The Pennsylvania State University

The Graduate School

The Huck Institutes of the Life Sciences

REGULATION OF GENE TRANSCRIPTION BY THE ARYL HYDROCARBON

RECEPTOR –NEW TARGETS AND MECHANISMS OF REGULATION

A Dissertation in

Integrative Biosciences

by

Rushang Dilipkumar Patel

© 2008 Rushang Dilipkumar Patel

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

August 2008

The dissertation of Rushang Dilipkumar Patel was reviewed and approved* by the following:

Gary H. Perdew John T. and Paige S. Smith Professor in Agricultural Sciences Dissertation Advisor Chair of Committee

Curtis Omiecinski Professor of Veterinary Science H. Thomas and Dorothy Willits Hallowell Chair

Jeffrey M. Peters Associate Professor of Environmental Toxicology

Robert Mitchell Professor Emeritus of Biology

Naomi S. Altman Associate Professor of Statistics

Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences

*Signatures are on file in the Graduate School

iii ABSTRACT

Adaptation in response to changes in internal as well as external environment is imperative to sustenance of life. Modulation of gene expression is a critical component of this adaptive response and is mediated by activation of various transcription factors.

Individual signaling pathways have been well characterized for many transcription factor systems. Aryl hydrocarbon receptor (AHR) is a transcription factor that is activated by a variety of structurally diverse ligands, including the environmental contaminant dioxin, the cigarette smoke constituent benzo[a]pyrene and the therapeutically prescribed drug omeprazole. Prior to activation, AHR is primarily located in a cytoplasmic complex with chaperone and co-chaperone proteins. Ligand-binding is believed to initiate a conformational change that leads to nuclear translocation, dissociation from the chaperones and heterodimerization with AHR-nuclear translocator (ARNT). AHR-ARNT heterodimer recognizes and binds to a consensus DNA sequence (TNGCGTG), commonly referred to as a dioxin response element (DRE), to drive transcription of target genes. Phase I and II xenobiotic metabolism enzymes have been the well-characterized targets of AHR-mediated transactivation. This sequence of coordinate events has been described as the classical pathway of AHR activity. Different lines of evidence suggest that AHR serves physiologically relevant functions, though the details have not been elucidated. The goal of this research project was to identify previously uncharacterized targets of AHR-mediated gene regulation and to investigate the hypothesis that AHR functions through mechanisms that are independent of DNA-binding. The advances in performing genome-wide transcriptional profiling at the time of commencement of this

iv project, encouraged the use of DNA-microarray technology for identifying new target

genes. Epiregulin, a potent mitogen belonging to the epidermal growth factor family, was

discovered to be regulated by AHR in immortalized murine hepatocytes. The fact that a

number of AHR ligands have been associated with carcinogenesis signifies that the induction of growth factors like epiregulin might be a potential mechanism for AHR-

mediated tumor enhancement. The next phase of this project led to the identification of

the constitutive androstane receptor (CAR), another receptor involved in drug

metabolism, as an in vivo target of AHR activation. This association between AHR-CAR

highlights the possibility of crosstalk between AHR and other pathways. Exposure to

divergent stimuli leads to simultaneous activation of multiple signaling pathways. This

suggests that it is essential to study the networking of various pathways to be able to

predict the biological outcomes. The third phase of this project focuses on the ability of

AHR to modulate the inflammatory pathway and on the involved mechanism. AHR

activation can repress the acute-phase response (APR) gene expression, implicated in

disorders like septic shock and Alzheimer’s, partly by antagonizing NF-κB mediated

gene regulation through a non-classical mechanism not involving DRE. Serum amyloid

family members, C-reactive protein and haptoglobin were found to be repressed by AHR,

signifying that AHR regulates multiple members of the APR. Thus, this research has led

to the identification of multiple AHR-regulated genes. It also presents a model to study

AHR-mediated gene repression, an aspect that has therapeutic potential.

v TABLE OF CONTENTS

LIST OF FIGURES ...... vii

LIST OF TABLES...... ix

ACKNOWLEDGEMENTS...... x

Chapter 1 INTRODUCTION...... 1

1.1 History and Characterization ...... 2 1.1.1 Discovery of AHR:...... 2 1.1.2 AHR structure:...... 3 1.1.3 AHR alleles and polymorphisms:...... 6 1.2 AHR activation:...... 8 1.2.1 Exogenous ligands:...... 8 1.2.2 Endogenous ligands:...... 9 1.2.3 Ligand-independent AHR activation:...... 11 1.3 AHR pathway: ...... 11 1.4 AHR mouse models:...... 16 1.4.1 AHR-null mouse models:...... 16 1.4.2 Other transgenic AHR mouse models:...... 18 1.4.3 Biosensor mouse models based on AHR: ...... 21 1.5 AHR Regulated Genes:...... 21 1.5.1 Phase I and Phase II enzymes:...... 23 1.5.2 Other AHR regulated genes: ...... 25 1.6 Potential physiological roles of AHR:...... 31 1.6.1 Reproduction: ...... 31 1.6.2 Cardiovascular:...... 32 1.6.3 Development: ...... 33 1.6.4 Endocrinal homeostasis:...... 34 1.7 Interaction of AHR with other signaling pathways:...... 35 1.7.1 AHR and estrogen signaling:...... 36 1.7.2 AHR and inflammatory signaling: ...... 38 1.8 Overview and significance of research:...... 46

Chapter 2 THE ARYL HYDROCARBON RECEPTOR DIRECTLY REGULATES EXPRESSION OF THE POTENT MITOGEN EPIREGULIN...54

2.1 Abstract:...... 55 2.2 Introduction...... 56 2.3 Materials and methods...... 59 2.4 Results...... 63 2.5 Discussion...... 72

vi Chapter 3 AHR ACTIVATION REGULATES CONSTITUTIVE ANDROSTANE RECEPTOR (CAR) LEVELS IN MURINE AND HUMAN LIVER...... 78

3.1 Abstract...... 79 3.2 Introduction...... 80 3.3 Materials and Methods ...... 82 3.4 Results: ...... 86 3.5 DISCUSSION...... 105

Chapter 4 AHR REPRESSES CYTOKINE MEDIATED ACUTE PHASE RESPONSE BY A DNA-INDEPENDENT MECHANISM...... 110

4.1 Abstract...... 111 4.2 Introduction...... 113 4.3 Materials and Methods: ...... 116 4.4 Results: ...... 120 4.5 Discussion:...... 150

Chapter 5 CONCLUSIONS AND FUTURE DIRECTIONS...... 157

Bibliography ...... 168

vii LIST OF FIGURES

Figure 1.1: Modular domain architecture of AHR...... 4

Figure 1.2: Classical AHR pathway...... 15

Figure 1.3: NF-κB pathway and the possible levels at which AHR can exert repression...... 42

Figure 1.4: Alternate models proposed for AHR-mediated activation of gene transcription...... 49

Figure 1.5: Alternate models proposed for AHR-mediated repression of gene transcription...... 50

Figure 2.1: TCDD increases Epiregulin mRNA...... 64

Figure 2.2: Epiregulin promoter occupancy by the ligand-activated AhR...... 66

Figure 2.3: AhR binds DRE in rat Epiregulin promoter...... 69

Figure 2.4: Epiregulin and TCDD increase primary mouse keratinocyte proliferation in a dose-dependent manner...... 71

Figure 2.5: The DRE is absent in the human epiregulin promoter...... 77

Figure 3.1: CAR mRNA levels increase in response to the AhR-ligand BNF...... 94

Figure 3.2: CAR up-regulation is AhR-dependent...... 97

Figure 3.3: Temporal and spatial patterns of CAR expression...... 99

Figure 3.4: AhR-dependent CAR up-regulation leads to increased CAR- mediated transcriptional activity...... 102

Figure 3.5: CAR induction in response to AhR ligands in primary human hepatocyte culture...... 104

Figure 4.1: Functional dissociation of the properties of AHR involved in Saa3 repression...... 122

Figure 4.2: AHR functional mutants...... 125

Figure 4.3: AHR represses Saa3 induction by various cytokines...... 127

viii Figure 4.4: Dose-response and ligand-specificity analysis of AHR mediated repression of Saa3...... 129

Figure 4.5: AHR-mediated Saa3 repression is due to direct transcriptional inhibition...... 131

Figure 4.6: AHR activation represses other Saa-family member gene expression...... 133

Figure 4.7: AHR represses Saa induction by physiologically attainable cytokine concentrations...... 136

Figure 4.8: ChIP assay to determine the effect of AHR activation on Saa1, Saa2 and Saa3 promoters...... 138

Figure 4.9: Effect of HDAC inhibition on Saa expression...... 140

Figure 4.10: AHR activation induces SOCS genes...... 142

Figure 4.11: AHR activation represses other APR genes as well...... 144

Figure 4.12: AHR-mediated repression in human cells...... 146

Figure 4.13: Saa repression in human cells is AHR-dependent...... 148

Figure 4.14: AHR-mediated NF-κB suppression is gene-specific...... 149

Figure 5.1: Schematic for a screen to identify ‘Selective AHR Modulators – SARM’...... 166

ix LIST OF TABLES

Table 1.1: Modular domain architecture of AHR...... 5

Table 1.2: Allelic variation in murine AHR...... 7

Table 1.3: Genes regulated by the classical AHR pathway...... 30

Table 3.1: Sequence information for primers used in qPCR...... 85

Table 3.2: BNF-mediated differentially regulated genes, sorted by Biological Process (BP)/Molecular Function (MF)...... 88

Table 4.1: List of genes regulated by A78D-AHR and WT-AHR...... 121

x ACKNOWLEDGEMENTS

I would like to take this opportunity to thank everyone who helped me in my research. Dr. Gary Perdew, my thesis advisor, has been a great source of encouragement and advice. His optimism and patience have been invaluable in my learning. Dr. Jeffrey

Peters has been kind enough to share advice and lab equipment for animal work and Dr.

Dae Joon Kim, a former member of the Peters lab, did the primary keratinocyte experiments in Chapter 2. Dr. Curtis Omiecinski procured primary human hepatocytes used for experiments in Chapter 3. Dr. Naomi Altman provided valuable suggestion for microarray data analysis. I would also like to thank Dr. Brett Hollingshead for animal treatments in Chapter 3. Dr. Iain Murray helped in the isolation of primary mouse hepatocytes used in Chapter 4 and for his overall help when I joined the lab. Dr. Ann

Kusnadi performed dose-response experiment in Chapter 4. I would also like to acknowledge DNA-microarray facility and the animal care facility. Finally, I am grateful for the love and support of my parents, my wife and one-year old daughter, Roma!

xi

‘Maatru Devo Bhaava’

- ancient Hindu teaching

‘Maatru devo bhaava’ appears at the beginning of the Vedaas – the four books of the

foundation of Hindu religion. It means ‘Always hold mother as God’. I dedicate this

thesis to my mother who devoted her life to nurture mine.

Chapter 1

INTRODUCTION

2

1.1 History and Characterization

1.1.1 Discovery of AHR:

Even before the existence of aryl hydrocarbon receptor (AHR) was conceived, researchers detected aryl hydrocarbon hydroxylase (initially B[a]P hydroxylase) activity in mammalian cell cultures that was inducible in response to aromatic hydrocarbons (1-

3). The observation that some mouse strains (C57BL/6) are responsive to the inducer of this hydroxylase activity while others (DBA/2) are not, and that ‘responsiveness’ is inherited in a dominant fashion, further indicated the involvement of a receptor protein in this mechanism (4, 5). Subsequent studies that examined the characteristics of induction of aryl hydrocarbon hydroxylase substantiated the notion of aryl hydrocarbon receptor. In a landmark report, Poland et. al. determined various [3H]TCDD-binding properties, such

as dissociation constant, of the hepatic cytosol from C57BL/6 mice and provided

convincing evidence that TCDD-binding species is a receptor (6). Examination of 23 other dioxins tested for their binding-properties to hepatic cytosol, revealed a correlation with their ability to induce hydroxylase activity. Later on, the synthesis of a photoaffinity ligand, 2-azido-3-iodo-7,8-dibromadibenzo-p-dioxin (7), facilitated the purification of

AHR and generation of antibodies to the receptor (8-10). These initial observations and

tools laid the basis for further research on AHR.

3 1.1.2 AHR structure:

The field of AHR has always drawn inspiration from the advancements in steroid receptor biology, especially the glucocorticoid receptor (GR). Though AHR behaves biochemically in a manner similar to GR, the architectural layout of AHR’s functional domains differs significantly from that of GR. Nuclear receptors have an amino-terminal activation function (AF-1) domain, a central DNA-binding domain (DBD) and a carboxy- terminal ligand-binding domain (LBD) which also encompasses the activation function

(AF-2) domain. The LBD also serves dimerization, coregulator recruitment and nuclear localization functions (reviewed multiple times, including (11). AHR, on the other hand, is a basic-helix-loop-helix (bHLH) PAS (Period (Per), Aryl Hydrocarbon Receptor

Nuclear Translocator (ARNT), Single Minded (Sim)) protein. The bHLH family of transcriptional regulators are involved in critical cellular processes (12). In general, the basic region imparts DNA binding ability while the HLH region serves as a dimerization domain along with a second one located in the PAS region. The PAS domain is a 250-

300 amino acid region comprising of two degenerate 50 amino acids subdomains (PAS A and PAS B). Like the LBD of the steroid receptors, the PAS domain mediates a number of functions – dimerization with other bHLH/PAS proteins, association with chaperones in the cytoplasm and ligand binding (reviewed in (13)). A systematic deletion analysis of

AHR and ARNT proteins has helped identify the role of various amino-terminal domains in the AHR signaling pathway (14, 15).

4 While the amino-terminal domains of AHR are responsible for generic functions like ligand and DNA binding, the carboxy-terminal domains impart a control over the transcriptional activation by mediating interactions with coregulator proteins. The initial report involved generation of chimeric proteins with the DNA-binding domain of yeast protein Gal4 and various deletion mutants of AHR and ARNT (16). Results from this study also demonstrated that the amino-terminal domains of AHR and ARNT were devoid of transactivation potential. A schematic representation of the distribution of AHR domains is presented in Figure 1.1 , and Table 1.1 summarizes the location and functions of various AHR domains.

Figure 1.1: Modular domain architecture of AHR AHR is composed of many domains. From the amino terminal to the carboxy terminal, these are the basic domain, helix-loop-helix (HLH) domain, Per-ARNT-Sim (PAS) A and B domains,

5

Table 1.1: Modular domain architecture of AHR.

Amino acid Motif / Domain Functions span Basic 12 – 39 DNA binding Helix-loop-helix 40 – 80 Dimerization, HSP90 binding Pas A 116 – 179 Dimerization Pas B 269 – 336 Dimerization, HSP90 binding, ligand binding (PAC) PAS – associated It is proposed to contribute to the PAS domain 342 – 380 C-terminal domain fold Acidic subdomain 491 – 593 Gln-rich subdomain 594 – 648 Part of the transactivation domain (C-terminal) PST subdomain 648 – 805 NLS 12 – 38 Nuclear localization signal NES 62 – 72 Nuclear export signal

6

1.1.3 AHR alleles and polymorphisms:

AHR demonstrates inter- as well as intra-species variation. In mice, there are four allelic variations in inbred strains that differ significantly in their biochemical properties and transactivation potential. As described, this allelic variation, in fact, helped in identification of AHR. The differences in the four mouse alleles are summarized in

Table 1.2. In addition, the Han/Wistar (Kuopio) strain of rats is significantly more resistant to the toxic effects of TCDD as compared to other rat strains. A point mutation that leads to alternate splice variant of AHR is believed to be responsible for this variation (17). Polymorphisms in human AHR have also been documented. Arg554Lys,

Pro517Ser and Val570Iso are the only polymorphisms supported by phenotypic effects

(18). Even these polymorphisms do not affect CYP1A1 induction individually. Paired polymorphisms at the 554 and 570 amino acids can more effectively inhibit CYP1A1 induction in vitro (19). Since all of these mutations are in the transactivation domain, it is likely that they alter the cohort of coregulator proteins recruited by AHR for gene regulation, leading to phenotypic variation. Since the physiological roles of AHR have not been conclusively established yet, it is difficult to assess the phenotypic association of polymorphisms outside the realm of xenobiotic metabolism.

7

Table 1.2: Allelic variation in murine AHR. Allele Allele Definition

Ahrb-1 • high affinity, relatively heat stable, 95 kDa receptor. • ten nucleotide differences between the coding sequences of the DBA/2J and C57BL/6J receptors. Five of the ten differences would cause amino acid changes. • one of these, a C to T transition in exon 11 would change the arginine codon in the DBA/2J allele to a termination codon. • C57, C58 and MA/My Ahrb-2 • high affinity, heat labile, 104 kDa receptor containing 848 amino acids. • BALB/cBy, A and C3H Ahrb-3 • high affinity, 105 kDa receptor with slightly more heat stability. • M. spretus, M. caroli and MOLF/Ei

Ahrd • 104 kDa receptor that is stabilized by molybdate. • affinity for ligand 10-100 fold lower than that of the receptor produced by the C57BL/6J allele. • DBA, AKR and 129

8

1.2 AHR activation:

AHR has always been described as a ligand-activated transcription factor.

Majority of research has been conducted by activating AHR with exogenous ligands, though there is an active ongoing search for an endogenous ligand as well. Non-ligand based AHR activation has also been reported. Important findings from the literature related to AHR activation are discussed here.

1.2.1 Exogenous ligands:

A number of aromatic hydrocarbons are capable of binding to AHR. Most of these can be classified as either polycyclic aromatic hydrocarbons (PAH) or halogenated aromatic hydrocarbons (HAH) (20). The structure of the ligand binding domain of AHR has not been established by x-ray crystallography studies. However, structure-activity relationship and binding affinity studies suggest that the ligand pocket can accommodate a compound that is planar, 12-14 Å long, 12 Å wide and 5 Å deep (21, 22). Generally, halogenated compounds have a higher affinity for the receptor. PAH, such as benzo[a]pyrene (B[a]P) and 3-methyl cholanthrene (3-MC), and HAH, such as polychlorinated dibenzo-p-dioxins (PCDD, including TCDD), biphenyls and dibenzofurans, are generated as a result of industrial processes like paper bleaching, waste incineration, and combustion, as well as cigarette smoking, automobile exhaust and charbroiled foods (23, 24). Polychlorinated biphenyls are also found in insulation

9 materials, adhesives and flame retardants. Thus, compounds capable of activating AHR are ubiquitous and impossible to avoid.

1.2.2 Endogenous ligands:

In the absence of a proven physiologically relevant endogenous ligand, AHR is still classified as an orphan receptor. There are a number of candidates (e.g. bilirubin) that can claim to be the endogenous activator of AHR, but, most of them have significantly lower affinities for the receptor as compared to TCDD (reviewed in (25,

26)). Consequently, a very high plasma concentration would be required for each of these candidates to activate the receptor. However, there are three important caveats that challenge the search for an endogenous ligand. First, though it would be highly improbable to achieve the required plasma concentration physiologically, it is possible that the local availability of an endogenous ligand might be adequate to activate the receptor. Second, the suitability of a ligand is measured by its ability to activate the prototypical AHR target gene Cyp1a1. Cyp1a1 does not have an explained role in many of the pathophysiological processes attributed to AHR. An endogenous ligand cannot be expected to activate AHR with an intention to upregulate Cyp1a1 to the same extent as exogenous environmental pollutants. Therefore, to identify an endogenous AHR ligand, it is essential to explicitly describe the role of AHR in cellular processes including the site of action and a measurable endpoint that is unrelated to xenobiotic metabolism. Finally, in many cases the proposed ligand may be unstable, making it difficult to differentiate whether the parent compound or a metabolite binds the receptor.

10

Endogenous AHR ligands include food derivatives, though not ‘truly’ endogenous, as well as de novo compounds synthesized in the body. Indole 3-carbinol

(I3C) and its acid condensation products indolo-(3,2,-b)-carbazole (ICZ) and diindolylmethane (DIM) (27-29) as well as curcumin (30), carotinoids and flavanoids, such as quercetin (31), are all derived from diet and have been shown to activate AHR.

Indigo and indirubin are tryptophan metabolites, previously used for dyeing fabrics.

These indigoids have been isolated from human urine and can activate the mammalian receptor in cultured cells (32, 33). Tryptamine (TA) and indole acetic acid (IAA) (34) and

6-formylindolo[3,2-b]carbazole (FICZ, a UV irradiation photoproduct (35, 36)) are derived from tryptophan and have been shown to bind AHR and drive DRE-mediated transcription. Arachidonic acid metabolites such as Lipoxin A4 (37) and prostaglandin G2

(38) as well as heme metabolites like bilirubin and biliverdin (39, 40) have also demonstrated AHR activation capabilities. Interestingly, AHR mediated induction of

UDP-glucuronyl transferase can detoxify bilirubin and thus serve as a feedback mechanism. Equilenin, an estrogenic molecule present in the widely prescribed hormone replacement therapy, Premarin, can also activate AHR. Equilenin induced CYP1A1 activity is independent of the ligand-affinity of different AHR alleles (41). Thus, candidate endogenous ligands are generated from a variety of sources under diverse scenarios.

11 1.2.3 Ligand-independent AHR activation:

AHR can also be activated in the absence of exogenous ligand, probably through post-translational modification. When rat epithelial cells (42), murine hepatoma cells (43) and human keratinocytes (44) were cultured in suspension, enhanced CYP1A1 transcription was detected. However, this response could also be attributed to the release or synthesis of a ligand endogenously. Even when adhered to tissue culture containers, cell confluence, and thus cell-cell contact, has been shown to modulate AHR activity; a higher DRE-driven reporter activity was noted when cells were sparsely seeded (45). An increase in cAMP can also activate AHR in Hepa1c1c7 cells, leading to its nuclear translocation and induction of target genes (46).

1.3 AHR pathway:

AHR signaling pathway can be broadly divided into three phases:

• the ‘resting’ cytoplasmic AHR complex,

• nuclear translocation upon ligand activation and exchange of partner proteins and

• DNA-binding and transcriptional activation of target genes.

Chemical crosslinking studies in Hepa1c1c17 cell fractions have demonstrated that in the absence of a ligand, AHR exists as a heteromeric, predominantly as a tetrameric, complex in cytosol (47). Prior to this study, it had already been established that 90-kDa heat shock protein (HSP90; current gene symbol: HSP90AA1) could

12 associate with cytosolic AHR (48, 49). Later on, it was realized that in fact two molecules of HSP90 are present in the AHR complex (50). In vitro translation of AHR deletion mutants using reticulocyte lysate revealed that amino acid sequences 1-166 and 289-347 of AHR mediate HSP90 association (51). A number of studies have examined the role of

HSP90 in the AHR-complex. It is believed that the most important functions of HSP90 are to maintain the receptor in a ligand-responsive state and stabilize it from proteolytic turnover (52, 53).

Hepatitis B virus X-associated protein 2 (XAP2, also referred to as ARA9 or AIP) was later identified to be the fourth member of the tetrameric complex (54, 55). Further studies using cos-1 and Hepa1c1c7 cells revealed that XAP2 can independently associate with AHR as well as HSP90 through three tetracotripeptide sites and that the AHR and

XAP2 binding sites on HSP90 do not overlap (56, 57). Elucidation of the role of XAP2 in

AHR complexes has led to conflicting results obtained from cell culture and mouse models. Based on cell culture experiments, it seems that XAP2 plays an important role in determining the subcellular localization of AHR (57, 58), while studies with a hepatocyte-specific XAP2 gain-of-function/overexpression transgenic mouse model did not reveal an alteration in localization or activity of AHR (59). Since XAP2 knock-out mice are embryonic lethal (60), tissue-specific XAP2 knock-out mice are required to definitively address this issue. HSP90 associated cytoplasmic molecular chaperone machinery is common to a number of other receptors. An effort to confirm whether observations from progesterone receptor could be extrapolated to AHR, revealed that p23 is also a member of AHR cytoplasmic complex (61). Though p23 has not been

13 extensively studied in the context of AHR-complex, it is believed that it facilitates ligand- responsiveness and transformation of AHR to a DNA-binding state (62, 63).

Ligand-binding is believed to initiate a series of ill-defined conformational changes in AHR that promote nuclear translocation, dissociation from the cytosolic complex and heterodimerization with aryl hydrocarbon nuclear translocator (ARNT).

This is perhaps one of the least characterized aspects of AHR pathway. It is not clear when and how the AHR dissipates its cytoplasmic complex, though it has been demonstrated with photo-affinity ligands that in Hepa1c1c7 cells, AHR-HSP90 complex can be isolated from the nuclear fraction (64). However, XAP2 has not been isolated from nuclear forms of AHR (57). Furthermore, a bipartite nuclear localization sequence

(NLS) and a nuclear export sequence (NES) have been identified in AHR (65).

Microinjection of AHR fragments fused to glutathione S-transferase (GST)-green fluorescent protein (GFP), nuclear export inhibitor – Leptomycin B and co- immunoprecipitation identified chromosome region maintenance 1 (CRM-1) to be a facilitator of AHR export (66). Similarly, an association between importer protein β- importin and the AHR-complex has been show to be involved in nuclear import (67).

After nuclear localization, AHR dimerizes with another bHLH-PAS protein,

ARNT (68). Even before the identification of ARNT, it was known that the nuclear form of AHR exists as a heterodimer (47). ARNT serves as a common dimerization partner to other bHLH-Pas proteins and can even function as a homodimer (69). It is primarily nuclear and its function is not dependent on ligand-activation (reviewed in (70)). AHR-

14 ARNT heterodimer recognizes cognate response element (known as dioxin response element (DRE) or xenobiotic response element (XRE)) sequences in promoters/enhancers and recruits a number of coactivators to induce transcription of target genes. The binding sequence for AHR-ARNT was identified initially by an 82-bp Cyp1a1 enhancer driven reporter assays (71), and then narrowed down to the core DRE (5`-TNGCGTG-3`) by electrophoretic mobility shift assays using synthetic oligonucleotides (72). Based on the information from other bHLH proteins, it is known that ARNT binds the GTG half-site while AHR recognizes TNGC half-site. However, this core sequence is not sufficient to form a functional enhancer and flanking nucleotides must contribute to the DRE (72).

However, a position weight matrix has not been identified for these flanking nucleotides.

A simplified schematic of AHR pathway is presented in Figure 1.2 .

Thus, extensive research focusing on AHR activation has highlighted the details of various steps involved in AHR signaling, though there remain certain aspects requiring further experiments. Many of these ambiguous aspects might not have a single face, but could be context-specific instead; for example, different ligands might transform the receptor in diverse ways which would, in turn, dictate differential coregulator recruitment and gene regulation. It is also noteworthy that the human and mouse AHR differ significantly (73-75), possibly resulting in the development of alternate viewpoints with respect to the potential adverse effects of AHR activation. In addition to the ‘classic’ pathway described above, new developments have focused on alternate modes of AHR activity, such as receptor cross-talk (discussed later).

15

Figure 1.2: Classical AHR pathway. Under basal conditions, AHR resides in the cytoplasm in a complex with HSP90, XAP2 and p23. Upon ligand activation, AHR translocates to the nucleus where it switches its cytoplasmic partner proteins for ARNT. AHR-ARNT heterodimer then drives transcription by binding to its response elements in the promoter/enhancer of its target genes.

16

1.4 AHR mouse models:

Most of the available mammalian AHR biology information has resulted from experiments using the murine system. Over the last few years, a number of mouse models have been developed to explore the role of AHR. Both, loss-of-function as well as gain- of-function models have provided insight into the physiological relevance of AHR.

1.4.1 AHR-null mouse models:

Three AHR knock-out mouse models have been reported, each generated with a slightly different strategy. The first AHR knock-out mouse was developed in Dr.

Gonzalez’s lab. Exon 1 (subsequently referred to as Δ1/Δ1) of the Ahr gene in J1 embryonic stem cells was partially replaced by a neomycin (neo) cassette by homologous recombination using an engineered fragment from 129SvJ genomic library. Screened clones were injected into C57BL/6 embryos to generate chimeric mice which were then back-crossed to the C57BL/6N background (76). The second AHR knock-out mouse was generated in Dr. Bradfield’s lab by replacing exon 2 (subsequently referred to as Δ2/Δ2) with a neo cassette in R1 embryonic stem cells. The final animals were derived on a

C57BL/6J background (77). In a third AHR knock-out model, generated in Dr. Fujii-

Kuriyama’s lab, a lacZ gene with a poly-A tail was fused downstream of exon 1 in CCE embryonic stem cells and the male chimeras were mated with C57BL/6J females to generate heterozygotes (Ahr+/-). These animals were then interbred (78).Δ1/Δ1 and Δ2/Δ2

17 AHR knock-out models have been more widely utilized as compared to the third model, probably due to the fact that the mixed genetic background of the third model makes it difficult to compare the results with established mouse lines.

The main phenotypic features observed in Δ1/Δ1 model include a 40-50% neonatal mortality and hypocellularity of spleen and peripheral lymph nodes, but not in the thymus, during the first few weeks of life (76). However, the mice that did survive were fertile. Subsequent studies also revealed fibrotic cardiomyopathy, vascular abnormalities and fibrosis in uterus and liver, polyp formation in stomach, enhanced susceptibility to Helicobacter infection, almost 50% rectal prolapse rate and skin changes resembling psoriasis (79). Δ2/Δ2 mice did not exhibit most of these phenotypic features, but did suffer from persistent embryonic vascular structures (most notably a patent ductus venosus) (80), microscopic fatty changes in the liver, fibrosis of the portal regions in the liver, spleenomegaly with increase in mononuclear cell fraction (77). Unlike Δ1/Δ1 mice,

Δ2/Δ2 mice demonstrate reduced fertility, probably correlating with decrease ovarian germ cells (81) and reduced pre-antral and antral follicles (82). However, all three AHR knock-out models do share growth retardation and a smaller liver size as compared to wild-type mice. Also, all three models are resistant to teratogenic and toxic effects of

TCDD (78, 83). The reason for differences in the observed phenotypes is not evident, though genetic variation and environmental factors have been proposed (84). An AHR and NRF2 double knock-out mouse has also been generated to study the interaction of these two receptors in regulation of phase II xenobiotic metabolism enzymes (85).

18 1.4.2 Other transgenic AHR mouse models:

In addition to the knock-out approach, several other models have employed different AHR manipulations in an attempt to delineate the AHR’s contribution to cellular processes. Poellinger and co-workers used a previously engineered constitutively active AHR (CA-AHR) mutant (deletion of amino acids 288-421 involving the ligand binding domain) (86) and subcloned it to express under the mouse Ig heavy chain intron enhancer and a modified simian virus 40 promoter. Transgenic mice were created by pronuclear injection into fertilized C57BL/6 × CBA eggs and backcrossed for two generations to C57BL/6 strain (87). The CA-AHR was expressed in liver, lung and stomach, in addition to the expected expression in thymus and spleen. These mice demonstrated cystic tumors in the glandular portion of the stomach and exhibited histological resemblance to hamartomas and intestinal metaplasia. Males suffered a higher frequency as well as severity of tumors. Another noticeable trait was a significant reduction in longevity, with most mice not surviving beyond 12 months (87). Later, these mice were crossed with C3H/He mice and the offspring were treated with N- nitrosodiethylamine (single intraperitoneal injection at six weeks). After thirty-five weeks, the CA-AHR mice demonstrated a significantly higher burden of liver tumors. A comparison of gene expression profile revealed down-regulation of heat shock proteins in

CA-AHR mice liver, though a definite link was not established with the observed phenotype (88).

19 Another model involved the study of an AHR mutant incapable of nuclear translocation and DRE-binding. As discussed, the AHR possesses a bipartite NLS sequence within the basic region that overlaps the DRE-binding domain. Arg, His and

Arg were changed to Ala, Gly and Ser at the 37-39th positions by PCR in a 15 kb region

from the 129SvJ genome that was homologous to the AHR sequence surrounding its

second exon. The mutated fragment was introduced in GS1 embryonic stem cells for

homologous recombination. Targeted clones were injected into C57BL/6 blastocysts and

subsequently backcrossed to Ahrd allele bearing C57BL/6 mice. The resulting Ahrnls/nls mice behaved exactly like the Ahr-/- mice with respect to TCDD toxicity and teratogenicity as well as AHR-DRE mediated gene expression. However, Ahrnls/nls mice

had normal fertility, unlike the Ahr-/- mice (89).

Bradfield and co-workers described vascular malformations (ductus venosus) in

Ahr-/- mice (80). In an effort to determine whether AHR activation during embryogenesis

could rescue this vascular aberration, they generated AHR- and ARNT-hypomorphic

mice (90, 91). A 15 kb region homologous to the Ahr locus was modified to introduce a

neomycin cassette and flank exon 2 as well as the neo cassette with loxp sites.

Ahrfxneo/fxneo (hypomorphic AHR) mice were generated using a strategy similar to that of

Ahrnls mice. AHR protein expression as well as its transcriptional activity in these hypomorphic mice was approximately 10-15% of the wild-type. Vascular anomalies in the Ahrfxneo/fxneo mice mimicked those of Ahr-/- mice, but were completely prevented by

treating pregnant mice with dioxin. This result clearly establishes a role for AHR in

embryonic vascular development.

20

Persistent ductus venosus in mice lacking a functional AHR could be due either to

AHR function in the hepatocytes or in endothelial cells. Bradfield and co-workers employed Cre-lox technology and derived conditional AHR knock-out mice to determine the answer. First, the Ahrfxneo/fxneo mice were crossed to a transgenic line that expresses

Cre under the EIIa promoter to remove the neo cassette. Next, the Ahrfxneo/+CreEIIa mice

were backcrossed to C57BL/6 strain and then, again crossed to the hepatocyte specific

CreAlb mice or the endothelial cell specific CreTek mice. Finally, the animals were backcrossed again to the C57BL/6 strain. Liver angiography demonstrated that ductus venosus was only observed in the endothelial cell-specific AHR knock-out mice

(Ahrfx/fxCreTek) and not in the hepatocyte-specific AHR knock-out mice (Ahrfx/fxCreAlb).

However, other AHR expression in hepatocytes was found to mediate other aspects of

TCDD toxicity (92).

