DOCSLIB.ORG

Phosphofructokinase Depend on the Interaction Between

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phosphofructokinase Depend on the Interaction Between Proc. Natl. Acad. Sci. USA Vol. 91, pp. 5242-5246, June 1994 Biochemistry The cooperativity and allosteric inhibition of Escherichia coli phosphofructokinase depend on the interaction between threonine-125 and ATP (phosphoryl transfer/site-directed mutgenesis/enzyme regulation) ISABELLE AUZAT, GIStLE LE BRAS, AND JEAN-RENAUD GAREL* Laboratoire d'Enzymologie du Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette, France Communicated by Robert L. Baldwin, February 14, 1994 ABSTRACT During the reaction catalyzed by the phos- 9), comparing the crystal structures of the R and T states of phofructokinase (EC 2.7.1.11) from Escherichia coli, the phos- PFK does not suggest a structural mechanism for cooper- phoryl group transferred from ATP interacts with Thr-125 ativity. The three-dimensional structure ofunliganded E. coli [Shir a, Y. & Evans, P. R. (1988) J. Mol. Biol. 204, PFK resembles that of the R state (10), indicating that 973-994]. The replacement of Thr-125 by serine changes the cooperativity (as well as activation by ADP or GDP) could saturation by fructose 6-phosphate from cooperative to hyper- involve only this R state. Also, the PFKs from E. coli and bolic and abolishes the allosteric inhibition by phospho- Bacillus stearothermophilus have similar three-dimensional enolpyruvate. The same changes, a saturation by fructose structures, and both undergo a transition from the R to the T 6-phosphate that is no longer cooperative and an activity that state upon binding PEP (5, 6, 11), but the two enzymes have is no longer inhibited by phosphoenolpyruvate, are observed different saturations by Fru-6P: extremely cooperative forE. with wild-type phosphofructokinase when adenosine 5'-[r coli PFK (3) and hyperbolic for B. stearothermophilus PFK thio]triphosphate is used instead of ATP as the phosphoryl (12). These results indicate that the cooperativity of PFK donor. These two perturbations of the ATP-Thr-125 interac- does not seem coupled to the transition between the crys- tion lead to the suppression of both the allosteric inhibition by tallographic R and T states. phosphoenolpyruvate and the cooperativity of fructose-6- In the x-ray structure ofthe R state of PFK with substrates phosphate saturation, as ifreplacing the neutral oxygen ofATP and/or products bound, the phosphoryl group transferred by sulfur or removing the methyl group of Thr-125 had from ATP to Fru-6P interacts with Thr-125 (5, 7, 13). The "locked" phosphofructokinase in its active conformation. The hydroxyl group of Thr-125 is important since the Thr-125 geometry ofthis ATP-Thr-125 interaction and/or the presence Ala mutation decreases the activity of PFK by three orders of the methyl group on the P-carbon of Thr-125 are crucial for of magnitude and abolishes the cooperativity of Fru-6P the regulatory properties of phosphofructokinase. This inter- saturation (13). In this work, we have replaced either Thr-125 action could be a hydrogen bond between the neutral oxygen of by a Ser (Thr-125 -- Ser mutant) or ATP by adenosine the rphosphate of ATP and- the hydroxyl group of Thr-125. 5'-[ythio]triphosphate (ATP[(yS]). The main result is that these two perturbations result in the same changes in the The regulation of many biological processes involves allo- regulatory properties ofE. coli PFK: the saturation by Fru-6P steric interactions between distinct sites of the same protein, is no longer cooperative but is hyperbolic, and the protein no such that ligand binding at one site modifies the functional longer undergoes a transition into the inactive T state upon properties at a distant site. Cooperativity is observed when PEP binding. This suggests that the