Genome-Wide Identification and Characterization of Notch Transcriptional Complex-Binding Sequence Paired Sites in Leukemia Cells

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Severson, Eric A. 2016. Genome-Wide Identification and Characterization of Notch Transcriptional Complex-Binding Sequence Paired Sites in Leukemia Cells. Master's thesis, Harvard Medical School.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42061442

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Genome-wide identification and characterization of Notch transcriptional complex-

binding sequence paired sites in leukemia cells

1,2 3 1 2 2 3 1 Severson EA , Arnett KL ,Wang HF , Zang C , Liu XS , Blacklow SC , Aster JC

1. BWH, Department of Pathology. 2. DFCI, Department of Biostatistics and Computational Biology. 3.

DFCI, Department of Cancer Biology.

Abstract Notch transcription complexes (NTCs) drive target gene expression by binding two distinct types of genomic response elements, NTC monomer sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and linked to rapid responses to Notch in a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that at least 16% of functional NTC binding sites are SPSs. While originally described in promoters, SPSs are present mainly in enhancers and contribute to regulation of both coding and non-coding RNAs. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in mammalian gene regulation.

Introduction Notch receptors participate in a highly conserved signaling pathway that regulates many aspects of development and cellular homeostasis in metazoans (for review, see (1)). Mammals have genes encoding four Notch receptors (NOTCH1-4) and four functional ligands (DLL1, DLL4, JAG1, and JAG2). Receptor activation is initiated upon binding of ligands expressed on neighboring cells, an event that triggers successive cleavages of Notch by ADAM metalloproteases and gamma secretase. The latter event releases the Notch intracellular domain (NICD) from the cell membrane, allowing NICD to traffic to the nucleus and form a Notch transcription complex (NTC) with the DNA binding protein RBPJ and coactivators of the MAML family. The NTC recruits other transcriptional regulators, such as p300 (2), LSD1 (3), and mediator (4), to upregulate transcription of target genes. Although the canonical elements of the Notch pathway are highly conserved, outcomes vary widely across cellular contexts, and inappropriate increases or decreases in Notch signaling are associated with several

1 developmental disorders and many human cancers (5, 6), emphasizing the importance of precise regulation of the timing and size of transcriptional responses to Notch activation. NTCs can activate target genes by binding to two different types of Notch response elements (NREs), monomeric sites containing single RBPJ binding sites (7, 8), and sequence- paired sites (SPSs) containing two RBPJ binding sites (9, 10). The DNA sequence requirements for binding of NTCs to monomeric sites have been characterized in vitro by studying the binding of fluorescently labeled RBPJ to an array containing all possible 8 base pair double-stranded DNA sequences in the presence and absence of other NTC components (11). This study revealed that the binding affinity and sequence preference of RBPJ was unaffected by the presence of other NTC components, and yielded protein binding microarray (PBM) “scores” for RBPJ binding to every possible 8-mer DNA sequence. By contrast, the DNA sequence requirements for binding of NTC dimers have been studied less extensively. DNA sequences containing two head-to-head RBPJ binding sites separated by spacer sequences of 15 to 17 base pairs are competent for binding of NTC dimers (9). The crystal structure of a NTC dimer bound to a SPS showed that RBPJ makes the same contacts with DNA in dimeric complexes as in monomeric complexes, and that NTC dimers are stabilized by homotypic contacts between residues on the convex face of the Notch ankyrin repeat (ANK) domain. Key residues at that interface include K1945, E1949, and R1984 (9). SPSs were described originally in promoter elements within the Drosophila enhancer of split [E(Spl)] locus and also are found in the promoters of vertebrate E(spl) homologs, such as Hes1 (12), Hes4, and Hes5 (9). The cooperative binding of NTCs to paired sites suggests that such elements serve to “tune” or sharpen transcriptional responses within a subset of Notch target genes. Indeed, prior work in Drosophila cell lines has shown that genes in the enhancer of split locus respond very rapidly to a pulse of activated Notch (13). We previously identified a set of NTC dimer-dependent target genes that contribute to the development of Notch-driven T- ALL in the mouse (14), and Castel et al. reported that 14% (22/158) of high confidence RBPJ sites identified by ChIP-Seq in murine C2C12 myoblasts have associated motifs resembling SPSs. These studies suggest that SPSs have a substantial role in regulating gene expression in mammalian cells, but to date genome-wide studies linking putative functional SPSs to gene expression have been lacking. Moreover, the SPS in the Hes5 promoter is “cryptic”, consisting of a high affinity RBPJ site paired with a site that fails to match the RBPJ binding consensus sequence (9), suggesting that SPSs may not be reliably identified by “sequence-gazing” alone. To fill these gaps in current knowledge, we first developed a fluorescence resonance energy transfer (FRET)-based assay using purified NTC components to quantitatively measure

2 NTC dimerization in the presence of defined DNA sequences. We determined that dimer formation on any particular DNA sequence was strongly correlated with the product of the PBM scores for the two potential RBPJ binding sites, providing a means to identify possible cryptic SPSs. Building on this work, we used an empiric predictive model for classifying NREs to identify high confidence SPSs in the human T-ALL cell line CUTLL1. To evaluate our model, we introduced a dimerization defective form of NICD, and noted a strong correlation between the presence (or absence) of SPSs in functional NREs and Notch dimerization-dependent (or independent) expression of flanking target genes. Altogether, we conservatively estimate that approximately 16% of functional NTC binding sites in CUTLL1 cells are SPSs, an estimate in line with experimental perturbations showing that approximately a third of genes that respond to Notch activation in CUTLL1 cells do so in a NTC dimer-dependent fashion. We also identified a set of long non-coding RNAs that are NTC dimer-dependent, including LUNAR1, which has been linked to regulation of IGFR1 (15), a potential therapeutic target in leukemias and other cancers. Relative to Drosophila, human leukemia cells contain a broader diversity of Notch- responsive gene regulatory elements, including enhancers with multiple SPSs or mixtures of SPSs and monomeric RBPJ binding sites. These observations indicate that SPSs are widely distributed in mammalian genomes and are associated with Notch-responsive gene regulatory elements with diverse architectures that regulate both coding and noncoding RNAs.

Results Identification of DNA sequences that support NTC dimerization using a fluorescent resonance energy transfer (FRET) assay. Using the structure of an NTC dimer on the Hes1 proximal promoter SPS as a model (Fig. 1A), we designed a FRET assay to monitor assembly of NTC dimers on 40 base pair duplex DNA oligonucleotides (Fig. 1B; see Materials and Methods). A FRET signal was generated only when DNA containing an SPS and all NTC components (Notch1, MAML, RBPJ) were present (Fig. 1C and 1D). Furthermore, the FRET signal was abrogated by the mutation R1984A (see Fig. 1A inset), which prevents NTC dimerization (Fig. S1A,B) and activation of transcription from reporter genes containing SPSs (Fig. S1B), yet has no effect on NICD activation of reporter genes containing monomeric NREs (Fig. S1A), as reported previously (9, 10). Using this FRET assay, we next tested a variety of DNA sequences for their ability to support NTC dimerization (Fig. 2A). First, we assessed the effect of DNA spacer length on NTC dimerization and observed that dimerization occurs only with DNAs containing spacer segments of 15-17 base pairs (Fig. 2B, Fig. S2). We then mutagenized the 5’ RBPJ binding site (site A)

3 alone and in combination with the 3’ RBPJ binding site (site B) to determine the effect of sequence variants on NTC dimerization, using both palindromic sequences with identical sites A and B (Fig. 2C) and non-palindromic sequences (Fig. 2D). Introduction of non-consensus RBPJ binding sites produced a broad range of FRET signals (Fig. 2C,D), suggesting that NTC dimerization on any particular DNA sequence differs as a continuous function of overall site affinity. To study the relationship between RBPJ binding affinity and dimerization in greater detail, we used biolayer inferometry to measure the affinity of RBPJ binding to a series of increasingly degenerate RBPJ binding motifs (Fig. S3A). As shown in Fig. S3B, NTC dimerization on palindromic DNAs containing pairs of these same sequences aligned head-to- head with 16 base pair spacers is highly correlated with the log Kd value for RBPJ binding to each sequence as a monomer, highlighting the cooperative nature of NTC dimerization on DNA.

SPSs are enriched in functional Notch response elements in the T-ALL cell line CUTLL1. NREs that regulate gene expression are characterized by rapid unloading and reloading of NTCs as cells are “toggled” between the Notch-off and Notch–on states (16). Such dynamic RBPJ/NOTCH1 binding sites are strongly associated with chromatin regions bearing acetylated histone H3K27 (H3K27ac) marks, are located predominantly in enhancers, and are spatially associated with genes whose expression is Notch-sensitive, suggesting that such sites regulate Notch target gene expression and thereby mediate Notch functions (16). CUTLL1 genomes also contain non-dynamic “static” RBPJ/NOTCH1 sites of uncertain function that show little change in apparent occupancy when cells are cycled between the Notch-on and -off state and are generally associated with Notch-insensitive genes (16). To determine the frequency of SPSs among RBPJ/NOTCH1 binding sites and test the idea that dynamic RBPJ/NICD1 sites are enriched for SPSs relative to static sites, 30 base pair-sequences immediately flanking dynamic and static RBPJ/NOTCH1 sites were surveyed for secondary RBPJ motifs using a position- weighted-matrix (PWM) motif score (17) (Fig. 3A). This revealed that secondary RBPJ sequence motifs are uniquely enriched adjacent to dynamic RBPJ/NOTCH1 binding sites (Fig. 3B). Moreover, the identified motifs possess the two key characteristics of SPSs, head-to-head orientation and separation by a 15-17 base pair spacer (Fig. 3B), in agreement with prior studies (9) and our FRET assay results (Fig. 1 and 2).

Predicting SPSs in functional Notch response elements in T-ALL cells. Although sequence scanning clearly indicated that functional NREs are enriched for likely SPSs, predicting which of these sites depend on NTC dimerization for function is problematic for

4 several reasons. The ability of DNA sequences to support NTC dimerization forms a continuum, without any clear cut-off to assign sequences to SPS and non-SPS classes (Fig. 2). Moreover, FRET signal in vitro correlates poorly with the total head-to-head PWM score (Fig. 4A), precluding the use of this score to predict dimerization on genomic sites. As an alternative, we used data for NTC binding to a protein binding microarray (PBM) containing all possible 8-mer DNA sequences (11) to produce a PBM score for each RBPJ site evaluated in the FRET dimerization assay. We noted that the PBM score of RBPJ binding site A multiplied by the PBM score of RBPJ binding site B (PBM(A) x PBM(B), henceforth referred to as the PBM product score) was highly correlated with FRET signal (Fig. 4B), in line with the cooperativity of NTC dimerization on SPSs. We then generated PBM product scores, assuming possible spacer lengths of 15 to 17 base pair spacers, for all dynamic RBPJ/NOTCH1 genomic binding sites in CUTLL1 cells. After generating a simulated data set using random sequences (Fig. 4C; see Materials and Methods for details), we set an empiric SPS false discovery rate (FDR) of <0.05 (Fig. 4D), and classified all NREs with PBM product scores exceeding this cutoff as high confidence SPSs. Of the 1179 dynamic RBPJ/NOTCH1 sites identified in our reanalyzed ChIP-Seq data sets from CUTLL1 cells, 994 are associated with high confidence RBPJ binding motifs (p<0.05), of which 160 (16%) contain high-confidence SPSs (p<0.05). The average NOTCH1 and RBPJ ChIP-Seq signals for predicted SPSs is greater than the signals seen at predicted monomeric sites, while the lowest signals are seen at dynamic sites that lack RBPJ motifs (Fig. 5A-5B). The latter may represent sites involved in looping interactions with true RBPJ/NOTCH1 binding sites. As is true of dynamic RBPJ/Notch1 binding sites generally in CUTLL1 cells (16), the majority of dynamic sites containing SPSs (86%) are located within distal enhancers (Fig. 5C-5D). The PBM product score also was used to calculate the spacer length that produces the maximal score for each high confidence genomic SPS. Of 160 SPSs, 65 (40.6%) have a maximal score with a spacer of 15 base pairs, 48 (30%) have a maximal score with a spacer of 16 base pairs, and 45 (28.1%) have a maximal score with a spacer of 17 base pairs. These results suggest that (as is true in vitro) genomic SPSs have DNA spacers that vary in length from 15-17 base pairs.

