SURE: Shizuoka University Repository

SURE: Shizuoka University REpository http://ir.lib.shizuoka.ac.jp/

Title Construction of spider venom peptide expressing baculovirus and its potential application as bioinsecticide

Author(s) MD. PANNA, ALI

Citation

Issue Date 2015-06

URL http://doi.org/10.14945/00009292

Version ETD

Rights

This document is downloaded at: 2016-03-28T11:38:10Z THESIS

Construction of spider venom peptide expressing baculovirus and its potential application as bioinsecticide

MD. PANNA ALI

Department of Environment and Energy System

Graduate School of Science and Technology, Educational Division, Shizuoka University

June 2015

THESIS

CONSTRUCTION OF SPIDER VENOM PEPTIDE EXPRESSING BACULOVIRUS AND ITS POTENTIAL APPLICATION AS BIOPESTICIDES クモ毒ペプチドを発現するバキュロウイルスの構築及びバイオ殺虫剤としての応用

モハマドパンナアリ

静岡大学大学院自然科学系教育部

バイオサイエンス専攻

2015 年 6 月

TABLE OF CONTENTS

LIST OF FIGURES...... …...... iv LIST OF TABLES...... x LIST OF ABBREVIATIONS...... xi ABSTRACT...... 1 CHAPTER I………………………………………………………………………….. 3 1. Introduction...... 4 1.1 Spider-venom as biopesticidal agent...... 4 1.1.1 The insect pest problem in the world...... 4

1.1.1.1 Agricultural pest insects...... 5

1.1.1.2 Insects act as disease carrier…………………………………………… 5

1.1.2 Chemical pesticides: current challenges to control insect pest……...... 6

1.1.2.1 Health consequences and environmental impacts……………………... 7

1.1.2.2 Pesticide resistance……………………………………………………. 10

1.1.2.3 Biological pesticide…………………………………………………..... 13

1.1.2.4 Spider venom peptides as bioinsecticides for insect pest control 14

1.2 Baculovirus uses as biopesticide for insect pest management…………...... 15

1.2.1 Baculovirus: classification, structure and life cycle………………………. 17

1.2.2 Recombinat baculoviruses: current challenges and future prospects 18

1.3 Spider venom as antimicrobial agent………………………………………… 20

1.3.1 Antibiotic-resistant………………………………………………………... 20

1.3.2 Discovery of new antibiotics: current challenge………………………….. 20

1.3.3. Natural sources for antimicrobial drugs………………………………….. 21

1.3.4 Antimicrobial peptides and future prospects for drugs…………………… 21

CHAPTER II………………………………………………………………………… 24 2. Expression and purification of cyto-insectotoxin (Cit1a) using silkworm larvae targeting for an antimicrobial therapeutic agent……………………... 25 2.1 Introduction………………………………………………………………….. 25

2.2 Materials and methods………………………………………………………. 27 2.2.1 Construction of recombinant BmNPV bacmid…………………………… 27 2.2.2 Expression of EGFP-Cit1a fusion protein in silkworm…………………... 27 2.2.3 Confocal laser scanning microscopy……………………………………… 29 2.2.4 SDS-PAGE and western blot analysis…………………………………….. 29 2.2.5 Purification of EGFP-Cit1a fusion protein from silkworm larvae 31 and pupae 2.2.6 Mass spectrometry analysis………………………………………………. 32 2.2.7 Antimicrobial assays……………………………………………………… 32 2.3 Results……………………………………………………………………….. 34 2.3.1 Construction of an expression recombinant BmNPV bacmid…………… 34 2.3.2 Expression of EGFP-Cit1a fusion protein from silkworm larvae and 34 pupae….. 3.3.3 Purification of EGFP-Cit1a fusion protein from silkworm larvae 36 And pupae 2.3.4 Antimicrobial activity of Cit1a…………………………………………… 38 2.4 Discussion……………………………………………………………………. 41 CHAPTER III……………………………………………………………………… 44 3. Improved insecticidal activity of a recombinant baculovirus expressing spider venom cyto-insectotoxin………………………………………………… 45 3.1 Introduction………………………………………………………………….. 45 3.2 Materials and methods……………………………………………………….. 46 3.2.1 Viruses, insects and insect cell lines……………………………………… 46 3.2.2 Construction of recombinant transfer vector…………………………….. 47 3.2.3 Recombinant virus construction and toxin expression in insect host 47 and cell…. 3.2.4 SDS-PAGE and western blot analysis……………………………………. 49 3.2.5 Purification of Polh-Cit1a fusion protein from silkworm larvae…………. 50 3.2.6 Bioassays…………………………………………………………………. 52 3.2.7 Polyhedra formation……………………………………………………… 53 3.2.8 Quantification of BmNPV and AcMNPV particles………………………. 53 3.2.9 Light and fluorescence microscopic analysis……………………………... 54

3.2.10 Cell cytotoxicity assays…………………………………………………. 54 3.3. Results………………………………………………………………………. 55 3.3.1 Construction of recombinant virus 55 3.3.2 Expression and purification of Polh-Cit1a in silkworm larvae…………… 55 3.3.3 Bioassays………………………………………………………………….. 57 3.3.4 Microscopic analysis of cells expressing the Polh-Cit1a fusion 60 protein 3.4 Discussion……………………………………………………………………. 63 CHAPTER IV…………………………………………………………………...... 71 4. Conclusion and future prospects……………………………………………... 72 4.1 Conclusion…………………………………………………………………… 72 4.2 Future prospects……………………………………………………………… 73 REFERENCES……………………………………………………………………… 75 ACKNOWLEDGEMENT………………………………………………………….. 96

iii

LIST OF FIGURES

Figure 1.1 Pesticide use is raising almost everywhere, with a few key exceptions……… 7 Figure 1.2 The variation of pesticide used by farmers in different countries…………….. 8 Figure 1.3 Pathways of environment pollution due to chemical pesticide application in agricultural farm...... 9 Figure 1.4 Effect of chemical pesticides for boosting agricultural yields………………... 11 Figure 1.5 Mechanisms of synthetic insecticide resistance. (A) Gene duplication of carboxylesterase (COE) that discharge insecticide; (B) Transcription of P450 induces hydroxylation of the pesticide. (C) Active binding site is altered by point mutations which ultimately decrease insecticidal activity. (D) Gaining more power to transport higher amount of metabolites with excretion from the cell………………………………………………………………………. 12 Figure 1.6 Mechanism of a principal rice insect pest, Nilaparvata lugens which develop resistance against chemical insecticide at field level………………………. 15 Figure 1.7 Pesticide resistant pest species toward different pesticide that once control them…………………………………………………………………………… 16 Figure 1.8 Insecticidal toxin producing spider family with their respective peptide number………………………………………………………………………. 17 Figure 1.9 Structure of a baculovirus (AcMNPV). Baculovirus has biphasic life stages making occlusion derived virion (ODV) and budded virus (BV). The ODV is essential for primary infection and BV is responsible systematic infection……………………………………………………………………… 18 Figure 2.1 Genetic structure of cit1a and its variants…………………………………… 29 Figure 2.2 Electrophoresis analysis of colony PCR products in which positive colony showing the insert (gene of interest) into vector. PCR were performed using pFastBac insert check-F and pFastBac insert check-R primers. They bind the ~868 bp of vector plus amount of insert. Here, insert is ~900bp. M: DNA marker; lane 1 and 2 negative and positive colony…………………………. 30 Figure 2.3 Construction of recombinant plasmid. A) Recombinant plasmid with egfp- cit1a. Electrophoresis of DNA extracted from recombinant colony shows the confirmation of gene of interest. Size of recombinant vector is ~5675bp and only vector without insert is ~4775bp……………………………………….. 30 Figure 2.4 Construction of recombinant bacmid. Recombinant plasmid (pFastBac/egfp-

cit1a) was transformed into DH10Bac E. coli cells. After transformation, the positive colony was checked using colony PCR. Positive colonies show the gene of interest. PCR were performed using M13-F and M13-R bacmid check primers. Thse primers bind the 2300bp plus insert length from positive colony. Here, insert is ~900bp……………………………………………….. 31 Figure 2.5 Construction of EGFP-Cit1a fusion gene and expression of EGFP-Cit1a fusion protein in silkworm. a Schematic representation of EGFP-Cit1a fusion gene obtained by PCR and description of EGFP-Cit1a fusion protein. Details of primers 1–5 are shown in Table 1. b Agarose gel electrophoresis of PCR products in PCR steps (PCR 1–3). Lane 1 PCR 1, lane 2 PCR 2, lane 3 PCR 3. c EGFP fluorescence analysis of the EGFP-Cit1a fusion protein expressed in silkworm on an SDS-PAGE gel. Lanes 1, 3, and 5 show the homogenates of BmNPV-CP−/EGFP-Cit1a bacmid-injected pupa, larval hemolymph, and fat body, respectively; lanes 2 and 4 show the homogenates of mock-injected pupa and larval hemolymph, respectively; and lane 6 shows the mock- injected larval fat body. Fluorescent bands were detected using Molecular Imager FX (Bio-Rad) indicated by arrows. d Western blot analysis of EGFP- Cit1a fusion protein cross-reacted with antibodies is indicated by arrows. Lane 1 shows the mock pupa homogenate; lanes 2, 4, and 6 show the BmNPV-CP−/EGFP-Cit1a bacmid-injected larval fat body, hemolymph, and pupa homogenate, respectively; lanes 3 and 5 show the mock larval hemolymph and fat body, respectively……………………………………… 35 Figure 2.6 Fluorescence detection of EGFP in silkworm larval and pupal fat bodies. a and c show BmNPV-CP−/EGFP-Cit1a bacmid-injected larval fat body and pupal fat bodies, respectively; b and d show mock-injected larval and pupal fat bodies, respectively. Cells were stained with DAPI (blue)……………… 36 Figure 2.7 SDS-PAGE and Western blot analysis of purified EGFP-Cit1a fusion protein. a SDS-PAGE and Western blot of EGFP-Cit1a purified from BmNPV- CP−/EGFP-Cit1a bacmid-injected silkworm fat body. An SDS-PAGE gel was stained with CBB. b SDS-PAGE and Western blot of EGFP-Cit1a purified from BmNPV-CP−/EGFP-Cit1a bacmid-injected silkworm pupae. The arrows indicate purified EGFP-Cit1a fusion protein……………………. 38 Figure 2.8 MALDI-TOF mass spectrometry of recombinant EGFP-FLAG-tagged cyto-

insectotoxin. The sample was dissolved in 0.1 % TFA: acetonitrile (2:1 v/v) and mixed with the matrix solution (1:4 v/v). The mixture (1 μl) was put on a stainless target and crystallized at room temperature. A mass calibration procedure was employed prior to the analysis of a sample using protein calibration standards I (Bruker Daltonics, Germany). The MALDI-TOF mass spectrum was acquired on an AutoFlex (Bruker Daltonics, Germany) and measured in linear mode using 20-kV ion acceleration without postacceleration. The spectrum was recorded at a detector voltage of 1.65 kV and was the averaged results of at least 300 laser shots. SDHB was used as the matrix……………………………………………………………………. 39 Figure 2.9 Growth inhibitory effect of EGFP-Cit1a fusion protein on bacterial strains. (A) E. coli W3110. (B) Staphylococcus aureus. For A and B, 1: 6 µM; 2: 3 µM; 3: 1.5 µM; 4: 0.75 µM; 5: 0.385 µM; 6: 0.187 µM. (C) Pseudomonas aeruginosa. (D) Bacillus subtilis, 1: 4 µM; 2: 2 µM; 3: 1.0 µM; 4: 0.5 µM; 5: 0.25 µM; 6: 0.125 µM; 8: 100 µg/ml ampicillin for gram-negative bacteria or 100 µg/ml chloramphenicol for gram-positive bacteria…………………… 40 Figure 3.1 Electrophoresis analysis for the amplification of polyhedrin, Cit1a and Polh- Cit1a fusin fragment. (A) Polh fragment which was ampliefied using Eco- Ac-Pol-F and FLAG-Ac-Polh-R primers (~726 bp). (B) Cit1a fragment which was amplified using Cit1 (~207 bp). (C) Polh-Cit1a fusion fragment which was amplified by Eco-Ac-Pol-F and Xba1-Cit1a-R primers (~ 933)………………………………………………………………………….. 49 Figure 3.2 schematic representation of a typical cloning experiment. (A) The vector (pFastBac1) is cut ( ) within its multicloning site (MCS). (b) The target DNA (polh-cit1a) is cut () so as to produce termini compatible with the vector………………………………………………………………………… 50 Figure 3.3 A schematic representation of a ligation experiment. The digested plasmid (pFastBac1) was mixed with digested Polh-Cit1a fragment and ligation was induced by T4 DNA polymerase enzyme……………………………………. 51 Figure 3.4 A schematic presentation of the construction of recombinant baculovirus. The recombinant plasmid (pFastBac/Polh-Cit1a) was transformed into DH10Bac E. coli cells. After antibiotic selection, the positive colony was evaluated by colony PCR and finally recombinant virus was selected from

the culture plate……………………………………………………………… 52 Figure 3.5 Electrophoretic analysis of Polh-cit1a fusion protein expressed in silkworm larvae, Sf9 cell and purification. (A) Western blot analysis of Polh-cit1a fusion protein expressed in silkworm larvae. The band at about 40 kDa was observed in infected larval fat body. M: molecular marker; lane 1: BmNPV/Polh-Cit1a-infected larval fat body; lane2: mock larval fat body. (B) Western blot analysis of Polh-cit1a fusion protein expressed in Sf9 cell. Lane 1: AcMNPV/Polh-Cit1a transfected cell; lane2: mock cell. (C) SDS-PAGE of purified Polh-Cit1a fusion protein using DDDDK tagged purification gel. Lane 1, 2 and 3 denote elution 1, 2 and 3, respectively. (D) Western blot analysis of purified sample (lane 1) and lane 3 silkworm larval fat body. Fat body was collected from death larvae. BmNPV/Polh-Cit1a infected-dead larval samples collected at 96 h p.i. Lane 2: mock fat body………………… 56 Figure 3.6 SDS-PAGE analyses of the fusion protein. Enterokinase-treated fusion protein was electrophoresed in 12% polyacrylamide gels. Polh-cit1a fusion protein was collected from silkworm fat body sample. M: Marker; Lane 2, 3 and 4: Enterokinase-treated sample at 2, 4 and 8 h respectively. Lane 1: Undigested sample……………………………………………………………. 57 Figure 3.7 Effect of Cit1a on the growth of silkworm larvae during recombinant baculovirus infection. Data were analyzed using ANOVA. Error bars indicate standard errors and the asterisks centered over the error bar to indicate the relative level of the p-value. Significant differences are indicated by * (P < 0.01, Tukey’s Honestly Significant Difference test)…………………………. 59 Figure 3.8 Photographs of recombinant baculovirus-infected silkworm larvae. (A) Cuticular melanization resulting from baculovirus expression of Cit1a in silkworm larvae. (B) Control virus-infected larvae are shown for comparison. (C) Light microscopic images of silk gland of larvae infected with viruses expressing Cit1a at 96 h p.i. (D) Larva infected with control virus without Cit1a at 96 h p.i.. Arrow head shows deposition of melanin. Bar represents 330 µm………………………………………………………... 60 Figure 3.9 Trypan-blue staining experiment of Bm5 cells infected with each recombinant BmNPV. (A) Microscopic analysis of Bm5 cells infected by BmNPV/Polh-Cit1a, BmNPV/EGFP, and mock at 48 h p.i. (B) Cell mortality

vii

of BmNPV/Polh-Cit1a (closed circles) and BmNPV/EGFP (open circles) infected Bm5 cells. Red and green arrow head show dead and live cell respectively. Cells were stained with Trypan-blue dye, and dead cells were counted by a hemocytometer. Error bars indicate the standard errors, and the asterisks centered over the error bar to indicate the relative level of the p- value ("**" means p<0.01). (C) Cell mortality of AcMNPV/Polh-Cit1a- (closed circles) and wild type AcMNPV- (open circles) infected Sf9 cells. Error bars indicate standard errors, and the asterisks centered over the error bar to indicate the relative level of the p-value ("*" means p<0.05)………… 62 Figure 3.10 Western blot analysis of Bm5 cell infected with BmNPV/Polh-Cit1a. M: molecular marker; lanes 2-6: samples collected at 24, 48, 72, 96 and 120 h p. i. lane 1: mock infected cell………………………………………………….. 63 Figure 3.11 Photographs of recombinant baculovirus-infected Bm5 and Sf9 monolayer cells by fluorescence microscope. (A) Mock infected cells (Sf9). (B) Cell (Bm5) was infected with the recombinant virus BmNPV/Polh-Cit1a, (C) Sf9 cell infected with AcMNPV/Polh-Cit1a expressing the toxin showing absence of cytoplasm and polyhedra accumulated in the nucleus. (D) Sf9 cell infected with wild type AcMNPV. Photographs were taken 72 h p.i. Arrow head indicates the polyhedra expressed in nucleus. Bar represents 10 µm……………………………………………………………………………. 64 Figure 3.12 Polyhedra production by recombinant baculoviruses in insect cell line. The cells were infected with virus at a MOI of 10. The yield of total released polyhedra from Sf9 infected with AcMNPV and AcMNPV/Polh-Cit1a and Bm5 infected with BmNPV/Polh-Cit1a were counted with hemocytometer… 65 Figure 3.13 Predicted structure of mature cyto-insectotoxin1a (cit1a) peptide. The Swiss- Model Server (http://swissmodel.expasy.org/) was used for protein structure prediction. The amino acid sequence was used in this model adopted from NCBI……………………………………………………………………….. 67 Figure 3.14 Effect of foreign genes that are used to construct recombinant baculovirus and their effect on the improvement of pathogenicity over wild-type baculovirus……………………………………………………………………. 68 Figure 3.15 Photographs of recombinant baculovirus-infected Bm5 monolayer cells by confocal laser scanning microscope (CLSM). (A) Cell was infected with the

viii recombinant virus BmNPV/Polh-Cit1a, expressing the toxin showing absence of cytoplasm and polyhedra accumulated in the nucleus. (B) Mock infected cells. Photographs were taken 72 h p.i. Arrow head indicates the polyhedra that expressed in nucleus…………………………………………. 70

LIST OF TABLES

Table 2.1 The primers used in this study……………………………………………….. 28

Table 2.2 Antimicrobial activity of EGFP-Cit1a……………………………………….. 41

Table 3.1 The primers used in this study……………………………………………….. 48

Table 3.2 LT 50 value and production of budded virus for the recombinant BmNPV/Polh-Cit1a and control virus BmNPV/EGFP in 5th instar larvae of Bombyx mori………………………………………………………………….. 58

LIST OF ABBREVIATIONS AcMNPV: Autographa californica multicapsid nucleopolyhedrovirus AMP: Antimicrobial peptide

BCA:Bbicinchoninic acid assay

Bm5: Bombyx mori cell line BmNPV: Bombyx mori nucleopolyhedrovirus BSA: Bovine serum albumin

CLSI: Clinical and Laboratories Standards Institute

CLSM: Confocal Laser scanning microscope DAPI: 4′,6- diamidino-2-phenyindole

DMRIE-C: 2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide

Ek: Enterokinase

HEK293: Human embryonic kidney 293 cell

LB: Luria-Bertani

MALDI-TOF: Matrix-assisted laser desorption/ionization-time of flight mass spectroscopy.

MAMP: Membrane-acting antimicrobial peptide

MIC: Minimal inhibitory concentration

PBS: Phosphate-buffered saline

PFU: Plaque forming units SD: Standard deviation

SDHB: 2-hydroxy-5-methoxybenzoic acid

SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis Sf9: Spodoptera frugiperda cell line

TBS: Tris-buffered saline

TFA: Trifluoroacetic acid

ABSTRACT

Insect pests cause significant losses in agricultural crop production which ultimately affects global food security. Therefore, the management of crop yield losses is an essential part of global food security. Beginning in the 1940s insect pest management primarily relied on chemical insecticides. Needless to say that these agrochemicals dramatically increased the yield of staple food crops resulting in improved food security at both local and global levels. However, the inappropriate use of synthetic chemical insecticides has caused negative impacts on the environment, biodiversity, and the health of humans and animals. Most of the early developed synthetic chemical insecticides showed negative effects on a wide range of non-target organisms resulting in negative affects the ecosystem. In order to avoid these negative effects while also maintaining food security, biological control agents such as natural enemies (i.e., predators, parasites, parasitoids) and microbials (e.g., baculovirus, fungus, and bacteria) have been used. These agents are more hosts selective and can be used as an alternative or supplement to synthetic chemical inseticides. Furthermore, recent advancements in our ability to genetically modify microbials have led to improvements in their insecticidal activity. The use, for example, of insecticidal toxins that are present in many venomous organisms has been shown to improve the efficacy of baculoviruses. Natural baculoviruses have a long history of safe use as specific, environmentally friendly insecticides. However, their widespread use has been limited by several factors, especially their slow pathogenicity. When baculovirus contaminated foliage is ingested by a lepidopterous insect, the occlusion-derived virions (ODVs) are released from the protective capsule (i.e., the polyhedron) within the midgut. The released ODVs attach to midgut cells, replicate, and subsequently initiate a systemic infection resulting in extensive tissue damage and thereafter death. Generally, in the case of nucleopolyhedroviruses (NPVs) it takes 4–5 days or longer for the host insect to succumb to virus infection in laboratory. In the field, this process can take more than a week. Because of this slow speed of kill the infected larva can continue to feed and continue to damage the host crop. In my dissertation, I hypothesize that the expression of an insect-selective toxin by the baculovirus will shorten the time from the initial exposure to the virus to death. In this dissertation two kinds of recombinant baculoviruses which express an insect-specific spider venom toxin gene were constructed. This toxin gene was identified from venom of the ant spider Lachesana tarabaevi. The toxin has two distinct properties one insecticidal and the other antimicrobial. The recombinant, baculovirus-expressed spider venom peptide was purified and its functional activity against several bacterial strains was evaluated.

