East Tennessee State University Digital Commons @ East Tennessee State University
Electronic Theses and Dissertations Student Works
8-2017 Role of TLRs, Hippo-YAP1 Signaling, and microRNAs in Cardiac Repair and Regeneration of Damaged myocardium During Ischemic Injury Xiaohui Wang East Tennessee State University
Follow this and additional works at: https://dc.etsu.edu/etd Part of the Cardiovascular Diseases Commons, and the Physiology Commons
Recommended Citation Wang, Xiaohui, "Role of TLRs, Hippo-YAP1 Signaling, and microRNAs in Cardiac Repair and Regeneration of Damaged myocardium During Ischemic Injury" (2017). Electronic Theses and Dissertations. Paper 3287. https://dc.etsu.edu/etd/3287
This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. Role of TLRs, Hippo-YAP1 Signaling, and microRNAs in Cardiac Repair and Regeneration of Damaged myocardium During Ischemic Injury
A dissertation
presented to
the faculty of the Departments of Surgery and Biomedical Science
East Tennessee State University
In partial fulfillment
of the requirements for the degree
Doctor of Philosophy in Biomedical Science
by
Xiaohui Wang
August 2017
Chuanfu Li, M.D., Chair
David L. Williams, Ph.D.
Krishna Singh, Ph.D.
Race Kao, Ph.D.
Gary Wright, Ph.D.
John Kalbfleisch, Ph.D.
Robert Wondergem, Ph.D.
Keywords: Myocardial Ischemia/Reperfusion Injury, Cardiac Regeneration, Toll-like Receptors, MicroRNAs, Hippo-YAP Signaling, PI3K/AKT Signaling ABSTRACT
Role of TLRs, Hippo-YAP1 Signaling, and MicroRNAs in Cardiac Repair and Regeneration of Damaged myocardium During Ischemic Injury
by
Xiaohui Wang
Cardiovascular disease is a leading cause of death in the United States. Toll-like receptor (TLR)-mediated pathways have been demonstrated to play a role in myocardial ischemia/reperfusion (I/R) injury. We and others have shown that PI3K/Akt signaling is involved in regulating cellular survival and protecting the myocardium from I/R induced injury. In this dissertation, we provide compelling evidence that miR-125b serves to “fine tune” TLR mediated NF-κB responses by repressing TNF-α and TRAF6 expression. We constructed lentiviral expressing miR-125b, delivered it into the myocardium. The data showed that delivery of lentivirus expressing miR-125b significantly reduces myocardial infarct size and improves cardiac function in I/R hearts. Mechanistic studies demonstrated that miR-125b negatively regulates TLR mediated NF-κB activation
pathway by repressing TNF-α and TRAF6 expression in the myocardium.
We also observed that transfection of the myocardium with lentivirus expressing miR-
214 markedly attenuates I/R induced myocardial infarct size and cardiac dysfunction.
We demonstrated that miR-214 activates PI3K/Akt signaling by targeting PTEN
expression in the myocardium.
We also investigated the role of TLR3 in neonatal heart repair and regeneration
following myocardial infarction (MI). Wild type (WT) neonatal mice showed fully cardiac
2 functional recovery and small infarct size, while TLR3 deficient mice exhibited impaired
cardiac functional recovery and large infarct area after MI. Poly (I:C), a TLR3 ligand,
administration significantly enhances glycolysis, YAP1 activation and the proliferation of
WT neonatal cardiomyocytes. 2-deoxyglucose (2-DG), a glycolysis inhibitor treatment
abolished cardiac functional recovery and YAP1 activation in neonatal mice after MI. In
vitro either inhibition of glycolysis by 2-DG or inhibition of YAP1 activation prevents Poly
(I:C) induced YAP1 activation and neonatal cardiomyocyte proliferation. Importantly,
YAP1 activation increases miR-152 expression, leading to cardiomyocyte proliferation
through suppression P27kip1 and DNMT1 expression.
We conclude that microRNAs play an important role in TLR modulation induced
protection against myocardial I/R injury by increasing the activation of PI3K/Akt
signaling pathway, decreasing TLR/NF-κB mediated inflammatory response, and suppressing activation of apoptotic signaling following myocardial I/R injury.
In addition, TLR3 is an essential for neonatal heart repair and regeneration after
myocardial infarction. TLR3 modulation could be a novel strategy for heart regeneration and repair.
3
DEDICATION
I would like to dedicate my dissertation work to my family and friends whose support and encouragement has made this achievement possible. Without the constant love, support, and encouragement of my beloved wife Hongxia, my precious daughter
Celina, my parents Jingxin and Xuemei, I would not have been able to complete my
Ph.D. They all contributed in significant ways to make my dream become a reality and I am forever grateful.
4
ACKNOWLEDGMENTS
Firstly, I would like to express my deepest appreciation to my advisor, Dr. Chuanfu
Li, for his excellent guidance, patience, constant encouragement, and providing me with an excellent learning and research environment. My special appreciation also goes to
Dr. David L. Williams, who is always willing to help and give me his insightful comments and encouragement. Many thanks to my committee members: Dr. Race Kao, Dr.
Krishna Singh, Dr. Gary Wright, Dr. John Kalbfleisch, and Dr. Robert Wondergem for their valuable suggestions and kindly help. Without their guidance and persistent help I would never have been able to finish my dissertation. A very special thank you to Dr. Ha for her motherly care of me and my family, and for always being so supportive of my research. I also thank Dr. Robinson, Dr. Ozment, Alice, Beverly, and Bridget, and all the faculty and staff in the Department of Surgery and the Biomedical Science graduate program. Many thanks to Fei Tu, Jingjing Xu, Min Fan, He Ma, Yuanping Hu, Xia
Zhang, Chen Lu, and other members in our research group for their kind help and collaboration in my research. I would also like to thank all my teachers, friends and classmates for their constant support and encouragement. Lastly, I wish to acknowledge my family for their constant love and support during the challenges of graduate school and life.
5
TABLE OF CONTENTS
ABSTRACT ...... 2
DEDICATION ...... 4
ACKNOWLEDGMENTS ...... 5
Chapter
1. INTRODUCTION ...... 15
Myocardial Ischemia/Reperfusion Injury ...... 15
Pathophysiological Mechanisms of Myocardial Ischemia and Reperfusion Injury .. 16
Toll-Like Receptors (TLRs) ...... 18
Role of TLRs in Myocardial Ischemia/Reperfusion Injury ...... 21
MicroRNAs ...... 23
Role of microRNAs in Myocardial Ischemia/Reperfusion Injury ...... 24
MicroRNAs and TLR Signaling Pathway ...... 27
PI3K/Akt Signaling Pathway ...... 29
Role of PI3K/Akt Signaling in Myocardial I/R Injury and Regeneration ...... 32
Hippo-YAP Signaling Pathway ...... 35
Heart Regeneration ...... 37
TLR Mediated Immune Response in Myocardial Repair and Regeneration ...... 41
Glycolytic Metabolism in Heart Regeneration ...... 44
MicroRNAs and Heart Regeneration ...... 46
6
Hippo-YAP Signaling Pathway and Heart Regeneration ...... 48
Questions to be Answered in this Dissertation ...... 49
2. MICRORNA-125B PROTECTS AGAINST MYOCARDIAL
ISCHEMIA/REPERFUSION INJURY VIA TARGETING P53-MEDIATED
APOPTOTIC SIGNALING AND TRAF6 ...... 54
Introduction ...... 55
Materials and Methods ...... 57
Animals ...... 57
qPCR assay of microRNAs (miRs) ...... 57
Construction of miR-125b into lentivirus expressing system ...... 57
Transgenic mice ...... 57
In vitro experiments ...... 58
microRNA microarray ...... 59
In vivo transfection of lentivirus expressing miR-125b (LmiR-125b) into mouse
hearts ...... 59
Induction of myocardial I/R injury ...... 59
In situ apoptosis assay ...... 59
Measurement of cell viability and LDH activity ...... 60
Western Blot ...... 60
Electrophoretic mobility shift assay (EMSA) ...... 60
7
Caspase-activity ...... 60
ELISA for cytokine assay ...... 61
Infiltration of neutrophils into the myocardium ...... 61
Statistical analysis ...... 61
Results ...... 61
Hypoxia/reoxygenation decreased miR-125b expression via NF-κB activation in
H9C2 cardiomyoblasts...... 61
Increased expression of miR-125b attenuated hypoxia/reoxygenation-induced
cell injury in H9C2 cardiomyoblasts...... 63
MiR-125b suppresses p53 and Bak-1 expression in H9C2 cardiomyoblasts...... 66
In vivo increased expression of miR-125b decreased infarct size and improved
cardiac function following myocardial I/R...... 68
I/R-induced myocardial apoptosis was attenuated by LmiR-125b transfection...... 70
Transfection of LmiR-125b prevented the increase in p53, Bak-1, Bax and Fas
levels in the myocardium following I/R...... 73
Increased expression of miR-125b decreased TRAF6 expression and
attenuated neutrophil infiltration in the myocardium...... 73
Transgenic mice with overexpression of miR-125b protect against myocardial
I/R injury...... 74
Discussion...... 76
References ...... 80
8
Supplement Data ...... 84
qPCR assay of microRNAs (miRs) ...... 84
Construction of miR-125b into lentivirus expressing system...... 84
Isolation of cardiac myocytes...... 86
Preparation of exosomes containing miR-125b...... 87
Transfection of cardiac myocytes with Exosomes containing miR-125b...... 88
In vivo transfection of miR-125b (LmiR-125b) into mouse hearts...... 88
In vivo delivery of anti-miR-125b mimics...... 89
Induction of myocardial I/R injury...... 89
MicroRNA microarray...... 90
Myocardial infiltration of neutrophils...... 90
3. MICRORNA-214 PROTECTS AGAINST HYPOXIA/REOXYGENATION
INDUCED CELL DAMAGE AND MYOCARDIAL ISCHEMIA/REPERFUSION INJURY
VIA SUPPRESSION OF PTEN AND BIM1 EXPRESSION ...... 93
Abstract ...... 94
Introduction ...... 95
Results ...... 97
Increased miR-214 levels suppressed PTEN expression and increased Akt
phosphorylation in H9C2 cardiomyoblasts...... 97
Increased expression of miR-214 attenuates H/R induced cell injury and
increases survival in H9C2 cardiomyoblasts...... 98
9
LmiR-214 transfection attenuates cardiac dysfunction and reduces infarct size
after myocardial I/R...... 100
LmiR-214 transfection suppresses PTEN expression and increases Akt
phosphorylation in the myocardium...... 101
Increased expression of miR-214 attenuates I/R induced myocardial apoptosis. . 103
LmiR-214 transfection increases Bad phosphorylation and suppresses the
expression of Bim1 in the myocardium...... 104
LmiR-214 suppresses the translocation of Bim1 from cytosol to mitochondria in
myocardioblasts following H/R...... 105
Discussion...... 107
Animals ...... 110
Induction of myocardial I/R injury ...... 111
In situ apoptosis assay ...... 112
Measurement of cell viability and mitochondrial membrane potential ...... 112
Real time PCR assay of miRNAs ...... 112
Construction of lentivirus expressing miR-214 ...... 113
Transfection of lentivirus expressing miRNA ...... 113
In vitro experiments ...... 114
Mitochondrial Isolation and Western Blot ...... 114
Caspase-3/7 and caspase-8 activities Assay ...... 115
Statistical analysis ...... 115
10
References ...... 116
4. TLR3 MEDIATES REPAIR AND REGENERATION OF DAMAGED NEONATAL
HEART THROUGH GLYCOLYSIS DEPENDENT YAP1 REGULATED MIR-152
EXPRESSION ...... 120
Abstract ...... 121
Introduction ...... 122
Results ...... 124
TLR3 deficiency impairs neonatal heart regeneration after MI...... 124
TLR3 activation enhances glycolysis and promotes cardiomyocyte proliferation. 126
TLR3 mediates YAP1 activation via a glycolytic dependent mechanism...... 126
YAP1 activation is needed for TLR3 mediated cardiomyocyte proliferation...... 128
The TLR3 activation suppresses YAP1 phosphorylation, leading to YAP1
activation...... 130
Suppression of YAP1 phosphorylation by Poly (I:C) is mediated through
dephosphorylation of LATS1 and MOB1...... 132
TLR3 activation induces an interaction between PP1a with LATS1 and MOB1 ... 134
Activation of TLR3 induces glycolysis mediated PP1a dependent LATS1 and
YAP1 dephosphorylation...... 135
TLR3 modulates AMPK phosphorylation and YAP1 activation via a glycolytic
dependent mechanism...... 137
Activation of YAP1 regulates miR-152 expression in neonatal cardiomyocytes. .. 139
11
MiR-152 contributes to TLR3 mediated cardiomyocyte proliferation...... 141
Discussion...... 141
Materials and Methods: ...... 148
Animals ...... 148
Induction of myocardial MI injury ...... 148
Isolation of neonatal cardiomyocytes ...... 149
Cardiomycoyte proliferation ...... 149
qPCR assay ...... 149
In vitro experiments ...... 150
AAV virus packaging ...... 151
Immunoprecipitation ...... 151
Immunoblotting ...... 151
Statistical analysis ...... 152
References ...... 153
Supplement Data ...... 158
5. SUMMARY AND CONCLUSIONS ...... 159
REFERENCES…………………………….…………………………………………………164
APPENDIX: ABBREVIATIONS ...... 188
VITA ...... 193
12
LIST OF FIGURES
Figure Page
1.1 Pathophysiologic Mechanisms of Myocardial Ischemia/Reperfusion Injury...... 17
1.2 PI3K/Akt Signaling Pathway...... 30
1.3 Hippo-YAP Signaling Pathway...... 36
2.1 H/R decreases miR-125b expression and increased NF-ƘB binding activity in
H9C2 cells...... 62
2.2. Increased expression of miR-125b attenuates H/R-induced cell injury and cell
death in H9C2 cardiomyoblasts and adult cardiac myocytes...... 65
2.3. Increased expression of miR-125b decreased p53 and Bak-1 expression in
H9C2 cells and adult cardiac myocytes...... 67
2.4. LmiR-125b transfection protects the myocardium from I/R injury ...... 69
2.5 Transfection of LmiR-125b attenuates I/R-induced myocardial apoptosis...... 72
2.6. LmiR125b transfection decreases TRAF6 expression and prevents I/R-induced
NF-κB binding activity...... 74
2.7. Reduced myocardial infarct size and attenuated cardiac dysfunction in the
transgenic mice with overexpression of miR-125b...... 76
2.S1. Increased in vivo expression of miR-125b attenuated I/R-induced neutrophil
infiltration into the myocardium...... 91
3.1. TLR4 deficiency or TLR2 ligand, Pam3CSK4 treatment increases the expression
of miR-214 in the myocardium...... 99
3.2. Transfection of lentivirus expressing miR-214 into the myocardium improved
cardiac function and decreased infarct size following myocardial I/R injury...... 102
13
3.3. Increased expression of miR-214 attenuates I/R-induced myocardial apoptosis. 104
3.4. Increased expression of miR-214 suppressed Bim expression and prevents
Bad phosphorylation in the myocardium following myocardial I/R...... 104
3.5. Increased expression of miR-214 suppressed the expression and mitochondrial
translocation of Bim1 and increased the levels of phosphorylated Bad in
cardiomyoblasts H9C2 cells ...... 106
4.1. TLR3 deficiency reduced neonatal cardiomyocyte proliferation and impaired
the cardiac functional recovery following MI...... 125
4.2. TLR3 deficiency suppressed MI induced YAP1/TAZ expression and nucleus
translocation following MI...... 128
4.3. YAP1 activation is required for TLR3 mediated cardiomyocyte proliferation...... 130
4.4. TLR3 activation reduces YAP1 phosphorylation, leading to YAP1 activation...... 131
4.5. PP1a is involved in Poly (I:C) induced LATS1 and MOB1 pephosphorylation,
YAP1 activation, and neonatal cardiomyocyte proliferation………...... 133
4.6. Poly (I:C) induced glycolysis mediated PP1a dependent LATS1 and YAP1
dephosphorylation...... 136
4.7. Effect of AMPK on TLR3 mediated YAP1 activation. TLR3 activation
significantly reduced the phosphorylation level of AMPK ...... 139
4.8. TLR3 mediated miR-152 expression is YAP1 dependent which is involved in
TLR3 mediated cardiomyocyte proliferation...... 140
4.9. Illustration of TLR3 mediated YAP1 activation and miR-152 expression in
cardiomyocyte proliferation...... 142
4.S1 miR-152 is involved in TLR3 mediated cardiomyocyte proliferation...... 158
14
CHAPTER 1
INTRODUCTION
Myocardial Ischemia/Reperfusion Injury
The heart is the first functional organ to be develop during embryogenesis and one of the most important organs in our body. The heart functions as a pump which drives blood throughout the body, carrying all the vital nutrients and oxygen, and assists in the removal of waste products that the body does not need. The heart, like all other tissues in our body, requires nutrients and oxygen through the coronary circulation.
Coronary heart disease is the most common type of heart disease, which is caused by the severe impairment of coronary blood supply from atherosclerotic plaque buildup.
The impairment of coronary circulation can damage or destroy part of the cardiac tissue also called myocardial ischemic injury.
Heart attack caused by coronary artery disease is the leading killer of both men and women in the United States. On average, more than 2,150 Americans die from heart disease each day, which is about 1 death every 40 seconds (Benjamin et al.
2017). In ischemic patients, the most efficient approach to reduce the myocardial ischemic injury and improve outcomes is to restore blood flow in a timely and effective manner. However, the process of restoring blood flow to the ischemic myocardium can also induce cardiomyocyte death and further damage, known as myocardial reperfusion injury (Braunwald and Kloner 1985; Piper et al. 1998; Yellon and Hausenloy 2007;
Hausenloy and Yellon 2013). It has been reported that up to 50% of the final infarct size is caused by myocardial reperfusion injury (Yellon and Hausenloy 2007). Experimental studies have identified some of the major contributors to myocardial reperfusion induced
15
injury including robust ROS production, increased mitochondrial permeability, and
calcium overload ( Brown et al. 1988; Ambrosio et al. 1993; Liu et al. 1993; Liu et al.
1994; Levraut et al. 2003; Weiss et al. 2003; Honda et al. 2005). However, at present,
no effective therapeutic treatment exists for myocardial reperfusion injury.
Pathophysiological Mechanisms of Myocardial Ischemia and Reperfusion Injury
The deprivation of nutrients and oxygen to the heart tissue caused by acute
occlusion of the coronary artery results in a series of abrupt metabolic and biochemical
changes within the myocardium (Yellon and Hausenloy 2007). Unlike the neonatal
heart, more than 90% of the energy in adult cardiomyocytes is produced by oxidative phosphorylation in mitochondria, a process which is necessary for myocardial contractile function(Harris and Das 1991). During myocardial ischemia, oxygen deprivation will prevent mitochondrial oxidative phosphorylation and ATP production
(Lesnefsky et al. 1997). In addition, oxygen deficiency causes cardiomyocyte metabolism to switch from oxidative phosphorylation to anaerobic glycolysis. This leads to lactate accumulation, a decrease in pH, and intracellular acidosis (Buja 2005; Sanada et al. 2011; Kalogeris et al. 2012; Kalogeris et al. 2016). Furthermore, ATP depletion and intracellular acidosis will impair the activity of Na+/H+ exchanger (NHE), Na+/K+-
ATPase and Ca2+-ATPase, and trigger Ca2+ overloading (Buja 2005; Sanada et al.
2011; Kalogeris et al. 2012; Kalogeris et al. 2016).
During reperfusion, the intracellular accumulation of H+ produced by anaerobic
glycolysis will be transported into the extracellular space causing an exacerbation of
Ca2+ overload (Liu et al. 1994; Buja 2005; Kalogeris et al. 2016). Meanwhile, the
16 increase in mitochondrial membrane potential will result in robust ROS generation
(Barry 1987; Lesnefsky et al. 1997; Levraut et al. 2003; Kalogeris et al. 2016). ROS overproduction will cause damage to cellular proteins, DNA, and lipids (Levraut et al.
2003; Weiss et al. 2003; Genova et al. 2004).
Figure 1Figure 1.1 Pathophysiologic Mechanisms of Myocardial Ischemia/Reperfusion injury. During myocardial ischemia, the derivation oxygen supply decreases ATP production, resulting in increased anaerobic glycolysis. The increased anaerobic glycolysis leads to lactate accumulation, a decrease in intracellular pH, Ca2+ overload and increased ROS production. Myocardial ischemia also leads to myocardial necrosis and inflammatory responses which contribute to myocardial infarction and cardiac remodeling. Myocardial reperfusion will further increase ROS production, calcium overload and mitochondrial mediated cellular apoptosis. Massive functional cardiomyocytes loss and inflammatory cytokine production will trigger left ventricular remodeling, leading to left ventricular dilation and heart failure.
17
Animal studies have demonstrated that the detrimental effects of the robust ROS production and intracellular Ca2+ overloaded will induce cardiomyocyte apoptosis and necrosis following myocardial ischemic injury (Barry 1987; Lesnefsky et al. 1997;
Levraut et al. 2003; Kalogeris et al. 2016).
Excessive production of inflammatory cytokines (IL-1β, TNF-a, IL-6) triggered by
DAMPs released from necrotic cells during ischemia/reperfusion also contribute to I/R induced contractile dysfunction, fibrosis, hypertrophy, and cell death (Kukielka et al.
1995; Seta et al. 1996; Kapadia et al. 1998; Arslan et al. 2011; Timmers et al. 2012; Lin and Knowlton 2014; Vilahur and Badimon 2014). In addition, accumulation and activation of neutrophils and macrophages in the infarcted myocardial tissue will further exaggerate I/R induced myocardial injury and cardiac dysfunction (Kukielka et al. 1995;
Seta et al. 1996; Kapadia et al. 1998; Ao et al. 2009; Arslan et al. 2010; Gao et al. 2011;
Lin and Knowlton 2014; Vilahur and Badimon 2014). The massive death of functional cardiomyocytes in conjunction with the dysregulated inflammatory response in the infarct area will trigger left ventricular remodeling, collagen deposition, cardiac hypertrophy and dilation (Kleinbongard et al. 2011; Sanada et al. 2011; Kalogeris et al.
2016; Moe and Marin-Garcia 2016). Uncontrolled left ventricular remodeling and fibrotic scar size enlargement will ultimately result in heart failure.
Toll-Like Receptors (TLRs)
It is well established that acute and chronic inflammatory responses are critical mediators for tissue damage which play a crucial role in the functional deterioration of the heart following myocardial I/R injury ( Lange and Schreiner 1994; Aderem and
Ulevitch 2000; Thomas et al. 2003; Oyama et al. 2004; Ao et al. 2009; Chao 2009; Ha
18
et al. 2011; Lu et al. 2014). Toll-like receptors (TLRs) are evolutionarily conserved
pattern-recognition receptors that play a critical role in the induction of inflammatory
responses (Medzhitov et al. 1997; Aderem and Ulevitch 2000; Aderem and Ulevitch
2000; Brightbill and Modlin 2000; Thomas et al. 2003; Oyama et al. 2004;Ao et al. 2009;
Chao 2009; Lu et al. 2014; Ha et al. 2011).
It is well known that TLRs recognize nucleotides, peptides, and proteins and play a
critical role in innate immune responses (Jin and Lee 2008; Ha et al. 2011). At present,
there are 11 human and 13 mouse TLRs that have been identified. TLRs are located at
the cell surface (TLR1, TLR2, TLR4, TLR5, TLR6), and in intracellular endosomes
(TLR3, TLR7, TLR8, TLR9, TLR11, TLR13). The cell surface TLRs that recognize
lipopeptides include TLR1, TLR2, TLR4, and TLR6 (Jin and Lee 2008; Ha et al. 2011).
The major ligands for TLR2 include multiple glycolipids, lipopetides, lipoproteins,
lipoteichoic acid from bacteria, beta-glucan from fungi, and HSP70 form the host cells
(Tsan and Gao 2004; Jin and Lee 2008; Ha et al. 2011). TLR4 recognizes specific
components (LPS) from gram-negative bacteria, several heat shock proteins,
fibrinogen, heparin sulfate fragments, and hyaluronic acid fragments from host cells
(Tsan and Gao 2004; Jin and Lee 2008; Ha et al. 2011). TLR5 is highly expressed by monocytes/macrophages and dendritic cells which can recognize bacterial flagellin
(Tsan and Gao 2004; Jin and Lee 2008; Ha et al. 2011).
The intracellular TLRs recognize nucleic acids, particularly viral and bacterial
DNA, as well as endogenous nucleic acids. For example, TLR3 detects double stranded viral RNA, synthetic dsRNA, and the RNAs released from damaged cells (Tsan and
Gao 2004; Jin and Lee 2008; Ha et al. 2011). TLR7 mainly recognizes signal strand
19
RNA from RNA viruses (Tsan and Gao 2004; Jin and Lee 2008; Ha et al. 2011), while
TLR9 recognizes bacterial and viral unmethylated DNA (Tsan and Gao 2004; Jin and
Lee 2008; Ha et al. 2011). The most important adaptor protein of the TLR mediated
pathways is myeloid-differentiation primary response protein 88 (MyD88)., The signaling pathways which act through this adaptor are termed MyD88 dependent pathways
(Wesche et al. 1997; Dunne et al. 2003; Akira and Takeda 2004; Ha et al. 2011). All of the TLRs except TLR3, use the adaptor protein MyD88 to recruit IRAK4 and activate
other IRAK family members, such as IRAK1 and IRAK2 (Wesche et al. 1997; Kanakaraj
et al. 1998; Suzuki et al. 2002; Dunne et al. 2003; Akira and Takeda 2004; Ha et al.
2011). The activated IRAK1/2 kinase complex then phosphorylates and activates the
TNF receptor associated factor 6 (TRAF6). TRAF6 acts as an E3 ubiquitin protein ligase
which in turn polyubiquinates and activates transforming growth factor-beta activated
kinase1 (TAK1). The activated TAK1 phosphorylates IκB kinases (IKK-α/IKK-β), and then phosphorylates and promotes IκB degradation. This allows NF-κB to be translocated into the nucleus and regulate pro-inflammatory gene expression (Akira and
Takeda 2004; Ha et al. 2011; Chen 2012; Walsh et al. 2015).
Another important adaptor protein of TLR mediated signaling pathway is TIR- domain-containing adapter-inducing interferon-β (TRIF). Both TLR3 and TLR4 utilize the
TRIF dependent pathway to activate the interferon (IFN) regulatory factor 3 and NF-κB
signaling pathway. Unlike TLR3, TLR4 requires the adaptor TRAM for activating TRIF
(Akira and Takeda 2004; Moynagh 2005; Ha et al. 2011). TRIF can interact with RIP1 for NF-κB activation and use TBK1 for IRF3 activation (Akira and Takeda 2004;
Moynagh 2005; Ha et al. 2011).
20
Role of TLRs in Myocardial Ischemia/Reperfusion Injury
Increasing evidence suggests that TLRs can be activated by various endogenous ligands, also called danger-associated molecular patterns (DAMPs) which are released by damaged tissues. DAMPs can induce an overwhelming inflammatory response via activation of NF-κB and/or IRF3 dependent pathways. Recent studies have shown that both NF-κB and IRF3 mediated signaling pathways play critical roles in extending ischemic myocardial injury, cardiac remodeling and the progression of heart failure
(Thomas et al. 2003; Oyama et al. 2004; Tsan and Gao 2004; Ao et al. 2009; Chao
2009; Arslan et al. 2010; Gao et al. 2011; Kleinbongard et al. 2011; Ha et al. 2011). NF-
κB activation and overwhelming cytokine production are hallmark indicators for the activation of immune activation following myocardial I/R injury. Previous studies have shown that inhibition of NF-κB activation protects against I/R induced myocardial injury and cardiac dysfunction (Tsan and Gao 2004; Chao 2009; Ha et al. 2011). In addition, numerous studies have demonstrated that deficiency or inhibition of either TLR2, or
TLR3, or TLR4 significantly attenuates I/R induced myocardial injury by reducing acute inflammatory responses, pro-inflammatory cytokine production, immune cell infiltration and cardiomyocyte apoptosis (Oyama et al. 2004; Ao et al. 2009; Chao 2009; Arslan et al. 2010; Ha et al. 2011; Lu et al. 2014). However, TLR5 deficiency exacerbates I/R induced myocardial oxidative stress, cardiac injury and inflammatory response
(Parapanov et al. 2015).
In contrast with the results obtained from deficiency of TLR2, or TLR3, or TLR4, modulation of TLRs by specific ligands, such as Pam3CSK4 for TLR2, LPS for TLR4, and CPG-DNA for TLR9 have been shown to exert a protective effect against I/R
21 induced myocardial injury (Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al.
2013). Interestingly, activation of the PI3K/Akt signaling pathway and decreasing of the inflammatory response have been reported to be involved in the underlying cardio- protective effects of TLR modulation (Hua et al. 2007; Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al. 2013). Why does TLR deficiency and TLR modulation have protective effects on myocardial I/R injury and are the underlying mechanisms similar?
It is easy to understand that TLR deficiency attenuates I/R induced acute inflammatory response, cytokine production, immune cell infiltration, and myocardial cell apoptosis.
The question is, why does an activation of TLRs reduce inflammatory responses in myocardial I/R injury. Currently cardiac protection mediated by TLR modulation is explained as preconditioning. However, preconditioning cannot fully explain the cardioprotective effects of TLR modulation on myocardial I/R injury. It is possible that there is a negative-feedback regulatory mechanism to control TLR/NF-κB signaling pathway during TLR modulation. Indeed, our previous studies have shown that TLR modulation significantly increases the expression of miR-146a, which could serve to
“fine tune” TLR mediated NF-κB signaling pathway activity. Increased expression of miR-146a significantly attenuated I/R induced myocardial injury and cardiac dysfunction by targeting IRAK1 and TRAF6 (Wang et al. 2013). In order to investigate the mechanisms by which TLR modulation attenuates I/R induced inflammatory response and tissue damage, we focused on the role of microRNAs.
22
MicroRNAs
MicroRNAs (miRNAs) are endogenous, small, single stranded non-coding RNAs
(about 22nt) which play an important role in posttranscriptional gene regulation by
inhibiting or promoting mRNA degradation in mammals, plants, fungi and some viruses
(Bartel 2004). The first miRNA discovered, lin-4, was found to regulate lin-14 expression
through an unexpected cellular regulatory mechanism by targeting the 3’UTR region of
lin-14 in C.elegans in 1993 (Lee et al. 1993). Only when let-7 was discovered in the early 2000s were microRNAs recognized as a class of biological regulators. Let-7 is necessary for larval development of C.elegans (Reinhart et al. 2000). Since then, thousands of miRNAs have been identified in mammals, plants, fungi and some viruses
(Griffiths-Jones et al. 2008). Plant miRNAs usually display perfectly or near perfectly matched nucleotide complements with their intended mRNA targets. There are similar small interfering RNAs (siRNAs) which cause repression of their target gene through cleavage of the target mRNAs. Unlike plant miRNAs, mammalian miRNAs have a large number of mismatches with their target mRNA binding sites (Millar and Waterhouse
2005). That explains why a given mammalian miRNA may have hundreds of different target mRNAs, and a given target mRNA might be regulated by multiple miRNAs.
The biogenesis of miRNAs is a multistep process that occurs in both the nucleus
and cytoplasm. Mature miRNAs are about 18-24 nucleotides of small non-coding RNAs
which are initially transcribed by RNA polymerase II in the nucleus as long primary transcripts, called primary miRNAs (pri-miRNAs). The expression of miRNAs is
controlled by RNA Pol II –associated transcription factors such as P53, NF-κB, and
YAP/TAZ which positively or negatively regulate miRNA expression (Taganov et al.
23
2006; Chang et al. 2007; Chaulk et al. 2014). Epigenetic modification such as histones
acetylatation and DNA methylation are also involved in miRNA gene regulation (Saito
and Jones 2006; Gatto et al. 2010).
Following transcription, the pri-miRNAs can fold to form a stem-loop hairpin structure. They are then cropped by the double-stranded RNA-specific ribonuclease
complex, including the RNase III Drosha, DiGeorge syndrome critical region 8 (DGCR8)
and other cofactors in the nucleus, to yielded specific hairpin shaped pre-miRNAs (also
called hairpin precursors) (Lee et al. 2003; Kim 2005; Han et al. 2006).
The excised hairpin pre-miRNAs are rapidly exported out of the nucleus by nuclear
export factor exportin 5 (Exportin 5)/RanGTP and additionally processed by dicer, a
second RNase III endonuclease, into 22 long nucleotide duplex in the cytoplasm (Yi et
al. 2003). Both strands of the duplex have∼ the potential to act as a functional miRNA,
however, only one strand is selectively incorporated into the RNA-induced silencing
complex (RISC). The selected strand serves as the functional mature miRNA which
recognizes its targets by the seed region and promotes target mRNA degradation or
translational inhibition (Kim 2005; Gregory et al. 2005; Behm-Ansmant et al. 2006).
Role of microRNAs in Myocardial Ischemia/Reperfusion Injury
MicroRNAs have been demonstrated to be involved in almost all biological processes including tissue development, homeostasis, aging, cell differentiation/dedifferentiation, proliferation, apoptosis, migration, and cellular
metabolism (Ambros 2003; Miska 2005; Wienholds and Plasterk 2005). Therefore, it is
not surprising that more than 90% of human genes are regulated by miRNAs (Miranda
24 et al. 2006). Profiles of miRNA expression have suggested that a large number of miRNAs are highly expressed in heart tissue and are considered to be novel regulators in cardiac physiological and pathophysiological processes, including heart development and aging, myocardial hypertrophy, ventricular arrhythmias, myocardial infarction, cardiac remolding, and heart failure (Callis and Wang 2008; Wang 2010; Barwari et al.
2016; Samanta et al. 2016;Yan and Jiao 2016). Such evidence suggests that miRNAs are attractive potential therapeutic targets for multiple heart diseases.
Numerous studies have demonstrated that TLR/NF-κB mediated inflammatory responses contribute to myocardial I/R injury, cardiac remodeling and the progression of heart failure (Seta et al. 1996; Kapadia et al. 1998; Chao 2009; Kleinbongard et al.
2011; Ha et al. 2011). We have reported that miR-146a overexpression protects the heart from I/R injury by targeting IRAK1 and TRAF6 expression and then negatively regulating the TLR/NF-κB signaling pathway (Wang et al. 2013).
It is well known that myocardial apoptosis and necrosis contribute to a loss of functional cardiomyocytes during myocardial I/R injury ( Levraut et al. 2003; Chiong et al. 2011; Moe and Marin-Garcia 2016). Therefore, preventing cardiomyocyte death or increasing cell survival is an effective intervention to restore impaired cardiac function and prevent later stage heart failure ( Levraut et al. 2003; Chiong et al. 2011; Moe and
Marin-Garcia 2016). Several microRNAs have been reported to be important for the regulation of cell death by targeting apoptotic and/or necrotic signaling pathways. For example, inhibition of miR-15 family members by anti-miRs significantly reduces infarct size, improves cardiac function and prevents cardiac remodeling following ischemic injury. Mechanistic studies suggest that inhibition of the miR-15 family causes an
25
increases in the expression of anti-apoptotic proteins (Bcl2 and SIRT1) and subsequent
reduction of cardiomyocyte apoptosis during myocardial ischemic injury (Hullinger et al.
2012). MiR-320 is another proapoptotic miRNA, and inhibition of its expression has
been shown to exert a protective effect against myocardial I/R injury. In vitro studies
have demonstrated that miRNA-320 overexpression promotes cardiomyocyte death by
targeting a well-known cellular protective protein named heat shock protein 20 (Ren et
al. 2009). In addition, various miRNAs including miR-34, miR-140, and miR-92a serve as pro-apoptotic miRNAs to promote cardiomyocyte death ( Iekushi et al. 2012; Hinkel
et al. 2013; Liu et al. 2015).
In contrast to pro-apoptotic miRNAs, various miRNAs have been reported to serve as protective regulators in response to myocardial ischemic injury. MiR-21 protects
against oxidative stress induced damage of cardiomyocytes and I/R induced myocardial
injury by targeting programmed cell death 4 (PDCD4) and PI3K/AKT negative regulator
(PTEN) (Dong et al. 2009). Bcl2-like protein 11 (Bim1) is a pro-apoptotic protein of the
Bcl2 family that promotes mitochondrial mediated apoptosis by inhibiting Bcl2 anti- apoptotic function. It can directly interact with Bax in the mitochondrial outer membrane, and lead to mitochondrial membrane potential disruption, cytochrome c release, and apoptosis. Bim1 has been identified as a target of miR-24, another important antiapoptotic miRNA. Increased expression of miR-24 has been reported to significantly reduce infarct size and improve cardiac functional recovery following myocardial ischemic injury (Fiedler et al. 2011). MiR-103/107 is a cardiac protective miRNA cluster that has been shown to attenuate myocardial I/R injury by targeting FADD. In addition, various miRNAs including miR-210, miR-146a, miR-494, miR-150, etc. have been
26 shown to have protective effects on I/R induced death of cardiomyocytes and tissue damage (Wang et al. 2010; Wang et al. 2013; Tang et al. 2015; Ke et al. 2016).
In the first study of this dissertation, we have reported that increased expression of miR-125b significantly attenuates I/R induced infarct size and improves cardiac function by reducing cardiomyocyte cell death and decreasing acute inflammatory response following myocardial I/R injury. The protective effect is attributed to targeting of the pro- apoptotic proteins BAK1 and P53, and TNF receptor associated factor-6 (TRAF6).
MicroRNAs and TLR Signaling Pathway
As mentioned above, Toll like receptors are important for detecting invading pathogens, endogenous DAMPs released from damaged cells, and initiating inflammatory responses (Lange and Schreiner 1994; Seta et al. 1996; Chao 2009; Ha et al. 2011). Importantly, dysregulated immune function is involved in the majority of human diseases. TLR mediated signaling serves as a double-edged sword in human health, thus TLR activity needs to be tightly regulated. It is well established that TLR mediated signaling plays an important and complex role in myocardial ischemic injury
(Ao et al. 2009; Chao 2009; Arslan et al. 2010; Ha et al. 2011). Recent studies have shown that either modulation or inhibition of TLRs induces protective effects on myocardial I/R injury.
Growing evidence suggests that miRNAs are important immunomodulators for the regulation of immune responses by targeting their molecules and promoting mRNA degradation or translational inhibition (O'Neill et al. 2011; Virtue et al. 2012; Wang et al.
