DOCSLIB.ORG

Mouse Ppp2r3a Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ppp2r3a Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ppp2r3a Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Ppp2r3a conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ppp2r3a gene (NCBI Reference Sequence: NM_001161362 ; Ensembl: ENSMUSG00000043154 ) is located on Mouse chromosome 9. 14 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 14 (Transcript: ENSMUST00000075941). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Ppp2r3a gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-7C4 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 100% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 38099 bp, and the size of intron 2 for 3'-loxP site insertion: 16705 bp. The size of effective cKO region: ~2492 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele A T 5' G gRNA region 3' 1 2 14 Targeting vector A T G Targeted allele A T G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Ppp2r3a Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8992bp) | A(32.2% 2895) | C(18.66% 1678) | T(29.34% 2638) | G(19.81% 1781) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 - 101213373 101216372 3000 browser details YourSeq 133 8 2481 3000 90.4% chr14 - 62740085 63089800 349716 browser details YourSeq 127 8 2500 3000 89.5% chr1 + 80389667 80632391 242725 browser details YourSeq 106 2376 2544 3000 84.0% chr14 + 62781478 62781658 181 browser details YourSeq 103 2377 2541 3000 85.3% chr1 - 185506176 185506351 176 browser details YourSeq 91 2415 2542 3000 87.0% chr9 - 79548541 79548670 130 browser details YourSeq 88 2418 2540 3000 86.2% chr3 + 127730430 127730556 127 browser details YourSeq 86 4 179 3000 90.6% chr8 + 46135039 46135282 244 browser details YourSeq 86 2386 2518 3000 83.8% chr15 + 46543694 46543846 153 browser details YourSeq 81 2418 2541 3000 83.1% chr17 + 26272005 26272132 128 browser details YourSeq 81 2418 2539 3000 83.7% chr1 + 9260074 9260199 126 browser details YourSeq 80 2393 2518 3000 84.7% chrX - 12765440 12765572 133 browser details YourSeq 79 2418 2539 3000 82.8% chr7 - 111900020 111900145 126 browser details YourSeq 79 2389 2519 3000 84.4% chr11 - 61610759 61610895 137 browser details YourSeq 76 2418 2540 3000 89.7% chr7 + 126681120 126681245 126 browser details YourSeq 76 2418 2540 3000 81.4% chr12 + 55917947 55918073 127 browser details YourSeq 74 1 86 3000 93.1% chr12 - 108521942 108522027 86 browser details YourSeq 74 1 86 3000 93.1% chr11 - 62701822 62701907 86 browser details YourSeq 74 2416 2518 3000 86.3% chr1 - 183181709 183181813 105 browser details YourSeq 73 6 86 3000 95.1% chr16 - 22751319 22751399 81 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 - 101207881 101210880 3000 browser details YourSeq 150 145 334 3000 88.8% chr3 - 13561599 13561781 183 browser details YourSeq 149 149 327 3000 94.2% chr16 + 17337987 17338598 612 browser details YourSeq 147 146 334 3000 90.2% chrX + 151714606 151714797 192 browser details YourSeq 147 151 334 3000 88.7% chr15 + 99782399 99782579 181 browser details YourSeq 146 155 335 3000 91.5% chr13 + 100674632 100675052 421 browser details YourSeq 142 143 343 3000 89.6% chr9 - 54512186 54512391 206 browser details YourSeq 141 142 334 3000 89.4% chr15 + 92540182 92540507 326 browser details YourSeq 139 162 334 3000 91.7% chr13 - 5275222 5275401 180 browser details YourSeq 139 153 334 3000 88.9% chr2 + 6011780 6012200 421 browser details YourSeq 139 146 334 3000 90.3% chr15 + 85756096 85778937 22842 browser details YourSeq 138 161 332 3000 91.1% chr17 - 14602741 14602919 179 browser details YourSeq 138 161 334 3000 92.1% chr13 - 54619329 54619513 185 browser details YourSeq 138 163 334 3000 90.7% chr10 - 4352282 4352480 199 