Spiders deploy venom to help catch prey and for protection from enemies. Spider venom contains a wide range of toxins including neurotoxins and cytotoxins. Many of these toxins are insecticidal, and some spider venom peptide toxins are registered for use as a biopesticide. One of these toxins, a spider venom peptide called cyto-insectotoxin1a (cit1a) that is derived from L. tarabaevi was used in this study. The full length sequence of cit1a was amplified by PCR and subsequently used for construction of two recombinant baculoviruses. In part 1, cit1a was fused with enhanced green fluorescent protein (EGFP) and expressed in silkworm larvae using a recombinant Bombyx mori NPV (BmNPV). The EGFP-Cit1a fusion protein was expressed in silkworm larval fat body as well as silkworm pupa. The fusion protein was purified both from larvae and pupae, and the antimicrobial activity of the fusion protein was determined against several bacterial strains using the disk diffusion method. The purified EGFP-Cit1a fusion protein remained active and showed growth inhibitory effect against both Gram-positive (Bacillus subtilis (NBRC13719)) and Gram-negative (Pseudomonas aeruginosa (NBRC12689, NITE) and Escherichia coli W3110 (NBRC12713)) bacteria. The minimum inhibitory concentration (MIC) of EGFP-Cit1a against these bacteria was also calculated using a microdilution technique. The purified EGFP-Cit1a fusion protein showed growth inhibitory effect at micro molar concentrations. These study findings suggest that spider venom peptide (cit1a) will increase the pathogenicity of the baculovirus. In addition this study developed a new low cost and safe strategy for the expression and production of cit1a using silkworms. This system may allow cit1a to be used for insecticidal as well as therapeutic purposes. In part 2 of my dissertation project, the cit1a was fused with polyhedrin (Polh) and the fusion protein was expressed by a recombinant Bombyx mori NPV (BmNPV) and a recombinant Autographa californica multicapsid NPV (AcMNPV), BmNPV/Polh-Cit1a and AcMNPV/Polh- Cit1a, respectively. The Polh-Cit1a fusion protein was expressed in silkworm larvae, Bm5 cells, and Sf9 cells and its authenticity was confirmed by western blot analysis and detected by Coomassie brilliant blue staining. In 5th instar silkworms, BmNPV/Polh-Cit1a showed a significant reduction of median lethal time (LT50) when compared to wild-type BmNPV, which suggests that Polh-Cit1a improved the pathogenicity of BmNPV. In addition, BmNPV/Polh-Cit1a induced early cuticular melanization of silkworm larva compared to wild-type BmNPV. BmNPV/Polh-Cit1a also induced early Bm5 cell death. Similar results were found in AcMNPV/Polh-Cit1a infected Sf9 cells. The nuclear membrane of Bm5 cells that were infected with BmNPV/Polh-Cit1a appeared disrupted and the outline of cells was blurred under light microscopy. This study suggests a new strategy for the development of a recombinant baculovirus biopesticide that produces an insect-selective toxin fused to polyhedrin.

CHAPTER I

Introduction

1. Introduction

1.1 Spider-venom as biopesticidal agent Without any control measure pests including arthropods, weeds and pathogens cause considerable losses in food crop production (Oerke 2006). Therefore, pest management is necessary to gain food security and protect losses of crop productions. Synthetic chemical insecticides have been applied for insect pests management since 1940s (Casida and Quistad 1998); there is no doubt that pesticide increase crop production, on the other hand they cause harmful effects on other non-target organisms, environment as well as human health risks (Carson 1962). Still synthetic pesticides have a continuous significant role in the management of pest for food crop production. Pesticides bring considerable profits in several ways however inspite of higher risks for human and animal health, there is no alternative in their use. Potential alternatives to all agrochemicals need to be developed for safe crop production. Biological pesticide such as bio-agents or biomolecule bearing high affinity to host species might be a potential target (Glare et al. 2012). The efforts need to increase the various diverse biological materials which have specific target sites. With less detrimental environmental effects agrochemicals in plant delivery system should be developed for new generation. Pesticides that have no significant risks to other animals, microbes, human health, biodiversity loss and environment friendly are highly demanded. Nowadays, most promising strategy is to utilize directly recombinant proteins that are insect specific toxin (neurotoxin, cytotoxins and so on) in association with other proteins which make oral toxicity (Nakasu et al. 2014) or indirectly by making recombinant baculovirus using spider venom peptide which are highly toxic to target insect pests. Baculovirus itself is a pathogen which kills host specific insects but their extensive use in farmers’ field is limited due to their slow pathogenicity. Baculovirus expression vector expressing insect specific toxin during their infection might alleviate this problem (Choi et al. 2008; Gramkow et al. 2010; Shim et al. 2013; Stewart et al. 1991). Spider venom peptide which is highly toxic to insect and has no adverse effects on other non target organisms could be a potential candidate for developing improved recombinant baculovirus.

1.1.1 The insect pest problem in the world Insect pests are one of the major threats for agricultural production system which

4 ultimately affect global food security. They have adverse and damaging impacts on agricultural production along with market access, the natural environment, and our lifestyle. Insect pests are continuously creating our problems by several ways such as damaging crops and food production, parasitizing livestock, or being a nuisance and health hazard to humans. Though a significant development of insect pests control methods, they still cause the significant damage global food production by 10–14% each year (Oreke 2006), 9–20% of stored grain products (Phillip and Throne 2010), and act as a vector of a numerous life threat diseases of human and animal (Pimentel 1997). Synthetic pesticides still remains the principal part of insect pests’ management although they have tremendous effects on environment, biodiversity and human health risks.

1.1.1.1 Agricultural pest insects

There are 2.8–10 million arthropods on earth and they share a large group of animals (Ødegaard 2000). Among them only 10,000 are designated as agricultural pests which cause 14% of agricultural production loss. In addition they also induce 20% damage of stored food grains both in quantitative and qualitative ways (Oreke and Dehne 2004; Pimentel 2009). Thus they cause an estimated USD100 billion loss annually (Carlini and Grossai-de-Sa 2002). Herbivorous insects belonging to Orders Coleoptera, Orthoptera and Lepidoptera are the leading causal agents for this estimated loss (Novotny et al. 2002). The immature stage of lepidopteran insects causes considerable damage (McCaffery 1998). Therefore approximately 40% of chemical insecticides are used to control heliothines (Brooks and Hines 1999), insect species from the other Order such as Diptera, Hemiptera, Thysanoptera and Acarina (mites) can also be considered as agricultural pests (McCaffery 1998; Nicholson 2007). To increase food security is continuously hampered by insect pests which cause a large part of agricultural food production both loss in field and storage condition which ultimately affect our efforts to meet the demand of global food production. But the appeal of additional food production is continuously increasing to feed the additional growing people in the world, which is predicted approximately 9.31 billion for the next 40 years (UN Department of Economic and Social Affairs; http://esa.un.org/unpd/wpp/unpp/panelpopulation.htm) with a limited expansion agricultural land. So we need to develop cost-effective, less negative impact on other non-target organisms, environment including human health methods to combat pests in agricultural production system as well as in storage period.

1.1.1.2 Insects act as disease carrier Some arthropods species act as dangerous infectious disease carriers for human and animal (Nauen 2007). Especially mosquitoes, midges and flies belong to the Order Diptera cause the major infectious disease of human and animals (Gratz 1999; Gubler 2002; Hall et al. 2009). Some death oriented disease such as malaria, dengue fever, West Nile virus, yellow fever, filariasis, leishmaniasis, Japanese encephalitis and African trypanosomiasis are spread by hematophagous (blood-sucking) dipterans (Gratz 1999; Gubler 2002; Hall et al. 2009). Other several diseases including lyme disease, ehrlichiosis, various rickettsioses, Rocky mountain spotted fever, tularemia, bubonic plague, chagas disease and bartonella are carried out and spread by ticks, fleas, lice and triatomid bugs (Billeter et al. 2008; Brogdon and McAllister 1998; Gayle 2001; Gratz 1999; Gubler 2002; Lounibos 2002; Schofield and Kabayo 2008). Arthropods also transmit onchocerciasis, Barmah forest virus, Japanese spotted fever and dengue-dengue hemorrhagic fever diseases (Gratz 1999). The control of insects is the most important issue to prevent these infectious diseases which cost human and animal life. Among them malaria is the best example which asks for insect control. More than 3.3 billion global human population remains at risk to infect malaria disease which is transmitted by mosquitoes (Centers for Disease Control and Prevention Malaria Facts 2012).

1.1.2 Chemical pesticides: current challenges to control insect pest

By killing insects, weeds, fungi, and other agents which cause human and animal disease chemical pesticides make great benefits to society (Enserink et al. 2013). They have been used to grow food which is essential for human and animal and most importantly they protect millions of people from malaria and other infectious diseases which are principally caused by arthropods. The utilization of pesticide is rising everywhere with a few key exceptions (Fig. 1.1). Surprisingly large variation of pesticide use is found in farmers of different countries in the world (Fig. 1.2). Pesticide also increase the economic condition of industrial sector such as cotton and flower industries by reducing pests and also create comfortable life leading by declining mosquito, ant, and cockroach populations from house. In 1940s agrochemical insecticides are first developed and used but still it occupies the principal component of insect pests’ management. Application of DDT in malaria eradication programs is demonstrated as the remarkable success of synthetic chemicals (Attaran et al. 2000; Casida and Quistad 1998). In 1960s organophosphates are introduced (Casida and Quistad 1998).

To control insect pest problems both in agriculture and human and animal health insurance organophosphates and other pesticides make a profitable and comparatively cheap solution. But negative impacts of agrochemicals application in agriculture and malaria eradication programme have been reported and documented over the years. The major problems associated with agrochemicals are negative impacts against non-target organisms, resurgence of secondary pest populations, development of resistant organisms and the expense. Human health and environmental impacts arise from pesticide due to lack of phyletic specificity, pesticide resistance due to limited sources in the bioactivity of pesticides are the major problems which have been associated with the application of chemical pesticides.

Fig. 1.1 Pesticide use is raising almost everywhere, with a few key exceptions (Reprinted with permission from Science Magazine 341: 730-731, 2013. Copyright Science).

1.1.2.1 Health consequences and environmental impacts The people who are exposed with pesticide can be visualized in acute state or delayed (U.S. Environmental Protection Agency 2007). Bassil et al. (2007) reported that non-Hodgkin lymphoma and leukemia are positively correlated with insecticide exposure. Neurological problems, birth deformities, fetal death, lower IQs (Sanborn et al. 2007), neurodevelopmental disorder (Jurewicz et al. 2008, 2013a, b) resulting of pesticide exposure. On the other hand

7 the effects of pesticides on non-target species are also considered the environmental impact of pesticides. When pesticides are applied in crop fields, more than 98% of applied insecticides and 95% of herbicides transport to a place where non-target organisms live (Miller 2004). These can be happened in many ways, for example spray drift, runoff transport pesticides into aquatic ecosystem very close to agricultural land or fresh water ecosystem while spraying pesticide can be moved by strong wind. In this way pesticides can be transported from target field to other fields, grazing areas, human settlements and finally could affect non-target organisms. Poor production, transport and storage practices also create other problems (Tashkent 1998). Longer period, pesticide induce pest resistance by repeated use as well as pest's resurgence resulting from their effects on non-target species (Damalas et al. 2011). The overall pathways of pesticide how they pollute the environment (major component of environment: air, water and soil) is demonstrated in Fig.1.3.

Fig. 1.2 The variation of pesticide used by farmers in different countries (Reprinted with permission from Science Magazine 341: 730-731, 2013. Copyright Science).

To avoid such dramatic impacts and to get out of this dead end alternative pest control strategies must be developed to deliberate cost efficient, low possibility to develop resistance, less negative impact on environment. Certainly it can be achieved by developing insecticides which has high affinity at target sites of an insect pest. However, most of currently available chemical pesticide acts on targets remains across the target and non-target invertebrate. Acute

8 toxicity effect of chemical pesticide both in animal and human is widely documented. Annually more than 250,000 people die due to chemical insecticides use including suicide in the developing world (Gunnel et al. 2003, 2007). Use of pesticide for suicide death is a simple and more convenient way of rural woman including young girl and WHO concluded that pesticide poisoning is an important means of suicide world (Bertolote et al. 2006). One- third of world suicides deaths are caused by pesticide (Gunnel et al. 2007). However, residual chemical pesticides with the effects of chronic exposure are still contentious (Pimentel 2005). Human health hazards range from fatal to chronic intoxication and include neurological disorders, birth defects, fetal deaths and deformities during early childhood development (Jurewicz and Hanke 2008; Lawrence 2007; Mascarelli 2013; Reynolds et al. 2002; Rogan and Ragan 2007; Sanborn et al. 2007; Valery et al. 2002). They result from direct pesticide contact e.g. by users, or from contaminated food and drinking water. Studies showed a probable relationship between chronic insecticide exposure and congenital defects (Alavanja et al. 2004; Barone et al. 2000; Eriksson 1997), preterm birth (Longnecker et al. 2001), Parkinson’s disease (Betarbet et al. 2000; Gorell et al. 1998; Priyandarshi et al. 2000; Semchuk et al. 1992; Sherer et al. 2003), and neuropsychological dysfunctions (Kamel and Hoppin 2004).

Fig. 1.3 Pathways of environment pollution by chemical pesticide application in agricultural farm (this figure taken from the free encyclopedia, prepared by Dr Roy Bateman, 2010, available from https://commons.wikimedia.org/wiki/File:Env_contamination1.if.gif)

Currently negative impacts of chemical pesticides use on environmental pose a considerable attention. Single pesticide or mixture of several pesticides pollutes soils, drainage water, and plants in arable lands as well as neighboring place. For example variable levels of neonicotinoids or fipronil alone or their mixtures are found in soils, waterways, and crops in cultivated field and neighboring areas (Bonmatin et al. 2015). Thus non-target animals have a greater chance to be exposed with pesticides or pesticide contaminated environment such as if water of a canal contaminated with pesticide which was applied in crop field, the organism living in this aquatic ecosystem will be exposed. Approximately every year 4 million tons of agrochemicals are spread globally, estimating to on an average 0.27 kg/ha of global land ecosystem. Biodiversity of invertebrates in fresh water ecosystem can be reduced up to 40% due to pesticide exposure and this estimate can be increased with the increased application of pesticide as a result of ongoing climate change. Several pesticides remain for a long time in the ecosystem, such as DDT has detrimental impacts of bioaccumulation. Human health concerns as well as environmental problems have inspired the withdrawing 169 pesticides from January 2005 to December 2009 and with a limited number insecticides (only 9) have been registered within the following period (Dale 2012).

1.1.2.2 Pesticide resistance Fig. 1.4 clearly shows that chemical pesticides have been quite effective in boosting agricultural yields (Science Magazine 341: 730-731). The most of the insecticides are developed with a single specific binding site of the host nervous system. The sodium (NaV) channels, glutamate, γ-aminobutyric acid (GABA), nicotinic acetylcholine and acetylcholinesterases are the main target receptors of each chemical pesticide (Casida 2009). Recently ryanodine receptors target specific chemical pesticide is developed (Sattelle et al. 2008). A limited target site is the major drawback of synthetic pesticides which induce to develop resistance (Brogdon and McAllister 1998; Sattelle et al. 2008). Insect pests can develop resistance against a target pesticide by increasing metabolic detoxification, declining target sensitivity, rising sequestration and/or lowering insecticide bioavailability (Brogdon and McAllister 1998; Feyereisen 1995). Detoxification can be happened by physiological as well as molecular approaches such as gene duplication of carboxylesterase (COE), that discharges target pesticide; transposon insertion inducing higher transcription of P450, that hydroxylates target pesticide; binding capacity of pesticide can be decreased by point mutations; sometimes insect develop more power to transport higher amount of excreta with pesticide metabolites from their cell (Fig. 1.5). Though the point mutation is the principal 10 molecular mechanism for the evolution of these resistances but majority of the point mutation occurs in the GABA receptor channel or NaV channel. Binding site of acetylcholinesterase, genes duplication, and detoxification enzymes can also be mutated (Brogdon and McAllister 1998; Feyereisen 1995; Hemingway et al. 2004; Hemingway and Rangson 2000). However, almost all human and animal diseases vectors insect has grown resistance (Georghiou 1990; WHO 1992). Especially after application of insecticide to control insect vectors, the surviving insect vectors are predicted to affect the resurgence (Krogstad 1996), or make difficult the protection of insect-borne diseases (WHO 1992).

Fig. 1.4 Effect of chemical pesticides for boosting agricultural yields (Reprinted with permission from Science Magazine 341: 730-731, 2013. Copyright Science)

The frequent application and higher rate of insecticide when applied to the agricultural field in order to control a target pest, the gene pool of the target pest make undesirable change to form another artificial selection, resistance. How a pest population develops resistance against a specific insecticide at field level is illustrated in Fig. 1.6. Few number of a pest population may survive after application of a pesticide in the crop field due to their specific genetic feature. The survival population goes onward the genes with resistance to the next generation. Subsequent application of the same insecticide leads the increasing of less susceptible individual in the population (Fig. 1.6). Passing this course, the population progressively generates resistance to the chemical insecticide. To date significant number of arthropods, weeds, pathogens and vertebrate pests developed resistant against different pesticides that once controlled them. Among the documented resistant individuals arthropods 11 represent the highest number (Fig. 1.7). Currently insecticide resistance is a great problem for our agricultural production system. For example, the excessive application of synthetic pesticide induces to generate insecticide resistance toward brown planthoppers (BPH and WBPH) in the tropics and in temperate Asian countries (Heinrichs 1994). China, India, Indonesia, and Thailand had reports of rice planthopper resistance to insecticide (Catindig et al. 2009).

Fig. 1.5 Mechanisms of synthetic insecticide resistance. (A) Gene duplication of carboxylesterase (COE) that discharge insecticide; (B) Transcription of P450 induces hydroxylation of the pesticide. (C) Active binding site is altered by point mutations which ultimately decrease insecticidal activity. (D) Gaining more power to transport higher amount of metabolites with excretion from the cell (Reprinted with permission from Heckel 2012. Copyright Science)

In China, planthoppers exhibited 28.8-fold and 79.1- to 81.1-fold resistance to buprofezin and imidacloprid, respectively, in 2004 and 2005 to 2006. Over the year, resistance problem increases rapidly. In India, common organophosphates were tested against planthoppers in 1998. However, the planthoppers did not show any significant resistance to 12 the chemical. Other tests in 2006 took place that showed planthopper resistance by 35.13-, 10.78-, and 4.98-fold to imidacloprid, thiamethoxam, and clothianidin, respectively (Catindig et al. 2009). Multiple resistances are another most critical problem in agricultural production system in which pest grows resistance to more than one pesticide. To date 17 arthropod species recorded as resistant to all major classes of pesticides (Bellinger 1996).

1.1.2.3 Biological pesticide The pesticides which are made from natural substances including animals, plants, bacteria, viruses, plant extracts and some minerals. There are more than 430 registered biopesticide active ingredients and 1320 active product registrations in 2014 (US EPA 2015). Research on biopesticide development has continuously been investigated for their low possibility to develop resistance, less environmental impact, human health riskless, easy application and their replacing capacity for chemical pesticide from agricultural production system. It is believed that biopesticide must help us to alleviate negative impact on environment involving broad-spectrum agrochemicals and ultimately develop a new concept for controlling already pesticide resistant pest species (Nauen and Bretschneider 2002). Biological pesticides might also be used to stimulate the efficiency of plant protection technique and in many cases it can be used for synergistic action with current integrated crop management programme (Wratten 2009). In 2009 approximately 43 USD billion was the chemical pesticide market and this can be reached at 51 billion USD and their expected annual growth rate is 3.6% (Lehr et al. 2010). On the other side, annual growth rate of biopesticide is 15.6% with an expected value 1.6 billion USD in 2009 and it can be increased upto 3.3 billion USD in 2014. Biological pesticides share 2.5% world pesticide market in 2006 and majority of this biopesticide was used in orchard crops which represents 55% of the total (Thakore et al. 2006). However, agrochemicals occupy the largest market segment involving an annual growth rate 3% (Lehr 2010). Five-fold higher annual growth rate of biopesticide indicates that demand of this sector already increased (Thakore 2006).

Microbes including baculovirus, entomophagous nematodes; plant extracts (especially oil); pheromones represent the potential sources of biopesticide. Toxins derived from both vertebrate and invertebrate are the potential sources of developing biopesticide. Recently research on the development of bioinsecticides based on toxins including neurotoxins, peptide toxin, cyto-insectoxin identified from scorpion venom (Froy et al. 2000), parasitic wasps (Quistad et al. 1994), the straw itch mite (Tomalski et al. 1998), and spiders (King 13

2007; Nicholson 2007). Spider venoms comprise a variety of potent insecticidal, neurotoxic peptides which currently raise a great deal of interest for making novel biopesticides.

1.1.2.4 Spider venom peptides as bioinsecticides for insect pest control Before 300 million years, the most ancient arthropods belonging arachnid ancestor are identified as spiders which contain a variety of venom complex. Up to date, more than 42,000 venomous animals including predatory beetles and spiders have been identified (Platnick 2012). Spiders produce dangerous toxins and conserve them in their venom gland which they utilize to catch and feed prey and protect themselves from other enemies. They contain various kinds of toxins, enzymes, neurotoxins, antimicrobial peptides including cytolytic elements. These toxins are stored in their venom gland and use for feeding purpose (Escoubas et al. 2006, 2008; Escoubas and King 2009; Escoubas and Rash 2004; Estrada et al. 2007; Kuhn-Nentwig et al. 2011; Rash and Hodgson 2002; Sollod et al. 2005; Tedford et al. 2004; Vassileviski et al. 2008). Based on molecular weight, the toxins of spider venom is classified as (a) lower molecular weight peptides which are less than 1kDa, (b) linear cytolytic compound and disulfide-rich neurotoxins, their molecular weight ranged from 1 to 10 kDa, (c) higher molecular weight peptides which are more than 30 kDa.

Up to date 1464 toxins have been identified from 92 spider species which is available in ArachnoServer (www.arachnoserver.org) (Herzig et al. 2011). Among the all toxins, only the insecticidal toxins producing spider families is shown in Fig. 1.8. Araneomorphs is a major infraorder which represent more than 90% of all identified spider species producing toxins (Windley et al. 2012). King et al. (2011) reported that several venom alone produce more than 1000 distinct peptides. There are 100,000 species bearing venom and each of them contains 200 peptides, thus total spider venoms might harbor more than 10 million biomolecules (peptides) (King et al. 2008). A good number of spider venom peptides are characterized as pesticidal agents and some of them are already being used for application as insecticide. One hundred and thirty six (136) pesticidal peptides are characterized in which 38 selective and 34 non-selective. Some selective peptides have been used for plant protection programme and registered as patent (Herzig et al. 2011).

Fig. 1.6 Mechanism of a principal rice insect pest, Nilaparvata lugens which develop resistance against chemical insecticide at field level (parts of pictures were adopted from rice hoopers net; www.ricehoppers.net).

1.2 Baculovirus uses as biopesticide for insect pest management In 1940 the discovery of synthetic pesticides with easy application techniques greatly improved the plant protection system (Osman 2012). Shortly people start to observe the drawback of this system. Insect pests which are being naturally controlled by the action of their natural enemies also begin to develop resistance against agrochemicals (EL-Ghareeb et al. 2012). Furthermore these pesticides increase the crop production cost and make a threat for environment and its surrounding organisms (Inceoglu et al. 2006). Application of biopesticide alone or combined with other plant protection techniques is an promising tactics for efficient pest management (Assaeedi et al. 2011; Harrison and Bonning 2001). The advantages of microbial control, particularly baculoviruses have been appeared during last decade and their research continuously increases. The genome size of baculovirus varies from 80 to 220 kb and they are the largest family of insect viruses (Lauzon et al. 2006). Baculoviruses are highly host specific primarily in insects belong to the Order of

Lepidoptera. This group of insects has high alkaline midgut. They never infect to non-host insects. The pesticidal values of baculovirus have been evaluated for a period of long time (Li et al. 2007). As they are not harmful to other vertebrates or human or plant, they might be recognized as a potential tool for plant protection programme (Choi et al. 2008).

