Micrornas Regulate Β-Catenin of the Wnt Signaling Pathway in Early Sea Urchin Development

Developmental Biology 402 (2015) 127–141

Contents lists available at ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/locate/developmentalbiology microRNAs regulate β-catenin of the Wnt signaling pathway in early sea urchin development

Nadezda Stepicheva a, Priya A. Nigam a, Archana D. Siddam a, Chieh Fu Peng b,1, Jia L. Song a,n a Department of Biological Sciences, University of Delaware, 323 Wolf Hall, Newark, DE 19716, USA b Department of Biology, University of Miami, Coral Gables, FL 33124, USA article info abstract

Article history: Development of complex multicellular organisms requires careful regulation at both transcriptional and Received 5 March 2014 post-transcriptional levels. Post-transcriptional gene regulation is in part mediated by a class of non- Received in revised form coding RNAs of 21–25 nucleotides in length known as microRNAs (miRNAs). β-catenin, regulated by the 18 December 2014 canonical Wnt signaling pathway, has a highly evolutionarily conserved function in patterning early Accepted 9 January 2015 metazoan embryos, in forming the Anterior–Posterior axis, and in establishing the endomesoderm. Available online 19 January 2015 Using reporter constructs and site-directed mutagenesis, we identiﬁed at least three miRNA binding sites Keywords: within the 30 untranslated region (30UTR) of the sea urchin β-catenin. Further, blocking these three Endoderm miRNA binding sites within the β-catenin 30UTR to prevent regulation of endogenous β-catenin by Mesoderm miRNAs resulted in a minor increase in β-catenin protein accumulation that is sufﬁcient to induce Larval gut aberrant gut morphology and circumesophageal musculature. These phenotypes are likely the result of Circumesophageal muscles PMCs increased transcript levels of Wnt responsive endomesodermal regulatory genes. This study demon- Sea urchin strates the importance of miRNA regulation of β-catenin in early development. Target protectors & 2015 Elsevier Inc. All rights reserved. Post-transcriptional regulation

Introduction complex and inhibition of the degradation of β-catenin (Logan and Nusse, 2004). Increased cytoplasmic levels of β-catenin leads to its β-catenin, the key effector molecule of the canonical Wnt pathway, accumulation in the nucleus, where β-catenin interacts with TCF/LEF has a highly conserved function in regulating cell proliferation, transcription factors and activates the transcription of target genes differentiation and fate decisions (Komiya and Habas, 2008; Moon, that mediate body plan determination, tissue patterning, and endo- 2005). Aberrant Wnt signaling has been associated with many human derm speciﬁcation (Komiya and Habas, 2008; Moon, 2005; Peter and diseases, including cancer, skeletaldisorders,neuronaldiseases,and Davidson, 2010). cardiovascular diseases (Anastas and Moon, 2013; Clevers, 2006; In addition to its essential role as a transcription coactivator, β- Clevers and Nusse, 2012; Kim et al., 2013; MacDonald et al., 2009; catenin is also a central structural component of the Cadherin/ Moon et al., 2004). In the absence of a Wnt ligand, β-catenin is Catenin adhesion complex (Aberle et al., 1996; Nelson and Nusse, phosphorylated at several N-terminal serine and threonine residues by 2004). The Cadherin/Catenin-based adhesion system is the major β β casein kinase I and Glycogen Synthase Kinase 3 (GSK3 ). Phosphor- mechanism by which cells adhere to one another. The abundance ylation of β-catenin occurs in a multiprotein complex composed of β β of -catenin in the adhesion complex at the plasma membrane GSK3 , a scaffolding protein Axin, and the tumor suppressor gene affects its accumulation and function with the signaling complex product Adenomatous Polyposis Coli protein (APC). Phosphorylation in the nucleus. This is demonstrated with experiments in which by GSK3β leads to the ubiquitination and proteasome-mediated perturbation of cadherin complexes has an effect on Wnt/ degradation of β-catenin. Upon binding of the Wnt ligand to the β-catenin regulated processes. For example, overexpression of Frizzled and LRP5/6 receptors, activated Disheveled (Dvl) recruits Axin cadherins in Xenopus embryos inhibited dorsal axis formation to cell membrane leading to the disassembly of the destruction which is known to be dependent on canonical Wnt signaling (Heasman et al., 1994). E-cadherin knockout embryonic stem cells n Corresponding author. Fax: þ1 302 831 2281. showed accumulation of β-catenin/Lef1 in the nucleus and activa- E-mail address: [email protected] (J.L. Song). tion of a Wnt reporter, which could be reversed by expression of E- 1 Current address: Institute of Cellular and Organismic Biology, Academia Sinica, Taiwan, ROC. cadherin (Orsulic et al., 1999). http://dx.doi.org/10.1016/j.ydbio.2015.01.008 0012-1606/& 2015 Elsevier Inc. All rights reserved. 128 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

The initial regionalization of β-catenin in the early embryo endodermal differentiation, and less developed circumpharyngeal contributes to polarity establishment, patterning, and germ layer musculature. Further, at the molecular level, a greater than 2-fold specification (Logan et al., 1999; Petersen and Reddien, 2009). In increase of Wnt responsive gene transcript levels, including numerous deuterostome embryos, including amphibians, fish, endodermal regulatory genes Krl (Howard et al., 2001), FoxA (de- chicks, ascidians and sea urchins, β-catenin becomes localized in Leon and Davidson, 2010; Oliveri et al., 2006), Eve (Peter and the nuclei of blastomeres at one pole of the cleavage stage embryo Davidson, 2010, 2011), Wnt8 (Wikramanayake et al., 2004), Bra (Imai et al., 2000; Larabell et al., 1997; Logan et al., 1999; Roeser (Gross and McClay, 2001), and ectodermal regulatory gene Nodal et al., 1999; Rowning et al., 1997; Schneider et al., 1996). In general, (Duboc et al., 2010; Yaguchi et al., 2008) was observed in β-catenin the pole of the embryo in which β-catenin is detected in the miRNA TP-treated embryos. These results demonstrate the impor- nucleus gives rise to endodermal and mesodermal tissues. Similar tance of miRNA regulation on β-catenin in early development. to many deuterostomes, the sea urchin β-catenin is required for the specification of the endoderm and mesoderm. (Logan et al., 1999; Wikramanayake et al., 1998). Overexpression of proteins Materials and methods that interfere with nuclear localization and/or function of β- catenin such as cadherins, GSK3β, and dominant forms of TCF/ Animals LEF, lead to embryos with excess ectodermal tissues and a lack of mesenchyme cells and gut (Emily-Fenouil et al., 1998; Logan et al., Adult Strongylocentrotus purpuratus were obtained from Cali- 1999; Vonica et al., 2000; Wikramanayake et al., 1998). Conversely, fornia (Point Loma Marine Company) and cultured in an aquarium overexpression of β-catenin leads to embryos deprived of ecto- (Marineland, Moonpark, CA) with artificial sea water (Instant dermal tissue, consisting of mainly endodermal and mesodermal Ocean). Gametes were obtained by intracoelomic injection of derivatives (Wikramanayake et al., 1998). 0.5 M KCl and embryos were cultured at 15 1Cinfiltered natural While the Wnt signaling pathway has been examined in the sea sea water collected from the Indian River Inlet; University of urchin (Emily-Fenouil et al., 1998; Logan et al., 1999; Vonica et al., Delaware Lewes campus. 2000; Wikramanayake et al., 1998), the regulatory roles of micro- RNAs (miRNAs) in this developmental pathway have not been Microinjections examined. miRNAs are a relatively novel class of 22-bp non-coding RNA molecules that fine tune gene expression by pairing to the 30 Control morpholino antisense oligonucleotides (MASO) 50 untranslated region (30UTR) of protein coding mRNAs to repress CCTCTTACCTCAGTTACAATTTATA 30, dicer MASO 50 GGACTC- their translation and/or induce mRNA degradation (Bartel, 2004; GATGGTGGCTCATCCATTC 30 (Song et al., 2012), and miRNA target Rajewsky, 2006). They are pivotal regulators of nearly all biological protector MASOs (miRNA TPs) were ordered from GeneTools processes, including cell fate specification and differentiation (Philomath, OR). 1.5 mM of Dicer MASO stock injection solution (Bartel, 2004; Mukherji et al., 2011). was used. Three miRNA TPs were designed to protect one The vast majority of miRNAs are transcribed by RNA polymer- miRDeep2-30364-35240 binding site and two miR-2007 binding ase II and initially processed by the enzyme Drosha and its sites from respective miRNA binding to the β-catenin 30UTR. The cofactor DGCR8 into stem-loop structures which get transported morpholino that blocks miR-2007 at position þ922 bp is 50 out from the animal nucleus to the cytoplasm (Lee et al., 2003). CTATTTCAGATATAATCTTGACGAG 30; the morpholino that blocks This stem-loop precursor is further processed into mature miRNAs miR-2007 at position þ2647 bp is 50 TTATTTCAGACATGAAAAATG- by the riboendonuclease Dicer. The mature miRNA is loaded onto GAAG 30 and the morpholino that blocks miRDeep2-30364-35240 the RNA Induced Silencing Complex (RISC) and used as a guide to is 50 TTATTGCACCTTTTTAAGAGGCATC 30. These miRNA target direct the binding of miRNA 50 seed (nucleotides 2–8) and anchor protectors were diluted to various stock injection solutions nucleotides to the 30UTR of target mRNAs to mediate translational (3 nM to 3 mM). The estimated injected miRNA TPs were the silencing and promote targeted mRNA degradation (Baek et al., following: from the 30 mM stock of injection solution, approxi- 2008; Bartel, 2009; Ghildiyal and Zamore, 2009; Guo et al., 2010; mately 35 attomoles (35 10–18) was injected. From the 300 mM Hendrickson et al., 2009; Liu, 2008; Selbach et al., 2008). The stock of injection solution, approximately 350 attomoles regulatory role of miRNAs in early development was demonstrated (350 10–18) was injected. The injected negative control morpho- by deleting or knocking down Dicer, an essential enzyme in lino contained the same molar concentration as the corresponding miRNA processing, which causes either developmental defects or sum of injected miRNA TPs. 300 mM stock of each of the β-catenin embryonic lethality in many animal systems (Bernstein et al., miRNA TPs were used in all real time, quantitative PCR, dual 2003; Giraldez et al., 2005; Saurat et al., 2013; Song et al., 2012). luciferase, Western blotting and phenotyping experiments. Our laboratory has previously demonstrated that knockdowns Microinjections were performed as previously described with of key enzymes in the miRNA biogenesis pathway in the sea urchin modifications (Cheers and Ettensohn, 2004; Song et al., 2012; embryos lead to gastrulation failure and embryonic lethality (Song Stepicheva and Song, 2014). MASO oligonucleotides were resus- et al., 2012). Dicer knockdown embryos at the gastrula stage pended in sterile water and heated for 10 min at 60 1C prior to use. express significantly reduced endodermal and mesodermal anti- Injection solutions contained 20% sterile glycerol, 2 mg/ml gens, suggesting a failure to properly specify these cell types. This 10,000 MW Texas Red lysine charged dextran (Molecular Probes, current study tests the hypothesis that the highly conserved Carlsbad, CA, USA) and various concentrations of MASO. Approxi- canonical Wnt/β-catenin pathway which is required for endome- mately 1–2 pl were injected into each newly fertilized egg. Eggs sodermal specification is regulated by miRNAs and may in part from S. purpuratus were collected and dejellied in acidic sea water contribute to the previous Dicer knockdown phenotype. The (pH 5.15) for 10 min on ice, followed by two sea water washes. strength of our study is to test miRNA regulation of β-catenin in Dejellied eggs were rowed onto 60 15 mm Petri dishes that were the context of a developing embryo at the systems level. Our previously coated with protamine sulfate (1% w/v). Eggs were results indicate that β-catenin is post-transcriptionally regulated fertilized with sperm in the presence of 1 mM 3-amino-1,2,4 by at least two miRNAs at three binding sites. Removal of miRNA triazole (Sigma, St. Louis, MO). Injections were performed using regulation using miRNA target protector morpholinos (miRNA TPs) the Femto Jet injection system (Eppendorf; Hamberg, Germany) specific to the β-catenin 30UTR resulted in a minor increase of the (Stepicheva and Song, 2014). A vertical needle puller PL-10 β-catenin protein level that led to aberrant gut morphology, (Narishige, Tokyo, Japan) was used to pull the injection needles N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 129

(1 90 mm glass capillaries with filaments) (Narashige; Tokyo, according to the manufacturer's instructions. Blots were treated Japan). with Restore™ Western blot Stripping Buffer (Thermo Scientific, Rockford, IL) according to manufacturer's instructions and Preparation of anti-β-catenin polyclonal antibodies reprobed with the rabbit polyclonal actin antibody (Sigma-Aldrich, St. Louis, MO). Images were acquired with Fluorchem (TM) Q To investigate the level of the β-catenin protein, two affinity- imaging system (Proteinsimple, Santa Clara, CA). Quantification of purified anti-β-catenin polyclonal rabbit antibodies, β-catenin1 and bands was conducted using the Alpha view–FluorChem QSA,

