Central Regulation of Energy Homeostasis and the Reproductive Axis

CENTRAL REGULATION OF ENERGY HOMEOSTASIS AND THE REPRODUCTIVE AXIS

A thesis submitted for the degree of Doctor of Philosophy, Imperial College London.

2010

Charlotte Katie Boughton

Section of Investigative Medicine Division of Diabetes, Endocrinology and Metabolism Department of Medicine Imperial College London

ABSTRACT

Alarin is a recently discovered splice variant of the galanin-like peptide (GALP) gene. Alarin is a highly conserved 25 amino acid peptide which shares its first 5 amino acids with GALP, but lacks the galanin receptor binding domain, suggesting that it mediates its biological effects through alternative receptors. Alarin has been detected in the rodent hypothalamus. GALP has a well-characterised role in the integration of energy and reproductive homeostasis.

Intracerebroventricular (ICV) alarin increases food intake and plasma luteinising hormone (LH) levels in rats. Alarin stimulates the release of the orexigenic neuropeptide Y (NPY) and gonadotrophin releasing hormone (GnRH) from hypothalamic explants, and GnRH release from an immortalised GnRH releasing cell line. Pre-treatment with a GnRH antagonist blocked the alarin-induced increase in plasma LH levels in vivo. These results suggest that ICV alarin activates the HPG axis via hypothalamic GnRH release. My data also suggests that alarin does not bind to the known galanin receptors.

The ventral tegmental area (VTA) is the origin of the mesolimbic dopamine pathway, which mediates the rewarding properties of palatable food. Recent work suggests that the VTA reward pathway is regulated by appetite-regulating signals including leptin and ghrelin. I have shown that intra-VTA melanocortin receptor agonist administration inhibits food intake and administration of an antagonist stimulates food intake in rats, suggesting that the melanocortin system may be involved in hedonic regulation of appetite, in addition to its role in homeostatic regulation of appetite.

These studies have elucidated the biological effects of alarin in the regulation of appetite and the HPG axis, and identified a role for the melanocortin system in regulating the central reward circuitry modulating food intake. Further work is required to determine the receptor by which alarin mediates its effect and its precise physiological function, and the physiological importance of the VTA melanocortin system.

DECLARATION OF CONTRIBUTORS The majority of the work described in thesis was performed by the author. Any collaboration and assistance is described below.

All radioimmunoassays were carried out under the supervision of Professor M.A. Ghatei (Division of Diabetes, Endocrinology and Metabolism, Department of Medicine, Imperial College London).

Chapters 2 and 3 - In vivo ICV injection studies were carried out with the assistance of the ‘hypothalamic group’.

Chapter 5 - The competent bacteria used for generation of probes was produced by Dr J.V. Gardiner (Division of Diabetes, Endocrinology and Metabolism, Department of Medicine, Imperial College London). The GAD67 probe utilised for in situ hybridisation was generated by Dr T. Ambepitiya. In vivo iVTA injection studies were carried out with the assistance of Dr J. Cooke and Miss K. Beale. Immunocytochemistry and in situ hybridisation was carried out with the guidance of Mr J.A.Tadross.

ACKNOWLEDGEMENTS

I would first like to thank my supervisors:

Dr. Kevin Murphy for his unfailing scientific guidance and support, and for his positivity and sense of humour throughout.

Dr. Gavin Bewick for his practical advice and help.

I am grateful to Professor Stephen Bloom for giving me the opportunity to work in his department.

Many thanks to all members of the ‘hypothalamic group’ for help with in vivo studies.

Thanks to all of those in the lab who made my time so enjoyable.

Finally, I would like to thank my family and friends for all their support and ‘enthusiasm’ for my work.

TABLE OF CONTENTS

ABSTRACT ...... 2

DECLARATION OF CONTRIBUTORS ...... 3

ACKNOWLEDGEMENTS ...... 4

ABBREVIATIONS ...... 23

CHAPTER 1: GENERAL INTRODUCTION ...... 27 1.1 The Neuroendocrine system ...... 28 1.2 The Hypothalamus ...... 29 1.3. Food Intake ...... 31 1.3.1. Hypothalamic control of food intake ...... 31 1.3.1.1. Hypothalamic nuclei involved in the control of energy homeostasis ...... 32 1.3.1.1.1. Arcuate nucleus ...... 32 1.3.1.1.1.1. The melanocortin system ...... 33 1.3.1.1.1.2. Neuropeptide Y ...... 34 1.3.1.1.1.3. Cocaine and amphetamine regulated transcript ...... 35 1.3.1.1.2. Dorsomedial nucleus ...... 36 1.3.1.1.2.1. Cholecystokinin ...... 36 1.3.1.1.3. Ventromedial nucleus ...... 37 1.3.1.1.4. Lateral hypothalamic area ...... 38 1.3.1.1.4.1. Orexins ...... 39 1.3.1.1.4.2. Melanin concentrating hormone ...... 39 1.3.1.1.5. Paraventricular nucleus ...... 40 1.3.1.1.5.1. Corticotrophin releasing hormone ...... 41 1.3.1.1.5.1. Glucagon-like peptide 1 ...... 41 1.3.1.1.6. Tuberomammillary nucleus ...... 42 1.3.2. Brainstem regulation of energy homeostasis ...... 43 1.3.3. Peripheral regulators of energy homeostasis ...... 44 1.3.3.1. Leptin ...... 44 5

1.3.3.2. Insulin ...... 46 1.3.3.3. Gut hormones ...... 47 1.3.3.3.1. Ghrelin ...... 47 1.3.3.3.2. Cholecystokinin ...... 48 1.3.3.3.3. Peptide YY ...... 49 1.3.3.3.4. Pancreatic polypeptide ...... 49 1.3.3.3.5. Preproglucagon products ...... 50 1.3.4. Non-homeostatic regulation of feeding ...... 51 1.3.4.1. The mesolimbic dopaminergic pathway ...... 51 1.3.4.2. Dopamine and food intake ...... 53 1.4.The Neuroendocrine axes ...... 54 1.4.1. Hypothalamic releasing factors ...... 54 1.4.2. The median eminence ...... 54 1.4.3. The pituitary gland ...... 55 1.4.3.1. The posterior pituitary ...... 55 1.4.3.2. The anterior pituitary ...... 56 1.4.3.2.1. The growth hormone axis ...... 57 1.4.3.2.1.1. Hypothalamic control of the GH axis ...... 57 1.4.3.2.1.2. Pituitary control of the GH axis ...... 58 1.4.3.2.2. The hypothalamo-pituitary-thyroid axes ...... 59 1.4.3.2.2.1. Hypothalamic control of the HPT axis ...... 59 1.4.3.2.2.2. Pituitary control of the HPT axis ...... 59 1.4.3.2.2.3. Thyroid hormones ...... 60 1.4.3.2.3. The hypothalamo-pituitary-adrenal axis ...... 61 1.4.3.2.3.1. Hypothalamic control of the HPA axis ...... 61 1.4.3.2.3.2. Pituitary control of the HPA axis ...... 62 1.4.3.2.3.3. Glucocorticoids ...... 62 1.4.3.2.4. The hypothalamo-pituitary-gonadal axis ...... 63 1.4.3.2.4.1. Hypothalamic control of the HPG axis ...... 63 1.4.3.2.4.2. Pituitary control of the HPG axis ...... 65 1.4.3.2.3.3. Gonads and control of the HPG axis ...... 66 1.5.The galanin peptide family ...... 67 1.5.1. Galanin message associated peptide ...... 67 1.5.2. Galanin ...... 68 1.5.2.1. Localisation of galanin ...... 69

1.5.2.2. Galanin actions ...... 70 1.5.2.2.1. Galanin and arousal/sleep regulation ...... 70 1.5.2.2.2. Galanin and nociception ...... 70 1.5.2.2.3. Galanin and neuroprotection ...... 70 1.5.2.2.4. Galanin and epilepsy ...... 70 1.5.2.2.5. Galanin and learning/ memory ...... 71 1.5.2.2.6. Galanin and anxiety/depression ...... 71 1.5.2.2.7. Galanin and addiction ...... 71 1.5.2.2.8. Galanin and water balance ...... 72 1.5.2.3. Galanin over-expressing and knockout mice ...... 72 1.5.3. GALP ...... 73 1.5.3.1. GALP mRNA and peptide distribution ...... 74 1.5.3.2. GALP actions ...... 74 1.5.4. Alarin ...... 75 1.5.4.1. Alarin localisation ...... 76 1.5.4.2. Alarin actions ...... 77 1.6. Aims ...... 78

CHAPTER 2: ALARIN AND ENERGY HOMEOSTASIS ...... 79 2.1 Introduction ...... 80 2.1.1. Galanin and food intake ...... 80 2.1.1.1. Galanin regulation by leptin and insulin ...... 83 2.1.2. GALP and energy homeostasis ...... 84 2.1.2.1. GALP regulation by insulin ...... 86 2.1.2.2. GALP regulation by leptin ...... 86 2.1.3. Other galanin related peptides and food intake ...... 87 2.1.4. Galanin receptor mediating effects on feeding ...... 88 2.2. Hypothesis ...... 89 2.2.1. Aims………………………………………………………………………………..89 2.3. Materials and methods ...... 90 2.3.1. Materials ...... 90 2.3.2. Animals ...... 90 7

2.3.3. In vivo studies ...... 90 2.3.3.1. Intracerebroventircular cannulation ...... 90 2.3.3.2. Intracerebroventricular injection ...... 91 2.3.3.3. Effect of ICV alarin on food intake in ad-libitum fed male rats before the early dark phase ...... 92 2.3.3.4. Effect of ICV alarin on food intake in fasted male rats in the early light phase ...... 92 2.3.3.5. Effect of ICV alarin on food intake in ad-libitum fed male rats in the early light phase ...... 92 2.3.3.6 Effect of ICV alarin on behaviour in ad-libitum fed male rats in the early light phase ...... 92 2.3.4. In vitro studies ...... 93 2.3.4.1. Effect of alarin on neuropeptide release from medial basal hypothalamic explants

...... 93 2.3.4.2. Principles of radioimmunoassay ...... 94 2.3.4.2.1. Hypothalamic neuropeptide RIAs ...... 95 2.3.4.2.1.1. NPY RIA ...... 96 2.3.4.2.1.2. αMSH RIA ...... 96 2.3.4.2.1.3. CART RIA ...... 96 2.3.4.3. The effect of fasting on hypothalamic alarin immunoreactivity ...... 97 2.3.4.3.1. Rat hypothalamic tissue ...... 97 2.3.4.3.2. Acetic acid extraction ...... 97 2.3.4.3.3. Alarin ELISA ...... 97 2.3.5 Statistics ...... 98 2.4. Results ...... 99 2.4.1. Effect of ICV alarin on food intake in ad-libitum fed male rats before the early dark phase ...... 99 2.4.2. Effect of ICV alarin on food intake in fasted male rats in the early light phase ...... 99 2.4.3. Effect of ICV alarin on food intake in ad-libitum fed male rats in the early light phase ...... 99 2.4.4. Effect of ICV alarin on behaviour in ad-libitum fed male rats in the early light phase ...... 102 2.4.5. Effect of alarin on neuropeptide release from hypothalamic explants in vitro ...... 105 2.4.6. The effect of fasting on hypothalamic alarin immunoreactivity ...... 106 2.5. Discussion ...... 107 8

CHAPTER 3: ALARIN AND THE NEUROENDOCRINE AXES ...... 113 3.1. Introduction ...... 114 3.1.1. Galanin peptide family and the neuroendocrine axes ...... 114 3.1.2. Galanin peptide family and the HPG axis ...... 115 3.1.2.1. Galanin and the HPG axis ...... 115 3.1.2.2. GALP and the HPG axis ...... 116 3.1.3. Galanin peptide family and the HPT axis ...... 119 3.1.3.1. Galanin and the HPT axis ...... 119 3.1.3.2. GALP and the HPT axis ...... 119 3.1.4. Galanin peptide family and the growth hormone axis ...... 120 3.1.4.1. Galanin and the growth hormone axis ...... 120 3.1.4.2. GALP and the growth hormone axis ...... 121 3.1.5. Galanin peptide family and prolactin/dopamine ...... 122 3.1.5.1. Galanin and prolactin/dopamine ...... 122 3.1.5.2. GALP and prolactin/dopamine ...... 123 3.1.6. Galanin peptide family and the HPA axis ...... 124 3.1.6.1. Galanin and the HPA axis ...... 124 3.1.6.2. GALP and the HPA axis ...... 125 3.2. Aims ...... 127 3.3. Materials and Methods ...... 128 3.3.1. Materials ...... 128 3.3.2. Animals ...... 128 3.3.3. In vivo studies ...... 128 3.3.3.1. Intracerebroventircular cannulation ...... 128 3.3.3.2. Intracerebroventricular injection ...... 128 3.3.3.3. Effect of ICV alarin administration on plasma hormones in intact male rat ...... 129 .3.4. In vitro studies ...... 129 3.3.4.1. Effect of alarin on neuropeptide release from medial basal hypothalamic explants ...... 129 3.3.4.2. Hypothalamic factor RIAs ...... 130 3.3.4.2.1. GnRH RIA ...... 130 3.3.4.2.2. TRH RIA ...... 130 3.3.4.2.3. CRH RIA ...... 130 3.3.4.3. Effect of alarin on GnRH release from GT1-7 cells ...... 131