Fig. 1.7 Pesticide resistant pest species toward different pesticide that once control them

For insect pest management, the baculoviruses are firstly characterized in the early of 1900s (Steinhaus 1956). Thereafter several insect pests belong to order of Hymenoptera, Lepidoptera, and Coleoptera have been controlled using several baculoviruses. Two baculoviruses, Anticarsia gemmatalis NPV and Oryctes rhinoceros NPV are applied to controlled soybean, palm and coconut pests in Brazil (Entwistle and Evans 1985). Using baculovirus for plant protection programme was first commercialized in Brazil and later extended in Paraguay involving a soybean pest, Anticarsia gemmatalis control by a baculovirus (Moscardi 1989, 1999; Moscardi and Sosa-Gomez 1993). For each hectare of crop land 1.5 × 1011 occlusion bodies was applied. The coverage area was extended to more than 2 million hectare by 2005 while it was started at early 1980s (Szewczyk et al. 2006). In this programme virus production was not economic in laboratory. However culture of virus

16 was performed in farmer’s field. The field of soybean was artificially infested by A. gemmatalis and virus applied over the field. After 8-10 days of virus application each farmer could collect approximately 1.8 kg infected larvae/day with 15 USD dollar expense in the mid 1990s (Rohrmann 2013). Twelve companies in China used 1,600 tons of Helicoverpa armigera NPV infected insects and the amount of virus production was used to coverage on 200,000 to 300,000 ha of cotton field in 2005 (Sun and Peng 2007).

Fig. 1.8 Insecticidal toxin producing spider family with their respective peptide number (data taken from Windley et al. 2012).

1.2.1 Baculovirus: classification, structure and life Cycle Most of the baculovirus strains are isolated from Lepidopteran insect pests. Also several viruses are identified from ill sawflies and mosquito larvae. The viruses produce large crystal particle defined as an occlusion bodies. Based on occlusion body (OB) formation, Baculoviridae is categorized by the two genera nucleopolyhedrovirus (NPV) and granulovirus (Au et al. 2013). NPV has two distinct forms: one is single NPV where single nucleocapsid is covered by an envelope and another is a multiple NPV (MNPV) where multiple nucleocapsids are covered with an envelope (Hermiou et al. 2012). Two types of

17 virions are caused by baculovirus replication process. One is occlusion derived virions that initiate infection of midgut cells and another is budded virions which are not occluded but spread the infection from one cell to another new one within the host insect body. Therefore to initiate host infection cycle virions have important role which remain within occlusion bodies. At the final stage of infection cycle the OB is developed and discharged into the environment after death and damaged infected insect bodies. The overall structure of a NPV baculovirus is shown in Fig. 1.9. The OB is stable in environment and waiting for ingestion by healthy insects. After ingestion by target insect the OB is dissolved in the midgut of insect due to alkaline condition and released occlusion-derived virion (ODV). These ODVs enter into the peritrophic membrane and begin to infect the epithelial cells. This infection is happened due to direct fusion peritrophic membrane. Nucleocapsids start replication in the nucleus. Budded virus is developed within the midgut cells and transfers to tracheal and hemolymph system. Thus budded virus spread the infection within the entire body of the host insect.

Fig. 1.9 Structure of a baculovirus (AcMNPV). Baculovirus has biphasic life stages making occlusion derived virion (ODV) and budded virus (BV). The ODV is essential for primary infection and BV is responsible for systematic infection.

1.2.2 Recombinat baculoviruses: current challenges and future prospects As baculovirus is very much host-specific and does not have any negative effect to other organisms and therefore it has a possibility to utilize as biological pesticide for crop 18 protection programme (Choi et al. 2008). More than 600 insect species are reported to be infected with baculoviruses (Hee et al. 2009). Majority of the target host is Lepidopteran insects (Jeong et al. 2005; Martignoni and Iwai 1986; Murphy et al. 1995). However, there are several limitations of naturally occurring wild type viruses to be applied in crop field (Choo et al. 2012). Among them slow pathogenicity is the principal drawback of wild type baculovirus for using crop protection system globally (Choo et al. 2010). From the infection process of baculovirus it is clear that after ingestion of baculovirus OB discharges ODVs which initiate infection process and later on replicate in cells. Replication of foreign materials induces host tissue damage leading to death of host insect. To complete this system needs more than more than a week in field, thus the insect larvae have a chance to get more time to feed and cause extensive damage host plant (Stewart et al. 1991). For this reason farmers are reluctant to use baculoviruses in their field to combat insect pests. Baculovirus expression vectors expressing foreign genes including toxins, protease, hormones, spider venom peptide, neurotoxins, Bt toxin resolve the problem (Carbonnel et al. 1985; Choi et al. 2008; El- Menofy et al. 2014; El-Sheikh et al. 2011; Gramkow et al. 2010; Hammock et al. 1990; Maeda et al. 1990; Martners et al. 1990; Pennock et al. 1984; Shim et al. 2013; Smith et al. 1983).

With the advancement of recombinant DNA technology, the genome of wild-type baculovirus is modified by inserting pesticidal genes or other protease which enhance the spread of baculovirus infection. Thus these baculoviruses act faster than wild-type one. The improved pathogenicity of the recombinant baculovirus such as Autographa californica nucleopolyhedrovirus was investigated under laboratory condition (Bonning and Hammock 1996; Choi et al. 2008; Nusawardani et al. 2005; Osman 2012; Shim et al. 2013). The genes additionally used to modify the wild-type baculovirus included insect hormonal genes that induce physiological hormonal imbalance in host insects (Choi et al. 2007; Maeda et al. 1990) and Bt gene (Martens et al. 1995; Osman 2012; Ventura and Villaverde 2006). Furthermore, the recombinant baculoviruses which are modified by inserting mite or scorpion toxin genes (Maeda et al. 1991; Steward et al. 1991; Tomalski and Miller 1991) enhanced the biological activity of baculoviruses including pathogenicity. All of the recombinant baculoviruses reduce significant median lethal time (LT50). The field application and benefit of recombinant baculovirus use for pest management programme is already demonstrated (details can be seen in Sun and Peg 2007).

1.3 Spider venom as antimicrobial agent

1.3.1 Antibiotic-resistant

Currently antibiotic resistance causes a potential threat to human health. The pathogens grow resistance against an antibiotic which once was effective to the following pathogen. Recently, the rate of antibiotic resistant is rapidly increased. The microbes can develop resistance against drugs easily by changing their genetic makeup. Genetic makeup can be changed by spontaneous or induced mutation. Sometimes one microbe can obtain a resistance gene from other species and develop resistance against a specific drug. Without genetic mutation microbes can develop resistance by a variety of mechanism. As for example bacteria grow resistance various kinds of mechanisms such as change chemical structure inducing physical relief from the cell, or displace the active target site or enzymatic dysfunction. Though there is a great demand for new antibiotics for patient treatment, a decline trend of newly registered drugs is found in the market (Cassir et al. 2014). Several drug resistant bacteria have be identified including MRSA (methicillin-resistant Staphylococcus aureus), VRSA (vancomycin-resistant S. aureus), ESBL (extended spectrum beta-lactamase), and MRAB (multidrug-resistant Acinetobacter baumannii). Antibiotic- resistant species are rapidly increasing for intensive usage of antibiotics in medical practice (Goossens et al. 2005). Multidrug-resistant is another serious growing problem and already it is identified in several strains of pathogens such as strains of Mycobacterium tuberculosis, vancomycin-resistant Enterococcus (Science daily 2009). Some strains of MDR (multidrug resistant) Gram-negative bacteria such as Pseudomonas aeruginosa and Acinetobacter baumannii showed resistance to all commercially available drugs (Giamarellou and Poulakou 2009). Antibiotic resistance causes an emerging global problem reported by WHO (2014) that have already been happened all over the world. When a bacterium develops resistance against an antibiotic, the antibiotic does not act any longer in patients who require to protect themselves from bacterial infection (WHO 2014).

1.3.2 Discovery of new antibiotics: current challenge

Aside from the problem of obtained and intrinsic resistance among bacteria, new antibiotics are continually required to control the threat of newly identified infectious diseases (30 were characterized in the 1980s and 1990s alone) and to discover alternatives to some of the unacceptably toxic antibiotics which are currently available (Giamarellou and

Poulakou 2009). The discovery of antibiotics provide to significant optimism of eradicating infectious diseases. During the last two decades, there is a clear decline trend of newly registered novel antibiotics (Lee et al. 2012). There are many pharmaceutical companies have greatly reduced or completely ceased their antimicrobial drug development and research though there is an emerging appeal for novel drugs (Butler 2011). Because it is extremely expensive to discover new one and making the safety and efficacy of a new antibiotic and has no guarantee that a new antibiotic will be approved even after a huge investment of time and money (Lee et al. 2012). Currently available most antibacterial drugs are developed between 1940 and 1980 using traditional techniques, such as the screening of soil microbes that become saturated (Devasahayam et al. 2010) and majority of the newer antibacterial drugs have derived from chemical modification of alive antibiotic structures. Efforts to create new novel antibiotics using existing drugs scaffolds are most challenging due to their semi- synthetic derivatives which are often unable to penetrate the bacterial cell wall properly. More innovative, non-traditional strategies are therefore required in order to provide the urgently needed next generation antimicrobial drugs. To alleviate this problem, new antimicrobial agent discovery with lower possibility to grow resistance increasingly important.

1.3.3. Natural sources for antimicrobial drugs

Explore for novel antimicrobial agents from natural sources is an emerging research area. Natural products are used for numerous medical breakthroughs and life saving drugs particularly in the treatment of infectious diseases, cancer, hyper-cholesterolaemia, and immune dysfunction (Lee et al. 2012). Twenty one antimicrobial drugs derived from natural product (particularly from actinomycete, bacterial, or fungal) are approved during the period of 2003–2008 (Butler and Buss 2006), and there are 36 drug candidates from natural products in the pipeline (Lee et al. 2012). Secondary metabolites from plants, microbes and, to a lesser extent, invertebrates and their associated microbes have provided the main sources of natural product based drugs. Spider venoms might be a potential source of target antimicrobial drugs showing an effective medicinal application (Yan and Adams 1998).

1.3.4 Antimicrobial peptides and future prospects for drugs

Among potential candidates for new antimicrobial agents, antimicrobial peptides (AMPs) deserve special attention (Hanocock and Sahl 2006; Yount and Yeaman 2012). These peptides are found in a broad spectrum of organisms—from bacteria to vertebrates; AMPs probably belong to the most ancient defense systems of multicellular organisms. By the present time, numerous families of AMPs have been identified. To date there are 2533 antimicrobial peptides (249 bacteriocins from bacteria, 2 from archaea, 7 from protists, 13 from fungi, 317 from plants, and 1904 from animals including spiders) with several activities (Wang et al. 2009; Wang and Wang 2004)). At lower concentration level, AMPs are able to bind target cell membrane directly inducing structural damage. This mechanism support that bacteria have lower chance to develop resistance against AMPs (Peters et al. 2010). Surprisingly the main source of AMPs is natural venoms. Spider venom provides a vast source of diverse AMPs with different structure and consequently variable spectrum of activity (Kozlov et al. 2006; Kuhn-Nentwig et al. 2011; Vassileviski et al. 2009).

Pronounced antimicrobial properties and small size of AMPs provide an opportunity to consider these peptides as potential drugs for therapy of human diseases. Natural, chemically synthesized or recombinantly produced peptides are usually utilized in laboratory practice. This is often economically unreasonable for clinical practice, however, since purified preparations in relatively high concentrations are necessary and, in addition, they should be introduced repeatedly to achieve a therapeutic effect. A perspective trend in therapy of infectious diseases is the use of plasmid or viral vectors containing genes of AMPs (Huang 2002; Lazarev et al. 2005, 2011; Lazarev and Govorun 2012). In this case, systemic introduction of an antibacterial agent with probable side effects is replaced by local introduction of a recombinant vector with the possibility to regulate precisely AMP gene expression. This strategy is especially relevant for pathogens causing urogenital infections such as Mycoplasma and Chlamydia. They are characterized by extreme variability of their genome, which may result in quick generation of resistant strains. Besides, unique peculiarities of relationships with immune system often stimulate the development of persistence of Mycoplasma and Chlamydia in the infected organism (Citti and Blanchard 2013; Morrison 2003). Recently, Polina et al. (2012) made advances a novel method (plasmid expression cit1a in HEK293 cell) of AMP application as gene therapy agents, where the expensive stage of peptide synthesis is omitted. Chlamydia infection was controlled based on

22 expression of AMP genes in the infected cells. In this method they used a novel antichlamydial agent cyto-insectotoxin1a (cit1a), cytolytic peptide produced by the Central Asian spider Lachesana tarabaevi (Vassilevski et al. 2008), and representative of a unique class of spider venom constituents. This peptide shows two distinct properties: antimicrobial and insecticidal (Vassilevski et al. 2008).

Small polypeptide molecule with having special characters (antimicrobial effects) is designated as antimicrobial peptides (AMPs) (Yeaman and Yount 2003). Spider venom contains a vast amount of antimicrobial peptides which deserve the special attention for new antimicrobial drug development resources. The wide range of antimicrobial peptides has been identified from ant spider Lachesana tarabaevi. The latarcins 1, 2a, 3a, 4b, 5, and cytoinsectotoxin 1a have been characterized as cytolytic effect as like as melittin (Lazarev et al. 2011). Antibiotics are able to control Mycoplasma and Chlamydia infectious disease (Atkinson et al. 2008; Senn et al. 2005). Mycoplasma can also be suppressed by using AMPs in vitro (Fehri et al. 2007). But it requires comparatively higher therapeutic doses which are major drawback for commercialization of this product involving higher production cost (Vassilevski et al. 2008).

CHAPTER II

Expression and purification of cyto-insectotoxin (Cit1a) using silkworm larvae targeting for an antimicrobial therapeutic agent

DAPI EGFP Merged

EGFP-Cit1a expressed in Bm5 cells

2. Expression and purification of cyto-insectotoxin (Cit1a) using silkworm larvae targeting for an antimicrobial therapeutic agent

2.1 Introduction The widespread over-use and inappropriate use of antibiotics in medical practice inevitably resulting the emergence of resistant bacterial strains (Wright 2007). The rate of development of resistant species is higher than the development of new antibiotics (Giuliani et al. 2007). Some pathogens develop multi-drugs resistance which is more dangerous than single one resistance. The rising of multidrug-resistant strains of different pathogens makes the urgent need for the discovery of new antimicrobial agents increasingly important (Aziz and Wright 2005; Hayakawa et al. 2012). To alleviate this obstacle, novel effective drugs from biological sources need to be developed and commercialized. Antimicrobial peptides (AMP), both native forms and synthetic, deserve special attention as antimicrobial agents (Giuliani et al. 2007). Among potential candidates for new antimicrobial agents, AMPs deserve special attention (Yount and Yeaman 2012; Hancock and Sahl 2006). AMPs are small polypeptide molecules (Yeaman and Yount 2003) and are found in a broad spectrum of organisms, from bacteria to vertebrates. AMPs most likely belong to the most ancient defense systems of multicellular organisms. AMPs are identified and extracted from different organisms including from bacteria to higher eukaryotes (Lazarev et al. 2011). Most of the AMPs have a unique feature to bind target cell membranes directly at micromolar concentrations. This feature of AMPs cause functional and/or structural disturbance of the cell membrane. Moreover, AMPs have comparatively lower possibility to be developed resistance by bacteria (Yeaman and Yount 2003).

Spider venoms concurrently comprise several dozen of AMPs having diverse structures and possess a broad spectrum of activity (Kozlov et al. 2006; Vassilevski et al. 2008; Vassilevski et al. 2009). Recently, Vasslevski et al. (2008) identified cyto-insectotoxin (Cit1a), a novel AMP derived from the Central Asian spider (Lachesana tarabaevi), which represents a unique class of sider venom constituents. Cit1a is a linear cationic peptide having 69 amino acid residues and represents an attractive molecule to combat intracellular pathogens. Cit1a has shown high antibacterial activity with a significant reduction in Chlamydia trachomatis infection (Polina et al. 2012). Lazarev et al. (Polina et al. 2012; Lazarev et al. 2013) characterized Cit1a as an antimicrobial and insecticidal peptide. Cit1a has low toxicity as shown by negligible toxicity to HEK293 cells and suppressed Chlamydia 25 infection in the HEK293 cell line. Therefore, Cit1a is a potential agent for gene therapy for Chlamydia infection (Lazarev et al. 2011). Cit1a could serve an important breakthrough for making a novel class of therapeutic drug belonging to the linear amphipatic peptide class.

The wide range of Cit1a activity suggests that this peptide may be applied as an antimicrobial and pesticidal biomolecule in the future (Vassilevski et al. 2008). AMPc can be produced by chemical synthesis method as they are very short peptide. However, chemical synthesis method is not acceptable widely due to several factors. Biological system could be a promising approach to produce AMPs at large-scale for commercialization (Ramos et al. 2013). AMPs can also be produced by solid phase peptide synthesis method (Merrifield 1963), but this method require high expense, especially for commercial purposes (Wang et al. 2011). Extraction of AMPs from natural sources as well as chemical synthesis is not economical (Hancock and Sahl 2006). Recombinant production systems would enable the production of peptides and proteins in various expression systems and allow for the large- scale production of AMPs to be economically viable. Antimicrobial peptides are produced as a fusion protein in heterologous hosts (Wang et al. 2011). Large quantities of AMPs are required for pharmaceutical applications (Fan et al. 2010). The methods need to be developed for large scale production of AMPs for continuous use in medical practices. Currently numerous expression systems are being used for the economical production of antimicrobial peptides (Ingham and Moore 2007).

Silkworm (Bombyx mori) is an economically viable promising technique to produce recombinant AMPs (Liu et al. 2013; Fukushima et al. 2013). Recombinant proteins and peptides can be produced successfully in silkworm using baculovirus expression system (BES). Both in academic and industrial purposes, silkworm expression system is widely used and several recombinant proteins that are produced using this system have already been commercialized (Kato et al. 2010). There have been two systems, Bombyx mori nucleopolyhedrovirus and transgenic systems, which used silkworms for recombinant protein expression (Kato et al. 2010; Tomita 2011). The main of this study is to develop a novel cost effective cyto-insectotoxin1a production system with high bio-safety. We used silkworm in BmNPV bacmid system, for the expression and production of an AMP (Cit1a) which could potentially be used as a therapeutic agent for Chlamydia infection and as a potential pesticide. Green fluorescent protein, (EGFP) which has no antimicrobial activity, was fused with Cit1a for expression in silkworms. 26

2.2 Materials and methods

2.2.1 Construction of recombinant BmNPV bacmid

The oligonucleotide sequences of Cit1a (accession number FM165474) was purchased from Eurofins MWG Operon (Tokyo, Japan) and the cit1a was amplified by polymerase chain reaction (PCR) using the primer set FLAG-Cit1a-F and Cit1a-xba-R (Table 2.1, primer 1, 2). The EGFP fragment was also amplified as a DNA template from HPV174- EGFP E. coli BmDH10Bac (Palaniyandi et al. 2013) by PCR using primer set Eco-EGFP-F and EGFP-FLAG-R (Table 2.1, primer 3, 4). Genetic structure of cit1a and its variants are shown in Fig. 2.1. Each amplified fragment was electrophoresed in 1% agarose gel and purified using GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, USA). The egfp and cit1a was fused with each other by PCR to obtain an EGFP-Cit1a fusion gene. After 10 cycles of PCR, the two primer sets (Eco-EGFP-F and Cit1a-xba-R, primer 1, 5) were added for amplification of the fusion fragment (EGFP-Cit1a). The amplified fusion fragment was electrophoresed in 1% agarose gel and extracted from gel using GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, USA). The purified egfp-cit1a fusion gene was inserted at the EcoR1-Xba1 site in pFastBac1 (Life Technologies, Carlsbad, CA, USA) following the ligation protocol. The amplified EGFP-Cit1a fragment and pFastBac1 fragment were ligated in a reaction mixture containing 30 ng of EGFP-Cit1a fragment, 78 ng of pFastBac1 fragment and 1 μl of T4 DNA ligase, followed by incubation at 16°C for 16 h. Recombinant pFastBac1 was checked by PCR, electrophoresis (Figs. 2.2-3), and sequencing (data not shown). The resulting recombinant pFastBac1 was transformed into BmDH10Bac CP- E. coli cells (Hiyoshi et al. 2007) and cultivated at 37°C for 36 h. The recombinant BmNPVCP- bacmid DNA was purified from E. coli cells confirmed by PCR and was designated as rBmNPV CP-/EGFP-Cit1a bacmid (Fig. 2.4).

2.2.2 Expression of EGFP-Cit1a fusion protein in silkworm

The recombinant BmNPVCP- bacmid DNA was extracted by alkaline extraction, as explained in the Bac-to-Bac manual (Life Technologies). Ten micrograms of purified rBmNPV CP-/EGFP-Cit1a bacmid with a helper plasmid, were added with 1/10 volume of 1, 2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE-C) reagent (Life Technologies) and kept the mixture for 30 min at room temperature. This mixture (10

µg of DNA, 50 µl) was injected into the abdominal section of the silkworm pupa using a needle (26 gauges) and syringe. Bacmid DNA-injected silkworm pupae were reared at 25°C in a humidified (65%) incubator for 4 to 6 days. The infected pupa was homogenated with Tris-buffered saline (TBS, pH 7.4) containing 0.1% Triton X-100 (TBS-TX100) followed by sonication and the homogenate was stored at −80°C until use. For silkworm larva, 50 µl of pupae homogenate diluted with phosphate-buffered saline (PBS, pH7.4) by 25 times was injected into each larva. The injected silkworm larvae were reared at 25°C in a humidified (65%) environment for 3 to 5 days and artificial diet was supplied every day. The Silkmate 2S (NOSAN Co. Yokohama, Japan) was used as a diet. When it is confirmed that silkworm larvae were infected, the hemolymph and fat body were collected from the silkworm larvae. Collected hemolymph and fat body were also stored at −80°C until use.

Table 2.1 The primers used in this study

No. Name of primer Sequence (5' to 3')

1 Eco-EGFP-F gcgaattcatggtgagcaagggcgaggag

2 EGFP-FLAG-R cttgtcaatcgtcatccttgtagtccttgtacagctcgtccatgcc

FLAG-Cit1a-F gactacaaggatgacgatgacaagggtttcttcgggaatacgtggaaga

aaataaagggcaaagctgataagattatgctaaagaaagcagtaaagata

atggtaaagaaagaaggaatatctaaagaagaggcg

4 Cit1a-xba-R Gctctagatcacaatttttcggacgctttttgaagagctttttttccataatact

tgagtagatagagtcttatttgtttctttgacattgcatctacttttgcctgcgc

ctcttctttagatattcc

5 EGFP-FLAG-stop-R Gctctagattacttgtcatcgtcatccttgtagtccttgtacagctcgtccat

gcc

Fig. 2.1 Genetic construct of Cit1a and its variants with protein expression

2.2.3 Confocal laser scanning microscopy analysis

Small pieces of fat body were collected from rBmNPV CP-/EGFP-Cit1a bacmid- injected silkworm larva and pupa for detecting the expressed EGFP-Cit1a fusion protein. The samples were taken from both rBmNPV CP-/EGFP-Cit1a bacmid-injected and mock (control) silkworm larva and pupa. All samples were washed three times with PBS and cells were permeabilized using 0.1% Triton-X100 in PBS for 20 min. The cells were stained with 4,6- diamidino-2-phenylindole (DAPI). Confocal laser scanning microscope (LSM 700, Zeiss, Jena, Germany) was used to detect fluorescence from fat body cell and images were analyzed by Zen 2010 software.