interaction between positive interactions take place between identical sites (1). Thr-125 and ATP is important for the allosteric behavior of One ofthe "classic" cooperative enzymes is Escherichia coli PFK. The Thr-125 -) Ser mutant of PFK still has a hydroxyl phosphofructokinase (PFK; ATP:D-fructose-6-phosphate group, but the absence of the methyl group on the (3-carbon 1-phosphotransferase, EC 2.7.1.11) (2, 3), which shows a probably affects the interaction with ATP. Similarly, the markedly sigmoidal saturation by its substrate fructose replacement of a single oxygen atom by sulfur in ATP[YS] is 6-phosphate (Fru-6P), with a Hill cooperativity coefficient a "mutation" of the yphosphate that perturbs its interaction close to nH = 4 for four Fru-6P sites (3). This enzyme is also with Thr-125. These results indicate that the side chain of sensitive to allosteric effectors, which bind to a regulatory Thr-125 and its interaction with the noncooperative substrate site remote from the active site; PFK is activated by ADP (or ATP are essential for the coupling between distant sites GDP) and inhibited by phosphoenolpyruvate (PEP) (3). responsible for cooperativity towards Fru-6P and allosteric The steady-state kinetics of E. coli PFK have been inter- inhibition by PEP of E. coli PFK. preted according to the concerted allosteric mechanism (4), in which the protein is in equilibrium between two states, an active R state, which binds Fru-6P and the activator ADP or MATERIALS AND METHODS GDP, and an inactive T state, which binds the inhibitor PEP The oligonucleotide 5'-GTCGATAGAGCCCGGGTA-3' (3). X-ray crystallography shows that PFK exists in two (Bioprobe Systems, Sous BQis, France) with a single mis- different conformations, R with activator and substrate (or match (underlined) was used to replace the ACT codon (Thr) products) bound (5) and T with inhibitor bound (6), which at position 125 by TCT (Ser). Site-directed mutagenesis was provides a structural explanation for the allosteric inhibition performed with the Amersham kit using Pvu I instead of Nci by PEP (6-8). However, in contrast with hemoglobin for contains an Nci I which the differences between the oxy and deoxy states I because the mutagenic oligonucleotide could largely explain the cooperativity of oxygen binding (8, Abbreviations: AMPPCP, adenosine 5'-[3,B,-methylene]triphos- phate; ATP[(yS], adenosine 5'-[ythio]triphosphate; Fru-6P, D-fruc- The publication costs of this article were defrayed in part by page charge tose 6-phosphate; PEP, phosphoenolpyruvate; PFK, phosphofruc- payment. This article must therefore be hereby marked "advertisement" tokinase. in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 5242 Downloaded by guest on September 25, 2021 Biochemistry: Auzat et A Proc. Natl. Acad. Sci. USA 91 (1994) 5243 site. The modified gene was completely sequenced to verify Table 2. Comparison of the enzymatic properties of wild-type the lack of any other alteration. Mutated and wild-type pikA PFK and the Thr-125 -. Ser mutant measured in both the absence genes inserted into the pDR540 tac vector (Pharmacia) were and presence of the allosteric activator GDP at 2 mM expressed after transforming cells of E. coli strain DF1020, Property Wild type Thr-125 Ser which are deleted for both pJk genes (14). Wild-type and mutant PFKs were purified as described (14, Without GDP using a coupled assay (16) in kat, sec-1 120 45 15). PFK activity was measured [Fru-6P]o.s, MM 340 140 a buffer composed of 0.1 M Mes, 0.051 M N-ethylmorpho- Km for ATP, p.M 57 17 line, and 0.051 M diethanolamine at pH 8.2. The ATP- nH 3.9 0.9 regenerating system composed of creatine phosphate and Inhibition by 10 82 <10 creatine kinase was omitted when ATP[yS] was used as mM PEP, % substrate. With 2 mM GDP The same buffer containing 10 mM Mg2e ion was used to kct, sec-1 140 30 