2013; Kozloski et al. 2016; Mundy-Bosse et al. 2016). Several studies have demonstrated that the expression of multiple miRNAs is regulated by NF-κB, the major
27 transcription factor in the TLR mediated signaling pathway (O'Neill et al. 2011; Virtue et al. 2012; Wang et al. 2013). We and others have been reported that either TLR2 or
TLR4 modulation significantly increases the expression of miR-146a through an NF-κB dependent mechanism. MiR-146a has been identified as a negative regulator in TLR mediated inflammatory responses by targeting IL-1R-associated kinase 1 (IRAK1) and
TNFR-associated factor 6 (TRAF6), both of which are the key downstream molecules in
TLR/NF-κB signaling pathway (Wang et al. 2013). Increased expression of miR-146a in the myocardium significantly attenuates I/R induced acute inflammatory responses and myocardial injury (Wang et al. 2013). Myeloid differentiation primary response gene 88
(Myd88) is the most important adapter protein of TLR signaling pathway and is used by almost all TLRs except TLR3. It has been reported that MyD88 is a direct target of miR-
155 (Tang et al. 2010). MiR-155 also targets TAK1-binding protein 2 (TAB2) which is an important signaling molecule downstream of TRAF6 (Imaizumi et al. 2010).
Pro-inflammatory transcription factors are important for TLR mediated immune responses which can be directly regulated by miRNAs. For example, NF-κB has been reported to be regulated by a subset of miRNAs, including miR-9, miR-181 and miR-183
(O'Neill et al. 2011; Virtue et al. 2012; Sha et al. 2014; Sun et al. 2014; Kozloski et al.
2016). In addition, numerous studies have reported that TLR/NF-κB induced microRNAs can in turn feedback to negatively regulate TLR signaling by directly targeting TLRs (miR-223, let-7e) ( Chen et al. 2007; Wang et al. 2015), TLR signaling regulators (miR-126, miR-146a, miR-149, miR-199 and miR-203) (Mattes et al. 2009;
Primo et al. 2012; Callegari et al. 2013; Wang et al. 2013; Xu et al. 2014b), and inflammatory cytokines (miR-98, miR-125b, miR-211 and miR-579) ( Kim et al. 2012;
28
Venza et al. 2015; Song et al. 2017). Collectively, these findings suggest that miRNAs
“fine tune” TLR signaling and could be used to target and regulate TLR mediated
immune responses during myocardial I/R injury.
PI3K/Akt Signaling Pathway
Phosphoinositide-3 kinase (PI3K) mediated Akt signaling (PI3K/Akt) signaling is an
evolutionally conserved intracellular signaling pathway and is involved in pathologic and
pathophysiologic processes including cardiac hypertrophy, cellular metabolism, cell
proliferation, survival/apoptosis, and differentiation and migration ( Oudit et al. 2004;
Aoyagi and Matsui 2011; Martini et al. 2014; Dibble and Cantley 2015; Lien et al. 2016;
Mayer and Arteaga 2016; Yu and Cui 2016; Manning and Toker 2017). It has been
found that the dysregulation of PI3K/Akt signaling pathway is associated with developmental and overgrowth syndromes, cancer, diabetes, inflammatory and autoimmune diseases, neurological disorders and cardiovascular disease ( Oudit et al.
2004; Wu and Mohan 2009; Aoyagi and Matsui 2011; Foster et al. 2012; Maillet et al.
2013; Martini et al. 2014; Heras-Sandoval et al. 2014; Dibble and Cantley 2015; Mayer
and Arteaga 2016; Manning and Toker 2017).
The PI3K family is divided into three distinct classes based on their molecular
structure and substrate specificity: Class I PI3Ks, Class II PI3Ks and Class III PI3K. It has
been demonstrated that PI3Ks can be activated by RTK (receptor tyrosin kinase) and G
protein coupled receptors (GPCRs) ( Rodriguez-Viciana et al. 1994; Vanhaesebroeck et
al. 2010; Howes et al. 2003).
29
Figure 2Figure 1.2 PI3K/Akt signaling pathway. PI3K kinases can be activated by RTK, IGF-1R and G protein coupled receptors (GPCRs). The activated PI3K complexes phosphorylate PIP2 to PIP3 which then promotes an interaction of PDK1 and Akt, which activates Akt. PTEN acts as a negative regulator of PI3K/Akt signaling by dephosphorylating PIP3 to PIP2. The activated Akt modulates multiple substrates which are important for cell survival, apoptosis, cell cycle, metabolism, angiogenesis, and immune response.
Once the PI3Ks are activated, they promote PIP3 generation from the main precursor, PIP2. The increased production of PIP3 significantly promotes an interaction of PDK1 and Akt, resulting in the phosphorylation and activation of Akt (Guilherme et al.
1996; Alessi et al. 1997; Franke et al. 1997; Carver et al. 2000).
30
Akt/PKB is a serine/threonine protein kinase which contains three distinct
isoforms: Akt1, Akt2 and Akt3 (Cohen, Jr. 2013; Yu et al. 2015b; Manning and Toker
2017). All three isoforms of Akt are expressed and show distinct functions in the heart
(Yu et al. 2015b). Akt1 plays an important role in somatic cell growth and its deficiency
significantly reduces the proliferation of cardiomyocytes and heart size (Matsui et al.
2001; Cohen, Jr. 2013; Yu et al. 2015b). Alternatively, Akt2 regulates glucose
metabolism. Deficiency of Akt2 results in the development of severe insulin resistance
and diabetes ( DeBosch et al. 2006; Cohen, Jr. 2013). Akt3 is mainly expressed in the
brain and is present at a lower level in the myocardium. However, cardiac specific
overexpression of Akt3 results in maladaptive hypertrophy (Taniyama et al. 2005;
Cohen, Jr. 2013).
At present, over 100 Akt downstream target substrates have been identified
including transcriptional factors, metabolic enzymes, cell cycle regulators, protein
kinases and many others ( Manning and Cantley 2007; Manning and Toker 2017).
Activation of PI3K/Akt signaling promotes cell proliferation, survival and growth by inhibiting the activity of pro-apoptotic factors and cell cycle inhibitors such as BAD, BIM,
PUMA, MDM2, FOXO, P21CIP1, p27kip1 and others (Parcellier et al. 2008; Miyamoto et al. 2009; Abeyrathna and Su 2015a; Lin et al. 2015). PI3K/Akt signaling also
contributes to cellular metabolic changes by directly or indirectly interacting with
metabolic regulatory molecules, such as FOXO proteins, the mTOR signaling pathway,
GSK-3β, glucose transporter 4 (GLUT4), PGC1a and PFK1 (Li et al. 2007; Miyamoto et
al. 2009; Kim et al. 2015; Houddane et al. 2017).
31
Role of PI3K/Akt Signaling in Myocardial I/R Injury and Regeneration
Abundant evidence has suggested that the activation of PI3K/Akt signaling protects the heart from I/R induced injury and cardiac dysfunction by increasing cardiomyocyte survival and preventing overwhelming inflammatory responses (Howes et al. 2003; Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al. 2013).
Mitochondrial dependent cardiomyocyte apoptosis contributes to myocardial I/R induced injury. Bcl2 family members, including anti-apoptotic factors (Bcl2, Bcl-w, Bcl-XL, Mcl-1 and others) and pro-apoptotic factors (Bax, Bak, Bad, Bim, Puma and others) belong to a group of proteins that play a critical role in the regulation of mitochondria mediated apoptosis ( Gustafsson and Gottlieb 2008; Chiong et al. 2011). It has been reported the activity of pro-apoptotic factors such as Bad and Bim1 are tightly controlled by PI3K/Akt signaling through phospho-modification, and their phosphorylation prevents mitochondria mediated apoptosis (Murriel et al. 2004; Uchiyama et al. 2004; Lee et al.
2014). In addition, activation of PI3K/Akt signaling protects the myocardium from I/R induced injury by increasing mitochondrial fusion and elongation, promoting cell survival, proliferation, and reducing cardiomyocyte apoptosis or necrosis (Ong et al.
2015).
It has been shown that certain growth factors, i.e. insulin, TLRs ligands, and miRNAs, can protect the myocardium from I/R induced injury by positively upregulating
PI3K/Akt signaling pathway (Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al.
2013). Our previous studies have shown that modulation of either TLR2, or TLR4 or
TLR9 by their specific ligands induces protection against myocardial I/R injury through activation of PI3K/Akt signaling (Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al.
32
2013). Inhibition of either PI3K or Akt abolishes the cardioprotective effects of TLR modulation on I/R induced injury (Ha et al. 2008; Ha et al. 2010; Ha et al. 2011; Cao et al. 2013).
Activation of PI3K/Akt signaling also plays a central role in cardiac repair and regeneration following ischemic injury by inducing angiogenesis, cardiomyocyte proliferation, and cardiac progenitor cells activation ( Haider et al. 2008; Meloni et al.
2010; Siragusa et al. 2010; Dharaneeswaran et al. 2014; D'Uva et al. 2015; Lin et al.
2015; Li and Hirsch 2015). Angiogenesis is an essential process for restoring blood flow to the infarcted area, and serves as a key process to decrease cardiomyocyte apoptosis and necrosis, fibrotic scar expansion, as well as left ventricular dilation and heart failure.
Furthermore, new blood vessel formation is also critical for successful cardiac regeneration (Siragusa et al. 2010; Dharaneeswaran et al. 2014; Porrello and Olson
2014; Li and Hirsch 2015; Mandic et al. 2016; Oka et al. 2016). Activation of PI3K/Akt signaling plays a critical role in regulating angiogenesis by promoting endothelial or endothelial progenitor cell proliferation and migration, and by increasing the secretion of
VEGF, IGF, HIF-1α and eNOS (Ma and Han 2005; Konoplyannikov et al. 2013;
Abeyrathna and Su 2015b).
PI3K/Akt signaling is also involved in heart regeneration following myocardial ischemic injury by cross-talking with the Hippo-YAP signaling pathway. This crosstalk downregulates the expression of the cell cycle inhibitor p27kip1 and allows for cell cycle re-entry (Lin et al. 2015). Activation of PI3K/Akt signaling is also involved in therapeutic treatment of ischemic heart disease by bone marrow derived stem cells (Jackson et al.
2001; Kocher et al. 2001). Increased expression of Akt in bone marrow derived stem
33 cells significantly reduces infarct size, decreases fibrotic scar development, and restores impaired cardiac function following ischemic injury (Mangi et al. 2003).
Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is a highly- conserved phosphatase that is widely expressed in many type cells including neurons, immune cells, endothelial cells, fibroblasts and cardiomyocytes (Mocanu and Yellon
2007; Tamguney and Stokoe 2007; Worby and Dixon 2014). It is well known that PTEN is the most important negative regulator of PI3K/Akt signaling by dephosphorylating
PIP3 to PIP2. Therefore, PTEN is recognized as an important switch in the balance between cell proliferation and differentiation, as well as cell survival and death (Mocanu and Yellon 2007; Tamguney and Stokoe 2007; Worby and Dixon 2014). Inactivation or inhibition of PTEN significantly attenuates the myocardial damage and cardiac dysfunction caused by I/R injury (Mocanu and Yellon 2007; Ruan et al. 2009; Keyes et al. 2010). However, PTEN mutation or long term inhibition will cause over activation of
Akt and possible tumorigenesis and cardiac hypertrophy (Mocanu and Yellon 2007).
Recent studies have shown that cardiac protective miRNAs, such as miR-21, miR-93, and miR-494 protect the myocardium from I/R injury by targeting PTEN (Roy et al.
2009; Wang et al. 2010; Ke et al. 2016).
Our previous studies have revealed cross talk between the TLR/NF-κB pathway and PI3K/Akt signaling (Ha et al. 2008; Ha et al. 2010; Cao et al. 2013) during myocardial I/R injury. TLR modulation significantly enhances the expression of miR-
146a, miR-214 and miR-486 in the myocardium (Wang et al. 2013; Wang et al. 2016).
Furthermore, PTEN has been identified as a direct target of miR-214 and miR-486. The results presented in this dissertation demonstrate that cardiac specific overexpression
34 of miR-214 significantly promotes Akt activation and protects the heart from I/R induced injury by targeting PTEN. Thus, this evidence suggests that microRNAs play key roles in TLR modulation induced cardiac protection through their targeting of PTEN and activation of PI3K/Akt signaling pathway.
Hippo-YAP Signaling Pathway
The Hippo-YAP pathway is an evolutionary conserved signaling pathway which regulates cell differentiation, proliferation, apoptosis and plays a critical role in controlling organ size (Zhao et al. 2011; Yu et al. 2015a; Meng et al. 2016; Wang et al.
2017). The key components in the Hippo-YAP signaling pathway were initially identified by genetic screening in Drosophila and were found to also be highly conserved in mammals (Meng et al. 2016). The Hippo-YAP signaling pathway includes core kinase complexes MST1/2 and LATS1/2 as well as adaptor proteins SAV1 and MOB1
(Hergovich and Hemmings 2009; Avruch et al. 2012; Liu et al. 2012; Meng et al. 2016).
The activity of LATS1/2 kinases is regulated by MST1/2 Kinases and SAV1 complex through their phospho-modification. However, recent studies have revealed that AMPK and MAP4K family kinases also regulate LAST1/2 activation in parallel to MST1/2 kinases. YAP and TAZ are major downstream effectors of the Hippo-YAP signaling pathway. Activated LATS1/2 interacts with an adaptor protein MOB1 to further phosphorylate and inactivate the co-transcriptional factor YAP1/TAZ. This phosphorylation decreases YAP/TAZ transcriptional activity by promoting E3 ubiquitin ligase mediated degradation through a ubiquitin proteasome system or by promoting its interaction with protein 14-3-3 and cytoplasmic sequestration (Hergovich and
35
Hemmings 2009; Avruch et al. 2012; Liu et al. 2012; Meng et al. 2016). In addition,
YAP/TAZ can also be phosphorylated by multiple protein kinases such as Src family tyrosine kinases, JNK and cyclin-dependent kinase 1 (CDK1) (Yang et al. 2013; Codelia et al. 2014).
Figure 3Figure 1.3 Hippo-YAP signaling pathway. The MST1/2 activity will be regulated by multiple upstream signals including the GPCR, tight junction, growth factors, RASSF and NF2. MST1/2 Kinases and SAV1 complex phosphorylate and activate LATS1/2 and Mob1 which then phosphorylate YAP/TAZ. After phosphorylated, YAP/TAZ are sequestered in the cytoplasm with protein 14-3-3 or subjected to be ubiquitinated and degraded by β-TrCP. Unphosphorylated YAP/TAZ will translocate to the nucleus with TEADs to induce gene expression involving in the promotion of cell proliferation and inhibition of apoptosis. When the core kinase complexes (MST1/2 and LATS1/2) are inactivated, YAP/TAZ will translocate into the nucleus and interact with multiple transcription factors, including
TEADs, RUNX1/2, ERBB4, FOXO1, SMADs and others to regulate expression of various genes associated with cell proliferation, differentiation, survival, metabolism,
36
and migration (Komuro et al. 2003; Zhao et al. 2008; Shao et al. 2014; Grannas et al.
2015; Passaniti et al. 2017).
In addition, the Hippo-YAP signaling pathway can be regulated by multiple
extracellular and intracellular signals, including cell polarization and adhesion, cell
contact, G-protein couple receptors and growth-factor-triggered RTK signaling, cellular
stress such as hypoxia, oxidative stress, and cellular metabolic stress (Yu et al. 2012;
Aragona et al. 2013; Shao et al. 2014; Elbediwy et al. 2016). Furthermore, recent
studies have reported that there is a cross talk between the Hippo-YAP signaling
pathway and the PI3K/Akt/mTOR, WNT/β-catenin, Notch and MAPKs signaling
pathways (Yu et al. 2012; Xu et al. 2014a; Lin et al. 2015; Chen et al. 2017; Kim et al.
2017; Luo 2017). In this dissertation, we provide compelling evidence that activation of
TLR3 significantly stimulates YAP1 activation through cellular glycolytic metabolism.
Heart Regeneration
Heart attack caused by coronary artery disease (CAD), also known as ischemic
heart disease remains the leading cause of morbidity and mortality in the United States
( Benjamin et al. 2017). In general, most heart attacks (myocardial infarctions) are
unpredictable and 25% of these patients will develop heart failure (Koudstaal et al.
2016). At present, advanced medical treatments can significantly increase the survival
rates for patients with heart attack. However, the rate of heart failure results in these
patients is not reduced. This is due to, at least in part, to the limited ability of the adult
heart to regenerate and repair damaged heart tissue following heart attack. At present,
there is no effective treatment for heart failure patients (Houyel et al. 2017). Heart
transplantation is one approach for the treatment of heart failure, but the number of
37 suitable donors is very limited and the overall success rate is less than desired.
Consequently, approaches focused on regenerating damaged heart tissue is an attractive and exciting potential therapeutic approach for heart failure patients. To date, a number of cardiac regenerative strategies has been developed which include stem cell based therapies, stimulation of endogenous cardiac progenitor cell differentiation, direct reprogramming of fibroblasts to functional cardiomyocytes, and induced proliferation of pre-existing cardiomyocytes (Senyo et al. 2014; Batty et al. 2016; Duelen and Sampaolesi 2017; Oh 2017).
Stem cell based therapies have shown benefits in patients with heart failure by enhancing regeneration and repair of damaged heart tissue and restoring cardiac function (Goichberg et al. 2014; Hou et al. 2016; Golpanian et al. 2016; Duelen and
Sampaolesi 2017; Oh 2017). Several types of stem cells, including bone marrow derived mesenchymal stem cells, hematopoietic stem cells, endothelial progenitor cells, adult stem cells from adipose or heart tissue, embryonic stem cells and iPSCs have been employed for the clinical studies (Orlic et al. 2001; Beltrami et al. 2003; Murry et al. 2004; Jujo et al. 2008; Bu et al. 2009; Leri 2009; Loffredo et al. 2011; Schlueter and
Brand 2012; Chow et al. 2013; Goichberg et al. 2014; Fisher et al. 2016; Golpanian et al. 2016; Duelen and Sampaolesi 2017). The underlying mechanisms of stem cell based therapies include their direct transdifferentiation into functional cardiomyocytes to replace damaged tissue. The stem cells can also secrete paracrine factors that promote angiogenesis, increase survival and proliferation of pre-existing cardiomyocytes, stimulate the differentiation of resident cardiac progenitor cells, and modulate immune response around damaged areas of heart tissue (Orlic et al. 2001; Beltrami et al. 2003;
38
Murry et al. 2004; Jujo et al. 2008; Bu et al. 2009; Leri 2009; Loffredo et al. 2011;
Schlueter and Brand 2012; Chow et al. 2013; Goichberg et al. 2014; Fisher et al. 2016;
Golpanian et al. 2016; Hou et al. 2016; Duelen and Sampaolesi 2017).
Abundant studies have demonstrated that cardiac progenitor cells (CPCs) can
directly differentiate into functional cardiomyocytes, thus allowing for the regeneration
and repair of damaged tissue and functional recovery following ischemic injury (Beltrami
et al. 2003; Bu et al. 2009; Leri 2009; Schlueter and Brand 2012; Goichberg et al.
2014). CPCs are a group of endogenous cardiac stem cells that are distributed
throughout mammalian neonatal and adult hearts. CPCs based cardiac stem cell
therapy for damaged heart tissue can overcome the multiple shortcomings that are
present in therapies using extra-stem cells derived from other organs such as the
adipose tissue, blood, and bone marrow. Intra-myocardial transplantation studies have
shown that the CPCs have a higher protective effect and regenerative potential which
can benefit cardiac repair and regeneration following myocardial ischemic injury. The
potential mechanisms include directly transdifferentiation into functional cardiomyocytes
and endothelial cells, and release of multiple immunomodulatory, anti-apoptotic and
proangiogenic factors (Beltrami et al. 2003; Bu et al. 2009; Leri 2009; Schlueter and
Brand 2012; Goichberg et al. 2014). Recently, several CPC populations have been
isolated and identified based on their differentiation potential and the specific surface
markers such as c-kit+, Islet-1+, SCA-1+, WT-1+, CDCs, and SP cells (Mayfield et al.
2014; Le and Chong 2016). However, the numbers of resident CPCs in adult heart are
very limited compared with the numbers in the neonatal heart (Beltrami et al. 2003;
Hesse et al. 2014; Le and Chong 2016). Unlike adult hearts, the hearts of neonatal mice
39
have a high regenerative capacity which can allow for complete regeneration and repair
of damaged heart tissue. It is possible that the high regenerative capacity of neonatal
hearts may due to the high levels of resident CPCs.
Direct reprogramming of fibroblasts into functional cardiomyocytes is another
interesting regenerative strategy for replacing lost cardiomyocytes (Inagawa et al. 2012;
Nam et al. 2013; Batty et al. 2016; Kurotsu et al. 2017). Ieda M et al has reported there
are three cardiac specific transcription factors (TBX5, GATA4 and MEF2C) that can
directly reprogram fibroblasts into cardiomyocyte-like cells (Ieda et al. 2010).
Subsequent studies demonstrated that a new transcriptional factor (HAND2), inhibition
of Notch signaling, or activation of Akt can dramatically accelerate the reprogramming
process of fibroblasts into cardiomyocyte-like cells (Nam et al. 2013; Zhou et al. 2015;
Abad et al. 2017). In addition, the combination of miR-1, miR-133, miR-208, and miR-
499 has also been shown to initiate fibroblast reprogramming into functional
cardiomyocytes (Jayawardena et al. 2012; Muraoka et al. 2014). Although stem cell
based therapies have potential benefits to repair and regenerate the damaged heart
tissue, they are still many limitations to their use in clinical practice.
It is well known that the adult mammalian cardiomyocytes are terminally
differentiated cells that irreversibly lose their ability to proliferate (Poss et al. 2002;
Laflamme and Murry 2011; Witman et al. 2011). This limitation explains why the adult
mammalian heart fails to replace damaged heart tissue, and instead exhibits fibrotic
scarring and hypertrophic remodeling in response to ischemic injury. Interesting, recent
evidence indicates that adult mammalian cardiomyocytes can be generated from pre-
existing cardiomyocytes ( Senyo et al. 2013; Ali et al. 2014). In a 14C based study, it has
40 been shown that the annual turnover rate of cardiomyocytes is about 1% at 25 years of age and 0.45% at 75 years of age (Bergmann et al. 2009). This evidence suggests that about 50% of adult human cardiomyocytes are exchanged at a low rate during a normal life span. However, the limited functional recovery in humans following myocardial injury suggests that the capacity of myocardial regeneration is nevertheless limited and fails to fully restore the normal cardiac function. This is likely due to the limited capability of cardiomyocytes to proliferate in the adult human heart following myocardial ischemic injury.
Although the regenerative capacity of mammalian adult heart is very limited, several studies have demonstrated that endogenous cardiac regenerative processes can be facilitated by multiple signaling molecules, including miRNAs, the activation of
Hippo-YAP, PI3K/Akt and Wnt/beta-catenin signaling pathways (Buikema et al. 2013;
Chen et al. 2013; Heallen et al. 2013; Mahmoud et al. 2013; Porrello et al. 2013; Xin et al. 2013; Lin et al. 2015).
TLR Mediated Immune Response in Myocardial Repair and Regeneration
TLR mediated inflammatory responses, triggered by danger associated molecular patterns (DAMPs) that are released upon myocardial I/R injury, play a detrimental role in extending ischemic myocardial injury, cardiac remodeling, and the progression of heart failure (Lange and Schreiner 1994; Kapadia et al. 1998; Thomas et al. 2003; Oyama et al. 2004; Kleinbongard et al. 2011; Ha et al. 2011). However, increasing evidence indicates that TLR mediated inflammatory response, activation and infiltration of immune cells have complex and critical roles in the tissue homeostasis, cardiac tissue repair and regeneration (Lin et al. 2012; Grote et al. 2013; Aurora et al.
41
2014; Carvalho et al. 2014; Kulkarni et al. 2014; Epelman et al. 2015; Frangogiannis
2015; Nelson et al. 2015; Tonkin et al. 2015; Leor et al. 2016; Natarajan et al. 2016;
Pandolfi et al. 2016; Vannella and Wynn 2017). The underlying cellular and molecular mechanisms by which TLR-mediated signaling involved in cardiac repair and regeneration include activation and recruitment of immune cells, elimination of damaged cells, cytokine and growth factor production, activation of cardiac progenitor cells, stimulation of angiogenesis, and promotion of pre-existing cardiomyocyte survival and proliferation (Lin et al. 2012; Grote et al. 2013; Aurora et al. 2014; Carvalho et al. 2014;
Kulkarni et al. 2014; Epelman et al. 2015; Frangogiannis 2015; Nelson et al. 2015;
Tonkin et al. 2015; Leor et al. 2016; Natarajan et al. 2016; Pandolfi et al. 2016; Vannella and Wynn 2017).
Unlike embryonic development, cardiac repair and regeneration can be initialed and triggered by ischemic injury. Recent studies have shown that depletion of macrophages decreased growth factor production (FGF, VEGF, TGF- β) and angiogenesis, impaired fibroblast activation and fibrotic scar formation, and led to severe reparative defects and heart rupture after myocardial ischemic injury (Aurora et al. 2014; Epelman et al. 2015; Frangogiannis 2015; Tonkin et al. 2015; Leor et al.
2016). In neonatal mice, macrophages are recognized as necessary for heart regeneration by stimulating preexisting cardiomyocyte proliferation and neovascularization in responses to ischemic injury (Aurora et al. 2014; Frangogiannis
2015; Leor et al. 2016). In the neonatal heart, there are two different types of macrophages: embryo-derived macrophages (MHC-IIlowCCR2−) and monocyte derived macrophages (MHC-IIlowCCR2+) (Aurora et al. 2014; Lavine et al. 2014; Dutta et al.
42
2015; Frangogiannis 2015; Leor et al. 2016). Only MHC-IIlowCCR2− macrophages can selectively expand in sufficient amounts to promote neonatal cardiomyocyte proliferation following myocardial ischemic injury. However, in the injured adult heart the numbers of monocytes and MHC-IIhighCCR2+ monocyte-derived macrophages are significantly increased, rather than MHC-IIlowCCR2− macrophages (Lavine et al. 2014; Dutta et al.
2015; Leor et al. 2016). This evidence suggests that immune response involved in heart repair and regeneration depend on multiple factors, including age, species, and immune cell types.
Consistent with the above observations, it has been reported that cardiomyocyte proliferation and heart regeneration are significantly inhibited by immunosuppressive compounds, such as dexamethasone treatment or downregulation of inflammatory cytokines, such as IL-6, IL1β, Ccl3 and Cxcl5 (Lavine et al. 2014; Han et al. 2015;
O'Meara et al. 2015; Gay et al. 2016; Leor et al. 2016).
Since TLRs are major receptors for the induction of innate immune and inflammatory responses, TLR mediated signaling pathway could play an important role for cardiac repair and regeneration following ischemic injury. Recent studies have shown that TLR3 mediated immune signaling contributes to somatic cell nuclear reprogramming and de-differentiation (Lee et al. 2012; Sayed et al. 2015). In addition, dsRNA mediated TLR3 activation plays a critical role in skin regeneration (Nelson et al.
2015; Natarajan et al. 2016). However, the role of TLR3 in cardiac repair and regeneration has not been investigated. In this dissertation, we provide compelling evidence that TLR3 plays an important role in neonatal heart repair and regeneration following myocardial ischemic injury. The underlying cellular and molecular mechanisms
43
involve the promotion of glycolytic metabolism, the activation of Hippo-YAP signaling
pathway, and the expression of microRNAs.
Glycolytic Metabolism in Heart Regeneration
Glycolysis is the ten step metabolic pathway that converts glucose into pyruvate,
adenosine triphosphate (ATP), and reduced nicotinamide adenine dinucleotide (NADH)
(Jones and Bianchi 2015). A surge of studies indicated that tumor cells or other rapidly
proliferating cells exhibit high levels of glycolysis during proliferation, and suggested that
glycolytic metabolism is vital for cell proliferation (Vander Heiden et al. 2009; Krisher
and Prather 2012). Glycolytic metabolism provides the majority of chemical precursors
required for the synthesis of nucleotides, amino acids and lipids which are necessary
building blocks for cell growth and proliferation (Vander Heiden et al. 2009; Krisher and
Prather 2012; Donnelly and Finlay 2015). In addition, glycolytic metabolism also plays
crucial roles in regulating signal transduction and gene expression. It also influences
epigenetic modifications by altering DNA methylation/demethylation and affects protein posttranslational modifications such as acetylation and glycosylation (Donohoe and
Bultman 2012; Hirschey et al. 2015; Arts et al. 2016b; Jaworski et al. 2016).
It is well established that glycolysis is necessary for the reprogramming of somatic cells to induced pluripotent stem cells ( Panopoulos et al. 2012; Zhang et al. 2012;
Shyh-Chang et al. 2013). Moreover, metabolic rewiring is involved in immune cells activation, differentiation and dendritic cell maturation (Cheng et al. 2014; Everts et al.
2014; O'Neill 2014; Arts et al. 2016b). In addition, metabolic reprogramming is necessary for β-glucan induced innate immune memory which is termed as trained
44 immunity (Cheng et al. 2014; Arts et al. 2016a). Collectively, glycolytic metabolism is an important modulator for cell fate decision which is particularly important for tissue repair and regeneration.
Recent studies have suggested that glycolytic metabolism is tightly linked to multiple cellular signaling pathways associated with cell proliferation and differentiation.
These signaling include the Hippo-YAP, PI3K/Akt/mTOR, Wnt/beta-catenin, and TLR signaling pathways (Everts et al. 2014; O'Neill 2014; Courtnay et al. 2015; Enzo et al.
2015; Mo et al. 2015; Karner and Long 2017). Aerobic glycolysis increases YAP/TAZ transcriptional activity. On the other hand, glucose starvation or the glycolysis inhibitor
2-DG induces cellular energy stress which increases AMPK dependent LATS activation and inhibits YAP/TAZ activation (DeRan et al. 2014; Enzo et al. 2015; Mo et al. 2015).
In addition, administration of methylglyoxal, a metabolite of glycolysis, increases YAP activation and nuclear translocation by increasing Hsp90 glycation and LATS1 degradation (Nokin et al. 2016).
A hypoxic environment has been reported to be beneficial for promoting cardiomyocyte proliferation and heart regeneration. The mechanisms involve reducing oxidative induced DNA damage and cell cycle arrest. This observation suggests that glycolysis may be involved in hypoxia induced cardiomyocyte proliferation and heart regeneration (Kimura et al. 2015; Nakada et al. 2017). During neonatal heart development, glycolysis is the predominate metabolism for neonatal cardiomyocyte proliferation. However, mitochondrial fatty acid β-oxidation (FAO) and oxidative phosphorylation (OXPHOS) is the primary energy source for terminally differentiated mature cardiomyocytes (Lopaschuk et al. 1991; Kimura et al. 2015). This suggests that
45
cellular metabolism especially glycolytic metabolism may play an important role in
cardiomyocyte proliferation and heart regeneration.
However, the role of glycolysis in neonatal cardiomyocyte proliferation and
regeneration has not yet been defined. Importantly, we found that treatment of
cardiomyocytes with TLR3 ligands promotes metabolic switching from oxidative
phosphorylation to glycolysis. In this dissertation, we demonstrated that TLR3 is
essential for neonatal heart regeneration and explained the underlying mechanisms
involving glycolytic metabolism, TLR3 mediated YAP1 activation, miRNA expression
and cardiomyocytes proliferation.
MicroRNAs and Heart Regeneration
Growing evidences suggest that microRNAs play an important role in embryonic
and post-natal heart development and maturation (Callis and Wang 2008; Wang 2010;
Yan and Jiao 2016). Specific knockout of miRNAs processing enzymes (Dicer or
DGCR8) in cardiac progenitor cells leads to heart failure and embryonic lethal, suggesting that miRNAs are necessary for cardiac embryonic development (Chen et al.
2008; Chapnik et al. 2012). MiR-1 and miR-133 are muscle specific miRNAs and are expressed at high levels in cardiomyocytes (Liu et al. 2007). MiR-1 serves as an
important regulator for heart development and its deficiency leads to embryonic lethality
due to stunted cardiomyocyte maturation, pericardial edema and cardiac dysfunction
(Sayed et al. 2007; Zhao et al. 2007; Callis and Wang 2008; Wystub et al. 2013). In
contrast, cardiac specific expression of miR-1 results in heart development arrest (Zhao
et al. 2007; Callis and Wang 2008; Wystub et al. 2013). MiR-133 also plays an
46
important role in the heart development and maturation by regulating cardiomyocyte proliferation and maintaining cardiac progenitor cells (Wystub et al. 2013; Izarra et al.
2014). Collectively, these studies suggest that miRNAs are critical regulators of heart development and postnatal maturation.
Importantly, miRNAs are not only involved in the progression of heart development, but also served as important regulators in cardiac regeneration. For
example, Inhibition of miR-34a improves the cardiac regeneration after ischemic injury
by targeting BCL2, CyclinD1 and Sirt1, leading to cardiomyocyte proliferation and
survival (Yang et al. 2015). The tumor suppressor miRNAs (miR-15 and miR-195) are highly upregulated during heart development and have been shown to be important for postnatal cardiomyocyte cell cycle arrest (Porrello et al. 2011a; Porrello et al. 2013).
Overexpression of miR-195 leads to premature cell cycle arrest in the developing heart
and results in ventricular septal defects (Porrello et al. 2011a). In contrast, inhibition of
both miRs significantly promotes cardiomyocyte proliferation and heart regeneration
(Porrello et al. 2011a; Porrello et al. 2013). Overexpression of miR-590-3P and miR-
199-3p has been reported to significantly induce cardiomyocyte proliferation and heart
regeneration in adult mice (Eulalio et al. 2012). In addition, cardiac specific
overexpression of miR-17-92 protects heart from myocardial ischemic injury and
significantly promotes cardiomyocyte proliferation in adult hearts (Chen et al. 2013).
MiR-302-367cluster is highly expressed during early cardiac development and also
contributes to adult cardiomyocyte dedifferentiation and proliferation by targeting
several components of Hippo-YAP signaling pathway, MST1, LATS2 and MOB1 (Tian
et al. 2015).
47
These observations indicate that the delivery of miRNAs into damaged heart tissue or endogenous modulation of specific miRNAs expression could be a useful approach to stimulate cardiomyocyte proliferation, cardiac regeneration and heart functional recovery following ischemic injury.
Hippo-YAP Signaling Pathway and Heart Regeneration
The Hippo-YAP signaling pathway is highly conserved between Drosophila and mammals and plays an important role in controlling organ size and tissue homeostasis
(Zhao et al. 2011; Yu et al. 2015a). Mutation of the Hippo-YAP signaling pathway kinases (HPO and WTS), and upstream regulators (mer, kibra, ft. ets) or Yki overexpression results in overgrowth of wings, eyes and other appendages in
Drosophila (Justice et al. 1995; Wu et al. 2003; Lai et al. 2005; Harvey et al. 2003; Zhao et al. 2011; Yu et al. 2015a). In mammals, liver specific knockout of Hippo-YAP pathway kinases or related adaptor factors (Mob1, Sav1, MST1/2, or LATS1/2), or tissue specific
YAP1 overexpression leads to liver enlargement and liver tumor development by increasing cell proliferation and reducing apoptosis (Lai et al. 2005; Song et al. 2010;
Zhao et al. 2011; Yimlamai et al. 2014; Yu et al. 2015a; Patel et al. 2017).
Embryonic deletion of SAV1, MST1/2, or LATS1/2 or YAP1 overexpression leads to cardiomyocyte hyper-proliferation and heart enlargement (Xin et al. 2011; Zhao et al.
2011; Heallen et al. 2013; Yu et al. 2015a). In contrast, heart specific YAP1 or
YAP1/TAZ deletion results in heart hypoplasia. In adult mouse hearts, high levels of
YAP1 activation could enhance cardiomyocyte proliferation and heart regeneration following heart ischemic injury (Xin et al. 2011; Zhao et al. 2011; Heallen et al. 2013; Xin et al. 2013; Lin et al. 2015; Yu et al. 2015a). The role of Hippo-YAP signaling in
48 cardiomyocyte proliferation and heart regeneration has been clearly established, but the mechanisms by which YAP/TAZ regulate cardiomyocyte proliferation has not yet been completely defined. It is well established that miRNAs play a critical role in myocardial/reperfusion injury by regulating cellular proliferation, migration, differentiation, survival, apoptosis, as well as tissue remodeling, inflammatory responses, angiogenesis, fibrosis as we mentioned before. Recent evidence has shown that miRNAs also play an important role in neonatal and adult myocardial regeneration by regulating cardiomyocyte proliferation. In this dissertation, we defined that miR-152 expression was significantly increased following TLR3 ligand (Poly I:C administration) through a YAP1 dependent mechanism. We demonstrated that miR-152 is an important potential target in TLR3 mediated YAP1 mediated cardiomyocyte proliferation and heart regeneration.
Questions to be Answered in this Dissertation
As mentioned in the introduction section, the TLR mediated NF-κB signaling pathway plays a deleterious role in myocardial I/R injury (Chao 2009; Ha et al. 2011).
Our previous studies demonstrated that deficiency of either TLR3 or TLR4 significantly protects the myocardium from acute I/R induced injury by decreasing acute inflammatory response and increasing activation of PI3K/Akt signaling (Hua et al. 2007;
Lu et al. 2014). Interestingly, we and others also found that modulation of TLRs by their specific ligands, such as Pam3CSK4 for TLR2, Poly I:C for TLR3 and LPS for TLR4 resulted in the protection against I/R induced myocardial injury (Ha et al. 2008; Ha et al.
2010; Cao et al. 2013). Mechanistic studies suggest that modulation of TLRs
49 significantly decreases acute inflammatory response and promotes activation of
PI3K/Akt signaling in the myocardium subjected to I/R injury (Ha et al. 2008; Ha et al.
2010; Cao et al. 2013). The question is, why does a deficiency or activation of specific
TLRs(TLR2, TLR3, and TLR4) result in a similar protective effect on the myocardium in response to I/R challenge? As we mentioned above, miRNAs are the fine tuners of TLR signaling pathway(O'Neill et al. 2011). We demonstrated that treatment with TLR2 ligand, Pam3CSK4 , increases the expression of miR-146a serves as a negative regulator for TLR mediated pathway by targeting IRAK1 and TRAF6 (Wang et al. 2013).
Indeed, delivery of lentivirus expressing miR-146a into the myocardium significantly attenuates I/R-induced NF-κΒ activation by targeting IRAK1 and TRAF6 and thus deceasing inflammatory cytokine production and myocardial injury (Wang et al. 2013).
