Elevated CO2 enhances carbohydrate assimilation at flowering stage and seed yield in chickpea (Cicer arietinum)

Puja Rai, Ashish K. Chaturvedi, Divya Shah, C. Viswanathan & Madan Pal

Indian Journal of Plant Physiology An International Journal of Plant Physiology

ISSN 0019-5502

Ind J Plant Physiol. DOI 10.1007/s40502-016-0209-4

1 23 Your article is protected by copyright and all rights are held exclusively by Indian Society for Plant Physiology. This e-offprint is for personal use only and shall not be self- archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23 Author's personal copy

Ind J Plant Physiol. DOI 10.1007/s40502-016-0209-4

ORIGINAL ARTICLE

Elevated CO2 enhances carbohydrate assimilation at flowering stage and seed yield in chickpea (Cicer arietinum)

1 1 1 1 Puja Rai • Ashish K. Chaturvedi • Divya Shah • C. Viswanathan • Madan Pal1

Received: 22 September 2015 / Accepted: 28 January 2016 Ó Indian Society for Plant Physiology 2016

Abstract Rising atmospheric CO2 concentration can Introduction stimulate plant growth through enhanced photosynthesis and carbohydrate assimilation. A study was planned to Increasing CO2 is one of the important climate change analyse the effects of elevated CO2 (eCO2) factor, which has contributed significantly to global (570 ± 45 lmol mol-1) on photosynthesis, carbohydrate warming. It has increased linearly since pre-industrial assimilation and photorespiratory enzymes and their gene period and reached to the current level of 400 lmol mol-1 expression in desi (Pusa 1103) and kabuli (Pusa 1105) (IPCC 2014). Plants can cope up with high atmospheric chickpea genotypes. The findings showed higher rate of CO2 through its better utilization in the process of photo- photosynthesis in both desi and kabuli chickpea genotypes synthetic carbon assimilation and producing higher bio- under elevated CO2 and was accompanied with increased mass (Jaggard et al. 2010). Various studies on response to starch and sugar concentration and rubisco activity. elevated CO2 (eCO2) have confirmed that C3 crops can Expression of rbcS and rbcL genes was higher under ele- perform better in terms of enhanced growth and produc- vated CO2 during flowering stage but non-significant tivity under high CO2 environment (Ainsworth et al. 2008; changes occurred in expression at podding stage. Shoot Kumar et al. 2012; Wang et al. 2013). Enhanced rate of biomass and seed yield was significantly higher in both photosynthesis, improved plant growth and yield are the chickpea genotypes under eCO2. Glycolate oxidase activity well known changes in high CO2 grown plants (Pal et al. decreased under eCO2 and the reduction was greater in desi 2012; Chen and Setter 2012; Kant et al. 2012) which compared to kabuli genotype, suggesting suppressed pho- depends on capacity of plants to utilize extra C assimilates torespiration in both the chickpea genotypes. The finding of and sink availability (Aranjuelo et al. 2011, 2013). this study concludes that chickpea crop can perform better As compared with C4,C3 plants perform better under under eCO2 environment due to increased rate of photo- eCO2 due to increased rubisco carboxylation efficiency and synthesis and suppressed photorespiration. Between two suppression of photorespiration. Rubisco has affinity for types of chickpea, desi may respond better to eCO2 owing both CO2 and O2; a considerable amount of energy is to its higher sink potential than kabuli types. wasted through photorespiratory carbon cycle, at ambient

CO2 concentration (Sharkey 1988). The carbon losses Keywords Elevated CO2 Á Photosynthesis Á Rubisco Á through photorespiratory carbon oxidation (PCO) have Glycolate oxidase Á Cicer arietinum been reported around 40 % (Kant et al. 2012). High atmospheric CO2 in the atmosphere can suppresses pho- torespiration and help the plants to save photosynthetic & Ashish K. Chaturvedi carbon loss through PCO. Legumes have sink capacity and [email protected] potential to respond to eCO2 owing to their large carbon & Madan Pal demand for nodulation and biological N2 fixation processes [email protected] (Rogers et al. 2009). Ainsworth et al. (2002) have reported 1 Division of Plant Physiology, Indian Agricultural Research enhanced photosynthesis and higher productivity in Institute, New Delhi 110012, India legumes compared to non-legumes under eCO2. 123 Author's personal copy

Ind J Plant Physiol.