2.2.4 SDS-PAGE and western blot analysis

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis were performed following the previously published methods (Palaniyandi et al. 2013). For western blot, mouse anti-FLAG M2 antibody (Sigma-Aldrich Japan, Tokyo, Japan) was used as the primary antibody to detect the EGFP-Cit1a fusion protein at 1:10,000 dilution. Sheep anti-mouse IgG antibody (GE healthcare Japan, Tokyo, Japan) was utilized as secondary antibody at a 1:10,000 dilution. Total protein concentration was determined following the BCA (bicinchoninic acid assay) protein assay kit (Thermo Fisher Scientific,

Rockford, IL, USA).

Fig. 2.2 Electrophoresis analysis of colony PCR products in which positive colony showing the insert (gene of interest) into vector. PCR were performed using pFastBac insert check-F and pFastBac insert check-R primers. They bind the ~868 bp of vector plus amount of insert. Here, insert is ~900bp. M: DNA marker; lane 1 and 2 negative and positive colony.

Fig. 2.3 Construction of recombinant plasmid. A) Recombinant plasmid with egfp-cit1a. Electrophoresis of DNA extracted from recombinant colony shows the confirmation of gene of interest. Size of recombinant vector is ~5675bp and only vector without insert is ~4775bp. Lane 1 and 2 recombinant plasmid and plasmid without insert respectively. B) Recombinant 30 donor vector showing gene of interest (egfp-cit1a).

Fig. 2.4 Construction of recombinant bacmid. Recombinant plasmid (pFastBac/egfp-cit1a) was transformed into DH10Bac E. coli cells. After transformation, the positive colony was checked using colony PCR. Positive colonies show the gene of interest. PCR were performed using M13-F and M13-R bacmid check primers. Thse primers bind the 2300bp plus insert length from positive colony. Here, insert is ~900bp.

2.2.5 Purification of EGFP-Cit1a fusion protein from silkworm larvae and pupae

The fat bodies collected from 10 silkworm larvae were suspended in 25 ml of ice-cold TBS buffer (pH 7.4) and lysed by sonication 3 times for 30 s with an interval of 1 min intervals for each time. For silkworm pupae, 10 pupae were homogenized with TBS-100X Triton (0.1%) followed by sonication. The sample was then centrifuged at 20,000 g for 20 min and the supernatant was collected and filtered using a 0.45 µm filter. The collected

31 filtrate was used for affinity purification using anti-DDDDK tagged protein purification gel (Medical and Biological Laboratories Co., LTD, Nagoya, Japan). The anti-DDDDK tagged protein purification gel was equilibrated with TBS buffer prior to use. The 1 ml anti-DDDDK gel was added to the collected supernatant and gently stirred at 4°C for 1 h. Then the gel was separated following centrifuge at 2500 g for 5 min. The resin gel was washed with 36 ml of TBS buffer. Proteins attached to the resin were eluted with 0.1 M glycine buffer (pH 3.5). The protein solution was neutralized by adding 1M Tris buffer (pH 8.0). The purified protein was detected and confirmed using CBB staining and Western blot analysis. The EGFP was removed from the EGFP-Cit1a fusion protein using recombinant entrokinase (rEK; Novagen, Darmstadt, Germany) following the manufacturer's instructions. Fifty micrograms of purified fusion protein sample was digested with 1 unit of rEK at room temperature for 16 h. The product was analyzed by SDS-PAGE.

2.2.6 Mass spectrometry analysis

The molecular mass of the EGFP-FLAG-tagged Cit1a was calculated by SDS-PAGE and matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectroscopy. The MALDI-TOF mass spectrum was obtained on an AutoFlex (Bruker Daltonics, Germany) and calculated in linear mode following 20-kV ion acceleration without postacceleration. The spectrum was collected at a detector voltage of 1.65 kV and at least 300 laser shots were used to take the average result. The matrix was 2-hydroxy-5-methoxybenzoic acid (sDHB). The sample was dissolved in 0.1% Trifluoroacetic acid (TFA): acetonitrile (2:1 v/v) and mixed with the matrix solution (1:4 v/v). The mixture (1 μl) was placed on a stainless target and kept them to crystallize at room temperature. Protein calibration standards II (Bruker Daltonics, Germany) was used to calibrate prior to analysis of the sample.

2.2.7 Antimicrobial assays

The antimicrobial effect of EGFP-Cit1a was analyzed following disk diffusion and broth microdilution methods. These two methods are widely used and standardized by the Clinical and Laboratories Standards Institute (CLSI) for accounting in vitro susceptibility of bacteria (CLSI 2009). Although disk diffusion is the most popular method applied to investigate the antimicrobial effect of natural antimicrobial molecules (Kim and Kim 2007; Mayachiew et al. 2010), the foremost demerits of this method are the inability to measure the

32 minimal inhibitory concentration (MIC) value and the difficulty in examining the slow- growing bacteria (Dickert et al. 1981; Wilkins and Thiel 1973). Thus, disk diffusion is not suitable to analyze the inhibitory area that it generates for natural antimicrobials (Jiang et al. 2011). For these reasons, we used two standard methods in this study: the microdilution method for measuring the MIC values and the disk diffusion method for visualization of the inhibitory effects of EGFP-Cit1a against bacteria.

To analyze the antimicrobial effect of Cit1a following the disk diffusion method, the bacterial inoculum was adjusted to ~105 colony-forming units (CFU)/ml and inoculated onto the entire surface of a Luria-Bertani (LB) agar plate. The paper disks (BD Diagnostic Systems, New Jersey, USA) were impregnated in 6 mm diameter circles with 12 μl diluted EGFP-Cit1a solutions and placed on the LB agar plate. The experimental plates were then incubated aerobically overnight at 37°C and subsequently the inhibition zone was observed. A series of diluted EGFP-Cit1a solution in PBS was used, including a positive control using ampicillin for Gram-negative and chloramphenicol for Gram-positive bacteria. Bacillus subtilis (NBRC13719, NITE, Kisarazu-shi, Chiba, Japan) and Staphylococcus aureus (NBRC 100910, NITE) as Gram-positive and Pseudomonas aeruginosa (NBRC12689, NITE) and Escherichia coli W3110 (NBRC12713) as Gram-negative were kind gifts from Professor Shinya Kotani.

MIC determination of EGFP-Cit1a was done following a microtiter broth dilution assay (Vassilevski et al. 2008). In this method, antimicrobial activity was conducted with a bacterial strain in sterilized 96-well plates in a final volume of 100 μl composed of 50 μl of suspension containing 105 bacteria/ml in LB culture medium and 50 μl of the peptide in serial two-fold dilutions in PBS. Fifty microliters of purified rEGFP-Cit1a was added to 50 μl of the diluted bacterial suspension (~105 CFU/ml). The peptides, a non-treated control with PBS, a positive control with ampicillin or chloramphenicol and a negative control with BSA were investigated in triplicate. The microtiter plates were kept for overnight at 37°C and the inhibition of growth was calculated by investigating the absorbance at 595 nm. MIC is designated as the lowest concentration of a peptide which inhibits 100% growth of a bacterial strain (Vassilevski et al. 2008).

2.3 Results

2.3.1 Construction of an expression recombinant BmNPV bacmid

To express the Cit1a from Lachesana tarabaevi in silkworms, EGFP-Cit1a fusion protein was expressed according to Fig. 2.5A. Cit1a was fused to egfp as a reporter gene by PCR through the FLAG tag sequence, which was checked by agarose gel electrophoresis (Fig. 2.5B). The egfp-cit1a was successfully cloned into pFastBac1 (Fig. 2.5A). The generated recombinant pFastBac1-Cit1a was verified by amplifying the target region using PCR and sequencing (data not shown). The recombinant pFastBac1-Cit1a was transformed into BmDH10Bac E. coli competent cells, and finally recombinant BmNPV CP-/EGFP-Cit1a bacmid was constructed.

2.3.2 Expression of EGFP-Cit1a fusion protein from silkworm larvae and pupae

The recombinant BmNPV CP-/EGFP-Cit1a bacmid DNA was purified and injected into silkworm larvae and pupae. After 4 to 6 days, fat bodies collected from the infected larvae were suspended in TBS and sonicated. BmNPV CP-/EGFP-Cit1a bacmid-injected pupae were also homogenized with TBS. The specific EGFP fluorescent band was detected in the homogenate of the BmNPV CP-/EGFP-Cit1a bacmid-injected pupae and larvae's fat body, but not in the larval hemolymph and mock-injected fat body (Fig. 2.5C). In addition, western blot analysis confirmed the expression of EGFP-Cit1a fusion protein both in silkworm larva and pupa (Fig. 2.5D). The theoretical molecular weight of the GFP-Cit1a fusion protein was ~36 kDa, consisting with the detected fusion protein band and mock-injected silkworm did not show any band (Fig. 2.5D).

The expressions of EGFP-Cit1a fusion protein in silkworm larvae and pupae was further confirmed by confocal laser scanning microscopy analysis. EGFP fluorescence was observed in the larval and pupal fat body cells of the silkworm (Fig. 2.6A and C). EGFP fluorescence was not fund in mock-infected silkworm larvae and pupae (Fig. 2.6B and D).

Fig. 2.5 Construction of EGFP-Cit1a fusion gene and expression of EGFP-Cit1a fusion protein in silkworm. a) Schematic representation of EGFP-Cit1a fusion gene obtained by PCR and description of EGFP-Cit1a fusion protein. Details of primers 1–5 are shown in Table 1. b) Agarose gel electrophoresis of PCR products in PCR steps (PCR 1–3). Lane 1 PCR 1, lane 2 PCR 2, lane 3 PCR 3. c) EGFP fluorescence analysis of the EGFP-Cit1a fusion protein expressed in silkworm on an SDS-PAGE gel. Lanes 1, 3, and 5 show the homogenates of BmNPV-CP−/EGFP-Cit1a bacmid-injected pupa, larval hemolymph, and fat body, respectively; lanes 2 and 4 show the homogenates of mock-injected pupa and larval hemolymph, respectively; and lane 6 shows the mock-injected larval fat body. Fluorescent bands were investigated using Molecular Imager FX (Bio-Rad) indicated by arrows. d) Western blot analysis of EGFP-Cit1a fusion protein cross-reacted with antibodies is indicated by arrows. Lane 1 shows the mock pupa homogenate; lanes 2, 4, and 6 show the BmNPV- CP−/EGFP-Cit1a bacmid-injected larval fat body, hemolymph, and pupa homogenate, respectively; lanes 3 and 5 show the mock larval hemolymph and fat body, respectively. 35

Fig. 2.6 Fluorescence detection of EGFP in silkworm larval and pupal fat bodies. A and C show BmNPV-CP−/EGFP-Cit1a bacmid-injected larval fat body and pupal fat bodies, respectively; B and D show mock-injected larval and pupal fat bodies, respectively. Cells were stained with DAPI (blue).

3.3.3 Purification of EGFP-Cit1a fusion protein from silkworm larvae and pupae The expressed EGFP-Cit1a fusion protein was purified from silkworm larvae and pupae using DDDDK tagged purification gel. This purification gel facilitates the purification of FLAG-tagged proteins equally to anti-FLAG M2 agarose gel. Several proteins tagged with FLAG have been shown to be successfully purified using this gel (Deo et al. 2014). A single band was detected by CBB staining and Western blot (Fig. 2.7A) in the eluted fraction of the

BmNPV CP-/EGFP-Cit1a bacmid-injected larvae's fat body. In the same manner, purified samples (elution 1~3 of BmNPV CP-/EGFP-Cit1a bacmid-injected pupa’s homogenate) showed a single band in CBB staining and Western blot (Fig. 2.7B). In SDS-PAGE analysis, the band of EGFP-Cit1a was found below 37 kDa (Fig. 2.7). The molecular mass of the EGFP-Cit1a fusion protein, calculated from its amino acid sequence, is 36.067 kDa. In a previous study, cit1a has a 60% alpha-helix structure in 25 mM SDS solution (Vassilevski et al. 2008), suggesting that Cit1a has its native conformation in the sample buffer of SDS- PAGE to some extent and its structure may cause the difference between the molecular weight estimated from its amino acid sequence and detected by SDS-PAGE. In addition, this protein purified from BmNPV CP-/EGFP-Cit1a bacmid-injected larvae's fat body was investigated by MALDI-TOF mass analysis. The MALDI-TOF mass spectrum demonstrated a major peak at m/z 37338 (Fig. 2.8). Another peak was detected at m/z 28622. This low molecular weight corresponded to that of EGFP tagged with the FLAG sequence estimated from its amino acid sequence (28197). However, no band was observed in the SDS-PAGE or Western blot. These data suggest that this low molecular weight peak might be caused during the MALDI-TOFMS experiment or it may be possible that the purified protein still contained a significant amount of contaminated proteins. Around the peak at m/z 37338, several peaks were also detected which formed a broad peak. These data also suggest that the purified EGFP-Cit1a fusion protein had several variants. Spider peptide toxins are sometimes post- translationally modified by palmitoylation, C-terminal trimming and C-terminal amidation (Windley et al. 2012). C-terminal amidation was not detected in the native Cit1a (Vassilevski et al. 2008), therefore, it is most reasonable that the EGFP-Cit1a heterogeneity may be caused by C-terminal trimming.

To confirm the fusion of Cit1a with EGFP via the FLAG tag sequence, the purified fusion protein was treated with rEK and the difference between the molecular weights of the rEK-treated and non-treated samples were investigated in SDS-PAGE. rEK recognizes the DDDDK sequence in the FLAG tag sequence and can cleave the EGFP-Cit1a fusion protein into EGFP-FLAG and Cit1a. The rEK-treated fusion protein showed two bands (~27 and ~8 kDa) (data not shown). The rEK digestive experiment confirmed that Cit1a was expressed fused with EGFP in the silkworm and could be separated from EGFP. The expression level between the silkworm larval fat body and pupa was compared by western blot analysis. The amount of purified EGFP-Cit1a fusion protein was 10 µg/pupa from pupa and 7 µg/larva from the larval fat body. In this study, EGFP was adopted as a fusion partner of Cit1a and the 37 functional analysis of EGFP-Cit1a purified from silkworm fat body was performed in the next section.

Fig. 2.7 Analysis of purified EGFP-Cit1a fusion protein. a SDS-PAGE and Western blot of EGFP-Cit1a purified from BmNPV-CP−/EGFP-Cit1a bacmid-injected silkworm fat body. An SDS-PAGE gel was stained with CBB. b SDS-PAGE and western blot of EGFP-Cit1a purified from BmNPV-CP−/EGFP-Cit1a bacmid-injected silkworm pupae. The arrows indicate purified EGFP-Cit1a fusion protein.

2.3.4 Antimicrobial activity of Cit1a

Extensive biological studies were performed only for the synthetic Cit1a, which was tested on a number of Gram-positive and Gram-negative bacteria, and approximate MIC (low micromolar against E. coli) values were determined for the peptide (Lazarev et al. 2011; Lazarev et al. 2013; Polina et al. 2012; Vassilevski et al. 2008). The antimicrobial activity of Cit1a was evaluated using purified EGFP-Cit1a fusion protein following disk diffusion method. A clear inhibition zone was observed in E. coli W3110, Bacillus subtilis, and Pseudomonas aeruginosa bacterial growth (Fig. 2.9A, C and D). However, no inhibition zone was found in Staphylococcus aureus (Fig. 2.9B). The MIC values were accounted by a microdilution method. The MIC results indicated that E. coli W3110, Bacillus subtilis, and Pseudomonas aeruginosa was inhibited by the recombinant Cit1a at low concentrations

(0.75–2.00 µM) (Table 2.2). The MIC value of E. coli W3110 was 0.75 µM. Below 0.75 µM, the growth inhibition decreased (data not shown).

EGFP-FLAG

EGFP-FLAG-CIT1a

Fig. 2.8 Result of MALDI-TOF mass spectrometry analysis of recombinant EGFP-FLAG- tagged cyto-insectotoxin1a. The mass of the EGFP-FLAG-tagged Cit1a was calculated by SDS-PAGE and matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectroscopy. The MALDI-TOF mass spectrum was obtained on an AutoFlex (Bruker Daltonics, Germany) and calculated in linear mode following 20-kV ion acceleration. The spectrum was collected at a 1.65 kV voltage and at least 300 laser shots were used to take the average result. The used matrix was 2-hydroxy-5-methoxybenzoic acid (sDHB). Protein

39 calibration standards II (Bruker Daltonics, Germany) was used to calibrate prior to analysis of the sample.

Fig. 2.9 Growth inhibitory effect of EGFP-Cit1a fusion protein on bacterial strains. (A) E. coli W3110. (B) Staphylococcus aureus. For A and B, 1: 6 µM; 2: 3 µM; 3: 1.5 µM; 4: 0.75 µM; 5: 0.385 µM; 6: 0.187 µM. (C) Pseudomonas aeruginosa. (D) Bacillus subtilis, 1: 4 µM; 2: 2 µM; 3: 1.0 µM; 4: 0.5 µM; 5: 0.25 µM; 6: 0.125 µM; 8: 100 µg/ml ampicillin for gram- negative bacteria or 100 µg/ml chloramphenicol for gram-positive bacteria.

2.4 Discussion

Spider venoms represent a diverse sources of peptides with a variety of different types of bioactivity, representing vast natural resources (Kuhn-Nentwig et al. 2011; Liang 2008; Vassilevski et al. 2009). Cyto-insectotoxin1a (cit1a) identified from spider venom having equally potent antimicrobial and insecticidal effects (Vessilevski et al. 2008) were expressed and produced using silkworm. In this study, egfp was fused with cit1a to mask Cit1a activity.

In a previous report, when GFPuv fusion protein was expressed in silkworm larvae, several degraded fusion proteins appeared (Park et al. 2007). EGFP-Cit1a was not significantly degraded in silkworms even if Cit1a was fused with EGFP. This indicated that the EGFP- Cit1a fusion protein was not vulnerable to proteases in silkworms. In addition, the EGFP- Cit1a fusion protein was not observed in the hemolymph (Fig. 2.5C, D), because EGFP-Cit1a does not have any signal sequence at its N-terminus. Cit1a does natively possess a signal sequence and pro-domain, however, in this study these sequences were removed to fuse with EGFP at the N-terminus of Cit1a.

Table 2.2 Antimicrobial activity of EGFP-Cit1a

Target bacteria MIC (µM)

Gram-positive

Bacillus subtilis 1.5

Staphylococcus aureus Resistant

Gram-negative

Pseudomonas aeruginosa 2

Escherichia coli W3110 0.75

MIC: Minimum Inhibitory Concentration

Cit1a obtained from this study showed antimicrobial effect on E. coli W3110, Bacillus subtilis and Pseudomonas aeruginosa (Fig. 2.9A, C and D) but there was no effect on Staphylococcus aureus (Fig. 2.9B). A previous study reported that synthetic Cit1a showed no

41 inhibitory effect on S. aureus (Kozlov et al. 2008), similar result found in our study. These findings also confirmed that the recombinant protein which was produced using silkworm expression system remained active against bacteria, as reported previously (Chen et al. 2009; Kozlov et al. 2008) and the MIC value (Table 2.2) falls within the MIC values of other peptides (Kozlov et al. 2008). Moreover, the calculated MIC values of EGFP-Cit1a against E. coli, P. aeruginosa, and B. subtilis were comparable with the previous report (Vassilevski et al. 2008), indicating that the EGFP and FLAG tag do not have any negative influence on the properties of Cit1a. Also these data suggest that the EGFP-Cit1a fusion protein can be used directly without cleavage by EK and silkworm larvae can produce active Cit1a in its fat body. Cit1a has cytotoxicity to Sf9 cells and has been known as an insecticidal peptide (Vassilevski et al. 2008). These results show the contradiction that an active insecticidal peptide can be expressed and purified in insects. However, Cit1a can be expressed in HEK293 cells as an active form to suppress the infection of a parasitic bacterium, Chlamydia (Lazarev et al. 2011; Lazarev et al. 2013; Polina et al. 2012). These data suggest that Cit1a can be expressed as an active form intracellularly without cytotoxicity to host cells. Moreover, EGFP fusion proteins have been utilized for the intracellular trafficking and functional analysis of expressed proteins in vivo (Avilov et al. 2013; Sammons and Gross 2013). EGFP-Cit1a fusion protein allows us to analyze the intracellular trafficking of Cit1a in Chlamydia and its suppression mechanism.

Although we used the EGFP-Cit1a fusion protein to test for biological activity against bacteria, it was confirmed that the growth inhibition of bacteria happened due only to the action of the Cit1a gene because the egfp gene has no toxic effects on the cell (Chalfie et al. 1994). Cit1a is active at low micromolar concentrations, although a certain specificity of action was shown, with some bacteria essentially resistant to the peptide (Kozlov et al. 2008). The properties, wide spectrum of activity at micromolar concentration and membrane specificity are common to most other AMPs. These phenomena are described by the approved universal mechanism of AMP action with the plasma membrane serving as the target (Kozlov et al. 2008). Biologically active recombinant fusion protein could be obtained from both silkworm larvae and pupae, indicating that silkworm can produce soluble Cit1a to characterize it. Since currently there is a great demand of peptide use in medical application, need to develop cost effective method for peptide production. Recombinant DNA technology might provide a cost effective peptide production system using silkworm expression method. AMPs have also been shown to repress mycoplasma and Chlamydia development in vitro 42

(Fehri et al. 2007; Yasin et al. 1996).

In the present paper, we expressed and produced Cit1a as an EGFP-Cit1a fusion protein using silkworm and investigated the antimicrobial activity of Cit1a, a cytolytic peptide produced by L. tarabaevi which represents a unique class of spider venom constituents. Antimicrobial peptides have raised interest to investigate and evaluation for drugs because of their potential medical applications as pharmaceutical drugs (Fan et al. 2010).

In conclusion, our study developed a novel strategy for the expression and production of Cit1a using silkworm fused with the EGFP. For large-scale production of recombinant proteins, the BmNPV bacmid system with silkworm could be used due to its low cost, ease of treatment and high biohazard safety. The recombinant Cit1a showed high antimicrobial activity as previously reported, which makes Cit1a an antimicrobial therapeutic agent.