Since the mouse and human AHR differ in their properties, including ligand- binding and the C-terminal domain, attempt has been made to generate a mouse model that expresses the human AHR (hAHR). Human Ahr cDNA expressed under the control of 129SvJ mouse Ahr promoter, was introduced in E14 embryonic stem cells for homologous recombination. Ultimately, the hAHR knock-in mice were backcrossed to

C57BL/6 strain. The authors concluded that hAHR knock-in mice are resistant to the transcriptional and teratogenic effects of TCDD (93). However, the report does not demonstrate AHR protein expression.

21 1.4.3 Biosensor mouse models based on AHR:

Gene transcription is often used as the end-point for determining the suitability of a compound as an AHR ligand. However, in vivo experiments require sacrificing the animal and thus limit the range of possible experiments. A mouse model with an easily measurable marker under AHR regulation can serve to detect and study potential ligands.

To this end, a transgenic mouse on C57BL/6 background, with a DRE-driven secreted alkaline phosphatase (SEAP) has been generated. Upon oral administration of AHR ligands, only TCDD elicited a sustained (>40 days) serum SEAP activity. The mice also demonstrated reliable increase in SEAP upon exposure to cigarette smoke (94).

1.5 AHR Regulated Genes:

Gene regulation is the most well characterized function of AHR. In fact, until recently, the majority of efforts in the field of AHR biology have been focused on understanding the details of how the ligand-activated AHR enhances transcription of its target genes. The classical AHR-gene battery comprises of xenobiotic metabolizing enzymes. AHR has been shown to regulate the expression of enzymes involved in both

Phase I as well as Phase II metabolism reactions. These enzymes serve to modify chemical groups on xenobiotics with an intention to render them more polar and thus, easy to excrete. Regulation of these enzymes signifies the role of AHR in metabolic adaptation. A third group of proteins that are involved in the efflux of PhaseI/II substrates have been ‘unofficially’ labeled as Phase III. AHR has also been found to regulate some

22 members of this group. Unlike many other transcription factors, the cognate sequence recognized by AHR – the dioxin response element (DRE) – is relatively well defined.

This, and the use of AHR-specific ligand TCDD, provides a relatively simple model to define whether a gene is a direct AHR target or not.

This section is devoted to AHR-mediated gene regulation. After a brief overview of the established AHR target genes, the xenobiotic metabolizing enzymes are presented.

A significant number of other genes have been described to be directly regulated by

AHR. Most of these have been identified from high-throughput screens. These novel target genes are unrelated to xenobiotic metabolism and are expressed in a variety of tissues, suggesting a broader role for AHR in cellular processes. Unfortunately, in many cases, following the initial characterization, these target genes have not been further researched. In addition to the directly regulated genes described here, AHR has been found to interact with other signaling pathways, such as the estrogen receptor and NF-κB, and influence the expression of genes regulated through those pathways. Such ‘co- regulated’ genes have been discussed in the respective sections. Since the mechanism of

AHR-mediated gene repression has not been established, down-regulated target genes have been discussed in detail. Genes whose regulation most likely involves the prototypical AHR-DRE pathway are summarized in a tabular format.

23 1.5.1 Phase I and Phase II enzymes:

Cyp1a1: Cytochrome P450 family 1 subfamily A member 1 (Cyp1a1) is a monooxygenase localized to endoplasmic reticulum. It is the prototypical AHR target gene and induction of this gene has been extensively utilized as an end-point to study various aspects of AHR activation. In rodents as well as humans, well-characterized

DREs have been described in the promoter/enhancer regions of the Cyp1a1 gene. Unlike

Cyp1b1, Cyp1a1 expression is almost exclusively regulated by AHR and this provides a simple model to assess AHR transcriptional activity. Cyp1a1 is expressed primarily in the liver and lung tissues and is also believed to function in the intestine (95). Cyp1a1-null mice demonstrated significantly higher sensitivity to oral benzo[a]pyrene than Cyp1a2- null or Cyp1b1-null animals. Due to its involvement in detoxification of polycyclic aromatic hydrocarbons, it is expected that Cyp1a1 imparts a protection against chemical- induced carcinogenesis. A specific African-American Cyp1a1 polymorphism has been associated with adenocarcinoma of the lungs in individuals who smoke (96). A second polymorphism has also been associated with breast cancer risk in African-American women (97).

Cyp1a2: Cyp1a2 expression is primarily restricted to the liver and of all the Cyp1 family members, Cyp1a2 has been associated with the metabolism of common drugs more than others. Drugs like omeprazole, phenytoin and rifampin induce Cyp1a2 activity, while others like quinolone antibiotics and fluvoxamine (antidepressant) inhibit its activity. Cyp1a2 metabolizes many anti-psychotic and anti-depressant drugs, theophylline

24 (broncho-dilator) and warfarin (anti-coagulant). Since some of these drugs have a narrow therapeutic index, co-administration of a Cyp1a2 inhibitor can elevate the plasma levels of these drugs and unexpectedly result in adverse reactions. Cyp1a2 also metabolizes caffeine, an ingredient commonly found in hot beverages.

In humans, Cyp1a1 and Cyp1a2 are located on the same chromosome within 25 kb of each other. Functional DREs have been identified individually for both genes.

Interestingly, an attempt to reassess the regulation of these genes revealed that the DRE cluster closer to Cyp1a1 can function bidirectionally to regulate Cyp1a2 as well (98).

Cyp1b1: Cyp1b1 is expressed in extra-hepatic tissues in humans as well as rodents. Cyp1b1 can also be regulated by signals other than AHR activation. Primary congenital glaucoma has been linked to Cyp1b1 polymorphisms (99), suggesting that in addition to phase I metabolism, Cyp1b1 is also involved in developmental processes.

Cyp2s1: Dioxin induces Cyp2s1 in mice through three upstream DREs.

Chromatin immunoprecipitation (ChIP) assays demonstrated presence of AHR-ARNT heteromer at Cyp2s1 promoter. Interestingly, another ARNT based heteromer, hypoxia inducible factor-1 (HIF-1)-ARNT, can also upregulate Cyp2s1 by binding the same regulatory promoter region.

Cyp2a5: Cyp2a5 is expressed in liver, kidney and various tissues of the respiratory tract. Using TCDD in primary hepatocytes and 3-MC in vivo, Arpiainen and

25 co-workers reported induction of Cyp2a5 upon AHR activation (100). Induction of

Cyp2a5 varied with the ligand-affinity of AHR in C57BL6 and DBA/2 mice. The increase in functional activity of Cyp2a5 was assessed by a coumarin 7-hydroxylation assay. Reporter assays with a 3 kb Cyp2a5 promoter construct identified a functional

DRE. However, mutation of this DRE did not completely abolish reporter activity.

Subsequently, the same group published another report claiming that Cyp2a5 transcription can be controlled by the binding of ARNT homodimers to an E-box site in the promoter. Unlike other AHR-ARNT regulated genes, ARNT transactivation domain was required for Cyp2a5 transcription (69). CYP2A13 is the human homologue of murine Cyp2a5.

AHR also regulates various Phase II enzymes such as NAD(P)H menadione oxido-reductase 1 (NQO1), glutathione S-transferase A2 (GSTA2), UDP glycosyltransferase 1 family, polypeptide A1 (UGT1A1), UGT1A6 and aldehyde dehydrogenase 3 family, member A1 (ALDH3A1), as reviewed in (101). This clearly establishes a pivotal role for AHR in regulating xenobiotic metabolism.

1.5.2 Other AHR regulated genes:

NRF2: NF-E2 p45-related factor (NRF2) is a transcription factor that is activated by electrophilic compounds, binds antioxidant response elements (ARE) and regulates phase II metabolism enzymes. The gene battery of NRF2 and AHR overlap and probably this led investigators to hypothesize that these two transcription factors might

26 functionally interact. TCDD treatment induced NRF2 protein as well as Nrf2 mRNA in

Hepa1c1c7 cells. This induction was lost upon AHR-knockdown by siRNA oligos. ChIP assays demonstrated recruitment of AHR to three imperfect DRE sequences found in the putative Nrf2 regulatory region (102). Conversely, another report demonstrated that

NRF2 can regulate constitutive expression of AHR. Pharmacological activation of NRF2 induced Ahr, Cyp1a1 and Cyp1b1 mRNA in mouse embryonic fibroblasts. NRF2 binds an ARE located 230 bp upstream of Ahr transcription start site (103). Both these studies were performed using murine models and further studies are required to verify this effect in humans. It has also been suggested that AHR-mediated CYP1A1 upregulation can lead to an increase in electrophiles in the cell, which in turn can activate NRF2 (104).

EGR1: Early growth response 1 (EGR1) was identified as a differentially regulated gene in by toxicogenomic approaches in human lung epithelial cells (105).

Subsequently, it was proposed that TCDD prolongs the half-life of EGR1 mRNA rather than direct transcriptional induction. However, this conclusion was loosely based on the inability of TCDD to drive expression from reporter plasmids (106).

c-myc: Two different reports have been published on the effect of AHR on c-myc expression in human mammary epithelial cell-lines. The first report demonstrated that

RELA (p65) subunit of NF-κB and AHR positively interact to induce c-myc RNA (107).

AHR and RELA physically interact with each other and increase reporter activity from a c-myc promoter construct in a dose-dependent manner by forming a novel transcriptional complex that binds the κB element in the c-myc promoter. Most experiments required

27 over-expression of AHR and RELA, and an increase in c-myc protein was not demonstrated. The second report from the same laboratory claimed that AHR constitutively represses c-myc transcription in the same cell-lines (108). Five DRE-like and one DRE are present in the 3.2 kb promoter of human c-myc gene. Reporter assays using wild-type and mutated constructs revealed that at least two response elements are functional. Inhibition of constitutive AHR activity by transient expression of AHR- repressor (AHRR) led to an increase in c-myc RNA and protein. These results provide contrasting roles of AHR at the same promoter and should be explored further in primary cells.

MHC Q1b: Major histocompatibility complex Q1b is a non-classical class I MHC

whose function is not well defined. MHC Q1b was identified by differential display as the

sole TCDD-responsive gene that was down-regulated in Hepa1c1c7 cells. A relatively

low dose TCDD treatment (100 pM) repressed MHC Q1b RNA by sixty percent after 16

h. AHR dependence was verified by transfecting Hepa1c1c7 cells with a dominant

negative AHR mutant (R39A) that is capable of heterodimerization, but incapable of

binding DNA. Interestingly, when cells were treated with the translational inhibitor actinomycin D, MHC Q1b RNA levels remained unchanged even at 12 h (109). Although

microRNA concept was not prevalent at that time, these results strongly suggest AHR

mediated microRNA upregulation as a potential mechanism for MHC Q1b down-

regulation.

28 T-cadherin: T-cadherin is an atypical member of the cadherin family of adhesion molecules that is abundantly expressed in heart and vascular tissues. A DRE-like element is present in the 5` untranslated region (UTR) of rat, mouse and human T-cadherin genes.

However, it was not determined if this DRE was functional in TCDD-mediated down- regulation. Vascular smooth muscle cells (VSMC) obtained from Wistar Kyoto rat aortas showed a decrease in T-cadherin RNA after 20 h of AHR activation. Notably, the cells had to be treated with high doses of AHR ligands (75-100 nM TCDD or 10-30 µM

B[a]P). AHR antagonism by α-naphthoflavone pre-treatment abolished T-cadherin down- regulation. However, cycloheximide and actinomycin D treatment had no effect on

TCDD-mediated T-cadherin regulation (110).

Dystrophin Dp71: Dystrophin is a 427 kDa cytoskeletal protein, the dysfunction of which leads to Duchenne muscular dystrophy, an X-linked inherited disorder. The

Dp71 isoform is expressed in multiple tissues and bears four DRE-like motifs in its promoter. AHR activation by 50 µM β-naphthoflavone (BNF) for 24 h repressed Dp71 protein by forty percent in Hepa1c1c7 cells. This effect was also observed at 24 h in mice injected with 100 mg/kg BNF (111).

Spp1: Secreted phosphoprotein 1 (commonly known as osteopontin) expression was found to be negatively regulated in the tissues of transgenic mice expressing a constitutively active AHR mutant. These mice have an increased incidence of gastric tumors. Interestingly, immunohistochemistry revealed that the suppression of osteopontin

29 was confined to the corpus portion of stomach and this correlated with tumor occurrence

(112).

In addition to the genes discussed above, a number of other genes have been described to be induced by AHR. These target genes are enlisted in Table 1.3 along with the species, cell-type and significant experimental details.

30

Table 1.3: Genes regulated by the classical AHR pathway. Gene Function Species / Experiments to Ref. Cell-type demonstrate AHR dependence Cycloxygenase-2 catalyzes the conversion Rat insulinoma, Reporter assays, (113- (a.k.a. Prostaglandin of arachidonic acid human breast chemical AHR 116) G/H synthase 2 products to prostaglandin cancer cells, antagonists Human lung fibroblasts, murine lymphatic tissue Small inducible chemotactic for Primary human siRNA, chemical (117) cytokine A1 (CCL1) monocytes but not for macrophages, AHR antagonists, neutrophils Murine lungs ChIP assay Suppressor of cytokine part of a classical Murine B-cell AHR-deficient B (118) signaling 2 (SOCS2) negative feedback system lymphoma cells cells that regulates cytokine (CH12.LX) signal Paraoxonase1 (PON-1) Protective role in Human siRNA, (119) organophosphate hepatoma cell- Quercetin activated poisoning and line (Huh7), significantly better cardiovascular diseases Balb/c mice liver than TCDD DNA polymerase DNA polymerase Murine testes No induction in (120) kappa (POLK) specifically involved in AHR knock-out DNA repair mice testes Scinderin (a.k.a Ca(2+)-dependent actin Immature TCDD (121, Adversin) filament-severing protein thymocytes in responsiveness 122) that is presumed to have a murine thymic correlates with regulatory function in cortex ligand affinity of exocytosis different mouse strains N-myristoyltransferase Adds a myristoyl group to Rat hepatoma AHR-deficient BP8 (123) 2 the N-terminal glycine cells (5L), cells residue Murine liver Gulonolactone oxidase enzyme for ascorbic acid Murine liver Induction varied (124) biosynthesis with mouse strains correlating with ligand affinity of AHR Slug Transcriptional repressor Human ChIP assays, (125) keratinocytes siRNA cell-line (HaCaT) Hairy and Enhancer of Transcriptional repressor Human (126) Split homolog-1 of genes that require a mammary (HES-1) bHLH protein for their carcinoma cells transcription (T47D) Plasminogen activator Mouse hepatoma AHR-deficient (127) inhibitor-1 (PAI-1) cell-line hepatoma cells, AHR antagonists Breast cancer may function as a major Human intestinal AHR antagonists (128) resistance protein control point in the cell line (Caco- (BCRP) regulation of fibrinolysis 2)

31 1.6 Potential physiological roles of AHR:

Though AHR is best known for its regulation of enzymes involved in xenobiotic metabolism, several arguments can be made for the physiological importance of the receptor. AHR orthologues can be traced across the animal kingdom to worms and flies.

This argues against xenobiotic metabolism as being the sole reason for AHR’s existence, as the evolutionary pressures could not have been the same during pre-historic times and throughout animal taxa. In the last couple of decades, interest in identifying the ‘true’ physiological function of AHR has significantly increased amongst the researchers in this field. Development of a variety of mouse models and the availability of high-throughput genomic and proteomic technologies has certainly inspired this quest. Though a physiological function has not been precisely outlined for AHR, various lines of evidence, as discussed below, that indicate a cellular role for AHR are emerging. Most of these potential physiological roles have been inferred from the phenotypes observed in

AHR knock-out mice and, ironically, from TCDD toxicity studies. Certain aspects of this topic are elaborated further in the next section.

1.6.1 Reproduction:

As discussed, AHR knock-out mice demonstrate various levels of impairment in reproduction. AHR-knock out males apparently posses the same potency as wild-type males, though studies are required to confirm this observation. In sexually mature mice

(8-11 week old), AHR is most abundantly expressed in the oocytes (129). Studies have revealed a significant decrease in the efficiency of follicle maturation. This inefficiency is

32 due to inadequate levels of estrogen synthesis in the ovary and not due to alterations in the pattern or levels of gonadotrophins (130, 131). Administration of exogenous estrogen partially rescued this phenotype. Ovaries from AHR knock-out mice weigh significantly less as compared to their wild-type counterparts, in proportion to total body weight. Also, the estrous cycle of knock-out mice was found to be dysregulated. Further exploration identified cooperative regulation of Cyp19 gene by AHR and Ad4BP/SF-1 through DRE- binding (130). Cyp19 enzyme is essential for estradiol synthesis during folliculogenesis.

AHR has also been shown to participate at other stages in successful reproduction, including dynamic tissue changes during blastocyst implantation (132) and development of lactation structures in the mammary gland (133).

1.6.2 Cardiovascular:

AHR knock-out mice demonstrate a decrease in liver weight and this is most likely due to the persistence of a fetal vascular shunt, ductus venosus, resulting in an inadequate blood supply. These effects are observed in the absence of exogenous AHR activation, indicating that AHR might function to ensure proper vascular development. In addition to the ductus venosus anomaly, AHR knock-out mice also demonstrate vascular abnormalities in the kidney and the eye (persistent embryonic hyaloid artery) (80).

Though these effects are labeled as ‘vascular’, they might simply be the result of AHR’s involvement in cell proliferation and apoptosis, the implications of which would obviously be most noticeable in the development of blood vessels.

33 Adult AHR knock-out mice also demonstrate other effects on the cardiovascular system such as cardiac hypertrophy and hypertension (79, 134, 135). However, the anatomical cardiac lesions did not demonstrate the expected changes in molecular biomarkers (135). Elevated arterial pressures in AHR knock-out mice were accompanied by increased levels of two potent vasoactive peptides – angiotensin II and endothelin-1.

Treatment of these mice with captopril, a commonly used antihypertensive, improved some aspects of cardiac functions (136).

1.6.3 Development:

Experiments performed in C.elegans and D. melanogster indicate that AHR and

ARNT orthologues (AHR-1 and AHA-1 in C. elegans, and Spineless and Tango in D. melanogaster) perform important functions in developmental processes such as neuronal differentiation, appendage development and regulation of photoreceptor mosaic

(reviewed in (137)). Even in mammalian systems, AHR contributes to anatomic development and cell differentiation. Increased incidence of hydronephrosis, tortuous ureters and a reduction in kidney size was noticed in TCDD treated wild-type mice, but not in AHR knock-out mice (83). Wilms’ tumor suppressor gene (Wt1) regulates mesenchymal-to-epithelial transition during nephrogenesis. AHR activation leads to an abnormal shift in the relative expression of different splice variants of Wt1, which in turn perturbs gene expression during renal cell differentiation (138). AHR activation in undifferentiated neuronal cells induces formation of specialized axon-like structures and alters molecular milieu to resemble catecholinergic neuron-like properties (139). A

34 previous study also showed that β-naphthoflavone exposure inactivated STAT3 mediated transcription, resulting in inhibition of astrocytic differentiation of C6 glioma cell-line

(140). However, this study did not conclusively demonstrate the requirement of AHR in this process.

1.6.4 Endocrinal homeostasis:

Owing to the fact that AHR can be activated by a variety of structurally diverse compounds, any influence that AHR activation might have on other hormonal signaling pathways would be interesting. Consequently, a number of groups have investigated the effects of PAH and HAH on disruption of other hormonal systems, especially the estrogen, thyroid and retinoic acid pathway. In many cases, the absolute requirement of

AHR has not been assessed, making it difficult to isolate AHR-independent effects of aromatic hydrocarbons from the AHR-mediated ones. However, TCDD exposure of wild- type and AHR knock-out animals demonstrated that AHR was essential for TCDD- mediated reduction in thyroid hormone levels (141). In the same study, TCDD-mediated reduction in liver retinoid content was also found to be AHR dependent.

Besides the preceding overview of potential physiological AHR functions, a number of studies have examined the effect of constitutive as well as induced activity of

AHR on cell proliferation (reviewed in (142)). However, the evidence is controversial and the only conclusion that can be drawn at this time is that AHR’s influence on cell growth is context-specific. Also, an increasing amount of evidence implicating the

35 influence of AHR on immune system is accumulating. AHR seems to cross-talk with inflammatory signaling pathways and, as a result, this aspect of AHR biology is discussed in the subsequent section.

1.7 Interaction of AHR with other signaling pathways:

Nuclear receptors and other transcription factors are known to regulate the expression of their target genes though direct association with their cognate response elements in response to activation signals. The discovery and characterization of these relatively straight forward signaling pathways has served to identify the molecular phenomena for many biological processes. However, it would be naïve to expect these independent signaling cascades to illuminate the details of complex homeostatic physiology. Since organisms are simultaneously exposed to a variety of stimuli, an interaction, or cross-talk, between different signaling systems is inevitable. In fact, this interaction is more likely to dictate biological outcomes, rather than activation of individual transcription factors. The advent of high capacity molecular biology tools has inspired investigators to probe the effects of cross-talk between different receptors.

AHR also interacts with other transcription factors. Perhaps the most studied interactions of AHR are with the estrogenic and inflammatory signaling, which are described in further detail below. In addition, AHR communicates with transforming growth factor-beta (TGF-β) driven developmental processes. All three isoforms of TGF-β

36 are altered either by the constitutive presence of AHR or via its ligand-dependent activation (143-145). This alteration is unlikely to be mediated via a DRE-dependent mechanism, as the TGF-β promoters lack a canonical DRE. Though the mechanistic aspects of this cross-talk have not been resolved as yet, it is possible that AHR mediated plasminogen activator inhibitor-2 (PAI-2) induction (146) can lower TGF-β levels. It has also been proposed that strong exogenous activation (TCDD exposure) or an absolute deficiency of AHR can lead to increased all-trans-retinoic acid levels, and thus enhanced retinoic acid receptor/ 9-cis-retinoic acid receptor (RAR/RXR) signaling (147, 148). In fact, feeding a vitamin A deficient diet to AHR knock-out mice attenuated liver fibrosis and elevated TGF-β levels (149), suggesting that accumulation of retinoids in AHR- deficient mouse livers plays a role in the observed abnormalities. Decreased levels of

Cyp2C39, a potential AHR target gene, in AHR knock-out mice might partially explain this accumulation of retinoids (150). Further experiments are required to fully elucidate the details of this cross-talk.

1.7.1 AHR and estrogen signaling:

Interaction of AHR and estrogen receptor (ER) has been an interesting aspect of

AHR function. In a cell-type specific manner, AHR has been shown to modulate ER- mediated gene induction. Cathepsin D in MCF-7 (human mammary tumor) cells, pS2 in

MCF-7, HeLa (human cervical cancer cells) and Hepa1c1c7 (mouse liver tumor) cells

(151) and heat shock protein 27 in MCF-7 cells (152) are some examples of ER target genes whose induction by 17β-estradiol is inhibited by TCDD. The concept of inhibitory

37 DRE (iDRE) has been favored by some research groups to explain the inhibitory effect of

AHR (153). Additional proposed mechanisms of repression include metabolism of estrogen (17β-estradiol) by cytochrome enzymes induced via AHR (154) and proteosomal degradation of ER by AHR (155, 156). Based on the most recent report,

AHR seems to perform a non-genotropic task by acting as an E3 ubiquitin ligase in a cullin 4B complex (156) to facilitate degradation of specific target proteins such as ER.

AHR-ER interaction studies are further complicated by the fact that many AHR ligands themselves possess estrogenic properties, most recently revisited by Abdelrahim et. al.(157). Thus, multiple mechanisms might be responsible for AHR mediated ER repression.

Interestingly, in addition to interaction of the two pathways upon activation with respective ligands, AHR activation can even recruit unliganded ER, along with the coactivators p300, to estrogen response elements (ERE) to drive gene transcription (158).

In the same report, it was demonstrated that AHR activation also correlates with estrogenic effects of AHR activation in ovarectomized mouse uteri, such as increased uterine weight and enhanced proliferation of glandular epithelium. Along the same line, another report described that ER activation leads to recruitment of unliganded AHR to

ER target gene promoters, specifically breast cancer 1, early onset isoform 1 (BRCA-1).

However, upon providing AHR ligand, the activating complex transforms to a inhibitory complex (159). Moreover, ARNT – the heterodimerization partner of AHR, can independently function as a coactivator for estrogen-activated ER (160) by associating via its C-terminal domain. C-terminal domain of ARNT is dispensable for the functioning

38 of AHR-ARNT heteromer. However, the requirement of AHR in this process was not investigated adequately. Even, an isoform of ARNT, ARNT-2, was able to coactivate ER.

Though the effect of AHR activation on ER-driven transcription has been highly focused on, it is also known that in response to estrogen treatment ER can transrepress AHR target gene expression (161). ER mediates its repressive effects by physically associating with the AHR-ARNT complex at Cyp1a1/Cyp1b1 promoters, as demonstrated by successive ChIP assays. Similar to the AHR-ER transcriptional interference, cross-talk has also been demonstrated between dioxin and testosterone signaling pathways in prostate cancer cells (162) and in vivo (163).

1.7.2 AHR and inflammatory signaling:

Due to its immense clinical significance, inflammation and immunity-related processes have been widely examined for interaction with numerous surface and soluble receptors. An especially favorite topic has been the effect of glucocorticoids on inflammatory pathways, resulting in identification of therapeutic avenues to regulate

‘over-expression’ of inflammation. Other nuclear receptors, such as ER, progesterone receptor (PR), androgen receptor (AR) and peroxisome proliferator-activated receptor- alpha and -gamma (PPARα and PPARγ) are also known to influence NF-κB driven transcription (164, 165). Inflammatory signaling involves activation of multiple interconnected pathways with several possible substitutions at different steps in these pathways, resulting in an extremely intricate and yet unresolved network of molecular

39 switches. In general, the signaling can be initiated by a wide variety of cytokine/chemokine molecules or exogenous entities like lipopolysaccharide (LPS).

These molecules bind their respective receptors leading to a coordinated and sequential recruitment/post-translational modification of adaptor proteins. These changes activate one or more of many transcription factors involved in inflammation – NF-κB, C/EBP,

STAT, AP-1 or IRFs. These transcription factors translocate to the nucleus and bind their response elements in the promoters of their target genes. Two critical components that have drawn wide attention lately are cofactor exchange (166) (swapping of repressors for activators) and modification of histone code (167). Different nuclear receptors utilize separate methods of cross-talk with inflammatory signaling and this makes it difficult to delineate the precise mechanisms.

A bilateral transcriptional interference also exists between AHR and inflammation associated transcription factors. Inflammatory cytokines are capable of altering expression of cytochrome P450 genes (168, 169). Specifically, IL-1β, IL-6 and TNF-α have been shown to downregulate Cyp1a1 expression (170, 171). RELA subunit of NF-

κB can physically bind to AHR and can also deacetylate histones at the Cyp1a1 promoter

(172, 173). Conversely, with the help of a ‘triple cytokine receptor-null’ mouse model, it has also been proposed that IL1-like cytokines may in fact contribute to certain aspects of dioxin toxicity (174). It is interesting to note that investigations have focused significantly more on communication of nuclear receptors with NF-κB as compared to that with CEBP, STAT or AP-1 pathways. Owing to the relative simplicity of AHR signaling and the lack of a defined physiological function for AHR, the ‘NF-κB affecting

40 AHR’-arm of the crosstalk is relatively simple and perhaps of less clinical relevance than its counterpart.

The effect of AHR activation on inflammatory signaling has been of greater interest and has been more widely explored. AHR activation perturbs inflammatory proceedings at the molecular as well as systemic levels. Figure 1.3 is a simplified schematic of NF-κB pathway demonstrating the steps at which AHR can possibly act to influence inflammatory signaling. A number of studies have revealed that AHR activation can alter cytokine levels and the downstream signaling. B[a]P, an AHR ligand found in cigarette smoke, can induce IL-8 in primary human macrophages in an AHR dependent fashion through a DRE found in IL-8 promoter (175). The same group has also demonstrated the chemokine CCL1 to be an AHR target gene (117). CCL1, along with other cytokines – B-cell activating factor of TNF family (BAFF) and B-lymphocyte chemoattractant (BLC), has also been claimed to be an AHR target in another study

(176). TCDD exposure of murine fetal thymus cultures leads to increased IL-1β, IL-6 and

TNF-α, though the requirement of AHR for this response remains to be firmly established

(177). In addition to direct induction of cytokine transcription, AHR activation can also increase IL-1β expression by prolonging IL-1β mRNA half-life, though the precise mechanism has not been evaluated (178). Recently, IL-22 was also found to be upregulated upon AHR activation (179).Contrary to the AHR-mediated induction of cytokine expression observed in the above studies, AHR has also been reported to repress cytokine levels under certain circumstances. TCDD pre-treatment attenuated IL-6 induction by LPS in bone marrow stromal cells (180). In fact, AHR mediated inhibition

41 of IL-6 expression could present therapeutic opportunities (181). Wild-type mice (AHR present) generate less IL-12 and IL-10 than AHR knock-out mice, upon challenging with

Listeria monocytogenes (182). Hence, AHR exerts a complex effect on cytokine expression that is highly cell-type and context-specific. Further studies are required to better understand the consequence of AHR activation on different cytokines. Finally,

AHR can also regulate the expression of inflammatory mediators other than cytokines, such as arachidonic acid derivatives – prostaglandin E2 – and the enzymes involved in arachidonic acid metabolism, for example cyclooxygenase-2 (113, 183). Thus, regulating cytokine levels might be a critical part of AHR-inflammation cross-talk.

42

Figure 1.3: NF-κB pathway and the possible levels at which AHR can exert repression. Under basal conditions, NF-κB resides in the cytoplasm in association with IκB- containing inhibitor complex. Inflammatory molecules (A) bind to their receptors (B) and this initiates a cascade of protein recruitment and post-translational modifications (C) which result in degradation of IκB and release of NF-κB (D). NF-κB itself undergoes acetylation (Ac) and phosphorylation (P) (E) to assemble a coactivator complex at the promoter to drive transcription of its target genes (F). This is facilitated by acetylation of histones (gray circles on the DNA) at the promoter (G). Disruption of any of these steps (A-G) by AHR could lead to repression.

43 In addition to altering cytokine levels, AHR can operate at various steps in the intracellular part of the inflammatory network. Altering absolute protein levels or the subcellular localization (cytoplasmic vs. nuclear) of inflammatory transcription factors would be an obvious way to effectively regulate inflammation. TCDD can induce prostaglandin endoperoxide H synthase-2 in rat hepatocytes by activating AHR and by increasing C/EBP levels (184, 185). The effect of TCDD on AP-1 family members has been shown to be cell-type specific – induction in liver derived cells (186), but repression in immunological cells (187). In DC2.4, a dendritic cell-line, TCDD exposure resulted in decreased levels of transcriptionally active RELA/p50 dimers, while transcriptionally repressive p50 homodimers were unaffected (188). In a macrophage cell-line, AHR activation induces interferon gamma responsive factor-3 (IRF-3) through an AHR/RELB complex bound to NF-κB element in the IRF-3 promoter (176). AHR may have a protective effect on RELB, as AHR deficient mice demonstrate rapid degradation of

RELB resulting in a enhanced inflammatory response (189). Though regulation of NF-κB and other transcription factor levels can provide a simple explanation, it is unlikely to be the major component because of the gene-specificity of AHR-mediated suppression. The selectivity of transcriptional repression can be more rationally explained by a model wherein one receptor alters post-translational modification of the other receptor and/or the chromatin remodeling at the specific gene promoter. One of the very few studies analyzing such effects demonstrated that B[a]P mediated activation of MAP kinase

ERK1/2 in primary human macrophages was responsible for induction of TNF-α (190).

Similarly, coactivators p300/CBP and steroid receptor coactivator-1 were found to attenuate NF-κB mediated repression of AHR driven reporter activity (191). The same

44 study also showed that TNF-α can inhibit AHR-ligand induced acetylation of histone H4 at the Cyp1a1 promoter thereby exerting repression of AHR regulated genes. AHR and

NF-κB/cytokines may also cooperate with each other through physical and functional interaction, as in the induction of c-myc expression in breast cancer cells (107) and induction of cyclin A in rat liver progenitor cell model (192). These reports again emphasize that the AHR-inflammatory pathways interaction is highly context-specific.

The multitude of effector cells – T cells, B cells, macrophages, dendritic cells, granulocytes, etc. and their subtypes – make the immune system highly versatile. A balance between different cell types is critical during development as well as under pathological circumstances. At the systemic level, AHR can alter immune/inflammatory outcomes by perturbing this balance in immune cell-types, affecting immune-related disease processes. In humans and mice, AHR activation increases T(H)17 T cells, which might be responsible for elevated severity of autoimmune encephalomyelitis in wild-type mice as compared to AHR knock-out mice (179). AHR activation by TCDD elevates macrophage infiltration in numerous organs including liver, lung and heart, through induction of monocyte chemoattractant protein-1 (MCP-1) and keratinocyte chemoattractant (193). AHR-dependent induction of MCP-1 in murine (ApoE knock-out mice) and human (primary endothelial cells) models has also been linked to rapid progression of atherosclerosis (194). Two studies examining the role of AHR in artificially induced infections in mice revealed that the constitutive presence (182) as well as ligand activation of AHR (195) reduced pathogenic burden and improved survival.

When a transgenic mouse model expressing the constitutively active form of AHR in

45 keratinocytes was examined, severe skin lesions resembling allergic dermatitis developed

(196). However, at this time, it is not clear whether the effects described above are simply a consequence of AHR-mediated alteration in cytokine levels, or are due to other additional effects of AHR on inflammation-responsive gene transcription.

Contrary to the inflammation-supportive roles of AHR described in the previous paragraph, some studies support an anti-inflammatory function for AHR. Prolonged AHR activation by TCDD exposure made mice more susceptible to bacterial infection (197-

199). However, this might be due to a reduction in AHR levels by continuous TCDD treatment. In a recent study, AHR was implicated as the receptor for a novel low molecular weight compound capable of attenuating allergic lung inflammation (181).

Also, endotoxin exposure through inhalation causes a greater accumulation of neutrophils as well as inflammatory cytokines in AHR knock-out mice lungs as compared to wild- types (189). AHR may exert its anti-inflammatory effect in a different ways, one of which could be by up-regulating expression of anti-inflammatory gene products, such as suppressor of cytokine signaling 2 (Socs2) (118). Finally, long-term TCDD exposure in a tumor allograft C57BL/6 mice model, led to diminished activation of CD4+ as well as

CD8+ T-cells. This effectively resulted in decreased production of type 1 cytokines and the related antibody isotypes (200). Thus, based on the current evidence, it is very difficult to draw a conclusion regarding the role of AHR in immune processes/inflammation.