3.3.4.4. Effect of alarin on pituitary hormone release from pituitary explants ...... 131 3.3.4.5. Effect of alarin and GALP on LH release from LβT2 cells ...... 132 3.3.5. Effect of ICV alarin administration on plasma hormones in intact male rats following pretreatment with cetrorelix ...... 132 3.3.6. Plasma hormone RIAs ...... 132 3.3.6.1. LH RIA ...... 132 3.3.6.2. FSH, TSH, PRL and GH RIA ...... 133 3.3.6.3. Total testosterone RIA ...... 133 3.3.6.4. ACTH immunoradiometric assay for measurement of ACTH in plasma ...... 134 3.3.6.5. Corticosterone RIA ...... 134 3.3.7. Regulation of hypothalamic alarin by the oestrus cycle ...... 135 3.3.8. Statistics ...... 136 3.4. Results ...... 137 3.4.1. Effect of ICV alarin administration on plasma hormones in intact male rats ...... 137 3.4.2. Effect of alarin on neuropeptide release from medial basal hypothalamic explants ...... 139 3.4.3. Effect of alarin on GnRH release from GT1-7 cells ...... 140 3.4.4. Effect of alarin on pituitary hormone release from pituitary explants ...... 142 3.4.5. Effect of alarin and GALP on LH release from LβT2 cells ...... 143 3.4.6. Effect of ICV alarin administration on plasma hormones in intact male rats following pretreatment with cetrorelix ...... 145 3.4.7. Regulation of hypothalamic alarin by the oestrus cycle ...... 148 3.5. Discussion ...... 149

CHAPTER 4: INVESTIGATING THE RECEPTOR MEDIATING THE BIOLOGICAL EFFECTS OF ALARIN ...... 155 4.1. Introduction ...... 156 4.1.1. Galanin receptors ...... 156 4.1.1.1. Galanin receptor 1 ...... 157 4.1.1.2. Galanin receptor 2 ...... 159 4.1.1.3. Galanin receptor 3 ...... 161 4.1.2. Galanin receptor agonists and antagonists ...... 162 4.1.2.1. Non-specific galanin receptor agonists ...... 162 4.1.2.2. Non-specific galanin receptor anatgonists ...... 162 4.1.2.3. Subtype selective galanin receptor agonists/antagonists ...... 163 4.1.2.3.1. GalR1 ...... 163 4.1.2.3.1. GalR2 ...... 163 4.1.2.3.1. GalR3 ...... 163 4.1.3. A GALP specific receptor? ...... 164 4.2 Aims ...... 165 4.3 Materials and Methods ...... 166 4.3.1. Materials ...... 166 4.3.2. Cell culture of galanin recpeptor expressing cells ...... 166 4.3.3. Confirmation of galanin receptor expression by RT-PCR ...... 166 4.3.3.1. Total RNA extraction ...... 166 4.3.3.2. Denaturing formaldehyde gel to check viability of total RNA ...... 167 4.3.3.3. Reverse transcription ...... 168 4.3.3.4. Polymerase chain reaction ...... 168 4.3.3.5. Visualisation of PCR products ...... 169 4.3.4. Membrane preparations ...... 170 4.3.4.1. Preparation of membranes from galanin receptor expressing cells and GT1-7 cells ...... 170 4.3.4.2. Preparation of membranes from rat hypothalamic tissue ...... 170 4.3.4.3. Biuret assay to determine protein concentration of membranes ...... 171 4.3.5. Iodination of galanin and GLP-1 ...... 171 4.3.6. Competitive receptor binding assays ...... 172 4.3.6.1. Galanin receptor expressing membranes ...... 172 4.3.6.2. Hypothalamic membrane ...... 172 4.3.6.3. GT1-7 membrane ...... 172

4.3.7. Galanin receptor antagonist studies ...... 173 4.3.7.1. Competitive receptor binding of C7 to membranes expressing GalR1, GalR2 and GalR3 ...... 173 4.3.7.2. Effect of galanin on GnRH release from GT1-7 cells ...... 173 4.3.7.3. Effect of C7 on galanin induced GnRH release from GT1-7 cells ...... 173 4.3.7.4. Effect of galanin and C7 on LH release from LβT2 cells ...... 173 4.3.7.5. Effect of C7 on GALP induced LH release from LβT2 cells ...... 174 4.3.8. The effect of N terminal truncation on alarin bioactivity ...... 175 4.3.8.1. In vivo studies ...... 175 4.3.8.1.1. ICV cannulation and ICV injection ...... 175 4.3.8.1.2. Effect of ICV alarin 3-25 on food intake in ad-libitum fed male rats in the early light phase ...... 175 4.3.8.1.3. Effect of ICV alarin 3-25 on plasma LH and corticosterone in intact male rats ...... 175 4.3.8.2. In vitro studies ...... 176 4.3.8.2.1. Effect of alarin 3-25 and alarin 6-25 on GnRH release from GT1-7 cells176 4.3.8.2.2. Competitive receptor binding of alarin 3-25 and alarin 6-25 at membranes expressing GalR1, GalR2 and GalR3 ...... 176 4.3.9. Statistics ...... 176 4.4 Results ...... 177 4.4.1. Confirmation of galanin receptor expression by RT-PCR ...... 177 4.4.2. Competitive receptor binding assays ...... 178 4.4.2.1. Galanin receptor expressing membranes ...... 178 4.3.2.2. Hypothalamic membrane ...... 178 4.4.3. Determining galanin receptor expression in GT1-7 and LβT2 cells ...... 180 4.4.4. Competitive receptor binding assays at GT1-7 membrane ...... 181 4.4.5 . Galanin receptor antagonist studies ...... 182 4.4.5.1. Competitive receptor binding of C7 at membranes expressing GalR1, GalR2 and GalR3 ...... 182 4.4.5.2. Effect of galanin on GnRH release from GT1-7 cells ...... 182 4.4.5.3. Effect of C7 on galanin induced GnRH release from GT1-7 cells ...... 183 4.4.5.4. Effect of galanin and C7 on LH release from LβT2 cells ...... 183 4.4.5.5. Effect of C7 on GALP induced LH release from LβT2 cells ...... 184 4.4.6. The effect of N terminal truncation on alarin bioactivity ...... 186 4.4.6.1. In vivo studies ...... 186

4.4.6.1.1. Effect of ICV alarin 3-25 on food intake in ad-libitum fed male rats in the early light phase ...... 186 4.4.6.1.2. Effect of ICV alarin 3-25 on plasma LH in intact male rats ...... 187 4.4.6.1.3. Effect of ICV alarin 3-25 on plasma corticosterone in intact male rats ... 187 4.4.6.2. In vitro studies ...... 188 4.4.6.2.1. Effect of alarin 3-25 and alarin 6-25 on GnRH release from GT1-7 cells188 4.4.6.2.2. Competitive receptor binding of alarin 3-25 and alarin 6-25 at galanin receptor expressing membranes ...... 189 4.5. Discussion ...... 190

CHAPTER 5: THE ROLE OF THE VTA IN THE REGULATION OF FEEDING ...... 194 5.1. Introduction ...... 195 5.1.1. The VTA ...... 195 5.1.1.1. VTA structure ...... 195 5.1.1.2. VTA projections ...... 196 5.1.2. Dopamine ...... 198 5.1.2.1. Dopamine synthesis and release ...... 198 5.1.2.2. Dopamine signalling ...... 198 5.1.2.3. Dopamine metabolism ...... 199 5.1.3. Role of VTA dopaminergic neurons in drug addiction ...... 201 5.1.4. Role of the VTA in feeding ...... 202 5.1.4.1. Food reward in fed/fasted states ...... 204 5.1.5. Peripheral hormones and food reward ...... 205 5.1.5.1. Leptin ...... 205 5.1.5.2. Insulin ...... 206 5.1.5.3. Ghrelin ...... 207 5.1.6. Hypothalamic peptides and food reward ...... 208 5.1.6.1. LHA neuropeptides and food reward ...... 208 5.1.6.1.1. Orexin ...... 208 5.1.6.1.2. MCH ...... 209 5.1.6.2. ARC neuropeptides and food reward ...... 210 5.1.6.2.1. NPY ...... 210 13

5.1.6.2.2. CART ...... 211 5.1.6.2.3. Melanocortins ...... 212 5.2 Aims ...... 214 5.3 Materials and Methods ...... 215 5.3.1. Materials ...... 215 5.3.2. Animals ...... 215 5.3.3. VTA cannulation ...... 215 5.3.4. IntraVTA administration of factors involved in energy homeostasis ...... 215 5.3.5. Verification of intraVTA cannula location ...... 216 5.3.5.1. India ink injection and tissue processing ...... 216 5.3.5.2. Haemotoxylin staining ...... 216 5.3.6. IntraVTA feeding studies ...... 217 5.3.6.1. Effect of iVTA administration of peripheral factors on food intake ...... 217 5.3.6.1.1. Effect of iVTA insulin on food intake in ad-libitum fed rats during the early light phase ...... 217 5.3.6.1.2. Effect of iVTA insulin on food intake in ad-libitum fed rats during the early dark phase ...... 217 5.3.6.2. Effect of iVTA administration of LHA neuropeptides on food intake ...... 218 5.3.6.2.1. Effect of iVTA orexin and MCH on food intake in ad-libitum fed rats during the early light phase ...... 218 5.3.6.3. Effect of iVTA administration of ARC neuropeptides on food intake ...... 218 5.3.6.3.1. Effect of iVTA CART(55-102) on food intake in fasted rats during the early light phase ...... 218 5.3.6.3.2. Effect of iVTA CART (55-102) on food intake in ad-libitum fed rats during the early light phase ...... 219 5.3.6.3.3. Effect of iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ...... 219 5.3.6.3.4. Effect of iVTA NPY and AgRP on food intake in ad-libitum fed rats during the early light phase ...... 219 5.3.7. Characterisation of melanocortin receptor expressing neurons in the VTA ...... 220 5.3.7.1. Production of GAD65 and TH probes ...... 221 5.3.7.1.1. Reverse transcription and PCR ...... 221 5.3.7.1.2. Purification of PCR products ...... 221 5.3.7.1.3. Restriction endonuclease digestion of PCR products and plasmids ...... 222 5.3.7.1.4. Electroelution of DNA fragments ...... 222

5.3.7.1.5. Ligation of PCR products into plasmids ...... 223 5.3.7.1.6. Preparation of plasmids ...... 223 5.3.7.1.6.1. Production of competent bacteria ...... 223 5.3.7.1.6.2. Transformation of competent bacteria ...... 224 5.3.7.1.6.3. Small scale preparation of plasmid DNA ...... 225 5.3.7.1.6.4. Large scale preparation of plasmid DNA ...... 226 5.3.7.1.6.5. Caesium chloride gradient purification of plasmid DNA ...... 227 5.3.7.1.6.6. Determination of DNA concentration by spectrophotometry ...... 227 5.3.7.2. In situ hybridisation for GAD65, GAD67 and TH ...... 228 5.3.7.2.1. Production of DIG-labelled RNA probe for in situ hybridisation - GAD65, GAD67 and TH ...... 229 5.3.7.2.2. In situ hybridisation for TH and GAD65/67 on fresh frozen rat brain sections ...... 230 5.3.7.2.3. In situ hybridisation for TH and GAD65/67 on paraffin embedded rat brain sections ...... 232 5.3.7.2.3.1. Brain tissue fixation and processing ...... 232 5.3.7.2.3.2. In situ hybridisation ...... 233 5.3.7.3. Immunocytochemistry for melanocortin receptors in the VTA ...... 235 5.3.7.3.1. Brain tissue fixation and processing ...... 235 5.3.7.3.2. Melanocortin receptor ICC ...... 235 5.3.7.4. Dual ISH /ICC for GAD65/67 or TH mRNA and MC3R-IR ...... 236 5.3.8. Studies investigating the mechanisms by which iVTA melanocortins mediate their effects on food intake ...... 237 5.3.8.1. Effect of iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ...... 237 5.3.8.2. Effect of iVTA NDP-MSH (lower doses) on food intake in ad-libitum fed rats during the early dark phase ...... 237 5.3.8.3. Effect of iVTA NDP-MSH on food intake in fasted rats during the early light phase ...... 237 5.3.8.4. Effect of iVTA AgRP (low doses) on food intake in ad-libitum fed rats during the early light phase ...... 238 5.3.8.5. Effect of iVTA AgRP on food intake in ad-libitum fed rats during the early light phase ...... 238 5.3.8.6. Effect of iVTA γMSH on food intake in ad-libitum fed rats during the early dark phase ...... 238