measure the changes at 340 nm with excitation at 295 nm in Km for Fru-6P, p.M 41 170 intrinsic fluorescence of PFK upon binding Fru-6P, adeno- Km for ATP, p.M 60 21 sine 5'-[(3, -t-methylene]triphosphate (AMPPCP), or PEP as 0.9 reported (17). nH 1.0 [Fru-6P]o.s, half-saturating Fru-6P concentration. RESULTS AND DISCUSSION ATP (7, 13). The half-saturating Fru-6P concentration in the Fluorescence Measurements of Ligand Binding to the Thr- absence of GDP is not drastically altered by replacement of 125 -& Ser Mutant. Like that of wild-type PFK (17, 18), the Thr-125, with a 2.5-fold decrease for the Thr-125 -+ Ser fluorescence of the Thr-125 -+ Ser mutant changes upon the mutant (Table 2) and a 2.5-fold increase for the Thr-125 -- Ala binding of ligands. The fluorescence is increased by the mutant (13). binding ofAMPPCP (a nonhydrolyzable ATP analog) or PEP The prominent features of the Thr-125 -* Ser (Fig. 1 and and decreased by the binding of Fru-6P (Table 1). Fru-6P Table 2) and Thr-125 -+ Ala (13) mutants are their hyperbolic binding to wild-type PFK is not cooperative as seen from saturations by Fru-6P. The complete absence of cooperativ- equilibrium dialysis (17) and fluorescence (17, 18) measure- ity of the saturation by Fru-6P of the Thr-125 -- Ser mutant ments, and the fluorescence changes of the Thr-125 -> Ser is shown by the value of nH = 0.9 obtained for the cooper- mutant upon binding Fru-6P also show no cooperativity. The ativity coefficient using the Hill equation (Table 2). The mutation Thr-125 -> Ser does not drastically affect the methyl group on the (-carbon that distinguishes wild-type equilibrium constants for the binding of Fru-6P, AMPPCP, and the Thr-125 -) Ser mutant PFKs appears essential for and PEP (Table 1). The absence of cooperativity for Fru-6P cooperativity, even though it contributes only marginally to saturation or of PEP inhibition of the Thr-125 -* Ser mutant substrate binding and catalysis (Tables 1 and 2).
Load more

Recommended publications
  • Galactokinase (B) Glucokinase (C) Galactose-1-Phosphate Uridyltransferase (D) UDP-Galactose 4- Epimerase Sol
    1. Which of the following enzymes are not involved in galactose metabolism? (a) Galactokinase (b) Glucokinase (c) Galactose-1-Phosphate Uridyltransferase (d) UDP-Galactose 4- epimerase Sol. (b) Glucokinase. 2. Which of the following enzymes leads to a glycogen storage disease known as Tarui’s disease? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphofructokinase (d) Phosphoglucomutase Sol. (c) Phosphofructokinase. 3. Which of the following enzymes is defective in galactosemia- a fatal genetic disorder in infants? (a) Glucokinase (b) Galactokinase (c) UDP-Galactose 4- epimerase (d) Galactose-1-Phosphate Uridyltransferase Sol. (d) Galactose-1-Phosphate Uridyltransferase. 4. Which of the following enzyme deficiency leads to hemolytic anaemia? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase. 5. Which of the following glucose transporters are important in fructose transport in the intestine? (a) GLUT5 (b) GLUT3 (c) GLUT4 (d) GLUT7 Sol. (a) GLUT5. 6. Which of the following is a tricarboxylic acid? (a) Acetic acid (b) Succinic acid (c) Oxaloacetic acid (d) Citric acid Sol.(d) Citric acid. 7. Which of the following enzymes plays an important role in tumour metabolism? (a) Glucokinase (b) Pyruvate Kinase M2 (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase M2. 8. Which of the following metabolites negatively regulates pyruvate kinase? 1. (a) Citrate (b) Alanine (c) Acetyl CoA (d) Fructose-1,6-Bisphosphate Sol. (b) Alanine 9. The glycerol phosphate shuttle functions in___________. (a) Lipid catabolism (b) Triglyceride synthesis (c) Anaerobic glycolysis for the regeneration of NAD (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. Sol. (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria.