46 In conclusion, AHR can functionally interact with multiple signaling pathways.

This exponentially increases the scope of AHR activity and presents exciting scopes for further research.

1.8 Overview and significance of research:

The aryl-hydrocarbon receptor (AhR) is a ligand activated transcription factor classically associated with regulation of a battery of xenobiotic metabolizing enzymes.

The list of AhR ligands encompasses halogenated aromatic hydrocarbons (HAH) and polycyclic aromatic hydrocarbons (PAH) as well as non-classical ligands like omeprazole and thiabendazole. Many of these compounds are persistent and widespread environmental contaminants of considerable concern due to their potential for adverse health effects. There is also a growing body of evidence supporting the concept of endogenous ligand(s) for the AhR, even though no single molecule has been identified so far. Phylogenetics can provide vital information regarding the properties and functions of proteins. AHR homologues are found across the animal kingdom, including mammals, fish, avians and even invertebrates. In the invertebrates, AHR lacks an ability to bind exogenous ligands; an observation that strongly emphasizes a role for AHR in development and homeostasis (201).

As described in the previous sections, besides its established role in xenobiotic metabolism, there is an increasing body of evidence implicating AhR in a myriad of

47 pathophysiological processes involving the immune system, liver and the cardiovascular system as well as in cell cycle control. AhR activation in response to xenobiotic exposure leads to a variety of adverse effects, including tumor promotion. A transgenic mouse model expressing a constitutively active AhR demonstrated increased occurrence of hepatic and gastric tumors (87, 88). The fact that benzo[a]pyrene, a known AhR ligand, is unable to exhibit its carcinogenic effects in the skin of AhR null mice, provides further evidence supporting a role for AhR in tumorigenesis (202). Conversely, studies using mice deficient in AhR have provided clues to its critical role in growth and development.

AhR null mice exhibit increased hepatic fibrosis, decreased liver weight, abnormalities of the immune system in the form of a reduced number of peripheral lymphocytes (76, 77), decreased fertility, vascular abnormalities in heart, liver and uterus, delayed wound healing, impaired skin homeostasis and an overall slower growth (79). These studies have also shown that AhR might have a role in the formation of primordial follicles and in regulating the number of antral follicles, thus affecting development of the mouse ovary

(81). Also, the incidence of cardiac hypertrophy in AhR null mice suggests a role for

AhR in normal cardiovascular development and angiogenesis (136). However, there is no known association between most of these effects and the established role of AHR in xenobiotic metabolism and it has not been clearly defined how AhR mediates these effects.

Evolutionary conservation, the possibility of an endogenous ligand, implication in developmental and pathological processes and above else, inability to explain these phenomena, solely on the basis of DRE-driven metabolism genes, warrants the necessity

48 to search for AHR regulated genes in different ontological groups as well as alternate models of receptor function. Sequence analysis of the human and the mouse genomes revealed that only 48 of the 133 mouse-rat orthologous genes with a DRE between -1500 to +1500 had a human ortholog (203). Many of these putative AhR targets did not show any change in mRNA levels as determined by microarray and real time PCR analysis. To explain these observations a number of possibilities have been proposed, which are partially supported by preliminary evidence. Examples of certain DRE-independent models of AHR-regulated transcription are presented in Figure 1.4 (activation models) and in Figure 1.5 (repression models).

49

Figure 1.4: Alternate models proposed for AHR-mediated activation of gene transcription. (A) Classical DRE-dependent mechanism. AHR-ARNT heterodimer directly binds o the DRE to drive gene transcription. (B) AHR-ARNT may tether to another protein to bind DNA. This could be a protein that cannot drive transcription on its own. (C) In response to its activation signal, another transcription factor can bind to its response element and induce its own target genes. However, ligand-activated AHR-ARNT may recruit the nonactivated form of this transcription factor to drive gene expression. The legend key also refers to the next figure.

50

Figure 1.5: Alternate models proposed for AHR-mediated repression of gene transcription. (A) ARNT has multiple heterodimerization partners. If the ARNT pool is limiting, activation of AHR could sequester ARNT away from other ARNT-based transcriptional complexes (left to right). (B) DRE can overlap with other response elements. Upon ligand-activation, AHR- ARNT heterodimer would bind to DRE and inhibit DNA-binding of the other transcription factor. (C) ‘Co-factor exchange’ model. Transcription factors recruit coactivators upon activation (left). AHR can associate with this complex and switch coactivators with corepressors, thereby converting it to a repressive complex.

Refer to Figure 1.4 for legend key.

51 Of all the views presented, non-genotropic mode of AHR activity is the most favored. Recently it was demonstrated that AHR could drive the expression of a reporter by binding to a novel ‘response element’ in the enhancer region of the Cyp1A2 gene

(204). Using a DNA-binding mutant (replacing Arg39 by Ile – a mutation different from the one proposed here), it was proved that AHR can function in the absence of its ability to bind the DNA. Further, electrophoretic mobility gel shift assays (EMSA) revealed that the AHR-ARNT heterodimer binds to Cyp1A2 enhancer through another factor constitutively present in nuclear extracts from HepG2 cells. All the experiments in this report employed the cell-culture system, the focus was on the enhancer of a single gene, an AHR null background was not used and the bacterially expressed AHR-ARNT used for EMSA formed aggregates. Despite the pitfalls, this report was the first description of

AHR-ARNT heterodimer modulating gene transcription through protein-protein interactions at a gene promoter.

The concept of functional dissociation of response element dependent and independent activities has been previously demonstrated in other receptors. Reichardt et. al. (205) generated DNA-binding mutant glucocorticoid receptor (GR) expressing mice by introducing a previously characterized mutation (Ala458Thr) in GR’s D-loop. This mutant GR failed to transactivate target genes through the glucocorticoid response element (GRE). However, even in the absence of DNA-binding, it retained transrepression by interacting with transcription factors AP-1 and NFκB. Using these mice, it was possible to segregate DNA-binding-dependent and -independent functions of

GR. Later, in a separate report, Bladh et. al. (206) were able to further isolate NFκB

52 repression from AP-1 repression by using a different GR mutant. Similarly, Valentine et. al. (207) were able to discriminate between transactivation (DNA-binding-dependent) and transrepression (DNA-binding-independent) properties of the estrogen receptor (ER) by incorporating mutations in the receptor’s ligand-binding domain. These studies exemplify the possibility of a functional role for transcription factors that extends beyond

DNA-binding.

To summarize, the following facts inspired this research project:

• the known battery of AHR regulated xenobiotic metabolism enzymes is unlikely

to explain many of the pathophysiological effects associated with AHR

• not all genes altered upon AHR activation possess a consensus DRE within a

reasonable region of their putative promoter

• microarray experiments reveal that many genes are repressed by activation of

AHR.

• AHR can regulate gene expression in the absence of direct DNA binding

• functional dissociation of nuclear receptor domains can help segregate their

functions, as seen in the case of GR and ER

Overall hypothesis:

AHR modulates expression of genes involved in varied cellular processes through the classical DRE-dependent mechanism as well as mechanism(s) independent of direct DNA binding.

53 This series of studies was designed to expand the battery of known AHR regulated genes, and to characterize the ability of AHR to function in a DNA-independent manner. The experiments described in Chapter 2 deal with identification of a growth factor, epiregulin, as a classic AHR target gene. Chapter 3 describes another important transcription factor, constitutive androstane receptor (CAR), as an AHR target gene.

However, a consensus DRE does not exist in putative murine CAR promoter. Though the precise mechanism remains to be elucidated, CAR is unlikely to be a classical AHR target gene. Chapter 4 provides evidence for functional dissociation of AHR domains. A

DNA-binding mutant of AHR is found to repress NF-κB mediated gene transcription to the same extent as the wild-type AHR. Thus, this research has identified novel AHR regulated genes as well as contributed to expanding the scope of AHR function.

Chapter 2

THE ARYL HYDROCARBON RECEPTOR DIRECTLY REGULATES EXPRESSION OF THE POTENT MITOGEN EPIREGULIN

55

2.1 Abstract:

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is known to cause a large number of adverse effects, mediated largely by its binding to the aryl-hydrocarbon receptor (AhR) and subsequent modulation of gene expression. It is thought that AhR mediates these effects through the untimely and disproportionate expression of specific genes. However, the exact mechanism, or the genes involved, through which TCDD leads to these effects is still unknown. This study reports the discovery of a novel target gene, epiregulin, which is regulated by TCDD-activated AhR. Epiregulin is a growth regulator which belongs to the epidermal growth factor (EGF) family. Using real time quantitative PCR

(qPCR), it was established that TCDD upregulates epiregulin gene expression. The promoter region of epiregulin has a dioxin responsive element (DRE) 56 nucleotides upstream of the transcription start site, along with three potential Sp1 binding sites.

Chromatin immunoprecipitation (ChIP) assays with an anti-AhR antibody showed promoter occupancy upon TCDD treatment. Luciferase reporter assays using a vector harboring the first 125 base pairs of the epiregulin rat promoter revealed an increase in signal on TCDD treatment, which was lost upon mutation of the DRE. Epiregulin and

TCDD treatment mediated a dose-dependent increase in primary mouse keratinocyte growth. These results demonstrate that AhR directly increases epiregulin expression, which could play an important role in TCDD mediated tumor promotion observed in rodent models.

56 2.2 Introduction

Aside from its role in xenobiotic metabolism, there is an increasing body of evidence implicating AhR in a diverse range of patho-physiological processes involving the immune system, liver and the cardiovascular system (208) as well as in cell cycle control (209). AhR activation in response to xenobiotic exposure leads to a variety of adverse effects, including tumor promotion. Studies using mice deficient in AhR have provided clues to its role in growth and development. AhR null mice exhibit increased hepatic fibrosis, decreased liver weight, abnormalities of the immune system in the form of a reduced number of peripheral lymphocytes (76, 77), decreased fertility, vascular abnormalities in heart, liver and uterus, delayed wound healing, impaired skin homeostasis and an overall slower growth (79). In addition, studies using null mice have also shown that AhR might have a role in the formation of primordial follicles and in regulating the number of antral follicles, thus affecting development of the mouse ovary

(81). Also, the incidence of cardiac hypertrophy in AhR null mice suggests a role for

AhR in normal cardiovascular development and angiogenesis (136). However, it has not been clearly defined how AhR mediates these functions. Differential regulation of genes, other than those involved in xenobiotic metabolism, could possibly account for these

AhR mediated effects. Alternate mechanisms have also been suggested in the recent years to explain the different functions of AhR. For example, it has been shown to interact with retinoblastoma (Rb) (210) and nuclear factor κ-B (211) transcription factors and modulate cell proliferation. Co-expression of AhR and BRG-1 restored Rb-

57 sensitivity to a tumor cell line, C33A, which could otherwise progress through the cell cycle even in the presence of active Rb protein (212).

A number of exogenous and endogenous ligands are capable of activating the

AhR (213). 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is known to be the most potent exogenous AhR ligand. While there is evidence suggesting that TCDD exerts almost all its toxic effects through the AhR, the exact mechanisms underlying these effects are not clear. TCDD has been shown to be more effective as a tumor promoter than as a tumor initiator, due to the fact that TCDD is essentially not metabolized (reviewed in (214)).

TCDD has been shown to promote skin tumor formation in hairless mice (215) as well as promote liver tumor formation (reviewed in (216)). The importance of AhR in tumor promotion is also highlighted by the results obtained in a recent study using transgenic mice expressing a constitutively active AhR where a significant increase in hepatocarcinogenesis was noted compared to wild-type mice (88). In addition, studies using constitutively active AhR have demonstrated that the receptor can induce tumors in the stomach (87). The fact that benzo[a]pyrene, a known AhR ligand, is unable to exhibit its carcinogenic effects in the skin of AhR null mice, provides further evidence supporting a role for AhR in tumorigenesis (202).

Epidermal growth factor (EGF) and other members of its family are potent peptide growth factors and are involved in a plethora of physiological and pathological processes through their signaling properties (217). Mutations and/or over-expression of

EGF-family members cause cells to acquire an oncogenic phenotype. Epiregulin is a

58 relatively newly identified member of the EGF family, isolated from the conditioned medium of NIH/3T3/clone 7 cells (218). It is secreted as a 46-amino acid single chain polypeptide with contrasting growth regulatory properties, inhibiting the growth of several epithelial cell lines while promoting growth of other cell types, like vascular smooth muscle cells (211), hepatocytes (218, 219) and keratinocytes (220). Epiregulin is expressed during development as well as later on in the genitourinary (221, 222) tract, gastrointestinal tract, vascular smooth muscle cells and skin. In the latter two tissues, it has been shown to function in a paracrine as well as autocrine fashion (223).

This study demonstrates, for the first time, that ligand activated AhR binds to its cognate element in the epiregulin promoter and mutation of this binding element results in loss of AhR-driven reporter activity. AhR increases epiregulin transcription in cultured primary mouse keratinocytes, immortalized hepatocytes and mouse hepatoma derived cell line. It is also shown that epiregulin is capable of significantly enhancing the proliferation of cultured primary mouse keratinocytes. This could possibly account for one of the mechanisms by which TCDD exerts its tumor promotional effects in rodent skin.

59

2.3 Materials and methods

Cell culture

Primary mouse keratinocytes were obtained from 2-day old neonatal C57BL/6 mice and cultured using a previously described method (224). NIH/3T3 cells and

Hepa1c1c7 were grown in α-minimal essential medium (α-MEM) supplemented with 10

% FBS (HyClone Laboratories, Logan, UT), 100 IU/ml penicillin, and 0.1 mg/ml

streptomycin (Sigma) at 37 °C in 5% CO2 atmosphere. Hepatocytes from 2-week old

C57BL/6N mice were infected with SV40 virus to prepare temperature sensitive SV40

immortalized mouse hepatocytes in our laboratory (225) using a previously described

protocol with modifications (226, 227). Three cell lines of immortalized hepatocytes

were established. Cells from line 2 were used for experiments. These cells were

maintained in 4% FBS and 0.1 μM dexamethasone at 34°C.

Real Time Quantitative PCR (qPCR)

Real time qPCR was performed on the DNA Engine Opticon (MJ Research, Inc.)

using DyNAmo Hot Start SYBR Green qPCR kit purchased from MJ Research, Inc.

cDNA synthesis was carried out using High Capacity cDNA Archive Kit from Applied

Biosystems. The reverse transcription reactions were set up according to the

manufacturer’s instructions. cDNA synthesized from 50 ng of total RNA was used per qPCR reaction. Epiregulin mRNA was detected using 5`-

TGGGTCTTGACGCTGCTTTGTCTA-3` and 5`-

60 AAGCAGTAGCCGTCCATGTCAGAA-3` primers. Epiregulin promoter in ChIP assays was detected using 5`-TTCCTGAGAGGGAGGATGACAT-3` and 5`-

CCCACCAAGTCGCTGTGACT-3` primers. Thermal cycling conditions were setup according to the manufacturer’s protocol.

Plasmids

The following plasmids were used for reporter assays : pEpi125 – derived by inserting rat epiregulin promoter region -125/+12 (genomic contig: NW_047424.1) in pGL3-Basic luciferase vector, pmutABC – pEpi125 with all three GT and CT boxes mutated (228), pmutARNT – pEpi125 with ARNT half-site of DRE mutated and pmutAhR – pEpi125 with AhR half-site of DRE mutated. pEpi125 and pmutABC were a kind gift of Dr. Kaoru Miyamoto (Fukui Medical University, Japan). pmutARNT and pmutAhR were modified forms of pEpi125, generated by site-directed mutagenesis using the QuikChange mutagenesis kit (Stratagene). Forward and reverse primer pairs used to mutate the ARNT and AhR half-sites, respectively were (5`-

GTAAGTCCTCGCTGGCCTAAGCACC-3` and 5`-

GGTGCTTAGGCCAGCGAGGACTTAC-3`) and (5`-

GTAAGTCCTCGAGTGCCTAAGCACC-3` and 5`-

GGTGCTTAGGCACTCGAGGACTTAC-3`).

Transient transfections and luciferase reporter assays

These experiments were carried out using NIH/3T3 cells, obtained from the

American Type Culture Collection (ATCC). Transfections were performed using

61 Lipofectamine Plus (Invitrogen). Cells at 70% confluence in 6-well plates were washed with PBS and 1.5 ml Optimem (Life Technologies) containing 5 μl of Lipofectamine, 1

μl of Plus and 1.5 μg DNA were added per well. The DNA was comprised of 500 ng of a luciferase reporter vector harboring wild-type or mutated versions of the rat epiregulin promoter, 100 ng of pDJM/β-gal to control for transfection efficiency and empty expression vector. After 4 h cells were washed with PBS and α-MEM containing 10%

FBS and antibiotics was added. Cells were allowed to grow overnight and treated with 10 nM TCDD or DMSO the next day for 7 h and lysed with 1X cell lysis buffer (25 mM

Tris buffer pH 7.8, 2 mM DTT, 2 mM EDTA, 10% glycerol and 1% Triton X-100).

Luciferase activity from cell lysates was measured using a Turner TD-20e luminometer

(Turrner Designs, Sunnyvale, CA) and values were normalized to β-gal values.

Chromatin Immunoprecipitation assay and PCR

Chromatin Immunoprecipitation (ChIP) assays were performed as described by

Spencer et. al. (229) with some modifications. Briefly, 80% confluent cells were treated with 10 nM TCDD or DMSO for 100 min and crosslinked for 8 min at room temperature with 0.33% formaldehyde (SIGMA, F-8775). Cells were harvested and lysed with 750

μl/flask lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8). Lysates were sonicated with Branson Sonifier 250 using 40% duty cycle and output set at 4 for 8 cycles of 12 pulses each. Protein-DNA complexes were immunoprecipitated from 200 μl lysate using either 6 μl rabbit polyclonal anti-AhR antibody (Biomol, SA-210), control IgG or no antibody and 50 μl Goat Anti-Rabbit IgG-Agarose resin (SIGMA, A1027). Resin was

62 washed once each with low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8 and 150 mM NaCl), 1X RIPA buffer (0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 10 mM

Tris-HCl pH 8) and 1 X MENG buffer (25 mM MOPS, 2 mM EDTA, 0.02% sodium azide, 10% glycerol pH 7.5) in that order. Immunoprecipitated protein-DNA complexes were incubated in 300 μl digesting buffer (50 mM Tris-HCl pH 8, 1 mM EDTA, 100 mM

NaCl, 0.5% SDS, 100 μg/ml Proteinase K). DNA was isolated by phenol-chloroform extraction and concentrated using ethanol precipitation. PCR was performed using following primers: Epiregulin (5`- TTCCTGAGAGGGAGGATGACAT-3` and 5`-

CCCACCAAGTCGCTGTGACT-3`; located 107 bases upstream and 75 bases

downstream relative to TATA box), Cyp1A1 (5`-GCCGAGCATCGCACGCAAACC-3`

and 5`-GGATCCACGCGAGACAGCAGG-3`; located 1168 and 784 bases upstream

relative to TATA box) and GAPDH (5`-CATGGCCTTCCGTGTTCCTA-3` and 5`-

GCGGCACGTCAGATCCA-3`). 10% DMSO was added to the reactions.

Keratinocyte proliferation studies

Equivalent number of keratinocytes were seeded in 12 well plates and cultured in

low calcium medium (0.05 mM) containing 8% chelexed FBS for 24 h before treatment.

To test the effect of epiregulin or TCDD on keratinocyte growth, cells were cultured in

low calcium medium containing epiregulin (R&D Systems, 1068-EP), at a concentration

from 1 – 20 ng/ml, or TCDD at a concentration from 0.1 – 1.0 nM, continuously with

medium change after 24 and 72 h. After 24, 72, or 120 h incubation, cell number was

measured using a Z1 coulter® particle counter (Beckman Counter, Inc., Hialeah, FL).

63 2.4 Results

TCDD treatment upregulates Epiregulin transcription

The principal mode of action of AhR is through binding its cognate cis-regulatory element, the DRE, in the promoter region of its target genes. AhR heterodimerizes with

ARNT and then recruits coregulators to enhance transcription (reviewed in (230)).

Despite the fact that AhR is implicated in a diverse range of physiological processes, as discussed in the introduction, few genes outside the gamut of xenobiotic metabolism have been reported to be directly regulated by the AhR pathway. In an attempt to identify novel target genes, whose expression is under the regulation of AhR, microarray experimentsi were performed using SV-40 immortalized mouse hepatocytes. These

experiments revealed epiregulin as one of the target genes whose mRNA levels increased

on TCDD treatment. Microarray results were confirmed with real-time qPCR

(Figure 2.1). Effect of TCDD on epiregulin mRNA levels was also tested in Hepa1c1c7,

a mouse hepatoma cell line. Epiregulin was upregulated by 2.6 fold, 90 min after TCDD

exposure. As TCDD exerts significant adverse effects on skin, including tumor

promotion, upregulation of epiregulin in response to TCDD was assessed in primary

keratinocytes. Primary mouse keratinocytes were treated with 10 nM TCDD for 90 min

and change in the level of epiregulin mRNA was compared by real time qPCR. TCDD

increased epiregulin mRNA expression by 3.3 fold (Figure 2.1) in primary mouse

keratinocytes also. Thus AhR activation resulted in epiregulin upregulation in primary cells as well as immortalized cell lines.

64

Figure 2.1: TCDD increases Epiregulin mRNA. Primary mouse keratinocytes, SV-40 immortalized hepatocytes and Hepa1c1c7 cells were treated with 10 nM TCDD and total RNA was extracted at 90 min. Real time qPCR was performed using cDNA synthesized from 50 ng RNA. Experiments were performed four times with primary keratinocytes and twice each with immortalized hepatocytes and Hepa1c1c7 cells. qPCR was performed in duplicate for each biological replicate. Data from representative experiments are presented as fold increase in relative fluorescence units upon TCDD treatment compared to untreated samples. Data is normalized to GAPDH mRNA levels within each cell type. * p<0.05 as determined by Student’s t-test.

65 AhR binds the DRE in the epiregulin promoter

In accordance with the currently accepted theory, AhR must bind its response element in the promoter of a gene to directly regulate its expression. A search for binding sites for AhR-ARNT heterodimer by sequence analysis identified a consensus DRE

(TCGCGTG) 56 nucleotides upstream of the transcription start site in the epiregulin promoter in mouse and rat genomic DNA. To assess if AhR binds the DRE in the epiregulin promoter sequence, ChIP assays were performed with SV40 virus immortalized mouse hepatocytes treated with TCDD. DNA fragments isolated from ChIP assays were analyzed using PCR (Figure 2.2 A). CYP1A1 was used as a positive control.

GAPDH and immunoprecipitations with no antibody or with control IgG were used as negative controls. CYP1A1 showed a strong signal in the TCDD treated sample, compared to a carrier solvent treated sample, while there was no difference in the case of

GAPDH (data not shown). Immunoprecipitations with control IgG or no antibody showed minimal background signals. While the epiregulin signal was more intense in

TCDD samples compared to carrier solvent treated samples, the difference was less than that of CYP1A1. This difference could be explained by the fact that epiregulin has only one DRE in its promoter while the CYP1A1 promoter has multiple DREs, and that AhR upregulates CYP1A1 expression by a greater magnitude than epiregulin. These results were confirmed by realtime qPCR (Figure 2.2 B) performed on DNA isolated from ChIP assays. The relative signal for epiregulin in TCDD treated samples was 1.7 fold greater than carrier solvent treated samples. Combined, these results demonstrate an increase in epiregulin promoter occupancy by AhR in response to TCDD treatment.

66

Figure 2.2: Epiregulin promoter occupancy by the ligand-activated AhR. (A) SV-40 immortalized mouse hepatocytes were treated with TCDD or carrier solvent (DMSO), crosslinked with formaldehyde, lysed and sonicated. Protein-DNA complexes were immunoprecipitated with anti-AhR antibody, control IgG or no antibody as outlined in materials and methods. The crosslinked DNA was resolved by heating, PCR amplified using appropriate primers and visualized on agarose gel. Immunoprecipitations using anti-AhR antibody were done in duplicate. Experiment was repeated three times and similar results were obtained.

(B) Real time qPCR revealed an increase in AhR binding to the DRE in epiregulin promoter. Reverse crosslinked DNA from ChIP assay was analyzed by real time qPCR using primers surrounding the DRE in Epiregulin promoter. Data is represented as average relative fluorescence units in TCDD and carrier solvent treated samples across two ChIP assays, each measured in duplicate. (* p-value = 0.014 on Student’s t-test) AhR IP = immunoprecipitation using anti-AhR antibody; IgG IP = control IgG antibody; No Ab IP = no antibody; RFU = relative fluorescence units; Input = 10% of lysate used for immunoprecipitation with different antibodies.

67

AhR driven promoter activity is dependent on the DRE

To further confirm the role of the DRE in modulating epiregulin gene expression, a luciferase reporter assay was performed using a construct containing the first 125 bases of the rat epiregulin promoter cloned into pGL3-Basic vector (pEpi125). There is a single nucleotide difference between the first 125 bases of the mouse (genomic contig:

NT_039308.3) and the rat (genomic contig: NW_047424.1) epiregulin promoters, which

is not a part of the DRE or the Sp1 binding sites. This construct has been previously used

by Sekiguchi et. al to study transcriptional regulation of the epiregulin gene in the rat

ovary (222). They showed by deletion and mutation analyses that the region

encompassing 125 bp upstream of the transcription start site was essential for controlling

transcription of the epiregulin gene. According to their results, Sp1/Sp3 proteins bind to

one or more of the two CT boxes and one GT box within this 125 bp region and are

involved in regulating epiregulin gene expression.

The relative contributions of the AhR and Sp1/Sp3 were studied using plasmids

derived from pEpi125 by mutating their binding sites, the DRE and the CT and GT

boxes, respectively (Figure 2.3 A). Luciferase reporter plasmid pEpi125 was transiently

transfected in NIH/3T3 cells, while pDJM/β-gal vector was cotransfected to control for

transfection efficiency. Reporter assays were also carried out with pmutABC plasmid,

derived from pEpi125 by mutating both the CT boxes as well as the GT box, pmutARNT

plasmid, derived from pEpi125 by mutating the ARNT half-site of DRE and pmutAhR

plasmid, derived from pEpi125 by mutating the AhR half-site of DRE (Figure 2.3 C).

68 There was a two-fold increase (2.3 fold) in luciferase reporter activity observed upon

TCDD treatment (Figure 2.3 B) with the pEpi125 transfections. Surprisingly, a similar increase in luciferase activity (2.2 fold) was observed with the pmutABC transfections compared to vehicle treated control samples. There was no increase in luciferase activity on TCDD treatment when the AhR and ARNT binding half-sites were mutated in pmutARNT and pmutAhR, respectively (~1.2 fold in pmutARNT and pmutAhR each).

Interestingly, the reporter gene activity in pmutABC transfections was 3.2 times lower compared to pEpi125 transfections, both in TCDD and carrier solvent treated samples.

This decrease in reporter activity was not observed when the DRE was mutated

(pmutAhR and pmutARNT transfections). These results, along with ChIP assays, demonstrate that the activated AhR binds to the DRE within the epiregulin promoter and is responsible for the observed increase in transcriptional activity.

69

Figure 2.3: AhR binds DRE in rat Epiregulin promoter. (A) NIH/3T3 cells were transfected in 6-well dishes with pEpi125, pmutABC, pmutARNT or pmutAhR plasmids using Lipofectamine Plus protocol as described in materials and methods. Cells were subjected to no treatment, carrier solvent (DMSO) or 10 nM TCDD. Transcriptional activity was assessed by measuring luciferase assay signals. Data is shown as mean and standard deviation of triplicate transfections. Experiment was repeated four times with similar results. Statistical analysis is performed using Student’s t-test; * p<0.001 in both cases (significant); # p>0.05 in both cases (insignificant).

(B)Graphic representation of the fold-increase in luciferase assay data from panel A.

(C)Schematic diagram of first 125 bases of rat epiregulin promoter present within the plasmid pEpi125. Transcription start site is indicated by an arrow. DRE is shown as two half-sites (AhR and ARNT) represented by ovals. Box A and C are the two CT boxes and Box B is the GT box. In pmutABC, pmutARNT and pmutAhR, mutation of respective elements are shown as blacked out boxes/ovals.

70 Effect of Epiregulin and TCDD on Mouse Keratinocyte Proliferation

To characterize the functional role of increased epiregulin expression on cell growth, the effect of epiregulin treatment was determined using primary mouse keratinocytes. It has previously been shown that epiregulin stimulates proliferation of cultured human keratinocytes in a dose-dependent manner and acts as an autocrine growth factor (220). Recombinant human epiregulin at a concentration of 1 ng/ml resulted in a three-fold increase in cell growth. In the present study, primary mouse keratinocytes showed a dose-dependent increase in cell number when treated with recombinant mouse epiregulin, even in the presence of other growth factors found in fetal bovine serum (Figure 2.4 A). Epiregulin stimulated a statistically significant proliferation of primary mouse keratinocytes across a dose range of 1-20 ng/ml at 24, 72 and 120 h of treatment, as determined by ANOVA (p<0.05). Significant increase in proliferation was observed at all three-time points with the higher doses (10 and 20 ng/ml), whereas 1 ng/ml epiregulin induced proliferation only at 72 and 120 h.

71

Figure 2.4: Epiregulin and TCDD increase primary mouse keratinocyte proliferation in a dose-dependent manner. 105 cells were seeded per well in 12-well plates. After 24 h, fresh medium containing either recombinant mouse epiregulin (A) or TCDD (B) was added at indicated doses. Cells were counted 24, 72 and 120 h after adding epiregulin or TCDD. Data is presented as the mean and standard error of cells measured in triplicate wells. Data presented was checked for statistical significance by ANOVA and Tukey HSD test (see text). Observed increase in proliferation was significant for both epiregulin and TCDD (p<0.05).

72 Similar cell proliferation studies were performed using TCDD as a stimulant

(Figure 2.4 B). Primary mouse keratinocytes were treated with 0.1 nM, 0.5 nM and 1 nM

TCDD, or vehicle solvent, and cells counted at 24, 72 and 120 h after addition of TCDD.

TCDD-induced cell proliferation was statistically significant, as determined by ANOVA

(p<0.05). Individually, all three doses induced statistically significant increase in cell proliferation when compared to vehicle treated cells. However, a statistically significant difference was not observed amongst the different doses, as determined by Tukey’s HSD test. When the effects of different doses were compared at individual time-points, an increase in the number of cells was observed at all three time-points with 0.1 nM and 0.5 nM TCDD treatments. Primary mouse keratinocytes treated with 1 nM TCDD showed a slight reduction in cell numbers at the 120 h time point. This could be due to increasing toxicity owing to prolonged TCDD exposure at this latest time point.

2.5 Discussion

TCDD causes a wide range of toxic effects including tumor promotion, but the exact mechanisms responsible for these effects are not known. However, most of the efforts investigating genes regulated by AhR have been focused on enzymes involved in xenobiotic metabolism. Though there are indications for involvement of AhR in a number of cellular processes (231), there is no well described role for the AhR in normal cellular function or tumor promotion that has been delineated at the gene expression

73 level. In this report we have examined the ability of the AhR to regulate expression of the potent mitogen epiregulin.

Skin and liver have been observed to be two of the most common sites of tumor development in TCDD tumor promotion studies. AhR-dependent upregulation of genes involved in growth promotion could be an important mechanism for TCDD mediated carcinogenesis. One of the functional classes of genes that could mediate these effects would be growth factors. The ability of TCDD to increase epiregulin mRNA in cell types known to exhibit TCDD-mediated toxicity, as revealed by the microarrays and real time qPCR experiments in hepatocytes and keratinocytes, support the hypothesis that TCDD exposure could stimulate the growth potential of precancerous cells through the enhanced expression of potent mitogens like epiregulin. Further, results from the ChIP assay and luciferase reporter assay, reveal that an increase in epiregulin mRNA levels is brought about by ligand-activated AhR binding to the DRE in the epiregulin promoter and thus, epiregulin is directly regulated by the AhR in response to TCDD. Earlier studies have demonstrated that two of the three Sp1 binding elements, in the epiregulin promoter, are actively involved in regulating epiregulin mRNA levels. A cooperative interaction between AhR-ARNT and Sp1 in the CYP1A1 gene promoter has been reported previously (232). According to their results, binding of either AhR-ARNT or Sp1 to its element in the CYP1A1 promoter facilitated binding of the other factor and increased reporter activity in a synergistic fashion. The DRE and GC/CT boxes are found in close proximity in a number of other AhR regulated gene promoters like UDP-glucuronosyl transferase, aldehyde dehydrogenase-3 and quinine reductase. An interaction between the

74 AhR/ARNT complex and Sp1 has been shown to exist even in the absence of exogenous ligand, for the Cathepsin D gene promoter (233). Since the epiregulin promoter has both the AhR and Sp1 binding elements, it was interesting to determine whether this kind of cooperative interaction existed at the epiregulin promoter. Notably, as revealed in the reporter assays, even when all three Sp1 binding sites were mutated within the epiregulin promoter (pmutABC transfections), the fold-increase in luciferase activity on TCDD induction was similar to that observed in the wild-type promoter, 2.2 and 2.3 fold respectively. However, the overall amount of luciferase signal decreased by approximately two thirds in pmutABC transfections. This shows that Sp1 is not necessary for AhR-mediated induction of epiregulin gene expression, but enhances the overall transcription rate of the epiregulin promoter. After demonstrating that TCDD activated

AhR increases epiregulin transcription, the next logical step would be to show a corresponding increase in epiregulin secreted in conditioned media. However attempts to detect epiregulin using Western blot were unsuccessful (data not shown).

Increased epiregulin mRNA expression has been observed in pancreatic cancer tissue samples (234) as well as in prostate and pancreatic cell lines (234, 235). It has been proposed that over-expression of epiregulin is an important factor in growth regulation of malignant fibrous histiocytoma (236), colon cancer cells (237) and various gynecological malignancies (238). These data, along with the fact that ligands and receptors of the EGF- family have been implicated in a number of tumors, suggest that epiregulin might be an important factor in mediating TCDD dependent skin tumor promotion in mice. To show that modulation of epiregulin levels has a functionally significant role in primary mouse

75 keratinocytes, cells were treated with increasing concentrations of epiregulin. Epiregulin treatment caused an increase in proliferation of primary mouse keratinocytes as observed at three time points (24, 72 and 120 h), even at a concentration as low as 1 ng/ml. It is worth noting that this increase occurred in the presence of 8% fetal bovine serum.