Contribution of dimeric NTC complexes to gene expression in T-ALL cells. Of the homotypic NICD1-NICD1 contacts that are required for NTC dimerization on SPSs, R1984 is particularly important, as an R1984A substitution severely impairs NTC dimerization on DNA and abrogates activation of transcription from reporter genes containing SPSs (Fig.

5 S1A,B) (9). Because the R1984A mutant retains the ability to activate reporter genes containing monomeric RBPJ sites (Fig. S1A,B) (9), it can be used to selectively perturb the expression of genes that depend upon NTC binding to SPSs. Thus, to determine the contribution of NTC dimerization to gene expression in T-ALL cells under steady-state “Notch-on” conditions, RNA- seq was performed on CUTLL1 cells transduced with: GFP, in the presence (i) or absence (ii) of GSI; iii) wild type NICD1, in the presence of GSI; or iv) R1984A NICD1, in the presence of GSI. Importantly, wild type NICD1 and R1984A NICD1 are expressed at comparable levels in transduced cells (Fig. 6A). Comparison of gene expression profiles obtained from cells expressing wild type NICD1 or the R1984A mutant identified two distinct classes of Notch- dependent genes (Fig. 6B), those whose expression is inhibited by GSI and rescued by both wild type NICD1 and R1984A mutant NICD1 (“dimer-independent genes”), and those whose expression is inhibited by GSI and rescued only by wild type NICD1 (“dimer-dependent genes”). Overall, 33% (105/316) of Notch-dependent genes were dimer-dependent (Fig. 6B). As previously noted in vitro (10), the R1984A NICD1 failed to bind stably in CUTLL1 cells to known SPSs, such as those in the promoters of HES1 and HES4, whereas association with predicted RBPJ/NOTCH1 binding sites, such as those in the IL7R and MYC enhancers, was comparable to that of wild type NICD1 (Fig. S1D-G), providing a mechanistic explanation for the observed under-expression of particular genes in cells expressing the R1984A mutant. To study the overall association of SPSs with Notch target genes, we relied on a previous observation showing that Notch-dependent genes tend to be found within the same CTCF-bounded regulatory domain as dynamic RBPJ-NICD1 binding sites (16). By extension, Notch-sensitive genes that are dimer-dependent should be preferentially located within CTCF regulatory domains that contain dynamic SPSs. Indeed, predicted SPSs and predicted monomeric RBPJ/NOTCH1 sites were significantly associated with dimer-dependent and dimer- independent genes, respectively (Fig. 6C, p < 5.2 x 10-4). Discrepant associations (dimer- independent genes associated with SPSs, and dimer-dependent genes associated with monomeric sites) likely have several bases. Most notably, some of the most robust Notch target genes that score as dimer-independent are associated with a mixture of predicted SPS and monomeric sites. Included among such genes is NRARP, which is regulated by a large 5’ enhancer element that contains 5 dynamic RBPJ/NOTCH1 sites (16), of which 3 are predicted to be monomeric sites and 2 are predicted to be SPSs. Presumably, in the experimental system used here NRARP expression can be stimulated maximally through binding of RBPJ/NOTCH1 to the monomeric sites alone. Overall, 7 of 11 dimer-independent genes that are associated with predicted SPSs are also associated with nearby predicted monomeric RBPJ/NOTCH1 sites.

6 Other discrepant associations may stem from stable expression of wild type or R1984A mutant NICD1, an approach that does not preclude indirect, secondary effects on gene expression. Speaking to this point, of 316 genes that are altered by wild type NICD1 expression (Fig. 6B), 60 (19%) entirely lack dynamic RBPJ/NOTCH1 binding sites within their home CTCF domain and are presumably affected indirectly by alterations in Notch signaling. Nevertheless, despite these limitations, our findings show that NTC dimerization on SPSs contributes significantly to the Notch-dependent program of gene expression in human T-ALL cells.

A subset of long intervening non-coding RNAs (lncRNAs) is NTC dimer-dependent. Recent studies have identified a number of long intervening non-coding RNAs (lncRNAs) that are Notch-regulated in T-ALL cells. Because dimer-dependent genes are enriched among genes in T-ALL cells that do not respond to the R1984A mutant, we reanalyzed our steady-state RNA-seq data using Trinity, a de novo transcriptome assembly method (18). Similar to coding genes, we identified two classes of Notch-sensitive lncRNAs, one NTC dimer-dependent and the other dimer-independent (Fig. 7A). In most cases these transcripts were expressed from genomic regions bearing the histone mark H3K27ac, which is typical of transcriptionally active regions (Fig. 7B). Notably, a substantial fraction of Notch-regulated lncRNAs is associated with Notch regulated enhancer elements, defined as enhancers that exhibit a significant change in H3K27ac upon Notch activation (Fig. 7C). Examples of enhancer-associated lncRNAs showing dimer-dependent expression include LUNAR1, a lncRNA encoded by a sequence lying 3’ of IGF1R that has been implicated in regulation of IGFR1 expression in T-ALL cells (15). In line with the model proposed by Trimarchi et al. (15), in which in which LUNAR1 loops to a Notch- dependent intronic enhancer and the IGFR1 promoter, expression of NICD1 R1984A leads to loss of expression of both IGFR1 and LUNAR1, despite the absence of RBPJ/NOTCH1 binding near the LUNAR1 TSS (Fig. 7D). We also identified another dimer-dependent lncRNA near the HES5 locus, which we named NDANR1 (Notch dimer-associated non-coding RNA1) (Fig. 7E). NDANR1 is located near two predicted SPSs, E1 and E2, found within a large 5’ enhancer region (>20kb) region (16). Unlike the arrangement in LUNAR1, the E2 SPS lies very close to the NDANR1 TSS. These analyses suggest that SPSs within distal enhancers can co-regulate associated genes and enhancer lncRNAs directly (as with HES5 and NDANR1) or indirectly through looping interactions (as with IGF1R and LUNAR1).

Discussion

7 We and others (10, 13) have hypothesized that cooperative dimerization of NTCs on SPSs serves to properly “tune” transcriptional responses to Notch signals, but understanding the role of SPSs has been limited by the lack of a robust method to identify SPSs genome-wide. Here, building on direct measures of binding of NTC dimers to DNA in purified systems, we provide a method for identifying likely SPSs in genome-wide data sets. Like Notch response elements generally, SPSs are often found in long-range enhancers and appear to regulate the expression of both coding and noncoding RNAs. Included among the latter are lncRNAs (such as LUNAR1 and NDANR1) that are associated with Notch-regulated enhancers, and others (such as LINC00461) that are “stand-alone” RNA transcripts of uncertain functional significance. These findings expand the known role of SPSs in regulation of mammalian gene expression, and lay the groundwork for assessing the role of this conserved class of Notch response element in other Notch-dependent systems. What remains to be determined is precisely how SPSs contribute to regulation of transcriptional responses to Notch. Prior work in fly cells has shown that E(spl) genes associated with promoter-localized SPSs respond very rapidly to Notch activation (13), leading to the suggestion that SPS-regulated genes are early responders, possibly at low Notch doses because of the cooperative binding of NTC dimers on SPSs. Here, we also note that SPSs on average have stronger RBPJ/NOTCH1 ChIP-Seq signals, suggesting that SPS-associated genes may also have larger or more sustained responses to Notch activation. However, linking specific response element architectures to the kinetics and size of response to Notch activation is complicated by the diversity of NREs that are found in mammalian cells. Most prior work has focused on the existence of genes with promoters containing one of two types of Notch response elements, SPSs and monomeric response elements. Our genome-wide analyses revealed many additional variations on these themes, including genes associated with multiple SPSs (e.g. HES5), multiple monomeric response elements (e.g. IL4), and mixtures of SPS and monomeric response elements, often within long-range enhancers (e.g., NRARP, DTX1, IL7R, MYC). Additional variation in response to a particular dose of Notch may be created by: i) differing affinities of individual RBPJ binding sites; ii) differences in the number of functional NTC binding sites; and iii) the presence of nearby cis-regulatory elements that cooperate with NTCs to drive transcription, such as putative regulatory lncRNAs. These variables are likely to yield a large range of responsiveness to Notch signals, which are normally balanced by feedback controls involving Hes family repressors (13, 19) and Notch inhibitors such as NRARP (20, 21) to enable precise regulation of the strength and duration of Notch responses. Of note, while SPSs are present in flies, they appear to be absent from worms, suggesting that SPSs

8 arose to permit more precise and varied responses to Notch signals in more complex multicellular animals. Another level of emerging complexity is reflected in cross-lineage and cross-species variation in the regulation of Notch target genes. We previously identified a cryptic dimeric SPS in the HES5 promoter (9), yet here in a genome-wide analysis we show that in T-ALL cells HES5 appears to be regulated by two enhancer-based 5’ SPSs. Similarly, our group and Ferrando’s group recently reported that in T-ALL cells and normal developing thymocytes Notch regulates MYC through a enhancer element located ~1.3Mb 3’ of the MYC gene body (22, 23), whereas Kieff’s group has shown that EBV-mediated upregulation of MYC in B cells appears to occur via a RBPJ binding site located ~500kb 5’ of the MYC gene body (24). In the mouse the T-cell specific 3’ Notch-dependent MYC enhancer contains a SPS that is absolutely required for Notch to regulate MYC transcription in T-ALL cells (23), and that the dimer-defective R1984A NICD1 mutant can neither drive murine T-ALL development or sustain the growth of murine T- ALL cells (14). However, the dimer-defective R1984A NICD1 mutant drives MYC expression in the human T-ALL cell line CUTLL1 and rescues these cells from blockade of endogenous Notch1 with GSI. This distinction apparently stems from the presence of several monomeric RBPJ binding sites in human MYC 3’ enhancer that are absent from the murine MYC 3’ enhancer. How these varied regulatory architectures contribute to physiologic Notch function in various contexts remains to be determined, but their importance in regulation of transcriptional outputs is emphasized by a recent report showing that human T-ALL often harbors duplications of the 3’ Notch-dependent MYC enhancer (22). It will be of interest to determine if alterations in Notch response elements underlie other human disease states.