    [Show full text]
  • Phosphotransferase Activity of Liver Mitochondria (Oxidative Phosphorylation/Adenine Nucleotide Ni-Oxides/Substrate Specificity/In Vivo Phosphorylation) G
    Proc. Nat. Acad. Sci. USA Vol. 71, No. 11, pp. 4630-4634, November 1974 Participation of N1-Oxide Derivatives of Adenine Nucleotides in the Phosphotransferase Activity of Liver Mitochondria (oxidative phosphorylation/adenine nucleotide Ni-oxides/substrate specificity/in vivo phosphorylation) G. JEBELEANU, N. G. TY, H. H. MANTSCH*, 0. BARZU, G. NIACt, AND I. ABRUDAN Department of Biochemistry, Medical and Pharmaceutical Institute, Cluj, * Institute of Chemistry, University of Cluj, Cluj, and t Department of Physical Chemistry, University of Craiova, Craiova, Romania Communicated by Henry Lardy, September 3, 1974 ABSTRACT The modified adenine nucleotides ATP- rivatives of adenine nucleotides once produced become "ac- NO, ADP-NO, and AMP-NO were tested as potential tive" components of the mitochondrial or cellular adenylate substrates and/or inhibitors of mitochondrial phospho- transferases. ADP-NO is not recognized by the translocase pool. membrane; system located in the inner mitochondrial AND METHODS however, it is rapidly phosphorylated to ATP-NO in the MATERIALS outer compartment of mitochondria, by way of the The following commercially available chemicals were used: nucleosidediplhosphate kinase (EC 2.7.4.6) reaction, pro-' de- vitded there is sufficient ATP in the mitochondria. AMP- crystalline bovine serum albumin, glucose-6-phosphate NO is not phosphorylated by liver mitochondria to the hydrogenase (Glc-6-P dehydrogenase; EC 1.1.1.49; BDH corresponding nucleoside diphosphate; it cannot serve as Chemicals, Ltd.), yeast hexokinase (EC 2.7.1.1) (Nutritional substrate for adenylate kinase (EC 2.7.4.3). ATP-NO and Biochemicals, Cleveland), (log muscle lactate dehydrogenase ADP-NO, however, are substrates of this enzyme.
    [Show full text]
  • Pyruvate Kinase: Function, Regulation and Role in Cancer
    Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H
    EUKARYOTIC CELL, Jan. 2006, p. 148–154 Vol. 5, No. 1 1535-9778/06/$08.00ϩ0 doi:10.1128/EC.5.1.148–154.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved. Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H. Slamovits and Patrick J. Keeling* Canadian Institute for Advanced Research, Botany Department, University of British Columbia, 3529-6270 University Boulevard, Vancouver, British Columbia V6T 1Z4, Canada Received 29 September 2005/Accepted 8 November 2005 In pyrophosphate-dependent glycolysis, the ATP/ADP-dependent enzymes phosphofructokinase (PFK) and pyruvate kinase are replaced by the pyrophosphate-dependent PFK and pyruvate phosphate dikinase (PPDK), respectively. This variant of glycolysis is widespread among bacteria, but it also occurs in a few parasitic anaerobic eukaryotes such as Giardia and Entamoeba spp. We sequenced two genes for PPDK from the amitochondriate oxymonad Streblomastix strix and found evidence for PPDK in Trichomonas vaginalis and other parabasalia, where this enzyme was thought to be absent. The Streblomastix and Giardia genes may be related to one another, but those of Entamoeba and perhaps Trichomonas are distinct and more closely related to bacterial homologues. These findings suggest that pyrophosphate-dependent glycolysis is more widespread in eukaryotes than previously thought, enzymes from the pathway coexists with ATP-dependent more often than previously thought and may be spread by lateral transfer of genes for pyrophosphate-dependent enzymes from bacteria. Adaptation to anaerobic metabolism is a complex process (PPDK), respectively (for a comparison of these reactions, see involving changes to many proteins and pathways of critical reference 21).
    [Show full text]
  • Phosphoenolpyruvate-Dependent Phosphotransferase System in Lactobacillus Casei BRUCE M
    JOURNAL OF BACTERIOLOGY, June 1983, p. 1204-1214 Vol. 154, No. 3 0021-9193/83/061204-11$02.00/0 Copyright C 1983, American Society for Microbiology Regulation and Characterization of the Galactose- Phosphoenolpyruvate-Dependent Phosphotransferase System in Lactobacillus casei BRUCE M. CHASSY* AND JOHN THOMPSON Microbiology Section, Laboratory of Microbiology and Immunology, National Institute of Dental Research, Bethesda, Maryland 20205 Received 8 November 1982/Accepted 5 March 1983 Cells ofLactobacillus casei grown in media containing galactose or a metaboliz- able ,-galactoside (lactose, lactulose, or arabinosyl-P-D-galactoside) were in- duced for a galactose-phosphoenolpyruvate-dependent phosphotransferase sys- tem (gal-PTS). This high-affinity system (Km for galactose, 11 ,uM) was inducible in eight strains examined, which were representative of all five subspecies of L. casei. The gal-PTS was also induced in strains defective in glucose- and lactose- phosphoenolpyruvate-dependent phosphotransferase systems during growth on galactose. Galactose 6-phosphate appeared to be the intracellular inducer of the gal-PTS. The gal-PTS was quite specific for D-galactose, and neither glucose, lactose, nor a variety of structural analogs of galactose caused significant inhibition of phosphotransferase system-mediated galactose transport in intact cells. The phosphoenolpyruvate-dependent phosphorylation of galactose in vitro required specific membrane and cytoplasmic components (including enzyme Illgal), which were induced only by growth of the cells on galactose or ,B- galactosides. Extracts prepared from such cells also contained an ATP-dependent galactokinase which converted galactose to galactose 1-phosphate. Our results demonstrate the separate identities of the gal-PTS and the lactose-phosphoenol- pyruvate-dependent phosphotransferase system in L.