Different concentrations of TCDD also increased cell proliferation, albeit at a lower rate than epiregulin. Statistical analysis revealed this effect of TCDD to be significant, even though apparently modest. Although it is not possible to rule out the contribution of other growth factors, it is possible that this effect is due, at least in part, to an increase in epiregulin level.

Results from these studies also suggest that caution should be taken when extrapolating results across different species. The International Agency for Research on

Cancer (IARC) updated its classification of TCDD as a group 1 carcinogen in 1997 from its previous evaluation that classified it as a group 2B (possible) human carcinogen (239).

This upgrade has been debated in the literature (240, 241). However, it is clear from these discussions that not all data obtained from animal studies can be applied directly to humans. The toxic effects of TCDD appear to be less pronounced in humans than in rodents. A number of factors could be responsible for this, including differences in AhR, its cytosolic or nuclear binding partners, its affinity for ligands, endogenous ligands, transcriptional coregulators or the battery of genes whose transcription is modulated by

AhR. If a gene involved in a cellular process is regulated differently in humans and mice, it could be an important reason for possible differences. We compared the first 125 bases of epiregulin promoter sequence from human, mouse and rat and found that the DRE is

76 absent in humans (Figure 2.5) . Thus, TCDD-activated AhR may not regulate expression of epiregulin in humans. However, further studies in human tissue samples or cell lines will be needed to clarify this issue. In conclusion, we have shown for the first time that epiregulin is a direct target gene for the AhR pathway in rodents. Considering the mitogenic potential of epiregulin and the possibility that it might not be regulated through the AhR pathway in humans, these results point to a potential inter-species difference in regulation of a gene that could participate in TCDD-mediated tumor promotion.

77

Figure 2.5: The DRE is absent in the human epiregulin promoter. First 125 bases of epiregulin promoter, in mouse, rat and human, were aligned. Nucleotides representing Box A, B and C and DRE are enclosed. The DRE sequence is conserved in rodents but lost in human epiregulin promoter. Box A and C are conserved in all three species while Box B is lost in human promoter.

78

Chapter 3

AHR ACTIVATION REGULATES CONSTITUTIVE ANDROSTANE RECEPTOR (CAR) LEVELS IN MURINE AND HUMAN LIVER.

79

3.1 Abstract

The aryl-hydrocarbon receptor (AhR) is a bHLH/PAS (basic helix-loop-helix/Per-

Arnt-Sim) transcription factor that can be activated by exogenous as well as endogenous ligands. AhR is traditionally associated with xenobiotic metabolism. In an attempt to identify novel target genes, C57BL/6J mice were treated with β-naphthoflavone (BNF), a known AhR ligand, and genome-wide expression analysis studies were performed using high-density microarrays. Constitutive androstane receptor (CAR) was found to be one of the differentially regulated genes. Real-time quantitative polymerase chain reaction

(qPCR) verified the increase in CAR mRNA level. BNF treatment did not increase CAR mRNA in AhR-null mice. Time-course studies in mice revealed that the regulation of

CAR mRNA mimicked that of Cyp1A1, a known AhR-target gene. In order to demonstrate that the increase in CAR mRNA translates to an increase in functional CAR protein, mice were sequentially treated with BNF (6 hours) followed by the selective

CAR agonist, TCPOBOP (3 hours). qPCR revealed an increase in the mRNA level of

Cyp2b10, previously known to be regulated by CAR. This also suggests that CAR protein is present in limiting amounts with respect to its transactivation ability. Finally, CAR was also upregulated in primary human hepatocytes in response to AhR activation by TCDD and benzo[a]pyrene. In conclusion, this study identifies a novel mode of up-regulating

CAR and potentially expands the role of AhR in drug metabolism. This is the first study demonstrating in vivo upregulation of CAR through chemical exposure.

80 3.2 Introduction

Though a number of genes have been characterized to be regulated by AhR in a

DRE-dependent manner, alternative modes of receptor function as well as novel target genes must be identified to adequately explain the wide spectrum of patho-physiologic effects associated with AhR. An emerging aspect of transcription factor biology is the ability of various factors to interact with members of different signaling pathways.

Recent reports focusing on receptor cross-talk have highlighted the ability of AhR to influence the activity of other proteins involved in gene regulation, including NFkB

(173), estrogen receptor (ER) (158, 161, 242) and TGF-β1 (243).

The constitutive androstane receptor (CAR, also known as Nr1i3) is a member of the nuclear receptor family. It is found in the cytoplasm in a complex with heat shock protein 90 (HSP90) and CAR cytoplasmic retention protein (CCRP) (244). A unique feature of CAR is that it can be activated by two distinct mechanisms. Ligands like 1,4- bis [2-(3,5,-dichloropyridyloxy) benzene (TCPOBOP) can directly bind to CAR and activate the receptor (245). Alternately, CAR activity can be induced indirectly by a phenobarbital-responsive protein phosphatase-2A dependent signaling cascade (246).

Activated CAR undergoes nuclear translocation, heterodimerizes with 9-cis retinoic acid receptor (RXR) to bind its response element and drives the transcription of its target genes. Using cell-culture models, it has been demonstrated that activation of the glucocorticoid receptor can upregulate transcriptional activity at the CAR promoter (247)

81 and that IL-1β mediated NF-κB activation inhibits this upregulation by interfering with chromatin remodeling (248).

In the current study, we have identified CAR to be an AhR target gene.

Previously, it has been shown that both AhR and CAR play a significant role in response to exogenous stimuli as well as patho-physiologic events in the liver. Both the receptors induce numerous xenobiotic metabolism enzymes. AhR is also known to affect vascular development as demonstrated by persistent ductus venosus and microvasculature abnormalities in the liver of AhR-null mice (80). Recently it has been demonstrated that

TCDD exposure severely impairs the regenerative ability of partially excised mouse livers (249), an effect most likely mediated through AhR. On the other hand, TCDD is also known to be a potent tumor promoter in the mouse liver (250). CAR is similarly involved in a number of physiologic processes in the liver including bilirubin metabolism and hepatocyte proliferation as discussed below. As shown in this study, AhR-activation increases CAR mRNA in liver as well as extra-hepatic tissues and follows a temporal pattern similar to Cyp1A1, a known AhR target gene. This increase in CAR mRNA correlates with an increase in the transcriptional activity of CAR. Since a broad range of compounds can activate AhR, an AhR-mediated increase in CAR activity could potentially lead to unexpected effects on drug metabolism. Considering the importance of

AhR and CAR in liver biology, knowledge of the interaction between the two receptors will be useful in interpreting the observations made in relation to these receptors.

82 3.3 Materials and Methods

Mice and the treatments:

Adult (10 ± 2 weeks) male wild-type C57BL/6J mice were purchased from the

Jackson laboratory. AhR knock-out (AhR-KO) mice in a C7BL/6J background were a kind gift of Dr. Bradfield (McArdle Laboratory for Cancer Research, University of

Wisconsin-Madison Medical School). All mice were maintained in a temperature and light-controlled facility and had free access to water and diet. All experiments were performed in compliance with the standards for animal use and care set by the

Pennsylvania State University’s animal research program. Mice were injected intraperitoneally (I.P.) with BNF dissolved in corn oil (CO) or corn oil alone (control).

The volume of injection was adjusted in proportion to the body weight. Mice were sacrificed by carbon-dioxide inhalation and liver-tissue samples were collected. Tissues were frozen immediately in liquid nitrogen and stored at -80°C.

Microarray experiments:

Liver samples were homogenized in TRI-Reagent® with Ultra Turrax T25 basic disperser from IKA® Works, Inc. (Wilmington, NC). RNA was isolated from tissues using TRI Reagent® (Sigma-Aldrich Co.) and was further purified with RNeasy® kits

(Qiagen Inc.) according to the manufacturer’s protocol with minor modifications. The quality of RNA was analyzed on 1% agarose-formaldehyde gel and with Agilent 2100 bioanalyzer and RNA-6000 Nano Chip kit (Agilent Technologies, Inc.). GeneChip®

One-Cycle Target Labeling and Control Reagent package (Affymetrix, CA) was used to

83 label 8.0 μg total RNA for each microarray. The GeneChip® Hybridization, Wash, and

Stain kit (Affymetrix, CA) was used for processing the microarrays. Liver gene expression profiles were compared between BNF (10 mg/kg) treated versus vehicle- control mice using GeneChip® Mouse Genome 430 2.0 arrays. The arrays were scanned with GeneChip® Scanner 3000 at the microarray core facility of the Huck Institutes of

Life Sciences, Pennsylvania State University.

Microarray data analysis:

Background adjustment, normalization and summarization were performed on the raw data files (.CAB files) using RMAexpress (0.3 Release). Summarized data was further analyzed by Significance Analysis of Microarrays (SAM, Version 2.23A). The data was input in the log scale (base 2) and the default settings were accepted as the choice of analysis parameters i.e. T-statistic, 100 permutations, 10 neighbors for K- nearest neighbors imputer. A delta-value of 0.35 and 2-fold change was used as the threshold for significant differential expression. 97 probe-sets, corresponding to 80 distinct genes/ESTs, were found to be significantly changed with a false discovery rate of

5.7 percent using the settings detailed above.

Post-processing of the significantly altered genes was performed using the

DAVID Bioinformatic Resources 2006 online tool. Genes were clustered using the Gene

Functional Classification Tool using the lowest classification stringency settings. To reduce redundancy, the list of terms associated with the clustered genes was restricted to biological processes and/or molecular function (according to Gene Ontology

84 classification) with a p-value < 0.05, as computed by DAVID. A subset of genes was selected to confirm differential expression by real-time quantitative PCR.

Real-time quantitative PCR (qPCR):

Total RNA isolated from mice livers, as mentioned above, was reverse transcribed using the High Capacity cDNA Archive® kit (Applied Biosystems) according to the manufacturer’s protocol. cDNA made from 25 ng of RNA was used for each qPCR reactions. qPCR was performed on DNA Engine Opticon® system using DyNAmo™

SYBR® Green qPCR Kit purchased from New England Biolabs, Inc. Sequence

information for the qPCR primers is provided in Table 3.1.

85

Table 3.1: Sequence information for primers used in qPCR. Gene Primer Set (FP=forward primer; RP=reverse primer)

FP: 5`-GGAGCGGCTGTGGAAATATTGCAT-3` CAR RP: 5`-TCCATCTTGTAGCAAAGAGGCCCA-3`

FP: 5`-CTCTTCCCTGGATGCCTTCAA-3` Cyp1a1 RP: 5`-GGATGTGGCCCTTCTCAAATG-3`

FP: 5`-TTCATGTGGAGCCAAAGAAACGGC-3` PXR RP: 5`-TCCTGGAATGTGGGAACCTTTCCT-3`

FP: 5`-TTCTGCGCATGGAGAAGGAGAAGT-3` Cyp2b10 RP: 5`-TGAGCATGAGCAGGAAGCCATAGT-3`

FP: 5`-CATGGCCTTCCGTGTTCCTA-3` GAPDH RP: 5`-GCGGCACGTCAGATCCA-3`

FP: 5`-AGTGCTTAGATGCTGGCATGAGGA-3` CAR (human) RP: 5`-TGCTCCTTACTCAGTTGCACAGGT-3`

FP: 5`-CCTGGAGGAGAAGAGGAAAGAGA-3` Rpl13a (human) RP: 5`-GAGGACCTCTGTGTATTTGTCAA-3`

86 Primary human hepatocyte culture:

Primary human hepatocytes were obtained from the Liver Tissue Procurement and Distribution System (LTPDS) at the University of Pittsburgh, through NIH Contract

#NO1-DK-9-2310, and generously provided by Dr. Stephan C. Strom. Donor organs not designated for transplantation were used to isolate hepatocytes according to a three step collagenase perfusion protocol (251). Preparations enriched for hepatocytes were received plated in collagen-coated T25 flasks. Upon arrival, the media was changed to

William’s Media E supplemented with 1% penicillin/streptomycin, 10 mM HEPES, 20

μM glutamine, 25 nM dexamethasone, 10 nM insulin, 30 mM linoleic acid, 1 mg/ml

BSA, 5ng/ml selenious acid, 5 μg/ml transferring, as described previously (252). All cells were maintained at 37°C under 5% CO2. All culturing materials were purchased from

Invitrogen (Carlsbad, CA), unless otherwise noted.

3.4 Results:

AhR activation alters the expression of various genes in mouse liver:

In an effort to identify novel AhR target genes, we performed genome-wide expression profiling studies using high-density microarrays (Affymetrix). 10-week old male wild-type C57BL/6J mice were treated with 10 mg/kg BNF in corn oil by I.P. injections, for 5 h, following which, RNA was isolated from their livers. The RNA was processed and hybridized to GeneChip® Mouse Genome 430 2.0 arrays. After pre- processing and analyzing the data as described in the methods, significantly altered genes were classified on the basis of gene ontology (biological process (BP) and/or molecular

87 function (MF)) to identify patterns of biological importance. The ‘Gene Functional

Classification’ module, implemented in the online version of DAVID, clusters genes on the basis of the similarity of different ontology terms associated with the genes. The list of terms for each cluster comprised of overlapping and redundant entries and thus had to be manually limited to include those with high statistical significance of association and to prevent repetition of parent/child terms. The results are presented in Table 3.2 . The table also includes whether a dioxin response element (DRE) is present in the putative regulatory region (-5000 to +1000 bases relative to transcription start site) of the respective genes. To validate the microarray results, qPCR was performed on fourteen genes that included four previously known AhR targets and the results were similar to the changes observed on the microarrays. The induction/repression observed by qPCR is given as a fold-change in parenthesis. The alteration of genes belonging to diverse functional categories further supports the role of AhR in a variety of cellular processes.

88

Table 3.2: BNF-mediated differentially regulated genes, sorted by Biological Process (BP)/Molecular Function (MF)

Genes induced by BNF treatment Affy Id Fold Change Gene Name BP/MF Terms (p<0.05) DRE I of Presence qPCR confirmation Gene Group 1 Enrichment Score: 2.24 antigen 1425477_x_at, presentation, histocompatibility 2, class ii antigen a, 1 1451721_a_at, 2.8 exogenous beta 1 1450648_s_at antigen via MHC class II positive 1435290_x_at, histocompatibility 2, class ii antigen a, regulation of T 2 1452431_s_at, 2.6 alpha cell 1438858_x_at differentiation cd74 antigen (invariant polypeptide of MHC class II 3 1425519_a_at 2.4 major histocompatibility complex, class ii + receptor activity antigen-associated) antigen processing, histocompatibility 2, class ii antigen e 4 1417025_at 2.3 exogenous + beta antigen via MHC class II immune 5 1422527_at 2.2 histocompatibility 2, class ii, locus dma + response Gene Group 2 Enrichment Score: 1.98 hydrolase activity, acting 1 1449009_at 5.7 t-cell specific gtpase on acid anhydrides nucleoside- 2 1420549_at 3.9 guanylate nucleotide binding protein 1 triphosphatase + activity purine 3 1419518_at 2.7 tubulin, alpha 8 nucleotide binding 1425351_at, 4 1426875_s_at, 2.6 neoplastic progression 3 GTPase activity 1451680_at 1417141_at, 5 2.5 interferon gamma induced gtpase 1458589_at

89 1419748_at, Atp-binding cassette, sub-family d (ald), 6 2.4 1438431_at member 2 7 1418392_a_at 2.3 guanylate nucleotide binding protein 4 + atpase, aminophospholipid transporter 8 1423597_at 2.2 + (aplt), class i, type 8a, member 1 9 1425156_at 2.2 riken cdna 9830147j24 gene 1 1417101_at 2.1 heat shock protein 2 + 0 1 Atp-binding cassette, sub-family c 1443870_at 2.0 1 (cftr/mrp), member 4 Gene Group 3 Enrichment Score: 1.95 26 cytochrome p450, family 1, subfamily a, monooxygenas 1 1422217_a_at + + 6.6 polypeptide 1 e activity generation of precursor 2 1423627_at 3.4 nad(p)h dehydrogenase, quinone 1 + + metabolites and energy 1422904_at, 1422905_s_at, electron 3 2.7 flavin containing monooxygenase 2 + 1435459_at, transport 1453435_a_at oxygen and cytochrome p450, family 1, subfamily a, reactive oxygen 4 1450715_at 2.6 + + polypeptide 2 species metabolism 5 1454930_at 2.4 leucine rich repeat containing 35 FAD binding 6 1449525_at 2.3 flavin containing monooxygenase 3 NADP binding + 7 1447411_at 2.3 udp-glucose dehydrogenase heme binding + cytochrome p450, family 2, subfamily g, 8 1449565_at 2.2 polypeptide 1 cytochrome p450, family 1, subfamily b, 9 1416612_at 2.0 + + polypeptide 1 Gene Group 4 Enrichment Score: 0.94 establishment 1 1419647_a_at 3.1 immediate early response 3 + of localization 1419748_at, Atp-binding cassette, sub-family d (ald), 2 2.4 transport 1438431_at member 2 solute carrier family 6 (neurotransmitter 3 1421346_a_at 2.1 + transporter, taurine), member 6 Gene Group 5 Enrichment Score: 0.65 transmembrane 1 1419647_a_at 3.1 immediate early response 3 + receptor activity MHC class II 2 1417625_s_at 2.9 chemokine orphan receptor 1 + receptor activity cell surface 1425477_x_at, histocompatibility 2, class ii antigen a, receptor linked 3 1451721_a_at, 2.8 beta 1 signal 1450648_s_at transduction tumor necrosis factor receptor defense 4 1448147_at 2.7 + + superfamily, member 19 response histocompatibility 2, class ii antigen e G-protein 5 1417025_at 2.3 + beta coupled

90 receptor activity 6 1446850_at 2.1 phosphatidic acid phosphatase type 2b + 7 1417894_at 2.1 g protein-coupled receptor 97 Gene Group 6 Enrichment Score: 0.13 ligand- 1421818_at, dependent 1 3.3 b-cell leukemia/lymphoma 6 + 1450381_a_at nuclear receptor activity regulation of Hiv-1 tat interactive protein 2, homolog transcription, 2 1451814_a_at 3.3 + (human) DNA- dependent regulation of nucleobase, nucleoside, 3 1455267_at 3.2 estrogen-related receptor gamma + nucleotide and nucleic acid metabolism regulation of 1416543_at, 4 2.3 nuclear factor, erythroid derived 2, like 2 cellular 1457117_at metabolism nuclear receptor subfamily 1, group i, 5 1425392_a_at 2.3 + member 3 6 1429177_x_at 2.1 Sry-box containing gene 17 + Gene Group 7 Enrichment Score: 0.11 ubiquitin- dependent 1 1418191_at 3.8 ubiquitin specific peptidase 18 + + protein catabolism purine 2 1436532_at 3.6 doublecortin and cam kinase-like 3 nucleotide + binding cellular protein 3 1451453_at 3.1 death-associated kinase 2 + + metabolism proteosome (prosome, macropain) cellular 4 1422962_a_at 2.9 subunit, beta type 8 (large macromolecule + multifunctional peptidase 7) metabolism endopeptidase 5 1419518_at 2.7 tubulin, alpha 8 + activity protein tyrosine phosphatase, receptor- 6 1417801_a_at 2.7 type, f interacting protein, binding protein lipid transport + 2 7 1428484_at 2.5 oxysterol binding protein-like 3 + proteosome (prosome, macropain) 8 1450696_at 2.2 subunit, beta type 9 (large + multifunctional peptidase 2) 9 1417101_at 2.1 heat shock protein 2 + 10 1424518_at 2.0 riken cdna 2310016f22 gene + 11 1424518_at 2.0 cdna sequence bc020489 +

91

Genes that could not be classified Affy Id Fold Change Gene Name of Presence DRE I qPCR confirmation 1 1427912_at 5.6 carbonyl reductase 3 + 2 1452913_at 3.7 purkinje cell protein 4-like 1 3 1451486_at 3.7 riken cdna 1200006f02 gene + 4 1456319_at 3.5 Est x83313 1424167_a_at 5 , 3.1 phosphomannomutase 1 1430780_a_at 6 1428670_at 2.7 riken cdna 2610305j24 gene 7 1443138_at 2.6 sulfotransferase family 5a, member 1 + 8 1423410_at 2.5 meiosis expressed gene 1 + 1424296_at, 9 2.5 glutamate-cysteine ligase, catalytic subunit 1455959_s_at 10 1428120_at 2.4 f-box and wd-40 domain protein 9 + 11 1426936_at 2.4 hypothetical loc433593 1433685_a_at 12 2.3 riken cdna 6430706d22 gene , 1455654_at 13 1417185_at 2.3 lymphocyte antigen 6 complex, locus a + tumor necrosis factor, alpha-induced protein 14 1438855_x_at 2.3 + 2 15 1450699_at 2.3 selenium binding protein 1 + 16 1424594_at 2.3 lectin, galactose binding, soluble 7 + 17 1431240_at 2.3 c-type lectin domain family 2, member h + 18 1433710_at 2.2 hypothetical protein mgc36552 + 19 1431806_at 2.2 riken cdna 4931408d14 gene 20 1436576_at 2.2 riken cdna a630077b13 gene + 21 1418727_at 2.2 nucleoporin 155 + 22 1454890_at 2.2 Angiomotin + + 23 1418346_at 2.2 insulin-like 6 + + serine (or cysteine) peptidase inhibitor, clade 24 1419149_at 2.0 + e, member 1 25 1426215_at 2.0 dopa decarboxylase 26 1431648_at 2.0 riken cdna 4930528f23 gene 27 1438294_at 2.0 ataxin 1 +

92

Genes repressed by BNF treatment

n f o i at

I R C nfirm Affy Id Fold Change Gene Name o Presence DRE qP co 1444296_ a_at, 1444297_ serine (or cysteine) peptidase inhibitor, clade a, 1 3.5 + at, member 4, pseudogene 1 1448092_ x_at 1433898_ 2 solute carrier family 25, member 30 + at 2.3 1448724_ 3 cytokine inducible sh2-containing protein + + at 2.3 1437073_ 4 expressed sequence av025504 x_at 2.2 1418288_ 5 lipin 1 + at 2.1 1452426_ 6 hypothetical protein x_at 2.1 1436186_ 7 e2f transcription factor 8 at 2.0

93 AhR activation increases CAR mRNA in mouse liver:

CAR was one of the genes observed to be upregulated in the livers of BNF treated mice as compared to the vehicle (corn oil) alone. The results obtained from the microarray experiments were verified by real-time quantitative PCR (qPCR) and are presented in Figure 3.1. qPCR data revealed 2.1-fold increase in CAR mRNA on BNF treatment which correlated well with microarray results. The currently accepted model of

AhR-dependent transcription is based on the AhR-ARNT heterodimer binding to a consensus DRE in the regulatory region of a target gene. However, sequence analysis of the putative mouse CAR promoter (-5000 to +1000 bases relative to transcription start site) did not reveal any sequences matching the DRE (TNGCGTG). This observation generated further interest in examining the role of AhR in regulating CAR expression and whether the observed increase in CAR mRNA had a functional significance.

94

Figure 3.1: CAR mRNA levels increase in response to the AhR-ligand BNF. Six adult C57BL/6J mice were injected, either with 10 mg/kg BNF or vehicle control for 5 h. mRNA isolated from liver samples was reverse transcribed and quantified by qPCR using CAR-specific primers. The data represent the relative fluorescence units for each sample, obtained after normalization to GAPDH. p-value < 0.02, as determined by t-test.

95 Presence of AhR is essential for BNF-mediated increase in CAR mRNA:

BNF is an established AhR ligand and to the best of our knowledge, there are no reports confirming the ability of BNF to directly activate any transcription factor other than AhR. However, the possibility of a BNF-mediated effect that is independent of AhR has to be considered. BNF exposure is known to cause oxidative stress, which can possibly activate the nuclear factor erythroid 2 related factor 2 (Nrf2). Nrf2 is a transcription factor known to regulate genes involved with protection against cellular stress, such as Nqo1 (253). Additionally, Nqo1 is upregulated directly by AhR. Since the

AhR knock-out (AhR-KO) mice are devoid of AhR transcriptional activity, any increase in Nqo1 mRNA in AhR-KO mice can be attributed to oxidant stress.

To exclude the contribution of such an effect in the observed upregulation of

CAR mRNA, age-matched AhR-KO (77) and wild-type mice were injected with 50 mg/kg BNF or vehicle alone for 5 h. As compared to the previous experiment, mice were treated with a higher dose of BNF to definitively exclude such an effect. Liver CAR mRNA levels did not demonstrate a significant difference between BNF and vehicle treated AhR-KO mice, as determined by qPCR (Figure 3.2 B). Also, Nqo1 mRNA levels were the same between control and BNF treated AhR-KO mice (data not shown). This suggests that with the experimental parameters used in this study, the observed increase in CAR mRNA is not a result of BNF generated oxidant stress. Wild-type mice demonstrated an increase in CAR mRNA on BNF treatment similar to that in the microarray experiments (Figure 3.2 B). Cyp1A1 mRNA levels were determined as a control (Figure 3.2 A) for AhR activity. This finding, along with the absence of a

96 consensus DRE in the CAR promoter, makes it necessary to examine the mode by which

AhR influences CAR mRNA levels. Although it is possible to distinguish a secondary effect from direct transcription with the use of a protein synthesis inhibitor like cycloheximide, the inability to significantly induce transcription of CAR in established cell-lines has precluded such experiments.

97

Figure 3.2: CAR up-regulation is AhR-dependent. AhR knock-out (AhR KO) mice, or wild-type (WT) mice, were injected with 50 mg/kg BNF or vehicle alone. Liver mRNA, collected after 5 h, was reverse transcribed and quantified by qPCR using (A) Cyp1A1– and (B) CAR–specific primers. Normalized relative fluorescence values obtained with Cyp1A1, or CAR, primers are presented for individual mice. Statistical analysis was performed using t-test.

98 Temporal and spatial patterns of CAR upregulation mimics Cyp1A1:

As CAR plays a significant role in regulating many drug metabolism enzymes, most of which are distinct from the known AhR-target genes, an increase in CAR levels in response to AhR activation can significantly expand the role of AhR in controlling xenobiotic metabolism. Time course experiments were performed to determine whether

AhR-mediated increase in CAR mRNA was sustained over a longer period. Adult mice were injected 50 mg/kg BNF or vehicle alone and sacrificed at 6, 12 and 24 h. Maximal induction (3-fold) of CAR was observed 6 h after BNF exposure and was sustained till 24 h (Figure 3.3 A). Induction of Cyp1A1, a known AhR target gene, demonstrated a similar temporal pattern, although the level of induction was greater than that of CAR (data not shown). The decline in CAR and Cyp1A1 mRNA at the later time-points is most likely due to a decrease in BNF levels, and subsequent loss of AhR activity, as a result of metabolism.

99

Figure 3.3: Temporal and spatial patterns of CAR expression. (A) CAR mRNA levels were quantified by qPCR on liver samples from C57BL/6J mice treated with 50 mg/kg BNF or vehicle for the indicated times. Data are represented as mean (n=4) and standard deviation; *p-value<0.05 as determined by t-test.

(B) qPCR quantification of CAR mRNA levels in kidney obtained from mice treated for 6 h in the above time-course experiment. *p-value<0.05 as determined by t-test.

100 Increase in CAR levels in extra-hepatic tissues could significantly complement the hepatic clearance of xenobiotics. The ability of AhR to upregulate CAR mRNA in kidney and small intestine, both of which play a significant role in drug metabolism, was determined by qPCR. A statistically significant increase in CAR mRNA levels was observed in kidney after 6 h of 50mg/kg BNF treatment (Figure 3.3 B). CAR upregulation (2.2-fold) was also noted in small intestine (terminal ileum); however, increased inter-sample variability prevented statistical verification of the results (data not shown).

Increase in CAR mRNA results in increased CAR transcriptional activity:

We wanted to confirm that an increase in CAR mRNA would lead to a corresponding increase in the functional capacity of CAR, as determined by changes in

CAR-mediated transcription of its target genes. Cyp2b10 mRNA levels were chosen as a marker of CAR’s transcriptional activity. Previously, it has been reported that activation of CAR by TCPOBOP, a mouse-CAR-specific ligand, leads to an increase in hepatic

Cyp2b10 levels in mice (254). Adult mice were treated with either BNF or vehicle control, to upregulate CAR levels. Six hours later, the mice were treated with TCPOBOP to activate CAR protein, or with vehicle control. Three hours after TCPOBOP treatment, liver Cyp2b10 mRNA levels were measured by qPCR. Mice treated with BNF-

TCPOBOP demonstrated 2.4-fold increase in hepatic Cyp2b10 mRNA compared to vehicle-TCPOBOP (Figure 3.4 B). These results demonstrate that the observed increase in CAR mRNA translates to a similar increase in CAR activity. Interestingly, even in the absence of subsequent TCPOBOP treatment, an increase (2-fold) in Cyp2b10 mRNA was

101 observed in BNF treated mice compared to vehicle (Figure 3.4 B). However, the absolute levels of Cyp2b10 mRNA were significantly lower without TCPOBOP exposure. Based on these results, it is reasonable to assume that the AhR-dependent increase in CAR mRNA leads to a functionally significant change in CAR activity. Although a Western blot would serve to directly confirm an increase in CAR protein, the lack of a quality commercially available antibody to murine-CAR has prevented the demonstration of such an increase in protein level.

102

Figure 3.4: AhR-dependent CAR up-regulation leads to increased CAR-mediated transcriptional activity. Adult C57BL/6J mice were treated with an AhR ligand (50 mg/kg BNF for 6 h), to up- regulate CAR levels, or vehicle control. Subsequently, the mice were treated with a CAR ligand (3 mg/kg TCPOBOP for 3 h), or vehicle control, to activate CAR protein. CAR (A), Cyp2b10 (B) and PXR (C) mRNA levels were quantified in liver samples by qPCR. BNF/TCPOBOP treatment is indicated by a ‘+’ beneath the bars. Absence of a ‘+’ indicated vehicle treatment. Data are represented as mean (n=4) and standard deviation for each group. Statistical analysis was performed by t-test.

103 Pregnane-X-receptor (PXR), another transcription factor involved in regulating xenobiotic metabolism enzymes, is also capable of inducing Cyp2b10 mRNA (242).

Alterations in PXR levels were monitored by qPCR to determine if it contributed to the observed increase in Cyp2b10. PXR mRNA levels were found to be similar across all treatments (Figure 3.4 C), confirming that the increase in Cyp2b10 mRNA was most likely due to the AhR-mediated increase in CAR levels.

CAR induction in primary human hepatocytes with different AhR ligands:

CAR mRNA levels were determined after treating primary human hepatocytes with TCDD and benzo[a]pyrene (BaP). 10 nM TCDD treatment for 24 h and 1 μM BaP for 12 h resulted in a statistically significant increase in CAR mRNA as compared to control ( Figure 3.5 ). Increase in CAR mRNA with BaP treatment for 24 h was less than that observed at 12 h, possibly due to faster metabolism of BaP as compared to TCDD.

Although there is only a modest increase in CAR mRNA levels, it should be noted that this increase is in presence of 25 nM dexamethasone in the media. As discussed previously, dexamethasone is known to induce CAR level (247). Increase in CAR mRNA was further confirmed in primary human hepatocytes obtained from a second individual, as shown in Figure 3.5 .

104

Figure 3.5: CAR induction in response to AhR ligands in primary human hepatocyte culture. Primary human hepatocytes were cultured in 6-well plates and treated with 10 nM TCDD or 1 μM BaP for the indicated time periods. RNA was isolated and analyzed by qPCR. Bars represent mean and standard deviation of triplicate treatments for the first individual. * indicates statistical significance at p<0.05, as determined by t-test. The same experiment was repeated in duplicate for the second individual.

105

3.5 DISCUSSION

Transcription factors play a significant role in coordinating the responses of a cell to various external stimuli. Traditionally, these factors are thought to function by binding to defined consensus DNA sequences and driving the transcription of a certain array of target genes. However, a number of receptors have also been found to function in an alternate manner by influencing the functional capacity of other receptors. This significantly expands the range of effects attributed to the individual receptors. At the same time it also makes it challenging to interpret the results of genome-wide studies. As observed in the results of microarray experiments performed as a part of this study, AhR- activation leads to alteration in the expression of a variety of genes. The number of genes, whose expression was repressed by AhR activation, is small as compared to the number of up-regulated genes (7 down-regulated genes versus 73 up-regulated genes). A probable explanation for this discrepancy is the short time period of AhR activation used here.

Although 5 h is enough to upregulate the expression of direct as well as, in some cases, indirect target genes, it might not allow adequate time to notice a decline in the levels of down regulated genes.

AhR has been demonstrated to extensively participate in cross-talk with a number of other receptors. It can directly interact with the NF-κB (173), the retinoblastoma (RB) protein (210), Sp1 transcription factor (232) and the estrogen receptor. Interaction of the

AhR with each of these proteins has been shown to modulate signal transduction by these

106 proteins. In the case of AhR-ER, crosstalk has been postulated to arise from multiple mechanisms including binding to inhibitory DREs, ER ligand depletion due to increased metabolism by AhR induced enzymes, AhR-mediated proteasome-dependent ER degradation and inaccessibility to their respective response element because of protein- protein interaction (158, 161, 242). In this report, the ability of AhR to influence CAR- mediated signal transduction exemplifies regulation of receptor quantities as an additional mechanism of AhR-crosstalk.

Like AhR, CAR has been implicated in regulating the expression of a number of xenobiotic metabolism enzymes. CAR and PXR play a significant role in controlling the levels of Cyp2B and Cyp3A family of enzymes. These enzymes are believed to influence the metabolism of a number of currently available drugs (255). An alteration in the functional capacity of CAR, or of PXR, would affect the levels of these enzymes and potentially generate unanticipated changes in the pharmacokinetic properties of their target drugs. The observations recorded in this study demonstrate that in vivo activation of AhR alters Cyp2b10 levels by mediating an increase in CAR, without affecting the expression of PXR. This can have significant practical implications as AhR can be activated in response to a wide variety of compounds that are ubiquitous and are often encountered by humans. Common examples of AhR ligands include benzo[a]pyrene (a constituent of cigarette smoke), TCDD (generated by combustion of organic matter), flavones (present in common food items), indole 3-carbinol (found in cruciferous vegetables), tryptophan metabolites as well as drugs like omeprazole (reviewed in (26)).