β-catenin55, were made against two short sequences (NH2- version 3.2.2.0. CYKKRISVELGNSLFRGDS-COOH) and (NH2-CHSLHSNHGEYRQPPPT- COOH) of the S. purpuratus β-catenin protein. Antibodies were Cloning of the reporter constructs generated by Bethyl Labs (Montgomery, TX). To test the specificity of the antibodies, a preabsorption assay was performed by incubat- In order to test post-transcriptional regulation of β-catenin by ing the antibody with the peptide (provided by Bethyl labs) at a 10 miRNAs and miRNA TPs, its 30UTR was cloned downstream of GFP fold molar excess for one hour at room temperature prior to coding sequence (in pGEMT vector background) and Renilla lucifer- incubating with the samples for Western blot analysis (Fig. S2). ase from psiCHECK vector (Promega, Madison, WI). The mCherry 30 mg of 32-cell embryonic extracts were loaded on to the SDS-PAGE coding region was cloned into the pSP6T4 vector flanked with gel. The S. purpuratus β-catenin protein is predicted to be 825 amino Xenopus β-globin UTRs (Gustafson and Wessel, 2010). Primers were acids in length, and the molecular size is estimated to be approxi- designed using the Primer 3 program (Rozen and Skaletsky, 2000). mately 90 kDa. Primers used for β-catenin 30UTR cloning are: Forward, 50 AACGCTC- GAGATCCAGATGTACCAAGCCAA 30 and Reverse 50 GGCACTAGTAG- Real time, quantitative PCR (qPCR) GAACTACAAGAAAGTCTC 30. Restriction sites used for subcloning are underlined. PCR products were purified with Promega Wizard SVgel For Dicer morpholino, control morpholino, or β-catenin miRNA and PCR cleanup kit (Promega, Madison, WI) prior to ligation. The TP experiments (stock of injection solution at 300 mM for each ligated products were cloned into PCRII cloning kit dual promoter miRNA TP), 80–100 injected embryos were used. 200 uninjected (Invitrogen, Carlsbad, CA) and transformed into DH5-α cells (Invi- embryos were collected at various time points to determine trogen, Carlsbald, CA). β-catenin 30UTR positive clones (in pCRII) transcript levels of endonenous β-catenin throughout develop- were sequenced (Genewiz, Inc., South Plainfield, NJ) and subcloned ment. Total RNA was extracted using Qiagen microRNeasy kit downstream of eGFP coding region into a pGEMT vector backbone. according to manufacturer's instructions (Qiagen Inc., Valencia, Renilla luciferase was subcloned into the pGEMT vector to replace CA, USA). cDNA was synthesized using TaqMan Reverse Transcrip- the eGFP coding sequence. Firefly luciferase from psiCHECK vector tion Reagents kit (Invitrogen, Carlsbald, CA, USA). qPCR was was PCR amplified with primers Forward 50 GCATAGATCTAT performed using 2.5 embryo equivalent for each reaction with GGCCGATGCTAAGAACATT 30 and Reverse 50 ATAGCTCGAGATACCA the Applied Biosystem power SYBER Green PCR Master Mix CATTTGTAGAGGTTTTA 30 with restriction enzyme sites underlined, (Invitrogen) in the 7300 Real-Time PCR cycler system. Results and cloned into the pSP6T4 flanked by the Xenopus β-globin 30UTRs. were normalized to the mRNA expression of the housekeeping Positive clones were sequenced to confirm cloning of the β-catenin gene ubiquitin and shown as fold changes compared to control 30UTR downstream of the eGFP or Renilla luciferase reporters and embryos that were injected with the control morpholino using the the Firefly luciferase construct in pSP6T4 (Genewiz, Inc., South ΔΔCt method. The estimated numbers of β-catenin transcripts are Plainfield, NJ). calculated based on the level of ubiquitin in various developmental stages described previously (Materna and Davidson, 2012; Site-directed mutagenesis Materna and Oliveri, 2008). Three to five biological replicates were conducted. Primers used for qPCR analysis are listed in Table S1. The miR-2007 seed sequence was identified to have two binding sites within the β-catenin 30UTR. The miRDeep2-30364- Western blotting 35240 seed sequence was identified to have one binding site within the β-catenin 30UTR. All seed sequences were mutated at 200 embryos injected with control MASO and miRNA TPs were positions 3 and 5 within the miRNA seed sequence (Gregory et al., pelleted by spinning them down at 15,000 RPM for 30 s and 2008). miR-2007 seed sequence 50 CTGAAAT 30 was modified to 50 resuspended in 15 μlof4 sample buffer (1 mM Tris–HCl, 0.1 mM CTCACAT 30, and miRDeep2-30364-35240 was modified from 50 sucrose, 4% SDS and 10 mM EDTA) prior to heating at 100 1C for GTGCAAT 30 to 50 GTCCTAT 30. Modified bases are underlined. 10 min. Samples were stored at 80 1C until later use. 1 mM DTT Mutageneic primers were designed according to the primer was added to the protein sample and heated at 100 1C for 10 min design program at www.agilent.com/genomics/qcpd. All mutations before loading samples onto Tris–Glycine 4–20% gradient gel (Bio- were generated using the QuikChange Lightning kit according to Rad, Hercules, CA). The proteins were electrophoresed at 120 V for manufacturer’s instructions (Agilent Technologies, Santa Clara, CA). 1 h in Tris–glycine electrophoresis buffer (25 mM Tris, 250 mM Primer sequences used for site-directed mutagenesis for miR-2007 glycine at pH 8.3, 0.1% SDS). Proteins were transferred onto at position þ922 are 50 CAGGCCTCGTCAAGATTATATCTCACATAGA- nitrocellulose membranes (Pall Corporation, Pensacola, FL) using TATCTCATGATTGGCTAC 30 and 50 GTAGCCAATCATGAGATATCTATGT- 250 AMP for 2 h at 4 1C. Membranes were blocked with Blotto GAGATATAATCTTGACGAGGCCTG 30. The second set of primers for (0.05 mM Tris at pH 7.5, 0.18 M NaCl, 3% dry milk and 0.05% Tween miR-2007 at position þ2647 (Fig. 2A) are 50 AATCTAAGCTACTTC- 20) for 2 h at RT or overnight at 4 1C and then incubated with β- CATTTTTCATGTCTTAGATAAACTGAATACATTCTTTTAAGATTG 30 and 50 catenin55 antibody at 1:250 in Blotto overnight at 4 1C, followed GCAATCTTAAAAGAATGTATTCAGTTTATCTAAGACATGAAAAATGGAA- by three TBST (0.05 M Tris, 0.18 M NaCl, 0.05% Tween) washes. The GTAGCTTAGAT 30. The primers used for miRDeep2-30364-35240 are blot was incubated with secondary antibody goat anti-rabbit HRP 50 GCATATTGATGCCTCTTAAAAAGGTCCTATAAAGAGTACAATATGCAA- (Jackson Immuno Research, West Grove, PA) diluted to 1:3000 in CAATC 30 and 50 GATTGTTGCATATTGTACTCTTTATAGGACCTTTTTAA- Blotto for 45 min at RT. The blots were washed 3 times with TBST GAGGCATCAATATGC 30. Altered seed sequences are underlined. and signals were detected using SuperSignal West Femto Max- Positive clones were sequenced to validate the fidelity of the imum Sensitivity Substrate (Thermo Scientific, Rockford, IL) mutagenesis (Genewiz, South Plainfield, NJ). 130 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

In vitro transcription 4% sheep serum (Sigma Aldrich, St. Louis, MO) for 1 h at room temperature. Primary antibody incubation was performed with All reporter constructs were linearized prior to in vitro tran- Endo1 antibody (Wessel and McClay, 1985) at 1:200, 1D5 antibody scription. mCherry was linearized with Sal1 enzyme; β-catenin at 1:50 and myosin heavy chain antibody (Wessel et al., 1990)at eGFP, Renilla luciferase and Firefly luciferase reporter constructs 1:100 overnight at 4 1C. Embryos were washed three times 15 min were linearized with Spe1 enzyme (Promega, Madison, WI). with PBST followed by goat anti-mouse Alexa 488 or goat anti- Linearized reporter constructs were in vitro transcribed using rabbit Alexa 488 conjugated secondary antibody at 1:300 (Invitro- mMessage machine kit (Invitrogen, Carlsbad, CA). The T7 RNA gen, Carlsbad, CA). Immunolabeled embryos were imaged using a polymerase was used for generating the Renilla luciferase β- Zeiss LSM 780 scanning confocal microscope (Carl Zeiss Incorpora- catenin mRNAs, and the Sp6 RNA polymerase was used for tion, Thorwood, NY) and data were obtained and analyzed using generating the Firefly luciferase and mCherry mRNAs according the Zen software (Carl Zeiss Incorporation, Thorwood, NY). to the manufacturer’s instructions. mRNAs were purified by using Qiagen microRNeasy kit according to manufacturer’s instructions Detection of endogenous alkaline phosphatase (Qiagen Inc., Valencia, CA) and purified mRNAs were loaded onto the Millipore spin columns for further clean up (Millipore, Bill- The endogenous alkaline phosphatase was used to assay for erica, MA). For luciferase assays, the 2.5 ml of injection solution differentiated endoderm of the larvae (Annunziata et al., 2013; contained 100–500 ng of Renilla luciferase and 150 ng of Firefly Drawbridge, 2003; Hinman and Degnan, 1998; Kumano and luciferase mRNA. Nishida, 1998; Nishida and Kumano, 1997; Whittaker, 1990). Three-day-old larvae were fixed in MOPS–paraformaldehyde Quantitative microscopy analysis of GFP and mCherry signals based fixative (4% paraformaldehyde, 100 mM MOPS pH 7.0,

2 mM MgSO4, 1 mM EGTA, and 0.8 M NaCl) for 10 min at room To test if miRNA TPs bind to the three functional miRNA sites temperature. Embryos were washed with alkaline phosphatase 0 within the β-catenin 3 UTR, we tested the level of translated eGFP buffer three times (100 mM Tris pH 9.5, 100 mM NaCl, 50 mM β in the presence of all three -catenin miRNA TPs. Injected embryos MgCl2, 0.1% Tween-20), followed by staining until desired color were first treated with 2 sea water for 2 min to induce a development with the staining solution (0.1 M Tris pH 9.5, 50 mM temporary shedding of the cilia to immobilize the swimming MgCl2, 0.1 M NaCl, 1 mM Levamisole, 10% Dimethylformamide, embryos (Ettensohn et al., 2004). They were washed with 1 45 ml of 75 mg/mL NBT and 35 ml of 50 mg/mL BCIP per 10 ml of sea water twice and imaged with Zeiss Observer Z1 microscope solution). The staining step was stopped with washes with MOPS (Carl Zeiss Incorporation, Thorwood, NY) as living embryos at low buffer (0.1 M MOPS pH 7.0, 0.5 M NaCl, and 0.1% Tween-20). magnification (total magnification at 100 ) to maximally capture Images were acquired with Nikon D90 digital camera connected fluorescent pixels. The imaging settings were determined with all to a Zeiss Observer Z1 microscope. sets of embryos prior to image acquisition to ensure that the fl setting captures the GFP and the mCherry uorescence within the Whole mount in situ hybridization linear range. All embryos within an experiment were imaged fl under the exact same conditions. The GFP and mCherry uores- β-catenin, Krl, Blimp1b and FoxA were PCR-amplified from sea fi cence signals were quanti ed using Zeiss software (Axio vision SE urchin embryonic cDNA. PCR primers used to clone the RNA 64 Rel.4.8). The GFP signal in each embryo was normalized to the probes are listed in Table S1. Krl probe was made directly from mCherry signal to account for injection volume differences. the PCR product; Blimp1b, FoxA and β-catenin were cloned into fi Unpaired Student t-test was used to determine statistical signi - Blunt-TOPO, PGEMT and PCRII vectors, respectively. The plasmids cance (Fig. S1). containing β-catenin, Blimp1b, FoxA were linearized with Not1, EcoR1 and Pst1, respectively (Promega, Madison, WI). Antisense Dual luciferase quantitation probes were labeled with digoxigenin with the DIG RNA Labeling Kit (Roche Diagnostics Corporation, Indianapolis, IN, USA). 0.1 mg Dual luciferase quantitation was performed using the Pro- probe/mL was used to detect native transcript in embryos accord- ™ ™ ™ mega Dual-Luciferase Reporter (DLR ) Assay Systems with ing to previously published protocols (Minokawa et al., 2004). the Promega™ GloMax™ 20/20 Luminometry System (Promega, Madision, WI). 50 embryos at the mesenchyme blastula stage (24 hours post fertilization; hpf) were collected in 22 mlof1 Results Promega passive lysis buffer and vortexed for at least 5 min. Embryonic lysates were either stored at 80 1C or processed β-catenin transcripts are destabilized by miRNAs immediately. Prior to luciferase readings, 100 ml of the Luciferase Activating Reagent II (LAR-II) was added to the 96-well plate (BD To determine if β-catenin was potentially regulated by miRNAs, Falcon, Franklin Lakes, NJ). 20 ml of the embryonic lysates was then we examined its transcript levels in control morpholino (MASO) added to the corresponding wells and luciferase reading for the and Dicer MASO-injected embryos with real time, quantitative PCR Firefly was obtained. 100 ml of the Stop and Glow solution was (qPCR). Newly fertilized eggs were microinjected with Dicer MASO added into the 96-well plate to quench Firefly luciferase while the to perturb the miRNA biogenesis pathway, leading to global Renilla luciferase readings were obtained. miRNA depletion (Song et al., 2012). Embryos were collected at the 32-cell stage (5–6 hpf), early blastula (15 hpf), and mesench- Immunofluorescence yme blastula (24 hpf) stages. Transcript levels of β-catenin at all stages were increased in Dicer knockdown embryos (Fig. 1A). At For Endo1 and 1D5 immunolabeling, embryos were fixed in 4% the mesenchyme blastula stage, β-catenin transcript level was paraformaldehyde (16% stock; EMS, Hatfield, PA) in artificial sea significantly increased (Fig. 1A), suggesting that miRNAs regulate water for 10 min at room temperature. Four 10 min Phosphate β-catenin mRNA stability at 24 hpf. Buffered Saline-Tween (PBST) washes were performed. For myosin We tested the possibility that miRNAs may play a role in the immunolabeling, embryos were fixed in 100% methanol at 20 1C post-transcriptional regulation of β-catenin by analyzing the 30UTR for 30 min, followed by PBST washes. Embryos were blocked with of β-catenin for potential miRNA regulatory sites. The miRNA N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 131