Materials and Methods Protein expression and purification. The cysteine-free RAMANK (1760-2126) region of Notch1 containing the mutations C1890A and C1871A that assembles into NTC complexes like wild-type RAMANK was prepared as described (25). Single cysteine mutants (D1942C and H2018C) that permit incorporation were made by Quick Change mutagenesis. RAMANK- D1942C, RAMANK-H2018C, RAMANK-R1984A-D1942C, N1-RAMANK-R1984A-H2018C, CSL (9-435), and MAML (13-74) proteins were expressed and purified as described (26). RAMANK proteins were fluorescently labeled using AlexaFluor 546 C5-maleimide or AlexaFluor 488 C5- maleimide. RAMANK proteins (25 µM) in 20mM HEPES, pH 7.5, containing 150mM NaCl and 1mM TCEP was mixed with 1mM dye and incubated overnight at 4o C in the dark. Reactions

9 were quenched with β-mercaptoethanol. Excess dye was removed using a 30KDa centrifugal filter followed by size-exclusion chromatography.

FRET Assay. In the X-ray crystal structure of an NTC dimer bound to the SPS in the HES1 promoter, the DNA is bent and undertwisted compared to B-form DNA. A second model created by superimposing two NTCs on ideal B-form DNA was used as a hypothetical "open" conformation in which the two NTCs are not on the same DNA face. Two surface residues of RAMANK, D1942 and H2018, were chosen that are predicted i) to allow mutation to cysteine and fluorophore attachment without blocking complex assembly and ii) to be close together in the fully assembled NTC dimers and far apart in the theoretical "open" conformation. Specifically, the two D1942 residues are 14Å apart in the dimeric structure and 96 Å apart in the "open" model and are located on the surface of the ANK domain distal to the DNA-binding region of the NTC complex. The two copies of H2018 are 14Å apart in the dimeric X-ray structure and 61Å apart in the "open" conformation on B-form DNA, and are located on the surface of the ANK domain in the cavity between the ANK-ANK dimer interface and the DNA. Duplex DNA was generated by annealing complementary oligonucleotides at 100°C for 5 min and cooling slowly to room temperature. Complexes were assembled by combining fluorescently labeled RAMANK with untagged CSL, MAML and DNA in 20mM Tris pH 8.5, containing 150mM NaCl and 5mM EDTA. Assays were performed using a 1:1 mixture of D1942C-Alexa488 and D1942C-Alexa546, or with H2018-Alexa546 only. In mixtures of D1942C-Alexa488 and D1942C-Alexa546, loss of Alexa488 and gain of Alexa546 signal were coincident and energy transfer was measured as loss of Alexa488 signal (E= 1-F/Fo, where Fo is the fluorescence in the absence of DNA). In experiments using H2018-Alexa546, loss of Alexa

546 signal due to self-quenching was measured (E= 1-F/Fo).

Biolayer Interferometry. Dissociation constants for CSL and DNA were determined using a ForteBio Octet RED384 instrument. Biotinylated DNA duplexes at a concentration of 2µM were immobilized onto Steptavidin (SA) biosensors and CSL binding was measured at a range of concentrations between 0.01µM and 10µM. Kd values were determined using steady-state analysis and fit to the binding isotherm, R = Rmax*[CSL]/(Kd + [CSL]).

Cell culture. Human T-LL cell line CUTLL1 cells were maintained in RPMI1640 medium containing 10% fetal bovine serum and 1X penicillin-streptomycin-glutamine (PSG). Cells

10 transduced with NICD1 and R1984A were maintained in the presence of 1µM dibenzazepine (DBZ), a gamma-secretase inhibitor (GSI).

Retroviral packaging and transduction. Wild type NICD1 and dimer-defective R1984A mutant NICD1 cDNAs were cloned into the retrovirus vector MigR1 as described (14). Pseudotyped retrovius was produced by co-transfection of 293T cells with MigR1 and plasmids encoding VSV-G protein and gag-pol as described (27). CUTLL1 cells were infected with retroviruses by spinoculation as described (27). GFP-positive NICD1 or R1984A mutant NICD1 cells with equivalent GFP fluorescent intensities were isolated 2 days post-transduction using on a BD FACSaria flow-sorting instrument.

TruSeq stranded total RNA library preparation and RNAseq. Total RNA was extracted with the RNAeasy kit. After ribosomal RNA depletion, stranded RNA libraries were prepared following the TruSeq library preparation guide (Illunima # 15031048). Multiplexed RNAseq was performed using a HiSeq2000 instrument (Illumina).

RNAseq analysis. RNA-seq data were processed using TopHat and Cufflinks (Version 2.0.2) (28) with default parameters. RPKM levels for all annotated genes with official gene symbols were obtained from the Cufflinks output for each sample. Genes with RPKM > 0.5 in at least one of the 8 samples were used in differential expression analysis. A total of 10495 expressed genes were retained. Notch target genes were defined as concordant higher expression in DMSO than in GSI and concordant higher expression in NICD1-transduced cells treated with GSI in duplicate samples. Notch dimer-dependent genes were defined as Notch target genes showing concordant higher expression in NICD1-transduced cells treated with GSI than in R1984A mutant NICD1-transduced cells in duplicate samples. The significance of concordant high-ranked differential expression was determined based on the null hypothesis that the sum of the ranks of differential expression log fold-change follows the Irwin-Hall distribution. Notch- dependent genes were identified under a false discovery rate (FDR) cutoff of 0.01 and dimer- dependent genes were identified under a FDR cutoff of 0.05, both determined by the Benjamini- Hochberg procedure.

To identify and determine the expression of non-coding RNA transcripts, RNA-seq data from all samples were pooled together and processed using Trinity (29) with default parameters. Only non-coding transcripts (defined as transcripts that do not overlap with any annotated coding

11 exon in the human genome) with lengths >200 bp were retained in the candidate lncRNA pool. The low coding potential of lncRNAs was confirmed using CPAT (30). Only lncRNAs with an average RPKM >1 across all samples were retained, resulting in analysis of 12606 lncRNAs. Notch dimer-dependent and dimer-independent lncRNAs were identified with the same approaches used in analysis of coding genes.

RBPJ sequence motif analysis. RBPJ sequence motif hits (RBPJ consensus sequences) near dynamic NOTCH1/RBPJ binding sites were identified using FIMO (31). A 300 base pair region centered at the summit of each RBPJ/NOTCH1 ChIP-seq peak was screened and RBPJ sequence motif hits with an adjusted p value<0.05 were identified. A RBPJ sequence-motif scan was then performed in the flanking 30 base pair region in each of 4 potential RBPJ-RBPJ site orientations, head-to-head (HH), head-to-tail (HT), tail-to-head (TH), and tail-to-tail (TT). The RBPJ motif used for the screening and motif matching calculation was the position-weighted matrix (PWM) calculated using RBPJ protein binding microarray data in Del Bianco et al. (11).

Calculation of genomic PBM(A) x PBM(B) scores. Protein binding microarray data for RBPJ from Del Bianco et al. (11) was downloaded and enrichment scores were transformed from values of -0.5 to 0.5 to values of 0.0 to 1.0 by adding 0.5 to all scores. PBMa*PBMb scores were then generated for all 994 dynamic RBPJ/NOTCH1 sites bearing RBPJ motifs in CUTLL1 cells by multiplying the adjusted scores for each site A with the potential site B score, assuming that endogenous SPSs are strongly biased towards 16 bp spacers.

Random generation of PBM(A) x PBM(B) scores. The highest ranked RBPJ site in the 994 dynamic RBPJ/NOTCH1 ChIP-Seq peaks was determined by FIMO (31) and designated site A, while 1 million randomly generated 8-mers were used for site B. Each site A was then paired with each randomly generated site B to produce 9.94 x 108 PBM(A) x PBM(B) values.

ChIPseq analysis. Prior NOTCH1, RPBJ, and H3K27Ac data sets ((16), GEO accession GSE72175) were reanalyzed using BWA (32) after alignment to human genome build hg38 and uniquely mapped, non-redundant reads were retained. Genomic wiggle traces were generated using MACS2 (33) and were normalized by the total non-redundant read count of each dataset. ChIP-seq data processing was performed in R. Peaks with multiple summits greater than 150 base pairs apart were split in R, and dynamic peaks were determined as described (16). Further ChIP-seq data processing was performed in R. All ChIPseq and RNAseq data are

12 deposited in the Gene Expression Omnibus (GEO) under the accession numbers GSE51800 and GSE72175, respectively.

ChIP-seq peak to gene assignment. The ENCODE union of CTCF sites (as described in the methods of (16)) was used to associated ChIP-seq peaks and genes. If a peak was in the same CTCF domain as a gene, it was assigned to that gene. Individual peaks were assigned to all genes within a single CTCF domain.

CRISPR-Cas9-mediated targeted genome editing. Lentiviruses that co-express sgRNA and either Cas9-eGFP or Cas9-RFP657 were as described (34). sgRNA targeting SPS elements in the HES5 enhancer were cloned into these vectors, packaged into lentivirus, and used to transduce CUTLL1 cells as described (34). Cells expressing eGFP and/or RFP657 were isolated by flow sorting.

T7 Endonuclease I and sequencing assays for estimating CRISPR-Cas9 targeting efficiency. T7E1 assays were performed as described (35). Briefly, 100-200ng of PCR product spanning the targeted genomic region was denatured and annealed and then treated with T7E1 endonuclease I (New England Biolabs). Results of T7E1 digestion were visualized following electrophoresis on agarose gels. Mutations were confirmed by cloning PCR products generated from cells bearing successfully targeted genomic regions using the Blunt-end Topo Cloning Kit (Life Technologies) and sequencing of plasmid DNA isolated from individual colonies.

Single-cell clonal assay. CRISPR-Cas9-sgRNA expressing cells were sorted into 96-well plates at average densities of 1 cell/well and cultured for 3-4 weeks. Genomic DNA and RNA were extracted subsequently for genotyping and gene expression analysis.

Real-time RT-PCR. RNA was extracted with RNeasy kit (Qiagen) and cDNA was synthesized with a cDNA synthesis kit (BioRad). Real-time PCR was performed in triplicate in a CFX96 Touch™ Real-Time PCR Detection System instrument (Bio-Rad). Expression of HES1, HES4, IL7R, MYC, HES5 and noncoding RNA NDANR1 was analyzed with CFX manager software (BioRad). PCR primer sequences used to conduct RT-PCR are listed in the Supplemental Table 1.

13 Reporter Gene Assays. Notch reporter gene assays were carried out in transiently transfected U2OS cells as described (36).

14 Figure Legends Figure 1. Detection of dimerization of Notch transcription complexes on DNA by fluorescence resonance energy transfer (FRET) assay. (A) Structure of a Notch transcription complex (NTC) dimer bound to the HES1 proximal promoter sequence paired site (SPS). The inset shows the key ANK-ANK interface involving the residue R1984A. (B) Cartoon demonstrating the structural basis of the FRET-based NTC dimerization assay. (C) Wavelength scans for labeled NOTCH1 (N1) RAMANK (50:50 mix of RAMANK labeled with AlexaFluor-488 or AlexaFluor-546) in various combinations with purified RBPJ, MAML1 (MAML, residues 12-74), and DNA containing the HES1 SPS. FRET is only observed when all NTC components and DNA containing the SPS are present. (D) Quantitation of FRET. FRET is expressed as 1-F/Fo, where Fo is the fluorescence intensity in the absence of SPS DNA at the emission maxima for AlexaFluor-488.

