Light Influences Pigment, Biomass and Morphology in Chaetomium Cupreum - SS02 - a Photoresponse Study

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

ISSN: 2319-7706 Volume 3 Number 4 (2014) pp. 53-64 http://www.ijcmas.com

Original Research Article Light influences Pigment, Biomass and Morphology in Chaetomium cupreum - SS02 - A Photoresponse Study

K.Soumya, L.Swathi, G.L.Sreelatha and T.Sharmila*

Department of Microbiology and Biotechnology, Jnanbharthi Campus, Bangalore University, Bangalore 560 056, Karnataka, India *Corresponding author

A B S T R A C T

Increasing consumer awareness on toxic synthetic dyes has invoked interest in study and production of natural colors. Fungi are known to be potential source for natural colors due to their easy culturing and downstream production. Pigments produced by these organisms are influenced by many environmental factors; one of K e y w o r d s them being light. The present work focuses on the photoresponse in Chaetomium cupreum to different wavelengths of light. The organism was isolated from soil and selected for the studies owing for its ability to produce extracellular pigment. The Chaetomium present work aims to study the influence of different wavelengths of visible cupreum; spectrum on pigment and biomass production in Chaetomium cupreum. The study pigment; observes that green light incubation induced maximum pigmentation whereas photoresponse; yellow and white light incubation recorded low intensity and reduced pigment quantification. yield. In contrast, white and blue wavelength exhibited increased biomass production and red wavelength showed least biomass yield. There was a significant difference in the radial growth of the mycelia on solid media although the morphology showed less variation. This infers that photoreceptors are active as in other fungi and play a major role in pigment and biomass production. These findings are important and would likely assist in providing clue to the further research in Chaetomium cupreum.

Introduction

Light has a crucial influence on visible spectrum of light (Herrera-Estrella microorganisms due to its capability of et al., 2007). Several types of inducing morphological and behavioral photoreceptors (Molecules that receive changes (Casas-Flores et al., 2006). It and transduce the photon energy to induces varied response in nearly all forms promote a cell response) have been of life including filamentous fungi. Fungal described in fungi (Corrochano 2007; Photobiology shows the existence of Herrera-Estrella et al., 2007). Many greater convolution in responses for p hysiological processes such as growth,

53 Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64 the direction of growth, asexual and sexual developed from this species, and is widely reproduction, and pigment formation, all used as broad spectrum bio- fungicide for of which are very crucial aspects of the disease control in various plants survival and dissemination of fungi are (Soytong et al 2001). It is also known to regulated by light (Idnurm et al., 2005). It biodegrade catechin, a well-known is best studied and understood in recalcitrant compound and a related Neurospora crassa, where in blue light is enzyme catechin oxygenase (Arunachalam the type of light most associated with et al., 2007), Azaphilones, a novel bicyclic fungal photomorphogenesis, metabolic anthraquinone has been successfully pathways (Liu et al., 2003) and regulates isolated from it. The red oosporein, from circadian rhythms and other processes C. cupreum is known to have antifungal such as the synthesis of photo-protective effects against Rhizoctonia solani, Botrytis pigments and spore formation (Miyake et cinerea, Pytium ultimum and many al., 2005). pathogenic fungi. It has also shown antitumor activity against HL-60 and A number of natural colorants though A549 and acute toxicity against Artemia present, only a few are available in salina (Kanokmedhakul et al., 2007). Its adequate quantity and are of industrial antifungal activity is being exploited for importance, as they are straightly extracted natural medicines (Kanokmedhakul et al., from different parts of the plants (Lauro 2006). Four compounds, rotiorinols A, C, 1991). Microbial pigments are interesting stereoisomer (-) -rotiorin and rubrorotiorin as potential alternative, owing to their isolated from C. cupreum is known to nature, medicinal properties, nutritive exhibit antifungal activity against Candida value, expected yield, easy handling, albicans (Vengurlekar et al., 2012), the safety, production being independent of halogenated compound rubrorotiorin being season and geographical conditions [Latha the most active (Saleem et al., 2010). et al., 2010]. Increased consumer Some species of C. cupreum are very good awareness of the safer natural colors has cellulase, laccase (Ankudimova et al., led producers to move on to the natural 1999; Mimura et al., 1999), and chitinase and non-synthetic colorants in textile producers (Inglis et al., 2002) and are industry (Nagia et al., 2007), foods and implicated in biotechnological industry. cosmetics (Chiba et al., 2006). It is Earlier the focus was on production of therefore beneficial to produce colors from pigments from Monascus spp in various natural sources such as microbes. Some of media. Its light-dependent growth and the pigments successfully produced are food industry applications were ornately from Monascus (Wong et al.,1983; studied by Pandey et al., Carvalho et al., Yoshimura et al.,1975) and Serratia (Trias and Babitha et al., (1994, 2003; 2008). et al., 1988), however many However, very little has been known about microorganisms are yet to be explored for the influence of different colors of light on pigments. the growth and pigment production of Chaetomium cupreum. To overcome this C. cupreum is a widely distributed and lacuna, in this study, we have made an abundantly found soil fungus that exhibits effort to examine the effect of different antagonism against numerous colors of light for the production of phytopathogens (Mao et al., 2010). A pigments and biomass by growing the commercial product Ketomium® has been fungus in submerged fermentation.