we have now is to search for 100% miRNA seed matches within 5.0 30UTRs. We searched for 100% miRNA seed matches within the Control MASO 0 4.5 3 UTR of β-catenin and found that of the 16 bioinformatically Dicer MASO identiﬁed miRNA predicted sites, only spu-miRDeep2-30364- 4.0 p=0.053 35240 and spu-miR-2007 have greater than 1000 normalized deep 3.5 sequence reads during early developmental stages of the sea 3.0 urchin (Table S2)(Song et al., 2012). Next, we examined the mRNA expression proﬁle of endogenous 2.5 p=0.005 p=0.34 β-catenin and their potential miRNA regulators, spu-miRDeep2- 2.0 30364-35240 and spu-miR-2007, at various developmental stages. β 1.5 Results indicate that the levels of -catenin mRNA changes over Fold difference of time throughout development (Fig. 1B). The level of β-catenin -catenin mRNA levels

1.0 mRNA peaks at early blastula stage (15 hpf), followed by a 0.5 decrease at the mesenchyme blastula stage (24 hpf) and stabilization from the gastrula to larval stages. Coinciding with this 0.0 β early mesenchyme decrease and stabilization of -catenin mRNA from 24 hpf to larval 32-cell blastula blastula stages, spu-miRDeep2-30364-35240 and spu-miR-2007 have hpf: 6 15 24 increased sequence reads from 24 hpf to the larval stage (Fig. 1B) (Song et al., 2012). This inverse expression pattern of β-catenin and β 2000 10000 these two miRNAs is consistent with the possibility that -catenin mRNA may be regulated by these miRNAs (Baek et al., 2008; normalized miRNA sequence reads Bartel, 2009; Brodersen and Voinnet, 2009; Hendrickson et al., 2009; Liu, 2008; Selbach et al., 2008). 1600 8000

1200 6000 β-catenin is directly regulated by miRNAs

To test if β-catenin is directly regulated by miRNAs, we cloned 800 4000 the β-catenin 30UTR downstream of Renilla luciferase (Rluc) to analyze post-transcriptional regulation of β-catenin by spu- miRDeep2-30364-35240 and spu-miR-2007 (Fig. 2A). The 30UTR 400 2000 of β-catenin was ampliﬁed with PCR based on 30UTR sequences -catenin transcripts per embryo

identified from previous analyses (Samanta et al., 2006; Sodergren et al., 2006). miR-2007 has two binding sites (at positions 0 0 þ922 bp and þ2647 bp downstream of the stop codon at 0122436486072 þ1 bp) and miRDeep2-30364-35240 has one binding site (at Hours post fertilization (hpf) position þ2401 bp downstream of the stop codon) within the β- 0 average miR-2007 miRDeep2-30364-35240 catenin 3 UTR. We used site-directed mutagenesis to alter the third and fifth base pairs of the seed sequences to disrupt the miRNA to β Fig. 1. Real time, quantitative PCR (qPCR) of -catenin transcript levels. (A) The target recognition to test its direct regulation by miRNAs (Gregory transcript levels of β-catenin were measured in control MASO and Dicer MASO- et al., 2008). Firefly luciferase reporter construct was fused to the injected embryos (1.5 mM stock injection solution). Results were normalized to the β 0 mRNA expression of the housekeeping gene ubiquitin and shown as fold changes Xenopus -globin 3 UTR and used as a control for Rluc luciferase compared to control embryos that were injected with the control MASO using the normalization. ΔΔCt method. The transcript level of β-catenin was significantly more abundant in Newly fertilized eggs were co-injected with in vitro transcribed Dicer MASO than in the control MASO-injected embryos at the mesenchyme mRNAs of Renilla reporter constructs fused to the β-catenin 30UTR blastula stage. Standard error bars are graphed. At least three independent fl β biological replicates with 80–100 embryos per replicate were tested. Hpf¼hours and the Fire y reporter construct fused to the Xenopus -globin 0 post fertilization. *Student’s T-test, p¼0.005. (B) Time course expression profile of 3 UTR. We collected mesenchyme blastula stage embryos, when β- β-catenin mRNA. The transcript levels of β-catenin were measured in uninjected catenin mRNA is significantly increased in Dicer knockdown embryos collected at various developmental stages. Results were normalized to the embryos, to measure miRNA regulation on β-catenin using the mRNA expression of the housekeeping gene ubiquitin. The estimated numbers of β dual luciferase assay. Results indicate that miR-2007 regulates -catenin transcripts are calculated based on the level of ubiquitin in various β developmental stages described previously (Materna and Davidson, 2012; Materna both binding sites of -catenin, although only the miR-2007 and Oliveri, 2008). At least three independent biological replicates with 200 mutated at 922 bp reached statistical significance (Fig. 2B). miR- embryos per replicate were tested. 2.5 embryo equivalents were used. Individual 2007 regulation at these two sites are likely to be redundant, since β data points are shown and the average is graphed as a line. -catenin transcripts are the normalized luciferase reading of miR-2007 double mutant was most abundant between the 32-cell and early blastula stages. Its level decreases fi and stabilizes from the mesenchyme blastula stage to the larval stage. Normalized not signi cantly different than the normalized luciferase reading sequence reads of miR-2007 and miRDeep2-30364-35240 from our previous study of miR-2007 single mutants (Student T-test, p¼0.6). The Renilla are plotted (Song et al., 2012). β-catenin mRNAs and these miRNAs have inverse luciferase reporter construct with triple mutants abolishing bind- expression patterns. ing and regulation by both miR-2007 and miR-Deep2-30364- 35240 resulted in additional increase in luciferase protein levels, prediction tools that perform best according to high-throughput indicating additive regulation by miRNAs. The relatively small validation all scan 30UTRs for short motifs complementary to the change in the luciferase expression caused by the removal of miRNA seed sequences (Baek et al., 2008; Selbach et al., 2008). miRNA regulation is consistent with the previous studies (Nicolas, However, current miRNA prediction programs such as PicTar and 2011; Pelosi et al., 2013; Selbach et al., 2008; Wang et al., 2014). TargetScan rely heavily on conservation information, which is not Overall, these results indicate that β-catenin 30UTR contains at yet available for the S. purpuratus genome. Therefore, the best tool least three functional miRNA regulatory sites. 132 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

miR-2007 miRDeep2-35240 miR-2007 RLuc β-catenin-WT3’UTR 5’ β-Globin UTR RLuc CDS CTGAAAT GTGCAAT CTGAAAT AAAAAA (8) +1 +922 +2401 +2647

miR-2007 β RLuc -catein-miR-2007 5’β -Globin UTR RLuc CDS CTCACAT AAAAAA (8) mutation at 922 bp +922 miR-2007 RLuc β-catenin miR-2007 5’β -Globin UTR RLuc CDS CTCACAT AAAAAA (8) mutation at 2647bp +2647 miR-2007 miR-2007 β 5’ -Globin UTR RLuc CDS CTCACAT CTCACAT RLuc -catenin miR-2007 β AAAAAA (8) double mutant +922 +2647 miRDeep2-35240 β RLuc -catenin miR-Deep 5’β -Globin UTR RLuc CDS GTCCTAT AAAAAA (8) 2-30364-35240 mutation +2401 +2647 at 2401 bp miR-2007 miRDeep2-35240 miR-2007 β GTCCTAT CTCACAT RLuc -catenin triple 5’β -Globin UTR RLuc CDS CTCACAT AAAAAA (8) mutant +922 +2401 +2647

Firefly 5’β -Globin UTR Firefly CDS β-Globin 3’ UTR AAAAAA (8)

3.5 p=0.08 Blastula (24 hpf) N.S. 3.0 N.S. N.S. 2.5 p=0.02 N.S. 2.0 * 1.5

1.0

normalized to normalized wild type 0.5

0.0

at 922 bp at 2647 bp

seed mutations Triple mutations miR-2007 mutated miR-2007 mutated mutated at 2401 bp miR-2007 with double miR-Deep2-30364-35240

Fig. 2. Mutagenesis analysis of potential miRNA binding site within the β-catenin 30UTR. 30UTR of β-catenin was cloned downstream of the Renilla luciferase (RLuc) construct for testing miRNA regulation. (A) Schematic of various reporter constructs with wild type (WT) or mutated miRNA binding sites within the β-catenin 30UTR is depicted. The Firefly luciferase reporter construct is flanked with Xenopus β-globin UTRs and used as a microinjection control for normalization. Newly fertilized eggs were coinjected with mRNAs of either RLuc CDS fused with the wild type β-catenin 30UTR or fused with the β-catenin with miRNA seed mutations at miR-2007 and/or miRDeep2-30364-35240 sites and Firefly luciferase. (B) The embryos were collected at mesenchyme blastula stage (24 hpf). The RLuc readings were normalized to the Firefly luciferase readings. These RLuc/Firefly luciferase ratios of the mutated constructs were normalized to the control. miR-2007 at 922 bp and miRDeep2-30364-35240 contain functional miRNA binding sites (3 biological replicates with 50 embryos each). nStudent’s T-test is used to analyze the significance between the constructs with wild type β-catenin 30UTR and β-catenin 30UTR with mutated miRNA seeds. N.S.¼not significant.