As shown in Figure 3.5, AhR-mediated CAR induction occurs in human cells as well,

107 and therefore is not limited to only the murine model. We also demonstrate that a variety of AhR ligands, as exemplified by the use of TCDD and BaP, can lead to increased CAR levels. Thus, varying degrees of exposure to AhR ligands can result in significant inter- individual differences in CAR activity and consequent disparity in xenobiotic metabolism potential.

The physiological role of CAR extends beyond that of regulating xenobiotic metabolism. Because of its ability to control the expression of genes involved in hepatic uptake and clearance of bilirubin, CAR has been implicated in stress response during periods of hyperbilirubinemia (256). Also, bilirubin and biliverdin can function as AhR ligands (39, 40). It is possible that AhR-dependent increase in CAR levels is one of the mechanisms by which bilirubin indirectly increases CAR activity to protect the body from the adverse effects of elevated bilirubin levels. Recent reports have also associated

CAR activity with thyroid hormone homeostasis during states of restricted calorie intake

(250) as well as with hepatocyte proliferation (257) and tumor formation (258). An AhR- mediated increase in CAR activity may potentially alter the outcome of these states as well.

The activity of many transcription factors is regulated by their tissue-specific expression. Constitutive expression of CAR is principally observed in liver and small intestine, and most studies related to CAR have explored its functions primarily in a hepatic context. In contrast, AhR is expressed in a wide variety of tissues and can potentially induce CAR levels in these tissues, as demonstrated by an increase in renal

108 CAR expression reported here. Even in hepatic tissue, where maximal constitutive CAR levels are observed, it is possible to increase CAR activity by increasing its levels.

Figure 3.4 clearly demonstrates that an increase in CAR (approximately 2-fold) resulted in a proportionate increase in its transcriptional activity as demonstrated by a 2-fold increase in Cyp2b10 mRNA. Collectively, these results suggest that in extra-hepatic tissues, where the constitutive level of CAR is extremely low or absent, AhR-dependent induction of CAR expression can significantly enhance its functions and might reveal additional roles for this receptor. Additional experiments, such as profiling genome-wide expression changes in extra-hepatic tissues as well as effects of long-term exposure to

AhR-ligands in wild-type and CAR knock-out mice, can provide further information.

In conclusion, these results demonstrate the ability of activated AhR to increase

CAR activity, which can alter drug metabolism. Inhalation of cigarette smoke has been known to markedly increase Cyp1A1 levels in murine livers, thus indicating AhR activation (259). Similar circumstances can lead to unexpected changes in CAR- dependent drug metabolism. Thus, it may be important to be aware of the effects of AhR activation while determining the dosage of certain drugs in different patient populations.

Additionally, the direct transcription models of receptor function cannot explain all the observations from large-scale gene expression studies. There is clearly a need to explore different mechanisms by which transcription factors can influence gene expression. Our results demonstrate a link between AhR and CAR, and although further studies are required to determine the exact molecular mechanism, the information presented here

109 will be helpful in interpreting experimental results related to AhR and CAR, particularly in liver.

110

Chapter 4

AHR REPRESSES CYTOKINE MEDIATED ACUTE PHASE RESPONSE BY A DNA-INDEPENDENT MECHANISM.

111

4.1 Abstract

In the recent years, there has been considerable focus on identifying novel mechanisms for transcription factor activity. DNA-binding independent effects have been identified for receptors such as GR and ER. An endpoint for analyzing these effects has been the ability to influence the activity of other transcription factors. We investigated the ability of AhR to function in the absence of direct DNA-binding. A previously characterized DNA-binding mutant (A78D) form of AhR, along with the wild-type (WT) form of AhR, was transiently expressed in Simian virus 40 immortalized AhR-null mouse hepatocytes. Changes in gene expression were analyzed using Affymetrix microarrays.

Serum amyloid A3 (Saa3) was one of the genes whose expression was repressed 2-fold with the DNA-binding mutant (A78D) form as well as the WT from of AhR. Saa3 is an acute-phase protein and is significantly induced by pro-inflammatory cytokines, particularly interleukin (IL)-6 and IL-1β. Microarray results were verified with real-time

PCR in an independent experiment, which also included two additional mutants of AhR – a heterodimerization and a nuclear localization mutant – neither of which were able to repress Saa3 expression. Subsequent experiments, conducted in Hepa1c1c7 cells, demonstrated that AhR activation with different ligands can suppress IL-mediated Saa3 mRNA expression. Moreover, the fact that TCDD failed to repress Saa3 expression in primary AhR-null hepatocytes demonstrated that the effect is AhR-dependent. Chromatin immunoprecipitation assays revealed that AhR activation diminishes the acetylation of histones as well as recruitment of the p65 component of NFκB at the Saa3 promoter in

112 response to IL-6 and IL-1β. Other acute-phase response genes, notably Saa1, Saa2 and C- reactive protein, were also observed to be significantly repressed on AhR activation.

Finally, AHR-mediated inflammatory inhibition was verified in human liver cells. Our results provide evidence for a DNA-binding independent mode of AhR activity that may be critical in influencing inflammatory outcomes. This study also demonstrates that AhR can modulate the acute-phase response, thus establishing a role for AhR in inflammatory signaling.

113

4.2 Introduction

All organisms are programmed to react rapidly to environmental as well as intrinsic challenges by inducing physiological alterations that favor survival. The acute phase response (APR) is a set of such alterations that enable an organism to restore homeostasis in response to insults, such as infection, inflammation, stress and even neoplasm. Acute phase changes can be broadly classified into two groups – first, neuroendocrine and behavioral changes such as fever, somnolence, anorexia and lethargy, and second, an alteration in the expression of certain proteins, known as acute phase proteins (APP) (reviewed in (260)). Examples of APP include members of the complement and coagulation cascades, antiproteases, transport proteins and, the most famous of all, C-reactive protein (CRP) and serum amyloid A (SAA). Liver serves as the primary site of synthesis and secretion of acute-phase proteins. Collectively, an increase in the expression of these proteins serves to facilitate the immune and metabolic responses necessary to restore homeostasis. Induction of most acute phase proteins is mediated by cytokine signaling (261) through the activation of NF-κB, CEBP and Stat pathways.

NF-κB is a transcription factor that functions as a principal regulator of inflammatory and immune responses. It exists as a dimer formed by various combinations of seven proteins translated from five NF-κB/REL genes (reviewed in

(262)). The majority of gene regulatory effects mediated by NF-κB are attributed to the

114 heterodimer composed of the p50 and RELA (p65) subunits. Under basal conditions, the

RELA/p50 complex is sequestered in the cytoplasm by its association with a member of the IκB family of inhibitor proteins, IκBα (263, 264). Cytokine stimulation leads to phosphorylation, ubiquitylation and subsequent degradation of IκB by the proteasome complex. This releases NF-κB which then translocates to the nucleus and binds cognate

κB elements to drive transcription of its target genes. Phosphorylation (265-269) and acetylation (270, 271) act as nuclear molecular switches to modulate the transcriptional potential of NF-κB (272).

A number of activated nuclear receptors can interact with NF-κB signaling to alter biological outcomes (164, 165). Recently, there has been evidence suggesting that aryl hydrocarbon receptor (AHR) also influences NF-κB activity (173). Traditionally, AHR activation has been associated with induction of enzymes involved in xenobiotic metabolism. However, there is a growing body of evidence implicating a role for AHR in a wide array of cellular processes (137, 142) and DRE-dependent induction of target genes is unlikely to be able to explain all the patho-physiological effects attributed to

AHR.

Receptor cross-talk with other transcription factors has been an exciting emerging aspect of nuclear receptor biology. Understanding the networking of various signaling pathways can elucidate hitherto unexplained physiological phenomena. Here, we present evidence demonstrating the ability of the aryl-hydrocarbon receptor (AHR) to repress nuclear factor-kappa B (NF-κB) mediated induction of an important aspect of

115 inflammatory reaction – the acute phase response (APR). Cytokine mediated induction of an APR gene, serum amyloid A (Saa), can be significantly repressed by activated AHR in mouse and human cell lines as well as primary mouse hepatocytes. The observed repression is due to a direct effect on Saa transcription and may involve NF-κB regulation at multiple levels. Interestingly, DNA-binding is not essential for this new

AHR function. A previously described AHR mutant (273) incapable of binding to its cognate response element (A78D-AHR) repressed Saa transcription with the same efficiency as the wild-type AHR. Since DNA affinity studies have revealed that AHR binds only to a unique cognate DNA sequence, we believe that A78D-AHR can be described as a DNA-binding mutant. AHR-mediated repression is not limited to Saa, but extends to an array of other APR genes as well. This is the first report demonstrating the ability of AHR to repress a facet of inflammatory response in a non-traditional manner.

116

4.3 Materials and Methods:

Reagents:

Cycloheximide, Actinomycin D and TSA were purchased from Sigma Co. TCDD was a kind gift from Dr. Stephen Safe, Texas A & M University. Anti-RELA antibody

(sc-372) was purchased from Santa Cruz Biotechnology Inc. and anti-acetyl-histone H4

(Lys5) antibody was purchased from Upstate. Recombinant interleukins were purchased from PeproTech Inc. Hepa1c1c7 and Huh7 cells were obtained from American Type

Culture Collection. Primers for PCR reactions were purchased from Integrated DNA

Technology.

Cell Culture:

Hepa1c1c7 and Huh7 established cell-lines were cultured in α-minimum essential medium under 5% CO2 at 37°C. Primary bone marrow (BM) cells were isolated from lower limb bones of 8-12 weeks old C57BL/6 mice. Cells were flushed out and were dispersed by gentle manipulation with a 1 ml pipette. BM cells were cultured overnight in

Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 8% fetal bovine serum (FBS) and penicillin/streptomycin. Non-adherent cells were centrifuged and plated in DMEM supplemented with 10 ng/ml granulocyte-monocyte colony stimulating factor

(GM-CSF) and 2 mM glutamine. Half the volume of medium was replaced everyday for

4 days prior to treatment.

117

RNA isolation and Real-time PCR:

RNA was isolated from cells with TRI® reagent (Sigma-Aldrich Co.) and reverse transcribed with High Capacity cDNA Archive kit (Applied Biosystems ). Quantitative real-time PCR was performed on iQ systems (BioRad) using iQ SYBR Green master mix

(BioRad), according to the manufacturer’s protocol. Expression values of genes of interest were normalized to that of the housekeeping gene ribosomal protein L13a

(RpL13a).

Chromatin Immunoprecipitation assay:

Chromatin immunoprecipitation assays (ChIP) were performed as described previously in Chapter 2. Briefly, cells cultured in 150 mm culture dishes were crosslinked with 1% formaldehyde for 8 min at 37°C and sonicated to generate 500 - 700 bp fragments. The sonicated lysate was diluted to 2 A260 units and 1 ml of this lysate was subjected to immunoprecipitation with the respective antibodies and protein sepharose A resin. Enrichment of promoter fragments was determined by PCR/real-time PCR. Primer sequences are:

Saa1ChIP-F: AGAGCGACACACACACACTGTCTT Saa1ChIP-R: AGGTGAGAGGAGGCAGGCATTTAT

Saa2ChIP-F: TACTACACCCCAGAAGATTGCCAC Saa2ChIP-R: AGGTGAGAGGAGGCAGGCATTTAT

Saa3ChIP-F: GCGCAATCTGGGGAAAGAAGATGT Saa3ChIP-R: TGAGTGGCTTCTGTCCTTTGCTGA

118 siRNA:

AHR knock-down was attained with siRNA oligos purchased from Dharmacon

RNAi Technologies, Thermo Fisher Scientific Inc. Approximately 60% confluent Huh7 cells were transfected with 120 nM scrambled or anti-AHR oligos using 6 μl Dharmafect-

1 transfection reagent. Culture medium was changed after 24 h and the cells were allowed to recover for an additional 12 h before treatment.

ELISA:

Huh7 cells were treated with TCDD and interleukins for 10 h or 24 h under serum-free conditions. 100 μl of culture media was analyzed for SAA protein levels using

Human SAA ELISA kit purchased from Anogen, Yes Biotech Laboratories Ltd., according to the manufacturer’s protocol.

Microarrays:

RNA was isolated from 106 sorted cells using TRI® reagent and cleaned with

RNeasy® columns. RNA integrity was confirmed by Bioanalyzer (Applied Biosystems).

Samples were then hybridized to Affy mouse 2.0A genome chips. Labeling, hybridization

and washing was performed at the microarray core facility, the Pennsylvania State

University. Data was processed and significantly altered genes were identified using

GeneChip Operating Software (GCOS). Genes that were declared as increased or as

decreased in wild-type AHR (WT-AHR) and DNA-binding mutant AHR (A78D-AHR)

transfected cells, as compared to control transfections were enlisted.

119 Animal care:

C57BL6/J mice were maintained at the Penn State University’s animal care facility. Animals had ad libitum access to regular chow and water, and were maintained on a 12 h light cycle. Animals were euthanized by CO2 exposure. Guidelines for animal care provided by the Pennsylvania State University’s animal care program were adhered to. Conditional AHR knock-out mice (Ahrfx/fxCreAlb) were kindly provided by Dr.

Christopher Bradfield.

Statistics:

Results were analyzed by t-test and deemed significant at p<0.05, unlessotherwise

noted.

120

4.4 Results:

Identification of DNA-binding independent effects of AHR

The established mechanism of AHR function involves binding of the AHR-ARNT heterodimer to DNA with a consensus DRE sequence. As discussed, this mechanism is unlikely to be able to explain most of the effects observed with AHR activation or those observed in the AHR knock-out mouse. In an effort to determine the possibility of a

DNA-binding independent manner of AHR function, simian virus 40 (SV40) immortalized AHR null mouse hepatocytes (274) were transfected with either the wild- type (WT) AHR or DNA-binding mutant (A78D) AHR expressing plasmid or the empty vector. The A78D-AHR mutant has previously been shown to bind ligand, translocate to the nucleus and heterodimerize with ARNT, yet it fails to bind DNA at its response element. Green fluorescent protein (GFP) expressing plasmid was cotransfected along with AHR in a ratio of 1:3. Transfected cells were sorted for GFP expression and RNA and protein were isolated from the sorted cells. AHR expression was confirmed by

Western blot (Figure 4.1 A) and the RNA was used for microarray experiments. Data analysis was performed to identify the subset of genes altered in WT-AHR as well as

A78D-AHR transfected cells but not in the control (Table 4.1). Saa3 was found to be repressed by the wild-type and DNA-binding mutant AHR, and was selected for further analysis. Conversely, Cyp1a1 was upregulated only by WT-AHR, and not by A78D-

AHR.

121

Table 4.1: List of genes regulated by A78D-AHR and WT-AHR. Title Gene Gene Ratio Ratio WT vs Control Control Control Symbol A78D vs A78D aryl-hydrocarbon receptor Ahr 2.6 2.6 trimethyllysine hydroxylase, epsilon Tmlhe 2.1 2.7 LIM domain containing preferred translocation partner in lipoma Lpp 1.7 2.2 acidic (leucine-rich) nuclear phosphoprotein 32 family, member A Anp32a 1.7 1.8 denticleless homolog (Drosophila) Dtl 1.6 1.6 DNA segment, Chr 9, ERATO Doi 306, expressed D9Ertd306e 1.5 1.6 PREDICTED: LIM domain only 7 [Mus musculus], mRNA Lmo7 1.5 1.7 sequence germ cell-less homolog (Drosophila) Gcl 1.4 1.6 zinc finger protein 207 Zfp207 1.4 1.6 WD repeat domain 26 Wdr26 1.4 1.6 protein tyrosine phosphatase, receptor type, J Ptprj 1.4 1.7 RIKEN cDNA 3300001H21 gene 3300001H2 0.7 0.6 1Rik zinc finger protein 179 Zfp179 0.7 0.6 Ceruloplasmin Cp 0.7 0.5 procollagen, type VI, alpha 1 Col6a1 0.7 0.6 matrilin 2 Matn2 0.7 0.6 interferon, alpha-inducible protein 27 Ifi27 0.7 0.5 vanin 3 Vnn3 0.7 0.6 Transferring Trf 0.7 0.6 procollagen, type VI, alpha 2 Col6a2 0.7 0.6 procollagen, type VI, alpha 2 Col6a2 0.7 0.6 myxovirus (influenza virus) resistance 1 Mx1 0.7 0.6 complement component factor h Cfh 0.7 0.6 complement component 1, s subcomponent C1s 0.7 0.5 slit homolog 3 (Drosophila) Slit3 0.7 0.6 Kruppel-like factor 10 Klf10 0.7 0.6 lipocalin 2 Lcn2 0.6 0.6 lipopolysaccharide binding protein Lbp 0.6 0.5 serine (or cysteine) peptidase inhibitor, clade A, member 3M Serpina3m 0.6 0.6 proteoglycan 4 (megakaryocyte stimulating factor, articular Prg4 0.6 0.5 superficial zone protein) complement component 3 C3 0.6 0.5 FBJ osteosarcoma oncogene Fos 0.6 0.4 serine (or cysteine) peptidase inhibitor, clade A, member 3N Serpina3n 0.5 0.5 STEAP family member 4 Steap4 0.5 0.4 serine (or cysteine) peptidase inhibitor, clade A, member 3G Serpina3g 0.5 0.6 serum amyloid A 3 Saa3 0.4 0.4

122

A C 100

75 50 * * 25 Saa3 mRNA

0 1 8D H 4A WT 7 Δ 1 A K Control B D 600 500 400 300 200 100 Cyp1A1 mRNA 0 T 1 H W Δ A78D K14A Control

Figure 4.1: Functional dissociation of the properties of AHR involved in Saa3 repression. (A) Western blot analysis of WT-AHR and A78D-AHR protein expression in SV40 immortalized AHR-null mouse hepatocytes transfected with a combination of GFP and WT-AHR/A78D-AHR/control vector in a ratio of 1:3, using Lipo2000 transfection reagent. 106 cells were sorted for GFP expression.

(B) Schematic representation of murine WT-AHR domains and the deletion/mutation (arrowheads) for each AHR mutant.

(C) and (D) Real-time PCR on RNA isolated from SV40 immortalized AHR-null hepatocytes transfected with WT-AHR or various AHR mutants for 24 h. Data represents mean and standard deviation of triplicate measurements obtained from two independent experiments. WT, wild-type; A78D, DNA-binding mutant; ΔH1, heterodimerization mutant; K14A, nuclear localization mutant.

123 Generation and characterization of AHR-heterodimerization mutant

It is necessary to examine whether heterodimerization of AHR and ARNT is essential for the DNA-independent effects of AHR. An AHR-heterodimerization mutant

(ΔH1-AHR) was made by deleting amino acids 43 – 51, which encompasses the helix-1 of the helix-loop-helix domain. Experiments involving characterization of ΔH1-AHR mutant were performed by a colleague and will not be described here.

Saa3 repression requires heterodimerization and nuclear translocation

The conventional AHR pathway requires nuclear translocation and heterodimerization with ARNT. A previously described AHR mutant (K14A-AHR) incapable of translocating to the nucleus (67, 74) and the heterodimerization mutant

(ΔH1-AHR) described above, were expressed in SV40-immortalized AHR knock-out cells along with A78D-AHR and ΔH1-AHR 4.2 . Saa3 expression was found to be repressed by the WT-AHR and A78D-AHR, but not by K14A-AHR and ΔH1-AHR

(Figure 4.1 C). Thus, DNA-binding independent gene regulation by AHR appears to require nuclear translocation and heterodimerization. As expected, Cyp1a1 – a gene known to be upregulated through the conventional activated AHR pathway, was induced in the cells transfected with WT-AHR, but not with A78D-AHR or ΔH1-AHR

(Figure 4.1 D). K14A-AHR minimally induced Cyp1a1; however, this may be due overexpression that may occur in transient transfection experiments leading to a certain degree of diffusion of the receptor into the nucleus. It should be noted that activation of

124 AHR by TCDD did not alter the extent of Saa3 repression in SV40-immortalized AHR null hepatocytes (data not shown).

125

Figure 4.2: AHR functional mutants. Simplified AHR pathway is presented. Critical steps are marked by arrowheads – chaperone binding, ligand-binding, nuclear translocation, AHR-ARNT heterodimerization and DNA-binding at the DRE. Different AHR mutants (A78D, ΔH1 and K14A) result in a progressive loss of functionalities, as depicted by a reducing number of arrowheads.

126 Saa3 repression under different experimental conditions:

AHR-mediated Saa3 repression observed in immortalized AHR null cells was confirmed in other model systems to ensure that the observed effect was not an artifact of the SV40 driven immortalization. Saa3 transcription was induced in Hepa1c1c7 cells, a mouse hepatoma derived cell-line, by treatment with different pro-inflammatory cytokines – interleukin-1β (IL1B), interleukin-6 (IL6), tumor necrosis factor-α (TNFA) or a combination of IL1B and IL6 ( Figure 4.3 A and B). Activated AHR repressed the induction of Saa3 by approximately fifty percent for each cytokine treatment.

127

A

100 * 80 60 40 10 *

Saa3 mRNA Saa3 5

0

D rol L-6 L-6 L-6 L-6 nt CD I I I I o T + + + C D β β D L-1 L-1 TC I I + D D B TC 100

75 *

50

Saa3 mRNA 25 *

0 l o D β β α α tr D -1 -1 F F n C L L N N o T I I T T C

TCDD + TCDD +

Figure 4.3: AHR represses Saa3 induction by various cytokines. Hepa1c1c7 cells were treated with 10 nM TCDD or vehicle control. After 30 min, cells were treated with 2 ng/ml IL1B, IL6, TNFA or a combination of IL1B and IL6 for an additional 6 h. Data represents mean and standard deviation of triplicate measurements.

128 Repression of Saa3 induction by AHR ligands provides an interesting therapeutic avenue. However, it is essential to confirm that Saa3 repression is not limited to higher doses of an AHR ligand. To this end, repression of cytokine-induced Saa3 was studied with decreasing doses of TCDD in Hepa1c1c7 cells. TCDD was able to effectively repress Saa3 even at the lowest dose tested (200 pM) (Figure 4.4 A). Benzo[a]pyrene

(B[a]P), beta-naphthoflavone (β-NF), alpha-naphthoflavone (α-NF) and M50354 are examples of established AHR ligands. M50354 is a recently described AHR agonist compound capable of attenuating atopic allergic responses (275, 276). Hepa1c1c7 cells were treated with different AHR ligands (26) to determine if Saa3 repression was a

TCDD-specific effect. The established AHR ligands, were all able to repress Saa3 induction (Figure 4.4 C).

129

A C 14 50 TCDD + IL 12 40 TCDD 10 30 8 20 6 * * 10 4 Saa3 mRNA * Saa3 mRNA Saa3 3 * (fold change) * 2 2 1 0 0 l ) ) ) ) ) o -0.2 0.2 0.6 1.0 1.4 1.8 8 10 tr M M M M M n μ μ μ μ o (2 (2 (2 TCDD (nM) C F F D (1 n N N a]P (2 D α β [ C B T D M50354 B 30 60 TCDD 50 20 40

30 10 20 Cyp1a1 mRNA Cyp1a1 (fold change) (fold Cyp1a1 mRNA Cyp1a1 10 0 0 l ) ) ) ) ) o -0.2 0.2 0.6 1.0 1.4 1.8 8 10 tr M M M M M n μ μ μ μ o (2 (2 (2 TCDD (nM) C F F D (1 n N N a]P (2 D α β [ C B T M50354

Figure 4.4: Dose-response and ligand-specificity analysis of AHR mediated repression of Saa3. (A and B) Analysis of TCDD dose-response of AHR-mediated Saa3 repression. Hepa1c1c7 cells treated with increasing doses of TCDD (0.2 nM to 10 nM) for 30 min prior to interleukin (IL1B + IL6, 2ng/ml each) treatment. (A) Closed triangles represent repression of IL-induced Saa3 mRNA by various doses of TCDD, as determined by real- time PCR. Closed squares represent uninduced Saa3 mRNA levels, as a control. (B) TCDD-driven Cyp1a1 mRNA induction, as measured by real-time PCR.

(C and D) Various classes of AHR ligands can suppress Saa3. Hep1c1c7 cells were treated with different AHR ligands at the described doses for 30 min prior to interleukin (IL1B + IL6, 2ng/ml each) treatment. Saa3 mRNA (C) and Cyp1a1 mRNA (D) were measured by real-time PCR. Data represents the mean and standard deviation of triplicate measurements.

130 AhR mediated Saa3 repression is a direct transcriptional effect

In order to ascertain that AHR directly effects the transcription of Saa3,

Hepa1c1c7 cells were pretreated with cycloheximide, a translation inhibitor. Though cycloheximide treatment elevated the constitutive level of Saa3 expression, it did not alter its repression by AHR activation (Figure 4.5 A, B and C). This indicates that AHR- mediated Saa3 repression is a direct effect and not secondary to changes in the expression of another protein. Gene repression can be mediated by a decrease in transcription rate or by alteration of mRNA stability. AHR could also possibly upregulate the expression of a microRNA which could regulate Saa3 mRNA levels. After challenging with TCDD and interleukins, Hepa1c1c7 cells were treated with Actinomycin D, a transcription inhibitor, and followed to 4 hours for changes in Saa3 mRNA level. Decay rate of Saa3 mRNA was not altered by activated AHR and Saa3 mRNA appeared to be quite stable

(Figure 4.5 D).

131

A B 1750 900 1500 * * No CHX 800 No CHX 1250 CHX 700 CHX 1000 600 500 750 400 500 300 Saa3 mRNA Saa3 250 Saa3 mRNA 200 * 100 * 0 0 l α α l α α l F F F F β β β β tro tro -1 1 tro -1 1 N N N L n L on TCDDT on TCDDT TCDD I TCDD I C C + T Control Co D + TN D TC TCDD TCDD + IL- TCDD + IL- C D 200 3500 * DMSO 3000 No CHX TCDD 150 CHX 2500 2000 100 1500 50 1000 Saa3 mRNA Saa3 Saa3 mRNA 500 0 * 0 -6 6 0 1 2 3 4 trol L DD CDD IL-6 I IL-6 IL- T + TC + Con D Control D Time (h) CD TCD T

Figure 4.5: AHR-mediated Saa3 repression is due to direct transcriptional inhibition. Real-time PCR on RNA from Hepa1c1c7 cells treated first with (black bars), or without (open bars), the translational inhibitor – cycloheximide (10 µg/ml) for 30 min, then with TCDD (10 nM) for 30 min and finally with one of the cytokines – TNFα (A), IL1β (B) or IL6 (C) for 6 h. Data represent the mean and standard deviation of triplicate measurements.

(D) Real-time PCR to measure the effect of activated AHR on Saa3 mRNA decay rate. Hepa1c1c7 cells were treated with vehicle control or TCDD (10 nM) for 30 min and then with interleukins (2 ng/ ml each of IL1β and IL6) for 3 h to induce Saa3. Then, the cells were treated with the translational inhibitor, Actinomycin D and RNA samples collected at 30 min, 1 h, 2 h and 4 h. Data represent the mean and standard deviation of triplicate measurements.

132 AhR activation represses other Saa-family member genes

All members of the SAA family are upregulated simultaneously in an acute phase response. Hence, we examined the effect of AHR activation on the expression of Saa1 and Saa2 in Hepa1c1c7 cells (Figure 4.6 A and B). Cytokine-mediated induction of both

Saa1 and Saa2 was repressed by AHR activation by 75 and 85 percent respectively. This is significant as Saa1 and Saa2 are the major hepatic serum amyloid isoforms.

Interestingly, Saa1 and Saa2 did not appear to be repressed in the previous microarray results from WT-AHR or A78D-AHR transfected SV40-immortalized mouse hepatocytes, the reason for which is not clear.

133

A B

150 100 * 120 * 75 90 50 60

25 Saa2 mRNA

Saa1 mRNA 30

0 0 l L L o IL I tr + I TCDD TCDD Con Control DD C TCDD + IL D TC 250 * 250 * 200 200

150 150

100 100 Saa1 mRNA 50 Saa2 mRNA 50

0 0

IL IL D IL rol DD trol nt TC on TCD Co C CDD + T TCDD + IL E F 150 150

120 120

90 90

60 60

Saa1 mRNA 30 Saa2 mRNA 30

0 0

ol IL IL IL IL tr trol n on TCDD TCDD C Co CDD + TCDD + T

Figure 4.6: AHR activation represses other Saa-family member gene expression. (A and B) Real-time PCR on RNA from TCDD (10 nM, 30 min) followed by interleukin (2 ng/ ml each of IL1B and IL6) treated Hepa1c1c7 cells. Effect of AHR activation on induction of other SAA family members, Saa1 (A) and Saa2 (B), was determined. Data represents the mean and standard deviation of triplicate measurements. Experiment was repeated thrice with similar results.

(C and D) Real-time PCR on RNA from primary mouse hepatocytes treated with TCDD (10 nM for 30 min) followed by interleukin (2 ng/ ml each of IL1B and IL6) for 24 h. Prior to treatment, cells were transferred to α-MEM with 1 mg/ml bovine serum albumin for 24 h. Repression of Saa1 (C) and Saa2 (D) mRNA was measured.

(E and F) Real-time PCR measurement of Saa1 (E) and Saa2 (F) mRNA, as described above, in AHR-deficient primary mouse hepatocytes obtained from Ahrfx/fxCreAlb mice (liver-specific AHR knock-out).

134

Saa repression is AhR dependent

AHR-deficient or AHR-expressing primary hepatocytes were isolated from

Ahrfx/fxCreAlb (hepatocyte-specific AHR knock-out) (92) or wild-type C57BL6/J mice

respectively. Saa transcription was induced in these cells by interleukins. TCDD was able

to restrict the induction of Saa1 and Saa2 in AHR-expressing (Figure 4.6 C and D), but not in AHR-deficient hepatocytes (Figure 4.6 E and F). This, along with the observation

that AHR transfection in AHR knock-out cells is required for suppressing Saa3

(Figure 4.1 C), clearly establishes that AHR is essential for Saa repression.

Saa repression can occur under physiological conditions

Different cytokines can have counter-regulatory effects on various aspects of an

inflammatory response. It is possible that IL1β and IL6 mediated Saa induction might not

truly simulate the response obtained with a combination of cytokines, as expected in an

inflammatory response. To confirm the ability of AHR to repress Saa induction under

such circumstances, primary bone-marrow cells were isolated from C57BL6 mice and

were cultured to promote differentiation into macrophages. Following a three-day LPS

challenge, the conditioned culture medium was collected off of the macrophages and

used to treat Hepa1c1c7 cells. To differentiate the effect of secreted cytokines from those

of LPS, LPS-containing culture medium was incubated in the absence of macrophages

and used as a control. AHR-activation was able to repress the induction of Saa1, Saa2

and Saa3 in response to the macrophage-conditioned-media (Figure 4.7 A, B and C). This

demonstrates AHR’s ability to repress Saa induction under physiologically attainable

135 concentration/combination of cytokines. In contrast to Saa1 and Saa2, macrophage- conditioned media was unable to induce Saa3 to a significantly higher level as compared to LPS alone.

136

A B 600 * 75 * 500

400 50 300

200 25 Saa1 mRNA Saa1 Saa2 mRNA 100

0 0

D M S rol C nt MCM M LP LPS TCD ontrol TCDD MCM Co + C + MCM D D DD C CDD + LPS T T TC TCDD + LPS C

70 * 60 50 40 30 20 Saa3 mRNA 10 0

D M LPS LPS ontrol TCD MC MCM C + + DD DD TC TC

Figure 4.7: AHR represses Saa induction by physiologically attainable cytokine concentrations. Primary murine bone marrow cells were cultured to promote differentiation into macrophages, as outlined in the text. After a 3 d LPS challenge, the conditioned media was collected from macrophage containing plates (MCM – macrophage conditioned media) and used to treat Hepa1c1c7 cells for 6 h following TCDD (10 nM, 30 min) pre- treatment. ‘LPS’ refers to LPS-spiked media that was maintained under similar culture conditions in the absence of any cells, and thus was devoid of any cytokines secreted by macrophages. Saa1 (A), Saa2 (B) and Saa3 (C) mRNA levels were determined by real- time PCR. Data represent the mean and standard deviation of triplicate measurements.

137 Mechanistic insight into AHR mediated Saa repression

The fact that AHR directly represses Saa3 and that the K14A-AHR (nuclear localization) mutant failed to repress Saa3 induction, indicate that AHR likely effects the formation of transcription complex at the Saa promoters. Chromatin immunoprecipitation

(ChIP) assays in Hepa1c1c7 cells demonstrate that activated AHR reduced the presence of RELA (p65) subunit of NF-κB at the Saa3 and Saa2 promoters in response to interleukin treatment (Figure 4.8 A, B and C). AHR has previously been shown to physically interact with RELA (172) and this might contribute to preventing RELA recruitment to Saa promoters in response to interleukins.

138

Figure 4.8: ChIP assay to determine the effect of AHR activation on Saa1, Saa2 and Saa3 promoters. Hepa1c1c7 cells were treated with TCDD (10 nM for 30 min) prior to interleukins (2 ng/ml each of IL1B and IL6 for 20 min). Immunoprecipitation was performed with antibodies for RELA and acetylated histones (K5). Changes at the Saa3 promoter were assessed by regular PCR (A), while changes at Saa1 and Saa2 promoters were analyzed by real-time PCR (B and C). Data represents one of three independent experiments.

139 Chromatin immunoprecipitation with an acetylated-histone 4 antibody demonstrated that AHR activation also reduced histone acetylation at Saa1, Saa2 and

Saa3 promoters (Figure 4.8 A, B and C). These results lead us to explore the contribution of histone deacetylases (HDAC) in AHR-mediated Saa repression. If AHR activation increases HDAC activity at the Saa promoters to repress transcription, then trichostatin A

(TSA), an HDAC inhibitor, treatment should reverse the repression by blocking HDAC activity (Figure 4.9 A). To this end, Hepa1c1c7 cells were treated with TSA before activating AHR and NF-κB, and Saa1 and Saa3 mRNA levels were monitored by real- time PCR (Figure 4.9 B and C). HDAC inhibition by TSA treatment increased the basal rate of Saa1 transcription by two-fold. Interestingly, HDAC inhibition increased interleukin-mediated Saa1 induction by only five-fold in the absence of AHR activation, but, by ten-fold in the presence of AHR activation. Saa3 transcription demonstrated similar changes. This clearly suggests that AHR-mediated Saa repression involves an increase in HDAC activity. HDAC activity has previously been implicated in regulating

NFKB transcriptional activity (270, 271, 277). However, the results obtained here cannot be precisely attributed to HDAC activity at the Saa promoter because, acetylation / deacetylation have been known to regulate NFKB pathway at multiple levels (278).