These results have answered the question of why TLR modulation attenuates I/R injury trigged by acute inflammatory responses and cytokine production.
Our previous studies also showed that the cardioprotective effect of TLR modulation is mediated by activation of the PI3K/Akt signaling pathway. To address how modulation of TLRs activates PI3K/Akt signaling, we examined several miRNAs and observed that TLR2 modulation significantly enhances the expression of miR-214 and miR-486 (Wang et al. 2016). Both miR-214 and miR-486 directly target PTEN, leading to an activation of the PI3K/Akt signaling pathway. In this dissertation, we provide compelling evidence to show that miR-214 plays an important role in mediating the crosstalk between the TLR/NF-κB and PI3K/Akt signaling pathways during myocardial
I/R challenge. We also demonstrated that increased expression of miR-214 activates
PI3K/Akt signaling pathway in the myocardium and protects it from I/R induced injury. In
50 addition, we found that miR-125b also serves as a protective effect in I/R induced myocardial injury. It directly targets TRAF6 and TNF-α and therefore downregulates the
TLR mediated NF-κB pathway. In addition, increased expression of miR-125b markedly reduces the expression of the tumor suppressor protein p53 and mitochondrial related pro-apoptotic protein BAK1 in the myocardium following myocardial I/R injury.
Heart failure is the leading cause of death in the United States and throughout the world ( Benjamin et al. 2017). At present, there is no effective treatment approaches for heart failure patients (Houyel et al. 2017). In our previous studies, we found that there is a crosstalk between the TLR/NF-κB and PI3K/Akt signaling pathways during myocardium I/R injury. As mentioned in the introduction, activation of TLRs and
PI3K/Akt signaling contribute to the activation of Hippo-YAP signaling pathway which plays a critical role in cardiomyocyte proliferation and heart regeneration. In addition,
TLR3 mediated innate immune responses play a fundamental role in cell reprogramming and skin regeneration (Lin et al. 2012; Nelson et al. 2015). However, the role of TLR3 in heart regeneration has not been investigated. Therefore, we explored the role of TLR3 in neonatal heart repair and regeneration following myocardial infarction (MI). Unlike adult hearts, neonatal mouse hearts have a high regenerative capacity (Porrello et al. 2011b). Therefore, we employed one day old neonatal mice as our heart regeneration model and determined whether TLR3 is necessary for neonatal heart regeneration and functional recovery following myocardial infarction. In t this dissertation, we demonstrated that TLR3 is required for neonatal heart repair and regeneration after myocardial ischemic injury. We then investigated the mechanisms by
51
which TLR3 is an essential for neonatal heart repair and regeneration following
myocardial infarction.
Glycolysis is predominant metabolism for energy production in zebrafish and
neonatal hearts and is a necessary for somatic cell reprogramming and dedifferentiation
(Lopaschuk et al. 1991; Zhang et al. 2012). Recent studies have reported that TLR3 ligand, Poly I:C, promotes the metabolic reprogramming from oxidative phosphorylation to glycolysis (Cheng et al. 2014; Everts et al. 2014; O'Neill 2014). We investigated the role of TLR3 mediated glycolysis increasing in neonatal cardiomyocyte proliferation and
heart regeneration.
As mentioned in the introduction, YAP1 is an important downstream effector of
the Hippo signaling pathway and plays a critical role in cardiomyocyte proliferation and
heart regeneration (von et al. 2012; Xin et al. 2013; Lin et al. 2015). In this dissertation,
we found that stimulation of TLR3 by its ligand significantly increases YAP1 activation
and its nuclear translocation. YAP1 is necessary for TLR3 induced cardiomyocytes
proliferation. In addition, we demonstrated that TLR3 modulation enhanced YAP1
activation is mediated by glycolytic dependent mechanism.
Several research groups have report the role of YAP1 in cardiomyocyte
proliferation (von et al. 2012; Xin et al. 2013; Lin et al. 2015). However, the mechanism
by which YAP1 activation regulates cardiomyocyte proliferation and heart regeneration
remains elusive. YAP1 is a con-transcriptional factor that interacts with its DNA binding
partner TEAD and regulates miRNA biogenesis and expression (Chaulk et al. 2014).
Interestingly, we observed that stimulation of TLR3 significantly increases the
52
expression of miR-152 which is positively correlated with the YAP1 activation. We then
addressed several important questions: what is the role of YAP1 in TLR3 mediated miR-
152 expression? Does miR-152 contribute to TLR3 mediated YAP1 dependent
cardiomyocyte proliferation? What is the mechanism by which miR-152 regulates
cardiomyocyte proliferation? The results presented in this dissertation have answered
the above questions.
Overall, the studies in this dissertation focus on the role of TLRs, microRNAs, and the PI3K/Akt and Hippo-YAP signaling pathways in myocardial I/R injury and
neonatal heart repair and regeneration following myocardial infarction. We provide
compelling evidence to demonstrate that miRNAs and PI3K/Akt, as well as Hippo-Yap
signaling pathway, regulate innate immune and inflammatory responses, cell survival
and proliferation. This could provide novel strategies for therapeutic treatments in
patients with cardiac ischemic injury and heart failure.
53
CHAPTER 2
MICRORNA-125B PROTECTS AGAINST MYOCARDIAL ISCHEMIA/REPERFUSION
INJURY VIA TARGETING P53-MEDIATED APOPTOTIC SIGNALING AND TRAF6
Xiaohui Wang1, Tuanzhu Ha1, Jianghuan Zou2, Danyang Ren1, Li Liu3, Xia Zhang1,
John Kalbfleisch4, Xiang Gao2, David Williams1, Chuanfu Li1
Departments of Surgery1 and Biometry and Medical Computing4, James H. Quillen
College of Medicine, East Tennessee State University, Johnson City, TN 37614
Animal Model Research Center2, Nanjing University, Nanjing, China, 210093
Department of Geriatrics3, The First Affiliated Hospital of Nanjing Medical University,
Nanjing 210029, China
Running head: Attenuation of myocardial ischemic injury by microRNA-125b
Corresponding author:
Chuanfu Li, M.D. Department of Surgery East Tennessee State University Campus Box 70575 Johnson City, TN 37614-0575 Tel 423-439-6349 FAX 423-439-6259 Email Address: [email protected]
Number of words: 5,934
54
Introduction
It has well been documented that activation of NF-κB mediated by Toll-like receptor/interleukin-1 receptor (TLR/IL-1R) contributes to myocardial ischemia/reperfusion (I/R) injury(1-4). Inhibition of NF-κB binding activity has been shown to protect against myocardial I/R injury(2-6). The protective effects involve inhibition of innate immune and inflammatory responses and attenuated I/R-induced cardiac myocyte apoptosis(2-6). However, the mechanisms by which inhibition of NF-κB
binding activity decreases innate immune and inflammatory responses and attenuates
cardiac myocyte apoptosis during myocardial I/R are still unclear.
Recent studies have demonstrated that activation of NF-κB regulates microRNA
expression which, in turn, negatively regulate NF-κB binding activity(7, 8), thereby
decreases in the innate immune and inflammatory responses(9-11). MicroRNAs (miRs)
are 21 to 23 nucleotide non-coding RNA molecules and have been identified as novel
regulators of gene expression at the post-transcriptional level by binding to target
messenger RNAs(9-14). MicroRNAs have been demonstrated to play a critical role in the negative regulation of innate immune and inflammatory responses by regulation of
NF-κB binding activity(9-11). Importantly, recent studies have shown that NF-κB activation regulates the expression of microRNAs(7, 8), including miR-146, miR-155
and miR-21, etc., while these miRs, in turn, down regulate NF-κB binding activity. miR-
21 has been demonstrated to play a protective role in myocardial I/R injury(15). We have reported that increased expression of miR-146a significantly decreases myocardial infarct size and attenuates I/R-induced cardiac dysfunction via down- regulation of NF-κB activation by targeting IRAK1 and TRAF6(16). Collectively, the data
55
suggest that the miRs that regulate TLR/IL-R1 mediated NF-κB activation may be a new
approach for management and treatment of myocardial I/R injury.
MiR-125b is a homolog of lin-4, which is the first miR discovered and an important
regulator of developmental timing in C. elegans(17). Recent studies have shown that
activation of NF-κB decreases the expression of miR-125b(18, 19). Tili et al reported that treatment of Raw 264.7 cell with LPS, a TLR4 ligand, suppresses the expression of miR-125b(18), while miR-125b suppresses TNF-α expression by targeting the 3’- untranslated region of TNF-α mRNA(18, 19). MiR-125b has been reported to play a role in down-regulation of apoptosis by repressing p53 and Bak-1(20, 21). p53 is a tumor suppressor protein which plays a critical role in regulating cell cycle and apoptosis in response to hypoxia and ischemic stress(22, 23). Inhibition of p53-mediated apoptotic signaling significantly reduces I/R-induced myocardial injury(24). We have reported that increased expression of miR-125b in macrophages attenuates hypoxia/reoxygenation induced cell injury(25). However, whether miR-125b serves as a protective role in myocardial I/R injury in vivo has not been investigated. miR-125b has been shown to target TNFα(26) and inhibit p53-mediated apoptotic signaling(27), therefore it is possible
that miR-125b serves a protective role in myocardial I/R injury.
In the present study, we examined the role of miR-125b in myocardial I/R injury.
We observed that increased expression of miR-125b in the myocardium significantly decreases myocardial infarct size and prevents I/R-induced cardiac dysfunction. The
56
mechanisms involve the inhibition of I/R-induced activation of NF-κB and the prevention of I/R-activated p53 mediated apoptotic signaling in the myocardium.
Materials and Methods
Animals
Male wild type (WT) C57BL/6J mice were obtained from Jackson Laboratory. The
experiments outlined in this manuscript conform to the Guide for the Care and Use of
Laboratory Animals published by the National Institutes of Health (NIH Publication, 8th
Edition, 2011). The animal care and experimental protocols were approved by the
ETSU Committee on Animal Care.
qPCR assay of microRNAs (miRs)
miRs were isolated using the mirVanaTM miR isolation kit (Ambion)(16, 25)
Construction of miR-125b into lentivirus expressing system
MiR-125b, mature sequence mmu-miR-125b-5p (MIMAT0000136), was constructed into lentivirus expression vector using a lentivirus expressing system
(Invitrogen corporation) as described previously(16, 25) (Supplement Data, Methods section).
Transgenic mice
Transgenic mice (Tg) with overexpression of miR-125b were developed with
C57BL/6J background (Supplemental data, Methods section).
57
In vitro experiments
The H9C2 rat cardiomyoblasts were obtained from the American Type Culture
Collection (Rockville, MD) and was maintained in Dulbecco’s Modified Eagle’s Medium
o (DMEM) supplemented 10% fetal bovine serum (FBS) under 5% CO2 at 37 C(31). The cells were plated in 6 well plates at 1 x 105 cells/well. The cells were transfected with lentivirus expressing miR-125b (LmiR-125b) or lentivirus expressing vector that served as control (LmiR-con). The lentivirus expressing vector contains a non-sense miR sequence that allows formation of a pre-miRNA hairpin predicated not to target any known vertebrate gene (Invitrogen Corporation). Stably transfected cells were selected using a Blasticidin resistant marker. The cells were subjected to hypoxia for 2 h followed by reoxygenation (H/R)(25) for 24 h. The cells that were not subjected to H/R served as control (normoxia). There were 3 independent experiments in each group. The cells were harvested at 24 h for isolation of cellular protein.
In separate experiments, adult cardiac myocytes were isolated from 9 male mice as described previously(28). The cells were transfected with miR-125b, miR-scrambled control (miR-con) or anti-miR-125b, respectively carried by exosomes that were isolated from bone marrow stromal cells (BMSCs)(29) (Supplement data, Methods section). The cardiac myocytes were subjected to hypoxia (2 hrs) followed by reoxygenation for 24 hrs. Cardiac myocytes were harvested for analysis of the effect of miR-125b on H/R- induced cardiac myocyte injury.
58
microRNA microarray
Cardiac myocytes were isolated from 3 adult mice (28) and subjected to hypoxia (2
hrs) followed by reoxygenation (24 hrs) (Supplement data). The cells were harvested
and total RNA was isolated for microRNA microarray analysis (Supplement data,
Methods section).
In vivo transfection of lentivirus expressing miR-125b (LmiR-125b) into mouse hearts
Lentivirus expressing miR-125 or miR-125b mimics were delivered into the
myocardium of mice as described previously(16, 30) (Supplemental data, Methods
section).
Induction of myocardial I/R injury
Myocardial I/R injury was induced seven days after transfection of LmiR-125b or
Lmi-con as described previously(2, 3, 31) (Supplemental data, Methods section).
In situ apoptosis assay
Myocardial apoptosis was examined as described previously (2, 3, 31, 32) using the in situ cell death detection kit (Roche, USA). Three slides from each block were evaluated for percentage of apoptotic cells and four fields on each slide were examined
at the border areas using a defined rectangular field area with 20x magnification. A total
100 nuclei were accounted. Numbers of apoptotic cardiac myocytes are presented as
the percentage of total cells counted.
59
Measurement of cell viability and LDH activity
Cell viability was assessed by measuring mitochondrial dehydrogenase activity using
the MTT assay kit (Sigma). Cell injury was assessed by measurement of lactate
dehydrogenase (LDH) activity in culture medium using a commercial kit (Cytotoxicity
Detection Kit (Sigma).
Western Blot
Western blot was performed as described previously(2, 3, 31). The primary
antibodies (anti-Fas, anti-p-53, anti-Bax, Bak-1, and TRAF6) and peroxidase- conjugated secondary antibody were purchased from Cell Signaling Technology, Inc.
The signals were quantified using the G:Box gel imaging system by Syngene (Syngene,
USA, Fredrick, MD).
Electrophoretic mobility shift assay (EMSA)
Nuclear proteins were isolated from heart samples as previously described(2, 3, 31).
NF-κB binding activity was measured using a LightShift Chemiluminescent EMSA kit
(Thermo Fisher Scientific, Waltham, MA).
Caspase-activity
Caspase-3/7 and -8 activities in heart tissues were measured as described
previously(33) using a Caspase-Glo assay kit (Promega).
60
ELISA for cytokine assay
The levels of cytokines (TNFα and IL-1β) were measured by ELISA using OptEIA
cytokine kits according to instructions provided by the manufacture (BD Biosciences).
Infiltration of neutrophils into the myocardium
Neutrophil accumulation in heart tissues was examined by staining with anti-
neutrophil marker antibody (NIMP-R14, Santa Cruz Biotechnology) as described
previously(34) (Supplemental data, Methods section).
Statistical analysis
The data is expressed as mean ± SD. Comparisons of data between groups were
made using one-way analysis of variance (ANOVA), and Tukey’s procedure for multiple-
range tests was performed. P< 0.05 was considered to be significant.
Results
Hypoxia/reoxygenation decreased miR-125b expression via NF-κB activation in H9C2
cardiomyoblasts.
We examined the effect of hypoxia/reoxygenation (H/R) on the expression of
miR-125b in H9C2 cardiomyoblasts. As shown in Figure 2.1A, hypoxia (2 hrs) followed by reoxygenation (24 hrs) resulted in decreases in the levels of miR-125b by 33% compared with the normoxic control. To investigate whether miR-125b expression is regulated by NF-κB activation, we measured NF-κB binding activity following H/R.
Figure 2.1B shows that H/R induced increases in NF-κB binding activity by 27%
61
compared with the normoxic control. Treatment of the cells with an antioxidant,
pyrrolidine dithiocarbamate (PDTC), which has been shown to inhibit NF-κB
activation(35), significantly increases the expression of miR-125b in normoxic control and in H/R cells, when compared with untreated normoxia and H/R group, respectively.
Administration of PDTC also significantly decreased NF-κB binding activity following
H/R.
Figure 4Figure 2. 1 H/R decreases miR-125b expression and increased NF-ƘB binding activity in H9C2 cells. H9C2 cells were treated with or without PDTC 15 min prior to hypoxia (2 h) followed by reoxygenation (24 h). Cells were harvested. miRs were isolated from harvested cells and miR-125b expression was examined by quantitative polymerase chain reaction (qPCR). Nuclear proteins were isolated for analysis of NF- κB-binding activity. H/R decreases the expression of miR-125b (A, P = 0.001) and increases NF-κB-binding activity (B, P = < 0.001). LPS treatment decreases the expression of miR-125b (C, P = 0.006). H9C2 cells were treated with PDTC or NAC 15 min before LPS stimulation (24 h). The levels of miR-125b were measured by qPCR. There were three independent experiments in each group. *P < 0.05 compared with indicated groups.
62
Figure 2.1C shows that LPS stimulation significantly induced decreases in miR-
125b expression in H9C2 cells. However, treatment of the cells with antioxidants, PDTC
or N-acetyl cysteine (NAC), prevented LPS-mediated suppression of miR-125b
expression. Collectively, the data suggests that miR-125b expression during H/R is regulated by NF-κB activation.
We also analyzed the effect of H/R on microRNA expression in adult cardiac myocytes. MicroRNA array showed that 43 miRNAs were differentially expressed in the cardiac myocytes after H/R at a false discovery rate of 0.05, when compared with non-
H/R cells (normoxia) (supplemental data, Tables 1 and 2).
Increased expression of miR-125b attenuated hypoxia/reoxygenation-induced cell injury
in H9C2 cardiomyoblasts.
To determine whether miR-125b plays a role in the protection against H/R-induced
cell injury, we generated stably transfected H9C2 cells with LmiR-125b or LmiR-control
(LmiR-Con). The stably transfected cells were subjected to hypoxia (2 h) followed by
reoxygenation (24 h). Untransfected H9C2 cells served as control. As shown in Figure
2.2A, transfection of H9C2 cells with LmiR-125b significantly increased the levels of
miR-125b in the cells. Figure 2.2B shows that H/R induced increases in LDH activity by
5.0 fold compared with non-H/R (normoxia) groups. However, H/R-induced LDH activity
in H9C2 cells was significantly attenuated by LmiR-125b transfection. LmiR-Con transfection did not affect H/R-induced LDH activity in H9C2 cells. Figure 2.2C shows that H/R markedly decreased cell viability (51%) compared with untreated normoxic cells. However, H/R-induced decrease in cell viability was significantly attenuated by
63
LmiR-125b transfection when compared with untreated H/R cells. Transfection of LmiR- con did not alter H/R-decreased cell viability.
Similarly, increased expression of miR-125b in isolated adult cardiac myocytes significantly attenuated H/R-induced cell injury (Figure 2.2D, E and F). In addition, inhibition of miR-125b expression in adult cardiac myocytes increased the susceptible to H/R-induced cell injury (Figures 2.2D, E and F).
We also examined the effect of LmiR-125b transfection on H/R-induced caspase-3 and -8 activities. Figure 2.2G shows that H/R induced caspase-3/7 activity by 79.8% and caspase-8 by 44.2%, when compared with normoxic cells. However, increased expression of miR-125b markedly attenuated H/R-increased caspase-3/7 and
-8 activities. There was no significant difference in caspase-3/7 and -8 activities between LmiR-Con H/R cells and untreated H/R cells. The data suggests that increased expression of miR-125b plays a protective role in H/R-induced cellular injury.
64
Figure 5 Figure 2.2. Increased expression of miR-125b attenuates H/R-induced cell injury and cell death in H9C2 cardiomyoblasts and adult cardiac myocytes. Stably transfected H9C2 cells with LmiR-125b or LmiR-con were subjected to hypoxia (2 hrs) followed by reoxygenation (24 hrs). H9C2 cells that were not transfected served as control. (A) Increased levels of miR-125b after transfection of cells with LmiR-125b. Overexpression of miR-125b decreased LDH activity (B, p=<0.001), increased cell viability (C, p=<0.001), and attenuated caspase-3/7 and caspase-8 activities (G, p=0.003) following H/R. There were 3 independent experiments in each group. * p<0.05 compared with indicated groups. # p<0.05 compared with control H/R group. Cardiac myocytes were isolated from adult male mice and transfected with miR-125b mimics, anti-miR-125b mimics, or miR-scrambled control (miR-con) that were carried by BMSC-derived exosomes, respectively. Untransfected cells served as control. Twenty-four hrs after transfection, the cells were subjected to hypoxia (2 hrs) followed by reoxygenation (24 hrs). (D) Transfection of cardiac myocytes with BMSC-derived exosomes that loaded with miR-125b mimics significantly increased the levels of miR-125b in cardiac myocytes. Increased expression of miR-125b attenuated H/R-increased LDH activity (E) and H/R-decreased cell viability (F). Inhibition of miR-125b expression by transfection of anti-miR-125b mimics increased the susceptibility to H/R-induced cell injury (E) and H/R-decreased cell viability (F). There were 3 independent experiments in each group. * p <0.05 compared with indicated groups. # p<0.05 compared with control H/R group.
65
MiR-125b suppresses p53 and Bak-1 expression in H9C2 cardiomyoblasts.
To understand the mechanisms by which overexpression of miR-125b attenuated H/R- induced caspase-3/7 and -8 activities, we examined the effect of miR-125b on p53 and Bak-1 expression in H9C2 cardiomyoblasts in the presence and absence of H/R.
66
Figure 6Figure 2.3. Increased expression of miR-125b decreased p53 and Bak-1 expression in H9C2 cells and adult cardiac myocytes. LmiR-125b or LmiR-con stably transfected H9C2 cells were subjected to hypoxia (2 h) followed by reoxygenation (24 h). Untransfected H9C2 cells served as control. Overexpression of miR125b suppresses the expression of p53 (A, p=<0.001) and Bak-1 (B, p=<0.001) expression. (C, p=0.003) The supernatants were harvested for analysis of TNFα. There were 3 independent experiments in each group. * p<0.05 compared with indicated groups. #, & p<0.05 compared with normoxic groups.
Cardiac myocytes were isolated from adult male mice and transfected with miR-
125b mimics, anti-miR-125b mimics, or miR-scrambled controls (miR-con) that were carried by BMSC-derived exosomes, respectively. Untransfected cells served as control. Twenty-four hrs after transfection, the cells were subjected to hypoxia (2 hrs) followed by reoxygenation (24 hrs). Increased expression of miR-125b inhibited expression of p53 (C) and Bak1 (D) in the presence and absence of H/R. Inhibition of miR-125b expression by transfection of anti-miR-125b mimics increased the expression of p53 (C) and Bak1 (D) in the presence and absence of H/R. There were 3 independent experiments in each group. * p< 0.05 compared with indicated groups. # p
<0.05 compared with non-transfected control groups.
Figure 2.3 shows that the levels of p53 (A) and Bak-1 (B) were markedly lower in
LmiR-125b transfected normoxic cells than in normoxic control cells. H/R increased the levels of p53 (64.7%) and Bak-1 (91.3%) compared with normoxic control cells. The levels of p53 and Bak-1 in LmiR-125b transfected cells were also increased following
H/R stimulation. However, the levels of p53 and Bak-1 in LmiR-125b H/R cells were significantly lower by 49.3% and 42.5% compared with untransfected H/R cells and
67
were comparable with normoxic control group. LmiR-Con transfection did not alter H/R-
induced increases in p53 and Bak-1 expression.
Increased expression of miR-125b in isolated adult cardiac myocytes inhibited
H/R-increased expression of p53 and Bak1. In contrast, inhibition of miR-125b
expression in cardiac myocytes increased expression of p53 and Bak1 expression
(Figure 2.3C and D).
H/R also induced increases in TNFα production in the cardiomyoblasts compared
with normoxic control (Figure 2.3E). TNFα interacts with TNF receptors (TNFRs),
resulting in activation of extrinsic apoptotic signaling(37). However, increased
expression of miR125b prevents H/R-induced increases in TNFα production (Figure
2.3C).
In vivo increased expression of miR-125b decreased infarct size and improved cardiac
function following myocardial I/R.
To examine whether increased expression of miR-125b will induce protection against myocardial I/R injury, we transfected mouse hearts with LmiR-125b or LmiR-
Con before the hearts were subjected to I/R. Figure 2.4A shows that the green fluorescent protein (GFP) that is carried by LmiR-125b or LmiR-Con is mainly expressed in the myocardium. qPCR data showed the levels of miR-125b in LmiR-125b transfected hearts were significantly increased by 8.2 fold compared with LmiR-Con transfected hearts (Fig. 2.4B). Figure 2.4C shows that I/R induced significant injury as denoted by infarct size in untreated hearts. In contrast, infarct size was significantly reduced (60%) following I/R in LmiR-125b transfected mice compared with the
68
untreated I/R group. LmiR-Con transfection did not alter I/R-induced myocardial infarct size.
Figure 7Figure 2.4. LmiR-125b transfection protects the myocardium from I/R injury. Mouse hearts were transfected with either LmiR-125b or LmiR-con, respectively. Seven days after transfection, hearts were harvested and sectioned. (A) Green fluorescent protein expression was viewed using a fluorescent microscope (Green) and GFP
69
expression was confirmed by staining with anti-GFP antibody (Red). (B) Increased expression of miR-125b in the myocardium 7 days after LmiR-125b transfection. (C) Increased expression of miR125b by transfection of LmiR-125b for 7 days reduced myocardial infarct size (p=<0.001). The infarct area (white) and the area at risk (red + white) from each section were measured using an image analyzer. Ratios of risk area vs. left ventricle area (RA/LV) and infarct area vs. risk area (IA/RA) were calculated and are presented in the graphs. Photographs of representative heart sections are shown above. (D) Increased expression of miR-125b by transfection of LmiR-125b for 7 days attenuated I/R-induced cardiac dysfunction (p=<0.001). Cardiac function was examined by echocardiography before (Baseline), 3 and 7 days after I/R. There were 6-8 mice in each group. * p<0.05 compared with indicated groups.
We also examined the effect of increased expression of miR-125b on cardiac
function following myocardial I/R. As shown in Figure 2.4D, ejection fraction (EF%) and
fractional shortening (%FS) in untreated I/R hearts were significantly reduced by 39.6%
and 44.6% on day 3 and by 26.8% and 32.4% on day 7 after myocardial I/R compared
with baseline. However, I/R-induced cardiac dysfunction was prevented by LmiR-125b
transfection. EF% and %FS values in LmiR-125b transfected mice were not significantly
decreased at 3 and 7 days after myocardial I/R compared with LmiR-125b baseline.
Transfection of miR-Con did not alter I/R-induced cardiac dysfunction.
I/R-induced myocardial apoptosis was attenuated by LmiR-125b transfection.
Cardiac myocyte apoptosis contributes to myocardial I/R injury(38). We examined
the effect of increased expression of miR-125b on I/R-induced myocardial apoptosis.
Figure 2.5A shows that I/R markedly induced myocardial apoptosis compared with
sham control. In LmiR-125b transfected mice, I/R-induced myocardial apoptosis was
significantly attenuated, when compared with the untreated I/R group (12.0 ± 2.87% vs.
28.5 ± 1.72%). LmiR-Con transfection did not affect I/R-induced myocardial apoptosis.
70
Figure 2.5B shows that I/R increased caspase-3/7 (31.4%) and caspase-8
(40.5%) activities in the myocardium compared with sham control. However, increased expression of miR-125b prevented I/R-induced caspase-3/7 and -8 activities compared with the I/R group. There was no significant difference in caspase-3/7 and -8 activities between LmiR-Con I/R mice and the untreated I/R group.
71
Figure 8Figure 2.5 Transfection of LmiR-125b attenuates I/R-induced myocardial apoptosis. Mice were transfected with LmiR-125b or LmiR-control for 7 days before the hearts were subjected to myocardial ischemia (45 min) followed by reperfusion (4 hrs). (A) Myocardial apoptosis were examined by the TUNEL assay in the heart sections. DAPI stains nucleus (blue color) and TUNEL positive cells show green fluorescence. The bar graph shows the percent apoptotic cells (p=<0.001). (B) Increased expression of miR-125b attenuated I/R-induced caspase-3/7 and -8 activities in the myocardium (p=0.002). (C) Increased expression of miR-125b prevents I/R-increased p53, Bak-1, Bax, and FasL levels in the myocardium (p=<0.001). There were 5 mice in each group. * P<0.05 compared with indicated groups. # p< 0.05 compared with untreated I/R group.
72
Transfection of LmiR-125b prevented the increase in p53, Bak-1, Bax and Fas levels in
the myocardium following I/R.
To determine the mechanisms by which increased expression of miR-125b- attenuated I/R-induced myocardial apoptosis, we examined the levels of pro-apoptotic effectors including p53, Bak-1, Bax, and Fas in the myocardium. As shown in Figure
2.5C, I/R increased the levels of p53 by 94%, Bak-1 by 72%, Bax by 90%, and Fas by
64.5%, respectively, compared with sham control. LmiR-Con transfection did not alter the levels of pro-apoptotic effectors in the myocardium. However, increased expression of miR-125b prevented the increases in p53, Bak-1, Bax, and Fas levels in the myocardium following I/R. Both p53 and Bak-1 levels in LmiR-125b transfected hearts
were markedly lower than in the untreated sham control.
Increased expression of miR-125b decreased TRAF6 expression and attenuated
neutrophil infiltration in the myocardium.
Activation of TLR-mediated NF-κB signaling contributes to myocardial I/R injury by
promoting the inflammatory responses(2-4). We examined the effect of LmiR-125b transfection on NF-κB activation during myocardial I/R. TRAF6 is an important effector in TLR-mediated NF-κB activation pathway(36). Figure 2.6A shows that the levels of
TRAF6 in LmiR-125b transfected sham and I/R hearts were significantly lower than in untransfected sham and I/R groups. Transfection of LmiR-Con did not affect myocardial
TRAF6 levels in the presence and absence of I/R. I/R significantly induced NF-κB binding activity compared with the sham control (Figure 2.6B) In contrast, increased expression of miR-125b prevented I/R-induced NF-κB binding activity. There was no
73
significant difference in NF-κB binding activity between the untransfected I/R group and
LmiR-Con transfected I/R mice. In addition, we have observed that increased expression of miR-125b significantly attenuated I/R-induced neutrophil infiltration into the myocardium (supplemental data, Figure 2.S1).
Figure 9Figure 2.6. LmiR125b transfection decreases TRAF6 expression and prevents I/R-induced NF-κB binding activity. Mice were transfected with LmiR-125b or LmiR- control for 7 days before the hearts were subjected to myocardial ischemia (45 min) followed by reperfusion (4 h). Increased expression of miR125b suppresses TRAF6 expression (A, p=<0.001) and NF-κB binding activity (B, p=<0.001). There were 5 mice in each group. * p<0.05 compared with indicated groups. # p<0.05 compared with control sham or control I/R group.
Transgenic mice with overexpression of miR-125b protect against myocardial I/R injury.
To confirm our observation, we developed transgenic mice (Tg) with
overexpression of miR-125b. Figure 2.7A shows increased expression of miR-125b in the myocardium of Tg mice. Tg and WT mice were subjected to I/R. Figure 2.7B shows that I/R markedly induced myocardial infarct size in wild type (WT) mice.
74
However, infarct size in Tg mice were significantly reduced by 50% compared with WT
I/R mice. In contrast, inhibition of miR-125b by transfection of anti-miR-125b into the myocardium of WT mice resulted in susceptible to I/R-induced injury. Infarct size was markedly greater than in untreated I/R group (Figure 2.7B). Tg mice also showed prevention of cardiac dysfunction following I/R. As shown in Figure 2.7C, both EF% and
%FS values were significantly decreased by 42.6% and 48.8% in WT mice after myocardial I/R. However, I/R-induced cardiac dysfunction was prevented in Tg I/R mice.
75
Figure 10Figure 2.7. Reduced myocardial infarct size and attenuated cardiac dysfunction in the transgenic mice with overexpression of miR-125b. (A) Increased levels of miR- 125b in the myocardium of transgenic mice (Tg) mice. (B) Tg mice show decreases in myocardial infarct size. Tg and WT mice that were treated with and without anti-miR- 125b or anti-miR-scrambled control were subjected to ischemia (45 min) followed by reperfusion (24 hrs). The hearts were harvested and infarct size was analyzed. Ratios of risk area vs. left ventricle area (RA/LV) and infarct area vs. risk area (IA/RA) were calculated and are presented in the graphs. (C) Tg mice show the prevention of I/R- induced cardiac dysfunction (p=<0.001). Cardiac function was examined by echocardiography before (Baseline) and 24 h after I/R. There were 5 mice in each group. * p<0.05 compared with indicated groups.
Discussion
The present study demonstrates that increased expression of miR-125b in the
myocardium significantly decreased myocardial infarct size and prevented I/R-induced cardiac dysfunction. To the best of our knowledge, this is the first report that miR-125b exerts a protective role in myocardial I/R injury. Inhibition of miR-125b resulted in significant susceptibility to I/R-induced myocardial injury. The mechanisms by which miR-125b protects against myocardial I/R injury involve the prevention of I/R-induced
NF-κB activation and p53-mediated apoptotic signaling. Our data suggest that modulation of miR-125b may be a useful strategy for the induction of cardioprotection.
We have previously reported that scavenger receptor type A (SR-A) deficiency attenuates myocardial I/R injury(25). Interestingly, we have observed that the levels of miR-125b in SR-A deficient mice are significantly greater than in wild type mice(25).
Transfection of macrophages with miR-125b mimics attenuated H/R-induced cell injury(25), indicating that miR-125b may play a protective role in myocardial I/R.
Indeed, we demonstrate in the present study that increased expression of miR-125b
76 attenuates myocardial I/R injury and prevents I/R-induced cardiac dysfunction. In contrast, inhibition of miR-125b expression resulted more injury of the myocardium following I/R. MiR-125b is highly conserved among mammals, vertebrates and nematodes(8). MiR-125b is expressed in several organs including brain, heart, lung, spleen, and skeletal muscle(39). Recent studies have reported that miR-125b expression is regulated by NF-κB activation(40), while miR-125b acts as a negative regulator of the NF-κB pathway by reducing the levels of tumor necrosis factor(18, 41) and by enhancing the stability of the NF-κB inhibitor NKIRAS2 (KBRAS2)(41). We have observed that hypoxia followed by reoxygenation decreased the expression of miR-
125b and increased NF-κB binding activity in H9C2 cells. Inhibition of NF-κB binding activity by antioxidant, PDTC, which has been reported to inhibit NF-κB activation(35), prevents H/R-induced decreases in miR-125b expression. The data indicates that H/R- induced decreases in the expression of miR-125b are mediated, in part, by NF-κB activation.
However, our in vivo data shows that increased expression of miR-125b in the myocardium significantly prevents I/R-induced myocardial NF-κB binding activity.
Importantly, we have observed that the expression of TRAF6 was suppressed by transfection of LmiR-125b. TRAF6 plays a crucial role in the induction of inflammatory response via activation of IκB kinases (IKKs), leading to NF-κB nuclear translocation and activation(36, 42). NF-κB activation regulates inflammatory cytokine expression(36,
42). We have observed that transfection of H9C2 cells with LmiR-125b prevents H/R- induced increases in TNFα production. Our observation is consistent with previous
77
reports showing that TNF-α mRNA is the target for miR-125b(18, 19). Androulidaki et al
(19) and Tili et al (18) reported that LPS, a TLR4 ligand, suppresses macrophage
expression of miR-125b, while miR-125b negatively regulates TNFα expression(18, 19).
Collectively, our data supports the concept that NF-κB activation regulates miR-125b
expression during H/R, while increased expression of miR-125b negatively regulates
NF-κB activation. Therefore, inhibition of NF-κB activation by targeting TRAF6 in the
myocardium could be an important mechanism for miR-125b protection against
myocardial I/R injury. In addition, increased expression of miR-125b also down-
regulated systemic inflammatory responses following myocardial I/R. We also observed
that transfection of LmiR-125b significantly attenuated I/R-induced infiltration of
neutrophils into the myocardium.
Myocardial apoptosis contributes to myocardial I/R injury(38). We have observed that
increased expression of miR-125b significantly attenuated I/R-induced myocardial
apoptosis. The mechanisms by which miR-125b attenuated I/R-induced myocardial
apoptosis involve suppression of p53-mediated apoptotic signaling in the myocardium following myocardial I/R. p53 is a tumor suppressor protein that regulates and interacts with the apoptotic protein Bax. Bax acts as an antagonist against anti-apoptotic Bcl2, resulting in increases in mitochondrial membrane permeability and the release of cytochrome c(22, 23). In addition, apoptotic lipid products serve as chemokines which promote infiltration of inflammatory cells into the myocardium during myocardial I/R(22,
23). Therefore, p53 is a critical pro-apoptotic effector for myocardial apoptosis during myocardial I/R injury(24). Inhibition of p53 expression is an important approach for
78
attenuation of myocardial I/R injury(24). Our in vitro data showed that increased
expression of miR-125b in H9C2 cells and adult cardiac myocytes suppressed the
expression of p53 and Bak-1 in both non-H/R and H/R cells, suggesting that miR-125b targets both p53 and Bak-1 in cardiomyoblasts. In vivo data demonstrated that transfection of the myocardium with LmiR-125b prevents I/R-induced increases in the expression of p53 and Bak-1 in the myocardium. In addition, increased expression of miR-125b also prevents I/R-induced increases in Fas levels and caspase-3/7 and -8 activities in the myocardium. The data indicate that anti-apoptotic properties of miR-
125b include inhibition of both extrinsic and intrinsic apoptotic signaling pathways during myocardial I/R.
In summary, we demonstrated in the present study that miR-125b plays a significant role in the protection against myocardial I/R injury. The mechanisms involve the inhibition of NF-κB activation as well as TNF-α production and the prevention of p53- mediated apoptotic signaling following myocardial I/R. Our data suggest that miR-125b is a target for the induction of protection against myocardial I/R injury.
Funding:
This work was supported by NIH HL071837 to C.L., GM083016 to C.L. and D.L.W.,
GM53522 to D.L.W.
Disclosure: None
79
References
1. Linde A, Mosier D, Blecha F, Melgarejo T. Innate immunity and inflammation -- New frontiers in comparative cardiovascular pathology. Cardiovasc Res 2006;In Press.
2. Li C, Ha T, Kelley J, Gao X, Qiu Y, Kao RL, et al. Modulating Toll-like receptor mediated signaling by (1-->3)-b-D-glucan rapidly induces cardioprotection. Cardiovascular Research 2003;61:538-47.
3. Hua F, Ha T, Ma J, Li Y, Kelley J, Gao X, et al. Protection against Myocardial Ischemia/Reperfusion Injury in TLR4 Deficient Mice is Mediated through a Phosphoinositide 3-Kinase Dependent Mechanism. J Immunol 2007;178:7317- 24.
4. Oyama J, Blais JrC, Liu X, Pu M, Kobzik L, Kelly RA, et al. Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4-deficient mice. Circulation 2004;109:784-9.