5.3.8.7. Effect of IP pretreatment with the GABA receptor antagonist bicuculline before iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ... 239 5.3.9. Statistics ...... 239 5.4 Results ...... 240 5.4.1. Confirmation of cannula placement ...... 240 5.4.2. IntraVTA administration of factors involved in energy homeostasis ...... 241 5.4.2.1. Effect of iVTA administration of peripheral factors on food intake ...... 241 5.4.2.1.1. Effect of iVTA insulin on food intake in ad-libitum fed rats during the early light phase ...... 241 5.4.2.1.2. Effect of iVTA insulin on food intake in ad-libitum fed rats during the early dark phase ...... 242 5.4.2.2. Effect of iVTA administration of LHA neuropeptides on food intake ...... 243 5.4.2.2.1. Effect of iVTA orexin and MCH on food intake in ad-libitum fed rats during the early light phase ...... 243 5.4.2.3. Effect of iVTA administration of ARC neuropeptides on food intake ...... 244 5.4.2.3.1. Effect of iVTA CART(55-102) on food intake in fasted rats during the early light phase ...... 244 5.4.2.3.2. Effect of iVTA CART (55-102) on food intake in ad-libitum fed rats during the early light phase ...... 244 5.4.2.3.3. Effect of iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ...... 247 5.4.2.3.4. Effect of iVTA NPY and AgRP on food intake in ad-libitum fed rats during the early light phase ...... 247 5.4.3. Characterisation of melanocortin receptor expressing neurons in the VTA ...... 250 5.4.3.1. Expression of TH and GAD65/67 mRNA in the rat VTA ...... 250 5.4.3.1.1. Production of GAD65 and TH probes ...... 250 5.4.3.1.2. Expression of TH mRNA on fresh frozen rat brain sections ...... 252 5.4.3.1.3. Expression of TH mRNA on paraffin embedded rat brain sections ...... 253 5.4.3.1.4. Expression of GAD65/67 mRNA on fresh frozen rat brain sections ...... 254 5.4.3.1.5. Expression of GAD65/67 mRNA on paraffin embedded rat brain sections ...... 255 5.4.3.2. Localisation of melanocortin receptors in the rat brain ...... 256 5.4.3.2.1. Localisation of MC3R-IR in the rat brain ...... 256 5.4.3.1.2. Localisation of MC4R-IR in the rat brain ...... 256 5.4.3.3. Dual ISH /ICC for GAD65/67 or TH mRNA and MC3R-IR ...... 257

5.4.4. Studies investigating the mechanisms by which iVTA melanocortins mediate their effects on food intake ...... 258 5.4.4.1. Effect of iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ...... 258 5.4.4.2. Effect of iVTA NDP-MSH (lower doses) on food intake in ad-libitum fed rats during the early dark phase ...... 258 5.4.4.3. Effect of iVTA NDP-MSH on food intake in fasted rats during the early light phase ...... 261 5.4.4.4. Effect of iVTA AgRP (lower doses) on food intake in ad-libitum fed rats during the early light phase ...... 262 5.4.4.5. Effect of iVTA AgRP on food intake in ad-libitum fed rats during the early light phase ...... 263 5.4.4.6. Effect of iVTA γMSH on food intake in ad-libitum fed rats during the early dark phase ...... 264 5.4.4.7. Effect of IP pretreatment with the GABA receptor antagonist bicuculline before iVTA NDP-MSH on food intake in ad-libitum fed rats during the early dark phase ... 265 5.5. Discussion ...... 266

CHAPTER 6: GENERAL DISCUSSION ...... 273 6.1 Introduction ...... 274 6.2 The role of alarin in the regulation of energy homeostasis and reproduction ...... 274 6.3 The role of the VTA melanocortin system in the regulation of feeding ...... 277

REFERENCES ...... 281

APPENDICES ...... 355 Appendix I: Solutions used in this thesis ...... 355 Appendix II: List of suppliers ...... 363

PUBLICATIONS ...... 364

INDEX OF FIGURES

Figure 1.1: Schematic sagittal diagram of the human hypothalamus ...... 30

Figure 1.2: The mesolimbic and mesocortical dopamine pathways ...... 52

Figure 1.3: Schematic diagram of the HPG axis ...... 64

Figure 1.4: Organisation of the preprogalanin gene ...... 68

Figure 1.5: Organisation of the preproGALP gene…………………………………………..... 76

Figure 1.6: Amino acid sequences of alarin, GALP and galanin peptides ……………...... …..77

Figure 2.1: The effect of ICV administration of alarin on food intake in ad-libitum fed adult male rats during the early dark phase ...... 100

Figure 2.2: The effect of ICV administration of alarin on food intake in fasted adult male rats in the early light phase ...... 100

Figure 2.3: The effect of ICV administration of alarin on food intake in ad-libitum fed adult male rats in the early light phase ...... 101

Figure 2.4: The effect of ICV administration of alarin on behaviour in ad-libitum fed adult male rats in the early light phase ...... 102

Figure 2.5: The effect of ICV administration of alarin on feeding behaviour in ad-libitum fed adult male rats in the early light phase...... 103

Figure 2.6: The effect of alarin on NPY, αMSh and CART release from hypothalamic explants in vitro ...... 105

Figure 2.7: Hypothalamic alarin levels in response to fasting in the male rat ...... 106

Figure 3.1: The effect of ICV administration of alarin on plasma hormones in intact adult male rats ...... 138

Figure 3.2: The effect of alarin on GnRH release from hypothalamic explants and GT1-7 cells in vitro ...... 141

Figure 3.3: The effect of alarin on LH and FSH release from pituitary segments, and LH release from LβT2 cells in vitro ...... …….144

Figure 3.4: The effect of ICV administration of alarin on LH, FSH and testosterone in intact adult male rats after injection with a GnRH receptor antagonist ...... 146

Figure 3.5: Hypothalamic alarin levels at different stages of the oestrus cycle in the female rat ...... ……148

Figure 4.1: Galanin receptor subtype signalling pathways ...... 156 19

Figure 4.2: Galanin receptor expression in GalR1 and GalR2 expressing cell lines ...... 177

Figure 4.3: Competitive receptor binding assays of alarin competing at the galanin receptors and hypothalamic membrane ...... 179

Figure 4.4: Galanin receptor expression in LβT2 and GT1-7 cells ...... 180

Figure 4.5: Competitive receptor binding assays of galanin competing at GT1-7 membrane .. 181

Figure 4.6: The effect of galanin and GALP on LH release from LβT2 cells ...... 185

Figure 4.7: The effect of ICV administration of alarin3-25 on food intake in ad-libitum fed adult male rats ...... 186

Figure 4.8: The effect of ICV administration of alarin3-25 on LH and corticosterone in intact adult male rats ...... 187

Figure 5.1: Schematic coronal section of the rat brain highlighting the VTA ...... 196

Figure 5.2: Schematic diagram of the mesolimbic dopamine circuitry in the rat brain ...... 197

Figure 5.3: Schematic diagram of the dopamine synthesis pathway ...... 200

Figure 5.4: Representative coronal section of ink injection into the rat VTA ...... 240

Figure 5.5: The effect of iVTA administration of CART (55-102) on food intake in fasted male rats ...... 245

Figure 5.6: The effect of iVTA administration of CART (55-102) on food intake in ad-libitum fed male rats in the early light phase ...... 246

Figure 5.7: The effect of iVTA administration of NDP-MSH on food intake in ad-libitum fed male rats in the early dark phase ...... 248

Figure 5.8: The effect of iVTA administration of NPY and AgRP on food intake in ad-libitum fed male rats in the early light phase ...... 249

Figure 5.9: Generation of a tyrosine hydroxylase probe ...... 250

Figure 5.10: Generation of a glutamic acid decarboxylase 65 probe ...... 251

Figure 5.11: Expression of TH mRNA in frozen rat brain sections ...... 252

Figure 5.12: Expression of TH mRNA in paraffin embedded rat brain sections ...... 253

Figure 5.13: Expression of GAD65/67 mRNA in frozen rat brain sections ...... 254

Figure 5.14: Expression of GAD65/67 mRNA in paraffin embedded rat brain sections ......

………………………………………………………………………………………...... 255

Figure 5.15: Localisation of MC3R-immunoreactivity in the rat brain ...... 256

Figure 5.16: Dual in situ hybridisation/ICC for GAD65/67 and MC3R-IR in the rat VTA

……...... 257

Figure 5.17: The effect of iVTA administration of NDP-MSH on food intake in ad-libitum fed male rats in the early dark phase ...... 259

Figure 5.18: The effect of iVTA administration of low doses of NDP-MSH on food intake in ad- libitum fed male rats in the early dark phase ...... 260

Figure 5.19: The effect of iVTA administration of NDP-MSH on food intake in fasted male rats in the early light phase ...... 261

Figure 5.20: The effect of iVTA administration of low doses of AgRP on food intake in ad-libitum fed male rats in the early light phase ...... 262

Figure 5.21: The effect of iVTA administration of AgRP on food intake in ad-libitum fed male rats in the early light phase ...... 263

Figure 5.22: The effect of iVTA administration of gamma-MSH on food intake in ad-libitum fed male rats in the early dark phase ...... 264

Figure 5.23: The effect of iVTA administration of NDP-MSH on food intake after IP administration of GABA receptor antagonist bicuculline in ad-libitum fed male rats in the early dark phase…………………………………………………………………………………………265

INDEX OF TABLES

Table 2.1: The effect of ICV administration of alarin on behaviour in ad-libitum fed adult male rats in the early light phase ...... 104

Table 3.1: The effect of ICV administration of alarin on plasma hormones in intact adult male rats...... 137

Table 3.2: The effect of alarin on GnRH, CRH and TRH release from hypothalamic explants in vitro...... 139

Table 3.3: The effect of rat alarin and murine alarin on GnRH release from GT1-7 cells in vitro.140

Table 3.4: The effect of alarin on LH, FSH, TSH and PRL release release from pituitary segments, in vitro ...... 143

Table 3.5: The effect of ICV administration of alarin on plasma hormones in intact adult male rats after injection with a GnRH receptor antagonist ...... 147

Table 4.1: Galanin receptor primer sequences used in PCR ...... 169

Table 4.2: Competitive receptor binding assays of C7 vs. I125 galanin to the galanin receptors ...... 182

Table 4.3: The effect of galanin on GnRH release from GT1-7 cells in vitro ...... 182

Table 4.4: The effect of C7 on galanin-induced GnRH release from GT1-7 cells in vitro ...... 183

Table 4.5: The effect of alarin1-25 and alarin3-25 on GnRH release from GT1-7 cells in vitro188

Table 4.6: The effect of alarin6-25 on GnRH release from GT1-7 cells in vitro ...... 189

Table 4.7: Competitive receptor binding assays of alarin3-25 and alarin6-25 vs. I125 galanin to the galanin receptors ...... 189

Table 5.1: GAD65, GAD67 and TH primer sequences used in PCR...... 221

Table 5.2: The effect of iVTA administration of insulin on food intake in ad-libitum fed adult male rats in the early light phase...... 241

Table 5.3: The effect of iVTA administration of insulin on food intake in ad-libitum fed adult male rats in the early dark phase ...... 242

Table 5.4: The effect of iVTA administration of orexin and MCH on food intake in ad-libitum fed adult male rats in the early light phase ...... 243

ABBREVIATIONS

ACSF – artificial cerebrospinal fluid

ACTH – adenocorticotrophic hromone

AgRP – agouti related peptide

α-MSH – alpha- melanocyte stimulating hormone

ANOVA – analysis of variance

ANS – autonomic nervous system

AP – area postrema

AQ – aqueduct

ARC – arcuate nucleus

AVP – argenine vasopressin

BBB – blood brain barrier

BNST – bed nucleus of the stria terminalis

BSA – bovine serum albumin

CCK – cholecystokinin

CGRP – calcitonin gene-related peptide

CLAMS – comprehensive laboratory animal monitoring system

CNS – central nervous system

COMT – catechol-O-methyl transferase

CPM – counts per minute

CPP – conditioned place preference

CRH – corticotrophin releasing hormone

DA – dopamine

DIO – diet induced obese

DMEM – Dulbecco’s modified eagle medium

DMN – dorsomedial nucleus

DNA – deoxyribonucleic acid

DOPAC - 3,4-dihydroxyphenylacetic acid

DPP-IV – dipeptidyl peptidase IV

DRN – dorsal raphe nucleus 23

DVC – dorsal vagal complex

FCS – fetal calf serum fMRI – functional magnetic resonance imaging

FSH – follicle stimulating hormone

γ-MSH – gamma-melanocyte stimulating hormone

GABA – gamma-aminobutyric acid

GAD – glutmatic acid decarboxylase

GALP – galanin-like peptide

GALR1 – galanin receptor 1

GALR2 – galanin receptor 2

GALR3 – galanin receptor 3

GH – growth hormone

GHRH – growth hormone releasing hormone

GHS-R – growth hormone secretagogue receptor

GI – gastrointestinal

GLP-1 – glucagon-like peptide 1

GMAP – galanin message associated peptide

GnRH – gonadotrophin releasing hormone

GPCR – G-protein coupled receptor

GR – glucocorticoid receptor

HPA – hypothalamopituitary adrenal

HPG – hypothalamopituitary gonadal

HPLC – high-performance liquid chromatography

HPT – hypothalamopituitary thyroid

HVA – homovanillic acid

ICC – immunocytochemistry

ICV – intracerebroventricular

IL – interleukin

IP – intraperitoneal

IR – immunoreactivity 24

ISH – in situ hybridisation

IV – intravenous

LC – locus coeruleus

LH – luteinising hormone

LHA – lateral hypothalamic area

LPS – lipopolysaccharide

LV – lateral ventricle

MAOA – monoamine oxidase A

MAOB – monoamine oxidase B

MCH – melanin concentrating hormone

MDMA – methamphetamine

MPOA – medial preoptic area

MPON – medial pre-optic nucleus

MR – mineralocorticoid receptor mRNA – messenger ribonucleic acids

NAc – nucleus accumbens

NDP-MSH – [Nle4,D-Phe7]-α-melanocyte stimulating hormone

NTS – nucleus of the solitary tract

OFC – orbitofrontal cortex

OLETF – Otsuka-Long Evans-Tokushima Fatty (rats)