β-catenin miRNA target protector morpholinos (miRNA TPS) miRNA TPs resulted in significant increase in translated eGFP modulate β-catenin mRNA and protein levels protein, indicating that miRNA TPs are able to compete with endogenous miRNAs for binding and block endogenous miRNA- Once we identified the three functional miRNA sites within the mediated translational repression (Fig. S1A). The amount of miRNA β-catenin 30UTR, we designed miRNA target protector morpholinos TP injected was designed to be a 1000 molar excess of the (miRNA TPs) against these three sites to compete with the amount of TPs calculated to block the injected amount of eGFP endogenous miRNAs for β-catenin regulation (Staton and reporter construct and did not seem to be toxic to the blastula Giraldez, 2011). These miRNA TP sequences are unique to the β- embryos at the morphological level (Fig. S1B). catenin 30UTR, as BLASTN searches in the sea urchin genome only We tested the effect of miRNA TPs on β-catenin mRNA level identified these sequences to be located within the β-catenin (Fig. 3A). Introducing β-catenin miRNA TPs caused an increase in 30UTR. To test if miRNA TPs bind to the three functional miRNA endogenous β-catenin mRNA levels at 15 and 24 hpf; however, this binding sites within the β-catenin 30UTR, we cloned β-catenin difference was not statistically significant (Fig. 3A). Further, to 30UTR downstream of eGFP and tested the level of translated eGFP examine if the removal of miRNA regulation on β-catenin would in the presence of miRNA TP morpholino treatments at the early lead to a change in its protein levels, we used S. purpuratus specific blastula stage (Fig. S1A). We determined that blocking functional β-catenin antibodies for detection. Preabsorption studies indicated spu-miRDeep2-30364-35240 and spu-miR-2007 miRNA sites with the specificity of the β-catenin antibodies (Fig. S2). We determined N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 133

6.0 Control MASO 5.5 TP Western miRNA TPs 2.0 5.0 1.8 replicate 1 4.5 p=0.3 1.6 replicate 2 4.0 replicate 3 1.4 3.5 average 1.2 3.0 p=0.49 2.5 1.0 2.0 0.8

Fold difference of 1.5 0.6 Fold difference of -catenin mRNA levels

1.0 0.4 β -catenin protein levels 0.5 0.2 0.0 0.0 early mesenchyme 32-cell early mesenchyme 32-cell blastula blastula blastula blastula hpf: 61524 hpf: 61524

Fig. 3. β-catenin miRNA TP induced increased β-catenin protein and mRNA levels. (A) qPCR was used to measure the transcript levels of β-catenin in the embryos injected with control and miRNA TP MASOs against the three functional miRNA binding sites. 100 embryos were collected at the 32-cell (6 hpf), early blastula (15 hpf) and mesenchyme blastula (24 hpf) stages. The mRNA level of β-catenin was increased at early blastula and mesenchyme blastula stages when miRNA regulation of β-catenin was abolished. However, these increases were not significant in β-catenin miRNA TP and control MASO-treated embryos (Student’s T-test). Hpf¼hours post fertilization. (B) Western blot of 200 embryos injected with control or miRNA TPs. The embryos were collected at the 32-cell (6 hpf), early blastula (15 hpf) and mesenchyme blastula (24 hpf) stages. Compared to control embryos, embryos injected with miRNA TPs accumulated on average 1.5 times more β-catenin protein at the 32-cell and mesenchyme blastula stages. β-catenin protein levels are normalized to actin (3 biological replicates). Individual data points were indicated by the different icons. The average is graphed as a black bar. that the microinjection of 300 mM of each miRNA TP (injection injection solutions from 3 nM to 3 mM (Fig. 5G and data not stock concentration) was able to elicit on average a 1.5 fold shown), and only 300 mM and 3 mM β-catenin miRNA TP-treated increase in β-catenin protein compared to the MASO control at embryos had statistically significantly smaller midgut widths 32-cell and mesenchyme blastula stages, indicating that blocking compared to the control (Fig. 5G). However, at the 3 mM stock miRNA mediated regulation in vivo is sufficient to cause a minor concentration, the control embryos had less than 60% healthy increase in β-catenin protein level (Fig. 3B). Because this β-catenin embryos, indicating non-specific toxic response to the morpho- antibody does not work in whole mount immunolabeling, we are lino, so these data were not included in our analysis. In addition, not able to address the spatial distribution of β-catenin or if this 18% of the β-catenin miRNA TP-treated embryos (in 2 replicates increase in β-catenin is of the cytoplasmic or nuclear β-catenin out of 4) have aberrant intestine (hindgut) morphology (Fig. 5E populations. and F). In β-catenin miRNA TP-treated embryos, the shape of their intestine (hindgut) is trapezoidally shaped instead of a cylindrical Removal of miRNA regulation of β-catenin does not affect spicule structure (Fig. 5A,B vs. Fig. 5E,F). formation in the sea urchin embryos Since we observed gut morphological difference in β-catenin miRNA TP-treated embryos, we tested if endodermal differentia- Since the specification of mesodermally-derived PMCs is down- tion was affected. Alkaline phosphatase is a digestive enzyme stream of the Wnt/β-catenin signaling pathway (Oliveri et al., expressed in the guts of most animals. In sea urchin pluteus larvae, 2003), we examined PMCs and skeleton formation in β-catenin alkaline phosphatase is expressed only in the gut epithelium and miRNA TPs-treated embryos. Results indicate that removal of serves as a marker for differentiated endoderm (Drawbridge, miRNA regulation of β-catenin resulted in reduced PMC (1D5) 2003; Kumano and Nishida, 1998; Nishida and Kumano, 1997; staining but did not affect PMC patterning or the spicule lengths Whittaker, 1990). Although the β-catenin miRNA TP treated (Fig. 4). Thus, the change in β-catenin protein levels induced by embryos expressed alkaline phosphatase in the gut, it seems to miRNA TPs is not sufficient to perturb PMC specification, pattern- be at a reduced level as compared to the control (Fig. 5H and I). ing, or skeleton formation. Further, a significant number of β-catenin miRNA TP-treated embryos have little or no alkaline phosphatase present in the Treatment of β-catenin miRNA TPs resulted in aberrant gut intestine (hindgut) as compared to the control (Fig. 5I). Thus, β- morphology catenin miRNA TP treated embryos may have defects in endodermal differentiation. Next, we examined the effect of this minor increase in β- catenin protein accumulation induced by the removal of miRNA β-catenin miRNA TP-treated embryos have normal sphincters but less regulation of β-catenin on gut development. We injected β-catenin well developed circumesophageal musculature miRNA TPs and examined the morphology of the gut. The larval digestive system has a tripartite structure, consisting of a muscular We further examined the circumesophageal muscles of meso- esophagus (foregut), a large stomach (midgut), and a short tubular dermal origin and the sphincters of endodermal origin with the intestine (hindgut) (Burke, 1981; Burke and Alvarez, 1988). A antibody against the sea urchin myosin heavy chain (MHC) gastrula embryo has a straight tubular gut that is lined with single (Wessel et al., 1990). In sea urchin embryos, a set of muscle cells epithelial cells (Burke, 1981). The β-catenin miRNA TP-treated partition the various compartments of the digestive system. The embryos had a significantly narrower gut at the gastrula stage cardiac sphincter, a constriction made from a simple striated than the control embryos (Fig. 5A,B vs. Fig. 5C,D). We tested a myoephithelium with myofibrils, separates the esophagus (fore- variable amount of β-catenin miRNA TPs, ranging from stocks of gut) and the stomach (midgut) (Burke, 1981; Wessel et al., 1990). 134 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

DIC PMCs Overlay p = 0.6624 35 N.S. 30 25 20 Control MASO 15

10 N=60 N=58 5 Length of D-V spicule (μm) 0 Control β-catenin β -catenin miRNA TP MASO miRNA TP

Scale bar is 50 μm

Fig. 4. Removal of miRNA regulation of β-catenin does not affect skeletogenesis. Gastrula stage embryos (48 hpf) were immunolabeled with the 1D5 antibody against primary mesenchyme cell (PMC)-specific membrane protein (McClay et al., 1983) and imaged with an LSM 780 scanning confocal microscope. Z-stacks were reconstructed into a single projected image. (A) Removal of miRNA regulation of β-catenin did not affect PMC patterning. (B) The length of Dorsal-Ventral connecting spicule (D-V spicule) measured from the triradiate skeletal primordium to the anterior end of the embryo was not significantly changed in the miRNA TP-injected gastrula embryos compared to control. Student’s T-test, p¼0.662. N is the total number of dorsal-ventral spicules measured. N.S.¼not significant.

Separating the stomach (or midgut) and the intestine (hindgut) is and Hox11/13b (Arenas-Mena et al., 2006; Howard et al., 2001; the pyloric sphincter. The digestive tract ends with an anal Peter and Davidson, 2010, 2011; Smith et al., 2008). Activation sphincter. All these sphincters are endodermally derived and of these genes in turn activates more endodermal regulators, contain myosin heavy chain (Annunziata et al., 2013; Burke, including Brachyury, FoxA, and GataE, thus promoting endoderm 1981; Wessel et al., 1990). These constrictions give the overall differentiation (Fig. 7A) (Peter and Davidson, 2011; Smith et al., gut structure an hourglass-like shape in the larva. The β-catenin 2008). miRNA TP-treated embryos have normal pyloric and anal sphinc- To dissect the molecular mechanism of the observed endome- ters (Fig. 6A,B vs. Fig. 6D,E). However, in general, embryos treated sodermal morphological defects, we examined if increase in β- with the β-catenin miRNA TPs had a less well developed circume- catenin protein induced by removal of its miRNA regulation has an sophageal musculature as compared to the control (Fig. 6C vs. impact on the spatial distribution of endodermal genes. First we Fig. 6F). Further, the diameter of the muscle fibers is significantly performed whole mount in situ hybridization of β-catenin itself to larger in control than in the β-catenin miRNA TP-treated embryos test if the expression domains of its mRNA would be affected upon (Fig. 6G). These results indicate that blocking miRNA regulation of removal of miRNA regulation (Fig. 7B). Results indicate that the β-catenin impacted mesodermally-derived circumesophageal ubiquitous spatial distribution of β-catenin mRNA was not altered musculature. upon β-catenin miRNA TP treatment. However, a noticeable increase in the mRNA levels of β-catenin in all blastomeres of Removal of miRNA regulation of β-catenin resulted in increased miRNA TP-treated embryos at 6 hpf and 10 hpf was observed. This transcripts of endodermal regulatory genes observed increased level of β-catenin mRNA may be translated to the protein that would become either cytoplasmic protein where it The sea urchin endoderm is derived from two layers of cells associates with the adherens junctions or acting as a nuclear that are specified early in development: Veg2 and Veg1 cells transcriptional activator (Logan et al., 1999). Because the β-catenin (Logan and McClay, 1997; Ransick and Davidson, 1998). The Veg2 antibody does not work in whole mount immunolabeling, we cells give rise to the non-skeletogenic mesodermal cells, the cannot address the potential domain expansion of β-catenin foregut and ventral/oral midgut, while the Veg1 cells give rise to protein in the cytoplasmic or the nuclear β-catenin population. the ectoderm, the dorsal/aboral midgut and hindgut (Logan and We also examined the spatial localization of known Wnt/β- McClay, 1997; Ransick and Davidson, 1998). Nuclearization of catenin downstream targets, including Krl, Blimp1b, and FoxA β-catenin was shown to play a critical role in differentiation of (Fig. 7). Krl is a transcriptional repressor containing a Zn-finger both Veg2 and Veg1 cells. Previous studies demonstrated that β- DNA-binding domain that was shown to be important for β- catenin protein localizes into the nucleus of specific cells according catenin-mediated endoderm specification (Howard et al., 2001; to the developmental stage (Fig. 7A): at the 32-cell stage (6 hpf) it Peter and Davidson, 2010, 2011). In S. purpuratus, knockdown of is mostly restricted to the micromeres, by 128-cell stage (10 hpf) it Krl resulted in the lack of endoderm (Howard et al., 2001). The extends to the Veg2 cells, and by early blastula stage (15 hpf) its expression of Krl mRNA (Fig. 7C and D) is similar to the expression expression begins to fade from the PMCs but remains in the Veg2 of nuclear β-catenin (Fig. 7A) (Logan et al., 1999). It is initially cells. By mesenchyme blastula stage (24 hpf) nuclear β-catenin restricted to the micromere descendants at the 32-cell stage, clears from the Veg2 region and shifts to the Veg1 region. followed by shifting to the Veg2 region upon hatching (Howard Interestingly, small micromeres always contain high amounts of et al., 2001; Peter and Davidson, 2011). However, unlike the nuclear β-catenin (Logan et al., 1999). Wnt/β-catenin signaling nuclear β-catenin, Krl clears from the small micromeres by early along with Otx induce Veg2 cells to become endoderm by blastula stage (Livi and Davidson, 2006). We did not observe activating endodermal regulatory genes such as Blimp1b, Krl, Eve, noticeable difference in spatial localization of Krl. N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 135

DIC Endo 1 p < 0.0001 N.S. 40 * 35 30 25 Control MASO 20 N=56 N=29 N=74 N=72 15 10

Width of the midgut (μm) 5

-catenin 0 miRNA TP Control MASO miRNA TP Control MASO miRNA TP 30 μM 300 μM -catenin miRNA TP

18% Scale bar is 50 μm

-catenin Control miRNA TP p<0.0001 * 100 90 no staining 80 weak staining 70 strong staining 60 N=37 N=24 50 40 30 20 Alkaline Phosphatase 10 0 -catenin Percent of embryos with hindgut staining Control Scale bar is 100 μm MASO miRNA TP

Fig. 5. Removal of miRNA regulation on β-catenin results in aberrant gut morphology. Gastrulae were immunolabeled with Endo1, an antigen expressed in the midgut and hindgut of the embryo (Wessel et al., 1990), and imaged with an LSM 780 scanning confocal microscope. (A-B) Gastrulae injected with control MASO had a straight tubular gut that is lined with a single layer of epithelial cells. (C–F) β-catenin miRNA TP treatment resulted in embryos with narrower gut structure. (E-F) 18% of the 97 embryos miRNA TP injected embryos had an aberrant hindgut structure (black arrow) (2 out of 4 biological replicates). (G) The width of the midgut was measured with embryos injected with either 30 mMor300mM stock of β-catenin miRNA TP (white arrows). Only the 300 mM miRNA TP treated embryos had a significantly narrower gut than the control. *Student’s T-test, po0.0001. N is the total number of embryos imaged and phenotyped. N.S.¼not significant. (H) The alkaline phosphatase staining was used to assess endodermal differentiation of the larvae. Control MASO-injected embryos have more intense alkaline phosphate staining than the β-catenin miRNA TP treated embryos. Many of the embryos exposed to the β-catenin miRNA TP lack alkaline phosphatase staining in the intestine (hindgut) (arrows). (I) The percentage of embryos with hindgut staining in the miRNA TP treatment group is significantly lower than in the control embryos. *Fisher’s Exact Test (no hindgut staining vs. hindgut staining, po0.0001). N is the total number of embryos examined.