    [Show full text]
  • Determination of Hexokinase and Other Enzymes Which Possibly Phosphorylate Fructose in Neurospora Crassa
    Fungal Genetics Reports Volume 8 Article 23 Determination of hexokinase and other enzymes which possibly phosphorylate fructose in Neurospora crassa W. Klingmuller H. G. Truper Follow this and additional works at: https://newprairiepress.org/fgr This work is licensed under a Creative Commons Attribution-Share Alike 4.0 License. Recommended Citation Klingmuller, W., and H.G. Truper (1965) "Determination of hexokinase and other enzymes which possibly phosphorylate fructose in Neurospora crassa," Fungal Genetics Reports: Vol. 8, Article 23. https://doi.org/ 10.4148/1941-4765.2129 This Technical Note is brought to you for free and open access by New Prairie Press. It has been accepted for inclusion in Fungal Genetics Reports by an authorized administrator of New Prairie Press. For more information, please contact [email protected]. Determination of hexokinase and other enzymes which possibly phosphorylate fructose in Neurospora crassa Abstract Determination of hexokinase and other enzymes which possibly phosphorylate fructose in Neurospora crassa This technical note is available in Fungal Genetics Reports: https://newprairiepress.org/fgr/vol8/iss1/23 silky sheen is usually observed when CI suspension of the crystals is agitated; the silky appearance is usually IX)+ present on initial crystallization. It is apparent that an enormous number of variations is possible in carrying out the described procedure. It is therefore of in- terest that each of the twelve systems with which we hove tried this method has allowed crystallization without recourse to changes in pH,temperotwe or other conditions except for the inclusion of a mercaptan where warranted. Ox experience at this time in- cludes dehydrogemses, decarboxylases, transferases and protein hornwnes and involves proteins usucllly sensitive to room tempero- tire, proteins with high and low polysoccharide content and complexes of more than one protein.
    [Show full text]
  • Isozymes of Human Phosphofructokinase
    Proc. Nat{. Acad. Sci. USA Vol. 77, No. 1, pp. 62-66, January 1980 Biochemistry Isozymes of human phosphofructokinase: Identification and subunit structural characterization of a new system (hemolytic anemia/myopathy/in vitro protein hybridization/column chromatography) SHOBHANA VORA*, CAROL SEAMAN*, SUSAN DURHAM*, AND SERGIO PIOMELLI* Division of Pediatric Hematology, New York University School of Medicine, 550 First Avenue, New York, New York 10016 Communicated by Saul Krugman, July 13, 1979 ABSTRACT The existence of a five-membered isozyme The clinical effects of the enzymatic defect consisted of system for human phosphofructokinase (PFK; ATP:D-fructose- gen- 6-phosphate 1-phosphotransferase, EC 2.7.1.11) has been dem- eralized muscle weakness and compensated hemolysis. The onstrated. These multimolecular forms result from the random differential tissue involvement led to the hypothesis that the polymerization of two distinct subunits, M (muscle type) and erythrocyte isozyme is composed of two types of subunits, one L (liver type), to form all possible tetrameters-i.e., M4, M3L, of which is the sole subunit present in muscle PFK (9, 10). The M2L4, ML3, and L4. Partially purified muscle and liver PFKs proposed structural heterogeneity of erythrocyte PFK protein were hybridized by dissociation at low pH and then recombi- was nation at neutrality. Three hybrid species were generated in supported by immunochemical neutralization experiments addition to the two parental isozymes, to yield an entire five- (11, 12). Karadsheh et al. (13) and Kaur and Layzer (14) have membered set. The various species could be consistently and recently presented data to support the suggested hybrid reproducibly separated from one another by DEAE-Sephadex structure for erythrocyte PFK.