CHAPTER III

Improved insecticidal activity of a recombinant baculovirus expressing spider venom cyto-insectotoxin

Significant reduction LT 50

3. Improved insecticidal activity of a recombinant baculovirus expressing spider venom cyto-insectotoxin

3.1 Introduction Insect pests cause a considerable reduction in crop yields and currently chemical pesticides are still the principal component for insect pest management (Oreke 2006). However, the emergence of resistant insects towards the chemical pesticides, and their harmful effects on environment as well as human health risks, explore for alternative pest management practice has been increased. Baculovirus can overcome these problems of chemical insecticides. They have been using as host specific, environmentally friendly biopesticides since 1970s. They have infectious particles that are preserved in occlusion bodies (OBs) called polyhedra, which favour for the formulation of biological insecticides with simple application method (Gramkow et al. 2010). Recently, researches on the insecticide production based on baculoviruses have been carried out (Inceoglu et al. 2001) due to their safe use in agricultural field. Baculovirus has evolved rod-shaped virions and there are two noticeable phenotypes, occlusion-derived virus (ODV) and budded virus, in an individual cycle of infection (Smith et al. 1983). ODVs are conserved within OBs termed as polyhedra that are discharged in the environment naturally upon the death of virus infected insect and disintegration of death larvae. These OBs are stable in environment and waits to be ingested by healthy insect. When host specific insects ingest them with foliage, the OB dissolved within midgut due to high alkaline condition and thereafter ODVs are discharged and penetrate into peritrophic membrane by direct fusion process. Thus OB-relief ODVs are responsible for primary infection (Slack and arif 2007). Then nucleocapsids move to nucleus and start to replicate. After replication within the midgut, new budded virus (BV) is formed that causes collateral systematic infection and spread into other tissues (Wang et al. 2010). This phenomenon requires 4-5 days in lab and more than a week before the infected insects stop feeding. This is the principal drawback of baculovirus using as an insecticide in the field. Extensive damage of the crop can be brought about until baculovirus-infected insects die.

Therefore, in order to apply baculovirus in field as insecticide, it is necessary to produce virus with high killing speed or reduced effective feeding time. Diverse alien genes with a potential to enhance pesticidal effect have been cloned into the wild-type baculovirus using genetic engineering approach (Szewczyk et al. 2006). Several insect toxin genes from 45 bacteria, spiders, and scorpions were cloned into wild-type baculovirus genome under the baculoviral promoter and then improved pesticidal performance, which can kill faster than wild type have been constructed (Gramkow et al. 2010; Chang et al. 2003; Choi et al. 2008; Stewart et al. 1991). These results indicate that insect toxins are favorable candidates to prevent extensive damage of the crop by reducing the time from the infection to the death of baculovirus-infected insects. Recently, a recombinant baculovirus, NeuroBctrus, which can express Bacillus thuringiensis crystal protein (Cry1-5) and insect-specific neurotoxin, AaIT, from Androctonus australis, was constructed (Shim et al. 2013). This NeuroBactrus showed high insecticidal activity to Plutella xylostella larvae and prominently reduced LT50 value against Spodoptera exigua larvae, compared to the wild type baculovirus. The purpose of this study was to develop improved recombinant baculovirus biopesticide by inserting foreign toxin gene into the wild-type virus following DNA recombinant technology.

In this study, to find the possibility of other spider toxins for the improvement of baculoviral insecticides, the gene of cyto-insectotoxin1a (Cit1a), a novel antimicrobial peptide (AMP) derived from the Central Asian spider (Lachesana tarabaevi) was inserted to the genome of Bombyx mori nucleopolyhedrovirus (BmNPV) as a fusion gene with polyhedrin (Polh) gene under the polyhedrin promoter. Cit1a is a linear cationic peptide having 69 amino acid residues and represents an attractive molecule to show high antibacterial activity and anti-Chlamydia trachomatis activity inside the infected cells (Lazarev et al. 2011; Vassilevski et al. 2008). The recombinant baculovirus (BmNPV/Polh- Cit1a) expresses Cit1a and produces polyhedra. The insecticidal activity of the recombinant baculovirus was significantly increased compared to control virus. Moreover, to confirm that improved insecticidal activity arose due to express of foreign gene (cit1a). The gene cit1a was also cloned into Autographa californica multinucleopolyhedrosis (AcMNPV) virus. We investigated the insecticidal activity of the recombinant AcMNPV/Polh-Cit1a and compared the result. The pathogenicity of recombinant baculovirus was evaluated both in vivo and in vitro.

3.2 Materials and methods

3.2.1 Viruses, insects and insect cell lines

Both Bm5 (derived from Bombyx mori) and Sf9 (derived from Spodoptera frugiperda)

46 cell were cultured at 27°C in SF-900II medium, supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA). The antibiotic-antimycotic mixture (Gibco, Carlsbad, CA, USA) was added to the culture media. Recombinant viruses derived from BmNPV and AcMNPV were propagated in insect cultures as well as cell culture. The insect, silkworm larvae (5th instar) were purchased from Ehime Sansyu Co. (Ehime, Japan) and used in this experiment. The control virus (BmNPV-CP—hMTP-EGFP-SH, here it is unified as BmNPV/EGFP) harboring egfp (Kato et al. 2o13), used in the present study was propagated in silkworm larvae. The artificial diet was used to feed the silkworm larvae as Silkmate 2S (NOSAN Co. Yokohama, Japan) at 25°C in a humidified (65%) environment chamber. The hemolymph of infected silkworm larvae containing viruses were collected as a virus stock, stored at - 80°C and used in this study.

3.2.2 Construction of recombinant transfer vector

The oligonucleotide sequences of the toxin gene (Cyto-insectoxins: Cit1a, accession number FM165474) purchased from Eurofins MWG Operon (Tokyo, Japan), was amplified by polymerase chain reaction (PCR) utilizing the primer set FLAG-Cit1a-F and Cit1a-xba-R (Table 3.1, primers 1, 2). The polyhedrin gene (polh) fragment was amplified using genomic template from AcMNPV by PCR following the primer set Polh-F and Polh-FLAG-R (Table 1, primers 3, 4). Each PCR product obtained was analyzed using electrophoresis in 1% agarose gels (Fig. 3.1) and target fragment was from the agarose gel using GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, USA) and fused to each other by PCR to obtain a Polh-Cit1a fusion gene. After 10 cycles of PCR, the two primer sets (Table 3.1, primers 2, 3) were added for amplification of the fusion fragment (Polh-Cit1a) and analyzed in 1% agarose gels (Fig. 3.1). The fusion fragments (Polh-Cit1a) obtained was also isolated from agarose gel using GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, USA) and inserted into the pFastBac1 vector (Life Technologies, Carlsbad, CA, USA) by cloning as previously described (Kato et al. 2013). The schematic presentation of a cloning experiment is illustrated in Fig. 3.2-3. The target insertion was analyzed by restriction enzyme digestion, amplified the target region by PCR and sequencing.

3.2.3 Recombinant virus construction and toxin expression in insect host and cell

The recombinant transfer vector (designed as pFastBac1polh-cit1a) harboring polh- cit1a fusion was transformed into BmDH10Bac CP- and AcDH10Bac competent cells by heat

47 shock as previously described (Hiyoshi et al. 2007), respectively and finally recombinant bacmids were selected. The schematic presentation of recombinant virus construction is illustrated in Fig. 3.4. Bacmid DNA was extracted and target gene of interest was investigated by PCR using M13 bacmid check primers (Table 3.1, primers 5, 6) and obtained bacmids were designated as BmNPV/Polh-Cit1a and AcMNPV/Polh-Cit1a bacmids, respectively. Ten µg of purified BmNPV/Polh-Cit1a were mixed with 1/10 volume of 1, 2- dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE-C) reagent (Life Technologies) and kept the mixture at room temperature for 30–40 min. This mixture (50 µl in which 10 µg of bacmid DNA) was injected into the silkworm larva through a syringe with a 26-gauge needle (Terumo Co. Tokyo, Japan). Larval hemolymph was collected from BmNPV/Polh-Cit1a-infected larvae at 96-120 h p.i. and subjected to budded virus (BV) production analysis during infection. The collected hemolymph and fat body were also stored at −80°C until use. The part of collected fat body was homogenated with Tris-buffered saline (TBS, pH 7.4) containing 0.1% Triton X-100 (TBS-TX100) followed by sonication and the homogenate was stored at −80°C until use.

Table 3.1 The primers used in this study No. Name of primer Sequence (5' to 3')

1 FLAG-Cit1a-F gactacaaggatgacgatgacaagggtttcttcgggaatacgtggaaga aaataaagggcaaagctgataagattatgctaaagaaagcagtaaagata atggtaaagaaagaaggaatatctaaagaagaggcg

2 Cit1a-xba-R gctctagatcacaatttttcggacgctttttgaagagctttttttccataatactt gagtagatagagtcttatttgtttctttgacattgcatctacttttgcctgcgcc tcttctttagatattcc

3 Ac-Pol-F gcgaattcatgccggattattcataccgtc

4 Ac-Pol-FLAG-R cttgtcatcgtcatccttgtagtcatacgccggaccagtgaacag

5 M13 Forward cccagtcacgacgttgtaaaacg

6 M13 Reverse agcggataacaatttcacacagg

7 Acie-1F cccgtaacggacctcgtactt

8 Acie-1R ttatcgagatttatttgcatacaacaag

In case of recombinant AcMNPV DNA with Polh-Cit1a gene, DNA was packaged with Cellfectin Reagent, and then transfected Sf9 cells. The transfected Sf9 cells were incubated in the Sf-900 II SFM medium at 27°C for 72 h, and centrifuged at 1000 × g for 5 min. The supernatant was designated as P1 viral stock which was further applied to Sf9 cells and high-titer P2 stock was collected. The P2 stock was collected after 72 h infection by centrifugation of the cultured cell and medium mixture at 1000 × g for 5 min and stored at −80°C until use.

Fig. 3.1 Electrophoresis analysis for the amplification of polyhedrin, Cit1a and Polh-Cit1a fusin fragment. (A) Polh fragment which was ampliefied using Eco-Ac-Pol-F and FLAG-Ac- Polh-R primers (~726 bp). (B) Cit1a fragment which was amplified using Cit1 (~207 bp). (C) Polh-Cit1a fusion fragment which was amplified by Eco-Ac-Pol-F and Xba1-Cit1a-R primers (~ 933).

3.2.4 SDS-PAGE and western blot analysis

SDS-PAGE and western blot were carried (Ali et al. 2014) in order to check the expression of toxin. For western blot analysis, anti-FLAG M2 conjugated with horseradish

49 peroxidase (HRP) (Sigma-Aldrich Japan, Tokyo, Japan) was used as an antibody to detect the Polh-Cit1a fusion protein at 1:10,000 dilution. The total protein concentration of the sample was calculated following BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL, USA).

Fig. 3.2 A schematic representation of a typical cloning experiment. (A) The vector (pFastBac1) is cut ( ) within its multicloning site (MCS). (b) The target DNA (polh-cit1a) is cut ( ) so as to produce termini compatible with the vector.

3.2.5 Purification of Polh-Cit1a fusion protein from silkworm larvae

The fat body was collected from 10 silkworm larvae and suspended in 25 ml of ice- cold TBS buffer (pH 7.4) and lysed by sonication 3 times for 30 s each time with 1 min intervals. The sample was then centrifuged at 20,000 × g for 20 min and the supernatant was filtered using a 0.45 µm filter. The collected filtrate was used for affinity purification using DDDDK tagged protein purification gel (Medical and Biological Laboratories Co., LTD, Nagoya, Japan). The DDDDK tagged protein purification gel was equilibrated with TBS buffer prior to use. The collected supernatant was added to 1 ml resin gel and gently stirred at 4°C for 1 h. After 1 h the resin gels was collected following centrifuge at 2500 × g for 5 min

50 and resin was washed with 36 ml of TBS buffer. Proteins attached with resin were separated using elution buffer (0.1 M glycine, pH 3.5) and collected. After collection of eluted protein from resin gel, 1M Tris-buffer was added to neutralize the protein solution. For checking the fusion fragment of purified protein, 50 µg of protein sample was digested with 1 unit of recombinant enterokinase (rEK; Novagen, Darmstadt, Germany) at room temperature for different time interval. The digested product was investigated by SDS-PAGE and silver staining according to company protocol (Silver Stain II Kit Wako, Wako Pure Chemical Industries, Ltd. Tokyo, Japan).

Insert (Polh-FLAG-Cit1a)

Fig. 3.3 A schematic representation of a ligation experiment. The digested plasmid (pFastBac1) was mixed with digested Polh-Cit1a fragment and ligation was induced by T4 DNA polymerase enzyme.

Fig. 3.4 A schematic presentation of the construction of recombinant baculovirus. The recombinant plasmid (pFastBac/Polh-Cit1a) was transformed into DH10Bac E. coli cells. After antibiotic selection, the positive colony was evaluated by colony PCR and finally recombinant virus was selected from the culture plate.

3.2.6 Bioassays

Twenty 5th instar Bombyx mori larvae were injected with 50 μl of each viral stock (approximately 1 × 106 virus titer). Ten B. mori larvae were also injected with medium without virus as a negative control. The experiment was repeated three times. The virus injected as well as control silkworm larvae were reared in Silkmate 2S (NOSAN Co. Yokohama, Japan) with artificial diet at 25°C in a humidified (65%) environment and observed twice daily until death. The insect mortality was accounted by recording the dead larvae at 12 h interval. Data were recorded up to all larvae dead, and the median lethal time

(LT50) was calculated following Probit analysis (SPSS Base 16.0 for Windows User's Guide. 52

SPSS Inc., Chicago, IL, USA). To study the growth inhibitory activity of cyto-insectotoxin1a, the insects were infected with recombinant viruses as well as control virus which have no toxin gene. The body weight of each larva was measured before infection and continues to monitor the growth upto 48 h after infection. Mock-infected silkworm larva was also used as expected for normal growth. The growth rate (GR) of recombinant virus infected insect was calculated using following formula: %GR = (FBW - IBW)/IBW × 100, where IBW and FBW represent the body weights of virus-infected insects at 0 and 48 h p.i., respectively. All statistical analysis was carried out using SPSS 2008 (SPSS Inc.) statistical package. Fat body was collected from the death larvae and applied to western blot analysis for the investigation of the expression of fusion toxin. Western blot analysis was performed using above described method.

3.2.7 Polyhedra formation

Polyhedrin gene was fused with toxin because polyhedra are important for stability of baculovirus. In this experiment, we used bacmid without harboring polyhedrin gene. The polyhedra formation was analyzed using fluorescence microscope. To perform this study, monolayers of Bm5 and Sf9 (5 × 106) cells were infected by viruses. The multiplicity of infection (MOI) was 10. BmNPV/Polh-Cit1a, BmNPV/EGFP-, AcMNPV-, AcMNPV/Polh- Cit1a- and mock-infected cells were collected at 72 h p.i. and washed with PBS (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) and observed using CLSM (LSM 700, Zeiss, Jena, Germany) and fluorescence microscope. Images were analyzed by Zen 2010 software for CLSM and DPC contrasted software for fluorescence microscope. The total polyhedra released from the cells were counted by hemocytometer as previously described (Hong et al. 2000). Before counting polyhedra, the cells infected with virus were harvested and washed with PBS (pH: 7.5). Thereafter, 1% sodium dodecyl sulfate was added to harvested cells and incubated at 37°C for 30 min. Polyhedra was released from the cells and counted by hemocytometer.

3.2.8 Quantification of BmNPV and AcMNPV particles

The DNA of recombinant baculoviruses was isolated from BmNPV/Ploh-Cit1a and AcMNV/Polh-Cit1a infected silkworm larval hemolymph and supernatant of Sf9 cells infected media respectively following High Pure Viral Nucleic Acid Kit (Roche Diagnostics

K. K., Tokyo, Japan) and quantified the virus titer by Quantitative Polymerase Chain Reaction (qPCR) as previously described (Kato et a. 2009; Lo and Chao 2004). Briefly, BmNPV DNA was extracted from BmNPV-infected larval hemolymph but in case of AcMNPV DNA, supernatant of AcMNPV-infected Sf9 cells (MOI: 10) at 72 h p.i. containing the BV was collected without cell debris by centrifugation (1000 × g for 5 min). Two microlitres (2 μl) of the collected supernatant was used for DNA extraction. Brilliant II Fast SYBR Green q-PCR Master Mix (Stratagene, Agilent Technologies, USA) was used for the q-PCR analysis with the primers 7 and 8 (Table 1). Wild-type AcMNPV and BmNPV were used as standard which were previously known by end-point dilution method. The following thermal cycle was used: 95°C for 5 min for one cycle, followed by 80 cycles: denaturation at 95°C for 10 s, annealing and extension at 63°C for 30 s. MxPro software (Stratagene) was used to investigate the PCR amplification and melting curves.

3.2.9 Light and fluorescence microscopic analysis

For light and fluorescence microscopy, monolayers of Bm5 (5 × 106) cells were infected at a MOI of 10. By the use of light microscope (Zeiss), infected cells were investigated and images were taken at different hours post-infection. For fluorescence microscopy, infected cells at different time interval were collected from culture tube and washed with PBS (pH 7.4). Then slides were prepared for examination of cell structure under microscope. Observation of internal tissues of recombinant baculovirus infected larvae, four days after injection, larvae were dissected and silk glands were collected, and examined under light microscope (SZX16, Olympus Corporation, Tokyo, Japan). Image was analyzed using DPC contrasted software.

3.2.10 Cell cytotoxicity assays

Both Bm5 and Sf9 cells were placed in 6-well plates (4 × 104 cells/well) and infected with viruses at MOI of 10. For the cell mortality analysis, Trypan-blue cell viability assay kit was used. The cell was harvested from the culture plate and washed with PBS. Then the cell was stained with Trypan-blue 0.4 % (Invitrogen, Carlsbad, CA, USA) for five minutes followed by washing with PBS (pH 7.4) for three times. Number of death cell was counted by hemocytometer (Neubaurer Improved Bright-Line, Hirschmann Laborgeräte GmbH & Co. Eberstadt, Germany) under light microscope. Three replications were used for this test and Student’s t-test was done for comparing two means in pairs.

3.3. Results

3.3.1 Construction of recombinant virus

The cit1a was fused to polh gene by PCR through the FLAG tag sequence, which was checked by 1% agarose gel electrophoresis (Fig. 3.1). The fusion gene was successfully cloned into the transfer vector and the generated recombinant pFastBac1Polh-Cit1a was checked by restriction enzyme digestion, and amplifying the target region using PCR, 1% agarose gel electrophoresis and sequencing (data not shown). The recombinant pFastBac1Polh-Cit1a was transformed into an E. coli BmDH10Bac CP- and AcDH10Bac competent cell, and finally recombinant BmNPV CP-/Polh-Cit1a and AcMNPV/Polh-Cit1a bacmids, respectively, were constructed and designated as BmNPV/Polh-Cit1a and AcMNPV/Polh-Cit1a, respectively.

3.3.2 Expression and purification of Polh-Cit1a in silkworm larvae

BmNPV/Polh-Cit1a bacmid was injected into silkworm larvae. At 4 to 5 d p.i., the expressed Polh-Cit1a fusion protein from fat body was confirmed by western blot analysis (Fig. 3.5A). The expression of Polh-Cit1a fusion protein in Sf9 cells transfected with AcMNPV/Polh-Cit1a was also confirmed by western blot analysis (Fig. 3.5B). The theoretical molecular mass of the Polh-Cit1a fusion protein is around 40 kDa ,consisted with the detected band in western blot analysis and no band was found in mock-injected silkworm sample (Fig. 3.5A, lane 2) and Sf9 cells (Fig. 3.5B, lane 2), respectively. This result confirmed that toxin was successfully expressed in host insect body. The expressed Polh- Cit1a fusion protein was purified from the fat body of the silkworm larvae using DDDDK tagged purification gel. A target band was detected by CBB staining (Fig. 3.5C) in the fraction purified from BmNPV/Polh-Cit1a bacmid-injected larval fat body and western blot detected the band at 40 kDa (Fig. 3.5D, lane 1).

To confirm the fusion of Cit1a with Polh via the FLAG tag sequence, the purified fusion protein was treated with rEK. The digested and non-digested samples were investigated in SDS-PAGE. rEK recognizes the DDDDK sequence in the FLAG tag sequence and can cleave the Polh-Cit1a fusion protein into Polh-FLAG and Cit1a. The rEK-treated product showed two bands corresponded to Polh-FLAG and Cit1a (Fig. 3.6).

Fig. 3.5 Electrophoretic analysis of Polh-cit1a fusion protein expressed in silkworm larvae, Sf9 cell and purification. (A) Western blot analysis of Polh-cit1a expressed in silkworm larvae. The band at about 40 kDa was observed in infected larval fat body. M: molecular marker; lane 1: BmNPV/Polh-Cit1a-infected larval fat body; lane2: mock larval fat body. (B) Western blot analysis of Polh-cit1a expressed in Sf9 cell. Lane 1: AcMNPV/Polh-Cit1a transfected cell; lane2: mock cell. (C) SDS-PAGE of purified Polh-Cit1a fusion protein using DDDDK tagged purification gel. Lane 1, 2 and 3 denote elution 1, 2 and 3, respectively. (D) Western blot analysis of purified sample (lane 1) and lane 3 silkworm larval fat body. Fat body was collected from death larvae. BmNPV/Polh-Cit1a infected-dead larval samples collected at 96 h p.i. Lane 2: mock fat body.

Fig. 3.6 Investigation of rEK treated sample in SDS-PAGE. Enterokinase-treated fusion protein was electrophoresed in 12% polyacrylamide gels. Polh-cit1a fusion protein was collected from silkworm fat body sample. M: Marker; Lane 2, 3 and 4: Enterokinase-treated sample at 2, 4 and 8 h respectively. Lane 1: Undigested sample.

3.3.3 Bioassays

Twenty 5th instar B. mori larvae were separately inoculated with approximately 1 × 106 virus per larva of each recombinant and control virus. The BmNPV/Polh-Cit1a showed a

LT50 of 76.43 h, while the BmNPV/EGFP, LT50 of 103.43 h (Table 3.2). This result indicates by 26.13% reduction in time required to kill the recombinant virus infected insects compared to control virus. Increased pathogenicity of recombinant baculovirus was estimated by reduction in median lethal time (LT50) in insect larvae (Stewart et al. 1991). So, the present constructed recombinant virus (BmNPV/Polh-Cit1a) showed improved pathogenicity against target host insect due to expression of Polh-Cit1a fusion protein. Analysis of recombinant protein from dead insects confirmed that larvae died earlier due to expression of toxin caused by the infection of BmNPV/Polh-Cit1a. Polh-Cit1a fusion protein was detected in fat body collected from dead larvae (Fig. 3.5D, lane 3).

Table 3.2 LT 50 value and production of budded virus for the recombinant BmNPV/Polh-Cit1a and control virus BmNPV/EGFP in 5th instar larvae of Bombyx mori.

1# Virus LT 50 (h) Budded virus/ml hemolymph

BmNPV/Polh-Cit1a 76.63 ± 4.31** 4.72×108 ± 0.74×108

BmNPV/EGFP 103.43 ± 4.76 4.95×108 ± 0.87×108

1 LT 50 value was determined using log Probit analysis. Virus titer was calculated from # 5 infected larval hemolymph. Median lethal time (LT50) values were calculated at 1×10 virus titer/larva. Significant difference is indicated by ** (p < 0.01, t-test).