PAM – peptidylglycine α-amidating monooxygenase

PFC – prefrontal cortex

PNS – peripheral nervous system

POMC – pro-opiomelanocortin

PP – pancreatic polypeptide

PRL – prolactin

PVN – paraventricular nucleus

PYY – peptide YY

RIA – radioimmunoassay

RT-PCR – reverse transcription polymerase chain reaction 25

SC – subcutaneous

SCN – suprachiasmatic nucleus

SEM – standard error of the mean

SON – supraoptic nucleus

TH – tyrosine hydroxylase

TMN – tuberomammillary nucleus

TRH – thyrotrophin releasing hormone

VMN – ventromedial nucleus

UV – ultraviolet

VIP – vasoactive intestinal peptide

VTA – ventral tegmental area

CHAPTER 1 GENERAL INTRODUCTION

1.1 THE NEUROENDOCRINE SYSTEM In order for a multicellular organism to survive in variable external environments, it must be able to control its body’s internal environment. In mammals, the co-ordinated activity of the autonomic nervous system (ANS) and the endocrine system play important roles in this internal regulation. The ANS generally responds rapidly to external changes with appropriate and tissue specific responses, transmitting information via neural impulses and neurotransmitter release. The endocrine system, in contrast, consists of glands which release hormones (internal messenger molecules which are involved in regulation and feedback of body systems) directly into the blood where they are transported to act at often distant target cells and organs. Due to the nature of transportation of hormones, this system tends to be slower and less localised, although its effects are often of a longer duration. There is considerable overlap and interaction between the ANS and the endocrine system. Endocrine glands are innervated by neural stimuli transmitted via the ANS, and the endocrine system regulates nervous system function. Many substances have a role in both of these systems with some factors acting as hormones in the periphery and as neurotransmitters in the nervous system. The ANS and the endocrine system can therefore be considered as a single neuroendocrine regulatory system, acting in a co-ordinated fashion to maintain a stable internal environment and to control, amongst other systems, the metabolic activities and reproductive functions of an organism.

Galanin, galanin-like peptide (GALP), galanin message-associated peptide (GMAP) and alarin comprise the galanin peptide family (Lang et al, 2007). Members of this family play key roles in numerous physiological functions in the central nervous system (CNS) and in the peripheral nervous system (PNS) and various organs (Lang et al, 2007). The genes encoding the galanin peptide family members are expressed in the CNS and neuroendocrine tissues, and galanin and GALP peptides have also been detected in the circulation. The galanin peptide family may therefore act as regulatory peptides at various levels of the neuroendocrine system (Lang et al, 2007).

1.2 THE HYPOTHALAMUS The hypothalamus is an area of neural tissue containing many discrete neuronal populations or nuclei. It occupies the ventral half of the diencephalon, extending from the region of the optic chiasm to the caudal border of the mammillary bodies. It lies below the thalamus and surrounds the third ventricle, directly above the pituitary gland. The hypothalamus controls body homeostasis, including body temperature, circadian rhythm and feeding behaviour through its regulation of the autonomic nervous system and the endocrine system. It has numerous afferent and efferent neuronal connections and a specific blood supply network which allow it to make appropriate regulatory responses following integration of nervous and chemical signals. The hypothalamus can be divided into three functionally and morphologically distinct longitudinal zones: the periventricular, medial and lateral zones (Crosby & Woodburne, 1949). Each zone comprises discrete regions or nuclei. Those nuclei expressing receptors of the galanin peptide family include the arcuate nucleus (ARC), a major site for the integration of peripheral appetite signals (Cone et al, 2001;Depczynski et al, 1998), called the infundibular nucleus in man, the paraventricular nucleus (PVN), which is the origin of important hypothalamic outputs in the regulation of both pituitary hormone secretion and the autonomic nervous system (Mitchell et al, 1997;Depczynski et al, 1998;Ulrich-Lai & Herman, 2009), the lateral hypothalamic area (LHA), once known as the ‘hunger centre’ of the brain (Mennicken et al, 2002;Anand & Brobeck J.R., 1951), and the tuberomammillary nucleus (TMN), the main histamine producing region of the brain which is involved in regulation of arousal, sleep and circadian rhythm (Haas & Panula, 2003;Depczynski et al, 1998).

FIGURE 1.1 The hypothalamic region of the left cerebral hemisphere viewed from the medial aspect and dissected to display the major hypothalamic nuclei. The lateral hypothalamic region is coloured magenta and the medial hypothalamic nuclei are coloured yellow. (Gray H, 1980).

1.3 FOOD INTAKE Obesity is a major public health issue world-wide. In 2005, approximately 1.6 billion adults world- wide were overweight and more than 400 million adults were obese. These figures are predicted to rise (World Health Organisation, 2006).

Increased weight predisposes to and can aggravate many clinical conditions, including cardiovascular disease, type II diabetes mellitus, restrictive lung disease, certain cancers and infertility (Kopelman, 2000). Obesity is a multi-factorial condition where genetic, environmental, behavioural and socio- economic conditions all contribute to determine body weight, adipose tissue mass and distribution (Bray, 1992).

1.3.1 HYPOTHALAMIC CONTROL OF FOOD INTAKE Despite wide variation in daily food intake and energy expenditure, most individuals are able to maintain a remarkably stable body weight over long periods of time (Leibel, 1990). In order for this to occur, food intake and energy expenditure must be constantly modulated and balanced. Studies carried out in the 1940s and 50s determined that the hypothalamus is essential for such regulation of both appetite and energy balance. Early work by Hetherington and Ranson (Hetherington A.W. & Ranson S.W., 1940) and Anand and Brobeck (Anand & Brobeck J.R., 1951) proposed a model consisting of a feeding centre within the lateral hypothalamus and a satiety centre within the ventromedial hypothalamus. These conclusions were based on lesioning studies in rodents which revealed that loss of mediobasal hypothalamic function caused obesity, and loss of lateral hypothalamic function decreased food intake. This model has subsequently been considered too simplistic. Surgical, electrolytic or chemical destruction of other hypothalamic nuclei including the ARC (Olney, 1969), and the PVN (Aravich & Sclafani, 1983) also leads to the development of obesity, while lesioning of the dorsomedial nucleus (DMN) causes hypophagia (Bellinger & Bernardis, 2002).

Energy homeostasis is now thought to be regulated by specific neuropeptides and classical neurotransmitters which transmit signals within neuronal circuits that span multiple brain regions. Extra-hypothalamic brain regions which are important in regulating energy homeostasis include the nucleus of the tractus solitari (NTS) and the area postrema (AP) in the brainstem, the ventral tegmental area (VTA) within the midbrain and the nucleus accumbens (NAc) in the striatum (Contreras et al, 1984;Hommel et al, 2006).

1.3.1.1 HYPOTHALAMIC NUCLEI INVOLVED IN THE CONTROL OF ENERGY HOMEOSTASIS

1.3.1.1.1 ARCUATE NUCLEUS The ARC is located at the base of the hypothalamus on either side of the third ventricle. Due to its location next to the median eminence, which has an incomplete blood brain barrier (BBB), the ARC is able to respond to circulating hormones such as leptin, insulin, gonadal and adrenal steroids (Banks, 2006;Irwig et al, 2004;Tempel & Leibowitz, 1994).

The ARC has a pivotal role in the integration and interpretation of signals of energy balance. There are two neuronal populations within the ARC known to be involved in energy homeostasis (Cone et al, 2001). One population, located more medially, expresses the orexigenic peptides neuropeptide Y (NPY) and agouti related peptide (AgRP) (Hahn et al, 1998;Broberger et al, 1998a). The second population is found more laterally and produces the anorexigenic peptides alpha-melanocyte stimulating hormone (α-MSH), cleaved from the pro-opiomelanocortin (POMC) precursor molecule, and a peptide encoded by cocaine and amphetamine regulated transcript (CART) (Elias et al, 1998a). NPY/AgRP co-expressing neurons project predominantly to the PVN and the DMN within the hypothalamus, but also to widespread extra-hypothalamic sites, including the bed nucleus of the stria terminalis (BNST), the amygdala, and the VTA (Broberger et al, 1998b). The expression of NPY and AgRP mRNA in the ARC is increased by fasting (Hahn et al, 1998), and the activity of these neurons is directly inhibited by leptin and insulin (Stephens et al, 1995;Sipols et al, 1995) and stimulated by ghrelin (Kohno et al, 2003). Specific destruction of these neurons in adult animals causes severe hypophagia and reduced body weight in rodents, highlighting their physiological importance (Luquet et al, 2005;Bewick et al, 2005). POMC/CART expressing neurons have wider projections to almost all hypothalamic nuclei and numerous extra-hypothalamic sites (Elias et al, 1998a;Elmquist et al, 1999). The activity of these neurons is also regulated by leptin and insulin (Cheung et al, 1997;Kristensen et al, 1998;Schwartz et al, 1997), and their selective ablation causes hyperphagia and obesity (Xu et al, 2005). In addition, a subpopulation of ARC NPY containing neurons co-express GABA and synapse directly onto POMC neurons within the ARC. This means that activation of the orexigenic neurons concurrently inhibits the activity of their anorexigenic counterparts (Cowley et al, 2001). Administration of leptin directly into the ARC inhibits feeding (Satoh et al, 1997) and lesioning of the ARC attenuates the anorectic effect of peripheral leptin administration (Tang- Christensen et al, 1999), suggesting that the ARC is critical in mediating leptin’s effects on energy homeostasis.

1.3.1.1.1.1 THE MELANOCORTIN SYSTEM The melanocortins are peptide products of the POMC polypeptide precursor. POMC is tissue specifically processed by prohormone convertase enzymes to generate the four melanocortins: adrenocorticotrophic hormone (ACTH) and α, β and γ-melanocyte stimulating hormone (MSH) (Bertagna, 1994). POMC mRNA is highly expressed in the anterior pituitary and is detectable in other peripheral tissues (Lacaze-Masmonteil et al, 1987). The majority of melanocortin peptides in the circulation are derived from the anterior pituitary gland (Gibson et al, 1994). In the CNS, POMC mRNA is expressed only in the ARC and the NTS in the brainstem (Smith & Funder, 1988). However, POMC-immunoreactivity (IR) is widespread throughout the brain, demonstrating the range of brain regions innervated by these discrete POMC neuronal populations (Joseph et al, 1985).

There are five cloned melanocortin receptors. All are G protein coupled receptors (GPCR). They differ in their tissue distribution and ligand selectivity. Genetic mutations of the melanocortin 4 receptor (MC4R) result in hyperphagia and obesity in both rodents and humans (Huszar et al, 1997;Yeo et al, 1998;Vaisse et al, 1998). This receptor is thus considered to be one of the most important regulators of energy homeostasis. The MC4R is highly expressed in the hypothalamic PVN, VMN, DMN and LHA, in addition to extra-hypothalamic sites including the VTA and the brainstem (Mountjoy et al, 1994). MC3-R knock-out mice do not have altered body weight but do have increased adipose mass, and the male knockouts show a reduction in locomotor activity (Butler et al, 2000).

Alpha-MSH is a 13 amino acid peptide agonist of both the MC4R and MC3R (Adan et al, 1994). Alpha-MSH inhibits feeding when injected into the 3rd cerebral ventricle (ICV) to food deprived rats (Tsujii & Bray, 1989). Unusually, the MC4R and MC3R also have an endogenous antagonist, agouti related peptide (AgRP) (Fong et al, 1997), a 132 (131 in rodents) amino acid peptide (Shutter et al, 1997;Brown et al, 2001). ICV injection of AgRP increases food intake by blocking the anorectic effect of α-MSH at the MC4R (Rossi et al, 1998). Transgenic mice overexpressing AgRP have a similar phenotype to MC4R knockout mice (Graham et al, 1997;Huszar et al, 1997;Ollmann et al, 1997).

Beta-MSH binds to the MC4R with a comparative affinity as α-MSH (Schioth et al, 2002). Rodents are β-MSH deficient (Bennett, 1986) and therefore there have been fewer studies determining the role of β-MSH in food intake. However, a human loss-of-function mutation of β-MSH is associated with childhood obesity, suggesting a role for β-MSH in human body-weight regulation (Biebermann et al,

2006). Gamma-MSH binds with high affinity to the MC3-R, but only weakly to the MC4-R (Oosterom et al, 1999). Chronic ICV infusion of γ-MSH stimulates food intake in rats, an effect possibly mediated by a suppression of hypothalamic POMC expression (Lee et al, 2008).