5. Li C, Browder W, Kao RL. Early activation of transcription factor NF-kB during ischemia in perfused rat heart. Am J Physiol 1999;276:H543-H552.
6. Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, et al. In vivo transfection of cis element "decoy" against nuclear factor-kappaB binding site prevents myocardial infarction. Nat Med 1997;3:894-9.
7. Taganov KD, Boldin MP, Chang K-J, Baltimore D. NF-kB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. PNAS 2006;103:12481-6.
8. Ma X, Buscaglia LEB, Barker JR, Li Y. MicroRNAs in NF-kB Signaling. Journal of Molecular Cell Biology 2011;3:159-66.
9. Sheedy FJ, O'Neill LAJ. Adding fuel to fire: microRNAs as a new class of mediators of inflammation. Ann Rheum Dis 2008;67:iii50-iii55.
10. Taganov KD, Boldin MP, Baltimore D. MicroRNAs and Immunity: Tiny Players in a Big Field. Immunity 2007;26:133-7.
11. Sonkoly E, Stahle M, Pivarcsi A. MicroRNAs and immunity: Novel players in the regulation of normal immune function and inflammation. Seminars in Cancer Biology 2008;18:131-40.
80
12. van Rooij E, Marshall WS, Olson EN. Toward MicroRNA-Based Therapeutics for Heart Disease: The Sense in Antisense. Circ Res 2008;103:919-28.
13. Schroen B, Heymans S. MicroRNAs and Beyond: The Heart Reveals Its Treasures. Hypertension 2009;54:1189-94.
14. Fishtlscherer S, De Rosa S, Fox H, Schwietz T, Fischer A, Liebetrau C, et al. Circulating MicroRNAs in Patients With Coronary Artery Disease. Circ Res 2010;107:677-84.
15. Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, et al. MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarction. J Biol Chem 2009;284:29514-25.
16. Wang X, Ha T, Liu L, Zou J, Zhang X, Kalbfleisch J, et al. Increased expression of microRNA-146a decreases myocardial ischemia/reperfusion injury. Cardiovascular Research 2013;97:432-42.
17. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993;75:843- 54.
18. Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, et al. Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF- alpha stimulation and their possible roles in regulating the response to endotoxin shock. J Immunol 2007;179:5082-9.
19. Androulidaki A, Iliopoulos D, Arranz A, Doxaki C, Schworer S, Zacharioudaki V, et al. The Kinase Akt1 Controls Macrophage Response to Lipopolysaccharide by Regulating MicroRNAs. Immunity 2009;31:220-31.
20. Le MTN, Teh C, Shyh-Chang N, Xie H, Zhou B, Korzh V, et al. MicroRNA-125b is a novel negative regulator of p53. Genes Dev 2009;23:862-76.
21. Le MTN, Shyh-Chang N, Khaw SL, Chin L, Teh C, Tay J, et al. Conserved Regulation of p53 Network Dosage by MicroRNA-125b Occurs through Evolving miRNA-Target Gene Pairs. PLoS Genetics 2011;7:e1002242.
22. Vaseva AV, Moll UM. The mitochondrial p53 pathway. Biochim Biophys Acta 2009;1787:414-20.
23. Zhou M, Liu Z, Zhao Y, Ding Y, Liu H, Xi Y, et al. MicroRNA-125b Confers the Resistance of Breast Cancer Cells to Paclitaxel through Suppression of Pro- apoptotic Bcl-2 Antagonist Kiler 1 (BAK1) Expression. Journal of Biological Chemistry 2010;285:21496-507.
81
24. Matsusaka H, Ide T, Matsushima S, Ikeuchi M, Kubota T, Sunagawa K, et al. Targeted deletion of p53 prevents cardiac rupture after myocardial infarction in mice. Cardiovascular Research 2006;70:457-65.
25. Ren D, Wang X, Ha T, Liu L, Kalbfleisch J, Gao X, et al. SR-A deficiency reduces myocardial ischemia/reperfusion injury; involvement of increased microRNA- 125b expression in macrophages. Biochimica et Biophysica Acta - Molecular Basis of Disease 2012;In Press.
26. Huang HC, Yu HR, Huang LT, Huang HC, Chen RF, Lin IC, et al. miRNA-125b regulates TNF-a production in CD14+ neonatal monocytes via post-transcriptional regulation. J Leukocyte Biol 2012;92:171-82.
27. Deacon RM, Bannerman DM, Kirby BP, Croucher A, Rawlins JN. Effects of cytotoxic hippocampal lesions in mice on a cognitive test battery. Behavioral Brain Research 2002;133:57-68.
28. O'Connell TD, Rodrigo MC, Simpson PC. Isolation and culture of adult mouse cardiac myocytes. Methods Mol Biol 2007;357:271-96.
29. Soleimani M, Nadri S. A protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow. Nat Protoc 2009;4:102-6.
30. Szatkowski ML, Westfall MV, Metzger JM. Direct gene transfer to the adult rodent myocardium in vivo. Methods Mol Biol 2003;219:195-202.
31. Ha T, Hu Y, Liu L, Lu C, McMullen JR, Shioi T, et al. TLR2 ligands induce cardioprotection against ischemia/reperfusion injury through a PI3K/Akt- dependent mechanism. Cardiovascular Research 2010;87:694-703.
32. Ha T, Hua F, Liu X, Ma J, McMullen JR, Shioi T, et al. Lipopolysaccharide- induced myocardial protection against ischemia/reperfusion injury is mediated through a PI3K/Akt-dependent mechanism. Cardiovascular Research 2008;78:546-53.
33. Lu C, Hua F, Liu L, Ha T, Kalbfleisch J, Schweitzer J, et al. Scavenger receptor class-A has a central role in cerebral ischemia/reperfusion injury. J Cereb Blood Flow Metab 2010;30:1972-81.
34. Gao M, Ha T, Zhang X, Liu L, Wang X, Kelley J, et al. Toll-like receptor 3 plays a central role in cardiac dysfunction during polymicrobial sepsis. Crit Care Med 2012;40:2390-9.
35. Munoz C, Pascual-Salcedo D, Castellanos MC, Alfranca A, Aragones J, Vara A, et al. Pyrrolidine dithiocarbamate inhibits the production of interleukin-6, interleukin-8, and granulocyte-macrophage colony-stimulating factor by human
82
endothelial cells in reponse to inflammatory mediators: modulation of NF-kappa B and AP-1 transcription factors activity. Blood 1996;88:3482-90.
36. Medzhitov R, Preston-Hurlburt P, Janeway JrCA. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:394-7.
37. van Empel VPM, Bertrand ATA, Hofstra L, Grijns HJ, Doevendans PA, De Windt LJ. Myocyte apoptosis in heart failure. Cardiovascular Research 2005;67:21-9.
38. Narula J, Hajjar RJ, Dec GW. Apoptosis in the failing heart. Cardiol Clin 1998;16:691-710, ix.
39. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschi T. Identification of tissue-specific microRNAs from mouse. Curr Biol 2002;12:735-9.
40. Murphy AJ, Guyre PM, Pioli PA. Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages. J Immunol 2010;184:5029-37.
41. Rajaram MV, Ni B, Morris JD, Brooks MN, Carlson TK, Bakthavachalu B, et al. Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPK-activated protein kinase 2 (MK2) and microRNA miR-125b. Proc-Natl-Acad-Sci-USA 2011;108:17408-13.
42. Zhang G, Ghosh S. Toll-like receptor-mediated NF-kB activation: a phylogenetically conserved paradigm in innate immunity. The Journal of Clinical Investigation 2001;107:13-9.
83
Supplement Data
Materials and methods
qPCR assay of microRNAs (miRs):
miRs were isolated using the mirVanaTM miR isolation kit (Ambion)(16, 25).
Quantitative real-time (qPCR) was conducted using a 4800 Real time PCR machine
(Bio-Rad)(25). miR-125b levels were quantified by qPCR using specific Taqman assays
for miR (Applied Biosystems, USA). Specific primers for miR-125b were obtained from
Applied Biosystems (Primer identification numbers: 000449 for hsa-miR-125b and
001973 for snRU6). miR-125b levels were quantified with the 2(-ΔΔct) relative quantification method that was normalized to the U6 small nucleolar RNA (snRU6).
Construction of miR-125b into lentivirus expressing system.
MiR-125b, mature sequence mmu-miR-125b-5p (MIMAT0000136), was
constructed into lentivirus expression vector using a lentivirus expressing system
(Invitrogen corporation) as described previously(16, 25). The oligonucleotides for pre-
miR-125b (up strand:
5’TGCTGGCCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTAACATCACAAG
TCAGGTTCTTGGGACCTAGGC-3’ and down strand:
5’CCTGGCCTAGGTCCCAAGAACCTGACTTGTGATGTTACTAAAATACCTCACAAGT
TAGGGTCTCAGGGACTAGGCC-3’), which contains mature miR-125b-5p, miR-125b-
3p and stem loop, were synthesized at Integrated DNA Technologies. Five specific
nucleotides indicated by red color were added to create a four nucleotide 5’ overhang
which is compatible with the overhang in linearized pcDNA (pcDNATM6.2-GW/
84
EmGFP-miR). After ligation of pre-miR-125b with pcDNATM6.2-GW/ EmGFP-miR, the pcDNATM6.2-GW/EmGFP-miR cassette was subsequently transferred to pDONR221TM and finally pLenti6/V5-DEST by two sequential Gateway BP and LR recombinations. The construct was verified by sequencing. The viral particles were produced by third generation packaging in 293FT cells and Lentiviral stocks were concentrated using ultracentrifugation.
Transgenic mice:
Transgenic mice (Tg) with overexpression of miR-125b were developed with
C57BL/6J background. Briefly, the pcDNA6.2-GW/EmGFP-miR125b vector was digested by NruI. Two fragments (3.5kp and 2.5kb) were obtained. The fragment of 3.5 kb was further digested with Pvu II and two fragments (2.1kb and 1.1kb) were obtained.
The 2.1kb fragment was isolated, purified and used for microinjection. The Tg mice were identified by PCR to confirm that the miR-125b fragments have been incorporated into genome. PCR Primer sequence: F1: TTCAAGACCCGCCACAAC and R1:
CAGCATACAGCCTTCAGCAA (312 bp). F2: ATGGGCGTGGATAGCGGTTTG and R2:
TCGGGCATGGCGGACTTGA (567 bp). For examination of miR-125b expression in transgenic mice, the specific primer sequences are: F: gtccctgagaccctaacttg; R: cttccgtgtttcagttagcc. There was no production in WT mice, but 218 bp were generated from transgenic mice. Tg mice exhibit the normal phenotype and normal cardiac function.
85
Isolation of cardiac myocytes.
Cardiac myocytes were isolated from adult mice as described previously(28).
Briefly, the mice were injected with heparin (50 IU) and anesthetized with isoflurane in
100% O2 as described in the Materials and Methods. The heart was removed and immediately placed in a 60 mm dish containing 10 ml of perfusion buffer at room temperature. After removing extraneous tissues, the heart was cannulated via the ascending aorta, and mounted on a modified Langendorff perfusion apparatus. The heart was perfused with perfusion buffer (NaCl ,113 mM; KCl,4.7 mM; KH2PO4,0.6 mM;
Na2HPO4,0.6 mM; MgSO4 ,1.2 mM; NaHCO3,12 mM; KHCO3, Taurine, 30 mM;
HEPES,10mM; Bleb, 0.01mM; Glucose, 5.5mM) for 2 min before the perfusion buffer was switched to the digestion buffer (CollagenaseII,1.6mg/ml in perfusion buffer). After
3 min of perfusion, the digestion buffer was supplemented with 15 ul of 100 mM cacl2, and perfusion was continued for an additional 10 min. After removing the atria and aorta, the ventricles were cut into small pieces and incubated in the digestion buffer for
3 min to allow further digestion. The suspension was then added with 5 ml stopping buffer (perfusion buffer plus 10%FBS and 0.1 mM CaCl2) and pipetted up and down, till no big pieces. The cells were pelleted at 100 g for 2 min and re-suspended in 10 ml stopping buffer. The cell suspension was added with 100 µl of ATP (200 mM). The Ca2+ concentration in the cell suspension was gradually increased through several steps. The cells were then pelleted at 100 g for 2 min and resuspended in plating media (10% FBS,
2 mM glutamine, 100 u/ml penicillin, 10 uM Bleb and 2 mM ATP in HMEM medium).
The cells were incubated on plates that were precocated with matrigel for 1 hour,
86 followed by incubation with culture media (1mg/ml BSA, 2 mM glutamine, 100u/ml penicillin, 10uM Bleb and 0.1% ITS in HMEM medium).
Preparation of exosomes containing miR-125b.
Bone marrow stromal cells (BMSCs) were isolated from C57BL/6J mice as described previously(29). Briefly, the femurs and tibias were isolated from mice and flushed with complete medium constituted of EMEM-LG (Sigma, St., Louis, MO), 10% fetal calf serum (HyClone, ThermoFisher Scientific Waltham, MA), glutamine (2 mM) and penicillin/streptomycin (50 U/ml and 50 mg/ml, Sigma), respectively, supplemented with heparin at a final concentration of 5 U/ml. The cells were washed twice in a medium without heparin, plated in a Petri dish at a density of 2 x 106 cells/cm2 and incubated at 37°C with 5% CO2. After three days, non-adherent cells were removed by two to three washes with PBS and adherent cells further cultured in complete medium
th th at 37°C with 5% CO2. The medium was changed every other day. Cells at the 4 -7 generation were transfected with 40 nmol/L microRNA mimics for miR-125b (MC10148,
Ambion), anti-miR-125b (AM10148, Ambion) or Cy3TM dye labeled miR-scrambled control (AM17010, Ambion), using Lipofectamine RNAiMAX Reagent (Invitrogen) according to the manufacture’s protocol. Twenty-four hours after transfection, supernatants were harvested for exosomes isolation using Exoquick-TCTM Exosome
Precipitation Solution (SBI) according to the manufacturer's protocol.
87
Transfection of cardiac myocytes with Exosomes containing miR-125b.
Adult cardiac myocytes were incubated on plates that were pre-cocated with
Matrigel and they were maintained in culture medium. Exosomes that were isolated from bone marrow cells (BMSC-derived exosomes) were added into the cultured adult cardiac myocytes (2 µg/ml). Transfection efficiency was confirmed by the fluorescence of Cy3TM dye labeled miR-scrambled control. The miR-125b levels were assessed by
TaqMan MicroRNA assay.
In vivo transfection of lentivirus expressing miR-125b (LmiR-125b) into mouse hearts.
Mice were intubated and anesthetized with mechanical ventilation using 5% isoflurane. The anesthesia was maintained by inhalation of 1.5-2% isoflurane in 100% oxygen. An incision was made in the middle of the neck and the right common carotid artery was carefully isolated. A micro-catheter was introduced into the isolated common carotid artery and positioned into the aortic root through an arteriotomy site in the external carotid artery(16). One hundred microliter of LmiR-125b (1x107 PFU) or LmiR- con was injected through the micro-catheter. The micro-catheter was gently removed and the common carotid artery was tightened before the skin was closed. Seven days after transfection, the hearts were harvested and transfection efficiency was evaluated by examining the green fluorescent protein (GFP) expression and the expression of miR125b in the heart tissues.
88
In vivo delivery of anti-miR-125b mimics.
Anti-miR-125b or anti-miR-scrambled control was with Lipofectamine RNAiMAX according to the protocol provided by the manufacturer (Invitrogen). Mice were anesthetized with isoflurane and the hearts were explored. A 30 G needle with microsyringe was inserted into the left ventricular wall in the direction from the base to the apex, penetrating about 1mm deep. Five microgram of anti-miR-125b or anti-miR- scrambled control that were mixed with Lipofectamine RNAiMAX was injected into the left anterior ventricular wall. After injection, the needle was removed from the left ventricular wall and the chest was closed in layers. The animals were allowed to recover.
Induction of myocardial I/R injury.
Myocardial I/R injury was induced as described previously(2, 3, 28). Briefly, the mice were anesthetized by 5.0% isoflurane, intubated and ventilated using a rodent ventilator. Anesthesia was maintained by inhalation of 1.5% to 2% isoflurane driven by
100% oxygen flow. Body temperature was regulated at 37oC by surface water heating.
The hearts were exposed and the left anterior descending (LAD) coronary artery was ligated with an 8-0 silk ligature. After completion of 45 min of occlusion, the coronary artery was reperfused by releasing the knot of suture. During reperfusion, cardiac function was measured by echocardiography as described previously(28, 29). After reperfusion for the time indicated, the mice were euthanized by CO2 inhalation and the hearts were harvested. Infarct size was evaluated by triphenyltetrazolium chloride (TTC,
Sigma-Aldrich) staining as described previously(2, 3, 28).
89
MicroRNA microarray.
The isolated adult cardiac myocytes were subjected to hypoxia (2 hrs) followed by
reoxygenation (24 hrs) as described previously(16). The cells that were not subjected to
H/R served as control. The cells were harvested for total RNA preparation using RNAzo
kit (Molecular Research Center INC). RNA samples were sent to Ocean Ridge
Biosciences (ORB, Palm Beach Gardens, FL) for analysis using custom multi-species microarrays containing 1281 probes covering 1279 mouse mature microRNAs present in miRBase version 19. The sensitivity of the microarray is such that it could detect as low as 20 amoles of synthetic microRNA being hybridized along with each sample.
There were 3 replicates in each group.
Myocardial infiltration of neutrophils.
Neutrophil accumulation in heart tissues was examined by staining with anti-
neutrophil marker antibody (NIMP-R14, Santa Cruz Biotechnology) as described
previously(24). Three slides from each block were evaluated and three different areas of
each section were evaluated. The results are expressed as the numbers of
neutrophils/field (40x).
90
Figure 11Figure 2.S1. Increased in vivo expression of miR-125b attenuated I/R-induced neutrophil infiltration into the myocardium. Mouse hearts were transfected with either LmiR-125b or LmiR-Con. Seven days after transfection, the hearts were subjected to myocardial ischemia (45 min) followed by reperfusion (4 hrs). Hearts were harvested and sectioned for immunohistochemical staining of neutrophils with anti-neutrophil antibody. The bar graph shows the numbers of neutrophils in examined fields. N=3/group. * p<0.05 compared with indicated groups.
Tables 1 and 2: Effect of hypoxia/reoxygenation on microRNA expression in the isolated adult cardiac myocytes. Cardiac myocytes were isolated from adult male mice and subjected to hypoxia (2 hrs) followed by reoxygenation (24 hrs). Non-H/R cells
91
(normoxia) served as control. The cells were harvested for the isolation of total RNA.
MicroRNA microarray was performed and analyzed by Ocean Ridge Biosciences for analysis using custom multi-species microarrays containing 1281 probes covering 1279 mouse mature microRNAs present in in miRBase version 19. There were 3 replicates in each group. After quality-control, background subtraction, transformation and normalization of probe intensity, 43 miRNAs were differentially expressed in the cardiac myocytes after H/R at a false discovery rate of 0.05, when compared with non-H/R cells
(normoxia). Among the 43 miRNAs, 18 were elevated and 25 were down regulated after
H/R. In addition, 28 miRNAs which are highly expressed in adult cardiac myocytes showed saturation such as miR-1, miR-24 and miR-125b (Table 2).
92
CHAPTER 3
MICRORNA-214 PROTECTS AGAINST HYPOXIA/REOXYGENATION INDUCED
CELL DAMAGE AND MYOCARDIAL ISCHEMIA/REPERFUSION INJURY VIA
SUPPRESSION OF PTEN AND BIM1 EXPRESSION
Xiaohui Wang1, Tuanzhu Ha1,4, Yuanping Hu1, Chen Lu1, Li Liu2, Xia Zhang1, Race
Kao1,4, John Kalbfleisch3,4, David Williams1,4, Chuanfu Li1,4,
1Department of Surgery, James H. Quillen College of Medicine, East Tennessee State
University, Johnson City, TN, USA
2Department of Anesthesiology, First Affiliated Hospital with Nanjing Medical University,
Nanjing, China
3Department of Biometry and Medical Computing, James H. Quillen College of
Medicine, East Tennessee State University, Johnson City, TN, USA
4Center of Excellence for Inflammation, Infectious Disease and Immunity, James H.
Quillen College of Medicine, East Tennessee State University, Johnson City, TN, USA
Correspondence to: Chuanfu Li, email: [email protected]
Department of Surgery
East Tennessee State University
Campus Box 70575
Johnson City, TN 37614-0575
Running head: microRNA-214 decreases myocardial I/R injury
Key words: microRNA-214, myocardial ischemia/reperfusion injury, myocardial apoptosis, PTEN, Bim1.
93
Abstract
Background
Myocardial apoptosis plays an important role in myocardial ischemia/reperfusion
(I/R) injury. Activation of PI3K/Akt signaling protects the myocardium from I/R injury.
This study investigated the role of miR-214 in hypoxia/reoxygenation (H/R)-induced cell damage in vitro and myocardial I/R injury in vivo.
Methods and Results
H9C2 cardiomyoblasts were transfected with lentivirus expressing miR-214 (LmiR-
214) or lentivirus expressing scrambled miR-control (LmiR-control) respectively, to
establish cell lines of LmiR-214 and LmiR-control. The cells were subjected to hypoxia for 4 h followed by reoxygenation for 24 h. Transfection of LmiR-214 suppresses PTEN expression, significantly increases the levels of Akt phosphorylation, markedly attenuates LDH release, and enhances the viability of the cells subjected to H/R. In vivo
transfection of mouse hearts with LmiR-214 significantly attenuates I/R induced cardiac
dysfunction and reduces I/R-induced myocardial infarct size. LmiR-214 transfection
significantly attenuates I/R-induced myocardial apoptosis and caspase-3/7 and
caspase-8 activity. Increased expression of miR-214 by transfection of LmiR-214 suppresses PTEN expression, increases the levels of phosphorylated Akt, represses
Bim1 expression and induces Bad phosphorylation in the myocardium. In addition, in vitro data shows transfection of miR-214 mimics to H9C2 cells suppresses the expression and translocation of Bim1 from cytosol to mitochondria and induces Bad phosphorylation.
94
Conclusions
Our in vitro and in vivo data suggests that miR-214 protects cells from H/R induced
damage and attenuates I/R induced myocardial injury. The mechanisms involve
activation of PI3K/Akt signaling by targeting PTEN expression, induction of Bad
phosphorylation, and suppression of Bim1 expression, resulting in decreases in I/R-
induced myocardial apoptosis.
Introduction
MicroRNAs (miRs) are 21 to 23 nucleotide non-protein-coding RNA molecules,
which have been identified as novel regulators of gene expression at the post-
transcriptional level by binding to target messenger RNAs (mRNAs). Recently published
data indicates that miRs, such as miR-1/106, miR-125b, miR-146a, miR-223, miR-21, miR-144/145, miR-320, miR-494, and miR-92a, are involved in ischemic heart disease[1-8]. miR-214 has been reported to protect cardiac myocytes from H2O2-
induced injury[9]. Recently, Aurora et al [10] have shown that deficiency of miR-214
resulted in severe myocardial ischemia/reperfusion (I/R) injury and increased fibrosis
progression as well as cardiac myocyte apoptosis. These authors demonstrated that
miR-214 targets sodium-calcium exchanger-1, thus influencing cardiac myocyte calcium
trafficking following myocardial I/R injury[10].
It is well known that myocardial apoptosis contributes to myocardial I/R injury[11].
Bad is a pro-apoptotic protein, a member of the Bcl-2 family and induces apoptosis by
inhibiting the anti-apoptotic effects of Bcl-2 and Bcl-X, thereby allowing the pro-apoptotic
proteins, Bak and Bax to aggregate and induce release of cytochrome c, followed by
95
activation of caspase-mediated apoptotic signaling[12]. Phosphorylation of Bad by
activated Akt prevents the interaction of Bad with Bcl-2 and Bcl-X[13]. Bcl-2 homology
domain 3 (BH3)-only Pro-Protein Bim1 is an another pro-apoptotic protein and plays an important role in Bax/Bak mediated cytochrome c release and apoptosis[14]. Bim expression is regulated by activated FOXO3 (Forkhead box transcription factor, class
O) which is controlled by activated phosphatidylinositol 3-kinase (PI3K)/Akt signaling[15]. In addition, activated Akt phosphorylates Bim1 at Ser87, resulting in blocking the pro-apoptotic effect of Bim1[16].
Toll like receptor (TLR)-mediated innate immune and inflammatory responses have been demonstrated to play a critical role in myocardial ischemia/reperfusion (I/R) injury[17]. We have previously reported that administration of TLR ligands to mice induced protection against myocardial I/R injury[18-20]. The protective mechanisms involve the activation of PI3K/Akt signaling[18-21] which plays an important role in regulating cellular proliferation and survival[22,23]. Phosphatase and tensin homolog
(PTEN) is a tumor suppressor lipid protein phosphatase which negatively regulates
PI3K/Akt signaling activation[24] by dephosphorylating PIP3 at its 3’ inositol position, resulting in decreased translocation of Akt to cellular membranes and subsequent down-regulation of PI3K/Akt activation[25]. Recent studies have shown PTEN plays a critical role in mitochondrial dependent apoptosis[26].
In the present study, we demonstrated that increased expression of miR-214 by transfection of the myocardium with lentivirus expressing miR-214 (LmiR-214) protects hearts from I/R injury. The mechanisms involve suppression of PTEN expression,
96
leading to activation of PI3K/Akt signaling, induction of Bad phosphorylation, and
targeting Bim1 expression, resulting in attenuation of I/R-induced myocardial apoptosis.
Results
Increased miR-214 levels suppressed PTEN expression and increased Akt
phosphorylation in H9C2 cardiomyoblasts.
We have previously reported that either TLR4 deficiency or TLR2 modulation by
Pam3CSK4 significantly attenuates-I/R induced myocardial injury via activating
PI3K/Akt dependent mechanism[20]. Interestingly, we observed that the levels of myocardial miR-214 were markedly greater in either TLR4 deficient mice or Pam3CSK4
treated mice compared with untreated group (Figure 3.1A). Our previous studies have
shown that TLR2 modulation can significantly attenuate I/R induced myocardium injury
by activating PI3K/Akt signaling. PTEN, a negative regulator of PI3K/Akt signaling is a
potential target of miR-214. To investigate the underlying mechanisms by which TLR2
modulation regulates the miR-214 expression, H9C2 cardiomyoblasts were treated with
TLR2 specific ligand Pam3CSK4. As shown in Figure3.1B, the levels of miR-214 in
Pam3CSK4 treated cells are significantly increased. The levels of phosphorylated Akt
are also significantly increased following Pam3CSK4 treatment (Figure3.1C) which is
consistent with our previous studies. However, PI3K inhibition with LY294002 (LY)
significantly prevented Pam3CSK4 induced Akt phosphorylation but did not alter
Pam3CSK4 induced increases in miR-214 expression. To determine whether NF-kB
signaling involves Pam3CSK4 induced miR-214 expression, we treated cells with NF-kB
specific inhibitor, JSH-23 and observed that JSH-23 treatment significantly prevented
97
Pam3CSK4 induced increases in the expression of miR-214 (Figure3.1B). Collectively,
these data suggest the TLR2 ligand induced increases in the expression of miR-214 is
mediated through NF-κB activation pathway.
To examine whether increased expression of miR-214 will activate PI3K/Akt signaling, we transfected H9C2 cells with lentivirus expressing miR-214 (LmiR-214) or
LmiR-control respectively, before the cells were subjected to hypoxia (2 h) followed by reoxygenation (H/R). Figures 3.1D and E show that LmiR-214 transfection markedly increases the levels of Akt phosphorylation and suppresses PTEN expression in the presence or absence of H/R. The data suggests that miR-214 targets PTEN expression, resulting in activation of PI3K/Akt signaling.
Increased expression of miR-214 attenuates H/R induced cell injury and increases
survival in H9C2 cardiomyoblasts.
Activation of PI3K/Akt signaling plays an important role in protection against H/R-
induced cell injury[27,28]. We examined whether transfection of LmiR-214 will protect the H9C2 cells from H/R-induced injury. Figure 3.1F shows that H/R significantly
increased LDH activity by 5.6-fold compared with the control cells (normoxia). In
contrast, transfection of cells with LmiR-214 markedly attenuates H/R-induced LDH activity by 54%, when compared with untransfected H/R group. H/R also significantly decreased cell viability by 47% compared with normoxia group (Figure 3.1G). However, the viability in LmiR-214 transfected cells that were subjected to H/R was significant greater by 75% compared with H/R group. Transfection of LmiR-control did not affect
H/R-induced cell injury and death in H9C2 cells.
98
Figure 12Figure 3.1. TLR4 deficiency or TLR2 ligand, Pam3CSK4 treatment increases the expression of miR-214 in the myocardium. TLR4 deficient (TLR4-/-) mice (n=3) or wild type (WT) mice were treated with and without Pam3CSK4 (50 µg/25 g body weight) and then subjected to myocardial ischemia (45 min) followed by reperfusion (4 h). Sham operation served as sham control. Hearts were harvested and microRNAs were isolated
99 for qPCR measurement of miR-214 (n=3-4/group). (B-C) NF-κB activation is required for Pam3CSK4 induced miR-214 expression. Myoblast H9C2 cells were treated with PamsCSK4 in the presence of LY294002 or JSH23 for 24 hrs. The cells were harvested for microRNA preparation for qPCR measurement of miR-214 expression (B) and for Western blot analysis of Akt phosphorylation (C). There were 3 replicates in each group. * p<0.05 compared with indicated groups. (D-G) H9C2 cells were transfected with lentivirus expressing miR-214 (LmiR-214) or lentivirus expressing miR-control (LmiR- control) respectively. The cells were subjected to hypoxia (4 h) followed by reoxygenation (24 h). The levels of Akt phosphorylation (D) and PTEN expression (E) were assessed by Western blot (n=3). LDH activity (F) in the supernatants was measured by a commercially available kit and cell viability (G) was measured by MTT assay (n=3-5). *p<0.05 compared with indicated groups. # p<0.05 compared with respective control.
LmiR-214 transfection attenuates cardiac dysfunction and reduces infarct size after myocardial I/R.
Our in vitro data shows that increased expression of miR-214 markedly activates
PI3K/Akt signaling and protects H9C2 cells from H/R-induced injury. We evaluated whether in vivo transfection of LmiR-214 will protect the heart from myocardial I/R injury.
Mouse hearts were transfected with LmiR-214 through the right carotid artery[1,2].
LmiR-control served as vector control. Figure 3.2D shows that seven days after transfection, the levels of miR-214 in the myocardium were significantly increased by
3.7-fold compared with control. We also examined whether increased expression of miR-214 will protect against myocardial I/R-induced injury. The hearts were subjected to ischemia (45 min) followed by reperfusion up to 7 days. As shown in Figures 3.2A and
B, I/R significantly decreased cardiac function. The values for ejection fraction (EF%) and fractional shortening (FS%) were markedly reduced by 38.1% and 44.5% on day 3 and by 24.6% and 32.1% on day 7 respectively, after myocardial I/R injury compared with sham control. In contrast, LmiR-214 transfection attenuated I/R-induced cardiac
100
dysfunction. The values for EF% and FS% in LmiR-214 transfected hearts were
significantly greater than in the untransfected I/R group. Figure 3.2C shows that
transfection of LmiR-214 into the hearts markedly reduced infarct size by 52.1%
compared with the untransfected I/R group. Transfection of LmiR-control into the
myocardium did not alter I/R-induced decreases in the values of EF% and FS% and
myocardial infarct size.
LmiR-214 transfection suppresses PTEN expression and increases Akt phosphorylation
in the myocardium.
PTEN is a negative regulator of PI3K/Akt signaling[29,30]. We examined the effect
of LmiR-214 transfection on PTEN expression and Akt phosphorylation in the
myocardium following I/R. Figure 3.2E shows that I/R did not affect PTEN expression
but enhanced the levels of Akt phosphorylation compared with sham control. However,
LmiR-214 transfection significantly suppressed the expression of PTEN and further
increased Akt phosphorylation levels in both sham and I/R groups when compared with
untransfected respective controls. In the LmiR-214 transfected group, the levels of phosphorylated Akt were increased by 34.1% and PTEN decreased by 42.4%, when compared with untransfected I/R hearts. Transfection of LmiR-control did not alter the
levels of Akt phosphorylation and PTEN expression in the myocardium of both sham
and I/R groups.
101
Figure 13Figure 3.2. Transfection of lentivirus expressing miR-214 into the myocardium improved cardiac function and decreased infarct size following myocardial I/R injury. Mouse hearts were transfected with LmiR-214 through the right common carotid artery (n=8/group). Seven days after transfection, hearts were subjected to ischemia (45 min) followed by reperfusion for up to 7 days. (A and B) Cardiac function was measured by echocardiography 3 and 7 days after myocardial I/R. (C) Hearts were harvested 24 h after reperfusion for TTC staining infarct size. (D) The level of miR-214 was increased following LmiR-214 transfection. (E) LmiR-214 transfection suppressed PTEN expression and increased Akt phosphorylation levels. n=6/group. * P<0.05 compared with indicated group. # p<0.05 compared with respective control.
102
Increased expression of miR-214 attenuates I/R induced myocardial apoptosis.
It is well known that myocardial apoptosis contributes to cardiac dysfunction after
myocardial I/R injury[31]. We examined the effect of LmiR-214 transfection on myocardial apoptosis following myocardial I/R injury. Figure 3.3A shows that I/R increased Tunnel positive myocardial apoptotic cells by 29.8% compared with sham control. In contrast, transfection of LmiR-214 into the myocardium significantly decreased I/R-induced myocardial apoptosis by 60.9%, when compared with the untransfected I/R group. Activation of caspase-3/7 and caspase-8 have been considered as specific markers for apoptosis[32,33]. Figures 3.3B and C show that I/R-
induced an increase in capase-7 by 30% and caspase-8 by 40.4%, when compared with sham control. However, increased expression of miR-214 prevents I/R-induced myocardial caspase-3/7 and caspase-8 activities (Figures 3.3B and C). Transfection of
LmiR-control did not alter I/R-induced myocardial apoptosis.
103
Figure 14Figure 3.3. Increased expression of miR-214 attenuates I/R-induced myocardial apoptosis. LmiR-214 or LmiR-control was transfected into the myocardium of mice via the right common carotid artery 7 days before the hearts were subjected to ischemia (45 min) followed by reperfusion (24 h). Hearts were harvested and sectioned for TUNEL assay of myocardial apoptosis (A). Caspase-3/7 (B) and Caspase-8 (C) activities were measured by ELISA kits. N=4-6, *p<0.05 compared with indicated group.
LmiR-214 transfection increases Bad phosphorylation and suppresses the expression of
Bim1 in the myocardium.
Figure 15Figure 3.4. Increased expression of miR-214 suppressed Bim expression and prevents Bad phosphorylation in the myocardium following myocardial I/R. LmiR-214 or LmiR-control was transfected into the myocardium of mice via the right common carotid artery 7 days before the hearts were subjected to ischemia (45 min) followed by reperfusion (24 h). The hearts were harvested for isolation of cellular proteins. The levels of phosphorylated Bad (A) and Bim1 (B) were examined by Western blot. N=4-6, *p<0.05 compared with indicated group.
Bad is a pro-apoptotic protein which interacts with Bcl2, resulting in blocking Bcl2 anti-apoptotic function[34]. When Bad is phosphorylated, Bcl2 will release from
Bad/Bcl2 complex and functions in an anti-apoptotic role[13,34,35]. Figure 3.4A shows
104
that transfection of LmiR-214 markedly increased the levels of phosphorylated Bad in
both sham and I/R groups compared with untransfected respective controls. Bim1 is a mitochondrial pro-apoptotic factor which will translocate from the cytosol to mitochondria, resulting in cardiomyocyte apoptosis during I/R[14;36]. As shown in
Figure 3.4B, I/R decreased the cytosolic levels of Bim1 compared with sham control.
However, transfection of LmiR-214 further decreases the cytosolic levels of Bim1 in both sham and I/R groups, indicating increased expression of miR-214 may suppress the expression and translocation of Bim1 from cytosol to mitochondria. Transfection of
LmiR-control did not alter I/R induced changes of Bad phosphorylation and Bim1 expression.
LmiR-214 suppresses the translocation of Bim1 from cytosol to mitochondria in
myocardioblasts following H/R.
To examine the effect of miR-214 on Bim1 translocation from cytosol to
mitochondria, we transfected H9C2 cells with miR-214 mimics or scrambled miR-control respectively, before the cells were subjected to hypoxia/reoxygenation (H/R). Figures
3.5A and B show that H/R induces translocation of Bim1 from the cytosol to the mitochondria as evidenced by a significant decrease in the cytosolic levels of Bim1 (A), but a markedly enhanced amount of Bim1 in mitochondrial extracts (B). In contrast, miR-214 markedly suppresses the expression of Bim1 in the cytosol and decreases the levels of Bim1 in the mitochondria following H/R challenge. MiR-214 transfection also significantly increased Bad phosphorylation in the presence and absence of H/R compared with untransfected control groups (Figure 3.5C). Transfection of scrambled miR-control did not induce Bad phosphorylation in the presence and absence of H/R. In
105 addition, H/R markedly decreased mitochondrial membrane potential which was significantly attenuated by LmiR-214 transfection (Figure 3.5D).
Figure 16Figure 3.5. Increased expression of miR-214 suppressed the expression and mitochondrial translocation of Bim1 and increased the levels of phosphorylated Bad in
106
cardiomyoblasts H9C2 cells. H9C2 cells were transfected with miR-214 mimics. miR- control mimics served as control. The cells were subjected to hypoxia (4 h) followed by reoxygenation (24 h). The cells were harvested for isolation of mitochondria. The levels of Bim1 (A and B) and phosphorylated Bad (C) were examined by Western blot. n=3/group. (D) Mitochondrial membrane potential was measured by JC-1 Dye (n=6-8). * p<0.05 compared with indicated groups. # p<0.05 compared with respective control.
Discussion
In the present study, we demonstrated that increased expression of miR-214 in the
myocardium significantly attenuates I/R-induced cardiac dysfunction and myocardial infarct size. The mechanisms involve an anti-apoptotic effect via activation of PI3K/Akt signaling and suppression of Bim expression. Specifically, we observed that miR-214 suppresses PTEN expression, leading to activation of PI3K/Akt signaling. It is well known that activated Akt phosphorylates Bad [13], thereby blocking the pro-apoptotic
effect of Bad. In addition, miR-214 represses the expression of pro-apoptotic protein
Bim1 [10] and its translocation from cytosol to the mitochondria, thus preventing I/R
induced apoptosis.