140

Figure 4.9: Effect of HDAC inhibition on Saa expression. (A) Schematic representation of the possible consequence of HDAC inhibition by trichostatin A (TSA). Hepa1c1c7 cells were treated with TSA (30 min) prior to TCDD (10 nM for 30 min) and interleukin treatment (2 ng/ml each of IL1B and IL6 for 6 h). Consequence of TSA treatment on changes in Saa1 (B) and Saa3 (C) mRNA were determined by real-time PCR. Data is represented as fold-change caused by TSA as compared to the expression in the absence of TSA, under each treatment condition. Three measurements were averaged before obtaining fold-values.

141 Suppressors of cytokine signaling (SOCS) proteins exert an anti-inflammatory effect through inhibition of the JAK-STAT pathway (recently reviewed in (279)) and might be an additional mechanism for AHR-mediated Saa repression. In fact, SOCS2 has been shown to be an AHR target-gene (118). The mRNA levels of SOCS1, SOCS2 and

SOCS3 in response to interleukin treatment in the presence or absence of AHR activation was tested. In Hepa1c1c7 cells both TCDD and interleukins were able to induce SOCS2 and SOCS3 (Figure 4.10 A and C). Treatment with a combination of TCDD and interleukins had an additive effect on the induction of these genes. However, in primary mouse hepatocytes, only SOCS3 was inducible (four-fold) with interleukin treatment.

TCDD alone had no effect on SOCS3 expression in primary mouse hepatocytes, but, in combination with interleukins, an eight-fold induction of SOCS3 was observed

(Figure 4.10 D). SOCS1 was not altered in either model.

142

AB 900 * 120 90 600

60 300 30 Socs2 mRNA Socs2 SOCS2 mRNA

0 0

D IL D IL MSO + IL + IL D TCD D TCD D D Control D C T TC

CD

1200 * 80 * 900 * 60 600 40

20 300 mRNA Socs3 SOCS3 mRNA

0 0 l D IL D IL tro D MSO n TCD o TC D C TCDD + IL TCDD + IL

Figure 4.10: AHR activation induces SOCS genes. Hepa1c1c7 cells (A and C) were treated with TCDD (10 nM for 30 min) prior to interleukins (2 ng/ml of IL1B and IL6 for 6 h). Primary mouse hepatocytes (B and D) were similarly treated, but for 24 h with interleukins. Socs2 (A and B) and Socs3 (C and D) mRNA levels were measured by real-time PCR. Data represents mean and standard deviation of triplicate measurements.

143 AHR-mediated suppression extends to other APR genes as well

After confirming the repression of Saa1 and Saa2 in primary mouse hepatocytes, expression of other acute phase response genes was also examined by real-time PCR

(Figure 4.11 A-I). AHR activation was able to repress induction of many of the acute phase genes including C-reactive protein (CRP), LPS-binding protein (LBP), haptoglobin, alpha-2-macroglobulin and alpha-1-acid glycoprotein-1. This suggests that

AHR represses the acute-phase probably through a central transcriptional regulatory mechanism common to most acute-phase genes.

144

ABC 150 300 * 120 90 100 200 60

50 100 30 Saa1 mRNA Saa3 mRNA Saa2 mRNA

0 0 0

IL IL ol D IL IL IL trol DD trol DD + n on TC D + TCD TC C Contr DD Co TCD TC TCDD + IL DEF 300 300 * * 20 * 225 225 15

150 150 10

Lbp mRNA 75 Crp mRNA 75 5 A2m mRNA A2m

0 0 0 l IL D IL IL D IL trol DD + ro CD + IL TC TCD T D Con Control DD Cont C CD TCDD + IL T T GHI 150 175 175 150 150 * 125 100 125 100 100 75 75 50 50

Hp mRNA 50 Apcs mRNA Orm-1 mRNA Orm-1 25 25 0 0 0 L L L l IL D I I o IL IL DD D + DD C C C T D + I T D T Control D Control Contr TC TCD TCDD +

Figure 4.11: AHR activation represses other APR genes as well. Real-time PCR on RNA from primary mouse hepatocytes treated with TCDD (10 nM, 30 min) followed by interleukin (2 ng/ ml each of IL1B and IL6) for 24 h. Repression of different APR genes was assayed. CRP, C-reactive protein; LBP, LPS-binding protein; Orm-1, acid-1 glycoprotein; A2m, alpha-2-macroglobulin; Hp, haptoglobin; Apcs, serum amyloid (P component).

145 Saa repression in human hepatocyte-derived cells

Another important question to address is whether human cells would elicit a similar response. The human AHR was capable of repressing SAA induction similar to the mouse AHR. SAA3 is not expressed in human liver (280), and SAA1 and SAA2 have a very high sequence similarity which did not allow designing a unique primer-set for detecting SAA2. Hence, SAA1 mRNA levels were monitored to assess the effect of AHR activation on acute phase response. Huh7 cells, a human hepatocarcinoma derived cell- line, were treated with vehicle or TCDD to activate the AHR and then with human IL1B and IL6. Activation of AHR repressed SAA1 mRNA induction by seventy-five percent

(Figure 4.12 A). Changes in the level of secreted SAA protein were determined by

ELISA and were found to mimic changes in mRNA (Figure 4.12 B). Since it is not possible to differentiate between different SAA family members by ELISA, this repression of SAA reflects the changes in the levels of all secreted SAA family members.

146

A

125 *

100

75

50

SAA1 mRNA 25

0

IL + IL TCDD D Control TCD B

60 50 * 40 30

(ng/ml) 20

10

SAA concentration 0 ) ) ) ) h h h h Ctrl 0 4 CDD T IL (1 IL (2 D+IL (10 D+IL (24 D D TC TC

Figure 4.12: AHR-mediated repression in human cells. (A) Real-time on RNA from Huh7 cells treated with TCDD (10 nM, 30 min) followed by recombinant human interleukins (2 ng/ml each of IL1B and IL6) for 6 h. Human SAA1 mRNA abundance was assayed.

(B) ELISA to quantify SAA protein secreted by Huh7 cells, treated for 10 h or 24 h with TCDD and interleukins. Just prior to treatment, cells were transferred to serum-free media.

147 Although TCDD exerts its effects almost exclusively through the AHR, we wanted to confirm that the observed TCDD-mediated Saa1 repression in human cells is indeed AHR dependent. AHR was knocked-down in Huh7 cells using AHR siRNA oligos. As expected, loss of AHR resulted in a loss of SAA1 repression with TCDD treatment (Figure 4.13 A and C). AHR knock-down was verified by the loss of its transcriptional activity, as demonstrated by a loss of CYP1A1 mRNA induction

(Figure 4.13 B). Interestingly, the loss of AHR resulted in an enhanced induction of SAA1 with interleukin treatment (Figure 4.13 A). In order to confirm that this was not an off- target effect of the AHR siRNA oligo sequence, a second anti-AHR siRNA oligo was transfected into Huh7 cells by electroporation. AHR knock-down by this second AHR siRNA also resulted in enhanced SAA1 induction by interleukins. This suggests that AHR might function to constitutively suppress the level of SAA1 transcription, and possibly suppress the expression of acute phase response in general. However, AHR-mediated repression of inflammatory genes is not a universal phenomenon. Two known NF-κB regulated genes, interleukin-8 (IL-8) and NF-kappa-B inhibitor alpha (NFKBIA, commonly known as IκBα) were found to be induced by interleukins, but remained unaffected by co-treatment with TCDD ( Figure 4.14 A and B).

148

A 800 C 700

600 150 500 *

mRNA 400 100

300 mRNA SAA1 200 50

100 * SAA1 0 0

IL IL IL T+IL IL T+IL

TCDD TCDD scrambled anti-AhR Control Control TCDD + IL TCDD + IL Scramble anti-AhR B 30000

25000

20000

mRNA 15000

10000 CYP1A1 5000

0 IL IL TCDD TCDD Control Control TCDD + IL TCDD + IL Scramble anti-AhR

Figure 4.13: Saa repression in human cells is AHR-dependent. (A and B) siRNA-driven AHR knock-down in Huh7 cells. 36 h after siRNA transfection, cells were treated with TCDD and interleukins, as in (Figure 4.12 A). SAA1 mRNA (A) and CYP1A1 (B) mRNA levels were determined by real-time PCR.

(C) An alternate representation of data from (A). SAA1 induction, upon interleukin exposure of scrambled and anti-AHR siRNA transfected cells, was scaled to 100 units.

149

A B 250 120

200 90 150 60 100 NFKBIA

IL-8 mRNA 30 50

0 0

ol IL IL IL IL r rol DD + nt C + TCDD T D Cont Co D TCDD TC

Figure 4.14: AHR-mediated NF-κB suppression is gene-specific. Huh7 cells were treated with TCDD (10 nM for 30 min) followed by interleukins (2 ng/ml of IL1B and IL6 each for 6 h). mRNA changes were measured for IL8 and NFKBIA (IκBα) by real-time PCR. Data represents mean and standard deviation of triplicate measurements.

150

4.5 Discussion:

The immune system is perhaps the most dynamic ‘organ’ system in our body. It plays a key role in our survival, empowering us to fight off infections and other foreign particles. Though the significance of immunity and inflammation in our lives is indisputable, the regulation of such a versatile and potent system is of equal importance.

Dysregulated inflammatory/immune response underlies many diseases such as asthma, lupus and rheumatoid arthritis. Acute phase response dominates the initial reaction to perceived insults and commences a series of biochemical and neuroendocrine changes that facilitate mounting an inflammatory/immune response. Acute phase proteins serve various tasks in this process, for example, CRP binds to phosphocholine on microbial surfaces to promote recognition, fibrinogen and haptoglobin promote wound healing and complement factors promote coagulation that may help ward off infection (reviewed in

(260)). However, persistent activation of APR has its own perils (281). Elevated CRP is associated with increased cardiovascular risk and has been proposed to be a better prognosticator of atherosclerosis and related events than lipid levels (282, 283). SAA is an apolipoprotein for high-density lipoproteins (HDL) and influences cholesterol metabolism in favor of inflammation. Conversely, constant elevation of SAA, and even alpha-2-macroglobulin, leads to extracellular amyloid plaques that interfere with organ function and underlie the pathology of diseases such as Alzheimer’s and prion diseases

(284). Thus, therapeutic approaches to regulate APP production are being actively

151 researched. Our results demonstrate that AHR activation has the potential to repress APP expression.

At the transcriptional level, the induction of SAA, and most other APPs, is regulated by NF-κB, CCAAT-enhancer-binding protein β (C/EBP-β or NFIL6) and signal transducer and activator of transcription-3 (STAT3) (285-287). The potential of these pro-inflammatory transcription factors has been shown to be repressed by many activated

NRs. The inhibitory effects of glucocorticoid receptor (GR), estrogen receptor (ER) and peroxisome proliferators-activated receptor family (PPAR) on NF-κB induced gene transcription has received wide attention (11, 164). NF-κB signaling allows multiple levels of regulation which have been utilized by NRs to interact with this pathway.

Cytokines engage distinct receptors on cell surface to commence inflammatory signaling.

The intracellular portions of these cytokine-receptors then recruit and activate a family of adaptor proteins through various post-translational modifications. Eventually, signaling from different cytokine receptors converges on phosphorylation-dependent activation of the IKK complex (IκB-kinase complex), which in turn releases NF-κB. Activated AHR can possibly inhibit any of these cell-surface receptors or the immediate downstream cytoplasmic signaling to repress NF-κB activity. However, in the context of APR gene regulation, AHR effectively repressed Saa3 mRNA when induced separately by IL1β,

IL6 and TNFα. Also, the K14A-AHR, nuclear localization mutant, was unable to repress

Saa3 mRNA induction. This demonstrates that AHR-mediated acute-phase gene suppression is not due to an effect on upstream cytokine signaling, but is primarily a nuclear phenomenon.

152

Following the degradation of IκB, NF-κB translocates to the nucleus and binds κB cognate response elements found in the promoter/enhancer region of its target genes.

Activation of AHR diminished cytokine-induced association of RELA subunit of NF-κB with its response elements in Saa2 and Saa3 promoters, as shown by ChIP assay. Other groups have previously demonstrated the ability of AHR to physically interact with the

RELA subunit of NF-κB by immunoprecipitation-Western blot (IP-WB) experiments

(172). While a direct physical interaction between the two proteins can certainly explain the reduction in RELA recruitment to Saa promoters, it cannot be the sole mechanism for

AHR-NF-κB cross-talk. The rationale for this argument is derived from the fact that AHR activation is unable to universally repress NF-κB driven gene expression (Figure 4.14).

Also, we did not observe a significant reduction in RELA or p50 protein levels upon

AHR activation (data not shown). Based on recent studies, it is evident that degradation of IκBα is not sufficient to induce transcriptional activity of NF-κB. Phosphorylation and acetylation of NF-κB at multiple sites is essential for optimizing DNA-binding and transactivation of target genes (267, 271, 288). A ChIP assay with an anti-acetylated histone 4 (anti-AcH4) antibody revealed that cytokine-responsive histone acetylation at

Saa promoters is reduced upon activation of AHR. This observation encouraged us to determine the effect that HDAC inhibition would have on Saa regulation. Though

Trichostatin A (TSA) pre-treatment enhanced basal as well as induced levels of Saa mRNA, the derepression effect was significantly higher (10-fold increase in TCDD + IL samples as opposed to, 5-fold increase in IL samples) in AHR activated samples. This strongly suggests that AHR-mediated NF-κB repression also involves an alteration of the

153 ‘histone code’. It is also possible that like GR (289), AHR recruits HDAC to the activated

NF-κB complex, resulting in decreased acetylation of critical lysine residues (218, 221 and 310) on RELA. Extensive protein interaction studies and ChIP assay would be needed to explore this hypothesis. Though universal mechanisms like direct physical interaction between AHR and NF-κB may play a role, commonly used experimental techniques like electrophorectic mobility shift assays and reporter-based experiments should be interpreted cautiously as these do not simulate promoter-specific chromatin dynamics.

NF-κB binding to its response elements establishes an activated transcriptional complex and drives target gene expression, including that of IκBα (290). Increased IκBα can terminate transcription by retrieving active NF-κB complexes from the nucleus back to the cytoplasm (291), as has been shown for some nuclear receptor (NR)-NF-κB interactions (292). Another possible feedback mechanism is a receptor-dependent reduction in the cytokines, such as AHR-mediated reduction in TNFA and IL6 (177,

180). However, these mechanisms are unlikely to contribute to APR repression because inhibiting protein translation by cycloheximide pre-treatment did not affect AHR’s ability to suppress NF-κB. Even in the absence of protein synthesis, a decrease in mRNA levels can be due to altered mRNA stability. When Hepa1c1c7 cells were treated with

Actinomycin D, a transcriptional inhibitor, no difference in Saa3 mRNA decay rate was observed between TCDD treated and control samples. These experiments clearly demonstrate that AHR represses APR gene induction by a direct effect on transcription.

154 AHR can be activated by a variety of ligands that are ubiquitously present in the environment. TCDD is perhaps the most potent inducer of AHR transcriptional activity and is believed to exert its toxicity through activating AHR. The lack of Saa repression upon TCDD treatment in AHR-deficient primary hepatocytes isolated from Ahrfx/fxCreAlb mice proves that AHR is essential even for TCDD-mediated repression. All AHR ligands tested were able to repress Saa mRNA, indicating that this is not a ligand-specific effect.

From the inflammatory viewpoint, an important aspect that is often overlooked is the complexity of the cytokine ‘network’. Signal amplification and feedback loops are integral to cytokine signaling and thus, the effects observed with a single cytokine at a defined dose might be counter-regulated by another cytokine. To this end, a physiologically feasible mix of inflammatory mediators was obtained by challenging bone-marrow derived primary mouse macrophages. AHR-activation was able to repress

Saa induction by this mix of inflammatory mediators, suggesting that AHR-mediated

APR regulation could occur under inflammatory situations. A larger repertoire of tools and models are available to study murine AHR biology as compared to human AHR.

However, the murine and human AHR have considerable differences, including nucleo- cytoplasmic shuttling and transactivation domain sequence (73, 74), and hence extrapolating observations from murine-models to humans requires caution. We verified the ability of AHR to repress SAA induction in human liver derived cell-line. AHR activation repressed SAA1 induction by more than seventy percent. This repression was also observed in levels of secreted SAA protein. AHR knock-down by siRNA confirmed

AHR-dependency of TCDD-mediated SAA1 repression in human cells.

155 Ligand-activated receptors have multiple domains that impart different functionalities, such as DNA-binding, ligand-binding, dimerization, nuclear trafficking signals and co-regulator recruitment. However, depending on the manner of activation and the physiological context, the functionalities of soluble receptors can be dissociated from their biological roles, as in the case of GR (205) and ER (207). Here, we demonstrate for the first time that DNA-binding is not essential for AHR-mediated repressive effects on NF-κB transactivation, while heterodimerization with ARNT and nuclear translocation are required. This report is also the first attempt at thoroughly characterizing a heterodimerization mutant of AHR. Based on Figure 4.1 B and C, it is clear that heterodimerization with ARNT is essential for AHR-mediated repression of acute-phase genes. Besides xenobiotic metabolism enzymes, this is also the first report identifying a functional role for AHR in an entire biological process, and not just individual gene regulation.

In conclusion, the data presented in this report demonstrate the interaction of

AHR and NF-κB signaling pathways to regulate multiple APR gene expression, an important aspect of the inflammatory reaction. This identifies a novel physiological function performed by the AHR in murine as well as human systems. AHR-mediated transcriptional repression is not conducted in the classical DRE-dependent fashion, but most likely involves multiple mechanisms. Altered post-translational modifications of

NF-κB proteins and histone code upon AHR activation seem to play an important part.

Finally, in order to therapeutically utilize the ability of AHR to function as a repressor of acute phase response, and possibly other inflammatory phenomena, it is necessary to

156 identify/design ‘selective ligands’. Selective AHR modulators (SARM), like the selective

ER modulators (SERM – e.g. Tamoxifen), would induce the beneficial effects of AHR without eliciting its potentially harmful effects. This concept has been described further as future directions in the next chapter.

157

Chapter 5

CONCLUSIONS AND FUTURE DIRECTIONS

158

AHR is a unique receptor – it is the only ligand inducible bHLH-PAS domain transcription factor, differs from steroid receptors in terms of modular domain architecture and can respond to structurally diverse chemicals that are so ubiquitous that it is impossible to escape them. In fact, excessive exposure to some of these ligands has been implicated in adverse health effects, including carcinogenesis. Though a considerable research effort has been invested in understanding AHR biology, and an appreciable amount of information has indeed been accumulated, two key issues that have not been satisfactorily answered are the identification of an endogenous ligand and a clear understanding of the physiological role of AHR. Both of these pieces of information can be instrumental in unveiling the therapeutic potential of manipulating AHR activity to attain desired biological effects. AHR knock-out mice are not embryonic lethal, however they exhibit remarkable phenotypic features including reproductive inferiority, delayed growth and heightened susceptibility to certain infections.

At the time of commencement of my research, non-xenobiotic gene regulation comprised a minimal amount of knowledge on AHR biology. With the simultaneously growth of high-capacity genome and proteome analysis technology, there have been multiple reports identifying new AHR target genes in divergent scenarios. This has certainly expanded the range of implications of AHR activation, but, ‘we are not there yet.’ My research involved identifying the cellular processes influenced by AHR activation that are unrelated to xenobiotic metabolism. The approach involved applying

159 DNA microarray technology to identify previously unknown AHR regulated genes. Since the classical DRE-driven gene regulation is unlikely to explain all the pathophysiological phenomena associated with AHR, an attempt was also made to identify alternate means of AHR function. As a result, two novel target genes and a DRE-independent mode of

AHR activity have been characterized.

Epiregulin is an epidermal growth factor family member and functions to promote cell proliferation. As a group, growth factors and receptors belonging to the epidermal growth factor family have been implicated in numerous cancers. In fact, inhibitors of epidermal growth factor receptor are in clinical use as anti-tumor agents (for example

(293, 294)). Epiregulin has also been associated with numerous tumors (295, 296) and immune disorders such as dermatitis (220, 297). Interestingly, carcinogenesis is also one of the adverse effects of AHR ligands (240, 298) and AHR-mediated epiregulin upregulation might contribute to tumor development. This hypothesis should be tested by tumor studies involving treatment of epiregulin knock-out mice (299) with AHR ligands.

After the discovery of epiregulin as a direct AHR target gene, another epidermal growth factor family member – amphiregulin – has also been described to be regulated by AHR

(300). Thus, one mechanism of AHR-mediated alteration of cell growth and proliferation could be related to its effect on growth factor expression.

Chapter 3 describes the impact of AHR activation on the expression and the activity of constitutive androstane receptor (CAR). AHR-mediated CAR induction differs significantly as compared to the regulation of epiregulin. First, CAR upregulation was

160 detected in vivo in the liver of C57BL/6 mice. Second, β-naphthoflavone (BNF) was utilized to activate AHR, as opposed to TCDD. Though there is no definite evidence to establish a ligand-specific AHR transactivation profile, it should be noted that there are important differences in biochemical properties of these two ligands. Third, genomic sequence analysis did not reveal a DRE within a reasonable putative CAR promoter.

Though, enhancer regions for gene regulation have been described several kilobases upstream of transcription start sites, and such a DRE-containing regulatory region might exist for CAR, it is not very common. It would have been exciting to elaborate the mechanism by which AHR regulates CAR expression in the absence of a consensus

DRE. However, the lack of induction of CAR expression in cell-culture system discouraged attempts to delineate mechanistic details. Whether upregulation of CAR is a

DRE-independent mechanism of gene upregulation can be tested by using transgenic mice expressing the DNA-binding mutant (A78D) form of AHR instead of the wildtype

AHR.

Though the particulars of inducible CAR expression might remain pending until a suitable cell-culture system is established, the observation that AHR activation can upregulate CAR activity might be of clinical relevance. CAR is an important transcription factor associated with metabolism of many pharmaceutical compounds via its ability to upregulate cytochrome P450 enzymes. Thus, AHR-mediated CAR upregulation could have clinically relevant effect on drug metabolism. The likelihood of this possibility is further enhanced when we consider that it is possible to achieve an increase in the AHR-mediated transcription in the lungs of smokers. ‘Personalized

161 medicine’ is an attractive concept and can be implemented at various levels in healthcare.

Though we may not be close enough to anticipate fabricating individualized drug molecules, efforts have certainly been initiated to individualize the dosing of medications. Genetic variability in the population renders some of us as ‘fast’, ‘normal’ or ‘slow’ metabolizers of certain drugs. Administration the same dose of a drug to various patients can result either in an overdose and undesired adverse effects in ‘slow’ metabolizers, or inadequate treatment in ‘fast’ metabolizers. Affymetrix, a pioneer in

DNA-microarray technology, and Roche pharmaceuticals have launched a microarray- based diagnostic platform to detect variations in CYP2D6 and CYP2C19, two clinically relevant drug metabolizing enzymes. Healthcare facilities in Europe are utilizing this technology to predict patient phenotype and regulate drug dosage between individuals. In addition to genetic variation, environmental determinants, such as smoking or dietary habits, can also potentially determine individual drug requirements. Thus, AHR-mediated

CAR induction can have prospective therapeutic implications that need to be investigated further.

The term ‘AHR activation’ typically conveys the classic DRE-dependent transactivation pathway. Research on AHR has almost exclusively focused on its transactivation potential, baring a few reports on AHR-mediated ER inhibition. After describing activation of two previously uncharacterized target genes in Chapter 2 and 3, efforts were focused on addressing the hypothesis that AHR mediates DRE-independent regulation of transcriptional responses. The ability of AHR to repress the acute phase response without binding a DRE, clearly establishes a non-classical mechanism of AHR

162 activity. This is also the first evidence (outside of the classical xenobiotic metabolism regulation) where the receptor has been shown to regulate an entire biological process, as opposed to controlling the expression of individual genes. The use of different AHR mutants and primary as well as established cell-culture systems permitted a thorough characterization of AHR-mediated suppression of cytokine signaling, while raising new questions which will require additional research. The following avenues would be a fair extension of the research presented in Chapter 4.

The mechanism for AHR-mediated NF-κB repression needs to be elucidated further. ‘Cofactor exchange’ is a concept that has gained considerable popularity.

Normally, transcription factors associate with coactivators to induce transcription of positively regulated genes, and with corepressors to suppress the transcription of negatively regulated genes. According to the ‘cofactor exchange’ model, activation of one transcription factor can influence the activity of another by exchanging coactivators with corepressors, and vice versa. Specific examples of this model are provided by glucocorticoid receptor (GR) and peroxisome-proliferator-activated receptor-γ (PPAR-γ) mediated repression of inflammatory response genes (reviewed in (11)). Some inflammatory gene promoters bear an inhibitory nuclear-receptor co-repressor (NCoR)- based complex that is lost in response to cytokine signaling. Upon ligand activation

PPAR-γ can be sumoylated, which in turn leads to its association with NCoR. This stabilizes the inhibitory complex and prevents the switch to a coactivator complex at the promoters of a subset of NF-κB regulated genes, resulting in continued repression of transcription (301). Genes that normally do not have NCoR-based repressive complexes

163 are not affected by PPAR-γ activation. Certain genes require NF-κB/IRF3 (interferon- regulatory factor 3) association to form activator complexes that would drive transcription in response to inflammatory signaling. Activated GR can disrupt

RELA/IRF3 association and avert formation of an activator complex thereby repressing the transcription of these genes. AHR-mediated inflammatory repression can possibly involve similar mechanics. Extensive chromatin immunoprecipitation studies will by necessary to study the dynamics of transcriptional complexes on the promoters of AHR- sensitive inflammatory genes. Another factor that dictates the composition of transactivation complexes is the cis element (the DNA sequence of the promoter/enhancer, including the ‘flexible’ bases within the core response elements)

(302). This allosteric effect of DNA has been documented for GR (303) and NF-κB

(304). To this end, microarray studies can be performed to identify AHR-sensitive and

AHR-resistant inflammatory genes. A bioinformatics approach to promoter analysis might provide valuable information that would help explain the selectivity of AHR- mediated repression. Furthermore, the results from Chapter 4 have established a role of histone deacetylases (HDAC) in mediating AHR-dependent repression of acute phase genes. Whether HDAC activity affects only chromatin remodeling or does it also alter acetylation of NF-κB, remains to be answered.

A number of disease states result from dysregulated immune responses. For AHR- mediated inflammatory repression to be advantageous, it is essential to determine the effect of AHR activation in in vivo models. A number of mouse models with phenotypic resemblance to human immune-related diseases have been described. For example,

164 DNase II-null/interferon type I receptor (IFNIR)-null mice and mice with an induced deletion of the DNase II gene develop arthritis of multiple joints resembling human rheumatoid arthritis (305). This correlates with the upregulation of a subset of cytokines, especially TNF-α, in the affected joints and high serum levels of rheumatoid factor.

Systemic lupus erythematosus (SLE) is another autoimmune disorder characterized by a chronic, remitting, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue. Dnase1-deficient mice show the classic symptoms of SLE, namely the presence of anti-nuclear antibodies, immune complex deposition in glomeruli, and consequent glomerulonephritis (306). This correlates with reduced Dnase1 activity in the serum from SLE patients compared to normal subjects (307). Patients with rheumatoid arthritis and other chronic inflammatory diseases develop amyloidosis, and it also can be induced in mice by increasing SAA concentrations through injection of silver nitrate or casein. 2 or 3 weeks after the inflammatory stimulus, systemic AA deposits develop in mice, identical to those with amyloidosis. Administration of protein extracted from AA amyloid-laden mouse spleen or liver further shortens this lag phase (308). It would be interesting to note whether AHR activation by chronic administration of AHR ligands would have any protective effects in these kinds of disease models.

Every coin has two faces. It would be nice to have only the winning face.

Activation of AHR also has two faces – activation of xenobiotic metabolism enzymes which bears the potential to generate harmful metabolites, and repression of inflammatory response which can be exploited therapeutically. However, in order to take advantage of the positive effects of AHR activation without suffering the consequences

165 of xenobiotic metabolism enzyme upregulation, it is necessary to identify selective ligands. In nuclear receptors, agonist (defined with reference to a positive transcriptional effect) binding induces a conformational change, particularly in the form of a physical shift of the AF2 domain. This event spawns the formation of surfaces with affinity for the

LXXLL motifs of transcriptional coactivators. Moreover, creation of these surfaces hinders the association of corepressors due to the structurally incompatible nature of their interaction motifs. Thus, it is possible to choose a ligand that induces a conformational change favoring association of corepressors rather than coactivators. Such a preferential modulator of transcription factor activity can be of a therapeutic value. Tamoxifen and raloxifene are examples of function-specific ER ligands that allow repressive effects of

ER without inducing its transactivation potential (309). Similarly, transcriptional effects of ER and androgen receptor (AR) can be dissociated from their anti-apoptotic effects with the use of selective synthetic ligands (310). Identification of acute phase genes as a candidate for AHR-mediated repression has now made it possible to screen for selective

AHR ligands. Based on the experiments optimized for Chapter 4, a high throughput screen can be established for analyzing libraries of compounds in search for the selective ligand. A schematic representation of the screen is presented in Figure 5.1.

166

Figure 5.1: Schematic for a screen to identify ‘Selective AHR Modulators – SARM’. Huh7 cells can be treated with interleukins (IL) and a library of compounds (X). SAA expression in conditioned media can be assessed by ELISA. Compounds capable of repressing SAA (top graph) would then be used to treat AHR-deficient Huh7 cells along with IL. Compounds that cannot repress SAA in the absence of AHR (bottom graph) are most likely to be AHR activators. This subset of compounds should then be used to assess their ability to induce classical AHR target genes (e.g. CYP1A1) by real-time PCR (qPCR). Compounds that cannot induce CYP1A1 would be potential SARMs. C=control.

167 Regulation of inflammatory responses by AHR is a significant contribution to the field of AHR-biology. It has widened the scope of AHR research and will spur many follow-up studies. However, it is prudent to continue the quest for involvement of AHR in other biological processes. Microarray studies can be initiated to analyze the interaction of AHR with other signaling pathways; for example, a comparison of gene regulation in response to dexamethasone treatment in the presence or absence of AHR ligands may generate a list of GR-regulated genes which are sensitive to AHR activation.

An in vivo mouse model would be a more physiologically relevant system to assay cross- talk properties of AHR. A liver-specific transgenic model expressing A78D-AHR in

AHR knock-out mice has been generated in our lab. However, inferior fertility of AHR knock-out mice has made it difficult to obtain enough age- and sex-matched animals to perform meaningful studies. As a result, we are now attempting to generate A78D-AHR expressing mice on a liver-specific AHR knock-out (Ahrfx/fxCreAlb) model, which breed

normally. This mouse model will also be valuable in re-assessing the hepatotoxic effects

of TCDD and determining the relative contributions of genotropic versus non-genotropic

effects of AHR activation. Primary hepatocytes from these mice can also be utilized to

search for other genes regulated by AHR in a DRE-independent fashion.

Bibliography

1. Nebert DW, Gelboin HV. Substrate-inducible microsomal aryl hydroxylase in mammalian cell culture. I. Assay and properties of induced enzyme. J Biol Chem 1968;243:6242-6249. 2. Nebert DW, Gelboin HV. Substrate-inducible microsomal aryl hydroxylase in mammalian cell culture. II. Cellular responses during enzyme induction. J Biol Chem 1968;243:6250-6261. 3. Poland AP, Glover E, Robinson JR, Nebert DW. Genetic expression of aryl hydrocarbon hydroxylase activity. Induction of monooxygenase activities and cytochrome P1-450 formation by 2,3,7,8-tetrachlorodibenzo-p-dioxin in mice genetically "nonresponsive" to other aromatic hydrocarbons. J Biol Chem 1974;249:5599-5606. 4. Nebert DW, Gielen JE. Genetic regulation of aryl hydrocarbon hydroxylase induction in the mouse. Fed Proc 1972;31:1315-1325. 5. Nebert DW, Goujon FM, Gielen JE. Aryl hydrocarbon hydroxylase induction by polycyclic hydrocarbons: simple autosomal dominant trait in the mouse. Nat New Biol 1972;236:107-110. 6. Poland A, Glover E, Kende AS. Stereospecific, high affinity binding of 2,3,7,8- tetrachlorodibenzo-p-dioxin by hepatic cytosol. Evidence that the binding species is receptor for induction of aryl hydrocarbon hydroxylase. J Biol Chem 1976;251:4936- 4946. 7. Poland A, Glover E, Ebetino H, Kende A. Photoaffinity labelling of the Ah receptor. Food Chem Toxicol 1986;24:781-787. 8. Perdew GH, Poland A. Purification of the Ah receptor from C57BL/6J mouse liver. J Biol Chem 1988;263:9848-9852. 9. Bradfield CA, Glover E, Poland A. Purification and N-terminal amino acid sequence of the Ah receptor from the C57BL/6J mouse. Mol Pharmacol 1991;39:13-19. 10. Poland A, Glover E, Bradfield CA. Characterization of polyclonal antibodies to the Ah receptor prepared by immunization with a synthetic peptide hapten. Mol Pharmacol 1991;39:20-26. 11. Glass CK, Ogawa S. Combinatorial roles of nuclear receptors in inflammation and immunity. Nat Rev Immunol 2006;6:44-55. 12. Massari ME, Murre C. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol 2000;20:429-440. 13. Gu YZ, Hogenesch JB, Bradfield CA. The PAS superfamily: sensors of environmental and developmental signals. Annu Rev Pharmacol Toxicol 2000;40:519- 561. 14. Reisz-Porszasz S, Probst MR, Fukunaga BN, Hankinson O. Identification of functional domains of the aryl hydrocarbon receptor nuclear translocator protein (ARNT). Mol Cell Biol 1994;14:6075-6086.