Chickpea (Cicer arietinum L.) is an important legume system (Li-6400, LI-COR, USA) during 9:30–11:30 h of crop in South Asia, and ranks second among the world’s the day. For each plant three different fully expanded upper food legumes in terms of area (FAO 2007). There are two leaflets were selected for measurement at flowering and types of chickpea: (1) the small-seeded desi chickpea with podding stage in both the genotypes. CO2 concentration in a dark and thick seed coat, and (2) the large-seeded kabuli leaf chamber was controlled with the LI-COR CO2 injec- chickpea with a light-coloured and thin seed coat. As tion system and a saturating photosynthetic photon flux compared to cereal crops and other legumes, the informa- density (PPFD) of 1200 lmol m-2 s-1 was supplied from tion regarding growth, photosynthesis and photorespiratory LED light source. process in chickpea in respect of their enzymes activity and gene expression under elevated CO2 is very scanty (Pal Biochemical estimations and enzyme assays et al. 2008). Since flower and pod drop are major con- straints in chickpea due to limited carbohydrate supply. We Fully expanded upper leaves were taken and frozen in hypothesized that in cereals enhanced photosynthesis and liquid nitrogen for sugar, starch and enzyme assay and gene carbon assimilation under elevated CO2 may limit above expression studies. For sugar and starch analysis leaves constraints. So, we planned to analyse the effects of eCO2 were immediately plunged in 95 % ethanol and preserved on carbohydrate supply, photosynthesis, photorespiration, for subsequent analysis. Leaf sample (0.5 g) preserved in and the activity and gene expression of rubisco and gly- 95 % ethanol was boiled for sugar extraction. Extract was colate oxidase (GO), growth and seed yield in desi and used for the sugar determination following Nelson’s Kabuli chickpea genotypes. arsenomolybdate (Nelson 1944) and improved copper reagent of Somogyi (1952) methods. Starch was extracted in residual samples using perchloric acid and refluxing by Materials and methods isopropanol (80 %), and estimated according to Anthrone method of Hodge and Hofreiter (1962).

Plant material and CO2 treatment For rubisco enzyme assay frozen leaf samples (100 mg) were homogenized in 2 ml of extraction buffer (50 mM

The experiment was carried out during the winter (rabi) Tris–HCl, 5 mM MgCl2, 10 mM DTT, pH 8.0) and season of 2011–2012 at Indian Agricultural Research homogenate was centrifuged at 25,000 g for 5 min at 4 °C Institute, New Delhi, India (28°350N latitude, 77°120E and supernatant was used for enzyme assay. Activity was longitude and 228.16 m above mean sea level). Seeds of measured in assay medium containing Tris–HCl chickpea (Cicer arietinum L.) genotypes, viz., Pusa 1103 (100 mM), DTT (5 mM), BSA (0.2 %, w/v), MgCl2 14 (desi) and Pusa 1105 (kabuli) were sown in soil inside (40 mM), NaH CO3 (20 mM), and RuBP (2.5 mM) in a Open Top Chamber (OTC) by maintaining row-to-row and 6-ml stoppered plastic vial. The vials were shaken and plant-to-plant distance of 30 and 10 cm, respectively. All incubated at 25 °C for 5 min and enzyme activity was recommended agronomic practices were followed and initiated by adding RUBP and incubated for 5 min at 25 °C irrigation was given as and when required to maintain with shaking. After incubation, vials were dried overnight moisture level at field capacity and avoid any moisture at 60 °C. Acid-sTable14C was determined by scintillation deficit stress. counting (Servaites and Torisky 1984).