    [Show full text]
  • The Phorbol Ester-Dependent Activator of the Mitogen-Activated Protein
    Proc. Nat!. Acad. Sci. USA Vol. 89, pp. 5221-5225, June 1992 Biochemistry The phorbol ester-dependent activator of the mitogen-activated protein kinase p42maPk is a kinase with specificity for the threonine and tyrosine regulatory sites (phosphatase 2A/casein kinase lI/pp6O0) ANTHONY ROSSOMANDOt, JIE WUt§, MICHAEL J. WEBERt, AND THOMAS W. STURGILLt§¶ Departments of :Internal Medicine, tMicrobiology, and §Pharmacology, University of Virginia, Charlottesville, VA 22908 Communicated by Stanley Cohen, March 10, 1992 ABSTRACT Mitogen-activated protein kinases (MAP ki- and peptide mapping studies, which identified the site of nases) are activated by dual tyrosine and threonine phospho- intramolecular tyrosine phosphorylation as Tyr-185, the reg- rylations in response to various stimuli, including phorbol ulatory tyrosine site, and excluded Thr-183 as a site of esters. To define the mechanism of activation, recombinant significant phosphorylation in recombinant p42maPk (ref. 8 wild-type 42-kDa MAP kinase (p42nuaPk) and a kinase-defective and unpublished data). Endogenous phosphorylation and mutant of p42maPk (K52R) were used to assay both activator activation of MAP kinase also occur upon incubation of activity for p42aPk and kinase activity toward K52R in stim- immunoprecipitates of p42maPk/p44maPk from mammalian ulated EL4.112 mouse thymoma cells. Phorbol 12,13- cells together with ATP/Mg (10). However, coprecipitation dibutyrate (10 min, 650 nM) stimulated a single peak of MAP of activating factor(s) cannot be excluded in this case. Thus, kinase activator that was coeluted from Mono Q at pH 7.5 and plausible mechanisms for activation include enhancement of 8.9 with K52R kinase activity. Both activities were inactivated autophosphorylation at one or both sites in addition to by the serine/threonine-specific phosphatase 2A but not by the phosphorylation by a Thr-183 and/or Tyr-185 kinase(s), and tyrosine-specific phosphatase CD45.
    [Show full text]
  • Pyrophosphate-Dependent Enzymes in Walled Bacteria Phylogenetically Related to the Wall-Less Bacteria of the Class Mollicutes?
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Oct. 1989, p. 413419 Vol. 39, No. 4 OO20-7713/89/O4O413-07$02.00/0 Copyright 0 1989, International Union of Microbiological Societies Pyrophosphate-Dependent Enzymes in Walled Bacteria Phylogenetically Related to the Wall-Less Bacteria of the Class Mollicutes? JAMES P. PETZEL,'S PAUL A. HARTMAN,'* AND MILTON J. ALLISON2 Department of Microbiology, Iowa State University, Ames, Iowa 5001 1-321I ,I and National Animal Disease Center, U.S. Department of Agriculture, Ames, Iowa 500102 Some of the wall-less bacteria of the class Mollicutes (mycoplasmas) have pyrophosphate (PP,)-dependent enzymic activities, including PP,-dependent phosphofructokinase (PP,-PFK), PP,-dependent nucleoside kinase, and pyruvate,orthophosphate dikinase (PPDK) activities. In most other bacteria, adenosine 5'-triphosphate (ATP), not PP,, is the cofactor of analogous enzymic reactions. Because PP,-dependent enzymes are more common among mollicutes than other bacteria, we describe here an examination of the six walled bacteria that have been reported to be phylogenetically related to the mollicutes (Clostridium innocuum, Clostridium ramosum, Erysipelothrix rhusiopathiae, Lactobacillus catenaformis, Lactobacillus vitulinus, and Streptococcus pleomorphus) for PP,-PFK, ATP-dependent PFK, phosphoenolpyruvate carboxytransphosphorylase, PPDK, and PP,- and ATP-dependent acetate kinases. Two anaerobic mollicutes, Anaeroplasma intermedium and Asteroleplasma anuerobium, were also tested. C. innocuum, E. rhusiopathiue, S. pleomorphus, and Anuero- plasma intermedium had PPi-PFK activities, whereas C. ramosum, the two lactobacilli, and Asteroleplasma anaerobium had only ATP-dependent PFK activities. Asteroleplasma anaerobium and all of the walled bacteria except E. rhusiopathiue had PPDK activities. All of the species except Asteroleplasma anaerobium and E. rhusiopathiae also had pyruvate kinase activities; the effects of allosteric activators were tested.