browser details YourSeq 137 170 336 3000 91.1% chr17 - 53474688 53474854 167 browser details YourSeq 136 163 327 3000 91.6% chr11 - 87437182 87466692 29511 browser details YourSeq 136 162 334 3000 91.5% chr8 + 67142775 67142957 183 browser details YourSeq 136 166 334 3000 91.0% chr12 + 28540821 28541001 181 browser details YourSeq 135 170 341 3000 91.0% chr2 - 24915374 24915548 175 browser details YourSeq 135 170 334 3000 91.0% chr12 - 111257109 111257273 165 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Ppp2r3a protein phosphatase 2, regulatory subunit B'', alpha [ Mus musculus (house mouse) ] Gene ID: 235542, updated on 12-Aug-2019 Gene summary Official Symbol Ppp2r3a provided by MGI Official Full Name protein phosphatase 2, regulatory subunit B'', alpha provided by MGI Primary source MGI:MGI:2442104 See related Ensembl:ENSMUSG00000043154 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as A730042E07; 3222402P14Rik; C530025M11Rik Expression Broad expression in heart adult (RPKM 13.2), CNS E18 (RPKM 5.5) and 20 other tissues See more Orthologs human all Genomic context Location: 9; 9 E4 See Ppp2r3a in Genome Data Viewer Exon count: 17 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 9 NC_000075.6 (101104989..101251832, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 9 NC_000075.5 (101007319..101154162, complement) Chromosome 9 - NC_000075.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 7 transcripts Gene: Ppp2r3a ENSMUSG00000043154 Description protein phosphatase 2, regulatory subunit B'', alpha [Source:MGI Symbol;Acc:MGI:2442104] Gene Synonyms 3222402P14Rik Location Chromosome 9: 101,105,084-101,251,795 reverse strand. GRCm38:CM001002.2 About this gene This gene has 7 transcripts (splice variants), 208 orthologues, 1 paralogue, is a member of 1 Ensembl protein family and is associated with 14 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ppp2r3a-202 ENSMUST00000075941.11 6786 1150aa ENSMUSP00000075327.5 Protein coding CCDS52900 B2RXC8 TSL:5 GENCODE basic Ppp2r3a-201 ENSMUST00000066773.8 4461 530aa ENSMUSP00000069688.7 Protein coding CCDS52899 G3X9E8 TSL:1 GENCODE basic APPRIS P1 Ppp2r3a-204 ENSMUST00000185735.1 3079 No protein - Retained intron - - TSL:NA Ppp2r3a-206 ENSMUST00000188612.1 2333 No protein - Retained intron - - TSL:1 Ppp2r3a-205 ENSMUST00000185887.1 2227 No protein - Retained intron - - TSL:1 Ppp2r3a-207 ENSMUST00000191226.1 807 No protein - lncRNA - - TSL:1 Ppp2r3a-203 ENSMUST00000185719.1 317 No protein - lncRNA - - TSL:5 Page 6 of 8 https://www.alphaknockout.com 166.71 kb Forward strand 101.10Mb 101.15Mb 101.20Mb 101.25Mb Genes Msl2-202 >protein coding Gm37953-201 >TEC Gm24338-201 >snoRNA (Comprehensive set... Msl2-201 >protein coding Gm37962-201 >TEC Gm37621-201 >TEC Contigs AC242670.3 > < AC120390.12 < AC138288.13 Genes (Comprehensive set... < Ppp2r3a-202protein coding < Ppp2r3a-201protein coding < Ppp2r3a-207lncRNA < Ppp2r3a-203lncRNA < Gm38344-201TEC < Ppp2r3a-206retained intron < Gm37314-201TEC < Ppp2r3a-205retained intron < Ppp2r3a-204retained intron Regulatory Build 101.10Mb 101.15Mb 101.20Mb 101.25Mb Reverse strand 166.71 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000075941 < Ppp2r3a-202protein coding Reverse strand 146.71 kb ENSMUSP00000075... MobiDB lite Low complexity (Seg) Superfamily EF-hand domain pair Pfam PP2A regulatory subunit B'', EF-hand domain EF-hand domain PROSITE profiles EF-hand domain PROSITE patterns EF-Hand 1, calcium-binding site PANTHER PTHR14095:SF3 PTHR14095 Gene3D 1.10.238.230 1.10.238.10 1.10.238.220 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 100 200 300 400 500 600 700 800 900 1000 1150 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Genome-Wide Analysis of 5-Hmc in the Peripheral Blood of Systemic Lupus Erythematosus Patients Using an Hmedip-Chip