Plants were exposed to elevated CO2 (eCO2) level of For GO assay 0.05 g frozen leaves were homogenized 570 ± 45 lmol mol-1 inside OTCs, as designed by Pal and extracted in cold potassium phosphate buffer (0.05 M, et al. (2004). During the entire experimental period, tem- pH 8.0). The homogenate was centrifuged at 4 °C and perature and humidity inside all OTCs were recorded 14,000g and used for assay. Assay medium consist of continuously with the help of sensors as described by Saha 100 ll potassium phosphate buffer (0.05 M, pH 8.0), et al. (2011). Elevated CO2 exposure was started after the 100 ll cold 1.6 % phenylhydrazine-hydrochloride, 100 ll emergence of the crop and continued till crop maturity freshly prepared FMN, 100 ll of enzyme extract and from 6:00 AM to 6:00 PM daily. For chamber control, double distilled water to make the final volume of 1.5 ml. -1 ambient CO2 (aCO2) (384 ± 30 lmol mol ) only pure air The sample tubes were incubated at 30 °C for 10 min using was injected instead of CO2–air mixture. There were three water bath shaker and 50 ll glycolic acid (0.1 M) was OTCs for control and high CO2 exposure each. added in each tube and incubated at room temperature for 20 min. The reaction was stopped using 500 ll HCl Leaf gas exchange (12 N). Potassium ferricyanide (100 ll, 8 %) was added to induce colour of glyoxylate phenylhydrazone and activity

Measurement of net CO2 assimilation rate was made on was assayed by recoding absorbance at 324 nm (Zelitch three plants per treatment using portable photosynthesis et al. 2009). 123 Author's personal copy

Ind J Plant Physiol.

Quantitative real-time PCR was used for calculation of relative expression as described by Yuan et al. (2006). cDNA sequences of GO genes of Pisumsativum, Phaseolus vulgaris, Medicagotruncatula, Vignaunguiculata and Gly- Statistical analysis cine max were downloaded from National Centre for Biotechnology Information (NCBI) and aligned using Experiment was conducted in completely randomized

ClustalW. Primer sequences (Table 1) were selected design with three replicates each for aCO2 and eCO2. The manually from the conserved regions of all five legumes, data were statistically verified with analysis of variation and the oligonucleotide properties were analyzed by using (ANOVA) and the significance of differences between the oligoanalyzer 3.1 software (http://www.idtdna.com/analy means was tested using Duncan’s post hoc test at the sig- zer/Applications/OligoAnalyzer/). GO cDNA was cloned nificance level P B 0.05 using SPSS v.10 for Windows into pGEM-T Easy vector (Promega) and sequenced from (SPSS Inc., Chicago, USA). both the genotypes. Sequences were submitted to NCBI (Accession No. JN009800 and JN009801). Based on these sequences, gene specific primers were designed for qRT- Results and discussion PCR analysis (Table 1). Nucleotide sequences of Chickpea for rubisco (rbcL and rbcS) were downloaded from NCBI High atmospheric CO2 concentration can enhance rate of and real-timePCR analysis was performed to investigate photosynthesis (PN) and carbon supply in C3 plants and the expression pattern of go and rubisco (rbcLand rbcS) increases their growth and productivity (Ainsworth et al. mRNA transcripts at flowering and podding stages under 2008; Rogers et al. 2009, Pal et al. 2012; Chen and Setter elevated CO2 (eCO2). Total RNA was extracted from leaf 2012). It can suppress PCO and saves carbon loss samples using the RNeasy Plant mini kit (Qiagen, Ger- (Aranjuelo et al. 2011). In the present study, two desi and many). First-strand cDNA synthesis was performed using kabuli chickpea genotypes were exposed to elevated CO2 2 lg RNA with MaximaÒ First Strand cDNA Synthesis Kit to study their photosynthetic responses. Both the geno- for Q-PCR (Fermentas). qRT-PCR was performed using types showed significantly enhanced rate of photosyn- TM Mx3005P sequence detection system and software thesis (PN) and the response differed at flowering and (Stratagene, USA). Each RT-PCR reaction was set up in podding stages (Fig. 1). PN increased at both flowering 25-ll total volumes, containing 12.5 ll SYBR Green and podding stages and the enhancement was more in Master Mix (Fermentas), 10 pmol of primers and B500 ng desi chickpea (56 % at flowering and 39 % at podding) of cDNA sample. The RT-PCR reactions were carried out compared to kabuli (33 % at flowering and 28 % at with the following cycling parameters: 2 min at 50 °C, podding). Such an increase in PN during flowering and 10 min at 95 °C, and 40 cycles of 15 s at 95 °C and 30 s at podding stages shows availability of potential sink in both