Figure 2. Quantitation of NTC dimerization on various DNAs using FRET. (A) Example of DNA sequences used in dimerization assays. SPS-1 has paired head-to-head consensus RBPJ motifs separated by a spacer of 16 base pairs. SPS1-24 is an example of a DNA with a non-consensus site B sequence, while SPS-24 has non-consensus substitutions in both sites A and B. Here and in C, D, and E, non-consensus base substitutions are shown in lower case. (B) Effect of spacer length on NTC dimerization. Each DNA contains the two consensus RBPJ binding sites shown in SPS-1. (C) NTC dimerization on the indicated palindromic DNA sequences with 16 base pair spacers. (D) NTC dimerization on the indicated non-palindromic DNA sequences with 16 base pair spacers.

Figure 3: Identification of sequence-paired site motifs in the genomes of CUTLL1 cells. (A) Position Weighted Matrix (PWM) logo in the head to head orientation used for subsequent calculations. (B) Motif matching scores for secondary RBPJ sites oriented head-to-head (HH), head-to-tail (HT), tail-to-head (TH), and tail-to-tail (TT) calculated for all possible spacer lengths across a 30bp region flanking the best RBPJ consensus sequence associated with dynamic and non-dynamic NOTCH1 binding sites. *, 16 base pair spacer. (C) Heat map showing K-means clustering of RBPJ sequence motif matching scores generated for sequences flanking dynamic RBPJ binding sites in CUTLL1 cells. Each row represents a single high confidence dynamic RBPJ site, and each column represents the sequence motif matching score in flanking DNA for positions 1 to 30 base pairs from the primary RBPJ site.

15 Figure 4: Generation and application of a metric for identifying genomic sequence-paired sites. (A) Relationship between NTC dimerization measured by FRET and the sums of protein weight matrix (PWM) scores for RBPJ sites A and B. (B) Relationship between NTC dimerization measured by FRET and protein binding microarray (PBM) product scores (PBM(A) x PBM(B)) for RBPJ sites A and B. (C) Distribution of PBM product scores for dynamic RBPJ sites in 106 randomly generated DNA 8-mers and in CUTLL1 genomes for 994 dynamic RBPJ/NOTCH1 binding sites. (D) Distribution of PBM products scores for dynamic RBPJ sites in CUTLL1 genomes and flanking genomic sequences. The red line in C and D represents the cut-off for a false discovery rate (FDR) of 0.05.

Figure 5: Characteristics of high confidence sequence-paired sites in CUTLL1 cell genomes. (A) NOTCH1 and (B) RBPJ ChIP-seq signals for predicted SPSs, monomeric RBPJ sites, and dynamic ChIP-seq peaks lacking RBPJ consensus sequences. (C,D) Location of predicted dynamic RBPJ/NOTCH1 monomeric sites (C) and SPSs (D) relative to transcription start sites (TSS) and RBPJ and NOTCH1 ChIP-seq signal intensity.

Figure 6: Association of predicted sequence-paired sites and monomeric Notch response elements -dependent and -independent Notch target genes in CUTLL1 cells. (A) Expression levels of wild type NICD1 and R1984A mutant NICD1 in transduced cells. (B) Heat map of Notch-dependent coding RNA expression in CUTLL1 cells treated with vehicle (DMSO), GSI (1mM DBZ), or GSI following transduction with wild type NICD1 or dimer-defective R1984A mutant NICD1. Gene expression was determined by RNA sequencing in replicates as described in the Materials and Methods. (C) Notch dimer-dependent and –independent genes are associated with predicted sequence-paired sites and monomeric RBPJ/NOTCH1 sties, respectively. Notch regulated genes were assigned to predicted SPS or monomeric RBPJ/NOTCH1 binding sites if the putative regulatory element for the gene and the gene’s TSS fall within a region flanked by two Encode consensus CTCF sites, as described (16). Genes that are rescued by R1984A expression in the presence of GSI are more likely to be associated with predicted monomeric RBPJ/NOTCH1 binding sites than with SPSs (p<3.63 x 10-4 by Fisher Exact Test).

Figure 7: Role of NTC dimerization in regulating non-coding RNA expression.

16 (A) Heat map of non-coding RNA expression in CUTLL1 cells treated with vehicle (DMSO), GSI (1mM DBZ), or GSI following transduction with wild type NICD1 or the dimer-defective R1984A NICD1 mutant. (B) Association of Notch-dimer-dependent (top) and dimer-independent (bottom) noncoding RNAs with H3K27ac, a mark associated with “active” chromatin. (C) Notch-regulated long non-coding RNAs are enriched in dynamic NOTCH1-associated, H3K27ac-marked active chromatin. (D, E) Chromatin landscapes and RNA transcripts mapped by RNA-seq to genomic regions near the 3’ end of the IGFR1 gene and 5’ of the HES5 gene. NOTCH1 and H3K27ac tracks correspond to ChIP-Seq data obtained from cells i) treated with GSI for 3 days (Notch-off) or ii) 4 hr following GSI washout (Notch-on) (16), whereas RNA-seq tracks were obtained from cells treated with vehicle (DMSO) or treated with GSI following transduction with empty MigRI (GSI) or transduction with MigRI expressing wild type NICD1 or R1984A mutant NICD1. Mapped transcripts for the non-coding RNAs LUNAR1 and NDANR1 also are shown.

Figure S1: The dimerization-defective NOTCH1 mutant R1984A fails to activate transcription from a reporter gene containing a sequence-paired site and also fails to bind to predicted sequence-paired sites in cells. (A) Wavelength scans for labeled NOTCH1 R1984A-mutated RAMANK (50:50 mix of AlexaFluor-488 and AlexaFluor-546 labeled R1984A-N1-RAMANK) mixed in various combinations with purified RBPJ, MAML1 (MAML, residues 12-74), and DNA containing the HES1 SPS. (B, C) Firefly luciferase reporter gene assays conducted in transiently transfected U2OS cells with promoter elements containing the murine Hes1 SPS element (B) or iterated RBPJ consensus site in a head-to-tail orientation (C). U2OS cells also were co-transfected in triplicate with an internal Renilla luciferase control vector and either empty pcDNA3 plasmid or pcDNA3 plasmid expressing wild type NICD1 or NICD1 bearing a R1984A mutation that disrupts dimerization on SPSs. Normalized luciferase activity is expressed relative to empty vector control, the mean activity of which is set to 1. All determinations were made in triplicate; error bars correspond to standard errors of the mean. (D-G) Binding of wild type NICD1 and R1984A mutant NICD1 to the SPSs in the HES1 and HES4 promoters and the monomeric NREs in the IL7R and MYC enhancers. Binding was determined by local ChIP followed by quantitative PCR in triplicate. Error bars correspond to standard errors of the mean. The negative control is a region of inactive chromatin near MYC (16).

Figure S2: Palindromic sequences used to assess the effect of spacer length on NTC dimerization.

17 Figure S3. RBPJ binding affinity for DNA correlates with FRET efficiency. (A) Biolayer interferometry measurements of RBPJ binding to DNA. Dissociation constants (Kd) are derived from a fit to the binding isotherm using a 1:1 binding model. (B) Correlation between the single site dissociation constant and the corresponding normalized FRET signal for palindromic SPS elements.

18 Supplementary Table 1. RT-qPCR primers.

GAPDH F GAAGGTGAAGGTCGGAGTCAAC GAPDH R TGGAAGATGGTGATGGGATTTC HES1 F ATAGCTCGCGGCATTC HES1 R AGGTGCTTCACTGTCATTTC MYC F ACCACCAGCAGCGACTCTGA MYC R TCCAGCAGAAGGTGATCCAGACT DTX1 F TCCCGGTGAAGAACTTGAATG MYC R ACAGCAGTATCCCGGTCAT HES4 F CCTGGAGATGACCGTGAGACA HES4 R TACTTGCCCAGAACGGCG HES5 F TGCACCAGGACTACAGCG HES5 R GCGTGGAGCGTCAGGAACT NRARP F GAGCTGTCCACCTGCTCCG NRARP R TCACGTTGAACTCGCAGTTGG IL7R F TTTCCCAGCAATAGGCGCAAGGTA IL7R R AGAGAAGTGAAAGCGAAGCTCCCA NDANR1 F CGTTTCCTGTTCTGTCCCCA NDANR1 R CCACCTTTCTGCTCTCCCTG

19 Supplemental Table 2. ChIP-qPCR primers. HES1 F CGTGTCTCCTCCTCCCATT HES1 R GGCCTCTATATATATCTGGGACTGC HES4 F GGTGTGTGAACCCGGCTCCG HES4 R CCGAGGCGTGACTGACAGCG IL7R peak1 F CAAGCCAGGTTGTTCAGACA IL7R peak1 R CACTTCACCCCACCCTATTG MYC 3'E F TCCCAGGTTAAAAACCCAGAA C MYC 3'E R AGCTCACAGCTGGCCTGATAC Negative region F AATGCTGGGCTTCCAAGGA Negative region R GACCTTGGTGACTGTTGAGGAAAC HES5 E2 F CAGGTCAGGTGGTCGGAAAG HES5 E2 R CAGGGAGAGCAGAAAGGTGG

Supplemental Table3: SPS sites in Notch1 ChIP-seq peaks. chr1 1000002 1000302 chr1 4356088 4356388 chr1 9125408 9125708 chr1 9420401 9420701 chr1 23995400 23995700 chr1 27632759 27633059 chr1 42240955 42241255 chr1 57082275 57082575 chr1 111215783 111216083 chr1 152038444 152038744 chr1 158333872 158334172 chr1 199176798 199177098 chr1 203296439 203296739 chr1 207459126 207459426 chr1 229141818 229142118 chr1 230124708 230125008 chr1 235297671 235297971 chr1 235883377 235883677 chr10 13700545 13700845 chr10 34869589 34869889 chr10 52216928 52217228 chr10 69353942 69354242 chr10 72297278 72297578 chr10 90947125 90947425 chr10 91186875 91187175

20 chr10 102718301 102718601 chr10 124657926 124658226 chr11 47002023 47002323 chr11 111414381 111414681 chr11 112321750 112322050 chr11 118316727 118317027 chr11 118692668 118692968 chr11 122743979 122744279 chr11 128525555 128525855 chr12 6426893 6427193 chr12 57027863 57028163 chr12 57047184 57047484 chr12 65822855 65823155 chr12 96401367 96401667 chr12 108334224 108334524 chr12 113086862 113087162 chr12 113089457 113089757 chr12 113208513 113208813 chr12 116559450 116559750 chr12 123134878 123135178 chr12 124221340 124221640 chr12 128549359 128549659 chr12 129079764 129080064 chr12 129712994 129713294 chr13 44352731 44353031 chr13 111051911 111052211 chr13 111178114 111178414 chr14 22435325 22435625 chr14 57485698 57485998 chr14 94823994 94824294 chr15 74387178 74387478 chr15 74400838 74401138 chr15 90530352 90530652 chr15 98952584 98952884 chr16 12092602 12092902 chr16 89026093 89026393 chr17 3963390 3963690 chr17 29674380 29674680 chr17 39172235 39172535 chr17 42312612 42312912 chr17 50360919 50361219