169 15. Fukunaga BN, Probst MR, Reisz-Porszasz S, Hankinson O. Identification of functional domains of the aryl hydrocarbon receptor. J Biol Chem 1995;270:29270- 29278. 16. Jain S, Dolwick KM, Schmidt JV, Bradfield CA. Potent transactivation domains of the Ah receptor and the Ah receptor nuclear translocator map to their carboxyl termini. J Biol Chem 1994;269:31518-31524. 17. Pohjanvirta R, Wong JM, Li W, Harper PA, Tuomisto J, Okey AB. Point mutation in intron sequence causes altered carboxyl-terminal structure in the aryl hydrocarbon receptor of the most 2,3,7,8-tetrachlorodibenzo-p-dioxin-resistant rat strain. Mol Pharmacol 1998;54:86-93. 18. Harper PA, Wong JY, Lam MS, Okey AB. Polymorphisms in the human AH receptor. Chem Biol Interact 2002;141:161-187. 19. Wong JM, Okey AB, Harper PA. Human aryl hydrocarbon receptor polymorphisms that result in loss of CYP1A1 induction. Biochem Biophys Res Commun 2001;288:990-996. 20. Poland A, Glover E. Chlorinated biphenyl induction of aryl hydrocarbon hydroxylase activity: a study of the structure-activity relationship. Mol Pharmacol 1977;13:924-938. 21. McKinney JD, Singh P. Structure-activity relationships in halogenated biphenyls: unifying hypothesis for structural specificity. Chem Biol Interact 1981;33:271-283. 22. Waller CL, McKinney JD. Three-dimensional quantitative structure-activity relationships of dioxins and dioxin-like compounds: model validation and Ah receptor characterization. Chem Res Toxicol 1995;8:847-858. 23. Tiernan TO, Taylor ML, Garrett JH, VanNess GF, Solch JG, Wagel DJ, Ferguson GL, et al. Sources and fate of polychlorinated dibenzodioxins, dibenzofurans and related compounds in human environments. Environ Health Perspect 1985;59:145-158. 24. Lawther PJ, Waller RE. Coal fires, industrial emissions and motor vehicles as sources of environmental carcinogens. IARC Sci Publ 1976:27-40. 25. Nguyen LP, Bradfield CA. The search for endogenous activators of the aryl hydrocarbon receptor. Chem Res Toxicol 2008;21:102-116. 26. Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol 2003;43:309-334. 27. Bjeldanes LF, Kim JY, Grose KR, Bartholomew JC, Bradfield CA. Aromatic hydrocarbon responsiveness-receptor agonists generated from indole-3-carbinol in vitro and in vivo: comparisons with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Proc Natl Acad Sci U S A 1991;88:9543-9547. 28. Perdew GH, Babbs CF. Production of Ah receptor ligands in rat fecal suspensions containing tryptophan or indole-3-carbinol. Nutr Cancer 1991;16:209-218. 29. Jellinck PH, Forkert PG, Riddick DS, Okey AB, Michnovicz JJ, Bradlow HL. Ah receptor binding properties of indole carbinols and induction of hepatic estradiol hydroxylation. Biochem Pharmacol 1993;45:1129-1136. 30. Ciolino HP, Daschner PJ, Wang TT, Yeh GC. Effect of curcumin on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Biochem Pharmacol 1998;56:197-206.

170 31. Ciolino HP, Daschner PJ, Yeh GC. Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially. Biochem J 1999;340 ( Pt 3):715-722. 32. Adachi J, Mori Y, Matsui S, Takigami H, Fujino J, Kitagawa H, Miller CA, 3rd, et al. Indirubin and indigo are potent aryl hydrocarbon receptor ligands present in human urine. J Biol Chem 2001;276:31475-31478. 33. Peter Guengerich F, Martin MV, McCormick WA, Nguyen LP, Glover E, Bradfield CA. Aryl hydrocarbon receptor response to indigoids in vitro and in vivo. Arch Biochem Biophys 2004;423:309-316. 34. Heath-Pagliuso S, Rogers WJ, Tullis K, Seidel SD, Cenijn PH, Brouwer A, Denison MS. Activation of the Ah receptor by tryptophan and tryptophan metabolites. Biochemistry 1998;37:11508-11515. 35. Rannug A, Rannug U, Rosenkranz HS, Winqvist L, Westerholm R, Agurell E, Grafstrom AK. Certain photooxidized derivatives of tryptophan bind with very high affinity to the Ah receptor and are likely to be endogenous signal substances. J Biol Chem 1987;262:15422-15427. 36. Fritsche E, Schafer C, Calles C, Bernsmann T, Bernshausen T, Wurm M, Hubenthal U, et al. Lightening up the UV response by identification of the arylhydrocarbon receptor as a cytoplasmatic target for ultraviolet B radiation. Proc Natl Acad Sci U S A 2007;104:8851-8856. 37. Schaldach CM, Riby J, Bjeldanes LF. Lipoxin A4: a new class of ligand for the Ah receptor. Biochemistry 1999;38:7594-7600. 38. Seidel SD, Winters GM, Rogers WJ, Ziccardi MH, Li V, Keser B, Denison MS. Activation of the Ah receptor signaling pathway by prostaglandins. J Biochem Mol Toxicol 2001;15:187-196. 39. Phelan D, Winter GM, Rogers WJ, Lam JC, Denison MS. Activation of the Ah receptor signal transduction pathway by bilirubin and biliverdin. Arch Biochem Biophys 1998;357:155-163. 40. Sinal CJ, Bend JR. Aryl hydrocarbon receptor-dependent induction of cyp1a1 by bilirubin in mouse hepatoma hepa 1c1c7 cells. Mol Pharmacol 1997;52:590-599. 41. Jinno A, Maruyama Y, Ishizuka M, Kazusaka A, Nakamura A, Fujita S. Induction of cytochrome P450-1A by the equine estrogen equilenin, a new endogenous aryl hydrocarbon receptor ligand. J Steroid Biochem Mol Biol 2006;98:48-55. 42. Monk SA, Denison MS, Rice RH. Transient expression of CYP1A1 in rat epithelial cells cultured in suspension. Arch Biochem Biophys 2001;393:154-162. 43. Sadek CM, Allen-Hoffmann BL. Suspension-mediated induction of Hepa 1c1c7 Cyp1a-1 expression is dependent on the Ah receptor signal transduction pathway. J Biol Chem 1994;269:31505-31509. 44. Sadek CM, Allen-Hoffmann BL. Cytochrome P450IA1 is rapidly induced in normal human keratinocytes in the absence of xenobiotics. J Biol Chem 1994;269:16067- 16074. 45. Cho YC, Zheng W, Jefcoate CR. Disruption of cell-cell contact maximally but transiently activates AhR-mediated transcription in 10T1/2 fibroblasts. Toxicol Appl Pharmacol 2004;199:220-238.

171 46. Oesch-Bartlomowicz B, Huelster A, Wiss O, Antoniou-Lipfert P, Dietrich C, Arand M, Weiss C, et al. Aryl hydrocarbon receptor activation by cAMP vs. dioxin: divergent signaling pathways. Proc Natl Acad Sci U S A 2005;102:9218-9223. 47. Perdew GH. Chemical cross-linking of the cytosolic and nuclear forms of the Ah receptor in hepatoma cell line 1c1c7. Biochem Biophys Res Commun 1992;182:55-62. 48. Perdew GH. Association of the Ah receptor with the 90-kDa heat shock protein. J Biol Chem 1988;263:13802-13805. 49. Denis M, Cuthill S, Wikstrom AC, Poellinger L, Gustafsson JA. Association of the dioxin receptor with the Mr 90,000 heat shock protein: a structural kinship with the glucocorticoid receptor. Biochem Biophys Res Commun 1988;155:801-807. 50. Chen HS, Perdew GH. Subunit composition of the heteromeric cytosolic aryl hydrocarbon receptor complex. J Biol Chem 1994;269:27554-27558. 51. Perdew GH, Bradfield CA. Mapping the 90 kDa heat shock protein binding region of the Ah receptor. Biochem Mol Biol Int 1996;39:589-593. 52. Coumailleau P, Poellinger L, Gustafsson JA, Whitelaw ML. Definition of a minimal domain of the dioxin receptor that is associated with Hsp90 and maintains wild type ligand binding affinity and specificity. J Biol Chem 1995;270:25291-25300. 53. Pongratz I, Mason GG, Poellinger L. Dual roles of the 90-kDa heat shock protein hsp90 in modulating functional activities of the dioxin receptor. Evidence that the dioxin receptor functionally belongs to a subclass of nuclear receptors which require hsp90 both for ligand binding activity and repression of intrinsic DNA binding activity. J Biol Chem 1992;267:13728-13734. 54. Meyer BK, Pray-Grant MG, Vanden Heuvel JP, Perdew GH. Hepatitis B virus X- associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol Cell Biol 1998;18:978-988. 55. Carver LA, Bradfield CA. Ligand-dependent interaction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo. J Biol Chem 1997;272:11452- 11456. 56. Carver LA, LaPres JJ, Jain S, Dunham EE, Bradfield CA. Characterization of the Ah receptor-associated protein, ARA9. J Biol Chem 1998;273:33580-33587. 57. Meyer BK, Perdew GH. Characterization of the AhR-hsp90-XAP2 core complex and the role of the immunophilin-related protein XAP2 in AhR stabilization. Biochemistry 1999;38:8907-8917. 58. Meyer BK, Petrulis JR, Perdew GH. Aryl hydrocarbon (Ah) receptor levels are selectively modulated by hsp90-associated immunophilin homolog XAP2. Cell Stress Chaperones 2000;5:243-254. 59. Hollingshead BD, Patel RD, Perdew GH. Endogenous hepatic expression of the hepatitis B virus X-associated protein 2 is adequate for maximal association with aryl hydrocarbon receptor-90-kDa heat shock protein complexes. Mol Pharmacol 2006;70:2096-2107. 60. Lin BC, Sullivan R, Lee Y, Moran S, Glover E, Bradfield CA. Deletion of the aryl hydrocarbon receptor-associated protein 9 leads to cardiac malformation and embryonic lethality. J Biol Chem 2007;282:35924-35932. 61. Nair SC, Toran EJ, Rimerman RA, Hjermstad S, Smithgall TE, Smith DF. A pathway of multi-chaperone interactions common to diverse regulatory proteins: estrogen

172 receptor, Fes tyrosine kinase, heat shock transcription factor Hsf1, and the aryl hydrocarbon receptor. Cell Stress Chaperones 1996;1:237-250. 62. Shetty PV, Bhagwat BY, Chan WK. P23 enhances the formation of the aryl hydrocarbon receptor-DNA complex. Biochem Pharmacol 2003;65:941-948. 63. Kazlauskas A, Poellinger L, Pongratz I. Evidence that the co-chaperone p23 regulates ligand responsiveness of the dioxin (Aryl hydrocarbon) receptor. J Biol Chem 1999;274:13519-13524. 64. Perdew GH. Comparison of the nuclear and cytosolic forms of the Ah receptor from Hepa 1c1c7 cells: charge heterogeneity and ATP binding properties. Arch Biochem Biophys 1991;291:284-290. 65. Ikuta T, Eguchi H, Tachibana T, Yoneda Y, Kawajiri K. Nuclear localization and export signals of the human aryl hydrocarbon receptor. J Biol Chem 1998;273:2895- 2904. 66. Ikuta T, Tachibana T, Watanabe J, Yoshida M, Yoneda Y, Kawajiri K. Nucleocytoplasmic shuttling of the aryl hydrocarbon receptor. J Biochem 2000;127:503- 509. 67. Petrulis JR, Kusnadi A, Ramadoss P, Hollingshead B, Perdew GH. The hsp90 Co- chaperone XAP2 alters importin beta recognition of the bipartite nuclear localization signal of the Ah receptor and represses transcriptional activity. J Biol Chem 2003;278:2677-2685. 68. Reyes H, Reisz-Porszasz S, Hankinson O. Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 1992;256:1193-1195. 69. Arpiainen S, Lamsa V, Pelkonen O, Yim SH, Gonzalez FJ, Hakkola J. Aryl hydrocarbon receptor nuclear translocator and upstream stimulatory factor regulate Cytochrome P450 2a5 transcription through a common E-box site. J Mol Biol 2007;369:640-652. 70. Kewley RJ, Whitelaw ML, Chapman-Smith A. The mammalian basic helix-loop- helix/PAS family of transcriptional regulators. Int J Biochem Cell Biol 2004;36:189-204. 71. Denison MS, Fisher JM, Whitlock JP, Jr. Inducible, receptor-dependent protein- DNA interactions at a dioxin-responsive transcriptional enhancer. Proc Natl Acad Sci U S A 1988;85:2528-2532. 72. Denison MS, Fisher JM, Whitlock JP, Jr. The DNA recognition site for the dioxin-Ah receptor complex. Nucleotide sequence and functional analysis. J Biol Chem 1988;263:17221-17224. 73. Ramadoss P, Perdew GH. Use of 2-azido-3-[125I]iodo-7,8-dibromodibenzo-p- dioxin as a probe to determine the relative ligand affinity of human versus mouse aryl hydrocarbon receptor in cultured cells. Mol Pharmacol 2004;66:129-136. 74. Ramadoss P, Perdew GH. The transactivation domain of the Ah receptor is a key determinant of cellular localization and ligand-independent nucleocytoplasmic shuttling properties. Biochemistry 2005;44:11148-11159. 75. Ramadoss P, Petrulis JR, Hollingshead BD, Kusnadi A, Perdew GH. Divergent roles of hepatitis B virus X-associated protein 2 (XAP2) in human versus mouse Ah receptor complexes. Biochemistry 2004;43:700-709.

173 76. Fernandez-Salguero P, Pineau T, Hilbert DM, McPhail T, Lee SS, Kimura S, Nebert DW, et al. Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 1995;268:722-726. 77. Schmidt JV, Su GH, Reddy JK, Simon MC, Bradfield CA. Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A 1996;93:6731-6736. 78. Mimura J, Yamashita K, Nakamura K, Morita M, Takagi TN, Nakao K, Ema M, et al. Loss of teratogenic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice lacking the Ah (dioxin) receptor. Genes Cells 1997;2:645-654. 79. Fernandez-Salguero PM, Ward JM, Sundberg JP, Gonzalez FJ. Lesions of aryl- hydrocarbon receptor-deficient mice. Vet Pathol 1997;34:605-614. 80. Lahvis GP, Lindell SL, Thomas RS, McCuskey RS, Murphy C, Glover E, Bentz M, et al. Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc Natl Acad Sci U S A 2000;97:10442-10447. 81. Benedict JC, Lin TM, Loeffler IK, Peterson RE, Flaws JA. Physiological role of the aryl hydrocarbon receptor in mouse ovary development. Toxicol Sci 2000;56:382- 388. 82. Benedict JC, Miller KP, Lin TM, Greenfeld C, Babus JK, Peterson RE, Flaws JA. Aryl hydrocarbon receptor regulates growth, but not atresia, of mouse preantral and antral follicles. Biol Reprod 2003;68:1511-1517. 83. Peters JM, Narotsky MG, Elizondo G, Fernandez-Salguero PM, Gonzalez FJ, Abbott BD. Amelioration of TCDD-induced teratogenesis in aryl hydrocarbon receptor (AhR)-null mice. Toxicol Sci 1999;47:86-92. 84. Lahvis GP, Bradfield CA. Ahr null alleles: distinctive or different? Biochem Pharmacol 1998;56:781-787. 85. Noda S, Harada N, Hida A, Fujii-Kuriyama Y, Motohashi H, Yamamoto M. Gene expression of detoxifying enzymes in AhR and Nrf2 compound null mutant mouse. Biochem Biophys Res Commun 2003;303:105-111. 86. McGuire J, Okamoto K, Whitelaw ML, Tanaka H, Poellinger L. Definition of a dioxin receptor mutant that is a constitutive activator of transcription: delineation of overlapping repression and ligand binding functions within the PAS domain. J Biol Chem 2001;276:41841-41849. 87. Andersson P, McGuire J, Rubio C, Gradin K, Whitelaw ML, Pettersson S, Hanberg A, et al. A constitutively active dioxin/aryl hydrocarbon receptor induces stomach tumors. Proc Natl Acad Sci U S A 2002;99:9990-9995. 88. Moennikes O, Loeppen S, Buchmann A, Andersson P, Ittrich C, Poellinger L, Schwarz M. A constitutively active dioxin/aryl hydrocarbon receptor promotes hepatocarcinogenesis in mice. Cancer Res 2004;64:4707-4710. 89. Bunger MK, Moran SM, Glover E, Thomae TL, Lahvis GP, Lin BC, Bradfield CA. Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J Biol Chem 2003;278:17767-17774. 90. Walisser JA, Bunger MK, Glover E, Bradfield CA. Gestational exposure of Ahr and Arnt hypomorphs to dioxin rescues vascular development. Proc Natl Acad Sci U S A 2004;101:16677-16682.

174 91. Walisser JA, Bunger MK, Glover E, Harstad EB, Bradfield CA. Patent ductus venosus and dioxin resistance in mice harboring a hypomorphic Arnt allele. J Biol Chem 2004;279:16326-16331. 92. Walisser JA, Glover E, Pande K, Liss AL, Bradfield CA. Aryl hydrocarbon receptor-dependent liver development and hepatotoxicity are mediated by different cell types. Proc Natl Acad Sci U S A 2005;102:17858-17863. 93. Moriguchi T, Motohashi H, Hosoya T, Nakajima O, Takahashi S, Ohsako S, Aoki Y, et al. Distinct response to dioxin in an arylhydrocarbon receptor (AHR)-humanized mouse. Proc Natl Acad Sci U S A 2003;100:5652-5657. 94. Kasai A, Hiramatsu N, Hayakawa K, Yao J, Kitamura M. Direct, continuous monitoring of air pollution by transgenic sensor mice responsive to halogenated and polycyclic aromatic hydrocarbons. Environ Health Perspect 2008;116:349-354. 95. Uno S, Dalton TP, Dragin N, Curran CP, Derkenne S, Miller ML, Shertzer HG, et al. Oral benzo[a]pyrene in Cyp1 knockout mouse lines: CYP1A1 important in detoxication, CYP1B1 metabolism required for immune damage independent of total- body burden and clearance rate. Mol Pharmacol 2006;69:1103-1114. 96. Taioli E, Crofts F, Trachman J, Demopoulos R, Toniolo P, Garte SJ. A specific African-American CYP1A1 polymorphism is associated with adenocarcinoma of the lung. Cancer Res 1995;55:472-473. 97. Taioli E, Trachman J, Chen X, Toniolo P, Garte SJ. A CYP1A1 restriction fragment length polymorphism is associated with breast cancer in African-American women. Cancer Res 1995;55:3757-3758. 98. Ueda R, Iketaki H, Nagata K, Kimura S, Gonzalez FJ, Kusano K, Yoshimura T, et al. A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Mol Pharmacol 2006;69:1924-1930. 99. Stoilov I, Akarsu AN, Sarfarazi M. Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 1997;6:641-647. 100. Arpiainen S, Raffalli-Mathieu F, Lang MA, Pelkonen O, Hakkola J. Regulation of the Cyp2a5 gene involves an aryl hydrocarbon receptor-dependent pathway. Mol Pharmacol 2005;67:1325-1333. 101. Kohle C, Bock KW. Coordinate regulation of Phase I and II xenobiotic metabolisms by the Ah receptor and Nrf2. Biochem Pharmacol 2007;73:1853-1862. 102. Miao W, Hu L, Scrivens PJ, Batist G. Transcriptional regulation of NF-E2 p45- related factor (NRF2) expression by the aryl hydrocarbon receptor-xenobiotic response element signaling pathway: direct cross-talk between phase I and II drug-metabolizing enzymes. J Biol Chem 2005;280:20340-20348. 103. Shin S, Wakabayashi N, Misra V, Biswal S, Lee GH, Agoston ES, Yamamoto M, et al. NRF2 modulates aryl hydrocarbon receptor signaling: influence on adipogenesis. Mol Cell Biol 2007;27:7188-7197. 104. Marchand A, Barouki R, Garlatti M. Regulation of NAD(P)H:quinone oxidoreductase 1 gene expression by CYP1A1 activity. Mol Pharmacol 2004;65:1029- 1037.

175 105. Martinez JM, Afshari CA, Bushel PR, Masuda A, Takahashi T, Walker NJ. Differential toxicogenomic responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin in malignant and nonmalignant human airway epithelial cells. Toxicol Sci 2002;69:409-423. 106. Martinez JM, Baek SJ, Mays DM, Tithof PK, Eling TE, Walker NJ. EGR1 is a novel target for AhR agonists in human lung epithelial cells. Toxicol Sci 2004;82:429- 435. 107. Kim DW, Gazourian L, Quadri SA, Romieu-Mourez R, Sherr DH, Sonenshein GE. The RelA NF-kappaB subunit and the aryl hydrocarbon receptor (AhR) cooperate to transactivate the c-myc promoter in mammary cells. Oncogene 2000;19:5498-5506. 108. Yang X, Liu D, Murray TJ, Mitchell GC, Hesterman EV, Karchner SI, Merson RR, et al. The aryl hydrocarbon receptor constitutively represses c-myc transcription in human mammary tumor cells. Oncogene 2005;24:7869-7881. 109. Dong L, Ma Q, Whitlock JP, Jr. Down-regulation of major histocompatibility complex Q1b gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Biol Chem 1997;272:29614-29619. 110. Niermann T, Schmutz S, Erne P, Resink T. Aryl hydrocarbon receptor ligands repress T-cadherin expression in vascular smooth muscle cells. Biochem Biophys Res Commun 2003;300:943-949. 111. Bermudez de Leon M, Gomez P, Elizondo G, Zatarain-Palacios R, Garcia-Sierra F, Cisneros B. Beta-naphthoflavone represses dystrophin Dp71 expression in hepatic cells. Biochim Biophys Acta 2006;1759:152-158. 112. Kuznetsov NV, Andersson P, Gradin K, Stein P, Dieckmann A, Pettersson S, Hanberg A, et al. The dioxin/aryl hydrocarbon receptor mediates downregulation of osteopontin gene expression in a mouse model of gastric tumourigenesis. Oncogene 2005;24:3216-3222. 113. Martey CA, Baglole CJ, Gasiewicz TA, Sime PJ, Phipps RP. The aryl hydrocarbon receptor is a regulator of cigarette smoke induction of the cyclooxygenase and prostaglandin pathways in human lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 2005;289:L391-399. 114. Vogel CF, Li W, Sciullo E, Newman J, Hammock B, Reader JR, Tuscano J, et al. Pathogenesis of aryl hydrocarbon receptor-mediated development of lymphoma is associated with increased cyclooxygenase-2 expression. Am J Pathol 2007;171:1538- 1548. 115. Miller ME, Holloway AC, Foster WG. Benzo-[a]-pyrene increases invasion in MDA-MB-231 breast cancer cells via increased COX-II expression and prostaglandin E2 (PGE2) output. Clin Exp Metastasis 2005;22:149-156. 116. Yang F, Bleich D. Transcriptional regulation of cyclooxygenase-2 gene in pancreatic beta-cells. J Biol Chem 2004;279:35403-35411. 117. N'Diaye M, Le Ferrec E, Lagadic-Gossmann D, Corre S, Gilot D, Lecureur V, Monteiro P, et al. Aryl hydrocarbon receptor- and calcium-dependent induction of the chemokine CCL1 by the environmental contaminant benzo[a]pyrene. J Biol Chem 2006;281:19906-19915. 118. Boverhof DR, Tam E, Harney AS, Crawford RB, Kaminski NE, Zacharewski TR. 2,3,7,8-Tetrachlorodibenzo-p-dioxin induces suppressor of cytokine signaling 2 in murine B cells. Mol Pharmacol 2004;66:1662-1670.

176 119. Gouedard C, Barouki R, Morel Y. Dietary polyphenols increase paraoxonase 1 gene expression by an aryl hydrocarbon receptor-dependent mechanism. Mol Cell Biol 2004;24:5209-5222. 120. Ogi T, Mimura J, Hikida M, Fujimoto H, Fujii-Kuriyama Y, Ohmori H. Expression of human and mouse genes encoding polkappa: testis-specific developmental regulation and AhR-dependent inducible transcription. Genes Cells 2001;6:943-953. 121. Svensson C, Silverstone AE, Lai ZW, Lundberg K. Dioxin-induced adseverin expression in the mouse thymus is strictly regulated and dependent on the aryl hydrocarbon receptor. Biochem Biophys Res Commun 2002;291:1194-1200. 122. Svensson C, Lundberg K. Immune-specific up-regulation of adseverin gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Mol Pharmacol 2001;60:135-142. 123. Kolluri SK, Balduf C, Hofmann M, Gottlicher M. Novel target genes of the Ah (dioxin) receptor: transcriptional induction of N-myristoyltransferase 2. Cancer Res 2001;61:8534-8539. 124. Braun L, Kardon T, El Koulali K, Csala M, Mandl J, Banhegyi G. Different induction of gulonolactone oxidase in aromatic hydrocarbon-responsive or -unresponsive mouse strains. FEBS Lett 1999;463:345-349. 125. Ikuta T, Kawajiri K. Zinc finger transcription factor Slug is a novel target gene of aryl hydrocarbon receptor. Exp Cell Res 2006;312:3585-3594. 126. Thomsen JS, Kietz S, Strom A, Gustafsson JA. HES-1, a novel target gene for the aryl hydrocarbon receptor. Mol Pharmacol 2004;65:165-171. 127. Son DS, Rozman KK. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces plasminogen activator inhibitor-1 through an aryl hydrocarbon receptor-mediated pathway in mouse hepatoma cell lines. Arch Toxicol 2002;76:404-413. 128. Ebert B, Seidel A, Lampen A. Identification of BCRP as transporter of benzo[a]pyrene conjugates metabolically formed in Caco-2 cells and its induction by Ah- receptor agonists. Carcinogenesis 2005;26:1754-1763. 129. Su AI, Cooke MP, Ching KA, Hakak Y, Walker JR, Wiltshire T, Orth AP, et al. Large-scale analysis of the human and mouse transcriptomes. Proc Natl Acad Sci U S A 2002;99:4465-4470. 130. Baba T, Mimura J, Nakamura N, Harada N, Yamamoto M, Morohashi K, Fujii- Kuriyama Y. Intrinsic function of the aryl hydrocarbon (dioxin) receptor as a key factor in female reproduction. Mol Cell Biol 2005;25:10040-10051. 131. Barnett KR, Tomic D, Gupta RK, Miller KP, Meachum S, Paulose T, Flaws JA. The aryl hydrocarbon receptor affects mouse ovarian follicle growth via mechanisms involving estradiol regulation and responsiveness. Biol Reprod 2007;76:1062-1070. 132. Kitajima M, Khan KN, Fujishita A, Masuzaki H, Koji T, Ishimaru T. Expression of the arylhydrocarbon receptor in the peri-implantation period of the mouse uterus and the impact of dioxin on mouse implantation. Arch Histol Cytol 2004;67:465-474. 133. Hushka LJ, Williams JS, Greenlee WF. Characterization of 2,3,7,8- tetrachlorodibenzofuran-dependent suppression and AH receptor pathway gene expression in the developing mouse mammary gland. Toxicol Appl Pharmacol 1998;152:200-210.

177 134. Thackaberry EA, Gabaldon DM, Walker MK, Smith SM. Aryl hydrocarbon receptor null mice develop cardiac hypertrophy and increased hypoxia-inducible factor- 1alpha in the absence of cardiac hypoxia. Cardiovasc Toxicol 2002;2:263-274. 135. Vasquez A, Atallah-Yunes N, Smith FC, You X, Chase SE, Silverstone AE, Vikstrom KL. A role for the aryl hydrocarbon receptor in cardiac physiology and function as demonstrated by AhR knockout mice. Cardiovasc Toxicol 2003;3:153-163. 136. Lund AK, Goens MB, Kanagy NL, Walker MK. Cardiac hypertrophy in aryl hydrocarbon receptor null mice is correlated with elevated angiotensin II, endothelin-1, and mean arterial blood pressure. Toxicol Appl Pharmacol 2003;193:177-187. 137. McMillan BJ, Bradfield CA. The aryl hydrocarbon receptor sans xenobiotics: endogenous function in genetic model systems. Mol Pharmacol 2007;72:487-498. 138. Ramos KS, Hadi Falahatpisheh M, Nanez A, He Q. Modulation of biological regulatory networks during nephrogenesis. Drug Metab Rev 2006;38:677-683. 139. Akahoshi E, Yoshimura S, Ishihara-Sugano M. Over-expression of AhR (aryl hydrocarbon receptor) induces neural differentiation of Neuro2a cells: neurotoxicology study. Environ Health 2006;5:24. 140. Takanaga H, Kunimoto M, Adachi T, Tohyama C, Aoki Y. Inhibitory effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on cAMP-induced differentiation of rat C6 glial cell line. J Neurosci Res 2001;64:402-409. 141. Nishimura N, Yonemoto J, Miyabara Y, Fujii-Kuriyama Y, Tohyama C. Altered thyroxin and retinoid metabolic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin in aryl hydrocarbon receptor-null mice. Arch Toxicol 2005;79:260-267. 142. Barouki R, Coumoul X, Fernandez-Salguero PM. The aryl hydrocarbon receptor, more than a xenobiotic-interacting protein. FEBS Lett 2007;581:3608-3615. 143. Zaher H, Fernandez-Salguero PM, Letterio J, Sheikh MS, Fornace AJ, Jr., Roberts AB, Gonzalez FJ. The involvement of aryl hydrocarbon receptor in the activation of transforming growth factor-beta and apoptosis. Mol Pharmacol 1998;54:313-321. 144. Gaido KW, Maness SC, Leonard LS, Greenlee WF. 2,3,7,8-Tetrachlorodibenzo- p-dioxin-dependent regulation of transforming growth factors-alpha and -beta 2 expression in a human keratinocyte cell line involves both transcriptional and post- transcriptional control. J Biol Chem 1992;267:24591-24595. 145. Guo J, Sartor M, Karyala S, Medvedovic M, Kann S, Puga A, Ryan P, et al. Expression of genes in the TGF-beta signaling pathway is significantly deregulated in smooth muscle cells from aorta of aryl hydrocarbon receptor knockout mice. Toxicol Appl Pharmacol 2004;194:79-89. 146. Sutter TR, Guzman K, Dold KM, Greenlee WF. Targets for dioxin: genes for plasminogen activator inhibitor-2 and interleukin-1 beta. Science 1991;254:415-418. 147. Andreola F, Fernandez-Salguero PM, Chiantore MV, Petkovich MP, Gonzalez FJ, De Luca LM. Aryl hydrocarbon receptor knockout mice (AHR-/-) exhibit liver retinoid accumulation and reduced retinoic acid metabolism. Cancer Res 1997;57:2835-2838. 148. Schmidt CK, Hoegberg P, Fletcher N, Nilsson CB, Trossvik C, Hakansson H, Nau H. 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the endogenous metabolism of all-trans-retinoic acid in the rat. Arch Toxicol 2003;77:371-383.

178 149. Andreola F, Calvisi DF, Elizondo G, Jakowlew SB, Mariano J, Gonzalez FJ, De Luca LM. Reversal of liver fibrosis in aryl hydrocarbon receptor null mice by dietary vitamin A depletion. Hepatology 2004;39:157-166. 150. Andreola F, Hayhurst GP, Luo G, Ferguson SS, Gonzalez FJ, Goldstein JA, De Luca LM. Mouse liver CYP2C39 is a novel retinoic acid 4-hydroxylase. Its down- regulation offers a molecular basis for liver retinoid accumulation and fibrosis in aryl hydrocarbon receptor-null mice. J Biol Chem 2004;279:3434-3438. 151. Zacharewski TR, Bondy KL, McDonell P, Wu ZF. Antiestrogenic effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on 17 beta-estradiol-induced pS2 expression. Cancer Res 1994;54:2707-2713. 152. Porter W, Wang F, Duan R, Qin C, Castro-Rivera E, Kim K, Safe S. Transcriptional activation of heat shock protein 27 gene expression by 17beta-estradiol and modulation by antiestrogens and aryl hydrocarbon receptor agonists. J Mol Endocrinol 2001;26:31-42. 153. Safe S, Wormke M, Samudio I. Mechanisms of inhibitory aryl hydrocarbon receptor-estrogen receptor crosstalk in human breast cancer cells. J Mammary Gland Biol Neoplasia 2000;5:295-306. 154. Spink DC, Lincoln DW, 2nd, Dickerman HW, Gierthy JF. 2,3,7,8- Tetrachlorodibenzo-p-dioxin causes an extensive alteration of 17 beta-estradiol metabolism in MCF-7 breast tumor cells. Proc Natl Acad Sci U S A 1990;87:6917-6921. 155. Wormke M, Stoner M, Saville B, Walker K, Abdelrahim M, Burghardt R, Safe S. The aryl hydrocarbon receptor mediates degradation of estrogen receptor alpha through activation of proteasomes. Mol Cell Biol 2003;23:1843-1855. 156. Ohtake F, Baba A, Takada I, Okada M, Iwasaki K, Miki H, Takahashi S, et al. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 2007;446:562-566. 157. Abdelrahim M, Ariazi E, Kim K, Khan S, Barhoumi R, Burghardt R, Liu S, et al. 3-Methylcholanthrene and other aryl hydrocarbon receptor agonists directly activate estrogen receptor alpha. Cancer Res 2006;66:2459-2467. 158. Ohtake F, Takeyama K, Matsumoto T, Kitagawa H, Yamamoto Y, Nohara K, Tohyama C, et al. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 2003;423:545-550. 159. Hockings JK, Thorne PA, Kemp MQ, Morgan SS, Selmin O, Romagnolo DF. The ligand status of the aromatic hydrocarbon receptor modulates transcriptional activation of BRCA-1 promoter by estrogen. Cancer Res 2006;66:2224-2232. 160. Brunnberg S, Pettersson K, Rydin E, Matthews J, Hanberg A, Pongratz I. The basic helix-loop-helix-PAS protein ARNT functions as a potent coactivator of estrogen receptor-dependent transcription. Proc Natl Acad Sci U S A 2003;100:6517-6522. 161. Beischlag TV, Perdew GH. ER alpha-AHR-ARNT protein-protein interactions mediate estradiol-dependent transrepression of dioxin-inducible gene transcription. J Biol Chem 2005;280:21607-21611. 162. Jana NR, Sarkar S, Ishizuka M, Yonemoto J, Tohyama C, Sone H. Cross-talk between 2,3,7,8-tetrachlorodibenzo-p-dioxin and testosterone signal transduction pathways in LNCaP prostate cancer cells. Biochem Biophys Res Commun 1999;256:462- 468.