We have previously reported that there is an interaction between TLR-mediated
pathway and PI3K/Akt signaling during myocardial I/R injury[20,37]. Activation of
PI3K/Akt signaling has been reported to protect the myocardium from I/R injury and promotes cell survival following H/R[27,28,37,38]. However, the mechanisms by which stimulation of TLRs induces activation of PI3K/Akt signaling are unclear. Interestingly, we observed that miR-214 expression in the myocardium was significantly increased by a TLR2 ligand, Pam3CSK4, in the presence and absence of I/R. Since Pam3CSK4 induced activation of PI3K/Akt signaling[20], we examined whether increased miR-214
107
expression would activate PI3K/Akt signaling. Indeed, our data show that increased
expression of miR-214 by transfection of LmiR-214 into H9C2 cells suppresses PTEN
expression and increases the levels of Akt phosphorylation in the presence and
absence of H/R challenge. LmiR-214 transfection also markedly attenuates H/R-
induced cell injury as evidenced by decreased LDH release after the cells were
subjected to H/R. In addition, cell viability was markedly improved by increased
expression of miR-214. Collectively, the in vitro data suggests that miR-214 has a
protective effect on H/R-induced cell injury via suppression of PTEN, leading to
activation of PI3K/Akt signaling.
Next, we investigated whether increased expression of miR-214 in the myocardium would protect the hearts from I/R-induced injury. We constructed LmiR-214 and transfected it into the myocardium through the right carotid artery seven days before the hearts were subjected to myocardial I/R[1,2]. The in vivo data shows that LmiR-214 transfection prevents I/R-induced cardiac dysfunction and reduced I/R-induced myocardial infarct size. Our data is consistent with the report by Aurora et al [10]
showing that deficiency of miR-214 resulted in more severe cardiac dysfunction and
myocardial I/R injury, indicating that miR-214 is essential for cardioprotection against I/R
injury. To understand the mechanisms by which miR-214 protects against myocardial
I/R injury, Aurora et al [10] observed that miR-214 targets sodium-calcium exchanger-1, thereby influencing calcium trafficking in cardiac myocytes after myocardial I/R injury[10]. We found that miR-214 significantly suppresses PTEN expression, leading to
Akt phosphorylation in the myocardium. Previous studies have demonstrated that activation of PI3K/Akt signaling plays a critical role in reduced I/R-induced injury and
108
attenuated I/R-induced cardiac dysfunction[18-21]. Our data indicates that activation of
PI3K/Akt signaling by miR-214 may be an important mechanism for protection against
I/R injury.
We observed that increased expression of miR-214 significantly attenuates I/R-
induced myocardial apoptosis. Apoptosis has been demonstrated to contribute to I/R-
induced myocardial damage and cardiac dysfunction[31]. Apoptosis is the process of
programmed cell death which is predominately dependent on mitochondrial function[39].
Bcl2 family members play a critical role in regulating mitochondrial mediated apoptosis through controlling the permeabilization of the mitochondrial membrane[39]. Bad is a pro-apoptotic protein that promotes activation of the programmed cell death pathway through formation of heterodimerizes with Bcl2 or Bcl-XL to inhibit their anti-apoptotic functions[35]. Our in vitro and in vivo data show that increased miR-214 expression significantly enhances Bad phosphorylation, thereby blocking Bad’s pro-apoptotic effect.
It has been reported that Bad is phosphorylated by a variety of kinases including Akt and P70S60 kinase[13,34] with subsequent loss of its pro-apoptotic action by binding with 14-3-3 protein[35,40]. Our findings indicate that targeting PTEN expression by mir-
214, resulting in activation of Akt could be responsible for Bad phosphorylation.
We also found that increased expression of miR-214 represses the expression of
Bim1 and prevents its translocation from the cytosol to mitochondria. Bim1 is another pro-apoptotic protein of Bcl-2 family and triggers apoptosis by inhibiting Bcl2 anti- apoptotic function and/or direct activation of Bax[14], leading to cytochrome c release and activation of apoptotic signaling[39]. Therefore, suppression of Bim1 expression and preventing its translocation from the cytosol to the mitochondria are necessary for
109
preventing apoptosis during myocardial I/R injury[36]. Aurora et al reported that the
expression of Bim1 in the myocardium was significantly increased in miR-214 deficient mice 7 days after myocardial I/R injury, indicating that miR-214 may target Bim[10]. We demonstrated in the present study that increased in vivo expression of miR-214 by
LmiR-214 transfection suppresses the expression of Bim1 in the myocardium following
I/R injury and that in vitro enhanced miR-214 levels prevent the translocation of Bim1 from the cytosol to the mitochondria. Collectively, targeting Bim1 expression and preventing its translocation from cytosol to mitochondria could be an important protective mechanism of miR-214 in myocardial I/R injury.
In summary, our data demonstrated that miR-214 plays a protective role in myocardial I/R injury. The mechanisms involve an anti-apoptotic effect through suppression of PTEN expression, leading to activation of PI3K/Akt signaling which suppresses Bad activity via its phosphorylation. In addition, miR-214 suppresses the expression and translocation of Bim1 from the cytosol to the mitochondria. MiR-214 could be a target for the induction of protection against myocardial I/R injury. Future studies should search for which natural conditions will induce miR-214 expression.
Materials and Methods
Animals
Male C57BL/6J mice were obtained from Jackson Laboratory and maintained in the Division of Laboratory Animal Resources, East Tennessee State University (ETSU).
The experiments outlined in this article conform to the Guide for the Care and Use of
110
Laboratory Animals published by the National Institutes of Health (NIH Publication, 8th
Edition, 2011). All aspects of the animal care and experimental protocols were approved by the ETSU Committee on Animal Care.
Induction of myocardial I/R injury
Myocardial I/R injury was induced as described previously[1,2,18,20,21]. Briefly, the mice were anesthetized by 5.0% isoflurane, intubated and ventilated using a rodent ventilator. Anesthesia was maintained by inhalation of 1.5% to 2% isoflurane driven by
100% oxygen flow. Body temperature was regulated at 37oC by surface water heating.
The hearts were exposed and the left anterior descending (LAD) coronary artery was ligated with an 8-0 silk ligature. After completion of 45 min of occlusion, the coronary artery was reperfused by releasing the suture knot. After reperfusion for the time indicated, the mice were euthanized by CO2 inhalation and the hearts were harvested.
Infarct size was evaluated by triphenyltetrazolium chloride (TTC, Sigma-Aldrich) staining as described previously[1,2,18,20,21].
Echocardiography
Transthoracic two-dimensional M-mode echocardiogram and pulsed wave Doppler spectral tracings were obtained using a Toshiba Aplio 80 Imaging System (Tochigi,
Japan) equipped with a 12-MHz linear transducer as described previously[1,2,19,20].
Ejection fraction (EF) and percent fractional shortening (FS) were calculated as described previously[1,2,19,20].
111
In situ apoptosis assay
Measurement of cardiac myocyte apoptosis was performed as described
previously[1,2,18-21] using the in situ cell death detection kit, fluorescein (Roche, USA)
according to instructions of the manufacturer.
Measurement of cell viability and mitochondrial membrane potential
Cell viability was assessed by measuring mitochondrial dehydrogenase activity
using the MTT assay kit (Sigma). Cell injury was assessed by measurement of lactate
dehydrogenase (LDH) activity in culture medium using a commercial kit (Cytotoxicity
Detection Kit, Sigma). Mitochondrial membrane potential was evaluated by the
fluorescence ratio of JC-1 aggregates (red) to monomers (green).
Real time PCR assay of miRNAs
miRs were isolated from heart tissues or cultured cells using the miRNAs isolation
kit (RNAzol®RT, MRC) in accordance with the manufacturer’s protocol. Quantitative real-time (qPCR) was conducted using a 4800 Real-time PCR machine (Bio-Rad).
MicroRNA levels were quantified by qPCR using specific Taqman assays for miR
(Applied Biosystems, USA) and Taqman Universal Master Mix (Applied Biosystems).
Specific primers for miR-214 were obtained from Applied Biosystems. MicroRNA-214
levels were quantified with the 2 (-DDct) relative quantification method that was
normalized to the snRU6.
112
Construction of lentivirus expressing miR-214
MiR-214 was constructed into a lentivirus expressing vector using a lentivirus expressing system (Invitrogen Corporation) as described previously[1,2]. Briefly, the oligonucleotides for miR-214 were synthesized at Integrated DNA Technologies, annealed and ligated into pcDNATM6.2-GW/EmGFP-miR. The pcDNATM6.2-
GW/EmGFP-miR cassette was subsequently transferred to pDONR221TM and finally pLenti6/V5-DEST by two sequential Gateway BP and LR recombinations. The construct was verified by sequencing. The viral particles were produced by third generation packaging in 293FT cells and lentiviral stocks were concentrated using ultracentrifugation.
Transfection of lentivirus expressing miRNA
We transfected mouse hearts with lentivirus expressing miR-214 (LmiR-214) or lentivirus expressing miR-control (LmiR-control) via the right common carotid artery as described previously[1,2]. Briefly, mice were intubated and anesthetized with mechanical ventilation using 5% isoflurane. The anesthesia was maintained by inhalation of 1.5-2% isoflurane in 100% oxygen. An incision was made in the middle of the neck and the right common carotid artery was carefully isolated. A micro-catheter was introduced into the isolated common carotid artery and positioned into the aortic root through an arteriotomy site in the external carotid artery [1,2]. One hundred microliters of LmiR-214 (1x107 PFU) or LmiR-Con was injected through the micro- catheter. The micro-catheter was gently removed and the common carotid artery was tightened before the skin was closed. Seven days after transfection, the hearts were
113
harvested and transfection efficiency was evaluated by examining the green fluorescent
protein (GFP) expression and the expression of miR-214 in the heart tissues.
In vitro experiments
The H9C2 cardiomyoblasts stably expressing miR-214 or miR-con were generated
by transfection of LmiR-214 or LmiR-con and selection with Blasticidin (Invitrogen).
Transient expression of miR-214 in H9C2 cells was accomplished by transfection of
miR-214 mimics (40 nM) or miR-control mimics (40 nM). The cells were subjected to
hypoxia/reoxygenation as described previously1. Briefly, the medium was changed to hypoxia-equilibrated medium immediately before the cells were incubated at 37°C with
5% CO2 and 0.1% O2 in a hypoxia chamber (Pro-Ox Model C21, BioSpherix Ltd,
Redfield NY) for 2 h followed by reoxygenation in an incubator with 5% CO2. The cells
were not subjected to H/R served as control (normoxia).The cells were harvested and
cellular proteins were isolated for Western blot analysis[19-21].
Mitochondrial Isolation and Western Blot
Mitochondria was isolated from H9C2 cells using a mitochondrial isolation kit
(Thermo Scientific) according to the manufacturer’s protocol. Western blots were
performed as described previously[19-21]. The membranes were incubated with appropriate primary antibodies respectively, including anti-PTEN, anti-p-Akt, anti-Akt, anti-Bim, anti-p-Bad, anti-COX4 (Cell Signaling Technology, Inc, Danvers, MA), respectively, followed by incubation with peroxidase-conjugated second antibodies (Cell
Signaling Technology, Inc.) and examination with the ECL system (Amersham
114
Pharmacia, Piscataway, NJ). The signals were quantified using a G: Box gel imaging
system by Syngene (Syngene, USA, Frederick, MD).
Caspase-3/7 and caspase-8 activities Assay
Caspase-3/7 and caspase-8 activity were measured using a Caspase-Glo assay
kit (Promega) according to the manufacturer’s protocol as described previously[20].
Statistical analysis
Data are expressed as mean ± SD. Comparisons of data between groups were made using one-way analysis of variance (ANOVA), and Tukey’s procedure for multiple- range tests was performed. The overall survival probabilities were analyzed using the
log-rank test. P< 0.05 was considered to be significant.
ACKNOWLEDGMENTS
None
CONFICT OF INTEREST
The authors have no conflicts of interest to declare.
SOURCES OF FUNDING
This work was supported, in part, by National Institutes of Health grants HL071837 (CL),
GM083016 (CL, DLW), GM53522 (DLW), and C06RR0306551.
115
References
1. Wang X, Ha T, Zou J, Ren D, Liu L, Zhang X, Kalbfleisch J, Gao X, Williams D, Li C. MicroRNA-125b protects against myocardial ischaemia/reperfusion injury via targeting p53-mediated apoptotic signalling and TRAF6. Cardiovasc Res 2014;102:385-395.
2. Wang X, Ha T, Liu L, Zou J, Zhang X, Kalbfleisch J, Gao X, Williams D, Li C. Increased expression of microRNA-146a decreases myocardial ischemia/reperfusion injury. Cardiovascular Research 2013;97:432-442.
3. Cheng Y, Zhu P, Yang J, Liu X, Dong S, Wang X, Chun B, Zhuang J, Zhang C. Ischaemic preconditioning-regulated miR-21 protects heart against ischaemia/reperfusion injury via anti-apoptosis through its target PDCD4. Cardiovasc Res 2010;87:431-439.
4. Ren XP, Wu J, Wang X, Sartor MA, Qian J, Jones K, Nicolaou P, Pritchard TJ, Fan GC. MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20. Circulation 2009;119:2357-2366.
5. Bonauer A, Carmona G, Iwasaki M, Mione M, Koyanagi M, Fischer A, Burchfield J, Fox H, Doebele C, Ohtani K, Chavakis E, Potente M, Tjwa M, Urbich C, Zeiher AM, Dimmeler S. MicroRNA-92a Controls Angiogenesis and Functional Recovery of Ischemic Tissues in Mice. Science 2009;324:1710-1713.
6. Wang X, Zhang X, Ren XP, Chen J, Liu H, Yang J, Medvedovic M, Hu Z, Fan GC. MicroRNA-494 targeting both proapoptotic and antiapoptotic proteins protects against ischemia/reperfusion-induced cardial injury. Circulation 2010;122:1308-1318.
7. Zhang X, Wang X, Zhu H, Zhu C, Wang Y, Pu WT, Jegga AG, Fan G-C. Synergistic effects of the GATA-4-mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion-induced cardiomyocyte death. J Mol Cell Cardiol 2010;49:841-850.
8. Qin D, Wang X, Li Y, Yang L, Wang R, Peng J, Essandoh K, Mu X, Peng T, Han Q, Yu KJ, Fan GC. MicroRNA-223-5p and -3p Cooperatively Suppress Necroptosis in Ischemic/Reperfused Hearts. J Biol Chem 2016;291:20247- 20259.
9. Lv G, Shao S, Dong H, Bian X, Yang X, Dong S. MicroRNA-214 protects cardiac myocytes against H2 O2 -induced injury. J Cell Biochem 2014; 115:93-101.
10. Aurora AB, Mahmoud AI, Luo X, Johnson BA, van Rooij E, Matsuzaki S, Humphries KM, Hill JA, Bassel-Duby R, Sadek HA, Olson EN. MicroRNA-214 protects the mouse heart from ischemic injury by controlling Ca2+ overload and cell death. The Journal of Clinical Investigation 2012;122:1222-1232.
116
11. Narula J, Hajjar RJ, Dec GW. Apoptosis in the failing heart. Cardiol Clin 1998;16:691-710, ix.
12. Kelekar A, Chang BS, Harlan JE, Fesik SW, Thompson CB. Bad is a BH3 domain-containing protein that forms an inactivating dimer with Bcl-XL. Mol Cell Biol 1997;17:7040-7046.
13. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. Akt phorphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 1997;91:231-241.
14. O'Connor L, Strasser A, O'Reilly LA, Hausmann G, Adams JM, Cory S, Huang DC. Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J 1998;17:384-395.
15. Luo H, Yang Y, Duan J, Wu P, Jiang Q, Xu C. PTEN-regulated AKT-FoxO3a/Bim signaling contributes to reactive oxygen species-mediated apoptosis in selenite- treated colorectal cancer cells. Cell Death Dis 2013;4:e481.
16. Qi XJ, Wildey GM, Howe PH. Evidence that Ser87 of BimEL is phosphorylated by Akt and regulates BimEL apoptotic function. J Biol Chem 2006;281:813-823.
17. Linde A, Mosier D, Blecha F, Melgarejo T. Innate immunity and inflammation -- New frontiers in comparative cardiovascular pathology. Cardiovasc Res 2007;73:26-36.
18. Li C, Ha T, Kelley J, Gao X, Qiu Y, Kao RL, Browder W, Williams DL. Modulating Toll-like receptor mediated signaling by (1-->3)-b-D-glucan rapidly induces cardioprotection. Cardiovascular Research 2003;61:538-547.
19. Ha T, Hua F, Liu X, Ma J, McMullen JR, Shioi T, Izumo S, Kelley J, Gao X, Browder W, Williams DL, Kao RL, Li C. Lipopolysaccharide-induced myocardial protection against ischemia/reperfusion injury is mediated through a PI3K/Akt- dependent mechanism. Cardiovascular Research 2008;78:546-553.
20. Ha T, Hu Y, Liu L, Lu C, McMullen JR, Shioi T, Isumo S, Kelley J, Kao RL, Williams DL, Gao X, Li C. TLR2 ligands induce cardioprotection against ischemia/reperfusion injury through a PI3K/Akt-dependent mechanism. Cardiovasc Res 2010;87:694-703.
21. Hua F, Ha T, Ma J, Li Y, Kelley J, Gao X, Browder IW, Kao RL, Williams DL, Li C. Protection against Myocardial Ischemia/Reperfusion Injury in TLR4 Deficient Mice is Mediated through a Phosphoinositide 3-Kinase Dependent Mechanism. J Immunol 2007;178:7317-7324.
22. Fruman DA, Cantley LC. Phosphoinositide 3-kinase in immunological systems. Seminars in Immunology 2002;14:7-18.
117
23. Cantley LC. The phosphoinositide 3-kinase pathway. Science 2002;296:1655- 1657.
24. Williams JF, Winters AL, Lowitt S, Szentivanyi A. Depression of hepatic mixed- function oxidase activity by B. pertussis in splenectomized and athymic nude mice. Immunopharmacol 1981;3:101-106.
25. Gericke A, Munson M, Ross AH. Regulation of the PTEN phosphatase. Gene 2006;374:1-9.
26. Zhu Y, Hoell P, Ahlemeyer B, Kriegistein J. PTEN; a crucial mediator of mitochonidria-dependent apoptosis. Apoptosis 2006;11:197-207.
27. Matsui T, Ling L, del Monte F, Fukui Y, Franke TF, Hajjar RJ, Rosenzweig A. Adenoviral Gene Transfer of Activated Phosphatidylinositol 3' -Kinase and Akt Inhibits Apoptosis of Hypoxic Cardiomyocytes In Vitro. Circulation 1999;100:2373-2379.
28. Dhanasekaran A, Gruenloh SK, Buonaccorsi JN, Zhang R, Gross GJ, Falck JR, Patel PK, Jacobs ER, Medhora M. Multiple antiapoptotic targets of the PI3K/Akt survival pathway are activated by epoxyeicosatrienoic acids to protect cardiomyocytes from hypoxia/anoxia. Am J Physiol Heart Circ Physiol 2008;294:H724-J735.
29. Stambolic V, Suzuki A, de la Pompa JL, Brothers GM, Mirtsos C, Sasaki T, Ruland J, Penninger JM, Siderovski DP, Mak TW. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 1998;95:29-39.
30. Cantley LC, Neel BG: New insights into tumor suppression. PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl Acad Sci USA 1999;96:4240-4245.
31. Yaoita H, Ogawa K, Maehara K, Maruyama Y. Apoptosis in relevant clinical situations: contribution of apoptosis in myocardial infarction. Cardiovasc Res 2000;45:630-641.
32. Porter AG, Janicke RU. Emerging roles of caspase-3 in apoptosis. Cell Death Differ 1999;6:99-104.
33. Chen C-Y, Juo P, Liou JS, Li C-Q, Yu Q, Blenis J, Faller DV. The Recruitment of Fas-associated Death Domain/Caspase-8 in Ras-induced Apoptosis. Cell Growth Differ 2001;12:297-306.
34. Harada H, Andersen JS, Mann M, Terada N, Korsmeyer SJ. p70S6 kinase signals cell survival as well as growth, inactivating the pro-apoptotic molecule BAD. Proc Natl Aad Sci USA 2001;98:9666-9670.
118
35. Datta SR, Katsov A, Hu L, Petros A, Fesik SW, Yaffe MB, Greenberg ME. 14-3-3 proteins and survival kinases coperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 2000;6:41-51.
36. Qian L, Van Laake LW, Huang Y, Liu S, Wendland MF, Srivastava D. miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes. J Exp Med 2011;208:529-560.
37. Cao Z, Ren D, Ha T, Liu L, Wang X, Kalbfleisch J, Gao X, Kao R, Williams D, Li C. CpG-ODN, the TLR9 agonist, attenuates myocardial ischemia/reperfusion injury: Involving activation of PI3K/Akt signaling. Biochim Biophys Acta 2013;1832:96-104.
38. Fujio Y, Nguyen T, Wencker D, Kitsis RN, Walsh K. Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart. Circulation 2000;101:660-667.
39. Wang X. The expanding role of mitochondria in apoptosis. Genes Dev 2001;15:2922-2933.
40. Masters SC, Yang H, Datta SR, Greenberg ME, Fu H. 14-3-3 inhibits Bad- induced cell death through interaction with serine-136. Mol Pharmacol 2001;60:1325-1331.
119
CHAPTER 4
TLR3 MEDIATES REPAIR AND REGENERATION OF DAMAGED NEONATAL HEART
THROUGH GLYCOLYSIS DEPENDENT YAP1 REGULATED MIR-152 EXPRESSION
Xiaohui Wang1,4, Tuanzhu Ha1,4, Li Liu2, Yuanping Hu1*, Race Kao1,4, John Kalbfleisch3,4, David Williams1,4, Chuanfu Li1,4,
1Departments of Surgery, 3Biometry and Medical Computing and the 4Center of
Excellence in Inflammation, Infectious Disease and Immunity, James H. Quillen College
of Medicine, East Tennessee State University, Johnson City, Tennessee, USA.
2Department of Geriatrics, The First Affiliated Hospital of Nanjing Medical University,
Nanjing, China.
* Current contact address: Department of Pharmacy, the Binhu Hospital of Hefei, Anhui,
China.
Running head: TLR3 is required for neonatal heart regeneration
Corresponding author:
Chuanfu Li, M.D. Professor Department of Surgery James H. Quillen College of Medicine East Tennessee State University Campus Box 70575 Johnson City, TN 37614-0575 Phone 423-439-6349 FAX 423-439-6259 Email Address: [email protected]
120
Abstract
The present study investigated whether TLR3 is required for neonatal heart repair and regeneration following myocardial infarction (MI). TLR3 deficient neonatal mice exhibited impaired cardiac functional recovery and a larger infarct size, while wild type neonatal mice showed cardiac functional recovery and small infarct size after MI. The data suggests that TLR3 is essential for the regeneration and repair of damaged neonatal myocardium. In vitro treatment of neonatal cardiomyocytes with a TLR3 ligand,
Poly (I:C), significantly enhances glycolytic metabolism, YAP1 activation and proliferation of cardiomyocytes which were prevented by a glycolysis inhibitor, 2- deoxyglucose (2-DG). Administration of 2-DG to neonatal mice abolished cardiac functional recovery and YAP1 activation after MI, suggesting that TLR3 mediated regeneration and repair of the damaged neonatal myocardium is through glycolytic dependent YAP1 activation. Inhibition of YAP1 activation abolished Poly (I:C) induced proliferation of neonatal cardiomyocytes. Interestingly, activation of YAP1 increases the expression of miR-152 which represses the expression of cell cycle inhibitory proteins,
P27kip1 and DNMT1, leading to cardiomyocyte proliferation. We conclude that TLR3 is required for neonatal heart regeneration and repair after MI. The mechanisms involve glycolytic dependent YAP1 activation, resulting in miR-152 expression which targets
DNMT1/p27kip1.
121
Introduction
Ischemic heart disease remains the major cause of death in the United States(1).
The adult heart has limited capacity to regenerate and repair damaged myocardium
induced by ischemia/reperfusion (I/R) injury. The mammalian heart, including humans,
contains pre-existing cardiomyocytes which have the capability of proliferation and
regeneration(2-4). The mechanisms involve multiple signaling molecules, including
Hippo-YAP, PI3K/Akt and Wnt/beta-catenin as well as microRNAs(2, 5-12). Although the pre-existing cardiomyocytes in the adult heart have the capability to proliferate, the ability to repair and regenerate the damaged adult heart seems to be extremely limited(2-4).
Interestingly, the hearts of zebrafish and the neonatal mouse have the ability to
repair and regenerate damaged myocardium(13-15). However, neonatal mouse hearts
lose the capacity for proliferation and regeneration seven days after birth(14). This
positively correlates with the changes in cardiomyocyte metabolism from glycolysis to
oxidative phosphorylation. It is well known that more than 90% of the energy in adult
cardiomyocytes is generated by mitochondrial oxidative phosphorylation(16),
suggesting that glycolysis could play an important role in the proliferation of
cardiomyocytes. Indeed, glycolytic metabolism is predominant in zebrafish and neonatal
cardiomyocytes(17, 18) and is essential for somatic cell reprogramming and
differentiation(19-22). Therefore, enhanced glycolytic metabolism could be an important
approach for induction of cardiomyocyte proliferation.
122
Toll like receptor (TLR) ligands have been reported to promote metabolic reprogramming from oxidative phosphorylation to glycolysis which is necessary for activation of immune cells and for trained innate immunity (23-25). TLRs are well known as pattern-recognition receptors that play a critical role in the induction of innate immunity, inflammatory responses(26, 27) and myocardial ischemia/reperfusion (I/R) injury(28). Recent studies have reported that TLR-mediated signaling involves cell reprogramming and tissue regeneration(29-31). However, the mechanisms remain elusive.
YAP and TAZ are major downstream effectors of the Hippo signaling pathway which play critical roles in controlling organ size(32). The Hippo pathway is comprised of core kinase complexes including mammalian STE20-like protein kinase 1 and 2
(MST1/2), large tumor suppressor 1 and 2 (LATS1/2), and the adaptor proteins SAV1 and MOB1. Activation of MST1/2 phosphorylates LATS1/2 which suppress YAP/TAZ transcriptional activity by phosphorylation(32, 33). YAP1 and TAZ have been demonstrated to regulate cardiomyocyte proliferation and regeneration(8, 9, 11, 12, 33,
34). However, the mechanisms by which YAP/TAZ regulates cardiomyocyte proliferation and heart regeneration have not been elucidated.
MicroRNAs (miRs) are 21 to 23 nucleotide non-coding RNAs that can regulate up to
90% of human gene expression(35). Several microRNAs have been reported to be involved in the protection against myocardial I/R injury(36, 37) and in the regulation of heart regeneration(5, 10, 38-40). Interestingly, miR-152 has been reported to target cell
123
cycle inhibition proteins(41, 42). However, the role of miR-152 in the cardiomyocyte
proliferation has not been investigated.
In the present study, we demonstrated that TLR3 is required for neonatal damaged
heart regeneration. TLR3 activation induces glycolysis dependent YAP1 activation
which regulates the expression of miR-152, leading to regulation of neonatal
cardiomyocyte proliferation by targeting cell cycle inhibitory proteins DNMT1/p27kip1.
Results
TLR3 deficiency impairs neonatal heart regeneration after MI.
Neonatal mouse heart has a high regenerative capacity(13, 14). To investigate
whether TLR3 could involve neonatal heart regeneration and repair, one day old wild
type (WT) or TLR3 deficient (TLR3-/-) mice were subjected to myocardial infarction (MI)
by permanent ligation of LAD. Cardiac function was examined by echocardiography and
cardiomyocyte proliferation was evaluated by 5-ethynyl-2′-deoxyuridine (EdU) incorporation 21 days after MI. As shown in Figure 4.1A, WT neonatal mice show a
smaller infarct size, while TLR3-/- neonatal hearts exhibit larger scarring compared with
WT MI mice. EdU positive staining of cardiomyocytes in WT neonatal MI heart tissues are significantly greater (52.9%) than that in TLR3-/- neonatal MI heart tissues. In
addition, the values of cardiac function in WT neonatal MI mice are compatible with WT
sham control. In contrast, the values of cardiac function in TLR3-/- neonatal MI mice are
significantly lower than that in TLR3-/- sham control and WT MI mice (Fig. 4.1B). The
data suggest that TLR3 is necessary for neonatal heart regeneration and repair after MI.
124
Figure 17Figure 4.1. TLR3 deficiency reduced neonatal cardiomyocyte proliferation (A) and impaired the cardiac functional recovery (B) following MI. TLR3 activation increases glycolysis and glycolytic capacity in isolated neonatal cardiomyocytes (C). Glycolysis is necessary for TLR3 mediated cardiomyocyte proliferation (D) and neonatal heart functional recovery after MI (E). n=4-8/group. *p<0.05 compared with indicated groups.
125
TLR3 activation enhances glycolysis and promotes cardiomyocyte proliferation.
TLR ligands have been reported to induce glycolytic re-programming through
PI3K/AKT/Hif1α dependent signaling in immune cells(23-25). To investigate whether activation of TLR3 with Poly (I:C) would enhance glycolysis in cardiomyocytes, we isolated neonatal cardiomyocytes from one day old WT mice, treated them with Poly
(I:C) for 12 hours, and analyzed glycolytic metabolism. As shown in Figure 4.1C, Poly
(I:C) treatment markedly enhances glycolysis and glycolytic capacity compared with untreated controls. Poly (I:C) treatment also significantly increases the proliferation rate of neonatal cardiomyocytes as evidenced by increased Edu staining of neonatal cardiomyocytes (Fig. 4.1D). Interestingly, treatment of neonatal cardiomyocytes with 2- deoxy-D-glucose (2-DG), an inhibitor for hexokinase 2 which is an initial step in glycolysis, prevents Poly (I:C) induced neonatal cardiomyocyte proliferation (Fig. 4.1D).
Importantly, in vivo administration of 2-DG to one day old (P1) WT neonatal mice immediately after induction of MI significantly impairs cardiac functional recovery, when compared with untreated WT neonatal hearts 21 days after MI (Fig. 4.1E). The data suggests that glycolytic metabolism plays a critical role in TLR3-mediated neonatal cardiomyocyte proliferation and neonatal heart regeneration and repair after MI.
TLR3 mediates YAP1 activation via a glycolytic dependent mechanism.
Our data shows that Poly (I:C) induced proliferation of neonatal cardiomyocytes is mediated via glycolysis. To address how enhanced glycolysis by Poly (I:C) promotes neonatal cardiomyocyte proliferation, we investigate whether YAP1/TAZ activation involves TLR3-mediated neonatal heart regeneration and repair following MI. YAP1/TAZ
126
are two main downstream effectors of Hippo signaling which plays a critical role in cell
proliferation and tissue regeneration(8, 11, 34, 43, 44). Figures 4.2A show that the
levels of YAP1/TAZ in cytosol and nuclei were markedly increased in WT MI hearts
compared with WT sham control. In TLR3-/- MI mice, however, the levels of YAP1/TAZ
in the cytosol and nuclei did not significantly change compared with TLR3-/- sham control and were markedly lower than that in WT MI mice. The data suggests that TLR3 is an essential for YAP1-/TAZ activation after MI.
We then examined whether Poly (I:C) induced activation of YAP1 is mediated by
glycolysis. As shown in Figure 4.2B/C, Poly (I:C) treatment significantly increases the
levels of YAP1 in both cytosol and nuclei in WT cardiomyocytes, but not in TLR3-/-
cardiomyocytes (Fig. 4.2B). However, inhibition of glycolysis by 2-DG prevented Poly
I:C-induced activation of YAP1 (Fig. 4.2C), suggesting that TLR3-mediated YAP1 activation is through glycolytic dependent mechanism.
127
Figure 18Figure 4.2. TLR3 deficiency suppressed MI induced YAP1/TAZ expression and nucleus translocation (A) following MI. TLR3 ligand Poly I:C treatment increases the level of YAP1 in the cytosol and promotes YAP1 nuclear translocation in WT cardiomyocytes, but not in TLR3 deficiency cardiomyocytes(B). Glycolysis inhibition with 2-DG prevents Poly I:C-induced YAP1 activation and nuclear translocation(C). n=3- 6/group. *p<0.05 compared with indicated groups.
YAP1 activation is needed for TLR3 mediated cardiomyocyte proliferation.
To determine the role of YAP/TAZ in TLR3-mediated cardiomyocyte proliferation, we analyzed the expression pattern of YAP/TAZ in the myocardium at the different stages of neonatal heart maturation. As shown in Figure 4.3A, the levels of YAP1/TAZ expression are the highest in P1 and P3 neonatal hearts, gradually reduced on P7, and remained low on P14, and p21 which were positively correlated with a loss of regenerative capacity in damaged neonatal hearts. To conform that YAP1 plays an important role in cardiomyocyte proliferation, we transfected neonatal cardiomyocytes
128 with activated YAP1 (AAV-YAPS127A) to induce overexpression of YAP1. AAV-Luci served as a vector control. Figures 4.3B and C show that activated YAP1 transfection significantly promotes neonatal cardiomyocyte proliferation. Inhibition of YAP1 with specific siRNA for YAP1 (Fig. 4.3D) or YAP1 inhibitor, verteporfin (Fig. 4.3D) markedly suppresses Poly (I:C)-induced YAP1 expression, YAP1 nuclear translocation (Fig.
4.3E-G) and proliferation of neonatal cardiomyocytes. Verteporfin was a more effective inhibitor of YAP1 than siRNA. However, by using both approaches we were able to confirm that activation of YAP1 is necessary for Poly (I:C)-induced proliferation of neonatal cardiomyocytes.
129
Figure 19Figure 4.3. YAP1 activation is required for TLR3 mediated cardiomyocyte proliferation. The expression of YAP/TAZ is gradually downregulated during post- neonatal heart development (A). AAV virus mediated activated YAP1 overexpression (B) promotes neonatal cardiomyocyte proliferation (C). YAP1 inhibition with specific siRNA for YAP1 or YAP inhibitor, verteporfin (VP) markedly suppresses Poly I:C (PIC)- induced neonatal cardiomyocyte proliferation (D), YAP1 expression in cytosol and nuclear translocation(E-G). n=3-8/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
The TLR3 activation suppresses YAP1 phosphorylation, leading to YAP1 activation.
Our data shows that YAP1 activation is involved in TLR3 mediated neonatal cardiomyocyte proliferation. To investigate whether Poly (I:C) induces YAP1 expression at transcriptional or post-transcriptional levels, we analyzed mRNA levels of YAP/TAZ in neonatal cardiomyocytes treated with Poly (I:C).
130
Figure 4.4A shows that Poly (I:C) treatment did not alter the levels of YAP/TAZ
mRNAs, indicating that TLR3 medicated YAP1 activation is through post-translational
modification.
Figure 20Figure 4.4. TLR3 activation reduces YAP1 phosphorylation, leading to YAP1 activation. TLR3 activation has no effect on YAP1 or TAZ mRNA expression (A). Poly (I:C) treatment significantly reduced the phosphorylation level of LATS1 (B), MOB1 and YAP1(C). n=3-5/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
YAP1 contains two main sites for the phosphorylation of S127 and S397(32).
Phosphorylation of S127 promotes YAP1 binding with protein 14-3-3, thus preventing its translocation into the nucleus(32, 45). Phosphorylation of S397 facilitates YAP1 degradation(32, 46). Therefore, dephosphorylation of YAP1 will lead to activation and nuclear translocation. As shown in Figure 4.4C, Poly (I:C) treatment significantly
131
decreases the levels of phosphorylated YAP1 at both S127 and S397 in a time
dependent manner, and markedly increases total YAP1 levels. The data suggests that
Poly (I:C) induces YAP1 activation by suppressing YAP1 phosphorylation.
Suppression of YAP1 phosphorylation by Poly (I:C) is mediated through
dephosphorylation of LATS1 and MOB1.
LATS1/2 phosphorylates YAP1 at both the S127 and S397 sites, resulting in
inactivation or degradation of YAP1(32, 45, 46). MOB1 is an adaptor protein of Hippo
signaling and interacts with LATS1/2 to promote YAP1 phosphorylation(47). In contrast, decreased LATS1 and MOB1 phosphorylation will release their inhibitory effect on
YAP/TAZ activation(32, 47). We examined the effect of Poly (I:C) treatment on LATS1 and MOB1 phosphorylation in neonatal cardiomyocytes. Figures 4.4B and C show that
Poly (I:C) treatment markedly reduced the levels of LATS1 and MOB1 phosphorylation
in a time dependent manner, indicating that Poly (I:C)-induced YAP1 activation is
mediated through induction of LATS1 and MOB1 dephosphorylation.
132
Figure 21Figure 4.5. PP1a is involved in Poly (I:C) induced LATS1 and MOB1 pephosphorylation, YAP1 activation, and neonatal cardiomyocyte proliferation. Poly (I:C) treatment increased the interaction of PP1 with LATS1 and PP1 with MOB1 (A). PP1 inhibitor Okadaic acid (OA) treatment increased phosphorylation of LATS, YAP1 and MOB1 and prevented Poly (I:C) induced decreases in the levels of LATS1, YAP1 and MOB1 phosphorylation. (B) PP1 inhibitor OA treatment prevented Poly (I:C) induced YAP1 nuclear translocation (C) and neonatal cardiomyocyte proliferation (D). n=3-8/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
133
TLR3 activation induces an interaction between PP1a with LATS1 and MOB1
Protein phosphorylase 1 (PP1) plays an important role in the induction of protein
dephosphorylation(48, 49). We investigated whether Poly (I:C) could induce an
interaction between PP1a and LATS1, resulting in LATS1 and the downstream effector
YAP1 dephosphorylation in the neonatal cardiomyocytes. As shown in Figure 4.5, Poly
(I:C) treatment significantly promotes the interaction between PP1a and LATS1 (Fig.
4.5A) as evidenced by showing high levels of LATS1 in the PP1a immuneprecipitates.
Poly (I:C) treatment also markedly promotes the interaction of PP1a with MOB1 (Fig.
4.5A). The data indicates that PP1a is involved in Poly (I:C) induced decreases in the
levels of LATS1 and MOB1 phosphorylation.
To confirm our observation, we treated neonatal cardiomyocytes with a PP1a inhibitor, Okadaic acid(50) and observed that PP1a inhibition abolished Poly (I:C) induced decreases in the levels of phosphorylated LATS1 as well as MOB1. PP1a inhibition also increased YAP1 phosphorylation, resulting in decreases in the levels of
YAP1 (Fig. 4.5B). In addition, PP1a inhibition markedly attenuated Poly (I:C) induced
YAP1 nuclear translocation and neonatal cardiomyocyte proliferation (Fig. 4.5C/D). The
data suggests that Poly (I:C) induced YAP1 activation and nuclear translocation are
mediated by promoting the interaction of PP1a with LATS1 and MOB1, resulting in
inactivation of both LATS1 and MOB1 through their dephosphorylation.