21 chr17 56296694 56296994 chr17 57454913 57455213 chr17 74478678 74478978 chr17 74480447 74480747 chr17 82884933 82885233 chr17 82908058 82908358 chr18 13569056 13569356 chr18 78414379 78414679 chr19 3155103 3155403 chr19 4638392 4638692 chr19 9562466 9562766 chr19 10604163 10604463 chr19 12965426 12965726 chr19 15195663 15195963 chr19 43754528 43754828 chr19 57651265 57651565 chr2 10120190 10120490 chr2 42105428 42105728 chr2 62213447 62213747 chr2 70010044 70010344 chr2 88755010 88755310 chr2 98549140 98549440 chr2 100655900 100656200 chr2 101440168 101440468 chr2 112156748 112157048 chr2 114293463 114293763 chr2 114389399 114389699 chr2 120013529 120013829 chr2 127586869 127587169 chr2 127615834 127616134 chr2 128414102 128414402 chr2 218877347 218877647 chr2 233076657 233076957 chr2 240151019 240151319 chr2 240155102 240155402 chr20 3811582 3811882 chr20 24742713 24743013 chr20 60215160 60215460 chr21 35100353 35100653 chr21 45588812 45589112 chr22 19419723 19420023

22 chr22 20100538 20100838 chr22 26579372 26579672 chr22 44633099 44633399 chr22 44955210 44955510 chr3 6737650 6737950 chr3 16483367 16483667 chr3 22458560 22458860 chr3 27575500 27575800 chr3 32684993 32685293 chr3 35276720 35277020 chr3 45498078 45498378 chr3 45915897 45916197 chr3 112115300 112115600 chr3 141108062 141108362 chr3 160837656 160837956 chr3 165768849 165769149 chr3 173425031 173425331 chr3 194135948 194136248 chr3 196503590 196503890 chr4 26319465 26319765 chr4 53688242 53688542 chr4 108159836 108160136 chr4 117983687 117983987 chr4 128295701 128296001 chr4 153522048 153522348 chr5 67181830 67182130 chr5 88665755 88666055 chr5 101791479 101791779 chr5 142420534 142420834 chr6 24779496 24779796 chr6 44000619 44000919 chr6 150815123 150815423 chr6 158653624 158653924 chr6 165841387 165841687 chr7 44178481 44178781 chr7 73420123 73420423 chr7 125244906 125245206 chr7 130310038 130310338 chr7 149147215 149147515 chr8 3080024 3080324 chr8 11768909 11769209

23 chr8 124299746 124300046 chr8 130045639 130045939 chr8 134381271 134381571 chr9 20984150 20984450 chr9 105039130 105039430 chr9 105128005 105128305 chr9 128293177 128293477 chr9 136599775 136600075 chr9 137305082 137305382 chrX 5042619 5042919 chrX 18856162 18856462 chrY 9993272 9993572

Supplemental Table 4: Monomeric sites in Notch1 ChIP-seq peaks. chr1 1213465 1213765 chr1 2205479 2205779 chr1 3032992 3033292 chr1 4421332 4421632 chr1 4422487 4422787 chr1 4495935 4496235 chr1 4512479 4512779 chr1 6359750 6360050 chr1 6414360 6414660 chr1 9629426 9629726 chr1 11355343 11355643 chr1 11407341 11407641 chr1 12340558 12340858 chr1 16151526 16151826 chr1 25009694 25009994 chr1 25010804 25011104 chr1 25022831 25023131 chr1 26620196 26620496 chr1 27660054 27660354 chr1 31587770 31588070 chr1 31928815 31929115 chr1 31929812 31930112 chr1 32273943 32274243 chr1 38785677 38785977 chr1 41868490 41868790 chr1 41882088 41882388 chr1 53047983 53048283

24 chr1 53341097 53341397 chr1 56106617 56106917 chr1 67557713 67558013 chr1 67732895 67733195 chr1 71733193 71733493 chr1 83701356 83701656 chr1 83790377 83790677 chr1 91021951 91022251 chr1 94950051 94950351 chr1 101371214 101371514 chr1 101388760 101389060 chr1 101407729 101408029 chr1 110555303 110555603 chr1 110636166 110636466 chr1 111221730 111222030 chr1 111226096 111226396 chr1 115670799 115671099 chr1 117615558 117615858 chr1 158334654 158334954 chr1 158398741 158399041 chr1 158399261 158399561 chr1 160838961 160839261 chr1 161399590 161399890 chr1 165851097 165851397 chr1 167110634 167110934 chr1 181430362 181430662 chr1 186375146 186375446 chr1 199031202 199031502 chr1 199041548 199041848 chr1 199282942 199283242 chr1 199284021 199284321 chr1 201308151 201308451 chr1 201310338 201310638 chr1 201310674 201310974 chr1 201311422 201311722 chr1 207071410 207071710 chr1 207869033 207869333 chr1 209220215 209220515 chr1 210394434 210394734 chr1 212158889 212159189 chr1 223190382 223190682

25 chr1 223301446 223301746 chr1 223323835 223324135 chr1 225848597 225848897 chr1 230109888 230110188 chr1 230280946 230281246 chr1 235931205 235931505 chr1 235932101 235932401 chr1 235946743 235947043 chr1 239719732 239720032 chr1 244047990 244048290 chr10 317314 317614 chr10 338707 339007 chr10 368116 368416 chr10 375069 375369 chr10 422305 422605 chr10 1532227 1532527 chr10 2920792 2921092 chr10 3430562 3430862 chr10 3741830 3742130 chr10 6678194 6678494 chr10 7163168 7163468 chr10 7601127 7601427 chr10 7984918 7985218 chr10 8332350 8332650 chr10 8353934 8354234 chr10 22320748 22321048 chr10 22606183 22606483 chr10 30434403 30434703 chr10 30525621 30525921 chr10 69354379 69354679 chr10 71877844 71878144 chr10 88062396 88062696 chr10 88095497 88095797 chr10 90944799 90945099 chr10 90983894 90984194 chr10 90986988 90987288 chr10 91187235 91187535 chr10 92894117 92894417 chr10 96306567 96306867 chr10 110010701 110011001 chr10 114538441 114538741

26 chr10 119428871 119429171 chr10 124153125 124153425 chr10 124160127 124160427 chr11 3860403 3860703 chr11 10308054 10308354 chr11 14583707 14584007 chr11 15650076 15650376 chr11 17867279 17867579 chr11 23569715 23570015 chr11 32162924 32163224 chr11 35079583 35079883 chr11 36684928 36685228 chr11 44095471 44095771 chr11 44568831 44569131 chr11 46307876 46308176 chr11 55956562 55956862 chr11 60906389 60906689 chr11 65497282 65497582 chr11 66242071 66242371 chr11 67685688 67685988 chr11 67791857 67792157 chr11 72815593 72815893 chr11 74232347 74232647 chr11 86637945 86638245 chr11 100105944 100106244 chr11 106577374 106577674 chr11 112525366 112525666 chr11 117828459 117828759 chr11 118338620 118338920 chr11 118342619 118342919 chr11 126893815 126894115 chr11 128342939 128343239 chr11 128423178 128423478 chr11 134270439 134270739 chr11 134577646 134577946 chr11 134637325 134637625 chr11 134643916 134644216 chr11 134654578 134654878 chr11 134667218 134667518 chr11 134730323 134730623 chr12 6959057 6959357

27 chr12 11947372 11947672 chr12 24425302 24425602 chr12 26798146 26798446 chr12 26870840 26871140 chr12 43730322 43730622 chr12 44611275 44611575 chr12 44618958 44619258 chr12 52081494 52081794 chr12 56634467 56634767 chr12 56725273 56725573 chr12 57851150 57851450 chr12 60760983 60761283 chr12 65279148 65279448 chr12 65660095 65660395 chr12 65668011 65668311 chr12 66964613 66964913 chr12 68365280 68365580 chr12 69721102 69721402 chr12 72330830 72331130 chr12 92030720 92031020 chr12 113086321 113086621 chr12 117152861 117153161 chr12 120835661 120835961 chr12 121980541 121980841 chr12 123131870 123132170 chr12 123132250 123132550 chr12 124477538 124477838 chr12 124574169 124574469 chr12 128132453 128132753 chr12 128534930 128535230 chr12 129564821 129565121 chr12 130521477 130521777 chr13 28658883 28659183 chr13 30354758 30355058 chr13 41004836 41005136 chr13 42049194 42049494 chr13 42369123 42369423 chr13 46550123 46550423 chr13 48585423 48585723 chr13 50319909 50320209 chr13 50651271 50651571

28 chr13 68974790 68975090 chr13 74026823 74027123 chr13 74070754 74071054 chr13 76816327 76816627 chr13 79451566 79451866 chr13 98571235 98571535 chr13 98826049 98826349 chr13 98976059 98976359 chr13 99214414 99214714 chr13 99420242 99420542 chr13 104875443 104875743 chr13 109707107 109707407 chr13 109779063 109779363 chr13 111052485 111052785 chr13 111177075 111177375 chr14 23986684 23986984 chr14 31208188 31208488 chr14 34199626 34199926 chr14 35286284 35286584 chr14 47778667 47778967 chr14 49598451 49598751 chr14 53226564 53226864 chr14 53613758 53614058 chr14 53882625 53882925 chr14 60249190 60249348 chr14 64044043 64044343 chr14 68210899 68211199 chr14 72476943 72477243 chr14 75175981 75176281 chr14 75247518 75247818 chr14 76947123 76947423 chr14 80973868 80974168 chr14 89067390 89067690 chr14 89201708 89202008 chr14 89202469 89202769 chr14 89467087 89467387 chr14 92108547 92108847 chr14 92615501 92615801 chr14 97723365 97723665 chr14 97777099 97777399 chr14 97994239 97994539

29 chr14 98168240 98168540 chr14 98198366 98198666 chr14 98210332 98210632 chr14 98416949 98417249 chr14 98829644 98829944 chr14 100068664 100068964 chr14 100071683 100071983 chr14 100079173 100079473 chr14 100339781 100340081 chr14 101706109 101706409 chr14 101721861 101722161 chr14 101839290 101839590 chr14 101876601 101876901 chr14 102591922 102592222 chr14 106774376 106774676 chr15 22890710 22891010 chr15 23503696 23503996 chr15 35398603 35398903 chr15 45608472 45608772 chr15 47644696 47644996 chr15 56537958 56538258 chr15 56613903 56614203 chr15 56678594 56678894 chr15 58454642 58454942 chr15 58463251 58463551 chr15 58464180 58464480 chr15 67029929 67030229 chr15 67034598 67034898 chr15 68818424 68818724 chr15 69748315 69748615 chr15 69760923 69761223 chr15 69806294 69806594 chr15 69821059 69821359 chr15 70257865 70258165 chr15 70425171 70425471 chr15 70492237 70492537 chr15 74399971 74400271 chr15 83557425 83557725 chr15 87202022 87202322 chr15 90851165 90851465 chr15 91308020 91308320