Blimp1b is a member of the SET domain family of proteins did not detect noticeable difference in the expression domain of (which are directly involved in histone modifications) that was Blimp1b mRNA upon miRNA TP treatment (Fig. 7F). shown to promote specification of endodermal cells from the Veg1 FoxA is an evolutionarily conserved forkhead transcription tier (Livi and Davidson, 2006). Blimp1b MASO resulted in blastula factor ortholog that specifies endoderm in many bilaterians and embryos lacking Veg1 descendants and gastrula embryos with cnidarians (Boyle and Seaver, 2008; Burtscher and Lickert, 2009; short truncated archenteron or gut invagination defects (Livi and Friedman and Kaestner, 2006; Hiruta et al., 2005; Oliveri et al., Davidson, 2006). Similar to the nuclear β-catenin and Krl, the 2006). Knockdown of FoxA resulted in severe defects in arch- expression of Blimp1b mRNA begins in large micromere descen- enteron formation with truncated gut, missing foregut or entire dants at 10 hpf, then shifts to Veg2 tier of cells by 18 hpf (Fig.7E) gut, and a lack of stomadaeum (Oliveri et al., 2006). Even though (Livi and Davidson, 2006). By 24 hpf, Krl is expressed in the Veg2 FoxA is a direct downstream target of β-catenin, its expression endoderm (Peter and Davidson, 2010, 2011), as well as in the Veg1 pattern does not completely mimic the pattern of β-catenin tier (Livi and Davidson, 2006). However, unlike the nuclear nuclearization (Fig. 7A and G). At 18 hpf FoxA mRNA was reported β-catenin and Krl, Blimp1b mRNA was never observed to be to be restricted to Veg2 endomesoderm followed by its expression expressed in small micromeres (Livi and Davidson, 2006). We in Veg2-derived endodermal ring by 21 hpf. The oral side of the 136 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

DIC MHC MHC p=0.0001 * 50 es in st 40 Control 30

10 N=17 N=13 es st miRNA TP in 0

Scale bar is 50 μm

Fig. 6. β-catenin miRNA TP-treated embryos have normal sphincters but less well developed circumesophageal musculature. Three-day-old larvae were immunolabeled with the myosin heavy chain antibody (MHC) (Wessel et al., 1990) to detect circumpharyngeal muscle fibers and sphincters (red arrow—pyloric sphincter; white arrow—anal sphincter) that compartmentalize the larval gut. (A) DIC image of the control larva. (B) Control larva immunolabeled with MHC. (C) Zoomed in view of a normal larval circumpharyngeal muscles. (D) DIC of the β-catenin miRNA TP-treated embryo. (E) β-catenin miRNA TP-treated embryo immunolabeled with MHC. (F) Zoomed in view of the larval circumpharyngeal muscles from β-catenin miRNA TP-injected larvae. es¼esophagus/foregut; st¼stomach/midgut; in¼intestine/hindgut. (G) The diameter of the circumesophageal muscle fibers is significantly smaller in the β-catenin miRNA TP-treated embryos compared to the control embryos. N is the number of embryos examined. *Student T-test (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) endodermal ring was shown to express more FoxA compared to differentiation, gut development, and circumesophageal muscle the aboral side (Oliveri et al., 2006). FoxA is initially expressed in structure in vivo (Figs. 5 and 6). Veg2 tier of cells at 15 hpf and is restricted to Veg2U that gives rise Across species from fruit flytozebrafish to human, miRNAs exclusively to the endoderm (Oliveri et al., 2006). We did not have been found to regulate various components of the Wnt/β- observe changes in FoxA mRNA spatial distribution in β-catenin catenin pathway (Hashimi et al., 2009; Kennell et al., 2008; Saydam miRNA TP-treated embryos compared to the control (Fig. 7H). et al., 2009; Silver et al., 2007; Thatcher et al., 2008; Wang and Xu, Using qPCR, we assayed for transcript level changes in Wnt 2010; Xia et al., 2010). Recently 38 miRNAs were identified to targeted transcription factors and signaling molecules involved in regulate the canonical Wnt pathway in human HEK293 cells, cell fate specification (Fig. 8). Transcript levels in the miRNA TP- including miR-25 which inhibits human β-catenin by targeting its treated embryos were normalized to the control MASO-treated coding sequence (Anton et al., 2011). Interestingly, miRDeep2- embryos. Results indicated that transcript levels of endodermal 30364-35240 that we found to regulate sea urchin β-catenin has regulators, Krl, Eve, Wnt8, Bra and, FoxA and ectodermal regulator, the same seed sequence as miR-25, suggesting that miRDeep2- Nodal, were increased on average of at least 2-fold in embryos 30364-35240 may play a potential conserved role as the mammalian treated with β-catenin miRNA TPs as compared to embryos treated miR-25 in regulating β-catenin.Wealsofoundβ-catenin to be post- with the control MASO in mesenchyme blastulae, suggesting that transcriptionally regulated by miR-2007 in the early embryo. miR- post-transcriptional regulation by miRNAs on β-catenin may con- 2007 is conserved within Eleutherozoa that is shared by Stronylo- tribute to endodermal cell specification and differentiation centrotus (Echinoidea) and Henricia (Asteroidea) (Wheeler et al., (Fig. 8C). Consistent with the in situ data, Krl mRNA had the 2009). highest transcript increase upon β-catenin miRNA TP treatment Of note is that the mammalian β-catenin gene is regulated by (Figs. 7D and 8C). miR-200a (Saydam et al., 2009; Xia et al., 2010). Even though a single miR-200 exists in the sea urchin, we did not bioinformatically identify any miR-200 seed sequences within the sea urchin β- Discussion catenin 30UTR. Interestingly, the miR-200n does have one predicted binding site within the β-catenin 30UTR (Table S2). It is likely that Our results for the first time demonstrated that miRNAs using seed sequence as the only criterion for bioinformatic modulate β-catenin in the canonical Wnt signaling pathway in identification of miRNA binding sites is insufficient in predicting the early sea urchin embryo. We identified at least three miRNA all the functional miRNA regulatory sites. Additional miRNAs may regulatory sites in the sea urchin β-catenin 30UTR, as supported also regulate the β-catenin 30UTR, even though they are not highly by the luciferase reporter data (Fig. 2) and by our observation expressed in the embryo (Table S2)(Song et al., 2012). miRNAs that blocking miRNA regulation of β-catenin resulted in an with conserved seed sequences may share conserved gene targets, increase of the β-catenin mRNA and protein levels (Fig. 3). as in the case of sea urchin miRDeep2-30364-35240 and the Importantly, this miRNA TP-induced increase in β-catenin protein mammalian miR-25 in mediating post-transcriptional regulation is sufficient to cause transcriptional changes in downstream of the β-catenin gene. Wnt responsive endodermal and mesodermal regulatory genes Our results indicate that the removal of miRNA regulation of (Fig. 8), potentially impacting endodermal specification/ β-catenin by using miRNA TP MASO is able to induce an increase in N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 137

early mesenchyme 6 hpf 10 hpf 15 hpf 24 hpf 32-cell 128-cell blastula blastula 6 hpf 10 hpf 15 hpf 24hpf Control miRNA TP Control miRNA TP Control miRNA TP Control miRNA TP lateral lateral mRNA -catenin vegetal nuclear β -catenin vegetal

10 hpf 15 hpf 24 hpf Control miRNA TP Control miRNA TP Control miRNA TP lateral lateral mRNA Krl Krl mRNA vegetal vegetal

15 hpf 24 hpf Control miRNA TP Control miRNA TP lateral lateral Blimp1b mRNA Blimp1b mRNA vegetal

15 hpf 24 hpf Control miRNA TP Control miRNA TP lateral lateral FoxA mRNA FoxA mRNA vegetal

Fig. 7. Removal of miRNA regulation of β-catenin does not affect the spatial localization of Wnt responsive genes. (A) Schematic depicts the localization of nuclear β-catenin (Logan et al., 1999). (C) Schematic depicts the localization of Krl mRNA (Howard et al., 2001; Minokawa et al., 2004; Peter and Davidson, 2010). (E) Schematic depicts the localization of Blimp1b mRNA (Livi and Davidson, 2006; Peter and Davidson, 2010, 2011; Smith et al., 2007). (G) Schematic depicts the localization of FoxA mRNA (Oliveri et al., 2006; Peter and Davidson, 2010). SM¼small micromeres, LM¼large micromeres, V1¼Veg1 tier, V2¼Veg2 tier, V2U¼Veg2 upper region, V2L¼Veg2 lower region, PMCs¼primary mesenchyme cells. Whole mount in situ hybridization was performed to address the spatial localization of (B) β-catenin and Wnt responsive genes, including (D) Krl, (F) Blimp1b and (H) FoxA as a result of β-catenin miRNA TP treatment. Embryos were collected at various developmental stages. Spatial localizations of Krl, Blimp1b and FoxA transcripts were not affected by removal of miRNA regulation of β-catenin.

β-catenin protein level by the 32-cell stage (6 hpf) and in both knockdown, the change in β-catenin mRNA would be a result of mRNA and protein levels by mesenchyme blastula stage (Fig. 3). global depletion of all miRNAs and the effect of their target gene The change in β-catenin protein level upon miRNA TP treatment at expression changes. the mesenchyme blastula stage (24 hpf) coincides with increased β-catenin is highly regulated at the transcriptional, post-tran- levels of miRDeep2-30364-35240 and miR-2007 sequence reads scriptional, translational, and post-translational levels (Huang reported from our previous study (Song et al., 2012)(Fig. 1B). et al., 2010; Zhao et al., 2011). We propose that the type of Removing miRNA regulation of β-catenin at the early blastula stage regulatory mechanism that controls β-catenin is dependent on (15 hpf) did not result in changes in the transcript levels of the developmental stage of the embryo. The most well understood endomesodermal regulators (Fig. 8B), consistent with the data regulatory mechanism of β-catenin is mediated by Wnt ligand that these miRNAs have relatively low sequence reads prior to the binding that leads to the disassembly of the destruction complex blastula stage (Fig. 1B). miRNA regulation of β-catenin is also and inhibition of the degradation of β-catenin (Logan and Nusse, supported by the Dicer knockdown experiments where the mRNA 2004). The binding interactions of β-catenin is also regulated by level of β-catenin was signiﬁcantly increased at the mesenchyme the transforming growth factor β (TGFβ), epidermal growth factor blastula stage (24 hpf) but not by early blastula stage (15 hpf) receptor (EGFR), hepatocyte growth factor, erythroblastic leukemia (Fig. 1A). One caveat is that in the complex background of Dicer viral oncogene-2 and Janus Kinase 2 (JAK2)-mediated signaling 138 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

pathways (Blume-Jensen et al., 1998; Gonzalez and Medici, 2014; Incassati et al., 2010; Liu et al., 2010; Paul et al., 2013; Zeng et al., 2006). Early in development, β-catenin may be predominantly regulated by activated Disheveled that disrupts the targeted degradation of β-catenin in the vegetal blastomeres (Peng and Wikramanayake, 2013), while miRNAs may facilitate the clearing of β-catenin later at and after the blastula stage. β-catenin may be crucial for activating signals that pattern ectoderm (Wikramanayake et al., 1998). Previous studies demonstrate that an overexpression of β-catenin in the animal halves of the sea urchin embryos (through microinjection of 0.01–0.02 pg of β-catenin mRNA into the newly fertilized eggs followed by isola- tion of animal halves) could induce ectoderm patterning along the dorsal/ventral (oral–aboral) axis, as supported by morphological and molecular alterations (Wikramanayake et al., 1998). Ectoderm 15 hpf miRNA TP patterning is mediated by FoxQ2 and Nodal which are important 3.0 for the formation of the anterior neuroectoderm territory and the primary (anterior–posterior) and secondary (dorsal–ventral) axes 2.5 (Angerer et al., 2011; Yaguchi et al., 2008). Recently it was shown 2.0 that the nuclear β-catenin dependent signal indirectly restricts FoxQ2 expression to the animal plate, allowing Nodal signaling to 1.5 increase through autoregulation to initiate dorsal–ventral pattern-