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Materials and Methods to get the final yield.

Isolation and Identification Color stability at varying pH

Chaetomium cupreum was isolated from a The color sensitivity of the pigment in litter sample collected from the GKVK aqueous state was determined by changing campus, Bangalore. Isolation was carried the pH of the extract to 1, 3, 5, 7, 9, 11, 12 out by the serial dilution method (Aneja and 14 individually and quantifying the 2003) on Potato Dextrose Agar (PDA) extract as discussed above. Absorbance medium. The colony was subjected to maximum was noted to confirm the morphological and microscopic change in color of the pigment at varying observations. The morphological identity pH. was confirmed by NFCCI, Agharkar Research Institute, Pune, India. To Effect of Visible Spectrum of Light confirm the species, sequence analysis of the ITS region using universal primers The organism was cultured in 100ml of (Forward primer, ITS 1 - Potato Dextrose Broth (PDB) to study the TCCGTAGGTGAACCTGCGG and effect of different wavelengths of light on Reverse primer, ITS 4 - biomass and pigment production. For the TCCTCCGCTTATTGATATGC) was studies on cultural morphology, the performed. Nucleotide Blast to the organism was cultured on PDA in obtained sequence was performed in NCBI petriplates. Five millimeter mycelial discs (www.ncbi.nlm.nih.gov/) using blastn bored out from the periphery of six days suite. The sequence was deposited in old culture were used for inoculation. The NCBI Genbank. flasks and plates were wrapped in color glass papers of red, blue, green and yellow Extracellular Pigment Extraction and colors. A set of flasks and plates were Quantification covered with black art paper to completely cut off the light and hence incubated in For the extraction of the pigment, the darkness. Another set of flasks and plates culture was grown in Potato Dextrose were exposed completely to light source to Broth (PDB) at 30oC. The flasks were record the effect of white light. The incubated for 7 days for maximum Principle behind the use of colored glass pigment production. The pigmented papers was that a colored glass paper culture broth was filtered and was directly allows only its particular color of light to quantified (Dhale et al., 2009), at 530nm pass through it whereas it filters out the in a UV-Visible spectrophotometer other colors of the spectrum. All the flasks (Schimadzu UV 1700, pharmaspec) to (Fig. 1a) and plates (Fig. 1b) were placed determine the absorption maxima ( max). at equidistant (15cm) from the illuminated The units were expressed as units of light source (Philips CFL 50 watts). After absorbance ml-1 of the broth (Lee et al., seven days of incubation, the pigment was 2001). The uninoculated Potato Dextrose quantified and extracted. The extract was Broth was used as blank. The pigment concentrated in rotary vacuum evaporator was extracted to ethyl acetate, according to and the concentrated extract was dried in a the protocol of Cho et al., [Cho et al., pre-weighed beaker to estimate dry solid. 2002] from the fermented broth. The The final yield was recorded as mg l-1. extract was vacuum evaporated to dryness 55