30 chr15 91853121 91853421 chr15 92838211 92838511 chr15 93987117 93987417 chr15 94067311 94067611 chr15 99014489 99014789 chr15 100292106 100292406 chr15 100295955 100296255 chr15 100307643 100307943 chr15 100329006 100329306 chr15 100335472 100335772 chr16 714865 715165 chr16 721614 721914 chr16 1408126 1408426 chr16 5063034 5063334 chr16 5086237 5086537 chr16 8796393 8796693 chr16 9127653 9127953 chr16 9154639 9154939 chr16 9235813 9236113 chr16 11298989 11299289 chr16 11654311 11654611 chr16 12080195 12080495 chr16 12567652 12567952 chr16 12613597 12613897 chr16 13056709 13057009 chr16 29029305 29029605 chr16 47113970 47114270 chr16 67159721 67160021 chr16 67846427 67846727 chr16 68332353 68332653 chr16 68355889 68356189 chr16 68418005 68418305 chr16 68773016 68773316 chr16 68782257 68782557 chr16 71852129 71852429 chr16 75148321 75148621 chr16 79089915 79090215 chr16 81433130 81433430 chr16 81591279 81591579 chr16 81598508 81598808 chr16 85422363 85422663

31 chr16 85448651 85448951 chr16 85455576 85455876 chr16 87707749 87708049 chr16 87725696 87725996 chr16 88992737 88993037 chr16 89015325 89015625 chr16 89308484 89308784 chr16 89722010 89722310 chr17 889013 889313 chr17 3712890 3713190 chr17 3738964 3739264 chr17 3740761 3741061 chr17 3750886 3751186 chr17 3770523 3770823 chr17 3796856 3797156 chr17 3905267 3905567 chr17 10120712 10121012 chr17 17757445 17757745 chr17 29722623 29722923 chr17 39755760 39756060 chr17 40026078 40026378 chr17 40560232 40560532 chr17 42319926 42320226 chr17 56798864 56799164 chr17 57487535 57487835 chr17 57518668 57518968 chr17 57526342 57526642 chr17 57551441 57551741 chr17 57956377 57956677 chr17 58333156 58333456 chr17 59829374 59829674 chr17 64020510 64020810 chr17 64712740 64713040 chr17 65155653 65155953 chr17 66076892 66077192 chr17 66542257 66542557 chr17 68087146 68087446 chr17 68344709 68345009 chr17 69712744 69713044 chr17 74463465 74463765 chr17 75765181 75765481

32 chr17 77325230 77325530 chr17 77843583 77843883 chr17 77928848 77929148 chr17 78343624 78343924 chr17 80765752 80766052 chr17 80790066 80790366 chr17 80861973 80862273 chr17 80887383 80887683 chr17 81094787 81095087 chr17 81095825 81096125 chr17 81403220 81403520 chr17 81428212 81428512 chr17 82302209 82302509 chr17 82303540 82303840 chr17 82864916 82865216 chr17_GL000258v2_alt 1064093 1064393 chr18 911066 911366 chr18 5296109 5296409 chr18 9915067 9915367 chr18 10247313 10247613 chr18 10322523 10322823 chr18 10340950 10341250 chr18 10499291 10499591 chr18 10525854 10526154 chr18 12750153 12750453 chr18 13438282 13438582 chr18 13612370 13612670 chr18 36067493 36067793 chr18 36536553 36536853 chr18 43915162 43915462 chr18 44501280 44501580 chr18 44508012 44508312 chr18 49161682 49161982 chr18 51030610 51030910 chr18 59923215 59923515 chr18 68715122 68715422 chr18 69900972 69901272 chr18 77062597 77062897 chr18 78130390 78130690 chr18 78678332 78678632 chr18 80033553 80033853

33 chr19 1259139 1259439 chr19 2086978 2087278 chr19 2215215 2215515 chr19 4935473 4935773 chr19 11505699 11505999 chr19 11697239 11697539 chr19 13882070 13882370 chr19 15197544 15197844 chr19 16370909 16371209 chr19 16587045 16587345 chr19 18045068 18045368 chr19 18091189 18091489 chr19 19668179 19668479 chr19 21602864 21603164 chr19 21612163 21612463 chr19 28633141 28633441 chr19 29942762 29943062 chr19 41888204 41888504 chr19 43983984 43984284 chr19 45584859 45585159 chr19 46958657 46958957 chr19 47752888 47753188 chr19 48333801 48334101 chr19 49568035 49568335 chr19 50777844 50778144 chr2 892636 892936 chr2 1781536 1781836 chr2 4674043 4674343 chr2 6909816 6910116 chr2 6917304 6917604 chr2 26044164 26044464 chr2 28594851 28595151 chr2 39920201 39920501 chr2 43025131 43025431 chr2 43050006 43050306 chr2 43426517 43426817 chr2 43537208 43537508 chr2 46549103 46549403 chr2 46922680 46922980 chr2 54571025 54571325 chr2 60105962 60106262

34 chr2 62305139 62305439 chr2 62305904 62306204 chr2 65416949 65417249 chr2 69012838 69013138 chr2 69957889 69958189 chr2 70664470 70664770 chr2 86839506 86839806 chr2 97712721 97713021 chr2 97725876 97726176 chr2 97728175 97728475 chr2 98467047 98467347 chr2 98586589 98586889 chr2 98637811 98638111 chr2 98768715 98769015 chr2 100064537 100064837 chr2 100660905 100661205 chr2 101435891 101436191 chr2 105361176 105361476 chr2 110748494 110748794 chr2 111632623 111632923 chr2 111706095 111706395 chr2 111708370 111708670 chr2 118698649 118698949 chr2 127597993 127598293 chr2 127619918 127620218 chr2 128631262 128631562 chr2 135825627 135825927 chr2 138861871 138862171 chr2 138897911 138898211 chr2 145502103 145502403 chr2 146882101 146882401 chr2 165054712 165055012 chr2 166491559 166491859 chr2 181308836 181309136 chr2 196263160 196263460 chr2 196939338 196939638 chr2 197847704 197848004 chr2 203951562 203951862 chr2 218315922 218316222 chr2 219217840 219218140 chr2 226970380 226970680

35 chr2 226984131 226984431 chr2 230894219 230894519 chr2 231665955 231666255 chr2 236569544 236569844 chr2 236607422 236607722 chr2 236794469 236794769 chr2 239322464 239322764 chr2 239326805 239327105 chr2 239327085 239327385 chr2 239545032 239545332 chr2 239553401 239553701 chr2 239602318 239602618 chr2 239623134 239623434 chr2 240296079 240296379 chr2 240300053 240300353 chr2 240426779 240427079 chr20 5548126 5548426 chr20 8144950 8145250 chr20 8385383 8385683 chr20 13447478 13447778 chr20 13684815 13685115 chr20 21395596 21395896 chr20 22371907 22372207 chr20 23125715 23126015 chr20 23823000 23823300 chr20 24588024 24588324 chr20 24698360 24698660 chr20 24741519 24741819 chr20 24934065 24934365 chr20 25485096 25485396 chr20 25690402 25690702 chr20 25868087 25868387 chr20 31540260 31540560 chr20 31587771 31588071 chr20 33020027 33020327 chr20 33732067 33732367 chr20 35768125 35768425 chr20 40931378 40931678 chr20 44646172 44646472 chr20 57003011 57003311 chr20 57709874 57710174

36 chr20 57792663 57792963 chr20 57838712 57839012 chr20 57900103 57900403 chr20 57932569 57932869 chr20 57938212 57938512 chr20 60292107 60292407 chr20 62696342 62696642 chr20 63009169 63009469 chr20 63010467 63010767 chr21 38981050 38981350 chr21 39445576 39445876 chr21 41783459 41783759 chr21 42426452 42426752 chr21 42683982 42684282 chr21 43961495 43961795 chr21 44065434 44065734 chr21 45592376 45592676 chr21 45615371 45615671 chr22 20111482 20111782 chr22 22166953 22167253 chr22 22914019 22914319 chr22 23237167 23237467 chr22 23523733 23524033 chr22 29221022 29221322 chr22 29628871 29629171 chr22 29633278 29633578 chr22 31489974 31490274 chr22 32638318 32638618 chr22 32720895 32721195 chr22 32738162 32738462 chr22 43263757 43264057 chr22 44684872 44685172 chr22 44709113 44709413 chr22 44711016 44711316 chr22 44718453 44718753 chr22 45201722 45202022 chr3 6542896 6543196 chr3 10551991 10552291 chr3 12356292 12356592 chr3 13343658 13343958 chr3 13349518 13349818

37 chr3 14279069 14279369 chr3 15199648 15199948 chr3 15271793 15272093 chr3 18018882 18019182 chr3 18778156 18778456 chr3 18782294 18782594 chr3 18840708 18841008 chr3 31213901 31214201 chr3 35296590 35296890 chr3 36740917 36741217 chr3 36839516 36839816 chr3 37536755 37537055 chr3 39353552 39353852 chr3 45381594 45381894 chr3 45507856 45508156 chr3 45978342 45978642 chr3 47613868 47614168 chr3 56800613 56800913 chr3 56838571 56838871 chr3 59773044 59773344 chr3 59981404 59981704 chr3 69368310 69368610 chr3 81817003 81817303 chr3 106302567 106302867 chr3 108091146 108091446 chr3 108125675 108125975 chr3 124835039 124835339 chr3 128316407 128316707 chr3 131945372 131945672 chr3 133492564 133492864 chr3 134904288 134904588 chr3 138578086 138578386 chr3 141261825 141262125 chr3 142120675 142120975 chr3 143171349 143171649 chr3 149085552 149085852 chr3 149553672 149553972 chr3 165839620 165839920 chr3 170128530 170128830 chr3 170426326 170426626 chr3 179956621 179956921

38 chr3 183987161 183987461 chr3 187929432 187929732 chr3 187979599 187979899 chr3 194134748 194135048 chr3 194137011 194137311 chr3 196179389 196179689 chr3 196246741 196247041 chr3 196712542 196712842 chr4 579752 580052 chr4 1712695 1712995 chr4 1830671 1830971 chr4 8228647 8228947 chr4 8229087 8229387 chr4 8236050 8236350 chr4 9743798 9744098 chr4 10629298 10629598 chr4 15410819 15411119 chr4 19930719 19931019 chr4 38132252 38132552 chr4 38560759 38561059 chr4 70736994 70737294 chr4 87049541 87049841 chr4 95985080 95985380 chr4 108171531 108171831 chr4 108360040 108360340 chr4 108360480 108360780 chr4 110362004 110362304 chr4 145034863 145035163 chr4 151802123 151802423 chr4 168453215 168453515 chr4 185209279 185209579 chr4 187314411 187314711 chr5 958627 958927 chr5 964177 964477 chr5 3891060 3891360 chr5 35816940 35817240 chr5 35884492 35884792 chr5 35899874 35900174 chr5 39211810 39212110 chr5 41698992 41699169 chr5 50564120 50564420

39 chr5 52725449 52725749 chr5 65172506 65172806 chr5 65925063 65925363 chr5 67033529 67033829 chr5 80204863 80205163 chr5 82312429 82312729 chr5 82419263 82419563 chr5 87231046 87231346 chr5 96961088 96961388 chr5 107784929 107785229 chr5 132466414 132466714 chr5 132466774 132467074 chr5 132688079 132688379 chr5 132688918 132689218 chr5 133467192 133467492 chr5 134086931 134087231 chr5 134103481 134103781 chr5 138981643 138981943 chr5 139388529 139388829 chr5 151124270 151124570 chr5 160260936 160261236 chr5 168852032 168852332 chr5 171307064 171307364 chr5 171897279 171897579 chr5 173187470 173187770 chr5 177389424 177389724 chr5 177454540 177454840 chr6 1527135 1527435 chr6 1595161 1595461 chr6 1596146 1596446 chr6 5782674 5782974 chr6 5786587 5786887 chr6 5793114 5793414 chr6 10855368 10855668 chr6 21953750 21954050 chr6 22045196 22045496 chr6 22063081 22063381 chr6 36912581 36912881 chr6 37290090 37290390 chr6 40019701 40020001 chr6 40389161 40389461