55 °C and extension at 72 °C for 30 s. The relative mRNA chickpea genotypes. Similar increase in PN due to eCO2 levels for each gene were computed with respect to the treatment has been reported in wheat (Tausz-Posch et al. internal standard, GAPDH (Glyceraldehyde-3-phosphate 2013; Biswas et al. 2013), soybean (Locke et al. 2013; dehydrogenase), to normalize for variance in the quality of Hao et al. 2012), barley (Wang et al. 2013), oat (Bhatt RNA and the amount of input cDNA. The DDCt method et al. 2010) and rice (Pal et al. 2012).

Table 1 Primer sequences for cloning and Real time PCR expression analysis of glycolate oxidase and rubisco Gene Primer sequence (50–30) Amplicon size (bp)

Primer to clone glycolate oxidase Glycolate oxidase gox-F: GAGGATCAGTGGACTCTGCAAGA 815 gox-R: CACCTAGTGCCAATGCCTTGAAGA qRT-PCR primers Glycolate oxidase gox-F: 50 GGACCAAGCTAATGACTCTGGACT-30 124 gox-R: 50-GACACCCTTGACAAGAATTGGCAG-30 Rubisco-1,5-bis phosphate carboxylase/oxygenase-large sub unit rbcL-F: 50-CCAATTCGGTGGAGGAACTTTAGG-30 113 rbcL-R: 50-CAAGATCACGTCCCTCATTACGAG-30 Rubisco-1,5-bis phosphate carboxylase/oxygenase-small sub unit rbcS F: 50-TACCTTCCACCATTGACTGAAGAG-30 126 rbcS R: 50-TGAGTTGTTGTGCTCACGGTACAC-30

123 Author's personal copy

Ind J Plant Physiol.

Fig. 1 Effect of elevated CO2 exposure on photosynthetic rate -2 -1 (lmol CO2 m s )in chickpea genotypes at flowering and podding stages. Data shown are mean ± SE. Values that do not share common letters are significantly different by Duncan’s post hoc test at P B 0.05

Fig. 2 Effect of elevated CO2 exposure on total sugars (A) and starch concentration (B) of chickpea genotypes at flowering and podding stages. Data shown are mean ± SE. Values that do not share common letters are significantly different by Duncan’s post hoc test at P B 0.05 123 Author's personal copy

Ind J Plant Physiol.

Fig. 3 Effect of elevated CO2 exposure on rubsico (A) and glycolate that do not share common letters are significantly different by oxidase (B) activity in the leaf tissues of chickpea genotypes at Duncan’s post hoc test at P B 0.05 flowering and podding stages. Data shown are mean ± SE. Values

Our finding showed that higher rate of photosynthesis comparison to starch, increase in sugar concentration was was accompanied by increase in sugar and starch content more at both the stages. Similar changes in carbohydrates