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 35: 1467-1479, 2015 Genome-wide analysis of 5-hmC in the peripheral blood of systemic lupus erythematosus patients using an hMeDIP-chip WEIGUO SUI1*, QIUPEI TAN1*, MING YANG1, QIANG YAN1, HUA LIN1, MINGLIN OU1, WEN XUE1, JIEJING CHEN1, TONGXIANG ZOU1, HUANYUN JING1, LI GUO1, CUIHUI CAO1, YUFENG SUN1, ZHENZHEN CUI1 and YONG DAI2 1Guangxi Key Laboratory of Metabolic Diseases Research, Central Laboratory of Guilin 181st Hospital, Guilin, Guangxi 541002; 2Clinical Medical Research Center, the Second Clinical Medical College of Jinan University (Shenzhen People's Hospital), Shenzhen, Guangdong 518020, P.R. China Received July 9, 2014; Accepted February 27, 2015 DOI: 10.3892/ijmm.2015.2149 Abstract. Systemic lupus erythematosus (SLE) is a chronic, Introduction potentially fatal systemic autoimmune disease characterized by the production of autoantibodies against a wide range Systemic lupus erythematosus (SLE) is a typical systemic auto- of self-antigens. To investigate the role of the 5-hmC DNA immune disease, involving diffuse connective tissues (1) and modification with regard to the onset of SLE, we compared is characterized by immune inflammation. SLE has a complex the levels 5-hmC between SLE patients and normal controls. pathogenesis (2), involving genetic, immunologic and envi- Whole blood was obtained from patients, and genomic DNA ronmental factors. Thus, it may result in damage to multiple was extracted. Using the hMeDIP-chip analysis and valida- tissues and organs, especially the kidneys (3). SLE arises from tion by quantitative RT-PCR (RT-qPCR), we identified the a combination of heritable and environmental influences. differentially hydroxymethylated regions that are associated Epigenetics, the study of changes in gene expression with SLE.
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • Uncovering Cancer Gene Regulation by Accurate Regulatory Network Inference from Uninformative Data
    www.nature.com/npjsba ARTICLE OPEN Uncovering cancer gene regulation by accurate regulatory network inference from uninformative data Deniz Seçilmiş 1, Thomas Hillerton1, Daniel Morgan 1, Andreas Tjärnberg 2, Sven Nelander3, Torbjörn E. M. Nordling 4 and ✉ Erik L. L. Sonnhammer 1 The interactions among the components of a living cell that constitute the gene regulatory network (GRN) can be inferred from perturbation-based gene expression data. Such networks are useful for providing mechanistic insights of a biological system. In order to explore the feasibility and quality of GRN inference at a large scale, we used the L1000 data where ~1000 genes have been perturbed and their expression levels have been quantified in 9 cancer cell lines. We found that these datasets have a very low signal-to-noise ratio (SNR) level causing them to be too uninformative to infer accurate GRNs. We developed a gene reduction pipeline in which we eliminate uninformative genes from the system using a selection criterion based on SNR, until reaching an informative subset. The results show that our pipeline can identify an informative subset in an overall uninformative dataset, allowing inference of accurate subset GRNs. The accurate GRNs were functionally characterized and potential novel cancer-related regulatory interactions were identified. npj Systems Biology and Applications (2020) 6:37 ; https://doi.org/10.1038/s41540-020-00154-6 1234567890():,; INTRODUCTION where the main aim is to improve the SNR of the dataset by Living organisms are orchestrated by the biochemical reactions permanently removing the least informative genes and their that occur as a result of the interactions between biomolecules.