179 163. Lin TM, Ko K, Moore RW, Simanainen U, Oberley TD, Peterson RE. Effects of aryl hydrocarbon receptor null mutation and in utero and lactational 2,3,7,8- tetrachlorodibenzo-p-dioxin exposure on prostate and seminal vesicle development in C57BL/6 mice. Toxicol Sci 2002;68:479-487. 164. De Bosscher K, Vanden Berghe W, Haegeman G. Cross-talk between nuclear receptors and nuclear factor kappaB. Oncogene 2006;25:6868-6886. 165. Pascual G, Glass CK. Nuclear receptors versus inflammation: mechanisms of transrepression. Trends Endocrinol Metab 2006;17:321-327. 166. Rosenfeld MG, Lunyak VV, Glass CK. Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptional response. Genes Dev 2006;20:1405-1428. 167. Natoli G, Saccani S, Bosisio D, Marazzi I. Interactions of NF-kappaB with chromatin: the art of being at the right place at the right time. Nat Immunol 2005;6:439- 445. 168. Morgan ET. Regulation of cytochromes P450 during inflammation and infection. Drug Metab Rev 1997;29:1129-1188. 169. Stoilov I, Krueger W, Mankowski D, Guernsey L, Kaur A, Glynn J, Thrall RS. The cytochromes P450 (CYP) response to allergic inflammation of the lung. Arch Biochem Biophys 2006;456:30-38. 170. Gharavi N, El-Kadi AO. Down-regulation of aryl hydrocarbon receptor-regulated genes by tumor necrosis factor-alpha and lipopolysaccharide in murine hepatoma Hepa 1c1c7 cells. J Pharm Sci 2005;94:493-506. 171. Paton TE, Renton KW. Cytokine-mediated down-regulation of CYP1A1 in Hepa1 cells. Biochem Pharmacol 1998;55:1791-1796. 172. Tian Y, Ke S, Denison MS, Rabson AB, Gallo MA. Ah receptor and NF-kappaB interactions, a potential mechanism for dioxin toxicity. J Biol Chem 1999;274:510-515. 173. Tian Y, Rabson AB, Gallo MA. Ah receptor and NF-kappaB interactions: mechanisms and physiological implications. Chem Biol Interact 2002;141:97-115. 174. Pande K, Moran SM, Bradfield CA. Aspects of dioxin toxicity are mediated by interleukin 1-like cytokines. Mol Pharmacol 2005;67:1393-1398. 175. Podechard N, Lecureur V, Le Ferrec E, Guenon I, Sparfel L, Gilot D, Gordon JR, et al. Interleukin-8 induction by the environmental contaminant benzo(a)pyrene is aryl hydrocarbon receptor-dependent and leads to lung inflammation. Toxicol Lett 2008;177:130-137. 176. Vogel CF, Sciullo E, Matsumura F. Involvement of RelB in aryl hydrocarbon receptor-mediated induction of chemokines. Biochem Biophys Res Commun 2007;363:722-726. 177. Lai ZW, Hundeiker C, Gleichmann E, Esser C. Cytokine gene expression during ontogeny in murine thymus on activation of the aryl hydrocarbon receptor by 2,3,7,8- tetrachlorodibenzo-p-dioxin. Mol Pharmacol 1997;52:30-37. 178. Henley DV, Bellone CJ, Williams DA, Ruh TS, Ruh MF. Aryl hydrocarbon receptor-mediated posttranscriptional regulation of IL-1beta. Arch Biochem Biophys 2004;422:42-51.

180 179. Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier L, Renauld JC, Stockinger B. The aryl hydrocarbon receptor links T(H)17-cell-mediated autoimmunity to environmental toxins. Nature 2008. 180. Jensen BA, Leeman RJ, Schlezinger JJ, Sherr DH. Aryl hydrocarbon receptor (AhR) agonists suppress interleukin-6 expression by bone marrow stromal cells: an immunotoxicology study. Environ Health 2003;2:16. 181. Lawrence BP, Denison MS, Novak H, Vorderstrasse BA, Harrer N, Neruda W, Reichel C, et al. Activation of the aryl hydrocarbon receptor is essential for mediating the anti-inflammatory effects of a novel low molecular weight compound. Blood 2008. 182. Shi LZ, Faith NG, Nakayama Y, Suresh M, Steinberg H, Czuprynski CJ. The aryl hydrocarbon receptor is required for optimal resistance to Listeria monocytogenes infection in mice. J Immunol 2007;179:6952-6962. 183. Degner SC, Kemp MQ, Hockings JK, Romagnolo DF. Cyclooxygenase-2 promoter activation by the aromatic hydrocarbon receptor in breast cancer mcf-7 cells: repressive effects of conjugated linoleic acid. Nutr Cancer 2007;59:248-257. 184. Vogel C, Boerboom AM, Baechle C, El-Bahay C, Kahl R, Degen GH, Abel J. Regulation of prostaglandin endoperoxide H synthase-2 induction by dioxin in rat hepatocytes: possible c-Src-mediated pathway. Carcinogenesis 2000;21:2267-2274. 185. Vogel CF, Sciullo E, Park S, Liedtke C, Trautwein C, Matsumura F. Dioxin increases C/EBPbeta transcription by activating cAMP/protein kinase A. J Biol Chem 2004;279:8886-8894. 186. Hoffer A, Chang CY, Puga A. Dioxin induces transcription of fos and jun genes by Ah receptor-dependent and -independent pathways. Toxicol Appl Pharmacol 1996;141:238-247. 187. Suh J, Jeon YJ, Kim HM, Kang JS, Kaminski NE, Yang KH. Aryl hydrocarbon receptor-dependent inhibition of AP-1 activity by 2,3,7,8-tetrachlorodibenzo-p-dioxin in activated B cells. Toxicol Appl Pharmacol 2002;181:116-123. 188. Ruby CE, Leid M, Kerkvliet NI. 2,3,7,8-Tetrachlorodibenzo-p-dioxin suppresses tumor necrosis factor-alpha and anti-CD40-induced activation of NF-kappaB/Rel in dendritic cells: p50 homodimer activation is not affected. Mol Pharmacol 2002;62:722- 728. 189. Thatcher TH, Maggirwar SB, Baglole CJ, Lakatos HF, Gasiewicz TA, Phipps RP, Sime PJ. Aryl hydrocarbon receptor-deficient mice develop heightened inflammatory responses to cigarette smoke and endotoxin associated with rapid loss of the nuclear factor-kappaB component RelB. Am J Pathol 2007;170:855-864. 190. Lecureur V, Ferrec EL, N'Diaye M, Vee ML, Gardyn C, Gilot D, Fardel O. ERK- dependent induction of TNFalpha expression by the environmental contaminant benzo(a)pyrene in primary human macrophages. FEBS Lett 2005;579:1904-1910. 191. Ke S, Rabson AB, Germino JF, Gallo MA, Tian Y. Mechanism of suppression of cytochrome P-450 1A1 expression by tumor necrosis factor-alpha and lipopolysaccharide. J Biol Chem 2001;276:39638-39644. 192. Umannova L, Zatloukalova J, Machala M, Krcmar P, Majkova Z, Hennig B, Kozubik A, et al. Tumor necrosis factor-alpha modulates effects of aryl hydrocarbon receptor ligands on cell proliferation and expression of cytochrome P450 enzymes in rat liver "stem-like" cells. Toxicol Sci 2007;99:79-89.

181 193. Vogel CF, Nishimura N, Sciullo E, Wong P, Li W, Matsumura F. Modulation of the chemokines KC and MCP-1 by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice. Arch Biochem Biophys 2007;461:169-175. 194. Knaapen AM, Curfs DM, Pachen DM, Gottschalk RW, de Winther MP, Daemen MJ, Van Schooten FJ. The environmental carcinogen benzo[a]pyrene induces expression of monocyte-chemoattractant protein-1 in vascular tissue: a possible role in atherogenesis. Mutat Res 2007;621:31-41. 195. Vorderstrasse BA, Lawrence BP. Protection against lethal challenge with Streptococcus pneumoniae is conferred by aryl hydrocarbon receptor activation but is not associated with an enhanced inflammatory response. Infect Immun 2006;74:5679-5686. 196. Tauchi M, Hida A, Negishi T, Katsuoka F, Noda S, Mimura J, Hosoya T, et al. Constitutive expression of aryl hydrocarbon receptor in keratinocytes causes inflammatory skin lesions. Mol Cell Biol 2005;25:9360-9368. 197. Hinsdill RD, Couch DL, Speirs RS. Immunosuppression in mice induced by dioxin (TCDD) in feed. J Environ Pathol Toxicol 1980;4:401-425. 198. Luster MI, Boorman GA, Dean JH, Harris MW, Luebke RW, Padarathsingh ML, Moore JA. Examination of bone marrow, immunologic parameters and host susceptibility following pre- and postnatal exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Int J Immunopharmacol 1980;2:301-310. 199. Sugita-Konishi Y, Kobayashi K, Naito H, Miura K, Suzuki Y. Effect of lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin on the susceptibility to Listeria infection. Biosci Biotechnol Biochem 2003;67:89-93. 200. Kerkvliet NI, Baecher-Steppan L, Shepherd DM, Oughton JA, Vorderstrasse BA, DeKrey GK. Inhibition of TC-1 cytokine production, effector cytotoxic T lymphocyte development and alloantibody production by 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Immunol 1996;157:2310-2319. 201. Hahn ME. Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact 2002;141:131-160. 202. Shimizu Y, Nakatsuru Y, Ichinose M, Takahashi Y, Kume H, Mimura J, Fujii- Kuriyama Y, et al. Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor. Proc Natl Acad Sci U S A 2000;97:779-782. 203. Sun YV, Boverhof DR, Burgoon LD, Fielden MR, Zacharewski TR. Comparative analysis of dioxin response elements in human, mouse and rat genomic sequences. Nucleic Acids Res 2004;32:4512-4523. 204. Sogawa K, Numayama-Tsuruta K, Takahashi T, Matsushita N, Miura C, Nikawa J, Gotoh O, et al. A novel induction mechanism of the rat CYP1A2 gene mediated by Ah receptor-Arnt heterodimer. Biochem Biophys Res Commun 2004;318:746-755. 205. Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, et al. DNA binding of the glucocorticoid receptor is not essential for survival. Cell 1998;93:531-541. 206. Bladh LG, Liden J, Dahlman-Wright K, Reimers M, Nilsson S, Okret S. Identification of endogenous glucocorticoid repressed genes differentially regulated by a glucocorticoid receptor mutant able to separate between nuclear factor-kappaB and activator protein-1 repression. Mol Pharmacol 2005;67:815-826.

182 207. Valentine JE, Kalkhoven E, White R, Hoare S, Parker MG. Mutations in the estrogen receptor ligand binding domain discriminate between hormone-dependent transactivation and transrepression. J Biol Chem 2000;275:25322-25329. 208. Heid SE, Walker MK, Swanson HI. Correlation of cardiotoxicity mediated by halogenated aromatic hydrocarbons to aryl hydrocarbon receptor activation. Toxicol Sci 2001;61:187-196. 209. Elizondo G, Fernandez-Salguero P, Sheikh MS, Kim GY, Fornace AJ, Lee KS, Gonzalez FJ. Altered cell cycle control at the G(2)/M phases in aryl hydrocarbon receptor-null embryo fibroblast. Mol Pharmacol 2000;57:1056-1063. 210. Ge NL, Elferink CJ. A direct interaction between the aryl hydrocarbon receptor and retinoblastoma protein. Linking dioxin signaling to the cell cycle. J Biol Chem 1998;273:22708-22713. 211. Koo BH, Kim DS. Factor Xa induces mitogenesis of vascular smooth muscle cells via autocrine production of epiregulin. J Biol Chem 2003;278:52578-52586. 212. Puga A, Marlowe J, Barnes S, Chang CY, Maier A, Tan Z, Kerzee JK, et al. Role of the aryl hydrocarbon receptor in cell cycle regulation. Toxicology 2002;181-182:171- 177. 213. Denison MS, Pandini A, Nagy SR, Baldwin EP, Bonati L. Ligand binding and activation of the Ah receptor. Chem Biol Interact 2002;141:3-24. 214. Dunson DB, Haseman JK, van Birgelen AP, Stasiewicz S, Tennant RW. Statistical analysis of skin tumor data from Tg.AC mouse bioassays. Toxicol Sci 2000;55:293-302. 215. Poland A, Palen D, Glover E. Tumour promotion by TCDD in skin of HRS/J hairless mice. Nature 1982;300:271-273. 216. Dragan YP, Schrenk D. Animal studies addressing the carcinogenicity of TCDD (or related compounds) with an emphasis on tumour promotion. Food Addit Contam 2000;17:289-302. 217. Harris RC, Chung E, Coffey RJ. EGF receptor ligands. Exp Cell Res 2003;284:2- 13. 218. Toyoda H, Komurasaki T, Uchida D, Takayama Y, Isobe T, Okuyama T, Hanada K. Epiregulin. A novel epidermal growth factor with mitogenic activity for rat primary hepatocytes. J Biol Chem 1995;270:7495-7500. 219. Komurasaki T, Toyoda H, Uchida D, Nemoto N. Mechanism of growth promoting activity of epiregulin in primary cultures of rat hepatocytes. Growth Factors 2002;20:61-69. 220. Shirakata Y, Komurasaki T, Toyoda H, Hanakawa Y, Yamasaki K, Tokumaru S, Sayama K, et al. Epiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem 2000;275:5748- 5753. 221. Sekiguchi T, Mizutani T, Yamada K, Kajitani T, Yazawa T, Yoshino M, Miyamoto K. Expression of epiregulin and amphiregulin in the rat ovary. J Mol Endocrinol 2004;33:281-291. 222. Sekiguchi T, Mizutani T, Yamada K, Yazawa T, Kawata H, Yoshino M, Kajitani T, et al. Transcriptional regulation of the epiregulin gene in the rat ovary. Endocrinology 2002;143:4718-4729.

183 223. Takahashi M, Hayashi K, Yoshida K, Ohkawa Y, Komurasaki T, Kitabatake A, Ogawa A, et al. Epiregulin as a major autocrine/paracrine factor released from ERK- and p38MAPK-activated vascular smooth muscle cells. Circulation 2003;108:2524-2529. 224. Dlugosz AA, Glick AB, Tennenbaum T, Weinberg WC, Yuspa SH. Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol 1995;254:3-20. 225. Murray IA, Reen, R.K., Leathery, N., Ramadoss, P., Bonati, L., Gonzalez, F.J., Peters, J.M., and Perdew G.H. Evidence that ligand binding is a key determinant of Ah receptor-mediated transcriptional activity. Arch. Biochem. Biophys. (In Press) 2005. 226. Chou JY. Establishment of rat fetal liver lines and characterization of their metabolic and hormonal properties: use of temperature-sensitive SV40 virus. Methods Enzymol 1985;109:385-396. 227. Lorenzen A, Kennedy SW, Bastien LJ, Hahn ME. Halogenated aromatic hydrocarbon-mediated porphyrin accumulation and induction of cytochrome P4501A in chicken embryo hepatocytes. Biochem Pharmacol 1997;53:373-384. 228. Sato K, Nakamura T, Mizuguchi M, Miura K, Tada M, Aizawa T, Gomi T, et al. Solution structure of epiregulin and the effect of its C-terminal domain for receptor binding affinity. FEBS Lett 2003;553:232-238. 229. Spencer VA, Sun JM, Li L, Davie JR. Chromatin immunoprecipitation: a tool for studying histone acetylation and transcription factor binding. Methods 2003;31:67-75. 230. Swanson HI, Whitelaw ML, Petrulis JR, Perdew GH. Use of [125I]4'-iodoflavone as a tool to characterize ligand-dependent differences in Ah receptor behavior. J Biochem Mol Toxicol 2002;16:298-310. 231. Carlson DB, Perdew GH. A dynamic role for the Ah receptor in cell signaling? Insights from a diverse group of Ah receptor interacting proteins. J Biochem Mol Toxicol 2002;16:317-325. 232. Kobayashi A, Sogawa K, Fujii-Kuriyama Y. Cooperative interaction between AhR.Arnt and Sp1 for the drug-inducible expression of CYP1A1 gene. J Biol Chem 1996;271:12310-12316. 233. Shelly M, Pinkas-Kramarski R, Guarino BC, Waterman H, Wang LM, Lyass L, Alimandi M, et al. Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem 1998;273:10496-10505. 234. Zhu Z, Kleeff J, Friess H, Wang L, Zimmermann A, Yarden Y, Buchler MW, et al. Epiregulin is Up-regulated in pancreatic cancer and stimulates pancreatic cancer cell growth. Biochem Biophys Res Commun 2000;273:1019-1024. 235. Torring N, Jorgensen PE, Sorensen BS, Nexo E. Increased expression of heparin binding EGF (HB-EGF), amphiregulin, TGF alpha and epiregulin in androgen- independent prostate cancer cell lines. Anticancer Res 2000;20:91-95. 236. Yamamoto T, Akisue T, Marui T, Nakatani T, Kawamoto T, Hitora T, Nagira K, et al. Expression of betacellulin, heparin-binding epidermal growth factor and epiregulin in human malignant fibrous histiocytoma. Anticancer Res 2004;24:2007-2010. 237. Baba I, Shirasawa S, Iwamoto R, Okumura K, Tsunoda T, Nishioka M, Fukuyama K, et al. Involvement of deregulated epiregulin expression in tumorigenesis in vivo through activated Ki-Ras signaling pathway in human colon cancer cells. Cancer Res 2000;60:6886-6889.

184 238. Freimann S, Ben-Ami I, Hirsh L, Dantes A, Halperin R, Amsterdam A. Drug development for ovarian hyper-stimulation and anti-cancer treatment: blocking of gonadotropin signaling for epiregulin and amphiregulin biosynthesis. Biochem Pharmacol 2004;68:989-996. 239. Fiorito F, Pagnini U, De Martino L, Montagnaro S, Ciarcia R, Florio S, Pacilio M, et al. 2,3,7,8-Tetrachlorodibenzo-p-dioxin increases Bovine Herpesvirus type-1 (BHV-1) replication in Madin-Darby Bovine Kidney (MDBK) cells in vitro. J Cell Biochem 2008;103:221-233. 240. Cole P, Trichopoulos D, Pastides H, Starr T, Mandel JS. Dioxin and cancer: a critical review. Regul Toxicol Pharmacol 2003;38:378-388. 241. Steenland K, Bertazzi P, Baccarelli A, Kogevinas M. Dioxin revisited: developments since the 1997 IARC classification of dioxin as a human carcinogen. Environ Health Perspect 2004;112:1265-1268. 242. Xie W, Barwick JL, Simon CM, Pierce AM, Safe S, Blumberg B, Guzelian PS, et al. Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev 2000;14:3014-3023. 243. Puga A, Tomlinson CR, Xia Y. Ah receptor signals cross-talk with multiple developmental pathways. Biochem Pharmacol 2005;69:199-207. 244. Kobayashi K, Sueyoshi T, Inoue K, Moore R, Negishi M. Cytoplasmic accumulation of the nuclear receptor CAR by a tetratricopeptide repeat protein in HepG2 cells. Mol Pharmacol 2003;64:1069-1075. 245. Tzameli I, Pissios P, Schuetz EG, Moore DD. The xenobiotic compound 1,4- bis[2-(3,5-dichloropyridyloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol Cell Biol 2000;20:2951-2958. 246. Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K, Negishi M. Phenobarbital-responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Biol 1999;19:6318-6322. 247. Pascussi JM, Busson-Le Coniat M, Maurel P, Vilarem MJ. Transcriptional analysis of the orphan nuclear receptor constitutive androstane receptor (NR1I3) gene promoter: identification of a distal glucocorticoid response element. Mol Endocrinol 2003;17:42-55. 248. Assenat E, Gerbal-Chaloin S, Larrey D, Saric J, Fabre JM, Maurel P, Vilarem MJ, et al. Interleukin 1beta inhibits CAR-induced expression of hepatic genes involved in drug and bilirubin clearance. Hepatology 2004;40:951-960. 249. Mitchell KA, Lockhart CA, Huang G, Elferink CJ. Sustained aryl hydrocarbon receptor activity attenuates liver regeneration. Mol Pharmacol 2006;70:163-170. 250. Maglich JM, Watson J, McMillen PJ, Goodwin B, Willson TM, Moore JT. The nuclear receptor CAR is a regulator of thyroid hormone metabolism during caloric restriction. J Biol Chem 2004;279:19832-19838. 251. Strom SC, Pisarov LA, Dorko K, Thompson MT, Schuetz JD, Schuetz EG. Use of human hepatocytes to study P450 gene induction. Methods Enzymol 1996;272:388-401. 252. Sidhu JS, Liu F, Omiecinski CJ. Phenobarbital responsiveness as a uniquely sensitive indicator of hepatocyte differentiation status: requirement of dexamethasone and extracellular matrix in establishing the functional integrity of cultured primary rat hepatocytes. Exp Cell Res 2004;292:252-264.

185 253. Venugopal R, Jaiswal AK. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci U S A 1996;93:14960- 14965. 254. Wei P, Zhang J, Egan-Hafley M, Liang S, Moore DD. The nuclear receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature 2000;407:920-923. 255. Guengerich FP. Cytochrome P-450 3A4: regulation and role in drug metabolism. Annu Rev Pharmacol Toxicol 1999;39:1-17. 256. Huang W, Zhang J, Chua SS, Qatanani M, Han Y, Granata R, Moore DD. Induction of bilirubin clearance by the constitutive androstane receptor (CAR). Proc Natl Acad Sci U S A 2003;100:4156-4161. 257. Ledda-Columbano GM, Pibiri M, Concas D, Molotzu F, Simbula G, Cossu C, Columbano A. Sex difference in the proliferative response of mouse hepatocytes to treatment with the CAR ligand, TCPOBOP. Carcinogenesis 2003;24:1059-1065. 258. Huang W, Zhang J, Washington M, Liu J, Parant JM, Lozano G, Moore DD. Xenobiotic stress induces hepatomegaly and liver tumors via the nuclear receptor constitutive androstane receptor. Mol Endocrinol 2005;19:1646-1653. 259. Koide A, Fuwa K, Furukawa F, Hirose M, Nishikawa A, Mori Y. Effect of cigarette smoke on the mutagenic activation of environmental carcinogens by rodent liver. Mutat Res 1999;428:165-176. 260. Gabay C, Kushner I. Acute-phase proteins and other systemic responses to inflammation. N Engl J Med 1999;340:448-454. 261. Ramadori G, Christ B. Cytokines and the hepatic acute-phase response. Semin Liver Dis 1999;19:141-155. 262. Ghosh S, Karin M. Missing pieces in the NF-kappaB puzzle. Cell 2002;109 Suppl:S81-96. 263. Baldwin AS, Jr. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649-683. 264. Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol 2004;4:499- 511. 265. Mosialos G, Gilmore TD. v-Rel and c-Rel are differentially affected by mutations at a consensus protein kinase recognition sequence. Oncogene 1993;8:721-730. 266. Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S. The transcriptional activity of NF-[kappa]B is regulated by the I[kappa]B-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 1997;89:413-424. 267. Duran A, Diaz-Meco MT, Moscat J. Essential role of RelA Ser311 phosphorylation by [zeta]PKC in NF-[kappa]B transcriptional activation. EMBO J. 2003;22:3910-3918. 268. Wang D, Baldwin AS. Activation of nuclear factor-[kappa]B-dependent transcription by tumor necrosis factor-[alpha] is mediated through phosphorylation of RelA/p65 on serine 529. J. Biol. Chem. 1998;273:29411-29416. 269. Sakurai H, Chiba H, Miyoshi H, Sugita T, Toriumi W. I[kappa]B kinases phosphorylate NF-[kappa]B p65 subunit on serine 536 in the transactivation domain. J. Biol. Chem. 1999;274:30353-30356.

186 270. Chen L, Fischle W, Verdin E, Greene WC. Duration of nuclear NF-[kappa]B action regulated by reversible acetylation. Science 2001;293:1653-1657. 271. Chen LF, Mu Y, Greene WC. Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-[kappa]B. EMBO J. 2002;21:6539-6548. 272. Chen LF, Greene WC. Shaping the nuclear action of NF-kappaB. Nat Rev Mol Cell Biol 2004;5:392-401. 273. Levine SL, Petrulis JR, Dubil A, Perdew GH. A tetratricopeptide repeat half-site in the aryl hydrocarbon receptor is important for DNA binding and trans-activation potential. Mol Pharmacol 2000;58:1517-1524. 274. Murray IA, Reen RK, Leathery N, Ramadoss P, Bonati L, Gonzalez FJ, Peters JM, et al. Evidence that ligand binding is a key determinant of Ah receptor-mediated transcriptional activity. Arch Biochem Biophys 2005;442:59-71. 275. Morales JL, Krzeminski J, Amin S, Perdew GH. Characterization of the antiallergic drugs 3-[2-(2-phenylethyl) benzoimidazole-4-yl]-3-hydroxypropanoic acid and ethyl 3-hydroxy-3-[2-(2-phenylethyl)benzoimidazol-4-yl]propanoate as full aryl hydrocarbon receptor agonists. Chem Res Toxicol 2008;21:472-482. 276. Negishi T, Kato Y, Ooneda O, Mimura J, Takada T, Mochizuki H, Yamamoto M, et al. Effects of aryl hydrocarbon receptor signaling on the modulation of TH1/TH2 balance. J Immunol 2005;175:7348-7356. 277. Kiernan R. Post-activation turn-off of NF-[kappa]B-dependent transcription is regulated by acetylation of p65. J. Biol. Chem. 2003;278:2758-2766. 278. Quivy V, Van Lint C. Regulation at multiple levels of NF-kappaB-mediated transactivation by protein acetylation. Biochem Pharmacol 2004;68:1221-1229. 279. Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol 2007;7:454-465. 280. Kluve-Beckerman B, Drumm ML, Benson MD. Nonexpression of the human serum amyloid A three (SAA3) gene. DNA Cell Biol 1991;10:651-661. 281. Bone RC. Toward a theory regarding the pathogenesis of the systemic inflammatory response syndrome: what we do and do not know about cytokine regulation. Crit Care Med 1996;24:163-172. 282. Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A, Lowe GD, et al. C-reactive protein and other circulating markers of inflammation in the prediction of coronary heart disease. N Engl J Med 2004;350:1387-1397. 283. Ridker PM, Hennekens CH, Buring JE, Rifai N. C-reactive protein and other markers of inflammation in the prediction of cardiovascular disease in women. N Engl J Med 2000;342:836-843. 284. Veerhuis R, Boshuizen RS, Familian A. Amyloid associated proteins in Alzheimer's and prion disease. Curr Drug Targets CNS Neurol Disord 2005;4:235-248. 285. Ray A, Ray BK. Serum amyloid A gene expression level in liver in response to different inflammatory agents is dependent upon the nature of activated transcription factors. DNA Cell Biol 1997;16:1-7. 286. Hagihara K, Nishikawa T, Sugamata Y, Song J, Isobe T, Taga T, Yoshizaki K. Essential role of STAT3 in cytokine-driven NF-kappaB-mediated serum amyloid A gene expression. Genes Cells 2005;10:1051-1063.

187 287. Shimizu H, Yamamoto K. NF-kappa B and C/EBP transcription factor families synergistically function in mouse serum amyloid A gene expression induced by inflammatory cytokines. Gene 1994;149:305-310. 288. Vermeulen L, De Wilde G, Damme PV, Vanden Berghe W, Haegeman G. Transcriptional activation of the NF-[kappa]B p65 subunit by mitogen- and stress- activated protein kinase-1 (MSK1). EMBO J. 2003;22:1313-1324. 289. Ito K, Barnes PJ, Adcock IM. Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits interleukin-1[beta]-induced histone H4 acetylation on lysines 8 and 12. Mol. Cell. Biol. 2000;20:6891-6903. 290. Sun SC, Ganchi PA, Ballard DW, Greene WC. NF-[kappa]B controls expression of inhibitor I[kappa]B[alpha]: evidence for an inducible autoregulatory pathway. Science 1993;259:1912-1915. 291. Arenzana-Seisdedos F. Inducible nuclear expression of newly synthesized I[kappa]B[alpha] negatively regulates DNA-binding and transcriptional activities of NF- [kappa]B. Mol. Cell. Biol. 1995;15:2689-2696. 292. De Bosscher K, Vanden Berghe W, Haegeman G. The interplay between the glucocorticoid receptor and nuclear factor-kappaB or activator protein-1: molecular mechanisms for gene repression. Endocr Rev 2003;24:488-522. 293. Galizia G, Lieto E, De Vita F, Orditura M, Castellano P, Troiani T, Imperatore V, et al. Cetuximab, a chimeric human mouse anti-epidermal growth factor receptor monoclonal antibody, in the treatment of human colorectal cancer. Oncogene 2007;26:3654-3660. 294. Sharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer 2007;7:169-181. 295. Nishimura T, Andoh A, Inatomi O, Shioya M, Yagi Y, Tsujikawa T, Fujiyama Y. Amphiregulin and epiregulin expression in neoplastic and inflammatory lesions in the colon. Oncol Rep 2008;19:105-110. 296. Khambata-Ford S, Garrett CR, Meropol NJ, Basik M, Harbison CT, Wu S, Wong TW, et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007;25:3230-3237. 297. Shirakata Y, Kishimoto J, Tokumaru S, Yamasaki K, Hanakawa Y, Tohyama M, Sayama K, et al. Epiregulin, a member of the EGF family, is over-expressed in psoriatic epidermis. J Dermatol Sci 2007;45:69-72. 298. Schwarz M, Appel KE. Carcinogenic risks of dioxin: mechanistic considerations. Regul Toxicol Pharmacol 2005;43:19-34. 299. Shirasawa S, Sugiyama S, Baba I, Inokuchi J, Sekine S, Ogino K, Kawamura Y, et al. Dermatitis due to epiregulin deficiency and a critical role of epiregulin in immune- related responses of keratinocyte and macrophage. Proc Natl Acad Sci U S A 2004;101:13921-13926. 300. Choi SS, Miller MA, Harper PA. In utero exposure to 2,3,7,8-tetrachlorodibenzo- p-dioxin induces amphiregulin gene expression in the developing mouse ureter. Toxicol Sci 2006;94:163-174.

188 301. Pascual G, Fong AL, Ogawa S, Gamliel A, Li AC, Perissi V, Rose DW, et al. A SUMOylation-dependent pathway mediates transrepression of inflammatory response genes by PPAR-[gamma]. Nature 2005;437:759-763. 302. Lefstin JA, Yamamoto KR. Allosteric effects of DNA on transcriptional regulators. Nature 1998;392:885-888. 303. Rogatsky I, Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq CM, Darimont BD, et al. Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor. Proc Natl Acad Sci U S A 2003;100:13845-13850. 304. Leung TH, Hoffmann A, Baltimore D. One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell 2004;118:453-464. 305. Kawane K, Ohtani M, Miwa K, Kizawa T, Kanbara Y, Yoshioka Y, Yoshikawa H, et al. Chronic polyarthritis caused by mammalian DNA that escapes from degradation in macrophages. Nature 2006;443:998-1002. 306. Napirei M, Karsunky H, Zevnik B, Stephan H, Mannherz HG, Moroy T. Features of systemic lupus erythematosus in Dnase1-deficient mice. Nat Genet 2000;25:177-181. 307. Yasutomo K, Horiuchi T, Kagami S, Tsukamoto H, Hashimura C, Urushihara M, Kuroda Y. Mutation of DNASE1 in people with systemic lupus erythematosus. Nat Genet 2001;28:313-314. 308. Lundmark K, Westermark GT, Nystrom S, Murphy CL, Solomon A, Westermark P. Transmissibility of systemic amyloidosis by a prion-like mechanism. Proc Natl Acad Sci U S A 2002;99:6979-6984. 309. Brzozowski AM. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 1997;389:753-758. 310. Kousteni S, Bellido T, Plotkin LI, O'Brien CA, Bodenner DL, Han L, Han K, et al. Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 2001;104:719-730.

VITA

Rushang Dilipkumar Patel

Education

07/2002 – 08/2008 Ph.D., Integrative Biosciences - Molecular Medicine Option The Pennsylvania State University, University Park, PA, USA

11/1996 - 03/2002 MBBS (Bachelor of Medicine and Bachelor of Surgery) M.S.University, Baroda Medical College, India

Membership and Honorary/Professional Societies

Society of Toxicology, U.S.A. Gujarat Medical Council, India.

Publications

Patel RD, Hollingshead BD, Omiecinski CJ, Perdew GH.. Aryl-hydrocarbon receptor activation regulates constitutive androstane receptor levels in murine and human liver.. Hepatology. 2007, Jul; 46(1):209-218.

Patel RD, Kim DJ, Peters JM, Perdew GH.. The aryl hydrocarbon receptor directly regulates expression of the potent mitogen epiregulin.. Toxicological Sciences. 2006, Jan; 89(1):75-82.

Hollingshead BD, Patel RD, Perdew GH.. Endogenous hepatic expression of the hepatitis B virus X-associated protein 2 is adequate for maximal association with aryl hydrocarbon receptor-90- kDa heat shock protein complexes.. Molecular Pharmacology. 2006, Sep; 70(6):2096-2107.

Chiaro CR, Patel RD, Marcus CB, Perdew GH. Evidence for an Ah receptor-mediated cytochrome P450 auto-regulatory pathway.. Molecular Pharmacology. 2007, Nov;72(5):1369-79.

Other Awards/Accomplishments

2006 Research Excellence Award - Society of Toxicology, U.S.A. 2006 2nd prize, Annual Graduate Student Research exhibit, Penn State University. 2005 Research Grant - College of Agricultural Sciences, Penn State University. 2002 – 2004 Life Sciences Consortium Fellowship, Penn State University. 1996 – 1998 Recipient of Baroda Educational Trust scholarship for two consecutive years in Baroda Medical College for securing 2nd (1996-1997) and 1st (1997-1998) ranks respectively. 1994 – 1995 4th rank in Senior- and 5th rank in Junior-Mathematics Olympiad (state level) Gujarat, India.