(Fig. 2) in both the genotypes. Increase in PN under eCO2 concentration under eCO2 has been reported in chickpea resulted in increase in carbohydrates in the leaves to sup- (Pal et al. 2008) and mungbean (Pandurangam et al. 2006). port the growth of chickpea. Between two genotypes, desi Accumulation of more sugars compared to starch in the type showed 42 % increase in concentration of total sugars leaves under eCO2 may result in down regulation of PN under eCO2 over aCO2, while in kabuli the increase was (Pandurangam et al. 2006); however, in this study con- 32 % (over aCO2) at flowering stage. On the other hand, at centration of both carbohydrates was similar. podding stage, the increase in concentration of total sugars The process of photosynthesis and photorespiration are under eCO2 was 22 and 26 % over aCO2 in kabuli and desi mediated through rubisco in C3 plants, and high atmospheric types, respectively (Fig. 2A). Similarly, starch concentra- CO2 promote photosynthetic carbon reduction over PCO tion increased significantly under eCO2 treatment in both (Long 1994). Elevated CO2 exposure enhanced rubisco the genotypes at above growth stages (Fig. 2B). The activity in both the genotypes and the enhancement was increase in starch concentration was more in Pusa 1103 greater in desi chickpea (17 % over aCO2) at flowering stage, (30 % at flowering and 24 % at podding) compared to Pusa while there was 8 % increase in rubisco activity of kabuli

1105 (26 % at flowering and 23 % at podding). In chickpea at flowering in eCO2 exposed plants. However, at

123 Author's personal copy

Ind J Plant Physiol.

Fig. 4 Effect of elevated CO2 exposure on relative transcript level of glycolate oxidase (go), and large (rbcL) and small (rbcS) sub-units of rubisco in leaf tissues of chickpea genotypes at flowering and podding stages. Data shown are fold changes under eCO2 over aCO2 podding stage, there were non-significant changes in rubsico more in desi compared to kabuli type during flowering activity in both the genotypes under eCO2 exposure stage (Fig. 4). Repression of photosynthetic genes has been (Fig. 3A). Similar enhancement in rubisco activity has been reported in eCO2 grown plants, which vary between intra reported in wheat cultivars in response to eCO2 (Biswas et al. and inter species (Moore et al. 1998). Similar increase in 2013). Elevated CO2 resulted in reduced GO activity in both transcript level of rbcS and rbcL has also been reported in the genotypes at flowering and podding stages. Between the cucumber under eCO2 (Jiang et al. 2012). Many studies two genotypes the reduction in GO activity in desi type was have suggested reduction in expression level and rubisco greater at both the stages (33 and 25 % at flowering and protein content due to feed back inhibition or photosyn- podding stages, respectively), while in kabuli, the reduction thetic acclimation and sugars accumulation (Ghildiyal et al. was lower than desi type and the magnitude of reduction was 2001; Pandurangam et al. 2006). Cheng et al. (1998) have almost similar at both the stages (15–16 % over aCO2) suggested that plant growth under eCO2 can result in a (Fig. 3B). Activity of GO, which is involved in oxidation of differential repression of rubisco genes in a species. In our glycolate in peroxisome, reflects changes in photorespiration study, there was correlation in enhancement of photosyn- (PCO) (Ogren 1984). In this study, we observed reduction in thesis and rubisco activity with expression of rbcS and

GO activity in both the chickpea genotypes grown under rbcL under eCO2 during flowering stage, and it was greater eCO2 environment, confirming suppression of the process of for desi chickpea genotype (Pusa 1103). Similar response photorespiration due to high CO2/O2 ratio at the site of between PN and rubisco or rbcS and rbcL expression under rubisco. Booker et al. (1997) have reported reduction in GO eCO2 in different crop species has been reported by Kant activity under eCO2 in soybean as a measure of suppressed et al. (2012) and Seneweera et al. (2011). photorespiration. Both the genotypes showed positive relationship Expression level of large (rbcL) and small subunits between photosynthesis, seed yield and shoot biomass