1.3.1.1.1.2 NEUROPEPTIDE Y Neuropeptide Y is a 36 amino acid neuropeptide which belongs to the pancreatic polypeptide (PP) fold family of proteins. This family is characterised by the presence of a hair-pin fold motif, a proline helix connected to an α-helix by a β turn, which is necessary for receptor binding (Glover et al, 1984). The PP fold peptides bind to members of the Y receptor family (Blomqvist & Herzog, 1997). NPY is one of the most abundant neuropeptides in the CNS (Allen et al, 1984). In the hypothalamus, NPY is synthesised by cell bodies in the ARC and the DMN, and is released from terminals in the PVN, DMN and LHA (Bai et al, 1985;Chronwall et al, 1985). ICV injection of NPY induces c-fos expression in the ARC, PVN, DMN and LHA of rats (Li et al, 1994;Lambert et al, 1995;Vinuela & Larsen, 2001).

NPY is the most potent orexigenic neuropeptide known (Woods et al, 1998). Injection of NPY into the third cerebral ventricle, and more specifically into the PVN, increases food intake (Clark et al, 1984;Stanley & Leibowitz, 1984). Chronic injection of NPY into the hypothalamus of rats results in hyperphagia and obesity (Stanley et al, 1986;Zarjevski et al, 1993). ARC and PVN NPY-IR is increased in response to fasting, which suggests that NPY plays a physiological role in the regulation of feeding (Sahu et al, 1988). Immunoblockade of hypothalamic NPY attenuates fasting induced re- feeding (Lambert et al, 1993) and blocks nocturnal feeding when administered during the dark phase (Dube et al, 1994b). NPY binds preferentially to the Y1 and Y5 receptors, and administration of a Y1 or Y5 receptor antagonist attenuates nocturnal feeding, fasting-induced re-feeding and NPY induced feeding (Kanatani et al, 1996;Criscione et al, 1998). Hypothalamic NPY expression is directly stimulated by ghrelin (Kamegai et al, 2001) and inhibited by insulin (Sahu et al, 1995;Schwartz et al, 1992) and leptin (Stephens et al, 1995). The hyperphagia seen in models of impaired leptin signalling (ob/ob and db/db mice) is in part due to increased NPY signalling in the hypothalamus (Wilding et al, 1993;Stephens et al, 1995;Chua et al, 1991). However, NPY knockout mice are phenotypically normal in their food intake and body weight, and respond normally to leptin, suggesting compensation by other leptin regulated pathways (Erickson et al, 1996).

1.3.1.1.1.3 COCAINE AND AMPHETAMINE REGULATED TRANSCRIPT CART codes for a neuropeptide widely distributed throughout the CNS and peripheral tissues. Within the hypothalamus, CART is expressed in the ARC, where it co-localises with POMC (Elias et al, 1998a), the PVN, supraoptic nucleus (SON), DMN and the ventromedial nucleus (VMN) (Douglass et al, 1995;Koylu et al, 1998;Kristensen et al, 1998).

ICV injection of the active CART peptide, CART (55-102), reduces both nocturnal feeding and fasting-induced re-feeding in rodents (Lambert et al, 1998;Kristensen et al, 1998). ICV injection of CART antiserum increases nocturnal feeding, and ARC and DMN CART mRNA expression is reduced in response to fasting, suggesting a physiological role for CART peptide in the regulation of feeding (Kristensen et al, 1998;Lambert et al, 1998). CART is regulated by leptin. Leptin deficient ob/ob mice show reduced ARC CART mRNA expression, and peripheral administration of leptin to ob/ob mice stimulates CART mRNA expression (Kristensen et al, 1998).

However, movement associated tremors are also observed following central CART (55-102) injection, raising the possibility that the anorectic effects of CART are secondary to behavioural abnormalities (Kristensen et al, 1998). Interestingly, direct injection of CART into discrete hypothalamic nuclei, including the ARC, VMN, DMN and LHA, stimulates food intake, suggesting CART may play both anorectic and orexigenic roles within the hypothalamus (Abbott et al, 2001).

1.3.1.1.2 THE DORSOMEDIAL NUCLEUS The DMN is situated caudal to the VMN in the plane of the dorsal premamillary nucleus. The majority of inputs to the DMN arise from within the hypothalamus, particularly from the VMN and LHA. However, there are also projections from the telencephalon and brainstem (Thompson & Swanson, 1998). DMN neurons have predominantly intrahypothalamic projections, with the PVN the most densely innervated nucleus (Thompson et al, 1996).

A role for the DMN in feeding control was demonstrated by lesioning studies in rodents: lesioning the DMN resulted in hypophagia and reduced body weight (Bellinger & Bernardis, 2002). Intra-DMN injections of neuropeptides and neurotransmitters known to be involved in appetite regulation, including NPY, galanin and gamma-aminobutyric acid (GABA), all increase acute food intake (Kyrkouli et al, 1990b;Kelly et al, 1979;Stanley et al, 1985).

The DMN expresses NPY mRNA and contains both NPY containing cell bodies and NPY-IR fibres (White & Kershaw, 1990;Bai et al, 1985;Chronwall et al, 1985). DMN NPY mRNA and protein levels are increased in response to chronic food restriction (Lewis et al, 1993;Bi et al, 2003;White & Kershaw, 1990), but DMN mRNA levels are also increased in models of obesity (Kesterson 1997, Guan 1998 Bi 2001). Although leptin receptor mRNA is found in the DMN (Schwartz 1996, Elmquist 1998), it is not co-localised with NPY containing neurons within this nucleus, suggesting that DMN NPY neurons are not directly regulated by leptin (Bi et al, 2003).

1.3.1.1.2.1 CHOLECYSTOKININ (CCK) CCK is one of the most widely distributed neuropeptides in the CNS. CCK-IR and CCK receptors are both abundant in the hypothalamus (Beinfeld et al, 1981;Saito et al, 1980). Hypothalamic CCK concentration is higher in fed rats than fasted rats (McLaughlin et al, 1985), CCK is released from the hypothalamus in response to food intake in monkeys (Schick et al, 1987), and ICV administration of anti-serum against CCK stimulates food intake in rats (Schick, 1986), suggesting a role for central CCK as a physiological regulator of appetite. ICV injection of CCK-8 suppresses food intake in rats and sheep (la Fera, 1979;Schick, 1986). Administration of CCK into several hypothalamic nuclei suppresses food intake in rats, most potently in the DMN (Blevins et al, 2000). It has been suggested that central CCK mediates its effects on food intake via regulation of NPY-containing neuronal populations in the DMN. CCK-1 receptors are found on NPY DMN neurons (Bi et al, 2004) and CCK-1 receptor deficient Otsuka-Long Evans-Tokushima Fatty (OLETF) rats have increased NPY expression in the DMN (Bi et al, 2001). Furthermore, iDMN injection of CCK reduces NPY mRNA expression in the DMN in rats (Bi et al, 2004).

1.3.1.1.3 THE VENTROMEDIAL NUCLEUS

The VMN is located between the lateral wall of the third ventricle and the fornix. The VMN was originally identified as a ‘satiety centre’, as lesions to this area resulted in profound and persistent hyperphagia and the development of obesity in rats (Hetherington A.W. & Ranson S.W., 1940). However, the VMN has not been found to produce any peptides known to be involved in the regulation of food intake (Kalra et al, 1999). It is therefore possible that the effects seen following surgical lesioning are due to a disruption of neuronal fibres passing through the VMN rather than destruction of neurons originating in this nucleus (Sclafani, 1971). However, selective destruction of VMN cell bodies also results in hyperphagia and increased body weight gain (Shimizu et al, 1987b). The VMN receives projections from the ARC, including neurons containing peptides involved in the regulation of food intake (Everitt & Hokfelt, 1989;Kristensen et al, 1998), and VMN neurons in turn project to the DMN and the parvocellular division of the PVN (Bernardis & Bellinger, 1987;Kalra et al, 1999;Moga & Saper, 1994). Despite not producing any known appetite regulating peptides, the VMN expresses receptors for peptides known to regulate food intake, and microinjection of NPY (Stanley et al, 1985) or galanin (Schick et al, 1993) into the VMN stimulates food intake in rats, while administration of leptin into the VMN inhibits feeding in rats (Jacob et al, 1997).

NPY is thought to mediate its orexigenic effect in the VMN via inhibition of VMN neurons, an action mediated by Y1 receptors. Approximately 80% of VMN neurons expressing leptin receptors are sensitive to the inhibitory actions of NPY. These data suggest that NPY inhibits VMN neurons that are excited by leptin, arresting the anorexigenic tone exerted by VMN neurons (Chee et al, 2010).

The VMN is also a key hypothalamic glucose sensing area. Destruction of the VMN leads to a reduction in the counter regulatory response to hypoglycaemia (Borg et al, 1994). VMN glucosensing neurons increase their firing rate in response to peripheral glucose infusion (Silver & Erecinska, 1998) and electrical stimulation of the VMN activates the sympatho-adrenal system in a manner similar to that seen in the counter regulatory response (Stoddard et al, 1986). Glucopenia specifically in the VMN causes the release of counter-regulatory response hormones adrenaline and glucagon (Borg et al, 1995), while conversely, glucose infusion into the VMN suppresses release of these hormones during systemic hypoglycaemia (Borg et al, 1997).

1.3.1.1.4 THE LATERAL HYPOTHALAMIC AREA The LHA forms a band dorsal and lateral to the VMN, extending from the midbrain tegmentum to the lateral preoptic area. The LHA comprises lateral hypothalamic neurons, a major sagittal pathway termed the medial forebrain bundle, and interspersed regions dense with synapses and glial cells (Sipe & Moore, 1977). The medial forebrain bundle is a large, diffuse collection of ascending and descending axons and is thought to be the major conduit of afferent and efferent connections of the LHA (Veening et al, 1982). Neuron density is lower in the LHA compared to other hypothalamic nuclei (Palkovits & Van Cuc, 1980), but neurons in the LHA are some of the largest in the hypothalamus (Bernardis & Bellinger, 1993).

Early studies revealed that lesions to the LHA caused a transient aphagia and profound reduction in body weight in rats leading it to be proposed as the ‘feeding centre’ of the brain (Anand & Brobeck J.R., 1951). In support of this hypothesis, electrical stimulation of this area increased food intake and body weight in rats (Delgado & Anand, 1953). The LHA contains neuronal populations expressing the orexigenic peptides melanin concentrating hormone (MCH) (Skofitsch et al, 1985) and orexins A and B (Sakurai et al, 1998;de Lecea, 1998). A subset of MCH expressing neurons in the LHA co- express CART (Broberger, 1999). Additionally, almost a third of neurons found within the LHA are glucose sensitive and respond to a rise in glucose concentration by decreasing their firing rate (Oomura et al, 1974).

Recent studies have identified a novel role for neurons of the lateral hypothalamus in energy balance. The LHA has abundant and reciprocal connections with critical areas of the limbic system, including the VTA in the midbrain and the NAc in the forebrain (Saper et al, 1979). As such, the LHA has been implicated in linking hypothalamic homeostatic control of feeding with corticolimbic motivation and reward based regulation of feeding (Margules & Olds, 1962). This is thought to be mediated by both orexin (Harris et al, 2005;Aston-Jones et al, 2009) and MCH (Georgescu et al, 2005) neurons, and an additional neuronal population which expresses the leptin receptor but neither orexin or MCH (Leinninger et al, 2009).

1.3.1.1.4.1 OREXINS Orexin A and orexin B are 33 and 28 amino acid neuropeptides respectively, synthesised in cell bodies within the LHA (de Lecea, 1998;Sakurai et al, 1998). Orexin-IR fibres project widely throughout the brain to areas including the cerebral cortex, thalamus, hypothalamus, VTA and brainstem (Elias et al, 1998b;Date et al, 1999). The orexins bind to the orexin receptors OX-R1 and OX-R2; the OX-R1 binds orexin A with greater affinity than orexin B while the OX-R2 binds both orexins with equal affinity (Sakurai et al, 1998). ICV injection of either of the orexins stimulates food intake in rats, an effect thought to be mediated in part by an increase in ARC NPY expression (Lopez et al, 2002), and prepro-orexin mRNA expression is up-regulated in fasted rats (Sakurai et al, 1998). Microinjection of orexin A directly into the LHA increases food intake in rats (Dube et al, 1999). The orexins are also involved in arousal; orexin deficiency in mice and OX-R2 knockout mice both exhibit a phenotype similar to that seen in human narcolepsy (Chemelli et al, 1999;Tokita, 2001), which itself is characterised by a deficiency in orexin production (Peyron et al, 2000;Nishino et al, 2000). More recently, orexins have also been suggested to modulate pleasure/reward pathways in the brain; increased orexin mRNA expression in the LHA correlates with increased intensity of reward seeking in rats (Harris et al, 2005;Aston-Jones et al, 2009).