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Pigment Hue/ color by National Fungal culture collection of India and Fungal Identification Service The final crude pigment was visually (NFCCI & FIS), Agharkar Research compared for color and texture variability. Institute, Pune. The Culture was deposited in the National Fungal Culture Collection Biomass estimation of India (NFCCI), with accession Number NFCCI 3117. BLAST search performed Mycelium was separated from the broth by for the sequence of ITS analysis, showed centrifugation and filtration after seven 99% homology with other strains of days of incubation. The separated mycelial Chaetomium cupreum available in Gen mass was washed thrice with distilled bank. The sequence was deposited in water and dried overnight at 105oC in hot NCBI Genbank with accession Number air oven. The dry weight was recorded as g KF668034. l-1. The radial growth (colony diameter) of the organism cultured on PDA plates was Quantification measured after incubation. The pigment showed absorption maxima Cultural Morphology ( max) at 530 nm indicating that it is a red pigment. The absorbance was expressed as The morphology of the culture was Units of Absorbance ml-1 (Fig. 3). compared with respect to the hyphae, pigmentation and texture of the colonies Color stability at varying pH after 7 days of incubation in PDA plates. The pigment color at varying pH varied Statistical Analysis significantly. As the pH of the aqueous solution shifted to alkaline, the maximum All the results were analyzed by means of absorption wavelength increased, Multivariate ANOVA using SPSS for associated with a variation in color. It windows (SPSS Inc.) 11.5 version. Post turned yellow at acidic pH and deep Hoc analysis was performed using Scheffe orange at alkaline pH, though it remained test with significance p < 0.05. deep red from pH 6 to 9 (Fig. 4).

Results and Discussion Effect of Visible Spectrum of Light on pigment and biomass production Isolation and Identification The results in this study indicated that The isolated fungus was identified as pigment and biomass production varied Chaetomium cupreum based on significantly depending on the different morphological (Fig. 2a & 2b) and wavelengths of light. Here, the culture microscopic characteristics (Fig. 2c & 2d). under submerged condition was exposed Diffusion of deep red pigment into the to different colors and thus different media was observed around the colony on wavelengths of light (Blue 492 455 nm, PDA plate, which suggested that it is Green 577 492 nm, Yellow 597 577 nm, water soluble. Red 780 622 nm, White and Darkness). Maximum pigment production was The identification was further confirmed observed in green light incubation (Fig. 5),

56 Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64 followed by blue light and dark analyzed by comparing the visible incubation. Though yellow and white light phenotypic characters observed on the incubation led to least pigment production, PDA plates after 7 days of incubation (Fig. they did not completely inhibit the 8). The colonies grown under blue and synthesis of pigment. Increased pigment white showed profuse growth of mycelia, production was observed in total dark denser and pigmented towards the center. incubation as compared to the flasks The colonies grown under red, yellow and completely exposed to white light. green light showed denser mycelial growth at the center and scanty growth towards The visual comparison of the extracted the outer circle, whereas the colonies pigment exhibited varied hue (shades of under dark incubation showed very dense color) to different wavelengths of light mycelia growth at the center and (Fig. 6). The white light incubation completely hyaline and scanty growth at yielded a deep red colored pigment the periphery. This observation showed whereas yellow light incubation yielded a that the incubation in white light and light red to orange colored pigment. The darkness increased the biomass production texture of the pigment also varied largely, and also exhibited variation in cultural yellow light incubated pigment was morphology. completely amorphous and the pigment from white light incubation was semi Regulation of fungal growth and behavior crystalline. Overall, as the shade of the is a prominent example of the effect of pigment grew darker, the texture turned light on fungi (Corrochano et al., 2006). In towards crystalline and the lighter shaded several model fungal species the effect of pigments exhibited amorphous nature. light has been studied. While the morphological effects and spectral On the contrary to the above observation, analyses of light have been well white and blue light, as well as dark characterized in basidiomycetes incubation favored biomass production (Coprinus) and zygomycetes whereas red light incubation reduced the (Phycomyces), it is best understood based biomass yield (Fig. 7). The growth was on the functions of the white collar genes also measured on solid media in terms of (WC-1 and WC-2) in light sensing. (Kues colony diameter. White light incubated 2000; Cerda Olmedo 2001; Liu et al., colony exhibited highest radial growth and 2003). Despite the importance of the light red light incubated colony showed the in fungal development and metabolism, least colony diameter on the solid media. there is a lot left unexplored to explain the However, green and white light incubation mechanisms and its influence on pigment did not have much effect on biomass production in C. cupreum. production. This observation suggests that white light induced the biomass The color of the pigment was found to be production in this organism, unlike in sensitive to pH. Similar variation in the pigment synthesis where it reduced the color of red pigment isolated from pigment yield. Paecilomyces sinclairii and Isaria Cultural morphology farinosa was also observed by Cho et al., (2002) and Velmurugan et al., (2010) The effects of different wavelength of the respectively. This shows that this pigment visible spectrum on the cultures were