(rbcS) of rubisco was more at flowering stage in both under eCO2. However, the relationship of photosynthesis chickpea genotypes under eCO2. rbcL transcript levels with grain yield was stronger for desi (Pusa 1103) increased by [1.5-fold in desi and B1.5 in kabuli type at (r2 = 0.84) compared to kabuli type (Pusa 1105) 2 flowering stage under eCO2 (Fig. 4). At podding stage (r = 0.59) (Fig. 5A), while the relationship of photosyn- there was a significant increase in the rbcS transcript level, thesis with shoot biomass was stronger for Pusa 1105 while rbcL transcript level showed non-significant changes (r2 = 0.74) compared to Pusa 1103 (r2 = 0.63) (Fig. 5B), in both the genotypes (Fig. 4). go transcript level changed which suggests that kabuli type (Pusa 1105) responded significantly under eCO2 in both the genotypes during better in terms of vegetative growth and produced more flowering and podding stages, however the increase was shoot dry weight but desi type (Pusa 1103) showed better

123 Author's personal copy

Ind J Plant Physiol.

Fig. 5 Relationship of leaf photosynthesis with seed weight (A) and shoot biomass (B) of chickpea genotypes Pusa 1103 and Pusa 1105 exposed to elevated CO2. Solid symbols are values from plants grown at aCO2 and open symbols are values from plants grown at eCO2 translocation to sink, resulting in increase in seed yield References under eCO2 environment. Similar growth and yield responses to eCO2 have also been shown in other crop Ainsworth, E. A., Davey, P. A., & Bernacchi, C. J. (2002). A meta species (Wang et al. 2013). analysis of elevated (CO2) effects on soybean (Glycine max) physiology, growth and yield. Global Change Biology, 8, The findings of this study conclude that elevated CO2 695–709. can improve growth and seed yield in chickpea crop Ainsworth, E. A., Leakey, A. D. B., Ort, D. R., & Long, S. P. (2008). through increased rate of photosynthesis and suppression of FACE-ing the facts: inconsistencies and interdependence among photo-respiratory carbon-losses. Between the two types of field, chamber and modeling studies of elevated [CO2] impacts on crop yield and food supply. New Phytologist, 179, 5–9. chickpea, desi can perform better owing to its high sink Aranjuelo, I., Cabrera-Bosquet, L., Morcuende, R., Avice, J. C., potential in terms of production of more number of pods Nogue´s, S., Araus, J. L., et al. (2011). Does ear C sink strength than kabuli type. contribute to overcoming photosynthetic acclimation of wheat plants exposed to elevated CO2? Journal of Experimental Botany, 62, 3957–3969. Acknowledgments The authors acknowledge Indian Council of Aranjuelo, I., Sanz-Sa´ez, A´ ., Ja´uregui, I., Irigoyen, J. J., Araus, J. L., Agricultural Research (ICAR) for providing financial grant under Sa´nchez-Dı´az, M., & Erice, G. (2013). Harvest index, a National Initiative on Climate Resilient Agriculture (NICRA) project.

123 Author's personal copy

Ind J Plant Physiol.