134
Activation of TLR3 induces glycolysis mediated PP1a dependent LATS1 and YAP1
dephosphorylation.
Our above data indicates that PP1a and LATS1 interaction contributes to Poly
(I:C) induced YAP1 activation via its dephosphorylation (Fig. 4.5). We also observed that Poly (I:C) induced YAP1 activation is mediated through glycolytic dependent mechanism (Fig. 4.2B/C). To investigate whether glycolysis plays a role in Poly (I:C) induced the interaction of PP1a with LATS1 and decreased levels of phosphorylated
LATS1 and YAP1, we treated neonatal cardiomyocytes with 2-DG in the presence or
absence of Poly (I:C) and examined the interaction of PP1a with LATS1 and the levels
of LATS1 and YAP1 phosphorylation. As shown in Figure 4.6A, Poly (I:C) treatment
significantly strengthened the interaction between PP1a and LATS1. However, inhibition
of glycolysis by 2-DG prevented Poly I:C-induced interaction of PP1a with LATS1,
suggesting that Poly I:C-induced interaction of PP1a with LATS1 is mediated through
glycolytic metabolism. To further conform the role of glycolysis in Poly I:C-induced
dephosphorylatoin of LATS1 and YAP1, we treated neonatal cardiomyocytes with 2-DG
and examined the levels of LATS1, MOB1 and YAP1 phosphorylation. As shown in
Figure 4.6B, 2-DG treatment alone markedly increased the levels of LATS1 and YAP1
phosphorylation (Figs. 4.6B and C). Importantly, 2-DG administration also abolished
Poly (I:C) suppressed phosphorylation of LATS1, thereby increasing YAP1 phosphorylation. The data suggests that glycolysis is involved in Poly (I:C) induced decreases in the levels of LATS1 phosphorylation by promoting the interaction between
PP1a and LATS1, leading to YAP1 activation. We observed that 2-DG treatment did not alter Poly (I:C) induced decreases in the levels of MOB1 phosphorylation (Fig. 4.6C),
135 indicating that MOB1 dephosphorylation induced by Poly (I:C) could be mediated through glycolytic independent mechanism.
Figure 22Figure 4.6. Poly (I:C) induced glycolysis mediated PP1a dependent LATS1 and YAP1 dephosphorylation. Glycolysis inhibitor, 2-DG treatment prevents Poly I:C- induced interaction of LATS1 with PP1 (A) and decreases in the levels of phosphorylated LATS and YAP1 (B and C). 2-DG treatment did not alter Poly (I:C) decreased MOB1 phosphorylation (C). n=3-5/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
136
TLR3 modulates AMPK phosphorylation and YAP1 activation via a glycolytic dependent mechanism.
AMPK is abundantly expressed in the heart and plays an important role in the regulation of cellular metabolism(51). AMPK activity is regulated by glycolysis and involves energy stress-induced inactivation of YAP1(52). Since Poly (I:C) enhances glycolysis in neonatal cardiomyocytes, we examined whether Poly (I:C) would regulate
AMPK activation via glycolysis. As shown in Figure 4.7A, following Poly (I:C) treatment, the levels of phosphorylated AMPK are gradually reduced in a time dependent manner.
Administration of 2-DG abolished Poly (I:C)-suppressed AMPK phosphorylation and significantly increase the levels of phosphorylated AMPK (Fig. 4.7B). The data indicates that Poly (I:C) decreases AMPK phosphorylation via glycolysis.
To examine whether AMPK would play a role in the regulation of YAP1 activation, we treated neonatal cardiomyocytes with an AMPK specific activator, metformin and examined YAP1 activation as well as the proliferation of neonatal cardiomyocytes in the presence and absence of Poly (I:C). As shown in Figure 4.7C, treatment of the cells with metformin abolished Poly (I:C) induced decreases in AMPK phosphorylation.
Importantly, metformin treatment also abolished Poly (I:C) induced dephosphorylation of
YAP1 (Fig. 4.7D), YAP1 nuclear translocation (Fig. 4.7E), and neonatal cardiomyocyte proliferation (Fig. 4.7F). The data suggests that AMPK is an upstream of YAP1 and that activation of AMPK negatively regulates YAP1 activation and nuclear translocation as well as neonatal cardiomyocyte proliferation.
137
138
Figure 23Figure 4.7. Effect of AMPK on TLR3 mediated YAP1 activation. TLR3 activation significantly reduced the phosphorylation level of AMPK (A). 2-DG treatment prevented TLR3 mediated dephosphorylation of AMPK (B). Treatment of neonatal cardiomyocytes with AMPK activator metformin prevents TLR3 mediated dephosphorylation of AMPK and YAP1 (C and D). Treatment with the AMPK activator, metformin, prevented TLR3 mediated YAP1 nuclear translocation (E). Metformin prevented TLR3 mediated neonatal cardiomyocyte proliferation (F). n=3-6/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
Activation of YAP1 regulates miR-152 expression in neonatal cardiomyocytes.
To investigate the mechanisms by which activated YAP1 induces neonatal
cardiomyocyte proliferation, we examined the role of microRNA-152 (miR-152) in TLR3
mediated YAP1 dependent neonatal cardiomyocyte proliferation. It is well known that
miR-152 targets cell cycle entry proteins p27kip1 and DNA methyltransferase1
(DNMT1) which are important proteins in the regulation of cell proliferation(41, 42). As
shown in Figure 4.8A, miR-152 levels are the highest in P1 neonatal hearts but
gradually reduced in P3 and P7 neonatal hearts (Fig. 4.8A). In vitro treatment of
neonatal cardiomyocytes with Poly (I:C) significantly increases expression of miR-152
(Fig. 4.8B). However, inhibition of YAP1 with a YAP1 inhibitor (VP) prevented Poly (I:C)
induced increases in miR-152 expression (Fig. 4.8B). In contrast, increased YAP1
activation by transfection of neonatal cardiomyocytes with AAV-YAP1 markedly
increases the levels of miR-152 expression (Fig. 4.8C). The data suggests that
activation of YAP1 regulates the expression of miR-152 in neonatal cardiomyocytes.
139
Figure 24Figure 4.8. TLR3 mediated miR-152 expression is YAP1 dependent which is involved in TLR3 mediated cardiomyocyte proliferation. The expression of miR-152 gradually decreased during postnatal heart development (A). YAP1 is necessary for TLR3 mediated miR-152 upregulation (B and C).miR-152 overexpression promotes cardiomyocyte proliferation (D) and inhibits p27kip1 and DNMT1 expression (E). Anti- miR-152 treatment partially reduces TLR3 mediated cardiomyoycte proliferation (F). n=3-6/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
140
MiR-152 contributes to TLR3 mediated cardiomyocyte proliferation.
To investigate the role of miR-152 in TLR3 mediated neonatal cardiomyocyte
proliferation, we transfected neonatal cardiomyocytes with miR-152 mimics or anti-miR-
152 mimics, respectively (Fig. 4.S1) and examined the proliferation of neonatal cardiomyocytes. Figure 4.8D shows that delivery of miR-152 mimics significantly promotes the proliferation of neonatal cardiomyocytes as evidenced by incorporation of
Edu into the neonatal cardiomyocytes. MiR-152 mimic transfection markedly suppresses the expression of p27kip and DNMT1 in the neonatal cardiomyocytes (Fig.
4.8E). P27kip1 is a cyclin-dependent kinase inhibitor while DNMT1 plays a critical role in regulation of the cell cycle(53, 54). Suppression of p27kip1 and DNMT1 will promote cell cycle entry, leading to proliferation. However, suppression of miR-152 expression by transfection of cells with anti-miR-152 significantly attenuated Poly (I:C) induced cell proliferation (Fig. 4.8F). The data suggests that an increased level of miR-152 promotes neonatal cardiomyocyte proliferation via suppression of p27kip and DNMT1 expression.
Discussion.
The present study demonstrated that TLR3 is needed for regeneration and repair
damaged neonatal hearts following myocardial infarction. Mechanisms involve glycolytic
dependent YAP1 activation which up-regulates the expression of miR-152, leading to
activation of cell cycle by suppressing p27kip1 and DNMT1 expression. There are
several novel findings in the present studies. First, we provided compelling evidence
showing TLR3 is essential for neonatal heart regeneration and repair of infarcted
myocardium. Second, we demonstrated that activation of TLR3 enhances glycolysis,
141
leading to YAP1 activation. Third, we observed that TLR3 mediated glycolysis also
induces AMPK dephosphorylation, resulting in YAP1 activation, indicating that AMPK
negatively regulates YAP activation and nuclear translocation. Finally, we demonstrated
that activation of YAP1 increases the expression of miR-152 which targets cell cycle
inhibitory proteins p27kip1 and DNMT1, resulting in promoting cell proliferation (Fig. 9).
Figure 25Figure 4.9. Illustration of TLR3 mediated YAP1 activation and miR-152 expression in cardiomyocyte proliferation. Activation of TLR3 increases glycolysis, resulting in inactivation of LATS and AMPK by reducing their phosphorylation. Inactivated LATS and AMPK lead to activation of YAP1 which, as a co-transcriptional factor regulates miR-152 expression. miR-152 suppresses p27kip1 and DNMT1 expression, promoting cell proliferation.
Toll-like receptors (TLRs) are conserved pattern-recognition receptors that play a
critical role in the induction of innate and inflammatory responses(26, 27) and involve
142
the pathophysiology of myocardial ischemia/reperfusion (I/R) injury(28). We have
previously reported that TLR3 contributes to acute and early I/R-induced adult
myocardial injury(28). Recent studies have shown that TLR3-mediated signaling is
involved in cell reprogramming and tissue regeneration(29-31), indicating that TLR3
may be involved in damaged heart repair and regeneration in the late stage of
myocardial ischemic injury. It is well known that adult heart has extremely limited
capability for regeneration and repair of damaged myocardium(2-4). Therefore, neonatal
heart is an optional model for investing the role of TLR3 in damaged heart repair and
regeneration. The role of macrophages in neonatal heart regeneration has been well
demonstrated(55). Therefore, the present study focused on the role of TLR3 in cardiac
myocyte proliferation in damaged heart repair and regeneration. We observed that
TLR3 is required for neonatal heart repair and regeneration after MI. Specifically, we
observed that TLR3 deficiency impairs neonatal heart repair and regeneration after MI.
At present, we do not understand what endogenous ligands might activate TLR3 for
repair and regeneration in the damaged neonatal heart. We observed that the TLR3
ligand, Poly (I:C), significantly induced proliferation of neonatal cardiomyocytes via
glycolytic dependent mechanisms. Recent studies have shown that activation of TLRs
involves re-programming in immune cells via glycolytic metabolism(23-25) which is necessary for cell proliferation by supplying most of the intermediates for lipid
production, nucleotide and amino acid synthesis. In contrast to non-proliferating adult
cardiomyocytes, glycolysis is predominant in neonatal cardiomyocytes(17, 18). We
observed that TLR3 activation markedly enhanced glycolysis in neonatal
cardiomyocytes and demonstrated, for the first time to our knowledge, that glycolysis
143 plays a critical role in the proliferation of neonatal cardiomyocytes in vitro and heart repair and regeneration in vivo.
Activation of YAP1 has been shown to play an important role in mediating cell proliferation and differentiation(32, 33). We observed that administration of Poly (I:C) significantly increased the activation of YAP1 in neonatal cardiomyocytes, indicating that Poly (I:C) induced neonatal cardiomyocyte proliferation could be mediated by activation of YAP1. Indeed, we observed that the levels of YAP1 are markedly greater in
P1 and P3 neonatal hearts, but gradually decreased in the hearts of P7, P14 and P21 neonatal mice, which is consistent with the capability of the neonatal heart to regenerate after ischemic injury. Reduced YAP1 levels in the post-neonatal heart may also be associated with the loss of regenerative capacity in adult heart. To investigate why neonatal hearts contain higher levels of YAP1, we examined whether glycolysis would regulate the expression of YAP1 in neonatal cardiomyocytes. We found that suppression of glycolysis by 2-DG significantly reduced the expression of YAP1 and prevented Poly (I:C) induced increases in the levels of YAP1 in the neonatal cardiomyocytes. This finding, suggests that glycolysis regulates YAP1 expression in neonatal cardiomyocytes.
We observed that TLR3 activation does not alter YAP/TAZ mRNA levels in neonatal cardiomyocytes, indicating that TLR3 regulates YAP1 activation at the post transcriptional level. It is well known that increased phosphorylation of LATS1 and its adaptor protein MOB1 will result in YAP1 phosphorylation and degradation(32, 47). The
144 present study showed that Poly (I:C) treatment significantly induced decreases in the levels of LATS1 and MOB1 phosphorylation. Importantly, inhibition of glycolysis by 2-
DG abolished Poly (I:C) induced de-phosphorylaiton of LATS1 but not MOB1. This data suggests that Poly (I:C) induced decreases in the levels of phosphorylated MOB1 may be mediated through a glycolytic independent mechanism.
PP1 is a protein phosphatase which has been reported to interact with LATS1, resulting in inactivation of LATS1/2 by de-phosphorylation of LATS1 or direct dephosphorylation of YAP1/TAZ, leading to their activation(48, 49, 52). We observed that Poly (I:C) treatment significantly promotes the interaction of PP1a with MOB1 as evidenced by showing that MOB1 appears in the immunoprecipitates by anti-PP1a. Poly
(I:C) administration also induces an interaction between PP1a and LATS1. Thus Poly
(I:C) induced de-phosphorylation of MOB1 and LATS1/2 could be through an interaction of PP1 with both molecules. To confirm our observation, we treated neonatal cardiomyocytes with a PP1a inhibitor, okadaic acid, and observed that inhibition of
PP1a significantly induced phosphorylation of MOB1 and LATS1 and abolished Poly
(I:C) induced decreases in the levels of phosphorylated MOB1 and LATS1. The data suggests that Poly (I:C) induced YAP1 activation promotes the co-association of PP1a with MOB1 and LATS1, resulting in inactivation of both MOB1 and LATS1. Indeed,
PP1a inhibition by okadaic acid abolished Poly (I:C) induced neonatal cardiomyocyte proliferation.
145
Activation of AMPK signaling has been reported to suppress YAP1 activation through phosphorylation of LATS1(52, 56). In the present study, we observed that
TLR3 activation induces enhanced glycolysis in neonatal cardiomyocytes. AMPK has been reported to be involved in glycolytic metabolism(51). We examined whether AMPK might be involved in Poly (I:C) induced proliferation of neonatal cardiomyocytes. To the best of our knowledge, this is the first report that TLR3 activation decreases AMPK phosphorylation. This effect was abolished by 2-DG administration, suggesting that Poly
(I:C) induced de-phosphorylation of AMPK is mediated by glycolysis. To confirm the role of AMPK in Poly (I:C) induced YAP activation and the proliferation of neonatal cardiomyocytes, we treated neonatal cardiomyocytes with metformin, an AMPK activator and observed that increased phosphorylation of AMPK by metformin significantly abolished Poly (I:C) induced YAP1 activation and nuclear translocation as well as proliferation of neonatal cardiomyocytes. Our findings suggest that, in addition to inactivation of LATS1 leading to activation of YAP1 through glycolysis, Poly (I:C) also induces de-phosphorylation of AMPK via glycolysis resulting in YAP1 activation and nuclear translocation in neonatal cardiomyocyte proliferation.
It is well known that activation of YAP1 promotes cell proliferation and differentiation(32, 33). However, the mechanisms by which activated YAP1 regulates cell proliferation and heart regeneration remain elusive. YAP1 is a co-transcriptional factor which can regulate microRNAs biogenesis and expression with its DNA binding partner TEAD(57, 58). To address this issue, we investigated whether activated
YAP1/TAZ could regulate the expression of proteins, such as P27kip1 and DNMT1
146
(DNA methyltransferase 1), controlling cell cycle entry(53, 54). P27kip1 is a cyclin- dependent kinase inhibitor by binding and inhibiting cyclin/CDKs(53). DNA methylation in the promoter region of cell cycle related genes is associated with gene repression and prevents cell proliferation. DNMT1 is gradually upregulated during post-neonatal heart development and inhibition of DNMT1 markedly increases cardiomyocyte proliferation(54). Therefore, it is possible that targeting both P27kip1 and DNMT1 could promote cell proliferation. We demonstrated that activation of YAP1 by Poly (I:C) significantly increases the expression of miR-152 which represses the expression of
P27kip1 and DNMT1, resulting in proliferation of neonatal cardiomyocytes. DNMT1 has been reported to be gradually upregulated during post-neonatal heart development(59).
Meanwhile, the miR-152 expression is downregulated which is associated with losing repair and regenerative capacity of damaged hearts.
In summary, we demonstrated that TLR3 is necessary for the proliferation of neonatal cardiomyocytes and repair and regeneration of ischemic injured hearts. The mechanisms involve glycolysis dependent YAP1 activation via PP1a mediated suppression of MOB1 and LATS1 and through AMPK inactivation. Activated YAP1 increases the expression of miR-152 which targets DNMT1/p27kip1, leading to promoting cell proliferation. Activation of TLR3 could be a novel strategy for the treatment of ischemic heart injury.
147
Materials and Methods:
Animals
TLR3 deficient (TLR3−/−) and wild type C57BL/6 mice were obtained from Jackson
Laboratory (Indianapolis, IN). The mice were maintained in the Division of Laboratory
Animal Resources at East Tennessee State University. The experiments outlined in this manuscript conform to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication, 8th Edition, 2011). The animal care
and experimental protocols were approved by the ETSU Committee on Animal Care.
Induction of myocardial MI injury
One day old (P1) mice were subjected to myocardial infarction (MI) as described
previously(55). Briefly, the neonatal mice will be anesthetized by hypothermia on ice for
3-5 min. The chest was swabbed with betadine and opened at the fourth intercostal
space. 8-0 silk ligature will be used for LAD permanent ligation. The ribs will be sutured
together and the chest wall incision closed. The pups will be warmed immediately after
surgery by hand. Once all the surgeries were completed, the blood and skin of the pups
were cleaned with mixed stuff from mother’s cage before the pups were sent back to
mother’s cage. Cardiac function was assessed by echocardiography for up to 21 days
after induction of MI as described previously(36, 37). Ejection fraction (EF%) and
percent fractional shortening (FS%) were calculated(36, 37).
148
Isolation of neonatal cardiomyocytes
Neonatal cardiomyocytes were isolated from one day old (P1) WT mouse hearts
as described previously(7). Briefly, hearts were harvested from P1 neonatal mice and cut into small pieces followed by digestion in dissociation buffer (116 mM NaCl, 20 mM
Hepes, 0.8 mM Na2HPO4, 5.6 mM glucose, 5.4 mM KCl, and 0.8 mM MgSO4, pH 7.35)
containing 0.6 mg/ml of pancreatin and 0.4 mg/ml Collagenase Type II for 10 min. The supernatant was removed and digestion buffer was added. After several repeated digestions with 10 min for each step, the cell suspension was added with fetal bovine serum followed by centrifugation for 5 min at 100g. The cells were seeded onto uncoated dishes for 2-4 hours. The supernatant was recollected and plated into gelatin pre-coated plates.
Cardiomycoyte proliferation
The proliferation of neonatal cardiomyocytes was measured by EdU incorporation
and anti-Ph3 staining(7, 9, 11). EdU incorporation was examined by Click-iT EdU
imaging kit (Life Technologies) according to the manufacture’s protocol. Nuclei were
stained with DAPI and cardiomyocytes were stained with a monoclonal anti-actin
(Abcam, Cambridge, MA). The proliferation rate was calculated by dividing EdU+
cardiomyocytes by the total number of cardiomyocytes(7, 9, 11).
qPCR assay
mRNAs and microRNAs were isolated from heart tissues or cultured cells using the
miRNAs isolation kit (RNAzol®RT, MRC) in accordance with the manufacture’s
149
protocol. Quantitative real-time (qPCR) was conducted using a 4800 Real-time PCR machine (Bio-Rad). mRNAs and microRNAs levels were quantified by qPCR using specific Taqman assays (Applied Biosystems, USA) and Taqman Universal Master Mix
(Applied Biosystems). The levels of miR-152 and mRNA levels of YAP1 or TAZ were
quantified with the 2 (-ΔΔct) relative quantification method that was normalized to the
snRU6 or β-Actin (Applied Biosystems, USA).
In vitro experiments
The isolated neonatal cardiomyocytes were maintained in Dulbecco's Modified
Eagle's Medium (DMEM) supplemented 10% fetal bovine serum under 5% CO2 at 37°C.
To determine the role of TLR3 in the metabolism and proliferation of neonatal
cardiomyocytes, the cells were treated with TLR3 specific ligand, Poly (I:C) (1 µg/ml).
Cell proliferation was assessed by EdU incorporation (10umol/L)(7). The glycolytic
capacity (ECAR) was examined with a Seahorse system. To examine the role of
glycolysis and protein phosphotase 1 (PP1a) in TLR3-mediated YAP1 activation and
cardiomyocyte proliferation, the isolated cardiomyocytes were treated with the glycolytic
inhibitor, 2-DG (5 mmol/L) or PP1a inhibitor, okadaic acid, (0.5 mmol/L) respectively,
before the cells were treated Poly (I:C) at 1 µg/ml. To determine whether YAP1 or miR-
152 is necessary for TLR3-mediated cardiomyocyte proliferation, the isolated
cardiomyocytes were treated with YAP1 inhibitor verteporfin (VP, 1 mmol/L) or
transfected with siRNA-Con (80 nmol/L), siRNA-YAP1 (80 nmol/L), microRNA-Con
mimics (40 nmol/L), miR-152 mimics (40 nmol/L), anti-miR-Con mimics (60 nmol/L), anti-miR-152 mimics (60 nmol/L), respectively prior to Poly (I:C) treatment. To
150
determine whether AMPK was involved in TLR3 mediated YAP1 activation and
cardiomyocyte proliferation, the AMPK activator Metformin (1 mmol/L) was used prior to
Poly (I:C) treatment.
AAV virus packaging
pAAV.cTnT::3Flag-hYAP and pAAV.cTnT::Luciferase vectors were kindly provided
by Dr. William T. Pu (Harvard Stem Cell Institute). AAV virus was packaged in 293T
cells using AAV-DJ Helper Free Packaging System (Cell Biolabs, Inc). The hYAP vector
contains a S-127-A mutation resulting in a constitutive active form. The AAV virus were
purified and concentrated by CsCl gradient centrifugation. The AAV virus titer was
determined by AAVpro Titration Kit (Takara).
Immunoprecipitation
Approximately 200 µg of cellular proteins were subjected to immunoprecipitation
with 2 µg of antibody to PP1a (Santa Cruz Biotechnology, CA) followed by the addition
of 15 µl of protein A-agarose beads (Santa Cruz Biotechnology) as previously
described(60). The precipitates were washed four times with lysis buffer and subjected
to immunoblotting with the appropriate antibodies.
Immunoblotting
Immunoblotting was performed as described previously(36, 37). The primary antibodies (p-LATS1, LATS1, p-YAP1 (S127), p-YAP1 (S397), YAP1, p-MOB1, MOB1, p-AMPK, AMPK, p27kip1, DNMT1) and peroxidase-conjugated secondary antibody
151
were purchased from Cell Signaling Technology, Inc. The PP1a antibody was
purchased from Santa Cruz Biotechnology. The signals were quantified using the G:Box
gel imaging system by Syngene (Syngene, Fredric, MD).
Statistical analysis
Data are expressed as mean ± SD. Comparisons of data between groups were
made using one-way analysis of variance (ANOVA), and Tukey’s procedure for multiple-
range tests was performed. P< 0.05 was considered to be significant.
Author contributions: XHW and CFL conceived the project, designed the
experiments, analyzed and interpreted data, and wrote the manuscript. XHW, TZH and
YPH performed experiments. LL, RK and DW contributed to the scientific discussion and data interpretation. JK provided support for statistical analysis.
Acknowledgments: The authors thank William T. Pu (Harvard Stem Cell Institute) for
providing pAAV.cTnT::3Flag-hYAP and pAAV.cTnT::Luciferase vectors, and Gary
Wright and Ying Li (ETSU) for technical assistance on the glycolytic capacity (ECAR)
examination by Seahorse system. This work was supported, in part, by NIH HL071837
(Li), GM083016 (Li and Williams), GM53522 (Williams), and C06RR0306551 to ETSU.
Disclosures:
None.
152
References
1. Go AS, Mozaffarian D, Roger VL, Benjamin EJ, Berry JD, Blaha MJ, et al. Heart disease and stroke statistics--2014 update: a report from the American Heart Association. Circulation 2014;129:e28-e292.
2. Bergmann O, Bhardwaj RD, Bernard S, Zdunek S, Barnabe-Heider F, Walsh S, et al. Evidence for cardiomyocyte renewal in humans. Science 2009;324:98-102.
3. Ali SR, Hippenmeyer S, Saadat LV, Luo L, Weissman IL, Ardehali R. Existing cardiomyocytes generate cardiomyocytes at a low rate after birth in mice. Proc Natl Acad Sci U S A 2014;111:8850-5.
4. Senyo SE, Steinhauser ML, Pizzimenti CL, Yang VK, Cai L, Wang M, et al. Mammalian heart renewal by pre-existing cardiomyocytes. Nature 2013;493:433- 6.
5. Eulalio A, Mano M, Dal FM, Zentilin L, Sinagra G, Zacchigna S, et al. Functional screening identifies miRNAs inducing cardiac regeneration. Nature 2012;492:376-81.
6. Buikema JW, Mady AS, Mittal NV, Atmanli A, Caron L, Doevendans PA, et al. Wnt/beta-catenin signaling directs the regional expansion of first and second heart field-derived ventricular cardiomyocytes. Development 2013;140:4165-76.
7. Chen J, Huang ZP, Seok HY, Ding J, Kataoka M, Zhang Z, et al. mir-17-92 cluster is required for and sufficient to induce cardiomyocyte proliferation in postnatal and adult hearts. Circ Res 2013;112:1557-66.
8. Heallen T, Morikawa Y, Leach J, Tao G, Willerson JT, Johnson RL, et al. Hippo signaling impedes adult heart regeneration. Development 2013;140:4683-90.
9. Lin Z, Zhou P, von GA, Gu F, Ma Q, Chen J, et al. Pi3kcb Links Hippo-YAP and PI3K-AKT Signaling Pathways to Promote Cardiomyocyte Proliferation and Survival. Circ Res 2015;116:35-45.
10. Porrello ER, Mahmoud AI, Simpson E, Johnson BA, Grinsfelder D, Canseco D, et al. Regulation of neonatal and adult mammalian heart regeneration by the miR-15 family. Proc Natl Acad Sci U S A 2013;110:187-92.
11. von GA, Lin Z, Schlegelmilch K, Honor LB, Pan GM, Buck JN, et al. YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy. Proc Natl Acad Sci U S A 2012;109:2394-9.
153
12. Xin M, Kim Y, Sutherland LB, Murakami M, Qi X, McAnally J, et al. Hippo pathway effector Yap promotes cardiac regeneration. Proc Natl Acad Sci U S A 2013;110:13839-44.
13. Bryant DM, O'Meara CC, Ho NN, Gannon J, Cai L, Lee RT. A systematic analysis of neonatal mouse heart regeneration after apical resection. J Mol Cell Cardiol 2014.
14. Porrello ER, Mahmoud AI, Simpson E, Hill JA, Richardson JA, Olson EN, et al. Transient regenerative potential of the neonatal mouse heart. Science 2011;331:1078-80.
15. Poss KD, Wilson LG, Keating MT. Heart regeneration in zebrafish. Science 2002;298:2188-90.
16. Harris DA, Das AM. Control of mitochondrial ATP synthesis in the heart. Biochem J 1991;280 ( Pt 3):561-73.
17. Yutzey KE. Cardiovascular biology: Switched at birth. Nature 2014;509:572-3.
18. Puente BN, Kimura W, Muralidhar SA, Moon J, Amatruda JF, Phelps KL, et al. The oxygen-rich postnatal environment induces cardiomyocyte cell-cycle arrest through DNA damage response. Cell 2014;157:565-79.
19. Nie B, Wang H, Laurent T, Ding S. Cellular reprogramming: a small molecule perspective. Curr Opin Cell Biol 2012;24:784-92.
20. Panopoulos AD, Yanes O, Ruiz S, Kida YS, Diep D, Tautenhahn R, et al. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell Res 2012;22:168-77.
21. Shyh-Chang N, Zhu H, Yvanka de ST, Shinoda G, Seligson MT, Tsanov KM, et al. Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell 2013;155:778-92.
22. Zhang J, Nuebel E, Daley GQ, Koehler CM, Teitell MA. Metabolic regulation in pluripotent stem cells during reprogramming and self-renewal. Cell Stem Cell 2012;11:589-95.
23. Cheng SC, Quintin J, Cramer RA, Shepardson KM, Saeed S, Kumar V, et al. mTOR- and HIF-1alpha-mediated aerobic glycolysis as metabolic basis for trained immunity. Science 2014;345:1250684.
24. Everts B, Amiel E, Huang SC, Smith AM, Chang CH, Lam WY, et al. TLR-driven early glycolytic reprogramming via the kinases TBK1-IKKvarepsilon supports the anabolic demands of dendritic cell activation. Nat Immunol 2014;15:323-32.
154
25. O'Neill LA. Glycolytic reprogramming by TLRs in dendritic cells. Nat Immunol 2014;15:314-5.
26. Medzhitov R, Preston-Hurlburt P, Janeway CA, Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:394-7.
27. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000;406:782-7.
28. Lu C, Ren D, Wang X, Ha T, Liu L, Lee EJ, et al. Toll-like receptor 3 plays a role in myocardial infarction and ischemia/reperfusion injury. Biochim Biophys Acta 2014;1842:22-31.
29. Grote K, Schuett H, Salguero G, Grothusen C, Jagielska J, Drexler H, et al. Toll- like receptor 2/6 stimulation promotes angiogenesis via GM-CSF as a potential strategy for immune defense and tissue regeneration. Blood 2010;115:2543-52.
30. Lee J, Sayed N, Hunter A, Au KF, Wong WH, Mocarski ES, et al. Activation of innate immunity is required for efficient nuclear reprogramming. Cell 2012;151:547-58.
31. Sayed N, Wong WT, Ospino F, Meng S, Lee J, Jha A, et al. Transdifferentiation of Human Fibroblasts to Endothelial Cells: Role of Innate Immunity. Circulation 2014.
32. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 2015;163:811-28.
33. Zhou Q, Li L, Zhao B, Guan KL. The hippo pathway in heart development, regeneration, and diseases. Circ Res 2015;116:1431-47.
34. Tian Y, Liu Y, Wang T, Zhou N, Kong J, Chen L, et al. A microRNA-Hippo pathway that promotes cardiomyocyte proliferation and cardiac regeneration in mice. Sci Transl Med 2015;7:279ra38.
35. Perron MP, Provost P. Protein interactions and complexes in human microRNA biogenesis and function. Front Biosci 2008;13:2537-47.
36. Wang X, Ha T, Liu L, Zou J, Zhang X, Kalbfleisch J, et al. Increased expression of microRNA-146a decreases myocardial ischaemia/reperfusion injury. Cardiovasc Res 2013;97:432-42.
37. Wang X, Ha T, Zou J, Ren D, Liu L, Zhang X, et al. MicroRNA-125b protects against myocardial ischaemia/reperfusion injury via targeting p53-mediated apoptotic signalling and TRAF6. Cardiovasc Res 2014;102:385-95.
155
38. Aguirre A, Montserrat N, Zacchigna S, Nivet E, Hishida T, Krause MN, et al. In Vivo Activation of a Conserved MicroRNA Program Induces Mammalian Heart Regeneration. Cell Stem Cell 2014;15:589-604.
39. Ibrahim AG, Cheng K, Marban E. Exosomes as critical agents of cardiac regeneration triggered by cell therapy. Stem Cell Reports 2014;2:606-19.
40. Yin VP, Lepilina A, Smith A, Poss KD. Regulation of zebrafish heart regeneration by miR-133. Dev Biol 2012;365:319-27.
41. Wang YS, Chou WW, Chen KC, Cheng HY, Lin RT, Juo SH. MicroRNA-152 mediates DNMT1-regulated DNA methylation in the estrogen receptor alpha gene. PLoS One 2012;7:e30635.
42. Guo SL, Peng Z, Yang X, Fan KJ, Ye H, Li ZH, et al. miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. Int J Biol Sci 2011;7:567-74.
43. Santucci M, Vignudelli T, Ferrari S, Mor M, Scalvini L, Bolognesi ML, et al. The Hippo Pathway and YAP/TAZ-TEAD Protein-Protein Interaction as Targets for Regenerative Medicine and Cancer Treatment. J Med Chem 2015;58:4857-73.
44. Hansen CG, Moroishi T, Guan KL. YAP and TAZ: a nexus for Hippo signaling and beyond. Trends Cell Biol 2015.
45. Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al. Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 2007;130:1120-33.
46. Zhao B, Li L, Tumaneng K, Wang CY, Guan KL. A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP). Genes Dev 2010;24:72-85.
47. Hergovich A. MOB control: reviewing a conserved family of kinase regulators. Cell Signal 2011;23:1433-40.
48. Liu CY, Lv X, Li T, Xu Y, Zhou X, Zhao S, et al. PP1 cooperates with ASPP2 to dephosphorylate and activate TAZ. J Biol Chem 2011;286:5558-66.
49. Lv XB, Liu CY, Wang Z, Sun YP, Xiong Y, Lei QY, et al. PARD3 induces TAZ activation and cell growth by promoting LATS1 and PP1 interaction. EMBO Rep 2015;16:975-85.
50. Haystead TA, Sim AT, Carling D, Honnor RC, Tsukitani Y, Cohen P, et al. Effects of the tumour promoter okadaic acid on intracellular protein phosphorylation and metabolism. Nature 1989;337:78-81.
51. Arad M, Seidman CE, Seidman JG. AMP-activated protein kinase in the heart: role during health and disease. Circ Res 2007;100:474-88.
156
52. Mo JS, Meng Z, Kim YC, Park HW, Hansen CG, Kim S, et al. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat Cell Biol 2015;17:500-10.
53. Resnitzky D, Hengst L, Reed SI. Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol Cell Biol 1995;15:4347-52.
54. Sim CB, Ziemann M, Kaspi A, Harikrishnan KN, Ooi J, Khurana I, et al. Dynamic changes in the cardiac methylome during postnatal development. FASEB J 2015;29:1329-43.
55. Aurora AB, Porrello ER, Tan W, Mahmoud AI, Hill JA, Bassel-Duby R, et al. Macrophages are required for neonatal heart regeneration. J Clin Invest 2014;124:1382-92.
56. DeRan M, Yang J, Shen CH, Peters EC, Fitamant J, Chan P, et al. Energy stress regulates hippo-YAP signaling involving AMPK-mediated regulation of angiomotin-like 1 protein. Cell Rep 2014;9:495-503.
57. Chaulk SG, Lattanzi VJ, Hiemer SE, Fahlman RP, Varelas X. The Hippo pathway effectors TAZ/YAP regulate dicer expression and microRNA biogenesis through Let-7. J Biol Chem 2014;289:1886-91.
58. Tumaneng K, Schlegelmilch K, Russell RC, Yimlamai D, Basnet H, Mahadevan N, et al. YAP mediates crosstalk between the Hippo and PI(3)K-TOR pathways by suppressing PTEN via miR-29. Nat Cell Biol 2012;14:1322-9.
59. Kou CY, Lau SL, Au KW, Leung PY, Chim SS, Fung KP, et al. Epigenetic regulation of neonatal cardiomyocytes differentiation. Biochem Biophys Res Commun 2010;400:278-83.
60. Cao Z, Ren D, Ha T, Liu L, Wang X, Kalbfleisch J, et al. CpG-ODN, the TLR9 agonist, attenuates myocardial ischemia/reperfusion injury: involving activation of PI3K/Akt signaling. Biochim Biophys Acta 2013;1832:96-104.
157
Supplement Data
Figure 26Figure 4. S1. miR-152 is involved in TLR3 mediated cardiomyocyte proliferation. Transfection of MiR-152 mimics significantly increased miR-152 expression in isolated neonatal cardiomyocytes. n=3-4/group. *p<0.05 compared with indicated groups. #P < 0.05 compared with the control group.
158
CHAPTER 5
SUMMARY AND CONCLUSIONS
Myocardial I/R injury is one of the most common forms of cardiovascular disease and the major cause of morbidity and mortality globally ( Benjamin et al. 2017). It has is well established that the acute inflammatory response triggered by I/R injury exacerbates myocardial injury and leads to heart failure (Lange and Schreiner 1994;
Kapadia et al. 1998; Chao 2009;Ha et al. 2011). Previous studies demonstrated that attenuation of I/R induced inflammatory responses significantly decreases I/R induced myocardial injury and cardiac dysfunction (Ha et al. 2008; Chao 2009; Ha et al. 2010;
Ha et al. 2011; Cao et al. 2013). We have reported that miR-146a overexpression protects the myocardium from I/R induced injury by negatively regulating TLR-mediated
NF-κB signaling pathway through suppressing the expression of IRAK1 and TRAF6
(Wang et al. 2013). Interestingly, TRAF6 is a potential target of miR-125b based on the microRNA target predication databases. In addition, miR-125b also plays an important role in apoptotic signaling by targeting tumor suppressor protein p53 and mitochondrial related pro-apoptotic protein BAK1. Activation of cellular apoptotic and necrotic signaling contribute to I/R induced myocardial injury and cardiac remodeling. Inhibition of the tumor suppressor gene p53 or pro-apoptotic protein BAK1, BAX, or Bim1 mediated apoptotic signaling markedly attenuates I/R induced myocardial injury and cardiac dysfunction (Lesnefsky et al. 1997; Levraut et al. 2003; Fiedler et al. 2011). Our microRNA array data indicates that miR-125b has a high level in adult cardiomyocytes.
However, the role of miR-125b in I/R induced myocardial injury remains elusive. In chapter 2, we demonstrated that cardiac specific increases in the expression of miR-
159
125b significantly reduce infarct size and cardiac dysfunction after myocardial I/R injury.