1.0 ing (Angerer et al., 2011; Range et al., 2013; Yaguchi et al., 2008). To examine if ectodermal speciﬁcation regulators were affected by mRNA fold changes 0.5 β-catenin miRNA TP treatment, we tested the transcript levels of

normalized to control MASO FoxQ2 and Nodal. The transcript of FoxQ2 was not altered but the 0.0 Nodal transcript is increased in the presence of increased β-catenin Krl Bra

Eve by mesenchyme blastula stage (Fig. 8C). Thus, Nodal is likely to be GCM Wnt8 Delta FoxA Nodal β FoxQ2 regulated by the Wnt/ -catenin pathway, independent from Blimp1b FoxQ2. The exact molecular mechanism of how this regulation 24 hpf miRNA TP occurs still needs to be explored. 6.0 The Wnt/β-catenin signaling is important for the skeletogenesis of the sea urchin embryos (Fig. 8A). PMCs arise from the large 5.0 micromere lineage in response to the canonical Wnt signaling that 4.0 leads to the activation of the transcriptional repressor Pmar1 (paired class homeodomain repressor) in the large micromeres 3.0 (Oliveri et al., 2003). Activation of Pmar1 results in transcriptional

2.0 inhibition of an ubiquitous transcriptional repressor HesC (Revilla- I-Domingo et al., 2007), leading to the activation of skeletogenic mRNA fold changes 1.0 transcription factors which regulate various differentiation effec-

normalized to control MASO tor genes that are essential for PMC patterning and spicule 0.0 formation (Damle and Davidson, 2011; Koga et al., 2010; Krl Bra

Eve Kurokawa et al., 1999; Sharma and Ettensohn, 2010, 2011; Wahl GCM Wnt8 Delta FoxA Nodal

FoxQ2 et al., 2009). Our data indicate that removal of miRNA regulation of Blimp1b β-catenin did not affect skeletogenesis of the sea urchin embryos β Fig. 8. Removal of miRNA regulation of -catenin results in the transcript changes (Fig. 4). In contrast to the specification of endomesoderm, which is of Wnt responsive genes. (A) Simplified gene regulatory network activated by Wnt/ regulated by multiple genes that are directly activated by the Wnt/ β-catenin signaling pathway. Skeletogenesis (red) is indirectly regulated by β- β fi catenin through a single transcriptional repressor Pmar1 (Oliveri et al., 2003). -catenin pathway, PMCs are speci ed indirectly through a single Endoderm (orange) and mesoderm (purple) formation is regulated by multiple β-catenin-responsive gene Pmar1 (Fig.8A). Thus, a relatively small direct targets of β-catenin such as Krl (Howard et al., 2001; Minokawa et al., 2004; accumulation of β-catenin protein observed in the miRNA TP- Peter and Davidson, 2011), FoxA (Oliveri et al., 2006), Blimp1b (Livi and Davidson, treated embryos is not sufficient to alter PMC development. 2006; Smith et al., 2007), Eve (Peter and Davidson, 2010, 2011), Wnt8 We then examined whether endodermal structures were (Wikramanayake et al., 2004) and Bra (Gross and McClay, 2001). In addition, β- β catenin regulates ectoderm differentiation through indirect regulation of FoxQ2 affected by the removal of -catenin regulation by miRNAs. The (Angerer et al., 2011; Range et al., 2013; Yaguchi et al., 2008). (B) qPCR was used to Wnt/β-catenin signaling pathway plays a central role in endome- measure the transcript levels of genes involved in the specification of endoderm, soderm formation and it was shown that overexpression of β- mesoderm, and ectoderm in control and β-catenin miRNA TP-injected embryos at catenin (0.05–0.1 pg RNA) in the sea urchin embryos led to strong the early blastula stage (15 hpf). (C) qPCR was used to measure the transcript levels vegetalization of an embryo, including formation of excessive of genes involved in the specification of endoderm, mesoderm, and ectoderm in endoderm and mesoderm (Wikramanayake et al., 1998). However, control and β-catenin miRNA TP-injected embryos at the mesenchyme blastula β stage (24 hpf). Most of the endomesodermal regulatory genes have Z2-fold the effect of low level of -catenin overexpression on gut devel- increase in transcript levels in miRNA TP-treated embryos in comparison to the opment in whole embryos is not known. Our data indicate that β- control embryos at mesenchyme blastula stage but not at early blastula stage (3–5 catenin miRNA TP treatment led to a significantly narrower gut biological replicates). The box plot represents the third quartile (purple) and the (Fig. 5A,B vs. Fig. 5C,D), reduced alkaline phosphatase staining fi fi rst quartile (green). Median is the junction between the rst and the third (Fig. 5H and I), and at least 2-fold increase in the levels of quartile. The whiskers represent the maximum and the minimum of the data. The endodermal regulators Krl, Eve, Wnt8 and Bra mRNAs in the average of the data is shown by the black line. Red line indicates the 2-fold changes. β (For interpretation of the references to color in this figure legend, the reader is vegetal pole (Figs.7 and 8C). A relatively minor increase in - referred to the web version of this article.) catenin protein level resulted in 2-fold increase in the expression N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 139 of endodermal regulators (Figs. 3 and 8). This result can potentially Appendix A. Supporting information be explained by restricted spatial expression of β-catenin regulatory miRNAs in a fraction of cells in the embryo. Since we Supplementary data associated with this article can be found in measured the total levels of β-catenin protein, whereas only the online version at: http://dx.doi.org/10.1016/j.ydbio.2015.01.008. changes in the nuclear β-catenin would affect the expression of its downstream targets, the actual effect on β-catenin in endodermal cells may be larger than the average effect measured for References the entire embryo. Although we do not understand how increased levels of these essential endodermal transcription factors may – result in gut developmental defects, we speculate that a combina- Aberle, H., Schwartz, H., Kemler, R., 1996. Cadherin catenin complex: protein interactions and their implications for cadherin function. J. Cell. Biochem. 61, tion of downstream targets of these transcription factors that are 514–523. critical for proper endodermal specification/differentiation and Anastas, J.N., Moon, R.T., 2013. WNT signalling pathways as therapeutic targets in – gut development result in the β-catenin miRNA TP-induced cancer. Nat. Rev. Cancer 13, 11 26. Andrikou, C., Iovene, E., Rizzo, F., Oliveri, P., Arnone, M.I., 2013. Myogenesis in the phenotypes. sea urchin embryo: the molecular fingerprint of the myoblast precursors. We also tested the expression of mesodermal regulatory genes, Evodevo 4, 33. Delta and GCM,inβ-catenin miRNA TP-treated embryos (Fig. 8). Angerer, L.M., Yaguchi, S., Angerer, R.C., Burke, R.D., 2011. The evolution of nervous system patterning: insights from sea urchin development. Development 138, The Delta/Notch signaling pathway is known to be important for 3613–3623. mesodermal specification which targets GCM at the top of the Annunziata, R., Perillo, M., Andrikou, C., Cole, A.G., Martinez, P., Arnone, M.I., 2013. early mesoderm gene regulatory hierarchy (Croce and McClay, Pattern and process during sea urchin gut morphogenesis: the regulatory landscape. Genesis. 2010; Ransick and Davidson, 2006; Sherwood and McClay, 1999; Anton, R., Chatterjee, S.S., Simundza, J., Cowin, P., DasGupta, R., 2011. A systematic Sweet et al., 1999, 2002). Our data indicate that both Delta and screen for micro-RNAs regulating the canonical Wnt pathway. Plos One, 6. Gcm mRNAs are not altered by β-catenin miRNA TP treatment. Arenas-Mena, C., Cameron, R.A., Davidson, E.H., 2006. Hindgut specification and fi cell-adhesion functions of Sphox11/13b in the endoderm of the sea urchin However, we observed a noticeable and signi cant difference in embryo. Dev. Growth Differ. 48, 463–472. the structure of the circumesophageal musculature (Fig. 4). Baek, D., Villen, J., Shin, C., Camargo, F.D., Gygi, S.P., Bartel, D.P., 2008. The impact of Recently a set of genes were identified in the sea urchin myoblasts microRNAs on protein output. Nature 455, 64–71. that appear in the late gastrula stage, including MyoD2, FoxF, FoxC, Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. FoxL1, Myocardin, Twist, and Tbx6 (Andrikou et al., 2013). It is not Bartel, D.P., 2009. MicroRNAs: target recognition and regulatory functions. Cell 136, clear if any of these molecules are directly regulated by the 215–233. canonical Wnt signaling pathway. In vertebrates, the Wnt pathway Bernstein, E., Kim, S.Y., Carmell, M.A., Murchison, E.P., Alcorn, H., Li, M.Z., Mills, A.A., Elledge, S.J., Anderson, K.V., Hannon, G.J., 2003. Dicer is essential for mouse regulates myogenic regulatory factors such as MyoD and Myf5 development. Nat. Genet. 35, 215–217. (Borello et al., 2006; Tajbakhsh et al., 1998; von Maltzahn et al., Blume-Jensen, P., Janknecht, R., Hunter, T., 1998. The kit receptor promotes cell 2012). Thus, the canonical Wnt pathway may regulate the struc- survival via activation of PI 3-kinase and subsequent Akt-mediated phosphorylation of Bad on Ser136. Curr. Biol. 8, 779–782. ture of mesodermally-derived circumesophageal musculature Borello, U., Berarducci, B., Murphy, P., Bajard, L., Buffa, V., Piccolo, S., Buckingham, (Figs. 5 and 8C). M., Cossu, G., 2006. The Wnt/beta-catenin pathway regulates Gli-mediated Myf5 expression during somitogenesis. Development 133, 3723–3732. Boyle, M.J., Seaver, E.C., 2008. Developmental expression of foxA and gata genes during gut formation in the polychaete annelid, Capitella sp. I. Evol. Dev. 10, 89–105. Brodersen, P., Voinnet, O., 2009. Revisiting the principles of microRNA target Conclusions recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10, 141–148. Burke, R., 1981. Structure of the digestive tract of thepluteus larva of Dendraster In summary, our results identified specific miRNAs that reg- excentricus (Echinodermata: Echinoida). Zoomorphology 98, 209-225. Burke, R.D., Alvarez, C.M., 1988. Development of the esophageal muscles in ulate β-catenin and demonstrated that blocking endogenous embryos of the sea urchin Strongylocentrotus purpuratus. Cell Tissue Res. 252, miRNA regulation of β-catenin resulted in increased transcript 411–417. levels of Wnt responsive endodermal regulatory genes in the sea Burtscher, I., Lickert, H., 2009. Foxa2 regulates polarity and epithelialization in the β endoderm germ layer of the mouse embryo. Development 136, 1029–1038. urchin, revealing potential molecular mechanism to -catenin Cheers, M.S., Ettensohn, C.A., 2004. Rapid microinjection of fertilized eggs. Methods miRNA TP induced phenotypes. This study demonstrates that Cell Biol. 74, 287–310. miRNA regulation of β-catenin at the post-transcriptional level in Clevers, H., 2006. Wnt/beta-catenin signaling in development and disease. Cell 127, 469–480. the developing embryo has an important impact on the develop- Clevers, H., Nusse, R., 2012. Wnt/beta-catenin signaling and disease. Cell 149, ment of the larval gut and the structure of circumesophageal 1192–1205. musculature. Croce, J.C., McClay, D.R., 2010. Dynamics of Delta/Notch signaling on endomesoderm segregation in the sea urchin embryo. Development 137, 83–91. Damle, S., Davidson, E.H., 2011. Precise cis-regulatory control of spatial and temporal expression of the alx-1 gene in the skeletogenic lineage of S. purpuratus. Dev. Biol. 357, 505–517. de-Leon, S.B., Davidson, E.H., 2010. Information processing at the foxa node of the Acknowledgments sea urchin endomesoderm specification network. Proc. Natl. Acad. Sci. USA 107, 10103–10108. Drawbridge, J., 2003. The color purple: analyzing alkaline phosphatase expression We thank the two anonymous reviewers for their comments. in experimentally manipulated sea urchin embryos in an undergraduate We thank Athula Wikramanayake for helpful discussions, reading developmental biology course. Int. J. Dev. Biol. 47, 161–164. of the manuscript, and the β-catenin antibodies. We thank David Duboc, V., Lapraz, F., Saudemont, A., Bessodes, N., Mekpoh, F., Haillot, E., Quirin, M., Lepage, T., 2010. Nodal and BMP2/4 pattern the mesoderm and endoderm McClay for his 1D5 antibody against the PMCs. We thank Gary during development of the sea urchin embryo. Development 137, 223–235. Wessel for his Endo1 and MHC antibodies. We also thank Dr. John Emily-Fenouil, F., Ghiglione, C., Lhomond, G., Lepage, T., Gache, C., 1998. GSK3beta/ – McDonald for his consultation in statistics. We thank Santiago shaggy mediates patterning along the animal vegetal axis of the sea urchin β embryo. Development 125, 2489–2498. Suarez in cloning the -catenin in situ probe. This work is funded Ettensohn, C.A., Wessel, G.M., Wray, G.A., 2004. Methods in cell biology. In: by the University of Delaware Research Fund (Grant no. Ettensohn, C.A., Wessel, G.M., Wray, G.A. (Eds.), Development of Sea Urchins, 11A00773), the NIH NIGMS 5P20GM103653-02, and NIH NIGMS Ascidians, and other Invertebrate Deuterostomes: Experimental Approaches. Elsevier Academic Press, San Diego, pp. 1–13. 8P20GM103446-12. CFP was supported by an NSF grant (IOS Friedman, J.R., Kaestner, K.H., 2006. The Foxa family of transcription factors in 0754323) to Athula Wikramanayake. development and metabolism. Cell. Mol. Life Sci. 63, 2317–2328. 140 N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141