BmNPV/Polh-Cit1a-infected insects showed strongly retarded growth, increasing their body weight only 44.80% over 2 days, whereas control insects increased their body weight 70.77% and BmNPV/EGFP-infected insect increased their weight 57.35% (Fig. 3.7). The significant different was found in mean larval body weight between BmNPV/Polh-Cit1a and BmNPV/EGFP infected insects (P < 0.05; ANOVA) at 48 h p.i. Moreover, in the final stages of BmNPV/Polh-Cit1a-infection, cuticular melanization was observed but not in BmNPV/EGFP infected insects (Fig. 3.8A-B) at 96 h.p.i. This result indicates that expression of toxin during baculovirus infection affects growth rate and induce early melanization of cuticle comparing to control virus lacking toxin gene. Melanization was also observed in internal tissues of infected insects (Fig. 3.8C). We have modified a baculovirus insecticide by inserting a gene encoding an insect-specific toxin so that it reduces survival time of infected insects, retards growth rate and induces early melanization of dead insects. This virus can still produce polyhedra, making a realistic proposition for field use, where it would cause less crop damage than normal, unmodified baculovirus insecticides. However, expression of toxin in insect host did not affect budded virus production during baculovirus infection (Table 3.2). There was no significant different of virus titer that was found in the hemolymph of infected insect (p > 0.05). In previous paper, improved insecticidal activity of the recombinant AcMNPV harboring an insect-specific toxin (AaIT) gene from scorpion under the control p10 promoter was demonstrated by reduction by 24% in median lethal time (LT50) in insect larvae (Stewart et al. 1991). This result indicates that, as well as recombinant AcMNPV containing AaIT gene in the previous paper, Polh-Cit1a fusion protein can also induce early insect death as an insecticide and Cit1a can function normally even if Cit1a is fused to C-terminal of Polh

58 via FLAG tag.

Fig. 3.7 Effect of Cit1a on the growth of silkworm larvae during recombinant baculovirus infection. Data were analyzed using ANOVA. Error bars indicate standard errors and the asterisks centered over the error bar showing the relative level of the p-value. Significant differences are indicated by * (P < 0.01, Tukey’s Honestly Significant Difference test).

Fig. 3.8 Photographs of recombinant baculovirus-infected silkworm larvae. (A) BmNPV/Polh-Cit1a infected silkworm larvae. (B) Control virus-infected larvae. (C) Light microscopic images of silk gland of larvae infected with viruses expressing Cit1a at 96 h p.i. (D) Larva infected with control virus without Cit1a at 96 h p.i. Arrow head shows deposition of melanin. Bar represents 330 µm.

3.3.4 Microscopic analysis of cells expressing the Polh-Cit1a fusion protein

For light, fluorescence and CLSM microscopy, Bm5 cells were infected with BmNPV/Polh-Cit1a and BmNPV/EGFP (MOI of 10) and Sf9 cells infected with AcMNPV/Polh-Cit1a and AcMNPV. The infected and mock cells were observed at various time intervals. Until 24 h p.i., similar cytomorphological changes including nuclear hypertrophy and cell rounding were observed when cells were infected with recombinant viruses as like as the wild-type virus infected cells (Hughes et al. 2012). In cell viability experiment using trypan blue, at 48 h p.i., more number of blue-stained cells infected with BmNPV/Polh-Cit1a was observed than that of cells infected with BmNPV/EGFP and mock (Fig. 3.9A). The recombinant virus expressing the toxin Cit1a induced death in 65 % (±

4.8%) of the cells at 48 h p.i., while for the control virus (BmNPV/EGFP) only 27.1 % (± 1.5%) (P< 0.01) were dead at 48 h p.i. (Fig. 3.9B). At 96 h p.i., almost all cells infected with BmNPV/Polh-Cit1a died even if approximately 40% cells infected with BmNPV/EGFP were alive. Similar result was found when we evaluated the AcMNPV/Polh-Cit1a infected cell line (Fig. 3.9C). The Polh-Cit1a fusion protein was detected from infected at different time interval (h p.i.) by western blot (Fig. 3.10).

BmNPV/Polh-Cit1a infected cell morphology at 72 h p.i. was considerably different from BmNPV/EGFP and mock-infected cells. Cells infected with BmNPV/Polh-Cit1a seem to lose its cytoplasm and outline of cells was blurred (data not shown). These results consisted with the previous report where a theraphosid spider toxin caused early Sf21 cell death by necrosis (Ardisson-Araújo et al. 2013). Normally, baculovirus infection induces apoptosis of infected cells (Ishikawa et al. 2004).

In addition, polyhedrin particles were found at 72 h p.i. in nucleus of cells infected with BmNPV/Polh-Cit1a, AcMNPV, and ACMNPV-Polh-Cit1a, but not in nucleus of mock infected cells (Fig. 3.11). To investigate and quantify the polyhedra particles formation in cells infected with recombinant as well as wild-type baculoviruses, Bm5 and Sf9 cells were infected with the respective baculovirus and total number of polyhedra formation was investigated at 5 days p.i. Overall, the polyhedral particles of the recombinant viruses were similar to wild-type AcMNPV (Fig. 3.12). This result indicated that recombinant virus might infect the insect pests similarly as like as wild-type virus.

Fig. 3.9 Trypan-blue staining experiment of Bm5 cells infected with each recombinant BmNPV. (A) Microscopic analysis of Bm5 cells infected by BmNPV/Polh-Cit1a, BmNPV/EGFP, and mock at 48 h p.i. (B) Cell mortality of BmNPV/Polh-Cit1a (closed circles) and BmNPV/EGFP (open circles) infected Bm5 cells. Red and green arrow head show dead and live cell respectively. Trypan-blue dye were used to stain death cells, and cells were counted by a hemocytometer. (C) Cell mortality of AcMNPV/Polh-Cit1a- (closed circles) and wild type AcMNPV- (open circles) infected Sf9 cells. Error bars indicate the standard errors, and the asterisks centered over the error bar showing significant level ("**" means p<0.01).

Fig. 3.10 Detection Polh-Cit1a from cells infected with BmNPV/Polh-Cit1 by western blot. M: molecular marker; lanes 2-6: samples harvested at 24, 48, 72, 96 and 120 h p. i. lane 1: mock infected cell.

3.4 Discussion

The main goal of this experiment to develop improved recombinant baculovirus by cloning spider venom peptide gene with the enhancement of pathogenicity by which the target pest will be died very soon or decrease their feeding damage by reducing effective feeding time. Several foreign genes derived from diverse source have been inserted into wild- type baculovirus targeting improved pathogenicity towards host insect pest. For instance, several recombinant virus constructed expressing different toxins under the control of the early/late promoter, showed improved pathogenicity with a 24.4–65.5% reduction of the LT50 compared to that of control baculovirus (Burden et al. 2000; Chang et al. 2003; Choi et al. 2008, 2013; Gramkow et al. 2010; Stewart et al. 1991; Shim et al. 2013). In this study, we inserted the gene of cyto-insectotoxin (cit1a) derived from the central Asian spider, Lachesana tarabaevi venom gland a novel class of cytolytic molecule showing equally potent antimicrobial and insecticidal effects.

Cit1a is a MAMP with the activity prefix “M” (Vassilevski et al. 2009) and retains an α-helical structure and form head-to-tail” shape with two short MAMPs (Fig. 3.13). This

63 spider venom peptide toxin did not show toxicity (intracellular expression) in HEK293 cells but showed insecticidal activity against flesh fly and cockroach (Vassilevski et al. 2008). The details insecticidal activity remains elusive.

Fig. 3.11 Photographs of recombinant baculovirus-infected Bm5 and Sf9 monolayer cells by fluorescence microscope. (A) Mock infected cells (Sf9). (B) Cell (Bm5) was infected with the recombinant virus BmNPV/Polh-Cit1a, (C) Sf9 cell infected with AcMNPV/Polh-Cit1a expressing the toxin showing absence of cytoplasm and polyhedra accumulated in the nucleus. (D) Sf9 cell infected with wild type AcMNPV. Photographs were taken 72 h p.i. Arrow head indicates the polyhedra expressed in nucleus. Bar represents 10 µm.

We reported the antimicrobial effect of Cit1a (Ali et al. 2014), and in this study we revealed the insecticidal effect both in vitro and in vivo. To target this purpose, cit1a was fused with polh gene and constructed the recombinant baculovirus. The bacmid used in this study lacks the polh gene and as a result, polyhedra was not produced in insect cells during

64 the baculovirus infection. Polh-Cit1a was successfully expressed in silkworm larval fat body, Bm5 and Sf9 cell lines (Figs. 3.11A-B and 3E). The fused Cit1a toxin could be separated from Polh-Cit1a fusion in the host insect by the action of proteases. rEK-treated experiment confirmed this hypothesis. In addition previous study showed that Cit1a remain active with its fusion partner (Ali et al. 2014).

Fig. 3.12 Polyhedra production by recombinant baculoviruses in insect cell lines. The yield of total released polyhedra from Sf9 infected with AcMNPV and AcMNPV/Polh-Cit1a and Bm5 infected with BmNPV/Polh-Cit1a were counted with hemocytometer.

BmNPV/Polh-Cit1a demonstrated significantly improved pathogenicity against Bombyx mori larvae by reducing LT50 value (Table 3.2, p < 0.05). Previously, several recombinant virus constructed expressing different toxins, showed similar improved pathogenicity with

24.4–65.5% reduction of the LT50 compared to control baculovirus (Choi et al. 2008, Shim et al. 2013, Stewart et al. 1991). Similarly our constructed recombinant virus, BmNPV/Polh-

Cit1a represents 26.12% reduction of the LT50 value compared to control virus. Several foreign genes when inserted into wild-type baculovirus showed significant improved over wild-type virus (Fig. 3.14). Beside this, significant lower growth rate of virus infected larvae 65 was observed when compared to control virus infected larvae (Fig. 3.7). This was happened due to expression of Polh-Cit1a in fat body cells. The expression of Cit1a also induced to spread budded virus in insect body by disrupting basement membrane. Basement membrane inhibits the spread of budded virus within the insect (Boughton 2001). This membrane consists of fibrous extracellular matrix encircled the tissues, helping structural support (Rohrback and Rohrback 1993).

This hypothesis was tested using cell lines of the same insects in vitro. Analysis of death insect infected with BmNPV/Polh-Cit1a showed early melanization comparing to control virus infected insects (Fig. 3.8). Fifth instar larvae of B. mori infected with BmNPV/Polh-Cit1a demonstrated a significant level of cuticular melanization (Fig. 3.8A). Similar result (cuticle melanization and slower growth) was observed due to other toxins toxin/toxin complex (Chen et al. 2014). Internal tissue of infected larvae also represented the patches of melanization, as well as fragmentation of some of the tissues (Fig. 3.8C). This can be explained by the appearance of damaged tissues which deposited on silk gland of silkworm larvae. Cerenius and Soderhall (2004) also reported that melanin is deposited due to presence of antigens and resulting of tissue damage. The observed cuticular melanization of silkworm larva infected with BmNPV/Polh-Cit1a can be explained by which prophenoloxidase enzyme converted into active form. A pro-enzyme (pro-phenoloxidase) remains in the hemolymph which is converted to active form phenoloxidase that induces melanization (Gramkow et al. 2010). Furthermore, Cit1a could activate phenoloxidase cascade indirectly by damaging the basement membrane and underlying tissues (Harrison and Bonning 2010). Because cit1a is a membrane-acting antimicrobial peptide (Vassilevski et al. 2009).

BmNPV/Polh-Cit1a harboring cytotoxin which causes direct or indirect membrane pores, and disrupting membrane structure causing stasis or lysis of the cell. Several cytotoxic molecules have been identified from spider venoms (Vorontsova et al. 2011; Windley et al. 2012) showing ability to cause membrane pores, and interact with signal transduction and eventually lead to cell death (Mintz 1994; Mintz and Bean 1993; Sanguinetti et al. 1997). AMPs act by interacting with microbial cell membranes, inducing stasis or lysis and it is unlikely that they have one single mechanism of action, but still disruption of membrane structures is considered to be an important feature for all the peptides (Hancock and Scott 2000; Lehrer and Ganz 1999). Microscopic analysis of Bm5 cells infected with 66

BmNPV/Polh-Cit1a represents loss of cytoplasm, disruption of membrane integrity and morphological changes evident from light, fluorescence microscope, confocal laser scanning microscopy analysis (Fig. 3.15), propound that Cit1a can cause cell death by necrosis or increase the spread of virus by damaging basement membrane when expressed by baculovirus infection.

Fig. 3.13 Predicted structure of mature cyto-insectotoxin1a (Cit1a) peptide. The Swiss-Model Server (http://swissmodel.expasy.org/) was used for protein structure prediction. The amino acid sequence was used in this model adopted from NCBI.

For cell cytotoxicity analysis, the Trypan-blue method was applied at different times p.i. to quantify the death cell infected with recombinant viruses. This method is widely utilized to determine cell death (Vandenabeele et al. 2010). Furthermore, structural and morphological change of cell infected with recombinant BmNPV/Polh-Cit1a also supports our conclusion (data not shown). We also analyzed cell mortality during control virus infection in Bm5 cells with expressing the non-toxin gene. In addition, cell mortality was also quantified when Sf9 cells were infected with recombinant AcMNPV/Polh-Cit1a expressing the same fusion toxin. Surprisingly similar mortality levels were found when compared to 67

Bm5 cells (Fig. 3.9B-C). However, different levels of cell mortality were found at various time intervals. The Number of death cells increased with increasing time interval of baculovirus infection both in recombinant virus with toxin and control virus. But significantly higher number of cell death occurred with recombinant virus containing toxin compared to control virus without toxin (P< 0.01) at each time interval after infection. This was happened due toxin expression during baculovirus infection in vitro. Expression of toxin was detected at each time interval (Fig. 3.10) after 24 h p.i. These data indicate that elevated mortality of cells earlier in infection due to expression of recombinant proteins and significant higher cells death arose at longer time interval due to higher expression of toxin.

Fig. 3.14 Effect of foreign genes that are used to construct recombinant baculovirus and their effects on the improvement of pathogenicity over wild-type baculovirus.

The fusion toxin which was expressed during recombinant baculovirus infection did not affect budded virus formation (Table 3.2). This results can be clarified that budded virus was formed before the massive activation of polyhedron promoter which was used to express toxin in this study (Oomens and Blissard 1999). Baculovirus (NPVs) follows a biphasic life cycle forming two virions phenotypes. BVs come out from the cells following basal direction and begin systematic infection throughout the host body. Occluted virions are formatted at the late stages of infection and cells died. After disintegration of cells, OBs released to the environment. Thus, released OBs remain in the environment and await for ingestion by a new healthy insect. BmNPV/Polh-Cit1a produced occlusion bodies, polyhedra in cell nucleus (Fig. 3.11) which is stable in environment. Moreover, similar number of total polyhedra was found during recombinant baculoviruses infection in cells (Fig. 3.12) comparing to wild type baculoviruses (p > 0.05). This result ensured that recombinant viruses still produced polyhedra, making a realistic proposition for field use as biopesticide since baculovirus has no negative impact on environment as well as human health.

In conclusion, two novel recombinant baculoviruses, BmNPV/Polh-Cit1a and AcMNPV/Polh-Cit1a were constructed which showed improved pathogenicity against target insects. This recombinant BmNPV containing a toxin (cit1a) gene fused with polh gene caused early Bm5 cell death by cell necrosis and early 5th silkworm larvae death, compared to BmNPV/EGFP. Polh-Cit1a can be applied for improved recombinant baculoviruses as a bioinsecticide as well as other peptide toxins from bacteria, spiders and scorpion.

Fig. 3.15 Photographs of recombinant baculovirus-infected Bm5 monolayer cells by confocal laser scanning microscope (CLSM). (A) Cell was infected with the recombinant virus BmNPV/Polh-Cit1a, expressing the toxin showing absence of cytoplasm and polyhedra accumulated in the nucleus. (B) Mock infected cells. Photographs were taken 72 h p.i. Arrow head indicates the polyhedra that expressed in nucleus.

CHAPTER IV

Conclusion and future prospects

4. Conclusion and future prospects

4.1 Conclusion Although in this dissertation, the main focus deployed on the development of recombinant baculoviruses by inserting a spider venom peptide gene into BmNPV and AcMNPV using recombinant DNA technology. A novel method is developed to express and produce an antimicrobial peptide Cit1a that was first reported by Vassilevski et al. in 2008, in a silkworm using a baculovirus expression system. This peptide is expressed both in silkworm larvae and pupae. The recombinant EGFP-FLAG-Cit1a fusion protein was antimicrobial as well as natural Cit1a. The purified recombinant protein showed antimicrobial effect against several bacterial strains. This expression system might be used for large-scale preparation of the recombinant protein without any biohazard with low cost. Since Cit1a is a candidate for a novel antimicrobial against pathogens including Chlamydia, this finding may provide some useful information for practical use of Cit1a. This study also indicates that spider venom peptide gene (cit1a) could be used to improve the pathogenicity of baculovirus.

Using cit1a, two novel engineered baculoviruses are constructed which showed improved insecticidal activity against insect. The cit1a was fused with polh and cloned into wild-type AcMNPV and BmNPV viruses. The purpose for the use of polh to improve the oral infectivity of the recombinant virus. Both engineered viruses produce polyhedra as like as wild-type baculovirus which indicate that recombinant baculoviruses might have similar infection rate in case of field application. Polyhedra also favors to make the formulation of viruses for large scale application in field. Moreover the engineered baculovirus inhibited the growth of insect. The inhibition rate was significantly higher than that of wild-type virus which indicates that recombinant virus-infected insects reduce feeding ability and less damage to host plant. The engineered BmNPV/Polh-Cit1a induced early melanization of silkworm larvae compared to control. This may be happened due to express of Polh-Cit1a which activates the phenoloxidase directly, remains pro-enzyme form in insect body or Cit1a can trigger phenoloxidase cascade by damaging the basement membrane indriectly. But still it is not confirmed the mechanism how Cit1a caused melanization. Details mechanisms need to be investigated. Furthermore recombinant viruses induced early insect death causing loss of cell cytoplasm and disrupt the membrane integrity. Toxin was detected during cell lines infection by western blot analysis which confirmed that earlier cell death arose due to

72 expression of Polh-Cit1a fusion protein. Finally it can be concluded that when engineered baculovirus contaminated foliage will be eaten by insect pests, the polyhedra will release ODVs (occlusion-derived virions) within midgut of ingested insect due to high alkaline condition (pH >8.0). Then ODVs penetrate the peritrophic membrane and eventually infect midgut cells by direct fusion with membrane epithelial cells. After that nucleocapsids move to the nucleus and start to replicate and Polh-Cit1a is expressed with other viral genes. Baculovirus have a long history of safe used as pesticide for plant protection programme. Wild-type baculoviruses as well as their recombinant forms provide an effective biopesticide which might replace or reduce chemical insecticides from agricultural production system. The viruses, AcMNPV/Polh-Cit1a and BmNPV/Polh-Cit1 containing spider venom peptide gene could be added to the list of engineered baculoviruses having improved pathogenicity and may have possibility to be used in integrated pest management (IPM) programme.

4.2 Future prospects On arrival of genetic engineering and the recent construction of fast acting recombinant baculovirus, the application of recombinant viruses for insect pest management programme has greatly increased. Some companies and different research institutes and academic laboratories are continuously leading this research area in worldwide. Application of wild-type baculovirus is a major component of integrated pest management (IPM) for numerous insect pests of various agricultural crops as well as forest plants and their utilization is very much effective for safe plant protection in several cases. However, comparing to classical agrochemicals wild-type baculovirus is not so much effective in most cases due to several factors especially their slow pathogenicity. This characteristic of baculovirus not only serve them low competitive, but also hinders the wide spread application. Particularly, their slow pathogenicity makes ceiling the commercialization including industrial investment in application method to increase efficiency. Recombinant DNA technology increased the action of baculovirus against insect pests since 1991. This advent has made chance for industrial investment of large scale commercialization. The company feels interest to invest in related technologies which would lead the recombinant baculovirus highly effective for insect pest management. Several genetically modified baculoviruses have been constructed by inserting various kinds of foreign genes including proteases, neurotoxins, and toxins. These selective toxins derived from diversified organisms and used for genetic modification of wild-type baculovirus. Efficacy of recombinant baculovirus somewhat depends on selective toxins that are cloned into wild-type virus. Spider 73 venom provides wide range of toxin complex and recently several insect selective toxins have been identified from spider venom and tested for insect killing efficiency.

Novel, more effective potential, insect-specific toxins need to be identified from different venomous organisms for making more recombinant baculoviruses with higher biological efficiency. Earlier and weaker promoters can be used if the toxin agents have higher insecticidal activity. This also causes early viral replication and insect death. Multiple fronts should be considered for future construction of recombinant baculovirus biopesticide More than one toxin including different mode of action cloned into the same baculovirus might be a novel idea for investigation. In this case synergistic of selective toxins expressed in one virus should be carefully considered. The formulation materials of recombinant baculovirus particularly polyhedra that can be directly applied in field is most important to increase pathogenicity of a modified virus. It must be confirmed that recombinant virus produces polyhedral as like as wild-type virus. To confirm the primary infectious particles either produced within polyhedra or not should be investigated. The polyhedra produced by recombinant baculoviruses indicating the virus should be applied in field. However recombinant baculovirus provides a promising technology which pose higher potential for effective component of insect pest management programme.

REFERENCES

References

1. Alavanja MC, Hoppin JA, Kamel F (2004) Health effects of chronic pesticide exposure: cancer and neurotoxicity. Annu Rev Public Health 25: 155–197. 2. Ali MP, Yoshimatsu K, Suzuki T, Kato T, Park EY (2014) Expression and purification of cyto-insectotoxin (Cit1a) using silkworm larvae targeting for an antimicrobial therapeutic agent. Appl Microbiol Biotechnol 98: 6973–6982. 3. Ardisson-Araújo DMP, Morgado FDS, Schwartz EF, Corzo G, Ribeiro BM (2013) A new theraphosid spider toxin causes early insect cell death by necrosis when expressed in vitro during recombinant baculovirus infection. PLoS One 8: e84404. doi:10.1371/journal.pone.0084404.

4. Assaeedi A, Osman E, Abulreesh H (2011) The occurrence and insecticidal activity of Bacillus thuringiensis in the arid environments. Austr J Crop Sci 5: 1185-1190. 5. Atkinson TP, Balish MF, Waites KB (2008) Epidemiology, clinical manifestations, pathogenesis and laboratory detection of Mycoplasma pneumoniae infections. FEMS Microbiol Rev 32: 956–973.

6. Attaran A, Roberts DR, Curtis CF, Kilama WL (2000) Balancing risks on the backs of the poor. Nat Med 6: 729–731. 7. Au S, Wuand W, Panté N (2013) Baculovirus Nuclear Import: Open, Nuclear Pore Complex (NPC) Sesame. Viruses 5: 1885-1900. 8. Avilov SV, Moisy D, Naffakh N, Cusack S (2013) Influenza A virus progeny vRNP trafficking in live infected cells studied with the virus-encoded fluorescently tagged PB2 protein. Vaccine 30: 7411–7417 9. Aziz MA, Wright A (2005) The World Health Organization/International Union against tuberculosis and lung disease global project on surveillance for anti- tuberculosis drug resistance: a model for other infectious diseases. Clin Infect Dis 41(Suppl 4): S258–S262 10. Barone S, Das KP, Lassiter TL, White LD (2000) Vulnerable processes of nervous system development: a review of markers and methods. Neurotoxicology 21: 15–36.