1.3.1.1.4.2 MELANIN CONCENTRATING HORMONE MCH is a 19 amino acid peptide (Vaughan et al, 1989) produced by neurons of the LHA and the zona incerta. MCH-IR neurons project to other hypothalamic nuclei, and to limbic areas (Bittencourt et al, 1992). ICV injection of MCH stimulates feeding in rats, and MCH mRNA expression is increased with fasting (Qu et al, 1996). Chronic MCH administration results in sustained hyperphagia and the development of obesity (la-Zuana, 2002). Transgenic mice overexpressing MCH have an obese hyperphagic phenotype (Ludwig et al, 2001) and conversely, targeted deletion of MCH results in a hypophagic, lean phenotype in mice (Shimada et al, 1998). MCH binds to the MCH-1R, which is widely distributed throughout the rodent brain, and highly expressed in the VMN and DMN (Marsh et al, 2002). MCH-1R antagonists suppress feeding and reduce body weight, suggesting MCH plays a physiological role in food intake, and are currently being developed as treatments for obesity (Takekawa et al, 2002). A second MCH receptor exists in humans (MCH-2R), although its function remains relatively obscure since it is absent in rodents (Tan et al, 2002).

1.3.1.1.5 THE PARAVENTRICULAR NUCLEUS The PVN is situated on either side of the top of the third ventricle and is thought to play an important role in the control of appetite, and in neuroendocrine and autonomic function. The structure of the PVN can be compartmentalised into two cytologically distinct groups. Magnocellular neurons containing oxytocin and vasopressin (AVP) project along the infundibular stalk to the neural or posterior lobe of the pituitary from which these hormones are released into the general circulation (Hatton et al, 1976). Parvocellular neurons project to other regions of the PVN, to other hypothalamic and CNS regions and to the median eminence, which lies adjacent to the hypophyseal portal vessels. Parvocellular neurons contain numerous neuropeptides, including those that act as hypothalamic releasing factors, such as thyrotrophin releasing hormone (TRH) and corticotrophin releasing hormone (CRH) (Ishikawa et al, 1988;Antoni, 1986).

Parvocellular PVN (pPVN) neurons express several neuropeptides known to effect appetite (Hokfelt 1990). Destruction of the PVN results in hyperphagia and weight gain (Weingarten et al, 1985). The importance of the PVN in food intake is illustrated by the stimulation of feeding elicited by microinjection of most known orexigenic peptides into the PVN, for example NPY (Stanley & Leibowitz, 1985), AgRP (Kim et al, 2000a), galanin (Kyrkouli et al, 1986), galanin-like peptide (GALP) (Patterson et al, 2006b) and opioids (Grandison & Guidotti, 1977). In addition, microinjection of anorectic signals such as αMSH, CRH and glucagons-like peptide 1 (GLP-1) into the PVN reduces fasting induced re-feeding (Kim et al, 2000a;Krahn et al, 1988;McMahon & Wellman, 1998). Receptors for most known appetite regulating peptides can be detected in the PVN (Mountjoy et al, 1994;Roselli-Rehfuss et al, 1993;Marcus et al, 2001;Kishi et al, 2005;Mitchell et al, 1997).

The PVN receives projections from both NPY/AgRP and POMC/CART expressing ARC neurons and peripheral administration of leptin induces c-fos expression in the PVN of mice (Woods & Stock, 1996), suggesting that the PVN plays an important role in mediating the effects of peripheral signals on energy homeostasis. The PVN also receives neuronal input from the brainstem via ascending fibres (Horst et al, 1989). Major projections relay vagus-mediated signals from the gastrointestinal (GI) tract and humoral signals to the PVN from the NTS in the brainstem (Schwartz et al, 2000).

1.3.1.1.5.1 CORTICOTROPHIN RELEASING HORMONE The role of CRH in energy homeostasis is complex and likely involves multiple neuronal circuits. Early studies noticed that adrenalectomy, which promotes the synthesis and release of hypothalamic CRH, prevents, attenuates or reverses obesity in models including the ob/ob mouse (Solomon & Mayer, 1973) and the fa/fa rat (Bray et al, 1991), although it does not reduce body weight in diet- induced obese (DIO) mice (Makimura et al, 2003).

The pPVN neurons are the main source of CRH in the brain. ICV and iPVN CRH injection reduces nocturnal and fasting-induced re-feeding (Krahn et al, 1988;Morley & Levine, 1982). However, it is likely that CRH mediates its anorectic effects via other hypothalamic nuclei, since PVN lesions do not prevent CRH induced anorexia (Rivest & Richard, 1990). CRH expression within the PVN is reduced in food deprived rats, indicating it may be a physiological regulator of appetite (Brady et al, 1990).

It is proposed that CRH suppresses feeding via the CRH-R2 receptor. CRH-R2 down-regulation attenuates CRH induced anorexia (Smagin et al, 1998) and CRH-R2 mRNA expression is reduced in food deprived rats (Timofeeva, 1997) and increased by ICV leptin injection (Schwartz et al, 1996b). However, CRH-R2 knockout mice have similar food intake and body weight to wild-type littermates, and only a small reduction in fasting-induced re-feeding has been reported (Bale et al, 2000).

1.3.1.1.5.2 GLUCAGON-LIKE PEPTIDE-1 GLP-1 is generated by processing of the proglucagon precursor protein in intestinal L cells, and is part of the glucagon family of peptides (Shimizu et al, 1987a;Fehmann et al, 1995). GLP-1 mRNA is also synthesised in brainstem neurons which project to the hypothalamus (Kreymann et al, 1989;Larsen et al, 1997). The GLP-1 receptor (GLP-1R) is found within the hypothalamus (Shughrue et al, 1996), and its localisation correlates with GLP-1 binding sites in the ARC and PVN (Kanse et al, 1988). Extensive GLP-1-IR fibres originating from the NTS in the brainstem terminate in the PVN, and ICV GLP-1 injection induces c-fos expression in the PVN, suggesting this may be the site of central GLP-1 action (Larsen et al, 1997;Turton et al, 1996).

ICV, and more specifically, iPVN, injection of GLP-1 inhibits fasting-induced re-feeding. This effect can be blocked by concurrent administration of the GLP-1R antagonist exendin9-39 (Turton et al,

1996;McMahon & Wellman, 1998). Chronic central administration of exendin9-39 increases food intake and body weight gain in rats, suggesting that GLP-1 plays a physiological role in energy homeostasis (Meeran et al, 1999).

1.3.1.1.6 TUBEROMAMMILLARY NUCLEUS

The TMN is a cluster of magnocellular neurons located dorsolaterally to the ARC, in the posterior hypothalamus. The TMN lies either side of the mammillary recess and extends dorsally along the tip of the third ventricle between the dorsal premammillary nucleus and the DMN; and ventrally, just rostral to the medial mammillary body (Schwartz et al, 1991).

Afferent projections to the TMN are widespread, arising from many different areas, including the infralimbic cortex, lateral septum, preoptic nucleus and the brainstem (Ericson, 1991;Ericson et al, 1989). The TMN is the site of synthesis of all histamine in the brain, and the origin of widely distributed histaminergic projections (Panula et al, 1984;Watanabe, 1984). The histaminergic TMN system regulates general states of metabolism and consciousness, including hibernation and the sedative component of anaesthesia (Haas & Panula, 2003).

In addition to histamine, TMN neurons contain several other neurotransmitters and modulators. The GABA synthesizing enzyme, glutamic acid decarboxylase (GAD), and GABA itself are found in most TMN neurons (Ericson et al, 1991;Airaksinen et al, 1992). The neuropeptides galanin, TRH, proenkephalin-derived peptides and substance P are also found in various populations of histamine- producing TMN neurons (Airaksinen et al, 1992;Staines et al, 1986).

There is evidence to suggest a link between the histaminergic system and energy homeostasis. Leptin- induced suppression of feeding is partially attenuated in mice that lack the histamine H1 receptor

(Masaki et al, 2001), implying that the histaminergic system and H1 receptors are important in the central regulation of feeding.

1.3.2 BRAINSTEM REGULATION OF ENERGY HOMEOSTASIS The brainstem plays an important role in the regulation of energy balance. The afferent vagus nerve transduces and transports meal related signals from the gut to nerve terminals in the NTS in the caudal brainstem. Vagal afferents are stimulated by signals including gut distension, pH, osmolarity and gut hormone signalling (McCann & Rogers, 1992). The NTS is also in close proximity to the AP, a circumventricular region of the brain which allows the brainstem to detect circulating signals. The NTS receives and integrates inputs related to food-intake from a number of peripheral systems, and it has been proposed that the brainstem plays a primary role in controlling meal initiation and termination (short term feeding effects), while the hypothalamus responds to changes in metabolic state and regulates longer term energy balance (Schwartz, 2006).

The brainstem has numerous reciprocal connections with forebrain regions, especially the hypothalamus (Horst et al, 1989). Many gut hormones, including CCK and peptide YY3-36 (PYY3-36), are proposed to signal to the CNS at least in part via the vagus nerve and the brainstem.

Leptin receptors (ObR) are detected throughout the dorsal vagal complex (DVC), which includes the NTS, AP, and dorsal motor nucleus, in the caudal brainstem (Grill et al, 2002;Mercer et al, 1998;Elmquist et al, 1998) and 4th ventricle administration of leptin reduces food intake and body weight to a similar extent as hypothalamic leptin administration (Grill et al, 2002). Unlike in the hypothalamus, where ObRb mRNA levels are increased in leptin deficient ob/ob mice (Mercer et al, 1997), the levels of ObRb mRNA in the hindbrain are similar in lean and ob/ob mice (Mercer et al, 1998). This discrepancy suggests that hypothalamic leptin signalling may be more important in the regulation of energy homeostasis than hindbrain leptin signalling. The brainstem also expresses melanocortin receptors, and DVC administration of the MC3/4R agonist MTII suppresses feeding, while iDVC administration of the MC3/4R antagonist SHU-9119 increased food intake in rats (Williams et al, 2000).

The brainstem also contains glucose sensitive neurons that appear to be a critical in mediating the sympatho-adrenal and ingestive responses to glucopenia (Ritter et al, 1981;Dallaporta et al, 2000).

1.3.3 PERIPHERAL REGULATORS OF ENERGY HOMEOSTASIS

1.3.3.1 LEPTIN Leptin is the 16kDa protein product of the ob gene, secreted into the circulation from adipocytes (Zhang et al, 1994) in direct proportion to adipose tissue mass in rodents and humans (Considine et al, 1996). Administration of leptin peripherally or centrally reduces food intake and body weight and increases thermogenesis in ob/ob mice (Halaas et al, 1995). Leptin is also present in the cerebrospinal fluid (CSF) of humans where it correlates with body mass index (BMI), suggesting that the rate of leptin uptake into the CNS is also proportional to body adiposity. The efficiency of uptake is reduced with higher leptin levels, suggesting a saturable transport mechanism across the BBB (Schwartz et al, 1996a).

Rare abnormalities of leptin production or mutations in leptin receptor genes have been observed in humans, and result in early onset, morbid obesity (Montague et al, 1997;Clement et al, 1998). Peripheral administration of leptin to humans with congenital leptin deficiency reduces food intake and body weight (Farooqi et al, 1999).

The leptin receptor gene (db or ObR) encodes a single transmembrane receptor belonging to the interleukin-6 family of class I cytokine receptors (Tartaglia et al, 1995). ObR has multiple splice variants with differing C-terminal sections. Only the ObRb splice variant is capable of activating intracellular signalling pathways. Non-functioning splice variants have only short intracellular domains, but the ObRb has a large extracellular domain and intracellular domain. In most tissues, ObRb mRNA is expressed at low levels compared to the short isoforms. However, in the hypothalamus, ObRb is more abundant, particularly in nuclei associated with the regulation of energy homeostasis: the ARC, PVN, VMN and DMN (Schwartz et al, 1996b;Baskin et al, 1999b;Cheung et al, 1997;Elmquist et al, 1998). The ObRb is co-localised throughout the hypothalamus with appetite- regulating neuropeptides (Baskin et al, 1999a). It is thought that leptin mediates its effects on energy homeostasis by regulating the action of hypothalamic neuropeptide systems to limit energy intake and increase energy expenditure (Friedman & Halaas, 1998).

As fat mass increases, plasma leptin levels rise, resulting in increased leptin receptor signalling in the hypothalamus. Leptin receptor activation reduces the activity of orexigenic pathways, including ARC NPY/AgRP neurons, and increases the activity of anorexigenic pathways, including ARC POMC/CART neurons (Cowley et al, 2001). Obese animals and humans have high levels of leptin. This suggests that obese individuals suffer from leptin resistance (Frederich et al, 1995a;Caro &

Kolaczynski, 1996). Administration of exogenous leptin to obese rodents and humans has only a minor effect on energy homeostasis (Halaas et al, 1997;Heymsfield et al, 1999). Such resistance may be due to impaired transport of leptin across the BBB, defective receptor signalling or impaired downstream signalling (Myers, Jr. et al, 2008).

Starvation results in reduced circulating leptin levels in rodents and humans (Frederich et al, 1995b;Kolaczynski et al, 1996). Lack of leptin signalling has profound effects causing a suppression of the growth, thyroid and gonadal axes and immune function (Lord et al, 1998) and a stimulation of the stress axis. These effects are all seen in ob/ob and db/db mice which are models of impaired leptin signalling. Administration of exogenous leptin to these animals corrects these abnormalities to varying extents (Lord et al, 1998).

These studies suggest that leptin is a critical component of the afferent signalling pathway communicating body adiposity and thus, nutritional status from the periphery to CNS structures to regulate energy homeostasis.