    [Show full text]
  • Profiling and Validation of the Circular RNA Repertoire in Adult Murine Hearts
    Accepted Manuscript Profiling and Validation of the Circular RNA Repertoire in Adult Murine Hearts Tobias Jakobi, Lisa F. Czaja-Hasse, Richard Reinhardt, Christoph Dieterich PII: S1672-0229(16)30033-X DOI: http://dx.doi.org/10.1016/j.gpb.2016.02.003 Reference: GPB 200 To appear in: Genomics, Proteomics & Bioinformatics Received Date: 20 November 2015 Revised Date: 19 January 2016 Accepted Date: 15 February 2016 Please cite this article as: T. Jakobi, L.F. Czaja-Hasse, R. Reinhardt, C. Dieterich, Profiling and Validation of the Circular RNA Repertoire in Adult Murine Hearts, Genomics, Proteomics & Bioinformatics (2016), doi: http:// dx.doi.org/10.1016/j.gpb.2016.02.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Profiling and Validation of the Circular RNA Repertoire in Adult Murine Hearts Tobias Jakobi1,2,*,a, Lisa F. Czaja-Hasse3,b , Richard Reinhardt3,c, Christoph Dieterich1,2,d 1Section of Bioinformatics and Systems Cardiology, Department of Internal Medicine III, University Hospital Heidelberg, Heidelberg D-69120, Germany 2 German Centre for Cardiovascular Research (DZHK), partner site Heidelberg / Mannheim, Heidelberg D-69120, Germany 3Max Planck-Genome-Centre Cologne, Cologne D-50829, Germany * Corresponding author. E-mail: [email protected] (Jakobi T).
    [Show full text]
  • Analysis of Gene Expression in Intracranial Aneurysms Jia Wang1,2, Lanbing Yu1, Dong Zhang1, Shuo Wang1 and Jizong Zhao1,2,3,4*
    Wang et al. Chinese Neurosurgical Journal (2017) 3:34 DOI 10.1186/s41016-017-0098-z ˖ӧӝߥ͗ᇷፂܰመߥѫ͗ CHINESE NEUROSURGICAL SOCIETY CHINESE MEDICAL ASSOCIATION RESEARCH Open Access Analysis of gene expression in intracranial aneurysms Jia Wang1,2, Lanbing Yu1, Dong Zhang1, Shuo Wang1 and Jizong Zhao1,2,3,4* Abstract Background: Different gene expression profiles are observed in intracranial aneurysm tissue. Understanding these genes and what regulates their expression will help us to understand intracranial aneurysm pathogenesis. We investigated whether differences in gene expression in intracranial aneurysms. Methods: Sixteen intracranial aneurysm tissues were compared with 16 matched samples from the superficial temporal artery as controls. We detected the gene expression profiles in these samples with the Human U133 Plus 2.0 GeneChip. Results: A total of 2142 differentially expressed gene transcripts were detected based on the gene expression profile. Verification analysis showed that the VCAM1, MAGI2, PPP2R2B, PPP2R3A genes were associated with the occurrence and development of intracranial aneurysm. These genes mainly encode cell adhesion molecules (CAMs) and ERK/JNK signaling pathways. Conclusion: Changes of genes expression involved in immune and inflammatory reactions, cell adhesion molecules may be associated with the development of aneurysms. Keywords: Intracranial aneurysm, Gene expression profile, Microarray analysis Background understanding gene expression and their regulating fac- Intracranial aneurysmal subarachnoid hemorrhage is asso- tors in intracranial aneurysms remains crucial for under- ciated with high mortality and morbidity [1]. The risk fac- standing its pathogenesis. tors for intracranial aneurysms include smoking, drinking, This study selected the tissue of intracranial aneurysm aging, female gender, hypertension, drug abuse, and use of and superficial temporal artery of the same patients as medicinethat can lead to arteriosclerosis and hypertension control group to discuss the mechanism of intracranial [2].