40 chr6 42045865 42046165 chr6 42911734 42912034 chr6 44219603 44219903 chr6 53301042 53301342 chr6 53735922 53736222 chr6 72621979 72622279 chr6 87725542 87725842 chr6 96897810 96898110 chr6 98777868 98778168 chr6 111764423 111764723 chr6 119313941 119314241 chr6 119598953 119599253 chr6 135323291 135323591 chr6 135346717 135347017 chr6 142569711 142570011 chr6 142843464 142843764 chr6 149060468 149060768 chr6 149989570 149989870 chr6 150623182 150623482 chr6 153002711 153003011 chr6 158517611 158517911 chr6 160462560 160462860 chr6 165606347 165606647 chr6 170271842 170272142 chr7 593460 593760 chr7 1962012 1962312 chr7 4739803 4740103 chr7 19708895 19709195 chr7 22445118 22445418 chr7 30330353 30330653 chr7 37382529 37382829 chr7 38233023 38233323 chr7 43516986 43517286 chr7 50342620 50342920 chr7 69906314 69906614 chr7 70778749 70779049 chr7 77101162 77101462 chr7 77351645 77351945 chr7 92754965 92755265 chr7 92835298 92835598 chr7 101958180 101958480

41 chr7 102307077 102307377 chr7 102441735 102442035 chr7 115089063 115089363 chr7 127186708 127187008 chr7 130294329 130294629 chr7 133682548 133682848 chr7 138768633 138768933 chr7 139071800 139072100 chr7 140261675 140261975 chr7 142808844 142809144 chr7 149126949 149127249 chr7 150362061 150362361 chr7 150363388 150363688 chr7 150663913 150664213 chr7 150668402 150668702 chr7 150959853 150960153 chr7 154072755 154073055 chr7 154771054 154771354 chr7 158170033 158170333 chr7 159026601 159026901 chr7 159026901 159027201 chr8 3076032 3076332 chr8 3077279 3077579 chr8 3088410 3088710 chr8 20963494 20963794 chr8 23567864 23568164 chr8 25346874 25347174 chr8 25350466 25350766 chr8 27491581 27491881 chr8 28701040 28701340 chr8 28777609 28777909 chr8 29806420 29806720 chr8 55989260 55989560 chr8 59655729 59656029 chr8 73475215 73475515 chr8 79767617 79767917 chr8 79768097 79768397 chr8 79784041 79784341 chr8 79952968 79953268 chr8 85175227 85175527 chr8 92674363 92674663

42 chr8 96290211 96290511 chr8 96293289 96293589 chr8 104420261 104420561 chr8 104731239 104731539 chr8 128537762 128538062 chr8 129059334 129059634 chr8 129168067 129168367 chr8 129179725 129180025 chr8 129378234 129378534 chr8 129415677 129415977 chr8 129546828 129547128 chr8 140155270 140155570 chr8 142201094 142201394 chr9 18909198 18909498 chr9 20981164 20981464 chr9 33082154 33082454 chr9 35940563 35940863 chr9 73114034 73114334 chr9 80881375 80881675 chr9 93268995 93269295 chr9 93291758 93292058 chr9 93463681 93463981 chr9 96777966 96778266 chr9 104928346 104928646 chr9 105405735 105406035 chr9 105557913 105558213 chr9 109458500 109458800 chr9 121738454 121738754 chr9 126419367 126419667 chr9 131500288 131500588 chr9 132851045 132851345 chr9 133709287 133709587 chr9 134407328 134407628 chr9 136552227 136552527 chr9 136587983 136588283 chr9 136589038 136589338 chr9 137175441 137175741 chr9 137236520 137236820 chr9 137304106 137304406 chr9 137307738 137308038 chr9 137311471 137311771

43 chr9 137312233 137312533 chr9 137312638 137312938 chr9 137316023 137316323 chr9 137316663 137316963 chr9 138182555 138182855 chrX 6226260 6226560 chrX 7069069 7069369 chrX 13085605 13085905 chrX 13087358 13087658 chrX 16870237 16870537 chrX 19883848 19884148 chrX 24025492 24025792 chrX 38641201 38641501 chrX 45851686 45851986 chrX 47233649 47233949 chrX 65035141 65035441 chrX 78651147 78651447 chrX 119654131 119654431 chrX 124208658 124208958 chrX 129781386 129781686 chrX 130416806 130417106 chrX 136496819 136497119 chrX 148926281 148926581 chrX 153972545 153972845 chrX 155026793 155027093 chrY 8479305 8479605 chrY 8593572 8593872

44

References 1. R. Kopan, M. X. Ilagan, The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137, 216-233 (2009). 2. F. Oswald et al., p300 acts as a transcriptional coactivator for mammalian Notch-1. Mol Cell Biol 21, 7761-7774 (2001). 3. P. Mulligan et al., A SIRT1-LSD1 corepressor complex regulates Notch target gene expression and development. Mol Cell 42, 689-699 (2011). 4. C. J. Fryer, J. B. White, K. A. Jones, Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover. Mol Cell 16, 509-520 (2004). 5. J. C. Aster, In brief: Notch signalling in health and disease. J Pathol 232, 1-3 (2014). 6. R. A. Previs, R. L. Coleman, A. L. Harris, A. K. Sood, Molecular pathways: translational and therapeutic implications of the Notch signaling pathway in cancer. Clin Cancer Res 21, 955-961 (2015). 7. S. H. Choi et al., Conformational locking upon cooperative assembly of notch transcription complexes. Structure 20, 340-349 (2012). 8. Y. Nam, P. Sliz, L. Song, J. C. Aster, S. C. Blacklow, Structural basis for cooperativity in recruitment of MAML coactivators to Notch transcription complexes. Cell 124, 973-983 (2006). 9. K. L. Arnett et al., Structural and mechanistic insights into cooperative assembly of dimeric Notch transcription complexes. Nat Struct Mol Biol 17, 1312-1317 (2010). 10. Y. Nam, P. Sliz, W. S. Pear, J. C. Aster, S. C. Blacklow, Cooperative assembly of higher-order Notch complexes functions as a switch to induce transcription. Proc Natl Acad Sci U S A 104, 2103-2108 (2007). 11. C. Del Bianco et al., Notch and MAML-1 complexation do not detectably alter the dna binding specificity of the transcription factor CSL. PLoS One 5, e15034 (2010). 12. S. Jarriault et al., Signalling downstream of activated mammalian Notch. Nature 377, 355-358 (1995). 13. B. E. Housden et al., Transcriptional dynamics elicited by a short pulse of notch activation involves feed-forward regulation by E(spl)/Hes genes. PLoS Genet 9, e1003162 (2013). 14. H. Liu et al., Notch dimerization is required for leukemogenesis and T-cell development. Genes Dev 24, 2395-2407 (2010). 15. T. Trimarchi et al., Genome-wide mapping and characterization of Notch-regulated long noncoding RNAs in acute leukemia. Cell 158, 593-606 (2014). 16. H. Wang et al., NOTCH1-RBPJ complexes drive target gene expression through dynamic interactions with superenhancers. Proc Natl Acad Sci U S A 111, 705-710 (2014). 17. R. A. Conlon, A. G. Reaume, J. Rossant, Notch1 is required for the coordinate segmentation of somites. Development 121, 1533-1545 (1995). 18. M. G. Grabherr et al., Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29, 644-652 (2011). 19. A. Krejci, F. Bernard, B. E. Housden, S. Collins, S. J. Bray, Direct response to Notch activation: signaling crosstalk and incoherent logic. Sci Signal 2, ra1 (2009). 20. E. Lamar et al., Nrarp is a novel intracellular component of the Notch signaling pathway. Genes Dev 15, 1885-1899 (2001). 21. T. J. Yun, M. J. Bevan, Notch-regulated ankyrin-repeat protein inhibits Notch1 signaling: multiple Notch1 signaling pathways involved in T cell development. J Immunol 170, 5834-5841 (2003).

45 22. D. Herranz et al., A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nat Med 20, 1130-1137 (2014). 23. Y. Yashiro-Ohtani et al., Long-range enhancer activity determines Myc sensitivity to Notch inhibitors in T cell leukemia. Proc Natl Acad Sci U S A 111, E4946-4953 (2014). 24. B. Zhao et al., Epstein-Barr virus exploits intrinsic B-lymphocyte transcription programs to achieve immortal cell growth. Proc Natl Acad Sci U S A 108, 14902-14907 (2011). 25. C. Del Bianco, J. C. Aster, S. C. Blacklow, Mutational and energetic studies of Notch 1 transcription complexes. J Mol Biol 376, 131-140 (2008). 26. K. L. Arnett, S. C. Blacklow, Analyzing the nuclear complexes of Notch signaling by electrophoretic mobility shift assay. Methods Mol Biol 1187, 231-245 (2014). 27. A. P. Weng et al., Growth suppression of pre-T acute lymphoblastic leukemia cells by inhibition of notch signaling. Mol Cell Biol 23, 655-664 (2003). 28. C. Trapnell et al., Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578 (2012). 29. B. J. Haas et al., De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc 8, 1494-1512 (2013). 30. L. Wang et al., CPAT: Coding-Potential Assessment Tool using an alignment-free logistic regression model. Nucleic Acids Res 41, e74 (2013). 31. C. E. Grant, T. L. Bailey, W. S. Noble, FIMO: scanning for occurrences of a given motif. Bioinformatics 27, 1017-1018 (2011). 32. H. Li, R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009). 33. Y. Zhang et al., Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137 (2008). 34. D. Heckl et al., Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol 32, 941-946 (2014). 35. L. Vouillot, A. Thelie, N. Pollet, Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases. G3 (Bethesda) 5, 407- 415 (2015). 36. J. C. Aster et al., Essential roles for ankyrin repeat and transactivation domains in induction of T-cell leukemia by notch1. Mol Cell Biol 20, 7505-7515 (2000).