The underlying mechanisms include the inhibition of TLR-NF-κB mediated inflammatory response by suppressing TRAF6. In addition, increased expression of miR-125b significantly attenuates I/R induced myocardial cell apoptosis by targeting P53, Bax and
BAK1. This study suggests that miR-125b could serve as a potential therapeutic target for inhibiting TLR-NF-kB signaling mediated inflammatory response, preventing P53,
Bax and Bak1 mediated apoptotic signaling and ultimately protect against myocardial ischemia/reperfusion injury.
As mentioned in the introduction, the cardio-protective effect of TLR modulation
is mediated by PI3K/Akt dependent mechanism (Hua et al. 2007; Ha et al. 2008; Ha et
al. 2010; Ha et al. 2011; Cao et al. 2013). Although abundant studies have proposed
that there has a crosstalk between TLR and PI3K/Akt signaling pathway, however, how
TLR mediated pathway regulates PI3K/Akt signaling pathway remains elusive. We
observed that TLR2 modulation by its ligands significantly attenuates I/R induced
myocardial injury by increasing the activation of PI3K/Akt signaling (Ha et al. 2010).
Importantly, we found that TLR2 ligand significantly increases the expression of miR-
214 (Wang et al. 2016). MiR-214 directly targets PTEN which is an important negative
regulator of PI3K/Akt signaling. In chapter 3, we investigated the role of miR-214 in I/R
induced myocardial injury and observed that increased expression of miR-214 protects
cardiac myoblasts H9C2 from hypoxia/reoxygenation induced cell injury in vitro and
attenuates I/R induced myocardial infarct size and cardiac dysfunction in vivo. Both in
vitro and in vivo data demonstrate that increased expression of miR-214 promotes
activation of the PI3K/Akt signaling by suppressing PTEN expression.
160
When put together as a whole, our studies demonstrated that microRNAs play an important role in TLR modulation induced protection against myocardial I/R injury by increasing the activation of PI3K/Akt signaling pathway, decreasing TLR/NF-κB mediated inflammatory response, and suppressing activation of apoptotic signaling following myocardial I/R injury. The information generated from this dissertation could be beneficial for the development of new strategies for the treatment of patients with heart attack and heart failure.
Adult patients have limited cardiac functional recovery following myocardial infarction mainly due to loss and/or insufficient regeneration of cardiomyocytes.
Interestingly, recent studies have shown that mammalian adult hearts can regenerate from pre-existing cardiomyocytes and exhibit a limited capacity of regeneration (Chen et al. 2013; Heallen et al. 2013; Senyo et al. 2013; Xin et al. 2013; Ali et al. 2014; Lin et al.
2015). TLR mediated immune response has an important role in tissue repair and regeneration (Grote et al. 2013; Carvalho et al. 2014; Kulkarni et al. 2014; Nelson et al.
2015; Natarajan et al. 2016). Recent studies have shown that TLR3 mediated signaling is required for somatic cell nuclear reprogramming and dsRNA mediated TLR3 activation plays an important role in skin regeneration (Lee et al. 2012; Nelson et al.
2015; Sayed et al. 2015; Natarajan et al. 2016). In the last study of this dissertation, we demonstrated for the first time to our knowledge, TLR3 is required for the neonatal heart repair and regeneration following myocardial infarction.
Mechanistic studies indicated that TLR3 mediated YAP1 activation plays an important role in neonatal cardiomyocyte proliferation and heart regeneration. YAP1 is a major downstream effector of the Hippo pathway which has been reported to regulate
161
cardiomyocyte proliferation and heart regeneration (Heallen et al. 2013; Xin et al. 2013;
Lin et al. 2015). It is well known that glycolysis is predominant in zebrafish and neonatal
heart which providing the most necessary building blocks for cell growth and
proliferation (Vander Heiden et al. 2009; Krisher and Prather 2012; Donnelly and Finlay
2015). Glycolytic metabolism also plays a fundamental role in somatic cell reprogramming and tissue regeneration (Krisher and Prather 2012; Panopoulos et al.
2012; Zhang et al. 2012; Jones and Bianchi 2015). In addition, we also observed the
level of YAP1 was high in P1(one day old) and P3 neonatal mice. However, the levels
were gradually decreased from P7 to P21 which were the periods of the metabolic
switching from glycolysis to oxidative phosphorylation in cardiomyocyte. Various studies
have demonstrated that glycolytic metabolism contributes to YAP1 transcriptional
activity (DeRan et al. 2014; Enzo et al. 2015; Mo et al. 2015). Interestingly, we observed
that TLR3 modulation by its specific ligand poly I:C significantly increased glycolysis and
glycolytic capacity. Our in vitro studies also demonstrated that glycolysis increasing is
necessary for TLR3 mediated YAP1 activation and cardiomyocyte proliferation. In vivo
suppression of glycolysis significantly impaired neonatal cardiac repair and regeneration
following MI injury in wild type mice, suggesting that glycolytic metabolism plays a
critical role in TLR3 mediated YAP1 activation and neonatal heart regeneration.
YAP1 plays a fundamental role in cardiomyocytes proliferation and heart
regeneration (Heallen et al. 2013; Xin et al. 2013; Lin et al. 2015). However, the
mechanisms by which activated YAP1 regulates heart regeneration remain elusive. We
found that TLR3 modulation significantly increases miR-152 expression which was
YAP1 dependent. Meanwhile, our study also demonstrates that miR-152 involved in
162
TLR3 mediated cardiomyocytes proliferation by targeting the cell cycle inhibitory protein
P27kip1 and DNMT1.
This study demonstrated for the first time to our knowledge, that TLR3 is necessary for neonatal heart repair and regeneration following ischemic injury. The underlying mechanisms including TLR3 induced glycolysis increasing and YAP1 activation. Moreover, YAP1 dependent miR-152 is also involved in the TLR3 mediated proliferative process by targeting p27kip1 and DNMT1. It is possible that TLR3 modulation could be a novel strategy for the treatment of heart failure patients by triggering heart regeneration and repair.
163
REFERENCES
Abad M, Hashimoto H, Zhou H, Morales MG, Chen B, Bassel-Duby R, Olson EN. 2017. Notch Inhibition Enhances Cardiac Reprogramming by Increasing MEF2C Transcriptional Activity. Stem Cell Reports 8(3):548-60
Abeyrathna P and Su Y. 2015. The critical role of Akt in cardiovascular function. Vascul Pharmacol 74:38-48
Aderem A and Ulevitch RJ. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406(6797):782-7
Akira S and Takeda K. 2004. Toll-like receptor signalling. Nat Rev Immunol 4(7):499- 511
Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P. 1997. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7(4):261-9
Ali SR, Hippenmeyer S, Saadat LV, Luo L, Weissman IL, Ardehali R. 2014. Existing cardiomyocytes generate cardiomyocytes at a low rate after birth in mice. Proc Natl Acad Sci U S A 111(24):8850-5
Ambros V. 2003. MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113(6):673-6
Ambrosio G, Zweier JL, Duilio C, Kuppusamy P, Santoro G, Elia PP, Tritto I, Cirillo P, Condorelli M, Chiariello M. 1993. Evidence that mitochondrial respiration is a source of potentially toxic oxygen free radicals in intact rabbit hearts subjected to ischemia and reflow. J Biol Chem 268(25):18532-41
Ao L, Zou N, Cleveland JC, Jr., Fullerton DA, Meng X. 2009. Myocardial TLR4 is a determinant of neutrophil infiltration after global myocardial ischemia: mediating KC and MCP-1 expression induced by extracellular HSC70. Am J Physiol Heart Circ Physiol 297(1):H21-H28
Aoyagi T and Matsui T. 2011. Phosphoinositide-3 kinase signaling in cardiac hypertrophy and heart failure. Curr Pharm Des 17(18):1818-24
Aragona M, Panciera T, Manfrin A, Giulitti S, Michielin F, Elvassore N, Dupont S, Piccolo S. 2013. A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154(5):1047-59
Arslan F, de Kleijn DP, Pasterkamp G. 2011. Innate immune signaling in cardiac ischemia. Nat Rev Cardiol 8(5):292-300
Arslan F, Smeets MB, O'Neill LA, Keogh B, McGuirk P, Timmers L, Tersteeg C, Hoefer IE, Doevendans PA, Pasterkamp G, et al. 2010. Myocardial
164
ischemia/reperfusion injury is mediated by leukocytic toll-like receptor-2 and reduced by systemic administration of a novel anti-toll-like receptor-2 antibody. Circulation 121(1):80-90
Arts RJ, Carvalho A, La RC, Palma C, Rodrigues F, Silvestre R, Kleinnijenhuis J, Lachmandas E, Goncalves LG, Belinha A, et al. 2016a. Immunometabolic Pathways in BCG-Induced Trained Immunity. Cell Rep 17(10):2562-71
Arts RJ, Novakovic B, Ter HR, Carvalho A, Bekkering S, Lachmandas E, Rodrigues F, Silvestre R, Cheng SC, Wang SY, et al. 2016b. Glutaminolysis and Fumarate Accumulation Integrate Immunometabolic and Epigenetic Programs in Trained Immunity. Cell Metab 24(6):807-19
Aurora AB, Porrello ER, Tan W, Mahmoud AI, Hill JA, Bassel-Duby R, Sadek HA, Olson EN. 2014. Macrophages are required for neonatal heart regeneration. J Clin Invest 124(3):1382-92
Avruch J, Zhou D, Fitamant J, Bardeesy N, Mou F, Barrufet LR. 2012. Protein kinases of the Hippo pathway: regulation and substrates. Semin Cell Dev Biol 23(7):770- 84
Barry WH. 1987. Mechanisms of myocardial cell injury during ischemia and reperfusion. J Card Surg 2(3):375-83
Bartel DP. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281-97
Barwari T, Joshi A, Mayr M. 2016. MicroRNAs in Cardiovascular Disease. J Am Coll Cardiol 68(23):2577-84
Batty JA, Lima JA, Jr., Kunadian V. 2016. Direct cellular reprogramming for cardiac repair and regeneration. Eur J Heart Fail 18(2):145-56
Behm-Ansmant I, Rehwinkel J, Izaurralde E. 2006. MicroRNAs silence gene expression by repressing protein expression and/or by promoting mRNA decay. Cold Spring Harb Symp Quant Biol 71:523-30
Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K, et al. 2003. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114(6):763-76
165
Benjamin EJ, Blaha MJ, Chiuve SE, Cushman M, Das SR, Deo R, de Ferranti SD, Floyd J, Fornage M, Gillespie C, et al. 2017. Heart Disease and Stroke Statistics-2017 Update: A Report from the American Heart Association. Circulation. 135(10):e146-e603 Bergmann O, Bhardwaj RD, Bernard S, Zdunek S, Barnabe-Heider F, Walsh S, Zupicich J, Alkass K, Buchholz BA, Druid H, et al. 2009. Evidence for cardiomyocyte renewal in humans. Science 324(5923):98-102
Braunwald E and Kloner RA. 1985. Myocardial reperfusion: a double-edged sword? J Clin Invest 76(5):1713-9
Brightbill HD and Modlin RL. 2000. Toll-like receptors: molecular mechanisms of the mammalian immune response. Immunology 101(1):1-10
Brown JM, Terada LS, Grosso MA, Whitman GJ, Velasco SE, Patt A, Harken AH, Repine JE. 1988. Hydrogen peroxide mediates reperfusion injury in the isolated rat heart. Mol Cell Biochem 84(2):173-5
Bu L, Jiang X, Martin-Puig S, Caron L, Zhu S, Shao Y, Roberts DJ, Huang PL, Domian IJ, Chien KR. 2009. Human ISL1 heart progenitors generate diverse multipotent cardiovascular cell lineages. Nature 460(7251):113-7
Buikema JW, Mady AS, Mittal NV, Atmanli A, Caron L, Doevendans PA, Sluijter JP, Domian IJ. 2013. Wnt/beta-catenin signaling directs the regional expansion of first and second heart field-derived ventricular cardiomyocytes. Development 140(20):4165-76
Buja LM. 2005. Myocardial ischemia and reperfusion injury. Cardiovasc Pathol 14(4):170-5
Callegari E, Elamin BK, D'Abundo L, Falzoni S, Donvito G, Moshiri F, Milazzo M, Altavilla G, Giacomelli L, Fornari F, et al. 2013. Anti-tumor activity of a miR-199- dependent oncolytic adenovirus. PLoS One 8(9):e73964
Callis TE and Wang DZ. 2008. Taking microRNAs to heart. Trends Mol Med 14(6):254- 60
Cao Z, Ren D, Ha T, Liu L, Wang X, Kalbfleisch J, Gao X, Kao R, Williams D, Li C. 2013. CpG-ODN, the TLR9 agonist, attenuates myocardial ischemia/reperfusion injury: involving activation of PI3K/Akt signaling. Biochim Biophys Acta 1832(1):96-104
Carvalho L, Jacinto A, Matova N. 2014. The Toll/NF-kappaB signaling pathway is required for epidermal wound repair in Drosophila. Proc Natl Acad Sci U S A 111(50):E5373-E5382
166
Carver DJ, Aman MJ, Ravichandran KS. 2000. SHIP inhibits Akt activation in B cells through regulation of Akt membrane localization. Blood 96(4):1449-56
Chang TC, Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ, et al. 2007. Transactivation of miR- 34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell 26(5):745-52
Chao W. 2009. Toll-like receptor signaling: a critical modulator of cell survival and ischemic injury in the heart. Am J Physiol Heart Circ Physiol 296(1):H1-12
Chapnik E, Sasson V, Blelloch R, Hornstein E. 2012. Dgcr8 controls neural crest cells survival in cardiovascular development. Dev Biol 362(1):50-6
Chaulk SG, Lattanzi VJ, Hiemer SE, Fahlman RP, Varelas X. 2014. The Hippo pathway effectors TAZ/YAP regulate dicer expression and microRNA biogenesis through Let-7. J Biol Chem 289(4):1886-91
Chen J, Huang ZP, Seok HY, Ding J, Kataoka M, Zhang Z, Hu X, Wang G, Lin Z, Wang S, et al. 2013. mir-17-92 cluster is required for and sufficient to induce cardiomyocyte proliferation in postnatal and adult hearts. Circ Res 112(12):1557-66
Chen JF, Murchison EP, Tang R, Callis TE, Tatsuguchi M, Deng Z, Rojas M, Hammond SM, Schneider MD, Selzman CH, et al. 2008. Targeted deletion of Dicer in the heart leads to dilated cardiomyopathy and heart failure. Proc Natl Acad Sci U S A 105(6):2111-6
Chen TH, Chen CY, Wen HC, Chang CC, Wang HD, Chuu CP, Chang CH. 2017. YAP promotes myogenic differentiation via the MEK5-ERK5 pathway. FASEB J
Chen XM, Splinter PL, O'Hara SP, LaRusso NF. 2007. A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem 282(39):28929-38
Chen ZJ. 2012. Ubiquitination in signaling to and activation of IKK. Immunol Rev 246(1):95-106
Cheng SC, Quintin J, Cramer RA, Shepardson KM, Saeed S, Kumar V, Giamarellos- Bourboulis EJ, Martens JH, Rao NA, et al. 2014. mTOR- and HIF-1alpha- mediated aerobic glycolysis as metabolic basis for trained immunity. Science 345(6204):1250684
Chiong M, Wang ZV, Pedrozo Z, Cao DJ, Troncoso R, Ibacache M, Criollo A, Nemchenko A, Hill JA, Lavandero S. 2011. Cardiomyocyte death: mechanisms and translational implications. Cell Death Dis 2:e244
167
Chow M, Boheler KR, Li RA. 2013. Human pluripotent stem cell-derived cardiomyocytes for heart regeneration, drug discovery and disease modeling: from the genetic, epigenetic, and tissue modeling perspectives. Stem Cell Res Ther 4(4):97
Codelia VA, Sun G, Irvine KD. 2014. Regulation of YAP by mechanical strain through Jnk and Hippo signaling. Curr Biol 24(17):2012-7
Cohen MM, Jr. 2013. The AKT genes and their roles in various disorders. Am J Med Genet A 161A(12):2931-7
Courtnay R, Ngo DC, Malik N, Ververis K, Tortorella SM, Karagiannis TC. 2015. Cancer metabolism and the Warburg effect: the role of HIF-1 and PI3K. Mol Biol Rep 42(4):841-51
D'Uva G, Aharonov A, Lauriola M, Kain D, Yahalom-Ronen Y, Carvalho S, Weisinger K, Bassat E, Rajchman D, Yifa O, et al. 2015. ERBB2 triggers mammalian heart regeneration by promoting cardiomyocyte dedifferentiation and proliferation. Nat Cell Biol 17(5):627-38
DeBosch B, Sambandam N, Weinheimer C, Courtois M, Muslin AJ. 2006. Akt2 regulates cardiac metabolism and cardiomyocyte survival. J Biol Chem 281(43):32841-51
DeRan M, Yang J, Shen CH, Peters EC, Fitamant J, Chan P, Hsieh M, Zhu S, Asara JM, Zheng B, et al. 2014. Energy stress regulates hippo-YAP signaling involving AMPK-mediated regulation of angiomotin-like 1 protein. Cell Rep 9(2):495-503
Dharaneeswaran H, Abid MR, Yuan L, Dupuis D, Beeler D, Spokes KC, Janes L, Sciuto T, Kang PM, Jaminet SC, et al. 2014. FOXO1-mediated activation of Akt plays a critical role in vascular homeostasis. Circ Res 115(2):238-51
Dibble CC and Cantley LC. 2015. Regulation of mTORC1 by PI3K signaling. Trends Cell Biol 25(9):545-55
Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, Wang D, Krall TJ, Delphin ES, Zhang C. 2009. MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarction. J Biol Chem 284(43):29514-25
Donnelly RP and Finlay DK. 2015. Glucose, glycolysis and lymphocyte responses. Mol Immunol 68(2 Pt C):513-9
Donohoe DR and Bultman SJ. 2012. Metaboloepigenetics: interrelationships between energy metabolism and epigenetic control of gene expression. J Cell Physiol 227(9):3169-77
Duelen R and Sampaolesi M. 2017. Stem Cell Technology in Cardiac Regeneration: A Pluripotent Stem Cell Promise. EBioMedicine 16:30-40
168
Dunne A, Ejdeback M, Ludidi PL, O'Neill LA, Gay NJ. 2003. Structural complementarity of Toll/interleukin-1 receptor domains in Toll-like receptors and the adaptors Mal and MyD88. J Biol Chem 278(42):41443-51
Dutta P, Sager HB, Stengel KR, Naxerova K, Courties G, Saez B, Silberstein L, Heidt T, Sebas M, Sun Y, et al. 2015. Myocardial Infarction Activates CCR2(+) Hematopoietic Stem and Progenitor Cells. Cell Stem Cell 16(5):477-87
Elbediwy A, Vincent-Mistiaen ZI, Spencer-Dene B, Stone RK, Boeing S, Wculek SK, Cordero J, Tan EH, Ridgway R, Brunton VG, et al. 2016. Integrin signalling regulates YAP and TAZ to control skin homeostasis. Development 143(10):1674-87
Enzo E, Santinon G, Pocaterra A, Aragona M, Bresolin S, Forcato M, Grifoni D, Pession A, Zanconato F, Guzzo G, et al. 2015. Aerobic glycolysis tunes YAP/TAZ transcriptional activity. EMBO J 34(10):1349-70
Epelman S, Liu PP, Mann DL. 2015. Role of innate and adaptive immune mechanisms in cardiac injury and repair. Nat Rev Immunol 15(2):117-29
Eulalio A, Mano M, Dal FM, Zentilin L, Sinagra G, Zacchigna S, Giacca M. 2012. Functional screening identifies miRNAs inducing cardiac regeneration. Nature 492(7429):376-81
Everts B, Amiel E, Huang SC, Smith AM, Chang CH, Lam WY, Redmann V, Freitas TC, Blagih J, van der Windt GJ, et al. 2014. TLR-driven early glycolytic reprogramming via the kinases TBK1-IKKvarepsilon supports the anabolic demands of dendritic cell activation. Nat Immunol 15(4):323-32
Fiedler J, Jazbutyte V, Kirchmaier BC, Gupta SK, Lorenzen J, Hartmann D, Galuppo P, Kneitz S, Pena JT, Sohn-Lee C, et al. 2011. MicroRNA-24 regulates vascularity after myocardial infarction. Circulation 124(6):720-30
Fisher SA, Doree C, Mathur A, Taggart DP, Martin-Rendon E. 2016. Stem cell therapy for chronic ischaemic heart disease and congestive heart failure. Cochrane Database Syst Rev 12:CD007888
Foster JG, Blunt MD, Carter E, Ward SG. 2012. Inhibition of PI3K signaling spurs new therapeutic opportunities in inflammatory/autoimmune diseases and hematological malignancies. Pharmacol Rev 64(4):1027-54
Frangogiannis NG. 2015. Emerging roles for macrophages in cardiac injury: cytoprotection, repair, and regeneration. J Clin Invest 125(8):2927-30
Franke TF, Kaplan DR, Cantley LC, Toker A. 1997. Direct regulation of the Akt proto- oncogene product by phosphatidylinositol-3,4-bisphosphate. Science 275(5300):665-8
169
Gao XM, Liu Y, White D, Su Y, Drew BG, Bruce CR, Kiriazis H, Xu Q, Jennings N, Bobik A, et al. 2011. Deletion of macrophage migration inhibitory factor protects the heart from severe ischemia-reperfusion injury: a predominant role of anti- inflammation. J Mol Cell Cardiol 50(6):991-9
Gatto S, Della RF, Cimmino A, Strazzullo M, Fabbri M, Mutarelli M, Ferraro L, Weisz A, D'Esposito M, Matarazzo MR. 2010. Epigenetic alteration of microRNAs in DNMT3B-mutated patients of ICF syndrome. Epigenetics 5(5):427-43
Gay MS, Dasgupta C, Li Y, Kanna A, Zhang L. 2016. Dexamethasone Induces Cardiomyocyte Terminal Differentiation via Epigenetic Repression of Cyclin D2 Gene. J Pharmacol Exp Ther 358(2):190-8
Genova ML, Pich MM, Bernacchia A, Bianchi C, Biondi A, Bovina C, Falasca AI, Formiggini G, Castelli GP, Lenaz G. 2004. The mitochondrial production of reactive oxygen species in relation to aging and pathology. Ann N Y Acad Sci 1011:86-100
Goichberg P, Chang J, Liao R, Leri A. 2014. Cardiac stem cells: biology and clinical applications. Antioxid Redox Signal 21(14):2002-17
Golpanian S, Wolf A, Hatzistergos KE, Hare JM. 2016. Rebuilding the Damaged Heart: Mesenchymal Stem Cells, Cell-Based Therapy, and Engineered Heart Tissue. Physiol Rev 96(3):1127-68
Grannas K, Arngarden L, Lonn P, Mazurkiewicz M, Blokzijl A, Zieba A, Soderberg O. 2015. Crosstalk between Hippo and TGFbeta: Subcellular Localization of YAP/TAZ/Smad Complexes. J Mol Biol 427(21):3407-15
Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. 2005. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123(4):631-40
Griffiths-Jones S, Saini HK, van DS, Enright AJ. 2008. miRBase: tools for microRNA genomics. Nucleic Acids Res 36(Database issue):D154-D158
Grote K, Petri M, Liu C, Jehn P, Spalthoff S, Kokemuller H, Luchtefeld M, Tschernig T, Krettek C, Haasper C, et al. 2013. Toll-like receptor 2/6-dependent stimulation of mesenchymal stem cells promotes angiogenesis by paracrine factors. Eur Cell Mater 26:66-79
Guilherme A, Klarlund JK, Krystal G, Czech MP. 1996. Regulation of phosphatidylinositol 3,4,5-trisphosphate 5'-phosphatase activity by insulin. J Biol Chem 271(47):29533-6
Gustafsson AB and Gottlieb RA. 2008. Heart mitochondria: gates of life and death. Cardiovasc Res 77(2):334-43
170
Ha T, Hu Y, Liu L, Lu C, McMullen JR, Kelley J, Kao RL, Williams DL, Gao X, Li C. 2010. TLR2 ligands induce cardioprotection against ischaemia/reperfusion injury through a PI3K/Akt-dependent mechanism. Cardiovasc Res 87(4):694-703
Ha T, Hua F, Liu X, Ma J, McMullen JR, Shioi T, Izumo S, Kelley J, Gao X, Browder W, et al. 2008. Lipopolysaccharide-induced myocardial protection against ischaemia/reperfusion injury is mediated through a PI3K/Akt-dependent mechanism. Cardiovasc Res 78(3):546-53
Ha T, Liu L, Kelley J, Kao R, Williams D, Li C. 2011. Toll-like receptors: new players in myocardial ischemia/reperfusion injury. Antioxid Redox Signal 15(7):1875-93
Haider HK, Jiang S, Idris NM, Ashraf M. 2008. IGF-1-overexpressing mesenchymal stem cells accelerate bone marrow stem cell mobilization via paracrine activation of SDF-1alpha/CXCR4 signaling to promote myocardial repair. Circ Res 103(11):1300-8
Han C, Nie Y, Lian H, Liu R, He F, Huang H, Hu S. 2015. Acute inflammation stimulates a regenerative response in the neonatal mouse heart. Cell Res 25(10):1137-51
Han J, Lee Y, Yeom KH, Nam JW, Heo I, Rhee JK, Sohn SY, Cho Y, Zhang BT, Kim VN. 2006. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell 125(5):887-901
Harris DA and Das AM. 1991. Control of mitochondrial ATP synthesis in the heart. Biochem J 280 ( Pt 3):561-73
Harvey KF, Pfleger CM, Hariharan IK. 2003. The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis. Cell 114(4):457- 67
Hausenloy DJ and Yellon DM. 2013. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest 123(1):92-100
Heallen T, Morikawa Y, Leach J, Tao G, Willerson JT, Johnson RL, Martin JF. 2013. Hippo signaling impedes adult heart regeneration. Development 140(23):4683- 90
Heras-Sandoval D, Perez-Rojas JM, Hernandez-Damian J, Pedraza-Chaverri J. 2014. The role of PI3K/AKT/mTOR pathway in the modulation of autophagy and the clearance of protein aggregates in neurodegeneration. Cell Signal 26(12):2694- 701
Hergovich A and Hemmings BA. 2009. Mammalian NDR/LATS protein kinases in hippo tumor suppressor signaling. Biofactors 35(4):338-45
171
Hesse M, Fleischmann BK, Kotlikoff MI. 2014. Concise review: The role of C-kit expressing cells in heart repair at the neonatal and adult stage. Stem Cells 32(7):1701-12
Hinkel R, Penzkofer D, Zuhlke S, Fischer A, Husada W, Xu QF, Baloch E, van RE, Zeiher AM, Kupatt C, et al. 2013. Inhibition of microRNA-92a protects against ischemia/reperfusion injury in a large-animal model. Circulation 128(10):1066-75
Hirschey MD, DeBerardinis RJ, Diehl AM, Drew JE, Frezza C, Green MF, Jones LW, Ko YH, Le A, Lea MA, et al. 2015. Dysregulated metabolism contributes to oncogenesis. Semin Cancer Biol 35 Suppl:S129-S150
Honda HM, Korge P, Weiss JN. 2005. Mitochondria and ischemia/reperfusion injury. Ann N Y Acad Sci 1047:248-58
Hou L, Kim JJ, Woo YJ, Huang NF. 2016. Stem cell-based therapies to promote angiogenesis in ischemic cardiovascular disease. Am J Physiol Heart Circ Physiol 310(4):H455-H465
Houddane A, Bultot L, Novellasdemunt L, Johanns M, Gueuning MA, Vertommen D, Coulie PG, Bartrons R, Hue L, Rider MH. 2017. Role of Akt/PKB and PFKFB isoenzymes in the control of glycolysis, cell proliferation and protein synthesis in mitogen-stimulated thymocytes. Cell Signal 34:23-37
Houyel L, To-Dumortier NT, Lepers Y, Petit J, Roussin R, Ly M, Lebret E, Fadel E, Horer J, Hascoet S. 2017. Heart transplantation in adults with congenital heart disease. Arch Cardiovasc Dis
Howes AL, Arthur JF, Zhang T, Miyamoto S, Adams JW, Dorn GW, Woodcock EA, Brown JH. 2003. Akt-mediated cardiomyocyte survival pathways are compromised by G alpha q-induced phosphoinositide 4,5-bisphosphate depletion. J Biol Chem 278(41):40343-51
Hua F, Ha T, Ma J, Li Y, Kelley J, Gao X, Browder IW, Kao RL, Williams DL, Li C. 2007. Protection against myocardial ischemia/reperfusion injury in TLR4-deficient mice is mediated through a phosphoinositide 3-kinase-dependent mechanism. J Immunol 178(11):7317-24
Hullinger TG, Montgomery RL, Seto AG, Dickinson BA, Semus HM, Lynch JM, Dalby CM, Robinson K, Stack C, Latimer PA, et al. 2012. Inhibition of miR-15 protects against cardiac ischemic injury. Circ Res 110(1):71-81
Ieda M, Fu JD, Delgado-Olguin P, Vedantham V, Hayashi Y, Bruneau BG, Srivastava D. 2010. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142(3):375-86
172
Iekushi K, Seeger F, Assmus B, Zeiher AM, Dimmeler S. 2012. Regulation of cardiac microRNAs by bone marrow mononuclear cell therapy in myocardial infarction. Circulation 125(14):1765-7
Imaizumi T, Tanaka H, Tajima A, Yokono Y, Matsumiya T, Yoshida H, Tsuruga K, Aizawa-Yashiro T, Hayakari R, Inoue I, et al 2010. IFN-gamma and TNF-alpha synergistically induce microRNA-155 which regulates TAB2/IP-10 expression in human mesangial cells. Am J Nephrol 32(5):462-8
Inagawa K, Miyamoto K, Yamakawa H, Muraoka N, Sadahiro T, Umei T, Wada R, Katsumata Y, Kaneda R, Nakade K, et al. 2012. Induction of cardiomyocyte-like cells in infarct hearts by gene transfer of Gata4, Mef2c, and Tbx5. Circ Res 111(9):1147-56
Izarra A, Moscoso I, Levent E, Canon S, Cerrada I, Diez-Juan A, Blanca V, Nunez-Gil IJ, Valiente I, Ruiz-Sauri A, et al. 2014. miR-133a enhances the protective capacity of cardiac progenitors cells after myocardial infarction. Stem Cell Reports 3(6):1029-42
Jackson KA, Majka SM, Wang H, Pocius J, Hartley CJ, Majesky MW, Entman ML, Michael LH, Hirschi KK, Goodell MA. 2001. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J Clin Invest 107(11):1395-402
Jaworski DM, Namboodiri AM, Moffett JR. 2016. Acetate as a Metabolic and Epigenetic Modifier of Cancer Therapy. J Cell Biochem 117(3):574-88
Jayawardena TM, Egemnazarov B, Finch EA, Zhang L, Payne JA, Pandya K, Zhang Z, Rosenberg P, Mirotsou M, Dzau VJ. 2012. MicroRNA-mediated in vitro and in vivo direct reprogramming of cardiac fibroblasts to cardiomyocytes. Circ Res 110(11):1465-73
Jin MS and Lee JO. 200). Structures of the toll-like receptor family and its ligand complexes. Immunity 29(2):182-91
Jones W and Bianchi K. 2015. Aerobic glycolysis: beyond proliferation. Front Immunol 6:227
Jujo K, Ii M, Losordo DW. 2008. Endothelial progenitor cells in neovascularization of infarcted myocardium. J Mol Cell Cardiol 45(4):530-44
Justice RW, Zilian O, Woods DF, Noll M, Bryant PJ. 1995. The Drosophila tumor suppressor gene warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and proliferation. Genes Dev 9(5):534-46
Kalogeris T, Baines CP, Krenz M, Korthuis RJ. 2012. Cell biology of ischemia/reperfusion injury. Int Rev Cell Mol Biol 298:229-317
173
Kalogeris T, Baines CP, Krenz M, Korthuis RJ. 2016. Ischemia/Reperfusion. Compr Physiol 7(1):113-70
Kanakaraj P, Schafer PH, Cavender DE, Wu Y, Ngo K, Grealish PF, Wadsworth SA, Peterson PA, Siekierka JJ, Harris CA, et al. 1998. Interleukin (IL)-1 receptor- associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production. J Exp Med 187(12):2073-9
Kapadia S, Dibbs Z, Kurrelmeyer K, Kalra D, Seta Y, Wang F, Bozkurt B, Oral H, Sivasubramanian N, Mann DL. 1998. The role of cytokines in the failing human heart. Cardiol Clin 16(4):645-56, viii
Karner CM and Long F. 2017. Wnt signaling and cellular metabolism in osteoblasts. Cell Mol Life Sci 74(9):1649-57
Ke ZP, Xu P, Shi Y, Gao AM. 2016. MicroRNA-93 inhibits ischemia-reperfusion induced cardiomyocyte apoptosis by targeting PTEN. Oncotarget 7(20):28796-805
Keyes KT, Xu J, Long B, Zhang C, Hu Z, Ye Y. 2010. Pharmacological inhibition of PTEN limits myocardial infarct size and improves left ventricular function postinfarction. Am J Physiol Heart Circ Physiol 298(4):H1198-H1208
Kim DH, Park MH, Lee EK, Choi YJ, Chung KW, Moon KM, Kim MJ, An HJ, Park JW, Kim ND, et al. 2015. The roles of FoxOs in modulation of aging by calorie restriction. Biogerontology 16(1):1-14
Kim SW, Ramasamy K, Bouamar H, Lin AP, Jiang D, Aguiar RC. 2012. MicroRNAs miR-125a and miR-125b constitutively activate the NF-kappaB pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci U S A 109(20):7865-70
Kim VN. 2005. MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol Cell Biol 6(5):376-85
Kim W, Khan SK, Gvozdenovic-Jeremic J, Kim Y, Dahlman J, Kim H, Park O, Ishitani T, Jho EH, Gao B, et al. 2017. Hippo signaling interactions with Wnt/beta-catenin and Notch signaling repress liver tumorigenesis. J Clin Invest 127(1):137-52
Kimura W, Xiao F, Canseco DC, Muralidhar S, Thet S, Zhang HM, Abderrahman Y, Chen R, Garcia JA, Shelton JM, et al. 2015. Hypoxia fate mapping identifies cycling cardiomyocytes in the adult heart. Nature 523(7559):226-30
Kleinbongard P, Schulz R, Heusch G. 2011. TNFalpha in myocardial ischemia/reperfusion, remodeling and heart failure. Heart Fail Rev 16(1):49-69
Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkhoff D, Wang J, Homma S, Edwards NM, Itescu S. 2001. Neovascularization of ischemic myocardium by
174
human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med 7(4):430-6
Komuro A, Nagai M, Navin NE, Sudol M. 2003. WW domain-containing protein YAP associates with ErbB-4 and acts as a co-transcriptional activator for the carboxyl-terminal fragment of ErbB-4 that translocates to the nucleus. J Biol Chem 278(35):33334-41
Konoplyannikov M, Haider KH, Lai VK, Ahmed RP, Jiang S, Ashraf M. 2013. Activation of diverse signaling pathways by ex-vivo delivery of multiple cytokines for myocardial repair. Stem Cells Dev 22(2):204-15
Koudstaal S, Pujades-Rodriguez M, Denaxas S, Gho JMIH, Shah AD, Yu N, Patel RS, Gale CP, Hoes AW, Cleland JG, et al. 2016. Prognostic burden of heart failure recorded in primary care, acute hospital admissions, or both: a population-based linked electronic health record cohort study in 2.1 million people. Eur J Heart Fail
Kozloski GA, Jiang X, Bhatt S, Ruiz J, Vega F, Shaknovich R, Melnick A, Lossos IS. 2016. miR-181a negatively regulates NF-kappaB signaling and affects activated B-cell-like diffuse large B-cell lymphoma pathogenesis. Blood 127(23):2856-66
Krisher RL and Prather RS. 2012. A role for the Warburg effect in preimplantation embryo development: metabolic modification to support rapid cell proliferation. Mol Reprod Dev 79(5):311-20
Kukielka GL, Smith CW, Manning AM, Youker KA, Michael LH, Entman ML. 1995. Induction of interleukin-6 synthesis in the myocardium. Potential role in postreperfusion inflammatory injury. Circulation 92(7):1866-75
Kulkarni OP, Hartter I, Mulay SR, Hagemann J, Darisipudi MN, Kumar VS, Romoli S, Thomasova D, Ryu M, Kobold S, et al. 2014. Toll-like receptor 4-induced IL-22 accelerates kidney regeneration. J Am Soc Nephrol 25(5):978-89
Kurotsu S, Suzuki T, Ieda M. 2017. Direct Reprogramming, Epigenetics, and Cardiac Regeneration. J Card Fail
Laflamme MA and Murry CE. 2011. Heart regeneration. Nature 473(7347):326-35
Lai ZC, Wei X, Shimizu T, Ramos E, Rohrbaugh M, Nikolaidis N, Ho LL, Li Y. 2005. Control of cell proliferation and apoptosis by mob as tumor suppressor, mats. Cell 120(5):675-85
Lange LG and Schreiner GF. 1994. Immune mechanisms of cardiac disease. N Engl J Med 330(16):1129-35
Lavine KJ, Epelman S, Uchida K, Weber KJ, Nichols CG, Schilling JD, Ornitz DM, Randolph GJ, Mann DL. 2014. Distinct macrophage lineages contribute to
175
disparate patterns of cardiac recovery and remodeling in the neonatal and adult heart. Proc Natl Acad Sci U S A 111(45):16029-34
Le T and Chong J. 2016. Cardiac progenitor cells for heart repair. Cell Death Discov 2:16052