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protein phosphatase 2, regulatory subunit B'', alpha Gene Symbol PPP2R3A Organism Human Gene Summary This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A a catalytic subunit C and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55 B'/PR61 and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms. Gene Aliases PPP2R3, PR130, PR72 RefSeq Accession No. NC_000003.11, NT_005612.16 UniGene ID Hs.518155 Ensembl Gene ID ENSG00000073711 Entrez Gene ID 5523 Assay Information Unique Assay ID qHsaCID0018097 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000264977, ENST00000490467, ENST00000334546, ENST00000492624 Amplicon Context Sequence GGAGAGAAGACAGGATTTGTGACAGCACAGTCATTCATTGCCATGTGGAGAAAG TTGCTGAATAACCATCATGATGATGCCTCTAAATTCATCTGTCTTCTAGCAAAGCC CAACTGCAGCTC Amplicon Length (bp) 92 Chromosome Location 3:135759752-135768169 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 Page 1/5 PrimePCR™Assay Validation Report R2 0.9982 cDNA Cq 22.01 cDNA Tm (Celsius) 79.5 gDNA Cq 42.67 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • Non‑Small‑Cell Lung Cancer Pathological Subtype‑Related Gene
    356 MOLECULAR AND CLINICAL ONCOLOGY 8: 356-361, 2018 Non‑small‑cell lung cancer pathological subtype‑related gene selection and bioinformatics analysis based on gene expression profiles JIANGPENG CHEN1, XIAOQI DONG2, XUN LEI1, YINYIN XIA1, QING ZENG1, PING QUE1, XIAOYAN WEN1, SHAN HU1 and BIN PENG1 1School of Public Health and Management, Chongqing Medical University, Chongqing 400016; 2Department of Respiratory Diseases, The First Affiliated Hospital of Zhejiang University, Hangzhou, Zhejiang 310003, P.R. China Received March 21, 2016; Accepted November 21, 2017 DOI: 10.3892/mco.2017.1516 Abstract. Lung cancer is one of the most common malignant Introduction diseases and a major threat to public health on a global scale. Non-small-cell lung cancer (NSCLC) has a higher degree of Lung cancer is one of the most common malignant diseases malignancy and a lower 5-year survival rate compared with that and a major threat to public health on a global scale. The main of small-cell lung cancer. NSCLC may be mainly divided into types of lung cancer are small-cell lung cancer (SCLC) and non- two pathological subtypes, adenocarcinoma and squamous cell small-cell lung cancer (NSCLC). NSCLC has a higher degree carcinoma. The aim of the present study was to identify disease of malignancy and a lower 5-year survival rate compared with genes based on the gene expression profile and the shortest path SCLC, and may be divided into two major histopathological analysis of weighted functional protein association networks subtypes, namely adenocarcinoma (ADC) and squamous cell with the existing protein-protein interaction data from the Search carcinoma (SCC).