11. Bassil KL, Vakil C, Sanborn M, Cole DC, Kaur JS、Kerr, KJ (2007) Cancer health

effects of pesticides: systematic review. Canadian Family Physician 53: 1704–1711.

12. Bellinger RG (1996) Pest Resistance to Pesticides. Available in

http://ipm.ncsu.edu/safety/factsheets/resistan.pdf

13. Bertolote JM, Fleischmann A, Eddleston M, Gunnell D (2006) Deaths from pesticide poisoning: a global response. Brit J Psychiatry 189: 201–203. 14. Betarbet R, Sherer TB, MacKenzie G, Garcia-Osuna M, Panov AV, Greenamyre JT (2000) Chronic systemic pesticide exposure reproduces features of Parkinson’s disease. Nat Neurosci 3: 1301–1306. 15. Billeter SA, Levy MG, Chomel BB, Breitschwerdt EB (2008) Vector transmission of Bartonella species with emphasis on the potential for tick transmission. Med Vet Entomol 22: 1–15.

16. Bonmatin JM, Giorio C, Girolami V, Goulson D, Kreutzweiser D, Krupke C, Liess M, Long E, Marzaro M, Mitchell E, Noome D, Simon-Delso N, Tapparo A (2015) Environmental fate and exposure; neonicotinoids and fipronil. Environm Sci Pollu Res 22: 35-67. 17. Bonning BC, Ward VK, van Meer MM, Booth TF, Hammock BD (1997) Disruption of lysosomal targeting associated with insecticidal potency of juvenile hormone esterase. PNAS 12: 6007–6012.

18. Bonning BC, Hammock BD (1996) Development of recombinant baculoviruses for insect control. Annu Rev Entomol 41: 191–210.

19. Boughton AJ (2001) Wild-type and recombinant baculoviruses for management of insect pests. Retrospective Theses and Dissertations. Paper 1099. Iowa State UniversityAvailable http://lib.dr.iastate.edu/cgi/viewcontent.cgi?

20. Brogdon WG, McAllister JC (1998) Insecticide resistance and vector control. Emerg Infect Dis 4: 605–613.

21. Brooks E, Hines E (1999) Viral biopesticides for heliothine control-fact or fiction. Todays Life Sci 11: 38–44.

22. Burden JP, Hails RS, Windass, JD, Suner MM, Cory SS (2000) Infectivity, speed of kill, and productivity of a baculovirus expressing the itch mite toxin txp-1 in second and fourth instar larvae of Trichoplusia ni. J Inverteb Patholo 75: 226–236.

23. Butler MS, Buss AD (2006) Natural products - the future scaffolds for novel antibiotics? Biochemical Pharmacology 71: 919-929.

24. Butler MS, Cooper MA (2011) Antibiotics in the clinical pipeline in 2011. J

Antibiotics 64: 413-425.

25. Carbonell LF, Klowen MJ, Miller LK (1985) Baculovirus- mediated expression of bacterial genes in dipteran and mammalian cells. J Virol 56: 153–160.

26. Carlini CR, Grossi-de-Sá MF (2002) Plant toxic proteins with insecticidal properties. A review on their potentialities as bioinsecticides. Toxicon 40: 1515–1539.

27. Carson R (1962) Silent Spring. Houghton Mifflin, Boston. NewYork, USA.

28. Casida JE (2009) Pest toxicology: the primary mechanisms of pesticide action. Chem Res Toxicol 22: 609–619.

29. Casida JE, Quistad GB (1998) Golden age of insecticide research: past, present, or future? Annu Rev Entomol 43:1–16.

30. Cassir N, Rolain JM, Brouqui P (2014) A new strategy to fight antimicrobial resistance: there vivalo fold antibiotics. Nadim Frontiersin Microbiolo 5: 551. doi: 10.3389/fmicb.2014.00551.

31. Catindig JLA, GS Arida, SE Baehaki, JS Bentur, LQ Cuong, M Norowi, W Rattanakarn, W Sriratanasak, J Xia, and Z Lu (2009) Situation of planthoppers in Asia. In: Heong KL, Hardy B editors. Planthoppers: new threats to the sustainability of intensive rice production systems in Asia. Los Baños (Philippines): International Rice Research Institute. pp. 191-220.

32. Centers for Disease Control and Prevention Malaria Facts: Malaria Worldwide. [(accessed on 20 January 2012)]. Available online: http://www.cdc.gov/malaria/about/facts.html.

33. Cerenius L, Soderhall K (2004) The prophenoloxidase-activating system in invertebrates. Immunol Rev 198:116–126.

34. Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasherf DC (1994) Green fluorescent protein as a marker for gene expression. Science 263: 802–804.

35. Chang JH, Choi JY, Jin BR, Roh JY, Olszewski JA, Seo SJ, O’Reilly DR, Je YH (2003) An improved baculovirus insecticide producing occlusion bodies that contain Bacillus thuringiensis insect toxin. J Invertebr Pathol 84: 30–37.

36. Chen W-J, Hsieh F-C, Hsu F-C, Tasy Y-F, Liu J-R, Shih MC (2014) Characterization of an insecticidal toxin and pathogenicity of Pseudomonas taiwanensis against

insects. PLoS Pathog 10(8): e1004288. doi:10.1371/journal.ppat.1004288

37. Chen X, Zhu FM, Cao YH, Qiao SY (2009) Novel expression vector for secretion of cecropin AD in Bacillus subtilis with enhanced antimicrobial activity. Antimicrob Agents Chemother 53: 3683–3689.

38. Chen SHL, Liu MY, Li TX, Wang YP (2000) Preliminary studies on control of Ectropis grisescens warren with Ectropis grisescens nucleopolyhedrovirus in fields. Virol Sin 15: 50-54.

39. Choi JY, Li MS, Shim HJ, Roh JY, Woo SD, Jin BR, Boo KS, Je YH (2007) Isolation and characterization of strain of Bacillus thuringiensis subsp. kenyae containing two novel cry1-type toxin genes. J Microbiol Biotechnol 17: 1498–1503.

40. Choi JY, Myung-Pyo Jung, Hong-Hyun Park, Xue Ying Tao a, Byung Rae Jin c, Yeon Ho Je (2013) Insecticidal activity of recombinant baculovirus co-expressing Bacillus thuringiensis crystal protein and Kunitz-type toxin isolated from the venom of bumblebee Bombus ignitus. J Asia-Pacific Entomol 16: 75–80.

41. Choi JY, Wang Y, Kim YS, Kang JN, Roh JY, Woo SD, Jin BR, Je YH (2008) Insecticidal activities of recombinant Autographa californica nucleopolyhedrovirus containing a scorpion neurotoxin gene using promoters from Cotesia plutellae bracovirus. J Asia-Pacific Entomol 11: 155–159.

42. Choo YM, Lee KS, Yoon HJ, Kim BY, Sohn MR, Roh JY, Je YH, Kim NJ, Kim I, Woo SD, Sohn HD, Jin BR (2010) Dual function of a bee venom serine protease: prophenoloxidase-activating factor in arthropods and fibrin(ogen)olytic enzyme in mammals. PLoS One 5: e10393.

43. Choo YM, Lee KS, Yoon HJ, Qiu Y, Wan H, Sohn MR, Sohn HD, Jin BR (2012) Antifibrinolytic role of a bee venom serine protease inhibitor that acts as a plasmin inhibitor. PLoS One 7: e32269.

44. Citti C, Blanchard A (2013) Mycoplasmas and their host: emerging and re-emerging minimal pathogens. Trends Microbiol 21: 196–203.

45. CLSI (2009) Method for antifungal disk diffusion susceptibility testing of filamentous fungi; proposed guideline. CLSI document M51-P. Clinical and Laboratory Standards Institute, Wayne.

46. Dale K (2012) Personal communication. U.S. Environmental Protection Agency;

Washington, DC, USA.

47. Damalas A, Velimezi G, Kalaitzakis A, Liontos M, Papavassiliou AG, Gorgoulis V (2011) Loss of p14ARF confers resistance to heat shock- and oxidative stress- mediated cell death by upregulating β-catenin. Int J Cancer 128: 1989–1995.

48. Deo VK, Yui M, Alam MJ, Yamazaki M, Kato T, Park EY (2014) A model for targeting colon carcinoma cells using single-chain variable fragments anchored on virus-like particles via glycosyl phosphatidylinositol anchor. Pharm Res 31: 2166-77.

49. Devasahayam G, Scheld WM, Hoffman PS (2010) Newer antibacterial drugs for a new century. Expert Opin Investig Drugs 19: 215–234.

50. Dickert H, Machka K, Braveny I (1981) The uses and limitations of disc diffusion in the antibiotic sensitivity testing of bacteria. Infection 9: 18–24.

51. El-Ghareeb M, Nasser MAK, El-sayed AMK, Mohamed GA (2002) Possible mechanisms of insecticide resistance in cowpea aphid, Aphis craccivora (Koch) The role of general esterase and oxidase enzymes in insecticide resistance of cowpea. The first Conf of The Central Agri Pesticide Lab, 3-5 Sep. (2): 635-649.

52. El-Menofy W, Osman G, Abdulrahman Assaeedi A, Salama M (2014) A novel recombinant baculovirus overexpressing a Bacillus thuringiensis Cry1Ab toxin enhances insecticidal activity. Biological Procedures Online 16: 7.

53. El-Sheikh ESA, Kamita SG, Kiem Vu K, Hammock BD (2011) Improved insecticidal efficacy of a recombinant baculovirus expressing mutated JH esterase from Manduca sexta. Biological Control 58: 354–361.

54. Enserink M, Hines PJ, Vignieri SN, Wigginton NS, Yeston JS (2013) The Pesticide Paradox. Science 341: 728-729.

55. Entwistle PF, Evans HF (1985) Viral control. In: Beckage NE, Thompson SN, Federici BA, editors. Parasites and Pathogens of Insects. New York Academic. pp. 347-412.

56. Eriksson P (1997) Developmental neurotoxicity of environmental agents in the neonate. Neurotox 18: 719–726.

57. Escoubas P, King GF (2009) Venomics as a drug discovery platform. Expert Rev Proteomics 6: 221–224.

58. Escoubas P, Quinton L, Nicholson GM (2008) Venomics: unravelling the complexity of animal venoms with mass spectrometry. J Mass Spectrom 43: 279–295.

59. Escoubas P, Rash LD (2004) Tarantulas: Eight-legged pharmacists and combinatorial chemists. Toxicon 43: 555–574.

60. Escoubas P, Sollod B, King GF (2006) Venom landscapes: mining the complexity of spider venoms via a combined cDNA and mass spectrometric approach. Toxicon 47: 650–663.

61. Estrada G, Garcia BI, Schiavon E, Ortiz E, Cestèle S, Wanke E, Possani LD, Corzo G (2007) Four disulfide-bridged scorpion beta neurotoxin CssII: heterologous expression and proper folding in vitro. Biochim Biophys Acta Gen Subj 1770: 1161– 1168.

62. Fan F, Wu Y, Liu J (2010) Expression and purification of two different antimicrobial peptides, PR-39 and Protegrin-1 in Escherichia coli. Protein Express Purif 73: 147– 151.

63. Fehri LF, Wroblewski H, Blanchard A (2007) Activities of antimicrobial peptides and synergy with enroﬂoxacin against Mycoplasma pulmonis. Antimicrob Agents Chemother 51: 468–474.

64. Feyereisen R (1995) Molecular biology of insecticide resistance. Toxicol Lett 1995: 82–90.

65. Froy O, Zilberberg N, Chejanovsky N, Anglister J, Loret E, Shaanan B, Gordon D, Gurevitz M (2000) Scorpion neurotoxins: structure/function relationships and application in agriculture. Pest Manag Sci 56: 472–474.

66. Fukushima M, Iiyama K, Yamashita J, Furue M, Tsuji G, Imaishi S, Mon H, Lee JM, Kusakabe T (2013) Production of small antibacterial peptides using silkworm- baculovirus protein expression. Prep Biochem Biotechnol 43: 565–576.

67. Gayle A (2001) Tick-borne diseases. Am Fam Physician 64: 461–466.

68. Georghiou GP (1990) Overview of insecticide resistance. ACS Symp Ser 421: 18–41.

69. Giamarellou H, Poulakou G (2009) Multidrug-resistant Gram-negative infections: what are the treatment options? Drugs 69: 1879–1901.

70. Giuliani A, Pirri G, Nicoletto SF (2007) Antimicrobial peptides: an overview of a

promising class of therapeutics. Cent Eur J Biol 2: 1–33.

71. Glare T, Caradus J, Gelernter W, Jackson T, Keyhani N, Kohl J, Marrone P, Morin L, Stewart A (2012) Have biopesticides come of age? Trends Biotechnolo 30: 250-258.

72. Goossens H, Ferech M, Stichele RV, Elseviers M, Group ESACP (2005) Outpatient antibiotic use in Europe and association with resistance: A cross-national database study. The Lancet 365: 579–587.

73. Gorell JM, Johnson CC, Rybicki BA, Peterson EL, Richardson RJ (1998) The risk of Parkinson’s disease with exposure to pesticides, farming, well water, and rural living. Neurology 50: 1346–1350.

74. Gramkow AW, Perecmanis S, Sousa RLB, Noronha EF, Felix CR, Nagata T, Ribeiro BM. 2010. Insecticidal activity of two proteases against Spodoptera frugiperda larvae infected with recombinant baculoviruses. Virol J 7: 143.

75. Gratz NG (1999) Emerging and resurging vector-borne diseases. Annu Rev Entomol 44: 51–75.

76. Gubler DJ (2002) The global emergence/resurgence of arboviral diseases as public health problems. Arch Med Res 33: 330–342.

77. Gunnell D, Eddleston M (2003) Suicide by intentional ingestion of pesticides: a continuing tragedy in developing countries. Int J Epidemiol 32: 902–909.

78. Gunnell D, Eddleston M, Phillips MR, Konradsen F (2007) The global distribution of fatal pesticide self-poisoning: systematic review. BMC Public Health 7: 357.

79. Hall RD, Gerhardt RR (2009) Flies (Diptera) In: Mullen GR, Durden LA editors. Medical and Veterinary Entomology. 2nd. Elsevier; Burlington, NJ, USA. pp. 127– 161.

80. Hammock BD, Bonning BC, Possee RD, Hanzlik TN, Maeda S (1990) Expression and effects of the juvenile hormone esterase in a baculovirus vector. Nature 344: 458– 461.

81. Hancock RE, Sahl HG (2006) Antimicrobial and host-defense peptides as new anti infective therapeutic strategies. Nat Biotechnol 24: 1551–1557.

82. Hancock REW, Scott MG (2000) The role of antimicrobial peptides in animal defenses. PNAS 9: 8856–8861.

83. Harrison RL, Bonning BC (2010) Proteases as insecticidal agents. Toxins 2: 935–953.

84. Harrison RL, Bonning, BC (2001) Use of proteases to improve the insecticidal activity of baculoviruses. Biological Control 20: 199-209.

85. Harrison RL, Bonning BC (2000) Genetic engineering of biocontrol agents for insects. In: JE Rechcigl, Rechcigl NA Editors. Biological and Biotechnological Control of Insect Pests. CRC Press, Boca Raton, FL. pp. 243–280.

86. Hayakawa K, Marchaim D, Martin ET et al. (2012) Comparison of the clinical characteristics and outcomes associated with vancomycin-resistant Enterococcus faecalis and vancomycin-resistant E. faecium bacteremia. Antimicrob Agents Chemother 56: 2452–2458.

87. Heckel DG (2012) Insecticide resistance after silent spring. Science 337: 1612-1614.

88. Hee JS, Choi JY, Li MS, Wang Y, Roh JY, Woo S-D, Jin BR, Je YH (2009) A novel recombinant baculovirus expressing insect neurotoxin and producing occlusion bodies that contain Bacillus thuringiensis Cry toxin. J Asia Pac Entomol 12: 217–220.

89. Heinrichs EA (1994) Impact of insecticides on the resistance and resurgence of rice planthoppers. In: Denno RF, Perfect TJ Editors. Planthoppers: Their Ecology and Management. Chapman & Hall, New York, NY, pp. 571–598.

90. Hemingway J, Hawkes NJ, McCarroll L, Ranson H (2004) The molecular basis of insecticide resistance in mosquitoes. Insect Biochem Mol Biol 34: 653–665.

91. Hemingway J, Ranson H (2000) Insecticide resistance in insect vectors of human disease. Annu Rev Entomol 45: 371–391.

92. Herniou EA, Arif BM, Becnel JJ et al. (2012) Virus Taxonomy Classification and Nomenclature of Viruses Ninth Report of the International Committee on Taxonomy of Viruses, Elsevier, Inc., San Diego. pp. 163–173.

93. Herzig V, David LA, Wood, Newell WF, Chaumeil PA, Kaas Q, Binford GJ, Nicholson GM, Gorse D, King GF (2011) ArachnoServer 2.0, an updated online resource for spider toxin sequences and structures. Nucleic Acids Res 39: D653- D657.

94. Hiyoshi M, Kageshima A, Kato T, Park EY (2007) Construction of a cysteine protease deficient Bombyx mori multiple nucleopolyhedrovirus bacmid and its application to

improve expression of a fusion protein. J Virol Methods 144: 91–97.

95. Hong HK, Woo SD, Choi JY, Lee HK, Kim MH, Je YH, Kang SK (2000) Characterization of four isolates of Bombyx mori nucleopolyhedrovirus. Arch Virol 145: 2351–2361.

96. Huang RH, Xiang Y, Liu XZ, Zhang Y, Hu Z, Wang D-C (2002) Two novel antifungal peptides distinct with a five disulfide motif from the bark of Eucommia ulmoides Oliv. FEBS Lett 521: 87–90.

97. Hughes SR, Dowd PF, Johnson ET (2012) Cell-penetrating recombinant peptides for potential use in agricultural pest control applications. Pharmaceuticals 5: 1054–1063.

98. Hughes PR, Wood HA, Breen JP et al (1997) Enhanced bioactivity of recombinant baculoviruses expressing insect-specific spider toxin in lepidopteran crop pests. J Invertebr Pathol 69: 112-118.

99. Inceoglu AB, Kamita S, Hinton AC, Hung Q, Severson TF, Kang KK, Hammock BD (2001) Recombinant baculoviruses for insect control. Pest Manag Sci 57: 981–987.

100. Inceoglu AB, Kamita SG, Hammock BD (2006) Genetically modified baculoviruses: A historical overview and future outlook. Adv Virus Res 68: 323-360.

101. Ingham AB, Moore RJ (2007) Recombinant production of antimicrobial peptides in heterologous microbial systems. Biotechnol Appl Biochem 47: 1–9.

102. Ishikawa H, Ikeda M, Felipe ACA, Thiem SM, Kobayashi M (2004) Host range factor1 from Lymantria dispar nucleopolyhedrovirus (NPV) is an essential viral factor required for productive infection of NPVs in IPLB-Ld652Y derived from L. dispar. J Virol 78: 12703–12708.

103. Jeong Hyun S, Joo Sang Y, Hyung Joon C (2005) Baculoviral polyhedrin–Bacillus thuringiensis toxin fusion protein: A protein-based bio-insecticide expressed in Escherichia coli. Biotechnol Bioeng 9: 166–172.

104. Jiang L (2011) Comparison of disk diffusion, agar dilution, and broth microdilution for antimicrobial susceptibility testing of five chitosans. MSc Thesis, Louisiana State University and Agricultural and Mechanical College, USA.

105. Jurewicz J, Polanska K, Hanke W (2013a) Exposure to widespread environmental toxicants and children's cognitive development and behavioral problems. Int J Occup

Med Environ Health 26: 185–204.

106. Jurewicz J, Polanska K, Hanke W (2013b) Chemical exposure early in life and the neyrodevelopment of children – an overview of current epidemiological evidence. Ann Agric Environ Med 20: 465–86.

107. Jurewicz J1, Hanke W (2008) Prenatal and childhood exposure to pesticides and neurobehavioral development: review of epidemiological studies. Int J Occup Med Environ Health 21: 121-132.

108. Kamel F, Hoppin JA (2004) Association of pesticide exposure with neurologic dysfunction and disease. Environ Health Perspect 112: 950–958.

109. Kamita SG, Kang KD, Inceoglu AB, Hammock BD (2005) Genetically modified baculoviruses for pest insect control. In: Gilbert LI, Iatrou K, Gill SS editors. Comprehensive Molecular Insect Science. Oxford, Elsevier. pp: 271-322.

110. Kato T, Kajikawa M, Maenaka K, Park EY (2010) Silkworm expression system as a platform technology in life science. Appl Microbiol Biot 85: 459–470.

111. Kato T, Manoha SL, Tanaka S, Park EY (2009) High-titer preparation of Bombyx mori nucleopolyhedrovirus (BmNPV) displaying recombinant protein in silkworm larvae by size exclusion chromatography and its characterization. BMC Biotechnol 9: 55.

112. Kato T, Thompson JR, Park EY (2013) Construction of new ligation-independent clonig vectors for the expression and purification of recombinant proteins in silkworms using BmNPV bacmid system. PLoS ONE 8(5): e64007. doi: 10.1371/journal.pone.0064007.

113. Kim JS, Kim YH (2007) The inhibitory effect of natural bioactives on the growth of pathogenic bacteria. Nutr Res Pract 1: 273–278.

114. King GF (2007) Modulation of insect CaV channels by peptidic spider toxins. Toxicon 49: 513–530.

115. King GF, Gentz MC, Escoubas P, Nicholson GM (2008) A rational nomenclature for naming peptide toxins from spiders and other venomous animals. Toxicon 52: 264– 276.

116. King GF, Sollod McFarland B, Nicholson GM, Gunning S (2011) Insecticidal

polypeptides and methods of use thereof. 2011/0237502 A1. U.S. Patent. 2011 Sep 29.

117. Korth KL, Levings CS (1993) Baculovirusexpression of the maize mitochondrialprotein URFl3 confers insecticidalactivity in cell cultures and lawae. PNAS 90: 3388-3392.

118. Kozlov SA, Vassilevski AA, Feofanov AV, Surovoy AY, Karpunin DV, Grishin EV (2006) Latarcins, antimicrobial and cytolytic peptides from the venom of the spider Lachesana tarabaevi (Zodariidae) that exemplify biomolecular diversity. J Biol Chem 281: 20983–20992.

119. Kozlov SA, Vassilevski AA, Grishin EV (2008) Antimicrobial peptide precursor structures suggest effective production strategies. Recent Pat Inﬂamm Allergy Drug Discov 2: 58–63

120. Krogstad DJ (1996) Malaria as a reemerging disease. Epidemiol Rev 18: 77–89.

121. Kuhn-Nentwig L, Stocklin R, Nentwig W (2011) Venom composition and strategies in spiders: is everything possible? Adv Insect Physiol 40: 1–86.