Ghildiyal, M., Zamore, P.D., 2009. Small silencing RNAs: an expanding universe. Nat. Materna, S.C., Davidson, E.H., 2012. A comprehensive analysis of Delta signaling in Rev. Genet. 10, 94–108. pre-gastrular sea urchin embryos. Dev. Biol. 364, 77–87. Giraldez, A.J., Cinalli, R.M., Glasner, M.E., Enright, A.J., Thomson, J.M., Baskerville, S., Materna, S.C., Oliveri, P., 2008. A protocol for unraveling gene regulatory networks. Hammond, S.M., Bartel, D.P., Schier, A.F., 2005. MicroRNAs regulate brain Nat. Protoc. 3, 1876–1887. morphogenesis in zebrafish. Science 308, 833–838. McClay, D.R., Cannon, G.W., Wessel, G.M., Fink, R.D., Marchase, R.B., 1983. Patterns Gonzalez, D.M., Medici, D., 2014. Signaling mechanisms of the epithelial- of antigenic expression in early sea urchin development. In: Jeffery, W.R., Raff, mesenchymal transition. Sci. Signal. 7, re8. R.A. (Eds.), Time, Space, and Pattern in Embryonic Development. A.R. Liss, New Gregory, P.A., Bert, A.G., Paterson, E.L., Barry, S.C., Tsykin, A., Farshid, G., Vadas, M.A., York, pp. 157–169. Khew-Goodall, Y., Goodall, G.J., 2008. The miR-200 family and miR-205 regulate Minokawa, T., Rast, J.P., Arenas-Mena, C., Franco, C.B., Davidson, E.H., 2004. epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol. Expression patterns of four different regulatory genes that function during 10, 593–601. sea urchin development. Gene Expr. Patterns 4, 449–456. Gross, J.M., McClay, D.R., 2001. The role of Brachyury (T) during gastrulation Moon, R.T., 2005. Wnt/beta-catenin pathway. Sci. STKE, 2005 (cm1). movements in the sea urchin Lytechinus variegatus. Dev. Biol. 239, 132–147. Moon, R.T., Kohn, A.D., De Ferrari, G.V., Kaykas, A., 2004. WNT and beta-catenin Guo, H., Ingolia, N.T., Weissman, J.S., Bartel, D.P., 2010. Mammalian microRNAs signalling: diseases and therapies. Nat. Rev. Genet. 5, 691–701. predominantly act to decrease target mRNA levels. Nature 466, 835–840. Mukherji, S., Ebert, M.S., Zheng, G.X., Tsang, J.S., Sharp, P.A., van Oudenaarden, A., Gustafson, E.A., Wessel, G.M., 2010. Exogenous RNA is selectively retained in the 2011. MicroRNAs can generate thresholds in target gene expression. Nat. Genet. small micromeres during sea urchin embryogenesis. Mol. Reprod. Dev. 77, 836. 43, 854–859. Hashimi, S.T., Fulcher, J.A., Chang, M.H., Gov, L., Wang, S., Lee, B., 2009. MicroRNA Nelson, W.J., Nusse, R., 2004. Convergence of Wnt, beta-catenin, and cadherin profiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1 pathways. Science 303, 1483–1487. in the coordinate regulation of dendritic cell differentiation. Blood 114, Nicolas, F.E., 2011. Experimental validation of microRNA targets using a luciferase 404–414. reporter system. Methods Mol. Biol. 732, 1392–15 . Hendrickson, D.G., Hogan, D.J., McCullough, H.L., Myers, J.W., Herschlag, D., Ferrell, Nishida, H., Kumano, G., 1997. Analysis of the temporal expression of endoderm- J.E., Brown, P.O., 2009. Concordant regulation of translation and mRNA specific alkaline phosphatase during development of the ascidian Halocynthia abundance for hundreds of targets of a human microRNA. PLoS Biol. 7, roretzi. Dev. Growth Differ. 39, 199–205. e1000238. Oliveri, P., Davidson, E.H., McClay, D.R., 2003. Activation of pmar1 controls Hinman, V.F., Degnan, B.M., 1998. Retinoic acid disrupts anterior ectodermal and specification of micromeres in the sea urchin embryo. Dev. Biol. 258, 32–43. endodermal development in ascidian larvae and postlarvae. Dev. Genes Evol. Oliveri, P., Walton, K.D., Davidson, E.H., McClay, D.R., 2006. Repression of meso- – 208, 336 345. dermal fate by foxa, a key endoderm regulator of the sea urchin embryo. Hiruta, J., Mazet, F., Yasui, K., Zhang, P., Ogasawara, M., 2005. Comparative Development 133, 4173–4181. expression analysis of transcription factor genes in the endostyle of inverte- Orsulic, S., Huber, O., Aberle, H., Arnold, S., Kemler, R., 1999. E-cadherin binding – brate chordates. Dev. Dyn. 233, 1031 1037. prevents beta-catenin nuclear localization and beta-catenin/LEF-1-mediated Howard, E.W., Newman, L.A., Oleksyn, D.W., Angerer, R.C., Angerer, L.M., 2001. transactivation. J. Cell Sci. 112 (Part 8), 1237–1245. SpKrl: a direct target of beta-catenin regulation required for endoderm Paul, I., Bhattacharya, S., Chatterjee, A., Ghosh, M.K., 2013. Current understanding – differentiation in sea urchin embryos. Development 128, 365 375. on EGFR and Wnt/beta-Catenin signaling in glioma and their possible crosstalk. Huang, K., Zhang, J.-X., Han, L., You, Y.-P., Jiang, T., Pu, P.-Y., Kang, C.-S., 2010. Genes Cancer 4, 427–446. MicroRNA roles in beta-catenin pathway. Mol. Cancer, 9. Pelosi, A., Careccia, S., Lulli, V., Romania, P., Marziali, G., Testa, U., Lavorgna, S., Lo- Imai, K., Takada, N., Satoh, N., Satou, Y., 2000. (beta)-catenin mediates the Coco, F., Petti, M.C., Calabretta, B., Levrero, M., Piaggio, G., Rizzo, M.G., 2013. specification of endoderm cells in ascidian embryos. Development 127, miRNA let-7c promotes granulocytic differentiation in acute myeloid leukemia. 3009–3020. Oncogene 32, 3648–3654. Incassati, A., Chandramouli, A., Eelkema, R., Cowin, P., 2010. Key signaling nodes in Peng, C.J., Wikramanayake, A.H., 2013. Differential regulation of disheveled in a mammary gland development and cancer: beta-catenin. Breast Cancer Res. 12, novel vegetal cortical domain in sea urchin eggs and embryos: implications for 213. the localized activation of canonical Wnt signaling. PLoS One 8, e80693. Kennell, J.A., Gerin, I., MacDougald, O.A., Cadigan, K.M., 2008. The microRNA miR-8 Peter, I.S., Davidson, E.H., 2010. The endoderm gene regulatory network in sea is a conserved negative regulator of Wnt signaling. Proc. Natl. Acad. Sci. USA urchin embryos up to mid-blastula stage. Dev. Biol. 340, 188–199. 105, 15417–15422. Peter, I.S., Davidson, E.H., 2011. A gene regulatory network controlling the Kim, W., Kim, M., Jho, E.H., 2013. Wnt/beta-catenin signalling: from plasma embryonic specification of endoderm. Nature 474, 635–639. membrane to nucleus. Biochem. J. 450, 9–21. Petersen, C.P., Reddien, P.W., 2009. Wnt signaling and the polarity of the primary Koga, H., Matsubara, M., Fujitani, H., Miyamoto, N., Komatsu, M., Kiyomoto, M., body axis. Cell 139, 1056–1068. Akasaka, K., Wada, H., 2010. Functional evolution of Ets in echinoderms with Rajewsky, N., 2006. microRNA target predictions in animals. Nat. Genet. 38 (Suppl.), focus on the evolution of echinoderm larval skeletons. Dev. Genes Evol. 220, S8–S13. 107–115. Range, R.C., Angerer, R.C., Angerer, L.M., 2013. Integration of canonical and Komiya, Y., Habas, R., 2008. Wnt signal transduction pathways. Organogenesis 4, noncanonical Wnt signaling pathways patterns the neuroectoderm along the 68–75. anterior–posterior axis of sea urchin embryos. PLoS Biol. 11, e1001467. Kumano, G., Nishida, H., 1998. Maternal and zygotic expression of the endoderm- Ransick, A., Davidson, E.H., 1998. Late specification of Veg1 lineages to endodermal speci fic alkaline phosphatase gene in embryos of the ascidian, Halocynthia fate in the sea urchin embryo. Dev. Biol. 195, 38–48. roretzi. Dev. Biol. 198, 245–252. Ransick, A., Davidson, E.H., 2006. cis-regulatory processing of Notch signaling input Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya, S., Shimada, H., fi Akasaka, K., 1999. HpEts, an ets-related transcription factor implicated in to the sea urchin glial cells missing gene during mesoderm speci cation. Dev. – primary mesenchyme cell differentiation in the sea urchin embryo. Mech. Biol. 297, 587 602. Revilla-I-Domingo, R., Oliver, P., Davidson, E.H., 2007. A missing link in the sea Dev. 80, 41–52. Larabell, C.A., Torres, M., Rowning, B.A., Yost, C., Miller, J.R., Wu, M., Kimelman, D., urchin embryo gene regulatory network: hesC and the double-negative fi – Moon, R.T., 1997. Establishment of the dorso-ventral axis in Xenopus embryos speci cation of micromeres. Proc. Natl. Acad. Sci. USA 104, 12383 12388. is presaged by early asymmetries in beta-catenin that are modulated by the Roeser, T., Stein, S., Kessel, M., 1999. Nuclear beta-catenin and the development of Wnt signaling pathway. J. Cell Biol. 136, 1123–1136. bilateral symmetry in normal and LiCl-exposed chick embryos. Development – Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, 126, 2955 2965. S., Kim, V.N., 2003. The nuclear RNase III Drosha initiates microRNA processing. Rowning, B.A., Wells, J., Wu, M., Gerhart, J.C., Moon, R.T., Larabell, C.A., 1997. Nature 425, 415–419. Microtubule-mediated transport of organelles and localization of beta-catenin Liu, J., 2008. Control of protein synthesis and mRNA degradation by microRNAs. to the future dorsal side of Xenopus eggs. Proc. Natl. Acad. Sci. USA 94, – Curr. Opin. Cell Biol. 20, 214–221. 1224 1229. Liu, Y.C., Lai, W.C., Chuang, K.A., Shen, Y.J., Hu, W.S., Ho, C.H., Chen, Y.B., Hsu, M.F., Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for Hsu, H.C., Lieu, C.H., 2010. Blockade of JAK2 activity suppressed accumulation of biologist programmers. Methods Mol. Biol. 132, 365–386. beta-catenin in leukemic cells. J. Cell. Biochem. 111, 402–411. Samanta, M.P., Tongprasit, W., Istrail, S., Cameron, R.A., Tu, Q., Davidson, E.H., Stolc, Livi, C.B., Davidson, E.H., 2006. Expression and function of blimp1/krox, an V., 2006. Report – The transcriptome of the sea urchin embryo. Science 314, alternatively transcribed regulatory gene of the sea urchin endomesoderm 960–962. network. Dev. Biol. 293, 513–525. Saurat, N., Andersson, T., Vasistha, N.A., Molnar, Z., Livesey, F.J., 2013. Dicer is Logan, C.Y., McClay, D.R., 1997. The allocation of early blastomeres to the ectoderm required for neural stem cell multipotency and lineage progression during and endoderm is variable in the sea urchin embryo. Development 124, cerebral cortex development. Neural Dev. 8, 14. 2213–2223. Saydam, O., Shen, Y., Wurdinger, T., Senol, O., Boke, E., James, M.F., Tannous, B.A., Logan, C.Y., Miller, J.R., Ferkowicz, M.J., McClay, D.R., 1999. Nuclear beta-catenin is Stemmer-Rachamimov, A.O., Yi, M., Stephens, R.M., Fraefel, C., Gusella, J.F., required to specify vegetal cell fates in the sea urchin embryo. Development Krichevsky, A.M., Breakefield, X.O., 2009. Downregulated microRNA-200a in 126, 345–357. meningiomas promotes tumor growth by reducing E-cadherin and activating Logan, C.Y., Nusse, R., 2004. The Wnt signaling pathway in development and the Wnt/beta-catenin signaling pathway. Mol. Cell Biol. 29, 5923–5940. disease. Annu. Rev. Cell Dev. Biol. 20, 781–810. Schneider, S., Steinbeisser, H., Warga, R.M., Hausen, P., 1996. Beta-catenin translo- MacDonald, B.T., Tamai, K., He, X., 2009. Wnt/beta-catenin signaling: components, cation into nuclei demarcates the dorsalizing centers in frog and fish embryos. mechanisms, and diseases. Dev. Cell 17, 9–26. Mech. Dev. 57, 191–198. N. Stepicheva et al. / Developmental Biology 402 (2015) 127–141 141