1.3.3.2 INSULIN Insulin is a 51 amino acid peptide hormone essential in the regulation of carbohydrate and fat metabolism. The major source of circulating insulin is the pancreatic β cell, where insulin is synthesised from the pro-insulin precursor. Circulating insulin levels positively correlate with body adiposity (Polonsky et al, 1988) suggesting that insulin, like leptin, may act as a signal of adiposity. Like leptin resistance, insulin resistance is associated with diabetes and obesity (Reaven, 1995;Colditz et al, 1990). Insulin is secreted acutely in response to an increase in blood glucose e.g. after a meal (Polonsky et al, 1988). Insulin has extensive and well-characterised effects on metabolism; it primarily stimulates glucose uptake from the blood by peripheral tissues, including the liver and muscle, and inhibits the breakdown of fat stores (Fain et al, 1966;Saltiel & Kahn, 2001). The insulin receptor is a tyrosine kinase receptor, widely distributed in the brain, with highest concentrations found in the olfactory bulb, cerebellum, dentate gyrus, piriform cortex, hippocampus, choroid plexus and the ARC of the hypothalamus (Marks et al, 1990).

Peripheral insulin can cross the BBB to enter the CNS via a saturable receptor mediated system (Baura et al, 1993). Little or no insulin is synthesised in the CNS (Woods et al, 2003). ICV administration of insulin reduces food intake in rats and baboons (Woods et al, 1979;McGowan et al, 1993;Air et al, 2002). The mechanism by which insulin regulates energy homeostasis is thought to involve neurons of the ARC. Both POMC and NPY containing neurons in the ARC express the insulin receptor (Benoit et al, 2002;Marks et al, 1992b). ICV administration of insulin to fasted rats blocks the fasting-induced increases in NPY mRNA in the ARC and NPY-IR in the PVN (Schwartz et al, 1992). ICV administration of insulin also induces ARC POMC mRNA expression, and administration of a melanocortin antagonist is able to attenuate the ICV insulin-induced anorexia (Benoit et al, 2002). These studies suggest that insulin can affect the regulation of energy homeostasis through a mechanism involving both the NPY and melanocortin systems.

Chronic central administration of anti-insulin antibodies increases food intake and body weight (McGowan et al, 1992), and mice with a brain-specific insulin receptor deficiency are obese (Bruning et al, 2000), suggesting that insulin acts as a physiological satiety signal in the brain.

1.3.3.3 GUT HORMONES The gut is the largest endocrine organ in the body (Ahlman & Nilsson, 2001). Gut derived peptides facilitate gut growth and development, regulate gut secretions and motility, and signal to the brain regarding the presence and absorptive status of nutrients (Glass, 1980). These gut hormones form a gut-brain axis which ensures effective regulation of nutrient intake, mediated via control of appetite, satiety and digestive and absorptive ability.

1.3.3.3.1 GHRELIN Ghrelin is a 28 amino acid peptide. It was first identified by Kojima et al as an endogenous ligand for the growth hormone secretagogue receptor 1a (GHS-R) (Kojima et al, 1999). Ghrelin exists in the circulation in two major forms: acylated at the serine residue at position three, and des-acylated. Des- acylated ghrelin lacks affinity for the GHS-R (Kojima et al, 1999). Ghrelin is primarily secreted by endocrine cells in the stomach (Date et al, 2000) and is the only known circulating factor to increase appetite.

Circulating ghrelin levels are increased by fasting and fall following food intake in both rats and humans (Tschop et al, 2000;Cummings et al, 2001). Peripheral administration of ghrelin acutely stimulates food intake in both rats and humans (Wren et al, 2000;Wren et al, 2001a), and chronic administration causes weight gain in rats and in malnourished humans (Wren et al, 2001b;Ashby et al, 2009). Ghrelin is thought to mediate its orexigenic actions via GHS-R mediated activation of NPY/AgRP expressing neurons in the ARC (Nakazato et al, 2001). However, there is also evidence that ghrelin mediates its orexigenic effects via the vagus nerve (Date et al, 2002).

GHS-R and ghrelin knockout mice have complex energy homeostasis-related phenotypes. Some, but not all, models of disrupted ghrelin signalling show resistance to diet induced obesity when maintained on a high fat diet (Wortley et al, 2005;Sun et al, 2008;Zigman et al, 2005).

1.3.3.3.2 CHOLECYSTOKININ (CCK) CCK was the first gut hormone implicated in the regulation of food intake (Gibbs et al, 1973). CCK exists in numerous forms with varying numbers of amino acids from CCK-4 to CCK-58, depending on post-translational modification of the CCK gene product, preprocholecystokinin. CCK-8 is the most extensively characterised form in the regulation of energy homeostasis. CCK is released from the I cells of the small intestine following food intake, and specifically by fat and protein intake (Liddle et al, 1985). In addition to its effects on satiety, CCK-8 also inhibits gastric emptying, stimulates pancreatic enzyme secretion and gall bladder contraction, all of which contribute to the efficient digestion of fats and protein. Peripheral administration of CCK-8 to both rodents and humans reduces food intake (Gibbs et al, 1973;Kissileff et al, 1981).

Two CCK receptors have been characterised: CCK-1R and CCK-2R (Wank et al, 1992;Kopin et al, 1994). The anorectic effects of CCK are thought to be mediated via the CCK-1R as they are abolished in CCK-1R knockout mice and unaffected in CCK-2R knockout mice (Kopin et al, 1999). In addition, CCK-1R antagonists stimulate food intake in rats and humans (Reidelberger & O'Rourke, 1989;Beglinger et al, 2001). CCK-1R knockout mice have unaltered food intake and body weight compared to wild type controls (Kopin et al, 1999), however OLETF rats, which lack the CCK-1R are hyperphagic and obese (Funakoshi et al, 1995). This discrepancy in phenotypes between OLETF rats and the CCK-1R knockout mice may be explained by species differences in the CCK system such as tissue distribution of receptors. It is also possible that the obesity observed in the OLETF strain may be the result of additional, as yet undefined, genetic alterations in these rats.

CCK-1 receptors are found on the vagus nerve and it is likely that the effects of CCK on satiety are mediated via the vagus nerve and the brainstem (Moran et al, 1990). Peripheral CCK administration induces expression of c-fos in the brainstem (Zittel et al, 1999). Lesioning of the vagus nerve abolishes the suppressive effect of CCK on feeding in rats (Smith et al, 1981). Importantly, the satiating effect of exogenous CCK administration is present in decerebrate rats where the neural connections between the brainstem and the forebrain have been lesioned, suggesting that the brainstem is able to mediate alterations in food intake without interaction with the hypothalamus or other forebrain areas (Grill & Smith, 1988).

1.3.3.3.3 PEPTIDE YY PYY is a member of the PP fold peptide family, which also includes pancreatic polypeptide (PP) and NPY. This family is characterised by a common tertiary structure (Glover et al, 1984). PYY exists in two forms, PYY1-36 and PYY3-36, following cleavage of the first two amino acids by the enzyme dipeptidyl peptidase-IV (DPP-IV) (Grandt, 1993). PP-fold peptide family members bind with differing affinities to the 5 identified Y receptors (Blomqvist & Herzog, 1997). PYY1-36 binds to Y1R,

Y2R and Y5R, and PYY3-36 preferentially binds to the Y2R (Dumont et al, 1995).

PYY is released from enteroendocrine cells of the gastrointestinal (GI) tract. PYY-IR is found in increasing concentrations distally throughout the GI tract, with highest levels detected in the rectum (Adrian et al, 1985). PYY is released post prandially in proportion to caloric load, and levels are reduced during fasting, suggesting that PYY may be a physiological circulating satiety signal (Adrian et al, 1985). In support of this role, peripheral administration of PYY3-36 to both rodents and humans reduces food intake (Batterham et al, 2002;Batterham et al, 2003a). PYY3-36 is thought to mediate its effects on feeding via the Y2R, as its anorectic effects are attenuated by iARC Y2R antagonist administration in rats (Abbott et al, 2005b) and abolished in Y2R knockout mice (Batterham et al, 2002).

The Y2R is expressed on vagal afferents and in the brainstem, and vagotomy blocks the satiating effect of peripheral PYY3-36 administration (Koda et al, 2005;Abbott et al, 2005a). Midbrain transections also blocked PYY3-36-induced anorexia, indicating that signalling from the hindbrain to the hypothalamus is critical for PYY3-36 induced satiety (Koda et al, 2005).

1.3.3.3.4 PANCREATIC POLYPEPTIDE (PP) PP is another member of the PP-fold peptide family and is synthesised and released by F cells in the endocrine pancreas (Adrian et al, 1977). PP binds with the highest affinity to the Y4R and Y5R. Like PYY, PP is released post-prandially (Adrian et al, 1977) and peripheral administration of PP reduces food intake in both mice and humans (Asakawa et al, 1999;Batterham et al, 2003b). PP overexpressing mice have reduced food intake and fat mass but also exhibit delayed gastric emptying (Ueno et al, 1999). The Y4R is expressed in the NTS, suggesting that the anorectic effect of PP may be mediated via the brainstem (Larsen & Kristensen, 1997). It is also possible that PP mediates some of its effects on feeding via the vagus nerve, as PP does not reduce food intake in vagotomised rats (Asakawa et al, 2003). It has been suggested that PP reduces food intake by delaying gastric emptying, rather than directly acting as a satiety signal in the CNS. However, reports from human

studies suggest that PP can inhibit food intake at doses that do not effect gastric emptying (Adrian et al, 1981;Schmidt et al, 2005).

1.3.3.3.5 PREPROGLUCAGON PRODUCTS IN THE GI TRACT

The preproglucagon gene codes for a protein which, in the gastrointestinal tract, is processed into the peptides GLP-1, oxyntomodulin, GLP-2 and glicentin (Holst, 2007). GLP-1 is synthesised in, and released from, L cells within the small intestine. GLP-1 is released in response to the presence of macronutrients in the lumen of the gut (Orskov et al, 1994). GLP-1 is the most potent endogenous incretin, stimulating insulin synthesis and secretion (Kreymann et al, 1987), inhibiting glucagon secretion (Naslund et al, 1999) and enhancing β-cell survival (Edvell, 1999). Peripheral GLP-1 administration inhibits food intake in rodents and humans (Abbott et al, 2005a;Flint et al, 2001). The exact mechanism by which peripheral GLP-1 mediates its effects on satiety is unclear. However it is thought that it acts via pathways involving the brainstem and the hypothalamus since both these areas express c-fos following intraperitoneal (IP) GLP-1 injection (Baggio et al, 2004a). The vagus nerve may play a role, as the anorectic effect of GLP-1 is blocked in vagotomised rats (Abbott et al, 2005a).

Oxyntomodulin is also released post-prandially in proportion to calories ingested (Le Quellec et al, 1992), and has known incretin effects as well as reducing gastric motility (Schjoldager et al, 1988). Peripheral administration of oxyntomodulin acutely reduces food intake, and chronically results in a sustained reduction in calorie intake and weight loss in both rats and humans (Dakin et al, 2004;Wynne et al, 2005;Cohen et al, 2003).

No specific oxyntomodulin receptor has been identified. Oxyntomodulin does bind to the GLP-1R, though with a much lower affinity than GLP-1 (Fehmann et al, 1994). The anorectic effects of oxyntomodulin are lost in GLP-1R knockout mice and are also inhibited by co-administration of the

GLP-1 receptor antagonist exendin9-39 (Dakin et al, 2001;Baggio et al, 2004b). However, other studies have suggested a novel receptor mediates the effect of oxyntomodulin on feeding (Baggio et al, 2004b;Chaudhri et al, 2006). The GLP-1R knockout mouse has normal food intake and body weight (Scrocchi et al, 1994), suggesting that GLP-1 signalling does not play a physiological role in energy homeostasis, or that there is developmental compensation sufficient to overcome this deficit.

1.3.4 NON-HOMEOSTATIC REGULATION OF FEEDING Non-homeostatic or hedonic regulation of feeding is an important component of appetite regulation (Finlayson et al, 2007). There are links between homeostatic and hedonic regulation. In energy negative states, the hedonic response to energy providing foods is enhanced, and in energy positive states, the hedonic effect of these foods is reduced (Cabanac, 1989). However, the concept of reward as a consequence of meeting nutritional demands is insufficient to explain the lack of compensation seen with over or under consumption. It has been proposed that in our obesogenic society, the hedonic drive to eat overrides the homeostatic regulation of appetite (Berthoud, 2002). Many studies have focussed on distinct neuromediators and separate neural circuits for homeostatic and hedonic systems. However, anatomically there are abundant and reciprocal connections between hypothalamic nuclei and regions involved in reward circuitry such as the VTA and the NAc. A growing body of evidence suggests that these two systems interact, and several signalling molecules have been shown to regulate both homeostatic and hedonic neural pathways (Abizaid et al, 2006;Fulton et al, 2006;Hommel et al, 2006).