122. Lauzon HA, Garcia-Maruniak A, Zanotto PM, Clemente JC, Herniou EA, Lucarotti CJ, Arif BM, Maruniak, JE (2006) Genomic comparison of Neodiprion sertifer and Neodiprion lecontei nucleopolyhedroviruses and identification of potential hymenopteran baculovirus-specific open reading frames. J Gen Virol 87: 1477–1489.

123. Lawrence D (2007) Chinese develop taste for organic food: Higher cost no barrier to safer eating. Bloomberg News, International Herald Tribune. 11: 155–159.

124. Lazarev V N, Shkarupeta MM, Titova GA, Kostrjukova ES, Akopian TA, Govorun VM (2005) Effect of induced expression of an antimicrobial peptide melittin on Chlamydia trachomatis and Mycoplasma hominis infections in vivo. Biochem Biophys Res Commun 338: 946–950.

125. Lazarev VN , Govorun VM (2012) Cyto-insectotoxin1a from Lachesana tarabaevi spider venom inhibits Chlamydia trachomatis infection. Probiotics Antimicrob Proteins 4: 208–216.

126. Lazarev VN, Polin NF, Shkarupeta MM, Kostrjukova ES, Vassilevski AA, Kozlov SA, Grishin EV, Govorun VM (2011) Spider venom peptides for gene therapy of Chlamydia infection. Antimicrob Agents Chemother 55: 5367–5369.

127. Lazarev VN, Shkarupeta MM, Polina NF, Kostrjukova ES, Vassilevski AA, Kozlov SA, Grishin EV, Govorun VM (2013) Antimicrobial peptide from spider venom inhibits Chlamydia trachomatis infection at an early stage. Arch Microbiol 195: 173– 179.

128. Lee H S, Bae T, Lee J H, Kim DG, Oh YS, Jang Y et al. (2012) Rational drug repositioning guided by an integrated pharmacological network of protein, disease and drug. BMC Syst Biol 6: 80.

129. Lee S, Qu X, Chen W (1997) Insecticidal activity of a recombinant baculovirus containing an antisense c-myc fragment. J Gen Virol 78: 273-81.

130. Lehr P (2010) Biopesticides: The Global Market. BCC Research; Wellesley, MA, USA. p. 160.

131. Lehrer RI, Ganz T (1999) Antimicrobial peptides in mammalian and insect host defence. Curr Opin Immunol 11: 23–27.

132. Li H, Tang H, Harrison RL, Bonning BC (2007) Impact of a basement membrane- degrading protease on dissemination and secondary infection of Autographa californica multiple nucleopolyhedrovirus in Heliothis virescens (Fabricus). J Gen Virol 88: 1109-19.

133. Liang S (2008) Proteome and peptidome profiling of spider venoms. Expert Rev Proteomics 5: 731–746.

134. Liu Y, Chen Y, Chen J et al. (2013) A shark liver gene-derived active peptide expressed in the silkworm, Bombyx mori: preliminary studies for oral administration of the recombinant protein. Mar Drugs 11: 1492–1505.

135. Lo H-R, Chao Y-C (2004) Rapid titer determination of baculovirus by Quantitative Real-Time Polymerase Chain Reaction. Biotechnol Prog 20: 354–360.

136. Longnecker MP, Klebanoff MA, Zhou H, Brock JW (2001) Association between maternal serum concentration of the DDT metabolite DDE and preterm and small-for- gestational-age babies at birth. The Lancet 358: 110–114.

137. Lounibos LP (2002) Invasions by insect vectors of human disease. Annu Rev Entomol 47: 233–266.

138. Ma PWK, Roelofs WL, Jurenka RA (1996) Characterization of PBAN and PBAN-

encoding gene neuropeptides in the central nervous system of the corn earworm moth, Helicoverpa zea. J Insect Physiol 42: 257–266.

139. Maeda S (1989) Increased insecticidal effect by a recombinant baculovirus carrying a synthetic diuretic hormone gene. Biochem Biophysic Res Comm 165: 1177–1183.

140. Maeda S, Mukohara Y, Kondo A (1990) Characteristically distinct isolates of the nuclear polyhedrosis virus from Spodoptera litura. J Gen Virol 71: 2631–2639.

141. Maeda S, Volrath S, Hanzlik TN, Harper SA, Majima K, Maddox DW, Hammock BD, Fowler E (1991) Insecticidal effects of an insect-specific neurotoxin expressed by a recombinant baculovirus. Virology 184: 777–780.

142. McCutchen BF, Hoove K, Preisler HK, Betana MD et al. (1997) Interaction of recombinant and wild-type baculoviruses with classical insecticides and pyrethroid- resistant tobacco budworm (Lepidoptera: Noctuidae). J Econ Entomol 90: 1170-1180.

143. McCutchen BF, Choudary PV, Crenshaw R (1991) Development of a recombinant baculovirus expressing an insect-selective neurotoxin: potential for pest control. Biotechnology 9: 848-852.

144. Martens JWM, Honee G, Zuidema D, Lent JWMV, Visser B, Vlak JM (1990) Insecticidal activity of a bacterial crystal protein expressed by a recombinant baculovirus in insect cells. Appl Environ Microbiol 56: 2764–2770.

145. Martens, J, Knoester, M, Weijts, F, Groffen, S, Hu ,Z, Bosch D, Vlack, J (1995) Characterization of baculovirus insecticides expressing tailored Bacillus thuringiensis Cry1A9b) crystal proteins. J Invertebr Pathol 66: 249-57.

146. Martignoni ME, Iwai PJ (1986) A Catalog of Viral Diseases of Insects, Mites and Ticks. USDA Forest Service PNW-195. USGPO: Washington, DC.

147. Mascarelli A (2013) Growing up with pesticides. Science 341: 740-741.

148. Mayachiew P, Devahastin S, Mackey BM, Niranjan K (2010) Effects of drying methods and conditions on antimicrobial activity of edible chitosan films enriched with galangal extract. Food Res Int 43: 125–132.

149. McCaffery AR (1998) Resistance to insecticides in heliothine Lepidoptera: a global view. Philos Trans R Soc Lond Ser B 353: 1735–1750.

150. Merrifield RB (1963) Solid phase peptide synthesis. The synthesis of a tetrapeptide. J

Am Chem Soc 85: 2149.

151. Miller GT (2004) Living in the Environment (12th Ed.). Belmont: Wadsworth/Thomson Learning, 2002. Inc. Pacific Grove, California, USA.

152. Mintz IM, Bean BP (1993) Block of calcium channels in rat neurons by synthetic omega-Aga-IVA. Neuropharmacology 32: 1161–1169.

153. Mintz IM (1994) Block of Ca channels in rat central neurons by the spider toxin omega-Aga-IIIA. J Neurosci 14: 2844–2853.

154. Morrison RP (2003) New insights into a persistent problem — chlamydial infections. J Clin Invest 111: 1647–1649.

155. Moscardi F (1989) Use of viruses for pest control in brazil: The case of the nuclear polyhedrosis virus of the soybean caterpillar, Anticarsia gemmatalis. Memorias do Instituto Oswaldo Cruz, Rio de Janeiro 84: 51-56.

156. Moscardi F (1999) Assessment of the application of baculovirus for control of lepidoptera. Ann Rev Entomol 44: 257-289.

157. Moscardi F, Sosa-Gomez DR (1993) A case study in Biological control: soybean defoliating caterpillars in Brazil, in 1st International Crop Science Congress. Crop Science Society of America, Inc.: Madison, WI.

158. Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Javis AW (1995) Virus taxonomy. In 6th Rep. Int. Comm. Taxon. Viruses. New York: Springer-Verlag; pp. 110–113.

159. Nakasu EYT, Williamson SM, Edwards MG et al. (2014) Novel biopesticide based on a spider venom peptide shows no adverse effects on honeybees. Proc Biol Sci 281:pii: 20140619 10.1098/rspb.2014.0619.

160. Nauen R (2007) Insecticide resistance in disease vectors of public health importance. Pest Manag Sci 63: 628–633.

161. Nauen R, Bretschneider T (2002) New modes of action of insecticides. Pestic Outlook 13: 241–245.

162. Nicholson GM (2007) Fighting the global pest problem: Preface to the special Toxicon issue on insecticidal toxins and their potential for insect pest control. Toxicon 49: 413–422.

163. Novotny V, Basset Y, Miller SE, Weiblen GD, Bremer B, Cizek L, Drozd P (2002) Low host specificity of herbivorous insects in a tropical forest. Nature 416: 841–844.

164. Nusawardani T, RubersonJR, Obrycki JJ, Bonning BC (2005) EVects of a protease- expressing recombinant baculovirus insecticide on the parasitoid Cotesia marginiventris (Cresson). Biological Control 35: 46–54

165. Ødegaard F (2000) How many species of arthropods? Erwin’s estimate revised. Biol J Linn Soc 71: 583–597.

166. Oerke E, Dehne H (2004) Safeguarding production-losses in major crops and the role of crop protection. Crop Prot 23: 275–285.

167. Oerke EC (2006) Crop losses to pests. J Agric Sci 144: 31–43.

168. Oomens AG, Blissard GW. 1999. Requirement for GP64 to drive efficient budding of Autographa californica multicapsid nucleopolyhedrovirus. Virology 254: 297–314.

169. O'Reilly DR, Miller LK (1991) Improvement of a baculovirus pesticide by deletion of the egt gene. Nature Biotechnol 9: 1086–1089.

170. Osman G (2012) Detection, cloning and bioinformatics analysis of vip1/vip2 genes from local bax\cillus thuringiensis. Afr J Biotechnol 15: 11678-11685.

171. Palaniyandi M, Kato T, Park EY (2013) Expression of human papillomavirus 6b L1 protein in silkworm larvae and enhanced green fluorescent protein displaying on its virus-like particles. SpringerPlus 1: 29.

172. Park EY, Kageshima A, Kwon MS, Kato T (2007) Enhanced production of secretory beta1,3-N-acetylglucosaminyltransferase 2 fusion protein into hemolymph of Bombyx mori larvae using recombinant BmNPV bacmid integrated signal sequence. J Biotechnol 129: 681–688.

173. Peters BM, Shirtliff ME, Jabra-Rizk MA (2010) Antimicrobial Peptides: Primeval Molecules or Future Drugs? PLoS Pathog 6: e1001067. doi:10.1371/journal.ppat.1001067.

174. Petrik DT, Iseli A, Montelone BA et al. (2003) Improving baculovirus resistance to UV inactivation: increased virulence resulting from expression of a DNA repair enzyme. J Invertebr Pathol 82: 50–56.

175. Phillips TW, Throne JE (2010) Biorational approaches to managing stored-product

insects. Annu Rev Entomol 55: 375–397.

176. Pimentel D (1997) Environmental and socio-economic costs of pesticide use. In: Pimentel D editor. Techniques for reducing pesticide use: environmental and economic benefits. Chichester, UK: John Wiley & Sons. pp. 51–78.

177. Pimentel D (2005) Environmental and economic costs of the application of pesticides primarily in the United States. Environ Dev Sustain 7: 229–252.

178. Pimentel D (2009) Environmental and economic costs of the application of pesticides primarily in the United States. In: Peshin R, Dhawan AK editors. Integrated pest management: innovation-development process. New York: Springer-Verlag. pp. 89– 111.

179. Platnick NI (2012) American Museum of Natural History [(accessed on 20 March 2012)]. The world spider catalog, version 12.0. Available online: http://research.amnh.org/iz/spiders/catalog.

180. Polina NF, Shkarupeta MM, Popenko AS, Vassilevski AA, Kozlov SA, Grishin EV, Lazarev VN, Govorun VM (2012) Cyto-insectotoxin1a from Lachesana tarabaevi spider venom inhibits Chlamydia trachomatis infection. Probiotics Antimicrob Proteins 4: 208–216.

181. Popham HJR, Miller LK (1997) Genetic improvement of Helicoverpa zea nuclear polyhedrosis virus as a biopesticide. Biol Control 10: 83–91.

182. Prikhodko GG, Robson M, Warmke JW et al. (1996) Properties of three baculovirus- expressing genes that encode insect-selective toxins: Mu-Aga-IV, As II, and SH I. Biological Control 7: 236–244.

183. Priyadarshi A, Khuder SA, Schaub EA, Shrivastava S (2000) A meta-analysis of Parkinson’s disease and exposure to pesticides. Neurotoxicology 21: 435–440.

184. Quistad GB, Skinner WS (1994) Isolation and sequencing of insecticidal peptides from the primitive hunting spider, Plectreurys tristis (Simon). J Biol Chem 269: 11098–11101.

185. Ramos R, Moreira S, Rodrigues A, Gama M, Domingues L (2013) Recombinant expression and purification of the antimicrobial peptide Magainin-2. Biotechnol Prog 29: 17–22.

186. Rash LD, Hodgson WC (2002) Pharmacology and biochemistry of spider venoms. Toxicon 40: 225–254.

187. Regev A, Eivkin H, Inceoglu B et al. (2003) Further enhancement of baculovirus insecticidal efficacy with scorpiontoxins that interact cooperatively. FEBS Lett 537: 106-110.

188. Reynolds P1, Von Behren J, Gunier RB, Goldberg DE, Hertz A et al. (2002) Childhood cancer and agricultural pesticide use: an ecologic study in California. Environ Health Perspect 110: 319-324.

189. Rogan WJ1, Ragan NB (2007) Some evidence of effects of environmental chemicals on the endocrine system in children. Int J Hyg Environ Health 210: 659-667.

190. Rohrback DH, Rohrback DT (1993) Molecular and cellular aspects of basement membranes. Academic Press, New York.

191. Rohrman G (2013) Baculoviruses as insecticides: Three examples in baculovirus molecular biology. Third Edition. http://www.ncbi.nlm.nih.gov/books/NBK138299.

192. Sammons JD, Gross AK (2013) Biochemical analysis of arhodopsin photoactivatable GFP fusion as a model of G-protein coupled receptor transport. Vision Res 93: 43–48.

193. Sanborn M, Kerr KJ, Sanin LH, Cole DC, Bassil KL, Vakil C (2007) Non-cancer health effects of pesticides: systematic review and implications for family doctors. Canadian Family Physician 53: 1712-1720.

194. Sanguinetti MC, Johnson JH, Hammerland LG, Kelbaugh PR, Volkmann RA, Saccomano NA, Muelle AI (1997) Heteropodatoxins: peptides isolated from spider venom that block Kv4.2 potassium channels. Mol Pharmacol 51: 491–498.

195. Sattelle DB, Cordova D, Cheek TR (2008) Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invert Neurosci 8: 107–119.

196. Schofield C, Kabayo JP (2008) Trypanosomiasis vector control in Africa and Latin America. Parasites Vectors 1: 1–7.

197. Science Magazine (2013) Infographic: Pesticide planet. Science 341 (6147): 730–731.

198. Semchuk KM, Love EJ, Lee RG (1992) Parkinson’s disease and exposure to agricultural work and pesticide chemicals. Neurology 42: 1328–1335.

199. Senn L, Hammerschlag MR, Greub G (2005) Therapeutic approaches to Chlamydia

infections. Expert Opin Pharmacother 6: 2281–2290.

200. Sherer TB, Kim JH, Betarbet R, Greenamyre JT (2003) Subcutaneous rotenone exposure causes highly selective dopaminergic degeneration and α-synuclein aggregation. Exp Neurol 179: 9–16.

201. Shim HJ, Cho JY, Wang Y, Tao XY, Liu Q, Roh JY, Kim JS, Kim WJ, Woo SW, Jin BR, Je YH (2013) NeuroBactrus, a novel, highly effective, and environmentally friendly recombinant baculovirus insecticide. Appl Environm Microbiol 79: 141–149.

202. Slack J, Arif BM (2007) The baculoviruses occlusion-derived virus: virion structure and function. Adv Virus Res 69: 99–165.

203. Smith GE, Vlak JM, Summers MD (1983) Physical analysis of Autographa californica nuclear polyhedrosis virus transcripts for polyhedrin and 10,000- molecular-weight protein. J Virol 45: 215–225.

204. Sollod BL, Wilson DT, Zhaxybayeva O, Gogarten JP, Drinkwater R, King GF (2005) Were arachnids the first to use combinatorial peptide libraries? Peptides 26: 131–139.

205. Steinhaus EA (1956) Microbical control-the emergence of an idea. Hilgardia 26: 107- 60.

206. Stewart LMD, Hirst M, Ferber ML, Weather ATM, Cayley PJ, Possee RD (1991) Construction of an improved baculovirus insecticide containing an insect-specific toxin gene. Nature 352: 85–88.

207. Sun X, Peng H (2007) Recent advances in biological control of pest insects by using viruses in China. Virolog Sinica 22: 158-162.

208. Szewczyk B, Hoyos-Carvajal L, Paluszek M, Skrzecz W, de Souza M (2006). Baculoviruses—re-emerging biopesticides. Biotechnol Adv 24: 143–160.

209. Tedford HW, Sollod BL, Maggio F, King GF (2004) Australian funnel-web spiders: master insecticide chemists. Toxicon 43: 601–618.

210. Thakore Y (2006) The new biopesticide market. BCC Research; Wellesley, MA, USA. p. 168.

211. Tomalski MD, Bruce WA, Travis J, Blum MS (1998) Preliminary characterization of toxins from the straw itch mite, Pyemotes tritici, which induce paralysis in the larvae of a moth. Toxicon 26: 127–132.

212. Tomalski MD, Miller LK (1991) Insect paralysis by baculovirus mediated expression of a mite neurotoxin gene. Nature 352: 82-85.

213. Tomita M (2011) Transgenic silkworms that weave recombinant proteins in silk cocoons. Biotechnol Lett. 33: 645-654.

214. US EPA (2015) Chemicals Evaluated for Carcinogenic Potential. Available: http://www.epa.gov/pesticides/carlist/ [accessed 20 June 2013].

215. USEPA (2007) EPA's 2007 Report on the environment: science report (SAB review draft). Available in http://cfpub.epa.gov/ncea/cfm/recordisplay.cfm?deid=140917

216. Valery PC1, McWhirter W, Sleigh A, Williams G, Bain C (2002) Farm exposures, parental occupation, and risk of Ewing's sarcoma in Australia: a national case-control study. Cancer Causes Control 13: 263-270.

217. Vandenabeele P, Galluzzi L, Vanden BT, Kroemer G (2010) Molecular mechanisms of necroptosis: an ordered cellular explosion. Nat Rev Mol Cell Biol 11: 700–714.

218. Vassilevski AA, Kozlov SA, Grishin EV (2009) Molecular diversity of spider venom. Biochemistry (Mosc) 74: 1505–1534.

219. Vassilevski AA, Kozlov SA, Samsonova OA, Egorova NS, Karpunin DV, Pluzhninkov KA, Feofanov AV, Grishin EV (2008) Cyto-insectotoxins, a novel class of cytolytic and insecticidal peptides from siper venom. Biochem J 411: 687–696.

220. Ventura S, Villaverde A (2006) Protein quality in bacterial inclusion bodies. Trends Biotechnol 24: 179–185.

221. Vorontsova OV, Egorova NS, Arseniev AS, Feofanov AV (2011) Haemolytic and cytotoxic action of latarcin Ltc2a. Biochimie 93: 227–241.

222. Wang G, Li X, Wang Z (2009) APD2: the updated antimicrobial peptide database and its application in peptide design. Nucleic Acids Res 37: D933-D937.

223. Wang Q, Zhu F, Xin Y, Liu J, Luo L, Yin Z (2011) Expression and purification of antimicrobial peptide buforin IIb in Escherichia coli. Biotechnol Lett 33: 2121–2126.

224. Wang R, Deng F, Hou D, Zhao Y, Guo L, Wang H, Hu Z (2010) Proteomics of the Autographa californica nucleopolyhedrovirus budded virions. J Virol 84: 7233–7242.

225. Wang Z, Wang G (2004) APD: the antimicrobial peptide database. Nucleic Acids Res 32: D590-D592.

226. WHO (2014) WHO’s first global report on antibiotic resistance reveals serious, worldwide threat to public health. Accessed on 30 April 2014. http://www.who.int/mediacentre/news/releases/2014/amr-report/en/.

227. WHO (1992) Vector resistance to insecticides. 15th Report of the WHO Expert Committee on Vector Biology and Control. World Health Org Tech Rep Ser 818: 1– 62.

228. Wilkins TD, Thiel T (1973) Modified broth-disk method for testing the antibiotic susceptibility of anaerobic bacteria. Antimicrob Agents Chemother 3: 350–356.

229. Windley MJ, Herzig V, Dziemborowicz SA, Hardy MC, King GF, Nicholson GM (2012) Speder-venom peptides as bioinsecticides. Toxins (Basel) 4: 191-227.

230. Wratten SD (2009) Conservation biological control and biopesticides in agriculture. In: Jorgensen SE editor. Applications in Ecological Engineering. Elsevier Academic Press; Maryland Heights, MO, USA: 2009. pp. 130–134.

231. Wright, GD (2007) The antibiotic resistome: the nexus of chemical and genetic diversity. Nat Rev Microbiol 5: 175–186.

232. Yan L, Adams ME (1998) Lycotoxins, antimicrobial peptides from venom of the wolf spider Lycosa carolinensis. J Biol Chem 273: 2059–2066.

233. Yasin B, Harwig SL, Lehrer RI, Wagar EA (1996) Susceptibility of Chlamydia trachomatis to protegrins and defensins. Infect Immun 64: 709–713

234. Yeaman MR, Yount NY (2003) Mechanisms of antimicrobial peptide action and resistance. Pharmacol Rev 55: 27–55.

235. Yount NY, Yeaman MR (2012) Emerging themes and therapeutic prospects for anti- infective peptides. Annu Rev Pharmacol Toxicol 52: 337–360.

ACKNOWLEDGEMENT

Dedicated to my Beloved Father

ACKNOWLEDGEMENT

First of all, I would like to thank Almighty Allah for his blessings and for all the achievements in my life. I take this opportunity to express my deep sense of gratitude and indebtedness to my beloved Prof. Dr. Enoch Y. Park (Director, Research Institute of Green Science and Technology) and Assoc. Prof. Dr. Tatsuya Kato, for their guidance, teaching, support, as well as providing a wonderful environment for doing research in Shizuoka University. They have enlightened my life and both are unique in my heart. Their enthusiasm toward science and their knowledge, dedication, hard-work, and creativity are the landmarks for me to follow in life. I especially thank Prof. Dr. Enoch Y. Park for providing positions and a welcoming atmosphere for doing research in his lab. I would also like to thank for his assistance and guidance in getting my graduate career started on the right foot and providing me with the foundation for becoming a researcher.

I would like to thank all of my lab members (past and present). I would also like to thank the Shizuoka University Corporation Environmental Leaders Program (ELSU), the fellowship to proceed research and lead my daily life successfully in Shizuoka.

I would like to begin by thanking to my family members. I am grateful for their understanding and support on my choice to leave home for higher education. I always remember my parents who raised me with a love of science and supported me in all my pursuits. No words are sufficient to describe my father contribution to my life. Currently he is suffering from a serious disease. I can do nothing for him as I am in abroad to accomplish this job. I owe every bit of my existence to him. This dissertation is dedicated for his memory.

My grateful thanks and dedication to my wife Lajuk and daughter Farifta for their continuous support and patience.

The author 97