    [Show full text]
  • Protein Phosphatase 2A Regulatory Subunits and Cancer
    Biochimica et Biophysica Acta 1795 (2009) 1–15 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbacan Review Protein phosphatase 2A regulatory subunits and cancer Pieter J.A. Eichhorn 1, Menno P. Creyghton 2, René Bernards ⁎ Division of Molecular Carcinogenesis, Center for Cancer Genomics and Center for Biomedical Genetics, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands article info abstract Article history: The serine/threonine protein phosphatase (PP2A) is a trimeric holoenzyme that plays an integral role in the Received 7 April 2008 regulation of a number of major signaling pathways whose deregulation can contribute to cancer. The Received in revised form 20 May 2008 specificity and activity of PP2A are highly regulated through the interaction of a family of regulatory B Accepted 21 May 2008 subunits with the substrates. Accumulating evidence indicates that PP2A acts as a tumor suppressor. In this Available online 3 June 2008 review we summarize the known effects of specific PP2A holoenzymes and their roles in cancer relevant pathways. In particular we highlight PP2A function in the regulation of MAPK and Wnt signaling. Keywords: Protein phosphatase 2A © 2008 Elsevier B.V. All rights reserved. Signal transduction Cancer Contents 1. Introduction ............................................................... 1 2. PP2A structure and function ....................................................... 2 2.1. The catalytic subunit (PP2Ac).................................................... 2 2.2. The structural subunit (PR65) ................................................... 3 2.3. The regulatory B subunits ..................................................... 3 2.3.1. The B/PR55 family of B subunits .............................................. 3 2.3.2. The B′/PR61 family of β subunits ............................................. 4 2.3.3. The B″/PR72 family of β subunits ............................................
    [Show full text]
  • Cells Phenotype of Human Tolerogenic Dendritic Glycolytic Capacity Represent a Metabolic High Mitochondrial Respiration
    High Mitochondrial Respiration and Glycolytic Capacity Represent a Metabolic Phenotype of Human Tolerogenic Dendritic Cells This information is current as of October 1, 2021. Frano Malinarich, Kaibo Duan, Raudhah Abdull Hamid, Au Bijin, Wu Xue Lin, Michael Poidinger, Anna-Marie Fairhurst and John E. Connolly J Immunol 2015; 194:5174-5186; Prepublished online 27 April 2015; Downloaded from doi: 10.4049/jimmunol.1303316 http://www.jimmunol.org/content/194/11/5174 Supplementary http://www.jimmunol.org/content/suppl/2015/04/25/jimmunol.130331 http://www.jimmunol.org/ Material 6.DCSupplemental References This article cites 35 articles, 12 of which you can access for free at: http://www.jimmunol.org/content/194/11/5174.full#ref-list-1 Why The JI? Submit online. by guest on October 1, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology High Mitochondrial Respiration and Glycolytic Capacity Represent a Metabolic Phenotype of Human Tolerogenic Dendritic Cells Frano Malinarich,*,† Kaibo Duan,† Raudhah Abdull Hamid,*,† Au Bijin,*,† Wu Xue Lin,*,† Michael Poidinger,† Anna-Marie Fairhurst,† and John E.
    [Show full text]
  • Structural Studies on PP2A and Methods in Protein Production
    Structural studies on PP2A and Methods in Protein Production Auður Magnúsdóttir ©Auður Magnúsdóttir, pp.1-53, Stockholm 2008 ISBN 978-91-7155-750-6 Printed in Sweden by Universitetsservice AB, Stockholm 2008 Distributor: Department of Biochemistry and Biophysics, Stock- holm University All previously published papers are reprinted with permission from the publisher To Elski Pelski Abstract PP2A is a major phosphatase in the cell that participates in multiple cell signaling pathways. It is a heterotrimer of a core dimer and variable regulatory subunits. Details of its structure, function and regulation are slowly emerging. Here, the structure of two regulators of PP2A are de- scribed; PTPA and B56γ. PTPA is a highly conserved enzyme that plays a crucial role in PP2A activity but whose biochemical function is still unclear. B56γ is a PP2A regulatory subunit linked to cancer and the structure pre- sented here of B56γ in its free form is particularly valuable in light of the recent structures of the PP2A holoenzyme and core dimer. Protein production is a major bottleneck in structural genomic pro- jects. Here, we describe two novel methods for improved protein produc- tion. The first is a colony based screening method where any DNA library can be screened for soluble expression of recombinant proteins in E.coli. The second method involves improvements of the well established IMAC purification method. We have seen that a low molecular weight component of E.coli lysate decreases the binding capacity of IMAC columns and by removing the low molecular weight components, recombinant proteins only present at low levels in E.coli lysate can be purified, which has previously been believed to be unfeasible.
    [Show full text]