Lee J, Bartholomeusz C, Mansour O, Humphries J, Hortobagyi GN, Ordentlich P, Ueno NT. 2014. A class I histone deacetylase inhibitor, entinostat, enhances lapatinib efficacy in HER2-overexpressing breast cancer cells through FOXO3-mediated Bim1 expression. Breast Cancer Res Treat 146(2):259-72
Lee J, Sayed N, Hunter A, Au KF, Wong WH, Mocarski ES, Pera RR, Yakubov E, Cooke JP. 2012. Activation of innate immunity is required for efficient nuclear reprogramming. Cell 151(3):547-58
Lee RC, Feinbaum RL, Ambros V. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75(5):843- 54
Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, et al. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature 425(6956):415-9
Leor J, Palevski D, Amit U, Konfino T. 2016. Macrophages and regeneration: Lessons from the heart. Semin Cell Dev Biol 58:26-33
Leri A. 2009. Human cardiac stem cells: the heart of a truth. Circulation 120(25):2515-8
Lesnefsky EJ, Tandler B, Ye J, Slabe TJ, Turkaly J, Hoppel CL. 1997. Myocardial ischemia decreases oxidative phosphorylation through cytochrome oxidase in subsarcolemmal mitochondria. Am J Physiol 273(3 Pt 2):H1544-H1554
Levraut J, Iwase H, Shao ZH, Vanden Hoek TL, Schumacker PT. 2003. Cell death during ischemia: relationship to mitochondrial depolarization and ROS generation. Am J Physiol Heart Circ Physiol 284(2):H549-H558
Li M and Hirsch E. 2015. Akt activation by PHLPP1 ablation prevents pathological hypertrophy by promoting angiogenesis. Cardiovasc Res 105(2):129-30
Li X, Monks B, Ge Q, Birnbaum MJ. 2007. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1alpha transcription coactivator. Nature 447(7147):1012- 6
Lien EC, Lyssiotis CA, Cantley LC. 2016. Metabolic Reprogramming by the PI3K-Akt- mTOR Pathway in Cancer. Recent Results Cancer Res 207:39-72
Lin L and Knowlton AA. 2014. Innate immunity and cardiomyocytes in ischemic heart disease. Life Sci 100(1):1-8
176
Lin Q, Wang L, Lin Y, Liu X, Ren X, Wen S, Du X, Lu T, Su SY, Yang X, et al. 2012. Toll-like receptor 3 ligand polyinosinic:polycytidylic acid promotes wound healing in human and murine skin. J Invest Dermatol 132(8):2085-92
Lin Z, Zhou P, von GA, Gu F, Ma Q, Chen J, Guo H, van Gorp PR, Wang DZ, Pu WT. 2015. Pi3kcb Links Hippo-YAP and PI3K-AKT Signaling Pathways to Promote Cardiomyocyte Proliferation and Survival. Circ Res 116(1):35-45
Liu AM, Wong KF, Jiang X, Qiao Y, Luk JM. 2012. Regulators of mammalian Hippo pathway in cancer. Biochim Biophys Acta 1826(2):357-64
Liu N, Williams AH, Kim Y, McAnally J, Bezprozvannaya S, Sutherland LB, Richardson JA, Bassel-Duby R, Olson EN. 2007. An intragenic MEF2-dependent enhancer directs muscle-specific expression of microRNAs 1 and 133. Proc Natl Acad Sci U S A 104(52):20844-9
Liu Q, Du GQ, Zhu ZT, Zhang C, Sun XW, Liu JJ, Li X, Wang YS, Du WJ. 2015. Identification of apoptosis-related microRNAs and their target genes in myocardial infarction post-transplantation with skeletal myoblasts. J Transl Med 13:270
Liu X, Engelman RM, Rousou JA, Flack JE, III, Deaton DW, Das DK. 1994. Normothermic cardioplegia prevents intracellular calcium accumulation during cardioplegic arrest and reperfusion. Circulation 90(5 Pt 2):II316-II320
Liu X, Engelman RM, Wei Z, Bagchi D, Rousou JA, Nath D, Das DK. 1993. Attenuation of myocardial reperfusion injury by reducing intracellular calcium overloading with dihydropyridines. Biochem Pharmacol 45(6):1333-41
Loffredo FS, Steinhauser ML, Gannon J, Lee RT. 2011. Bone marrow-derived cell therapy stimulates endogenous cardiomyocyte progenitors and promotes cardiac repair. Cell Stem Cell 8(4):389-98
Lopaschuk GD, Spafford MA, Marsh DR. 1991. Glycolysis is predominant source of myocardial ATP production immediately after birth. Am J Physiol 261(6 Pt 2):H1698-H1705
Lu C, Ren D, Wang X, Ha T, Liu L, Lee EJ, Hu J, Kalbfleisch J, Gao X, Kao R, et al. 2014. Toll-like receptor 3 plays a role in myocardial infarction and ischemia/reperfusion injury. Biochim Biophys Acta 1842(1):22-31
Luo K. 2017. Signaling Cross Talk between TGF-beta/Smad and Other Signaling Pathways. Cold Spring Harb Perspect Biol 9(1)
Ma FX and Han ZC. 2005. Akt signaling and its role in postnatal neovascularization. Histol Histopathol 20(1):275-81
177
Mahmoud AI, Kocabas F, Muralidhar SA, Kimura W, Koura AS, Thet S, Porrello ER, Sadek HA. 2013. Meis1 regulates postnatal cardiomyocyte cell cycle arrest. Nature 497(7448):249-53
Maillet M, van Berlo JH, Molkentin JD. 2013. Molecular basis of physiological heart growth: fundamental concepts and new players. Nat Rev Mol Cell Biol 14(1):38- 48
Mandic L, Traxler D, Gugerell A, Zlabinger K, Lukovic D, Pavo N, Goliasch G, Spannbauer A, Winkler J, Gyongyosi M. 2016. Molecular Imaging of Angiogenesis in Cardiac Regeneration. Curr Cardiovasc Imaging Rep 9(10):27
Mangi AA, Noiseux N, Kong D, He H, Rezvani M, Ingwall JS, Dzau VJ. 2003. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat Med 9(9):1195-201
Manning BD and Cantley LC. 2007. AKT/PKB signaling: navigating downstream. Cell 129(7):1261-74
Manning BD and Toker A. 2017. AKT/PKB Signaling: Navigating the Network. Cell 169(3):381-405
Martini M, De Santis MC, Braccini L, Gulluni F, Hirsch E. 2014. PI3K/AKT signaling pathway and cancer: an updated review. Ann Med 46(6):372-83
Matsui T, Tao J, del MF, Lee KH, Li L, Picard M, Force TL, Franke TF, Hajjar RJ, Rosenzweig A. 2001. Akt activation preserves cardiac function and prevents injury after transient cardiac ischemia in vivo. Circulation 104(3):330-5
Mattes J, Collison A, Plank M, Phipps S, Foster PS. 2009. Antagonism of microRNA- 126 suppresses the effector function of TH2 cells and the development of allergic airways disease. Proc Natl Acad Sci U S A 106(44):18704-9
Mayer IA and Arteaga CL. 2016. The PI3K/AKT Pathway as a Target for Cancer Treatment. Annu Rev Med 67:11-28
Mayfield AE, Tilokee EL, Davis DR. 2014. Resident cardiac stem cells and their role in stem cell therapies for myocardial repair. Can J Cardiol 30(11):1288-98
Medzhitov R, Preston-Hurlburt P, Janeway CA, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388(6640):394-7
Meloni M, Caporali A, Graiani G, Lagrasta C, Katare R, Van LS, Spillmann F, Campesi I, Madeddu P, Quaini F, Emanueli C. 2010. Nerve growth factor promotes cardiac repair following myocardial infarction. Circ Res 106(7):1275-84
178
Meng Z, Moroishi T, Guan KL. 2016. Mechanisms of Hippo pathway regulation. Genes Dev 30(1):1-17
Millar AA and Waterhouse PM. 2005. Plant and animal microRNAs: similarities and differences. Funct Integr Genomics 5(3):129-35
Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, Thomson AM, Lim B, Rigoutsos I. 2006. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 126(6):1203-17
Miska EA. 2005. How microRNAs control cell division, differentiation and death. Curr Opin Genet Dev 15(5):563-8
Miyamoto S, Murphy AN, Brown JH. 2009. Akt mediated mitochondrial protection in the heart: metabolic and survival pathways to the rescue. J Bioenerg Biomembr 41(2):169-80
Mo JS, Meng Z, Kim YC, Park HW, Hansen CG, Kim S, Lim DS, Guan KL. 2015. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat Cell Biol 17(4):500-10
Mocanu MM and Yellon DM. 2007. PTEN, the Achilles' heel of myocardial ischaemia/reperfusion injury? Br J Pharmacol 150(7):833-8
Moe GW and Marin-Garcia J. 2016. Role of cell death in the progression of heart failure. Heart Fail Rev 21(2):157-67
Moynagh PN. 2005) TLR signalling and activation of IRFs: revisiting old friends from the NF-kappaB pathway. Trends Immunol 26(9):469-76
Mundy-Bosse BL, Scoville SD, Chen L, McConnell K, Mao HC, Ahmed EH, Zorko N, Harvey S, Cole J, Zhang X, et al. 2016. MicroRNA-29b mediates altered innate immune development in acute leukemia. J Clin Invest 126(12):4404-16
Muraoka N, Yamakawa H, Miyamoto K, Sadahiro T, Umei T, Isomi M, Nakashima H, Akiyama M, Wada R, Inagawa K, et al. 2014. MiR-133 promotes cardiac reprogramming by directly repressing Snai1 and silencing fibroblast signatures. EMBO J 33(14):1565-81
Murriel CL, Churchill E, Inagaki K, Szweda LI, Mochly-Rosen D. 2004. Protein kinase Cdelta activation induces apoptosis in response to cardiac ischemia and reperfusion damage: a mechanism involving BAD and the mitochondria. J Biol Chem 279(46):47985-91
Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO, Rubart M, Pasumarthi KB, Virag JI, Bartelmez SH, Poppa V, et al. 2004. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 428(6983):664-8
179
Nakada Y, Canseco DC, Thet S, Abdisalaam S, Asaithamby A, Santos CX, Shah AM, Zhang H, Faber JE, Kinter MT, et al. 2017. Hypoxia induces heart regeneration in adult mice. Nature 541(7636):222-7
Nam YJ, Song K, Luo X, Daniel E, Lambeth K, West K, Hill JA, DiMaio JM, Baker LA, Bassel-Duby R, et al. 2013. Reprogramming of human fibroblasts toward a cardiac fate. Proc Natl Acad Sci U S A 110(14):5588-93
Natarajan C, Yao SY, Sriram S. 2016. TLR3 Agonist Poly-IC Induces IL-33 and Promotes Myelin Repair. PLoS One 11(3):e0152163
Nelson AM, Reddy SK, Ratliff TS, Hossain MZ, Katseff AS, Zhu AS, Chang E, Resnik SR, Page C, Kim D, et al. 2015. dsRNA Released by Tissue Damage Activates TLR3 to Drive Skin Regeneration. Cell Stem Cell 17(2):139-51
Nokin MJ, Durieux F, Peixoto P, Chiavarina B, Peulen O, Blomme A, Turtoi A, Costanza B, Smargiasso N, Baiwir D, et al. 2016. Methylglyoxal, a glycolysis side-product, induces Hsp90 glycation and YAP-mediated tumor growth and metastasis. Elife 5
O'Meara CC, Wamstad JA, Gladstone RA, Fomovsky GM, Butty VL, Shrikumar A, Gannon JB, Boyer LA, Lee RT. 2015. Transcriptional reversion of cardiac myocyte fate during mammalian cardiac regeneration. Circ Res 116(5):804-15
O'Neill LA. 2014. Glycolytic reprogramming by TLRs in dendritic cells. Nat Immunol 15(4):314-5
O'Neill LA, Sheedy FJ, McCoy CE. 2011. MicroRNAs: the fine-tuners of Toll-like receptor signalling. Nat Rev Immunol 11(3):163-75
Oh H. 2017. Cell Therapy Trials in Congenital Heart Disease. Circ Res 120(8):1353-66
Oka T, Morita H, Komuro I. 2016. Novel molecular mechanisms and regeneration therapy for heart failure. J Mol Cell Cardiol 92:46-51
Ong SB, Hall AR, Dongworth RK, Kalkhoran S, Pyakurel A, Scorrano L, Hausenloy DJ. 2015. Akt protects the heart against ischaemia-reperfusion injury by modulating mitochondrial morphology. Thromb Haemost 113(3):513-21
Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal-Ginard B, Bodine DM, et al. 2001. Bone marrow cells regenerate infarcted myocardium. Nature 410(6829):701-5
Oudit GY, Sun H, Kerfant BG, Crackower MA, Penninger JM, Backx PH. 2004. The role of phosphoinositide-3 kinase and PTEN in cardiovascular physiology and disease. J Mol Cell Cardiol 37(2):449-71
180
Oyama J, Blais C, Jr., Liu X, Pu M, Kobzik L, Kelly RA, Bourcier T. 2004. Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4-deficient mice. Circulation 109(6):784-9
Pandolfi F, Altamura S, Frosali S, Conti P. 2016. Key Role of DAMP in Inflammation, Cancer, and Tissue Repair. Clin Ther 38(5):1017-28
Panopoulos AD, Yanes O, Ruiz S, Kida YS, Diep D, Tautenhahn R, Herrerias A, Batchelder EM, Plongthongkum N, Lutz M, et al. 2012. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell Res 22(1):168-77
Parapanov R, Lugrin J, Rosenblatt-Velin N, Feihl F, Waeber B, Milano G, Vergely C, Li N, Pacher P, Liaudet L. 2015. Toll-like receptor 5 deficiency exacerbates cardiac injury and inflammation induced by myocardial ischaemia-reperfusion in the mouse. Clin Sci (Lond) 129(2):187-98
Parcellier A, Tintignac LA, Zhuravleva E, Hemmings BA. 2008. PKB and the mitochondria: AKTing on apoptosis. Cell Signal 20(1):21-30
Passaniti A, Brusgard JL, Qiao Y, Sudol M, Finch-Edmondson M. 2017. Roles of RUNX in Hippo Pathway Signaling. Adv Exp Med Biol 962:435-48
Patel SH, Camargo FD, Yimlamai D. 2017. Hippo Signaling in the Liver Regulates Organ Size, Cell Fate, and Carcinogenesis. Gastroenterology 152(3):533-45
Piper HM, Garcia-Dorado D, Ovize M. 1998. A fresh look at reperfusion injury. Cardiovasc Res 38(2):291-300
Porrello ER, Johnson BA, Aurora AB, Simpson E, Nam YJ, Matkovich SJ, Dorn GW, van RE, Olson EN. 2011a. MiR-15 family regulates postnatal mitotic arrest of cardiomyocytes. Circ Res 109(6):670-9
Porrello ER, Mahmoud AI, Simpson E, Hill JA, Richardson JA, Olson EN, Sadek HA. 2011b. Transient regenerative potential of the neonatal mouse heart. Science 331(6020):1078-80
Porrello ER, Mahmoud AI, Simpson E, Johnson BA, Grinsfelder D, Canseco D, Mammen PP, Rothermel BA, Olson EN, Sadek HA. 2013. Regulation of neonatal and adult mammalian heart regeneration by the miR-15 family. Proc Natl Acad Sci U S A 110(1):187-92
Porrello ER and Olson EN. (2014. A neonatal blueprint for cardiac regeneration. Stem Cell Res 13(3 Pt B):556-70
Poss KD, Wilson LG, Keating MT. 2002. Heart regeneration in zebrafish. Science 298(5601):2188-90
181
Primo MN, Bak RO, Schibler B, Mikkelsen JG. 2012. Regulation of pro-inflammatory cytokines TNFalpha and IL24 by microRNA-203 in primary keratinocytes. Cytokine 60(3):741-8
Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR, Ruvkun G. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403(6772):901-6
Ren XP, Wu J, Wang X, Sartor MA, Qian J, Jones K, Nicolaou P, Pritchard TJ, Fan GC. 2009. MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20. Circulation 119(17):2357-66
Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ, Waterfield MD, Downward J. 1994. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature 370(6490):527-32
Roy S, Khanna S, Hussain SR, Biswas S, Azad A, Rink C, Gnyawali S, Shilo S, Nuovo GJ, Sen CK. 2009. MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue. Cardiovasc Res 82(1):21-9
Ruan H, Li J, Ren S, Gao J, Li G, Kim R, Wu H, Wang Y. 2009. Inducible and cardiac specific PTEN inactivation protects ischemia/reperfusion injury. J Mol Cell Cardiol 46(2):193-200
Saito Y and Jones PA. 2006. Epigenetic activation of tumor suppressor microRNAs in human cancer cells. Cell Cycle 5(19):2220-2
Samanta S, Balasubramanian S, Rajasingh S, Patel U, Dhanasekaran A, Dawn B, Rajasingh J. 2016. MicroRNA: A new therapeutic strategy for cardiovascular diseases. Trends Cardiovasc Med 26(5):407-19
Sanada S, Komuro I, Kitakaze M. 2011. Pathophysiology of myocardial reperfusion injury: preconditioning, postconditioning, and translational aspects of protective measures. Am J Physiol Heart Circ Physiol 301(5):H1723-H1741
Sayed D, Hong C, Chen IY, Lypowy J, Abdellatif M. 2007. MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ Res 100(3):416-24
Sayed N, Wong WT, Ospino F, Meng S, Lee J, Jha A, Dexheimer P, Aronow BJ, Cooke JP. 2015. Transdifferentiation of human fibroblasts to endothelial cells: role of innate immunity. Circulation 131(3):300-9
Schlueter J and Brand T. 2012. Epicardial progenitor cells in cardiac development and regeneration. J Cardiovasc Transl Res 5(5):641-53
182
Senyo SE, Lee RT, Kuhn B. 2014. Cardiac regeneration based on mechanisms of cardiomyocyte proliferation and differentiation. Stem Cell Res 13(3 Pt B):532-41
Senyo SE, Steinhauser ML, Pizzimenti CL, Yang VK, Cai L, Wang M, Wu TD, Guerquin-Kern JL, Lechene CP, Lee RT. 2013. Mammalian heart renewal by pre-existing cardiomyocytes. Nature 493(7432):433-6
Seta Y, Shan K, Bozkurt B, Oral H, Mann DL. 1996. Basic mechanisms in heart failure: the cytokine hypothesis. J Card Fail 2(3):243-9
Sha F, Wu S, Zhang H, Guo X. 2014. miR-183 potentially inhibits NF-kappaB1 expression by directly targeting its 3'-untranslated region. Acta Biochim Biophys Sin (Shanghai) 46(11):991-6
Shao D, Zhai P, Del Re DP, Sciarretta S, Yabuta N, Nojima H, Lim DS, Pan D, Sadoshima J. 2014. A functional interaction between Hippo-YAP signalling and FoxO1 mediates the oxidative stress response. Nat Commun 5:3315
Shyh-Chang N, Zhu H, Yvanka de ST, Shinoda G, Seligson MT, Tsanov KM, Nguyen L, Asara JM, Cantley LC, Daley GQ. 2013. Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell 155(4):778-92
Siragusa M, Katare R, Meloni M, Damilano F, Hirsch E, Emanueli C, Madeddu P. 2010. Involvement of phosphoinositide 3-kinase gamma in angiogenesis and healing of experimental myocardial infarction in mice. Circ Res 106(4):757-68
Song H, Mak KK, Topol L, Yun K, Hu J, Garrett L, Chen Y, Park O, Chang J, Simpson RM, et al. 2010. Mammalian Mst1 and Mst2 kinases play essential roles in organ size control and tumor suppression. Proc Natl Acad Sci U S A 107(4):1431-6
Song J, Su W, Chen X, Zhao Q, Zhang N, Li MG, Yang PC, Wang L. 2017. Micro RNA- 98 suppresses interleukin-10 in peripheral B cells in patient post-cardio transplantation. Oncotarget 8(17):28237-46
Sun X, Sit A, Feinberg MW. 2014. Role of miR-181 family in regulating vascular inflammation and immunity. Trends Cardiovasc Med 24(3):105-12
Suzuki N, Suzuki S, Duncan GS, Millar DG, Wada T, Mirtsos C, Takada H, Wakeham A, Itie A, Li S, et al. 2002. Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4. Nature 416(6882):750-6
Taganov KD, Boldin MP, Chang KJ, Baltimore D. 2006. NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 103(33):12481-6
Tamguney T and Stokoe D. 2007. New insights into PTEN. J Cell Sci 120(Pt 23):4071-9
183
Tang B, Xiao B, Liu Z, Li N, Zhu ED, Li BS, Xie QH, Zhuang Y, Zou QM, Mao XH. 2010. Identification of MyD88 as a novel target of miR-155, involved in negative regulation of Helicobacter pylori-induced inflammation. FEBS Lett 584(8):1481-6
Tang Y, Wang Y, Park KM, Hu Q, Teoh JP, Broskova Z, Ranganathan P, Jayakumar C, Li J, Su H, et al. 2015. MicroRNA-150 protects the mouse heart from ischaemic injury by regulating cell death. Cardiovasc Res 106(3):387-97
Taniyama Y, Ito M, Sato K, Kuester C, Veit K, Tremp G, Liao R, Colucci WS, Ivashchenko Y, Walsh K, Shiojima I. 2005. Akt3 overexpression in the heart results in progression from adaptive to maladaptive hypertrophy. J Mol Cell Cardiol 38(2):375-85
Thomas JA, Haudek SB, Koroglu T, Tsen MF, Bryant DD, White DJ, Kusewitt DF, Horton JW, Giroir BP. 2003. IRAK1 deletion disrupts cardiac Toll/IL-1 signaling and protects against contractile dysfunction. Am J Physiol Heart Circ Physiol 285(2):H597-H606
Tian Y, Liu Y, Wang T, Zhou N, Kong J, Chen L, Snitow M, Morley M, Li D, Petrenko N, et al. 2015. A microRNA-Hippo pathway that promotes cardiomyocyte proliferation and cardiac regeneration in mice. Sci Transl Med 7(279):279ra38
Timmers L, Pasterkamp G, de Hoog VC, Arslan F, Appelman Y, de Kleijn DP. 2012. The innate immune response in reperfused myocardium. Cardiovasc Res 94(2):276-83
Tonkin J, Temmerman L, Sampson RD, Gallego-Colon E, Barberi L, Bilbao D, Schneider MD, Musaro A, Rosenthal N. 2015. Monocyte/Macrophage-derived IGF-1 Orchestrates Murine Skeletal Muscle Regeneration and Modulates Autocrine Polarization. Mol Ther 23(7):1189-200
Tsan MF and Gao B. 2004. Endogenous ligands of Toll-like receptors. J Leukoc Biol 76(3):514-9
Uchiyama T, Engelman RM, Maulik N, Das DK. 2004. Role of Akt signaling in mitochondrial survival pathway triggered by hypoxic preconditioning. Circulation 109(24):3042-9
Vander Heiden MG, Cantley LC, Thompson CB. 2009. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324(5930):1029- 33
Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. 2010. The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol 11(5):329-41
Vannella KM and Wynn TA. 2017. Mechanisms of Organ Injury and Repair by Macrophages. Annu Rev Physiol 79:593-617
184
Venza I, Visalli M, Beninati C, Benfatto S, Teti D, Venza M. 2015. IL-10Ralpha expression is post-transcriptionally regulated by miR-15a, miR-185, and miR- 211 in melanoma. BMC Med Genomics 8:81
Vilahur G and Badimon L. 2014. Ischemia/reperfusion activates myocardial innate immune response: the key role of the toll-like receptor. Front Physiol 5:496
Virtue A, Wang H, Yang XF. 2012. MicroRNAs and toll-like receptor/interleukin-1 receptor signaling. J Hematol Oncol 5:66 von GA, Lin Z, Schlegelmilch K, Honor LB, Pan GM, Buck JN, Ma Q, Ishiwata T, Zhou B, Camargo FD, et al. 2012. YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy. Proc Natl Acad Sci U S A 109(7):2394-9
Walsh MC, Lee J, Choi Y. 2015. Tumor necrosis factor receptor- associated factor 6 (TRAF6) regulation of development, function, and homeostasis of the immune system. Immunol Rev 266(1):72-92
Wang DZ. 2010. MicroRNAs in cardiac development and remodeling. Pediatr Cardiol 31(3):357-62
Wang J, Bai X, Song Q, Fan F, Hu Z, Cheng G, Zhang Y. 2015. miR-223 Inhibits Lipid Deposition and Inflammation by Suppressing Toll-Like Receptor 4 Signaling in Macrophages. Int J Mol Sci 16(10):24965-82
Wang X, Ha T, Hu Y, Lu C, Liu L, Zhang X, Kao R, Kalbfleisch J, Williams D, Li C. 2016. MicroRNA-214 protects against hypoxia/reoxygenation induced cell damage and myocardial ischemia/reperfusion injury via suppression of PTEN and Bim1 expression. Oncotarget 7(52):86926-36
Wang X, Ha T, Liu L, Zou J, Zhang X, Kalbfleisch J, Gao X, Williams D, Li C. 2013. Increased expression of microRNA-146a decreases myocardial ischaemia/reperfusion injury. Cardiovasc Res 97(3):432-42
Wang X, Zhang X, Ren XP, Chen J, Liu H, Yang J, Medvedovic M, Hu Z, Fan GC. 2010. MicroRNA-494 targeting both proapoptotic and antiapoptotic proteins protects against ischemia/reperfusion-induced cardiac injury. Circulation 122(13):1308-18
Wang Y, Yu A, Yu FX. 2017. The Hippo pathway in tissue homeostasis and regeneration. Protein Cell 8(5):349-59
Weiss JN, Korge P, Honda HM, Ping P. 2003. Role of the mitochondrial permeability transition in myocardial disease. Circ Res 93(4):292-301
Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao Z. 1997. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7(6):837-47
185
Wienholds E and Plasterk RH. 2005. MicroRNA function in animal development. FEBS Lett 579(26):5911-22
Witman N, Murtuza B, Davis B, Arner A, Morrison JI. 2011. Recapitulation of developmental cardiogenesis governs the morphological and functional regeneration of adult newt hearts following injury. Dev Biol 354(1):67-76
Worby CA and Dixon JE. 2014. PTEN. Annu Rev Biochem 83:641-69
Wu S, Huang J, Dong J, Pan D. 2003. hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts. Cell 114(4):445-56
Wu T and Mohan C. 2009. The AKT axis as a therapeutic target in autoimmune diseases. Endocr Metab Immune Disord Drug Targets 9(2):145-50
Wystub K, Besser J, Bachmann A, Boettger T, Braun T. 2013. miR-1/133a clusters cooperatively specify the cardiomyogenic lineage by adjustment of myocardin levels during embryonic heart development. PLoS Genet 9(9):e1003793
Xin M, Kim Y, Sutherland LB, Murakami M, Qi X, McAnally J, Porrello ER, Mahmoud AI, Tan W, Shelton JM, et al. 2013. Hippo pathway effector Yap promotes cardiac regeneration. Proc Natl Acad Sci U S A 110(34):13839-44
Xin M, Kim Y, Sutherland LB, Qi X, McAnally J, Schwartz RJ, Richardson JA, Bassel- Duby R, Olson EN. 2011. Regulation of insulin-like growth factor signaling by Yap governs cardiomyocyte proliferation and embryonic heart size. Sci Signal 4(196):ra70
Xu F, Zhang J, Ma D. 2014a. Crosstalk of Hippo/YAP and Wnt/beta-catenin pathways. Yi Chuan 36(2):95-102
Xu G, Zhang Z, Xing Y, Wei J, Ge Z, Liu X, Zhang Y, Huang X. 2014b. MicroRNA-149 negatively regulates TLR-triggered inflammatory response in macrophages by targeting MyD88. J Cell Biochem 115(5):919-27
Yan S and Jiao K. 2016. Functions of miRNAs during Mammalian Heart Development. Int J Mol Sci 17(5)
Yang S, Zhang L, Liu M, Chong R, Ding SJ, Chen Y, Dong J. 2013. CDK1 phosphorylation of YAP promotes mitotic defects and cell motility and is essential for neoplastic transformation. Cancer Res 73(22):6722-33
Yang Y, Cheng HW, Qiu Y, Dupee D, Noonan M, Lin YD, Fisch S, Unno K, Sereti KI, Liao R. 2015. MicroRNA-34a Plays a Key Role in Cardiac Repair and Regeneration Following Myocardial Infarction. Circ Res 117(5):450-9
186
Yellon DM and Hausenloy DJ. 2007. Myocardial reperfusion injury. N Engl J Med 357(11):1121-35
Yi R, Qin Y, Macara IG, Cullen BR. 2003. Exportin-5 mediates the nuclear export of pre- microRNAs and short hairpin RNAs. Genes Dev 17(24):3011-6
Yimlamai D, Christodoulou C, Galli GG, Yanger K, Pepe-Mooney B, Gurung B, Shrestha K, Cahan P, Stanger BZ, Camargo FD. 2014. Hippo pathway activity influences liver cell fate. Cell 157(6):1324-38
Yu FX, Zhao B, Guan KL. 2015a. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 163(4):811-28
Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, Zhao J, Yuan H, Tumaneng K, Li H, et al. 2012. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150(4):780-91
Yu H, Littlewood T, Bennett M. 2015b. Akt isoforms in vascular disease. Vascul Pharmacol 71:57-64
Yu JS and Cui W. 2016. Proliferation, survival and metabolism: the role of PI3K/AKT/mTOR signalling in pluripotency and cell fate determination. Development 143(17):3050-60
Zhang J, Nuebel E, Daley GQ, Koehler CM, Teitell MA. 2012. Metabolic regulation in pluripotent stem cells during reprogramming and self-renewal. Cell Stem Cell 11(5):589-95
Zhao B, Tumaneng K, Guan KL. 2011. The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat Cell Biol 13(8):877-83
Zhao B, Ye X, Yu J, Li L, Li W, Li S, Yu J, Lin JD, Wang CY, Chinnaiyan AM, et al. 2008. TEAD mediates YAP-dependent gene induction and growth control. Genes Dev 22(14):1962-71
Zhao Y, Ransom JF, Li A, Vedantham V, von DM, Muth AN, Tsuchihashi T, McManus MT, Schwartz RJ, Srivastava D. 2007. Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2. Cell 129(2):303-17
Zhou H, Dickson ME, Kim MS, Bassel-Duby R, Olson EN. 2015. Akt1/protein kinase B enhances transcriptional reprogramming of fibroblasts to functional cardiomyocytes. Proc Natl Acad Sci U S A 112(38):11864-9
187
APPENDICES
ABBREVIATIONS
AMPK -AMP-activated protein kinase
ANOVA -Analysis of variance
AP-1 -Activator protein-1
ATP -Adenosine triphosphate
Bak-1 -Bcl-2 homologous antagonist killer
Bax -Bcl-2-associated X protein
BMSCs -Bone marrow stromal cells
CDK1 -Cyclin-dependent kinase 1
CPCs -Cardiac progenitor cells
CpG DNA -Unmethylated CpG dinucleotides
DAMPS -Damage associated molecular patterns
DGCR8 -Drosha, DiGeorge syndrome critical region 8
DNMT1 -DNA methyltransferase1
dsRNA -Double stranded RNA
ECAR -Extracellular acidification rate
EdU -5-ethynyl-2′-deoxyuridine
EF -Ejection fraction
EMSA -Electrophoretic mobility shift assay
ER -Endoplasmic reticulum
ERBB4 -Receptor tyrosine-protein kinase erbB-4
FBS -Fetal bovine serum
FS -Fraction shortening
188
FOXO3 -Forkhead box transcription factor
GAPDH -Glyceraldehyde 3-phosphate dehydrogenase
GFP -Green fluorescent protein
HMGB1 -High-mobility group protein B1
H/R -Hypoxia/Reoxygenation
HIF-1α -Hypoxia-inducible factor 1-alpha
I/R -Ischemia/reperfusion
IA -Ischemic area
IFN -Interferon
IHC -Immunohistochemistry
IKK -IκB kinase
IL-1β -Interleukin-1β
IRAK -Interleukin-1 receptor-associated kinase
IRF -Interferon regulatory factor
IRF3 -IFN regulatory factor 3
LAD -Left anterior descending
LATS1/2 -Large tumor suppressor 1 and 2
LDH -Lactate dehydrogenase
LPS -Lipopolysaccharide
LV -Left ventricle
LY -LY294002
MI -Myocardial infarction
MiRNAs -MicroRNAs
MOB1 -Mps one binder kinase activator-like 1A
189 mPTP -Mitochondrial permeability transition pore
MyD88 -Myeloid differentiation primary response gene (88)
MST1/2 -Mammalian STE20-like protein kinase 1 and 2
MTT -3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
NAC -N-acetylcysteine
NF-κB -Nuclear factor kappa-B
OA -Okadaic acid
PFK1 -Phosphofructokinase 1
PAMPS -Pathogen associated molecular patterns
PBS -Phosphate buffered saline
PDCD4 -Programmed cell death 4
PDK1 -Phosphoinositide-dependent kinase-1
PDTC -Pyrrolidine dithiocarbamate
PGC1a -Peroxisome proliferator-activated receptor gamma coactivator 1-alpha
PP1 -Protein phosphorylase 1
PI3K -Phosphoinositide 3-kinase
PIP2 -Phosphatidylinositol 4, 5-bisphosphate or PtdIns(4,5)P2
PIP3 -Phosphatidylinositol (3, 4, 5)-triphosphate
Poly I:C -Polyinosine-polycytidylic acid
PRRS -Pattern recognition receptors
PTEN -Phosphatase and tensin homolog
PUMA -p53 upregulated modulator of apoptosis p53 -Tumor protein p53 qPCR -Quantitative real-time
190
RA -Risk area
RIP1 -Receptor-interacting serine/threonine-protein kinase 1
RISC -RNA-induced silencing complex
RUNX1/2 -Runt-related transcription factor 1/2
ROS -Reactive oxygen species
SAV1 -Protein salvador homolog 1
SD -Standard error
SEM -Standard error of the mean
SR-A -Scavenger receptor type A
ssRNA -Single stranded RNA
TAB2 -TAK1-binding protein 2
TAZ -WW domain-containing transcription regulator protein 1
TBST -Tris buffered saline tween 20
TEADs -Transcriptional enhancer factor TEF-s
Tg -Transgenic mice
TNFα -Tumor necrosis factor alpha
TIR domain -Toll/interleukin-1receptor homology domain
TRAF6 -TNFR-associated factor 6
TRAM -TRIF-related adaptor molecule
TRIF -TIR-domain-containing adapter-inducing interferon-β
TLRs -Toll-like receptors
TNF-α -Tumor necrosis factor-α
TRAF6 -TNF receptor associated factor 6
TRIF -TIR-domain-containing adapter-inducing interferon-β
191
TTC -Triphenyl tetrazolium chloride
TUNEL -Terminal deoxynucleotidyl transferase dUTP nick end labeling
WT -Wild type
VEGF -Vascular endothelial growth factor
VP -Verteporfin
YAP1 -Yes-associated protein 1
2-DG -2-deoxyglucose mg -Milligram ml -Milliliter pg -Picogram
μg -Microgram
μl -Microliter
μM -Micromolar
192
VITA
XIAOHUI WANG
Education: East Tennessee State University, Johnson City, USA Biomedical Science, Ph.D., 2017
Nanjing Normal University, Nanjing, China Developmental Biology, M.S., 2010
Xinyang Normal University, Xinyang, China Biotechnology, B.S., 2007
Publications: Wang X, Ha T, Liu L, Lu C, Kao R, Kalbfleisch J, Williams D, Li C. Bone marrow stromal cell derived exosomes carrying microRNA- 486 protects against myocardial ischemia/reperfusion injury (manuscript in preparation 2017). Wang X, Ha T, Hu Y, Liu L, Kao R, Kalbfleisch J, Williams D, Li C. TLR3 Mediates repair and regeneration of neonatal heart through glycolysis dependent YAP1 regulated miR-152 expression. (Submitted for publication 2017).
Wang X, Ha T, Hu Y, Lu C, Liu L, Zhang X, Race Kao, Kalbfleisch J, Williams D, Li C. MicroRNA-214 protects against hypoxia/reoxygenation induced cell damage and myocardial ischemia/reperfusion injury via suppression of PTEN and Bim1 expression. Oncotarget. 2016 Dec 27;7(52):86926-86936
Ma H*, Wang X*, Ha T, Gao M, Liu L, Wang R, Yu K, Kalbfleisch JH, Kao RL, Williams DL, Li C.MicroRNA-125b prevents cardiac dysfunction in polymicrobial sepsis by targeting TRAF6 mediated NFκB activation and p53 mediated apoptotic signaling. J Infect Dis. 2016 Sep 28. (*Equal contribution)
Lu C, Wang X, Ha T, Hu Y, Liu L, Zhang X, Yu H, Miao J, Kao R, Kalbfleisch J, Williams D, Li C. Attenuation of cardiac dysfunction and remodeling of myocardial infarction by microRNA-130a are mediated by suppression of PTEN and activation of PI3K dependent signaling. J Mol Cell Cardiol. 2015 Dec;89(Pt A):87-97
193
Gao M*, Wang X*, Zhang X, Ha T, Ma H, Liu L, Kalbfleisch JH, Gao X, Kao RL, Williams DL, Li C. Attenuation of Cardiac Dysfunction in Polymicrobial Sepsis by MicroRNA-146a Is Mediated via Targeting of IRAK1 and TRAF6 Expression. J Immunol. 2015 Jul 15;195(2):672-82. (*Equal contribution)
Wang X, Ha T, Liu L, Ren D, Zou J, Zhang X, Kalbfleisch J, Gao X, Williams D, Li C. MicroRNA-125b protects against myocardial ischemia/reperfusion injury via targeting p53-mediated apoptotic signaling and TRAF6. Cardiovasc Res. 2014 Jun 1;102(3):385-95
Lu C, Ren D, Wang X, Ha T, Liu L, Lee EJ, Hu J, Kalbfleisch J, Gao X, Kao R, Williams D, Li C. Toll-like receptor 3 plays a role in myocardial infarction and ischemia/reperfusion injury. Biochim Biophys Acta. 2014 Jan;1842(1):22-31.
Wang X, Ha T, Liu L, Zou J, Zhang X, Kalbfleisch J, Gao X, Williams D, Li C. Increased expression of microRNA-146a decreases myocardial ischemia/reperfusion injury. Cardiovasc Res. 2013 Mar 1;97 (3):432-42.
Wang X, Wang Z, Yao Y, Li J, Zhang X, Li C, Cheng Y, Ding G, Liu L, Ding Z. Essential role of ERK activation in neurite outgrowth induced by α-lipoic acid. Biochim Biophys Acta (BBA) - Molecular Cell Research. 2011; 1813:827-838.
Wang X, Zhang X, Cheng Y, Li C, Zhang W, Liu L, Ding Z. Alpha- lipoic acid prevents bupivacaine-induced neuron injury in vitro through a PI3K/Akt-dependent mechanism. Neurotoxicology. 2010; 31(1): 101- 12.
Ma R*, Wang X*, Lu C, Li C, Cheng Y, Ding G, Liu L, Ding Z. Dexamethasone attenuated bupivacaine-induced neuron injury in vitro through a threonine-serine protein kinase B-dependent mechanism. Neuroscience. 2010;167:329-42. (* Equal contribution)
Honors and Awards: 39th Shock Society Annual Conference Competitive Travel Award (2015, Denver, Colorado)
38th Shock Society Annual Conference Competitive Travel Award (2016, Austin, Texas)
Outstanding Young Investigator Award- The China-USA Cardiovascular Symposium (2016, Orlando, FL)
194