parameter conditioning responsiveness of wheat plants to Long, S. P. (1994). The potential effects of concurrent increases in elevated CO2. Journal of Experimental Botany, 64, 1879–1892. temperature, CO2 and O3 on net photosynthesis, as mediated by Bhatt, R. K., Baig, M. J., & Tiwari, H. S. (2010). Elevated CO2 Rubisco. In R. G. Alscher & A. R. Wellburn (Eds.), Plant influences photosynthetic characteristics of Avena sativa L. response to the gaseous environment (pp. 21–38). London: cultivars. Journal of Environmental Biology, 31, 813–818. Chapman and Hall. Biswas, D. K., Xu, H., Li, Y. G., Ma, B. L., & Jiang, G. M. (2013). Moore, B. D., Cheng, S. H., Rice, J., & Seemann, J. R. (1998). Modification of photosynthesis and growth responses to elevated Sucrose cycling, Rubisco expression, and prediction of photo- CO2 by ozone in two cultivars of winter wheat with different years synthetic acclimation to elevated atmospheric CO2. Plant Cell of release. Journal of Experimental Botany, 64, 1485–1496. Environment, 21, 905–915. Booker, F. L., Reid, C. D., Harti-Brunschon, S., Fiscus, E. L., & Nelson, N. (1944). A photometric adaptation of the Somogyi method Miller, J. E. (1997). Photosynthesis and photorespiration in for the determination of glucose. The Journal of Biological soybean [Glycine max (L.) Merr.] chronically exposed to Chemistry, 153, 375–380. elevated carbon dioxide and ozone. Journal of Experimental Ogren, W. L. (1984). Photorespiration: Pathways, regulation, and Botany, 48, 1843–1852. modification. Annual Review of Plant Biology, 35, 415–442. Chen, C., & Setter, T. L. (2012). Response of potato dry matter Pal, M., Jagadish, S. V. K., Craufard, P. Q., Fitzgerald, M., Lafarge, assimilation and partitioning to elevated CO2 at various stages of T., & Wheeler, T. R. (2012). Effect of elevated CO2 and high tuber initiation and growth. Environmental Experimental Botany, temperature on seed set and grain quality of rice. Journal of 80, 27–34. Experimental Botany, 63, 3843–3852. Cheng, S. H., Moore, B., & Seemann, J. R. (1998). Effects of short- Pal, M., Pandian, V. K., Jain, V., Srivastava, A. C., Raj, A., & and long-term elevated CO2 on the expression of ribulose-1,5- Sengupta, U. K. (2004). Biomass production and nutritional bisphosphate carboxylase/oxygenase genes and carbohydrate levels of berseem (Trifolium alexandrium) grown under elevated accumulation in leaves of Arabidopsis thaliana (L.) Heynh. CO2. Agriculture, Ecosystem & Environment, 101, 31–38. Plant Physiology, 116, 715–723. Pal, M., Talwar, S., Deshmukh, P. S., Vishwanathan, C., Khetarpal, Food and Agricultural Organization of the United Nations. (2007). S., Kumar, P., & Lutheria, D. (2008). Growth and yield of FAO Statistical Yearbook (Vol. 1 and 2). http://www.fao.org/ chickpea genotypes under elevated carbon dioxide concentra- statistics/yearbook/vol_1_1/index.asp tion. Indian Journal of Plant Physiology, 13, 367–374. Ghildiyal, M. C., Rafique, S., & Sharma-Natu, P. (2001). Photosynthetic Pandurangam, V., Sharama-Natu, P., Sreekanth, B., & Ghildiyal, M. acclimation to elevated CO2 in relation to leaf saccharide C. (2006). Photosynthetic acclimation to elevated CO2 in constituents in wheat and sunflower. Photosynthetica, 39, 447–452. relation to Rubisco gene expression in three C3 species. Journal Hao, X. Y., Han, X., Lam, S. K., Wheeler, T., Ju, H., Wang, H. R., of Experimental Biology, 44, 408–415. et al. (2012). Effects of fully open-air [CO2] elevation on leaf Rogers, A., Ainsworth, E. A., & Leakey, A. D. B. (2009). Will ultrastructure, photosynthesis, and yield of two soybean culti- elevated carbon dioxide concentration amplify the benefits of