knabi (Parker), P. misera (Walker), and P. ruficornis (Fabricius). Later the same species were studied by Bohart and Gressitt (1951) when they published descriptions of the larvae and pupae of all of them. Only Bezziola stricklandi (Hall and Bohart) and Phytosarcophaga gressitti (Hall and Bohart) seemed to be restricted to Micro­ nesia; the latter has now been found also in the Hawaiian Islands [Dodge, 1953, Hawaiian Ent. Soc., Proc. 15(1): 131, figs. 5-12].
    [Show full text]