    [Show full text]
  • Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J
    Biochemistry 2007, 46, 14845-14853 14845 Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J. Read,| Celia C. H. Chen,§ Aleksandra Tempczyk,§ Min Wei,⊥ Dongmei Ye,⊥ Chun Wu,⊥ Debra Dunaway-Mariano,⊥ and Osnat Herzberg*,§ Center for AdVanced Research in Biotechnology, UniVersity of Maryland Biotechnology Institute, RockVille, Maryland 20850, Department of Haematology, Cambridge Institute for Medical Research, UniVersity of Cambridge, Cambridge, United Kingdom, and Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico ReceiVed September 10, 2007; ReVised Manuscript ReceiVed October 17, 2007 ABSTRACT: Pyruvate phosphate dikinase (PPDK) catalyzes the reversible conversion of phosphoenolpyruvate (PEP), AMP, and Pi to pyruvate and ATP. The enzyme contains two remotely located reaction centers: the nucleotide partial reaction takes place at the N-terminal domain, and the PEP/pyruvate partial reaction takes place at the C-terminal domain. A central domain, tethered to the N- and C-terminal domains by two closely associated linkers, contains a phosphorylatable histidine residue (His455). The molecular architecture suggests a swiveling domain mechanism that shuttles a phosphoryl group between the two reaction centers. In an early structure of PPDK from Clostridium symbiosum, the His445-containing domain (His domain) was positioned close to the nucleotide binding domain and did not contact the PEP/pyruvate- binding domain. Here, we present the crystal structure of a second conformational state of C. symbiosum PPDK with the His domain adjacent to the PEP-binding domain. The structure was obtained by producing a three-residue mutant protein (R219E/E271R/S262D) that introduces repulsion between the His and nucleotide-binding domains but preserves viable interactions with the PEP/pyruvate-binding domain.
    [Show full text]
  • The Transport of Carbohydrates by a Bacterial Phosphotransferase System
    The Transport of Carbohydrates by a Bacterial Phosphotransferase System SAUL ROSEMAN From the McCollum-PrattInstitute and the Department of Biology,Johns Hopkins University, Baltimore, Maryland 21218 ABSTRACT The components and properties of a phosphoenolpyruvate: glu- cose phosphotransferase system are reviewed, along with the evidence implicating this system in sugar transport across bacterial membranes. Some possible physiological implications of sugar transport mediated by the phospho- transferase system are also considered. This paper is concerned with a bacterial phosphotransferase system; its properties, and evidence indicating it to be responsible for sugar transport in bacterial cells will be briefly reviewed, and some speculations will be offered concerning the physiological implications of sugar transport via this system. The discovery of the phosphotransferase system resulted from our long- standing interest in the biosynthesis of carbohydrate containing macro- molecules (1). The 9-carbon sugar acid, sialic acid, is a frequent component of these macromolecules, and enzymatic degradation of one of the sialic acids (N-acetylneuraminic acid) was found to give pyruvate and N-acetyl-D- mannosamine (2). Studies on the metabolism of the latter sugar led to the discovery of a specific kinase that catalyzes the reaction shown in Fig. 1 ; this kinase is widely distributed in animal tissues (3). Since certain bacterial cells synthesize polymers of N-acetylneuraminic acid, or can metabolize N-acetyl- D-mannosamine, extracts of these cells were examined for the kinase. The sugar was not phosphorylated by the reaction shown in Fig. 1, but it was phosphorylated when phosphoenolpyruvate (PEP) was substituted for ATP. The bacterial system, designated PEP:glycose phosphotransferase system, or simply phosphotransferase system, was found to catalyze the reaction shown in Fig.
    [Show full text]