vars. Photosynthetica, 50, 362–370. nitrogen fixation in legumes? Plant Physiology, 151, 1009–1016. Hodge, J. E., & Hofreiter, B. T. (1962). Analysis and preparation of Saha, S., Chakraborty, D., Pal, M., & Nagrajan, S. (2011). sugars. In: Whistler, R.L., & Miller, J.N.B. (Eds.), Methods in Impact of elevated CO2 on utilization of soil moisture and carbohydrate chemistry (6th ed., pp. 356–378). New York: associated soil biophysical parameters in pigeon pea (Cajanus- Academic Press. cajan L.). Agriculture, Ecosystem & Environment, 142, IPCC. (2014). Summary for Policymakers. In C. B. Field, V. 213–221. R. Barros, D. J. Dokken, K. J. Mach, M. D. Mastrandrea, T. Seneweera, S., Makino, A., Hirotsu, N., & Norton, S. Y. (2011). New E. Bilir, M. Chatterjee, K. L. Ebi, Y. O. Estrada, R. C. Genova, insight into photosynthetic acclimation to elevated CO2: The role B. Girma, E. S. Kissel, A. N. Levy, S. MacCracken, P. of leaf nitrogen and ribulose-1,5-bisphosphate carboxylase/oxy- R. Mastrandrea & L. L. White (Eds.) Climate change 2014: genase content in rice Leaves. Environmental Experimental Impacts, adaptation, and vulnerability. Part A: Global and Botany, 71, 128–136. sectoral aspects. Contribution of Working Group II to the fifth Servaites, J. C., & Torisky, R. S. (1984). Activation state of ribulose assessment report of the intergovernmental panel on climate bisphosphate carboxylase in soybean leaves. Plant Physiology, change (pp. 1–32). Cambridge: Cambridge University Press. 74, 681–686. Jaggard, K. W., Qi, A., & Ober, E. S. (2010). Possible changes to Sharkey, T. D. (1988). Estimating the rate of photorespiration in arable crop yields by 2050. Philadelphia Transaction of Royal leaves. Physiologia Plantarum, 73, 147–152. Society B, 365, 2835–2851. Somogyi, M. (1952). Notes on sugar determination. The Journal of Jiang, Yu-Ping, Cheng, F., Zhou, Yan-Hong, Xiao-Jian, Xia, Shi, K., Biological Chemistry, 195, 19–23. & Yu, J. Q. (2012). Interactive effects of CO2 enrichment and Tausz-Posch, S., Borowiak, K., Dempsey, R. W., Norton, R. M., brassinosteroid on CO2 assimilation and photosynthetic electron Seneweera, S., Fitzgeral, G. J., & Tausz, M. (2013). The effect of transport in Cucumis sativus. Environmental Experimental elevated CO2 on photochemistry and antioxidative defence capacity Botany, 75, 98–106. in wheat depends on environmental growing conditions—A FACE Kant, S., Seneweera, S., Rodin, J., Materne, M., Burch, D., Rothstein, S. study. Environmental Experimental Botany, 88,81–92. J., & Spangenberg, G. (2012). Improving yield potential in crops Wang, L., Pedas, P., Eriksson, D., & Schjoerring, J. K. (2013). under elevated CO2: Integrating the photosynthetic and nitrogen Elevated atmospheric CO2 decreases the ammonia compensation utilization efficiencies. Frontiers in Plant Science, 3, 1–9. point of barley plants. Journal of Experimental Botany, 64, Kumar, P., Rai, P., Chaturvedi, A. K., Khetarpal, S., & Pal, M. (2012). 2713–2724. High atmospheric CO2 delays leaf senescence and crop maturity Yuan, J. S., Reed, A., Chen, F., & Stewart Jr, C.N. (2006). Statistical in chickpea (Cicer arietinum L.). Indian Journal of Plant analysis of real-time PCR data. BMC Bioinformatics, 7, 85. Physiology, 17, 254–258. Zelitch, I., Neil, P., Richard, B. S., Brown, P. P., & Brutnell, T. P. Locke, A. M., Sack, L., Bernacchi, C. J., & Ort, D. R. (2013). (2009). High glycolate oxidase activity is required for survival of Soybean leaf hydraulic conductance does not acclimate to maize in normal air. Plant Physiology, 149, 195–204. growth at elevated [CO2] or temperature in growth chambers or in the field. Annals of Botany, 112, 911–918.

123