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Figure.1 (a) Experimental set up to study the effect of light on pigment production and growth in Chaetomium cupreum in submerged fermentation (b) On Solid Media.

Figure.2(a) Morphology and Pigmentation of Chaetomium cupreum on PDA plate. (b) Reverse side of the plate. (c) Microscopic view of the ascocarp and (d) ascospores of Chaetomium cupreum.

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Figure.3 Spectrphotometrical Quantification of the pigment of Chaetomium cupreum

Figure.4 Sensitivity of the pigment of Chaetomium cupreum to varying pH

Figure.5 Effect of different wavelengths of Light and darkness on pigment production of Chaetomium cupreum: Scheffe post hoc test: Means sharing different superscripts are significantly different (P<0.05)

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Figure.6 Effect of different wavelengths of Light and darkness on pigment hue of Chaetomium cupreum

Figure.7 Effect of different wavelengths of Light and darkness on growth and biomass production of Chaetomium cupreum: Scheffe post hoc test: Means sharing different superscripts are significantly different (P<0.05).

Figure.8 Effect of different different wavelengths of Light and darkness on morphology of Chaetomium cupreum

Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64 is sensitive to pH. This property of the (from the growth responses to pigment can be exploited for various phototropism) studied in the fungi industrial demands. (Kumagai 1988; Lauter 1996). Other classes of photoreceptors are also being The results of effect of visible spectrum of identified recently. Blumenstein et al., Light on pigment and biomass production, (2005)have reported a red light sensing via agrees with that of (Babitha et al., 2008) phytochrome in the model fungus and is significant as it is in contradiction to Aspergillus nidulans, Hoff et al., (2010) the postulated photo-protective role of have reported two components of a velvet- pigments according to (Yong et al., 1991; like complex that control hyphal Salih et al., 2000; Seagle et al., 2005). In morphogenesis in Penicillium N. crassa, blue light induces the chrysogenum. Hurley et al., (2012) have carotenoid pigment production. worked on the light inducible photoreceptor system for tunable protein The significant variation of pigment and expression in N. crassa. Retinal- biomass production in white light and reconstituted Nop-1 is a green-absorbing darkness could be explained by the pigment while Neurospora responds to hypothesis of the existence of blue light; Saranak and Foster (1997) photoreceptors responsive to darkness and concluded that in the chytrid Allomyces the presence of light in this fungus reticulates, a rhodopsin is responsible for (Velmurugan et al., 2010). Understanding zoospore phototaxis. WCC complex, the role of environmental stimuli in fungal Opsin and velvet photoreceptors have been development is very important to increase identified in Chaetomium globosum the benefits and reduce the costs that fungi (Rodriguez-Romero et al., 2012). Very present (Idnurm et al., 2005). The pigment recently a Poly Ketide Synthetase (PKS) hue produced by the fungi varies by strain, gene pks-1 has been identified to be medium composition, and growth involved in chaetoglobosin biosynthesis, Condition and is greatly affected by the pigmentation and sporulation in medium composition [Jung et al., 2003]. It Chaetomium globosum (Hu et al., 2012), is evidenced in Trichoderma atroviride, but the photoresponse studies in C. that the blue-light perception system cupreum have not yet been reported. The establishes a cross-talk with that involved phytochromes were thought to be found in in red light perception, which is reflected photosynthetic organisms only, but at the level of mycelial growth. Although recently it has been discovered even in the the blue region of the spectrum provides fungi and heterotrophic bacteria, where the dominant signal, the green and red little is known about their functions. photoresponses have often been overlooked (Herrera-Estrella et al., 2007). The experiments on the effect of different The wavelengths of light from UV to far- wavelengths of visible spectrum in this red can induce responses in the members study revealed that the incubation in green of the fungal kingdom. However, of late light was most effective followed by only one photoreceptor class (blue light darkness and blue light, in inducing the sensors) had been identified in the fungi. pigment production. The hue and texture Photoresponses mediated by the of the pigment also varied greatly with photoreceptors that absorb blue light white light incubation producing the constitute the majority of photoresponses darkest shade of the pigment. The colonies