Selbach, M., Schwanhaeusser, B., Thierfelder, N., Fang, Z., Khanin, R., Rajewsky, N., Stepicheva, N.A., Song, J.L., 2014. High throughput microinjections of sea urchin 2008. Widespread changes in protein synthesis induced by microRNAs. Nature zygotes. J. Vis. Exp. 455, 58–63. Sweet, H.C., Gehring, M., Ettensohn, C.A., 2002. LvDelta is a mesoderm-inducing Sharma, T., Ettensohn, C.A., 2010. Activation of the skeletogenic gene regulatory signal in the sea urchin embryo and can endow blastomeres with organizer-like network in the early sea urchin embryo. Development 137, 1149–1157. properties. Development 129, 1945–1955. Sharma, T., Ettensohn, C.A., 2011. Regulative deployment of the skeletogenic gene Sweet, H.C., Hodor, P.G., Ettensohn, C.A., 1999. The role of micromere signaling in regulatory network during sea urchin development. Development 138, Notch activation and mesoderm specification during sea urchin embryogenesis. – 2581 2590. Development 126, 5255–5265. Sherwood, D.R., McClay, D.R., 1999. LvNotch signaling mediates secondary Tajbakhsh, S., Borello, U., Vivarelli, E., Kelly, R., Papkoff, J., Duprez, D., Buckingham, fi mesenchyme speci cation in the sea urchin embryo. Development 126, M., Cossu, G., 1998. Differential activation of Myf5 and MyoD by different Wnts – 1703 1713. in explants of mouse paraxial mesoderm and the later activation of myogenesis Silver, S.J., Hagen, J.W., Okamura, K., Perrimon, N., Lai, E.C., 2007. Functional in the absence of Myf5. Development 125, 4155–4162. fi screening identi es miR-315 as a potent activator of Wingless signaling. Proc. Thatcher, E.J., Paydar, I., Anderson, K.K., Patton, J.G., 2008. Regulation of zebrafish Natl. Acad. Sci. USA 104, 18151–18156. fin regeneration by microRNAs. Proc. Natl. Acad. Sci. USA 105, 18384–18389. Smith, J., Kraemer, E., Liu, H., Theodoris, C., Davidson, E., 2008. A spatially dynamic von Maltzahn, J., Chang, N.C., Bentzinger, C.F., Rudnicki, M.A., 2012. Wnt signaling in cohort of regulatory genes in the endomesodermal gene network of the sea myogenesis. Trends Cell Biol. 22, 602–609. urchin embryo. Dev. Biol. 313, 863–875. Vonica, A., Weng, W., Gumbiner, B.M., Venuti, J.M., 2000. TCF is the nuclear effector Smith, J., Theodoris, C., Davidson, E.H., 2007. A gene regulatory network subcircuit of the beta-catenin signal that patterns the sea urchin animal–vegetal axis. Dev. drives a dynamic pattern of gene expression. Science 318, 794–797. Biol. 217, 230–243. Sodergren, E., Weinstock, G.M., Davidson, E.H., Cameron, R.A., Gibbs, R.A., Angerer, R.C., Wahl, M.E., Hahn, J., Gora, K., Davidson, E.H., Oliveri, P., 2009. The cis-regulatory Angerer, L.M., Arnone, M.I., Burgess, D.R., Burke, R.D., Coffman, J.A., Dean, M., Elphick, M.R., Ettensohn, C.A., Foltz, K.R., Hamdoun, A., Hynes, R.O., Klein, W.H., system of the tbrain gene: alternative use of multiple modules to promote – Marzluff, W., McClay, D.R., Morris, R.L., Mushegian, A., Rast, J.P., Smith, L.C., skeletogenic expression in the sea urchin embryo. Dev. Biol. 335, 428 441. Thorndyke, M.C., Vacquier, V.D., Wessel, G.M., Wray, G., Zhang, L., Elsik, C.G., Wang, D., Zhang, H., Li, M., Frid, M.G., Flockton, A.R., McKeon, B.A., Yeager, M.E., Fini, Ermolaeva, O., Hlavina, W., Hofmann, G., Kitts, P., Landrum, M.J., Mackey, A.J., M.A., Morrell, N.W., Pullamsetti, S.S., Velegala, S., Seeger, W., McKinsey, T.A., Maglott, D., Panopoulou, G., Poustka, A.J., Pruitt, K., Sapojnikov, V., Song, X., Sucharov, C.C., Stenmark, K.R., 2014. MicroRNA-124 controls the proliferative, Souvorov, A., Solovyev, V., Wei, Z., Whittaker, C.A., Worley, K., Durbin, K.J., Shen, Y., migratory, and inflammatory phenotype of pulmonary vascular fibroblasts. Fedrigo, O., Garfield, D., Haygood, R., Primus, A., Satija, R., Severson, T., Gonzalez- Circ. Res. 114, 67–78. Garay, M.L., Jackson, A.R., Milosavljevic, A., Tong, M., Killian, C.E., Livingston, B.T., Wang, T., Xu, Z., 2010. miR-27 promotes osteoblast differentiation by modulating Wilt, F.H., Adams, N., Belle, R., Carbonneau, S., Cheung, R., Cormier, P., Cosson, B., Wnt signaling. Biochem. Biophys. Res. Commun. 402, 186–189. Croce, J., Fernandez-Guerra, A., Geneviere, A.-M., Goel, M., Kelkar, H., Morales, J., Wessel, G.M., McClay, D.R., 1985. Sequential expression of germ-layer specific Mulner-Lorillon, O., Robertson, A.J., Goldstone, J.V., Cole, B., Epel, D., Gold, B., Hahn, molecules in the sea urchin embryo. Dev. Biol. 111, 451–463. M.E., Howard-Ashby, M., Scally, M., Stegeman, J.J., Allgood, E.L., Cool, J., Judkins, K. Wessel, G.M., Zhang, W., Klein, W.H., 1990. Myosin heavy chain accumulates in M., McCafferty, S.S., Musante, A.M., Obar, R.A., Rawson, A.P., Rossetti, B.J., Gibbons, dissimilar cell types of the macromere lineage in the sea urchin embryo. Dev. I.R., Hoffman, M.P., Leone, A., Istrail, S., Materna, S.C., Samanta, M.P., Stolc, V., Biol. 140, 447–454. Tongprasit, W., Tu, Q., Bergeron, K.-F., Brandhorst, B.P., Whittle, J., Berney, K., Wheeler, B.M., Heimberg, A.M., Moy, V.N., Sperling, E.A., Holstein, T.W., Heber, S., Bottjer, D.J., Calestani, C., Peterson, K., Chow, E., Yuan, Q.A., Elhaik, E., Graur, D., Peterson, K.J., 2009. The deep evolution of metazoan microRNAs. Evol. Dev. 11, Reese, J.T., Bosdet, I., Heesun, S., Marra, M.A., Schein, J., Anderson, M.K., Brockton, 50–68. V., Buckley, K.M., Cohen, A.H., Fugmann, S.D., Hibino, T., Loza-Coll, M., Majeske, A.J., Whittaker, J.R., 1990. Determination of alkaline phosphatase expression in endo- Messier, C., Nair, S.V., Pancer, Z., Terwilliger, D.P., Agca, C., Arboleda, E., Chen, N., dermal cell lineages of an ascidian embryo. Biol. Bull. 178, 222–230. Churcher, A.M., Hallbook, F., Humphrey, G.W., Idris, M.M., Kiyama, T., Liang, S., Wikramanayake, A.H., Huang, L., Klein, W.H., 1998. beta-Catenin is essential for Mellott, D., Mu, X., Murray, G., Olinski, R.P., Raible, F., Rowe, M., Taylor, J.S., Tessmar- patterning the maternally specified animal–vegetal axis in the sea urchin Raible, K., Wang, D., Wilson, K.H., Yaguchi, S., Gaasterland, T., Galindo, B.E., embryo. Proc. Natl. Acad. Sci. USA 95, 9343–9348. Gunaratne, H.J., Juliano, C., Kinukawa, M., Moy, G.W., Neill, A.T., Nomura, M., Wikramanayake, A.H., Peterson, R., Chen, J., Huang, L., Bince, J.M., McClay, D.R., Raisch, M., Reade, A., Roux, M.M., Song, J.L., Su, Y.-H., Townley, I.K., Voronina, E., Klein, W.H., 2004. Nuclear beta-catenin-dependent Wnt8 signaling in vegetal Wong, J.L., Amore, G., Branno, M., Brown, E.R., Cavalieri, V., Duboc, V., Duloquin, L., cells of the early sea urchin embryo regulates gastrulation and differentiation of Flytzanis, C., Gache, C., Lapraz, F., Lepage, T., Locascio, A., Martinez, P., Matassi, G., endoderm and mesodermal cell lineages. Genesis 39, 194–205. Matranga, V., Range, R., Rizzo, F., Rottinger, E., Beane, W., Bradham, C., Byrum, C., Xia, H., Ng, S.S., Jiang, S., Cheung, W.K., Sze, J., Bian, X.W., Kung, H.F., Lin, M.C., 2010. Glenn, T., Hussain, S., Manning, G., Miranda, E., Thomason, R., Walton, K., miR-200a-mediated downregulation of ZEB2 and CTNNB1 differentially inhi- Wikramanayke, A., Wu, S.-Y., Xu, R., Brown, C.T., Chen, L., Gray, R.F., Lee, P.Y., bits nasopharyngeal carcinoma cell growth, migration and invasion. Biochem. Nam, J., Oliveri, P., Smith, J., Muzny, D., Bell, S., Chacko, J., Cree, A., Curry, S., – Davis, C., Dinh, H., Dugan-Rocha, S., Fowler, J., Gill, R., Hamilton, C., Hernandez, J., Biophys. Res. Commun. 391, 535 541. Hines, S., Hume, J., Jackson, L., Jolivet, A., Kovar, C., Lee, S., Lewis, L., Miner, G., Yaguchi, S., Yaguchi, J., Angerer, R.C., Angerer, L.M., 2008. A Wnt-FoxQ2-nodal fi Morgan, M., Nazareth, L.V., Okwuonu, G., Parker, D., Pu, L.-L., Thorn, R., Sea, pathway links primary and secondary axis speci cation in sea urchin embryos. – Wright, R., Urchin Genome Sequencing, C., 2006. The genome of the sea urchin Dev. Cell 14, 97 107. Strongylocentrotus purpuratus. Science (New York, N.Y.) 314, 941–952. Zeng, G., Germinaro, M., Micsenyi, A., Monga, N.K., Bell, A., Sood, A., Malhotra, V., Song, J.L., Stoeckius, M., Maaskola, J., Friedlander, M., Stepicheva, N., Juliano, C., Sood, N., Midda, V., Monga, D.K., Kokkinakis, D.M., Monga, S.P., 2006. Aberrant Lebedeva, S., Thompson, W., Rajewsky, N., Wessel, G.M., 2012. Select microRNAs Wnt/beta-catenin signaling in pancreatic adenocarcinoma. Neoplasia 8, are essential for early development in the sea urchin. Dev. Biol. 362, 104–113. 279–289. Staton, A.A., Giraldez, A.J., 2011. Use of target protector morpholinos to analyze the Zhao, J.-X., Yue, W.-F., Zhu, M.-J., Du, M., 2011. AMP-activated protein kinase physiological roles of specific miRNA–mRNA pairs in vivo. Nat. Protoc. 6, regulates beta-catenin transcription via histone deacetylase. J. Biol. Chem. 5, 2035–2049. 286.