46 A N1 ANK RBPJ RBPJ 70°

MAML MAML R1984

B

No FRET FRET

excitation emission

MAML Notch + RAMANK DNA with dimerization motif RBPJ

+ MAML peptide

400 C Donor D 0.5 Emission no DNA DNA 300 0.4

Acceptor 0.3 200 Emission RFU 1-F/Fo 0.2

100 0.1

0.0 0 RA 500 550 600 650 N1 + + + Wavelength(nm) RA-CSL RBPJ + + + N1 N1-DNA RA-CSL-MAML + + N1-RBPJ N1-RBPJ-DNA MAML R1985A-CSL-MAML N1-RBPJ-MAML N1-RBPJ-MAML-DNA N1-R1984A +

Figure 1 B 0.4 A Site A Site B 0.3 SPS-1 CTAGCGTGGGAACGCGCCCGCCGGTGAGTTCCCACGTTCT SPS-24 CTAGCGTcGcAACGCGCCCGCCGGTGAGTTgCgACGTTCT 0.2 1-F/Fo SPS-1-24 CTAGCGTGGGAACGCGCCCGCCGGTGAGTTgCgACGTTCT 0.1

0.0 11 12 13 14 15 16 17 18 19 20 21 C spacer length no DNA

no DNA site single HES1A HES1AB SPS-1-CGTGGGAA D Site A SPS-2-tGTGGGAA SPS-3-CGTGtGAA 1 - CGTGGGAA SPS-21-CGTGaGAA SPS-16-CcTGGGAA SPS-20-CGTGGGAc 16 - CcTGGGAA SPS-19-CGTGGGAt SPS-14-CGTGcGAA 9 - tGTGaGAc SPS-5-CcTGtGAA SPS-22-tGTGaGAA SPS-8-CGTGGGtA 7 - CGTGGcAA SPS-35-tcTGGGAA SPS-17-CGTGGaAA SPS-36-CGcGGGAA 6 - CGTcGGAA SPS-9-tGTGaGAc SPS-18-CGTGGGgA SPS-4-CGaGGGAA 13 - CcTGGagt SPS-15-CGTGGtAA SPS-34-CcTGaGAc 24 - CGTcGcAA SPS-7-CGTGGcAA SPS-25-tGacGctA single27 SPS-32-CGTGaGgt noDNA SPS-29-CGTaGGAA HES1AB SPS-12-CcTGGGgt 0.0 0.2 0.4 0.6 0.8 1.0 SPS-33-CGTGGagt SPS-6-CGTcGGAA 1-F/Fo (normalized) SPS-31-CGTccGAA SPS-27-CGactGAA SPS-26-CGactctA Site B SPS-23-CGTGGctA 1 - CGTGGGAA (consensus) SPS-13-CcTGGagt SPS-30-CGTGccAA 16 - CcTGGGAA SPS-11-CGacGGAA 9 - tGTGaGAc SPS-10-CGTGctAA SPS-28-CGTGtctA 7 - CGTGGcAA SPS-24-CGTcGcAA 6 - CGTcGGAA 0.0 0.1 0.2 0.3 0.4 0.5 13 - CcTGGagt (Hes5B) 24 - CGTcGcAA (non-binding) 1-F/Fo

Figure 2 A

B * Dynamic Sites HH TH Non-dynamic Sites RBPJ Motif ScoreRBPJMotif ScoreRBPJMotif

Spacer Length Spacer Length

HT TT RBPJ Motif ScoreRBPJMotif ScoreRBPJMotif

Spacer Length Spacer Length

Figure 3 A B

1.0 2 1.0 R =0.04 2

) R =0.82 ) o o F F 0.75 0.75

0.50 0.50 FRET (1-F/ FRET FRET (1-F/ FRET 0.25 0.25

6 9 12 0.25 0.50 0.75 PWM Score PBM(A) x PBM(B)

C D

6 9 60

6 40

3 20 SequenceReads

SequenceReads 10 x 0 0 0 0.25 0.50 0.75 0 0.25 0.50 0.75 PBM(A) x PBM(B) PBM(A) x PBM(B)

Figure 4 A B

C D

12% 88% 14% 86%

Figure 5 Color Key and Histogram 100 Count 40 0

−1 0 0.5 1 Value

A B CR1APCDD1 CXCR7MYO7BHES5 GAS1CD300CIL4LOC389043 ZSCAN4NLGN1GPC1PGPEP1L CR1LAJAP1FBXO2RFX8 CYTIPLINC00226ABCA1CR2 NUDT9P1RHOVTMEM158WNK2 PFKFB2LINC00461CD300AID1 FOSL2PCGF5HES4CD55 GPR157NPM2HES1EPB41L5 YY1P2C9orf129HMGA2SHANK1 PLGLOC100506688IGF1RGPA33 NOTCH1 KTN1SNORD49AMIR4521RGPD4−AS1 NRARPSHISA9ULBP1NUDT8 PRKCANPPCSHQ1RGPD3 SPSB4NKD2FAM120AOSSNORD70 PLGLACD93SNORA70MYO1A KLF3LINC00669SCARB1AGPHD1 FOXN3C17orf96CDK5R1SAT2 −AS1 NOTCH1 CST2HSPA4LPLAC8L1KIF3A ARG2RASAL1BCHEPHLPP1 SNORD45CELOVL6ILDR2UFSP1 TNKS1BP1SNORD67CYTH3P2RY8 TMEM177RIMKLAGXYLT2MAP4K4 CISD3EIF5AL1MACROD1TIMP1 MORN2REP15SNORA8 Genes (105) HPDLCA8ASPHD1LOC100134868 EXD3SLC29A1SNORD56TPCN1 DCLK3BMP4SNORD30DTX1 LRP4SH2B2 DimerDependent CEACAM21SCN7ASFRP2RNF152 Histone H3 HMCN1FAM46CTARPSNORD65 LRP4SNORD126FAM27CFAM27B−AS1 BHLHE23KIFC3NKX2FAM27A−5 NLNS100A4RXRAITGA1 CD27PCBP3SNORD42BMIR663B NKG7GBE1TNFRSF4CYP51A1 YBX3EFNA5SMOXSLC19A1 PPFIBP1FRMD4BTBC1D16SUSD4 SLC7A11CHAC1SNORD68SNORD105B CAB39LRIPK2SETD7YBX3P1 RGS9ACTL8CNN3FERMT2 HK2PUS7CAMKVNPM1 ICOSHSP90AB1USTSPRY2 FBLN2RUNX3SLX1BSESN2 CPA5PSAT1TSPAN6VDAC1 IFRD2CST7DHCR7MIF RPS2TPI1P3PYCR1DNPH1 TASP1NCKAP1ANXA1PCK2 TPD52FAM95B1MINAEIF5A ZFYVE9AMDHD1TXKIPO4 GCSHTPI1P2SNORD18CSNORA45 PRKCHIL7RSNORA13PLCB1 SNORD9PELOPDCD2LLOC100507032 C MTFP1PER3RPL12GEMIN8P4 RANBP1ZNF593MYBBP1A PRELID1RRP12SNORD79CD72 EIF4A1CMSS1GOLIM4RPL14 PECRTEX19LOC729970POLR1B Only Monomeric POLR3GRPP40P2RY1ST6GALNAC4 SPS Peaks AIG1CEBPBCCDC58GPC5 NOB1FAHSLC7A11SNORA41−AS1 METTL1EIF4EBP1GPR65CREG1 Peaks SNRPFCCDC86LINC00239MSMO1 CLUHHMGCS1TUBA4ATRIM16L FAM86ALOC541471CHCHD10RPL8 EIF2S2FAM120APPA1PFN2 SORDATG16L2 Genes(211) XPOTRASL10BLOC401010TBCA PA2G4P4CYCSSLC25A33TRAP1 PTPN6RPSAP58TFRCCPPED1 GGCTTRIM16RPSAACAT1 NDUFAF2LOC401397RRS1LINC00029 RPS17ZNF883 DimerIndependent SNORA52TMEM64ATAD3AMTHFD2 TRIB3RPS23NME3CBX3P2 MRPL36RPSAP9CCT8SPSB1 GPATCH4ALKBH2SNORA21TTC8 KDELC1SNHG17WDR4CCDC85B CCDC102BCD82SCDCD7 GLI3TTLL12PDFIMMP2L ESF1AIMP2RPL9PRDX4 ICN_1 ICN_2 DBZ_1 DBZ_2 DMSO_1 DMSO_2 NumberPeaksof NumberPeaksof R1984A_1 R1984A_2 Dimer-Dependent Dimer Independent Genes Genes

Figure 6 Color Key and Histogram 400 200 Count 0

−1 0 0.5 1 Value

21912 A 5393412056 210221200 3126714494 4700614176 2906433923 2507254305 883121320 2828828669 5624030958 B C 25667 4460846464 234971896 50 398438560 3531231062 3832966 5269634384 4104847283 1556245554 Not rescued 5073629264 25 1719250557 162465085 69428128 P = 1.56E-39 388648880 by NICD1 276018136 40 923844328 827735782 162413567 R1984A (87) 2574451241 62 440528393 62127912 735227413 1720836070 247231603 3305627288 453511368 3953130721 30 160241021 2783227590 1912526150 315233304 4907828616 2165411712 118789427 182269499 4103049954 3542255572 4448337681 2205426621 localized 20 13915078 1897953327 13 392537781 35406312 2037610165 4637935167 3464829301 Rescued by 4917246342 1091810161 281446387 1091727397 NICD1 1227810919 46 10 4031816885 2168010135 216317557 594511655 R1984A(59) 3114243047 1227726070 %Notch-regulated enhancer 3792816400 850527147 2977237814 47907771 1627094 3107837376 0 3217419806 Notch all K27ac (+) target lncRNA ICN_1 ICN_2 DBZ_1 DBZ_2 K27ac (-) lncRNA DMSO_1 DMSO_2 R1984A_1 R1984A_2

D

Notch-off NOTCH1 Notch-on Notch-off H3K27ac Notch-on DMSO GSI RNA-seq NICD1 R1984A

IGFR1 LUNAR1 E E2 Notch-off E1 NOTCH1 Notch-on Notch-off H3K27ac Notch-on DMSO

GSI

RNA-seq NICD1

R1984A

ncRNA NDANR1 HES5

Figure 7 Supplementary Figures A 400

300 B

SPS Luciferase 200 Dimeric site reporter RFU

100

0 500 550 600 650 Wavelength(nm) R1984A R1984A/RBPJ R1984A/RBPJ/DNA R1984A/RBPJ/MAML R1984A/RBPJ/MAML/DNA Normalizedluciferase activity

D migR1 NICD1 R1984A

C

4x RBPJ Luciferase Monomeric site reporter

E Normalizedluciferase activity

migR1 NICD1 R1984A

F G

Fig. S1 Site A Site B SPS1-spacer11 CTAGCGTGGGAA CGCGCGGTGAG TTCCCACGTTCT SPS1-spacer12 CTAGCGTGGGAA CGCGCCGGTGAG TTCCCACGTTCT SPS1-spacer13 CTAGCGTGGGAA CGCGCCCGGTGAG TTCCCACGTTCT SPS1-spacer14 CTAGCGTGGGAA CGCGCGCCGGTGAG TTCCCACGTTCT SPS1-spacer15 CTAGCGTGGGAA CGCGCCGCCGGTGAG TTCCCACGTTCT SPS1-spacer16 CTAGCGTGGGAA CGCGCCCGCCGGTGAG TTCCCACGTTCT SPS1-spacer17 CTAGCGTGGGAA CGCGCCCAGCCGGTGAG TTCCCACGTTCT SPS1-spacer18 CTAGCGTGGGAA CGCGCCCATGCCGGTGAG TTCCCACGTTCT SPS1-spacer19 CTAGCGTGGGAA CGCGCCCATCGGCGGTGAG TTCCCACGTTCT SPS1-spacer20 CTAGCGTGGGAA CGCGCCCATACGGCGGTGAG TTCCCACGTTCT SPS1-spacer21 CTAGCGTGGGAA CGCGCCTCATACGGCGGTGAG TTCCCACGTTCT SPS1-spacer25 CTAGCGTGGGAA CGCGCCTCACGGATACGGCGGTGAG TTCCCACGTTCT

Fig. S2 A Kd (uM) 0.1+0.04 0.17+0.08 0.2+0.09 0.9+0.06 5+1 11+1 13+9 14+12

B

Fig. S3