61 Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64 grown under the direct white light Acknowledgment exhibited reduced pigment production; thus, postulating the existence of Soumya K is grateful to University Grants photoreceptors in this fungus, responsive Commission, Government of India, New to darkness and light. This photoresponse Delhi, India, for awarding Rajiv Gandhi on pigment production, when compared National Fellowship. The authors with the other reported photoresponses in acknowledge Bangalore University for fungi, is quite different. The operation of funding this project under young research the phytochrome type of system in this brigade programme - YRB- BUIRF: 2010 fungus is shown by the physiological and -11 and Fungal Identification Service, morphological responses. Varying Agharkar Research Institute, Pune and pigment concentrations suggested the loss Geneombio Technologies, Pune for their of pigments which is unexplainable as a support in the identification of the change in pigment location. One possible organism. explanation for degradation in pigments might be because of an enzymatic References pathway, which may be induced by nutrient exhaustion. A common Aneja, K.R. 2003. Experiments in phenomenon observed in fungi is that the microbiology plant pathology and secondary metabolites are degraded by biotechnology New Age International (P) enzymes (Johns et al., 1982). The pigment Limited New Delhi India. of Chaetomium cupreum, in the present Ankudimova, N.V., Baraznenok, V.A., study is extracellular and hence significant Becker, E.G., Okunev, O.N. 1999. as it is water soluble and possesses simpler Cellulase complex from Chaetomium and cheaper downstream processing. cellulolyticum: isolation and properties of major components. Biochem. 64, 1068- Probably the induction and reduction of 1073. pigment synthesis could be due to the Arunachalam, M., Mohan Raj, M., Mohan, N., varied light intensities (intensity of the Mahadevan, A. 2003. Biodegradation of green light usually lower than white light). catechin. Proc Indian natn. Sci. Acad. B. Therefore, to gain comprehensive insight 69(4), 353-370. into the regulation of pigment biosynthesis Babitha, S., Carvahlo, J.C., Soccol, C.R., induced by light, many parameters need to Pandey, A. 2008. Effect of light on be explored and we expect that the present growth, pigment production and culture study provides a strong approach towards morphology of Monascus purpureus in attaining this goal. The study also assures solid-state fermentation. World J. the possibility of establishing a relation Microbiol. Biotechnol. 24,2671 2675. Blumenstein, A., Vienken, K., Tasle,r R., between the photoreceptors, light Purschwitz, J. et al., 2005. The regulated genes and the photoresponse in phytochrome FphA controls development Chaetomium cupreum and may probably in the filamentous fungus Aspergillus unravel the possible functions interplaying nidulans. Curr. Biol. 15, 1833 1838. between the different light control systems. Furthermore, these studies may Carvalho, J.C., Pandey, A., Babitha, S., also help in significant commercial Soccol, C.R. 2003. Production of applications pertaining to the use of Monascus biopigments: an overview Agro pigments. Food Ind. Hi Tec. 14, 37 42. Casas-Flores S, Rios-Momberg M, Rosales- Saavedra T, Martinez-Hernandez P. et al.,

62 Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

2006. Cross talk between a fungal blue- Dunlap, J.C. 2012. Light-inducible system light perception system and the cyclic for tunable protein expression in AMP signaling pathway. Eukaryot Cell. Neurospora crassa. G3 (Bethesda). 1207- 5,499 506 1212. Cerda Olmedo, E. 2001. Phycomyces and the Idnurm, A., Heitman, J. 2005. Light controls biology of light and color. FEMS. growth and development via a conserved Microbiol. Rev. 25,503 512. pathway in the fungal kingdom. PLOS Chiba, S., Tsuyoshi, N., Fudou, R., Ojika, M. Biology. 3, 1 12. doi: et al., 2006. Magenta pigment produced 10.1371/journal.pbio.0030095. by fungus. J. Gen. Appl. Microbiol. Inglis, G.D., Kawchuk, L.M. 2002. 52,201 207. Comparative degradation of oomycete and Cho, Y.J., Park, J.P., Hwang, H.J., Kim, S.W. basidiomycete cell walls by mycoparasitic et al., 2002. Production of red pigment by & biocontrol fungi. Can. J. Microbiol. 48, submerged culture of Paecilomyces 60 70. sinclairii. Lett. Appl. Microbiol. 35,195 Johns, M.R., Chong, R., Maddox, I.S. 1982. 202. Hydrolysis of some natural and synthetic Corrochano, L.M. 2007. Fungal bile acid conjugates by Cerospora photoreceptors: sensory molecules for melonis. Can. J. Microbiol. 28,457 461. fungal development and behaviour. Jung, H., Kim, C., Kim, K., Shin, C.S. 2003. Photochemical & photobiological Color characteristics of Monascus sciences : Official journal of the pigments derived by fermentation with European Photochemistry Association and various amino acids. J. Agric. Food. the European Society for Photobiology. Chem. 51, 1302- 1306. 6,725 36. Kannokmedhakul, S., Kanokmedhakul, K., Corrochano, L.M., Galland, P. 2006. Nasomjai, P., Louangsysouphanh, S., Photomorphogenesis and gravitropism in Soytong, et al., 2006. Antifungal fungi. In The Mycota Vol I. Growth azaphilones from the fungus Chaetomium differentiation and sexuality. 233 259. cupreum CC3003. J. Nat. Prod. 69,891 Berlin Springer-Verlag. 895. Dhale, M.A., Vijay-Raj, A.S. 2009. Pigment Kanokmedhakul, S., Kanokmedhakul, K., and amylase production in Penicillium sp Soytong, K., Suksamrarn, A. 2007. NIOM-02 and its radical scavenging Bioactive compounds from Chaetomium activity. Int. J. Food Sci. Technol. 44 cupreum, C. globosum and Trichoderma (12), 2424-2430. harzianum. International Conference on Herrera-Estrella A, Horwitz, B. 2007. Looking Integration of Science & Technology for through the eyes of fungi: molecular Sustainable Development. Bangkok. 166- genetics of photoreception. Mol 169 Microbiol. 64, 5 15. Kues, U. 2000. Life history and development Hoff, B., Kamerewerd, J., Sigl, C., Rudolf, processes in the basidiomycete Coprinus Mitterbauer, Zadra. I. et al., 2010. Two cinereus. Microbiol. Mol. Bio. Rev. 64 components of velvet-like complex (2), 316-353. control hyphal morphogenesis, Kumagai, T. 1988. Photocontrol of fungal conidiophore development, and penicillin development. Photochem. Photobiol. biosynthesis in Penicillium chrysogenum. 47,889 896. Eukaryot. Cell. 9, 1236 1250. Latha, B.V., Jeevaratnam, K. 2010. Hu, Y., Hao, X., Lou, J., Zhang, P. et al., Purification and characterization of the 2012. A PKS gene, pks-1, is involved in pigments from Rhodotorula glutinis DFR- chaetoglobosin biosynthesis, pigmentation PDY isolated from natural source. Glob. J. and sporulation in Chaetomium globosum. Biotechnol. Biochem. 5(3), 166-174 Sci. China Life Sci. 55(12), 1100 1108. Lauro, G.J. 1991. A primer on natural colors. Hurley, J.M., Chen-Hui, Chen, Loros, J.J., Cereal Food World. 36,949-953

63 Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 53-64

Lauter, F. 1996. Molecular genetics of fungal Seagle Brandon-Luke, L., Rezai, K.A., photobiology. J. Genetics. 75,375 386. Kobori, Y., Gasyna, E.M. et al., 2005. Lee, B.K., Park, N.H., Piao, H.Y., Chung, Melanin photoprotection in the human W.J. 2001. Production of red pigments by retinal pigment epithelium and its Monascus purpureus in submerged correlation with light-induced cell culture. Biotechno. Bioprocess Eng. apoptosis. Proc. Natl. Acad. Sci. USA 6,341-346. 102(25), 8978 8983. Liu, Y., He, Q., Cheng, P. 2003. Soytong, K., Kanokmedhakuf, S., Photoreception in Neurospora: A tale of Kukongviriyapa, V., Isobe, M. 2001. two White Collar proteins. Cell Mol. Life Application of Chaetomium species Sci. 60, 2131 2138. (Ketomium) as a new broad spectrum Mao, B. Z., Huang, C., Yang, G.M., Chen, biological fungicide for plant disease Y.Z. et al., 2010. Separation and control: A review article. Fungal Divers. determination of the bioactivity of 7, 1-15. oosporein from Chaetomium cupreum. Trias, J., Vinas, M., Guinea, J., Loren, J.G. Afr. J. Biotechnol. 9(36), 5955-5961. 1988. Induction of yellow pigmentation in Mimura, S., Rao, U., Yoshino, S., Kato, M. et Serratia marcescens. Appl Environ. al., 1999. Depression of the xylanase- Microbiol. 54, 3138-3141. encoding cgxA gene of Chaetomium Velmurugan, P., Lee, Y.H., Nanthakumar, K., gracile in Aspergillus nidulans. Microbiol. Kamala Kannan, S. et al., 2010. Res. 153, 369-376. Water soluble red pigments from Isaria Miyake, T., Mori, A., Kii, T., Okuno, farinosa and structural characterization of T., Usui, Y. et al., 2005. Light effects on the main colored component. J. Basic cell development and secondary Microbiol. 50 (6), 581-590. metabolism in Monascus. J. Ind. Velmurugan, P., Lee, Y.H., Venil, C.K., Microbiol. Biotechnol. 32,103 8. Lakshmanaperumalsamy, P. et al., 2010. Nagia, F.A., EL-Mohamedy, R.S.R. 2007. Effect of light on growth intracellular and Dyeing of wool with natural extracellular pigment production by five anthraquinone dyes from Fusarium pigment-producing filamentous fungi in oxysporum. Dyes. Pigm. 75,550 555. synthetic medium. J. Biosci. Bioeng. Pandey, A. 1994. Solid-state fermentation: an 109(4), 346-50. over view, Solid State Fermentation Wiley Vengurlekar, S., Sharma, R., Trivedi, P. 2012. New Delhi India. 3 10 Efficacy of some natural compounds as Rodriguez-Romero, J, Hedtke, M., Kastner, antifungal agents; Pharmacogn. Rev. C., Muller, S. et al., 2010. Fungi, hidden 6(12), 91 99. in soil or up in the air: light makes a Wong, H.C., Koeheler, P.E. 1983. Production difference. Annu. Rev. Microbiol. 64,585 of red water soluble Monascus pigments. 610 J. Food Sci. 48, 1200-1203. Saleem, M., Nazir, M., Ali, MS., Hussain, H. Yong, Y.Y.R., Lee, Y.K. 1991. Do et al., 2010. Antimicrobial natural carotenoids play a photoprotective role in products: an update on future antibiotic the cytoplasm of Haematococcus lacustris drug candidates. Nat. Prod. Rep. 27, (Chlorophyta)? Phycologia. 30(3), 257- 238 254. 261. Salih, A., Larkum, A., Cox, G., Kuhl, M. et Yoshimura, M.S., Yamanaka, K., Mitsugi, al., 2000. Fluorescent pigments in corals Hirose, Y. 1975. Production of Monascus are photoprotective Nature. 408 (6814), pigment in a submerged culture. Agricult. 850 853 Biol. Chem. 39, 1789-1795. Saranak, J., Foster, K.W. 1997. Rhodopsin guides fungal phototaxis. Nature. 387,465 466.