1.3.4.1 THE MESOLIMBIC DOPAMINERGIC PATHWAY The mesolimbic pathway is one of the dopaminergic pathways originating in the VTA in the midbrain and projects to limbic structures in the forebrain, including the NAc, amygdala, hippocampus and medial prefrontal cortex. This pathway modulates behavioural responses to rewarding stimuli and motivation to work for rewards through the neurotransmitter dopamine (DA) (Koob, 1996). The VTA receives inputs from abundant and diverse brain regions, including hypothalamic nuclei (LHA and VMN), forebrain and hindbrain structures (Geisler & Zahm, 2005). These inputs regulate the activity of both dopaminergic neurons and a smaller population of GABA synthesising neurons within the VTA. GABAergic neurons are primarily implicated in the local inhibitory control of VTA DA neuron activity. Under normal conditions, VTA DA neurons fire in a slow and irregular manner, resulting in a tonic release of DA in the NAc (Bunney et al, 1973). When they are excited in response to environmental stimuli such as administration of drugs of abuse like cocaine, opiates or amphetamines, they fire bursts of action potentials which increase DA release in the NAc (Overton & Clark, 1997). This DA release mediates the rewarding and psychomotor effects of drugs of abuse. Food and water, or even cues related to them such as smell and sight of food also promote rapid firing by DA neurons and this is manifested in behaviours directed towards attaining food (Bassareo & Di Chiara, 1999;Schultz, 2006). Drug addiction is a result of permanent functional changes in the mesolimbic DA system originating from repetitive DA stimulation (Pierce & Kumaresan, 2006). It is possible that chronic overindulgence of food may also functionally alter the reward circuitry (Berridge et al, ).

FIGURE 1.2 Human (left) and rat (right) brains, showing the mesolimbic and mesocortical dopamine (DA) pathways, which originate in the ventral tegmental area (VTA) and send ascending projections to the nucleus accumbens (NAc) and prefrontal cortex (PFC), respectively. There is also a reciprocal connection between the VTA and the tegmental pedunculopontine nucleus (TPP), a brain region that is involved in non-DA-mediated reward signalling. Taken from (Laviolette & van der Kooy, 2004).

1.3.4.1.1 DOPAMINE AND FOOD INTAKE Dopamine has long been implicated in the regulation of energy homeostasis. DA release appears to have site-specific actions on appetite. In hypothalamic nuclei, including the perifornical area, DA inhibits feeding via suppression of hypothalamic NPY and stimulation of ARC POMC expression (Tong & Pelletier, 1992;Gillard et al, 1993). In the NAc, DA release is associated with the reinforcing effects of food (Bassareo & Di Chiara, 1997). Global DA deficiency in rodents markedly suppresses food intake and body weight (Ungerstedt, 1971;Szczypka et al, 1999;Zigmond & Stricker, 1972;Zhou & Palmiter, 1995).

There are five subtypes of DA receptors organised into D1-like (D1, D5) and D2-like (D2, D3 and D4) classes. Both classes of DA receptors are GPCRs and both are thought to play a role in the regulation of feeding behaviour (Terry et al, 1995). However, the D2 receptor has been most heavily implicated in appetite regulation (Johnson & Kenny, 2010). IP administration of a D2 receptor agonist reduces body weight in rats and humans, due to increased energy expenditure mediated via actions at the hypothalamus. Conversely, IP administration of the D2 receptor antagonist, sulpiride increases food intake and body weight in rats and humans (Baptista et al, 1987;Doknic et al, 2002). Interestingly, human genetic studies have shown a higher prevalence for the Taq I A allele, which is linked with lower levels of D2 receptors in obese individuals (Spitz et al, 2000).

1.4 THE NEUROENDOCRINE AXES

1.4.1 HYPOTHALAMIC RELEASING FACTORS Numerous parvocellular neurons of the PVN project to the external median eminence where they comprise a large proportion of the neuronal input to this region (Wiegand, 1980). These neurons contain many different neuropeptides, including the hypothalamic releasing factors CRH, TRH and somatostatin (Lennard et al, 1993;Fliers et al, 1994;Alonso et al, 1992;Merchenthaler & Liposits, 1994). Galanin, DA and vasoactive intestinal peptide (VIP) are also expressed within these neurons (Ceccatelli et al, 1989).

Hypothalamic releasing factors are also expressed in the ARC (Wiegand, 1980). Growth hormone releasing hormone (GHRH)-containing cell bodies are located in the lateral ARC (Bloch et al, 1983), and a few of the somatostatin releasing nerve terminals in the median eminence originate in the dorsal ARC (Makara et al, 1983). DA containing neurons also project from the ARC to the median eminence (Ajika & Hokfelt, 1973).

There is also a neuronal population that originates in the medial septal diagonal band (MSDB) and the adjacent medial preoptic area (mPOA), which projects to the external median eminence. These neurons express and release gonadotrophin releasing hormone (GnRH) (Silverman et al, 1987).

1.4.2 THE MEDIAN EMINENCE Anatomically, the median eminence lies immediately below the third cerebral ventricle, posterior to the optic chiasm and rostral to the neural stalk connecting the hypothalamus to the posterior pituitary gland (Gray H, 1980). The median eminence comprises two zones, an internal and an external zone. The internal zone contains the axons of magnocellular neurosecretory neurons originating from the hypothalamic PVN and SON and terminating in the posterior pituitary. The external zone contains nerve terminals of neuroendocrine neurons and the blood vessels of the hypophyseal-pituitary portal system. The nerve terminals are of fibres projecting from the PVN, ARC, periventricular area and the POA as described above. They are in close contact with the portal network, allowing transportation of hypothalamic releasing factors to the anterior pituitary gland (Knigge & Scott, 1970).

1.4.3 THE PITUITARY GLAND The pituitary gland (hypophysis) is situated directly below the hypothalamus and lies in the hypophyseal fossa of the sphenoid bone. It is continuous with the apex of the infundibulum (Gray H, 1980). The pituitary gland is divided into two distinct lobes: the anterior pituitary (adenohypophysis) and the posterior pituitary (neurohypophysis). In rats, a third intermediate region is found between these two lobes (Kurosumi et al, 1961).

1.4.3.1 THE POSTERIOR PITUITARY The posterior pituitary is composed of glial cells and the axonal terminals of magnocellular neurons originating from cell bodies in the SON and PVN. These glial cells, also known as pituicytes, have extensive filamentous processes that surround the nerve terminals and maintain the electrolyte composition of the extracellular fluid. Hormones are synthesised within hypothalamic nuclei and transported along the nerve fibres which make up the neurosecretory hypothalamo-hypophyseal tract to the posterior pituitary from where they are released into the general circulation. These hormones include oxytocin and AVP (Dierickx & Vandesande, 1979). Oxytocin promotes contraction of uterine and mammary muscle while AVP controls water reabsorption by the kidney (Swaab et al, 1975;Nielsen et al, 1995;Dale, 1906)

1.4.3.2 THE ANTERIOR PITUITARY The anterior pituitary is divided into the pars distalis and the pars tuberalis, which extends dorsally from the pars distalis and surrounds the infundibular stalk. The anterior pituitary is a highly vascularised structure supplied by the superior hypophyseal artery. It also receives venous blood from the hypophyseal portal system which drains into the sinusoidal vessels of the anterior pituitary (Gray H, 1980).

The pars distalis is comprised of epithelial cells which can be classified either histologically, or by the hormone they synthesise and release into the periphery. Histological classification divides these cells into acidophils, which stain with acid dyes, basophils, which stain with basic dyes, and chromophobes which manifest only pale staining. Classification of these cells by hormone production divides them into somatotrophs, which synthesise growth hormone (GH), thyrotrophs which synthesise thyroid- stimulating hormone (TSH), lactotrophs which synthesise prolactin (PRL), corticotrophs which synthesise adrenocorticotropic hormone (ACTH) and gonadotrophs which synthesise luteinising hormone (LH) and follicle-stimulating hormone (FSH). Anterior pituitary hormones are stored in secretory vesicles, and are released by calcium-dependent exocytosis following an increase in intracellular calcium. The distinct hormone-producing cell types are not distributed heterogeneously throughout the anterior pituitary. Somatotrophs make up approximately half of all the hormone secreting cells and are distributed laterally. Thyrotrophs are also concentrated laterally and these make up a tenth of epithelial cells. Corticotrophs are found more medially and comprise 15-20% of hormone producing cells. Lactotrophs and gonadotrophs are both randomly distributed and make up 25 and 10% of hormone-producing cells respectively (Nussey & Whitehead, 2001).

The main function of the anterior pituitary is the regulation of peripheral endocrine organ function through the secretion of circulating hormones. The secretion of these hormones is mediated by CNS inputs, predominantly those from the hypothalamus, and peripheral inputs from target endocrine organs(Nussey & Whitehead, 2001).

1.4.3.2.1 THE GROWTH HORMONE AXIS

1.4.3.2.1.1 HYPOTHALAMIC CONTROL OF THE GH AXIS GHRH is a 44 (43 in rats) amino acid peptide primarily synthesised in the ARC, and released by nerve terminals at the median eminence into the hypophyseal portal circulation. It is transported to the anterior pituitary gland where it binds to the GHRH receptor on somatotrophs, acting to maintain somatotroph structure and stimulate GH secretion. Ligand binding to the GHRH receptor results in a change in intracellular voltage and an increase in intracellular calcium which stimulates vesicle fusion and GH release. The GHRH receptor is primarily expressed in the anterior pituitary, but GHRH mRNA has also been detected in the ARC, VMN, PVN and suprachiasmatic nucleus (SCN) of the hypothalamus (Takahashi et al, 1995), in the brainstem and cerebral cortex, and in peripheral tissues including the kidney (Yokote et al, 1998).

GHRH also stimulates food intake, alters locomotor activity and has a role in the regulation of circadian rhythm in the SCN (Vaccarino et al, 1985;Nistic, 1987). GHRH release from the median eminence is pulsatile and is inhibited by GHRH itself in a short negative feedback loop, and by somatostatin (Bertherat et al, 1992). There is also evidence to suggest that GH itself participates in the regulation of its own secretion through feedback at the hypothalamus. Hypothalamic somatostatin neurons express the GH receptor; however, few ARC GHRH neurons express the GH receptor (Burton, 1992). NPY neurons in the ARC express the GH receptor and are also thought to play a physiological role in the feedback of regulation of GH secretion (Minami et al, 1999;Chan et al,

1996a). Somatostatin and GHRH are secreted alternately, driving the pulsatile secretion of GH.

Somatostatin has two active forms: a 14 and a 28 amino acid molecule. Somatostatin is released from neurosecretory nerve terminals of axons originating in the periventricular nucleus of the hypothalamus, and is transported in the hypophyseal portal circulation to the anterior pituitary where it inhibits GH secretion from somatotrophs and TSH release from thyrotrophs (Makara et al, 1983;Merchenthaler et al, 1989). Somatostatin release is stimulated by increased levels of circulating GH levels.

Somatostatin containing neurons are present in the ARC, the hippocampus and the NTS. Somatostatin is also involved in central regulation of motor activity, arousal, cognition and behaviour, and in the periphery suppresses the release of several gut hormones from the GI tract. There are five identified somatostatin receptors and all are GPCRs. The distribution of these receptors overlaps in the anterior pituitary, brain, pancreas and GI tract (Strowski & Blake, 2008;Miller et al, 1995).

1.4.3.2.1.2 PITUITARY CONTROL OF THE GROWTH HORMONE AXIS

GH is a 191 amino acid polypeptide (Niall, 1971) essential for growth and general cell reproduction and regeneration. GH is an anabolic hormone which stimulates increased protein synthesis, promotes lipolysis and gluconeogenesis and increases bone mineralisation (Davidson, 1987). GH also stimulates the immune system and the production of insulin-like growth factor IGF-1 by the liver, which itself has widespread and important roles in cell growth and repair, and numerous anabolic effects (Clemmons & Underwood, 1991;Hartman et al, 1993).

Several shorter forms of GH circulate in the plasma (Sinha & Jacobsen, 1994). The majority of circulating GH is bound to the GH-binding protein (Baumann, 2001). The pulsatile release of GH is regulated by hypothalamic GHRH and somatostatin; however, GH secretion is also stimulated by sex steroids (Chowen et al, 2004), exercise (Roth et al, 1963), and sleep (Hunter et al, 1966), and is inhibited by glucocorticoids (Tonshoff & Mehls, 1997). GH release is also regulated by ghrelin via the growth hormone secretagogue receptor-1a (Kojima et al, 1999).

The GH receptor (GH-R) is a member of the cytokine receptor family with a single transmembrane domain. Binding of GH to the GH-R leads to receptor dimerisation and the activation of multiple intracellular signalling pathways (Lanning & Carter-Su, 2006).

1.4.3.2.2 THE HYPOTHALAMO-PITUITARY-THYROID AXIS

1.4.3.2.2.1 HYPOTHALAMIC CONTROL OF THE HPT AXIS TRH is a tripeptide and the smallest known peptide releasing hormone. TRH is released from nerve terminals in the median eminence and is transported to the anterior pituitary where it maintains thyrotroph structure and function and stimulates the release of TSH (Butler, 1969). The precursor proTRH also gives rise to other peptides which have been shown to induce TSH gene expression (Pekary, 1998). TRH also stimulates prolactin synthesis and release (Malarkey, 1976;Lancranjan et al, 1980). Whilst the majority of TRH released into the median eminence originates from TRH neurons in the PVN, this only accounts for a third of all TRH found in the CNS (Winokur & Utiger, 1974). TRH also has central actions on arousal, motor activity, thermoregulation and blood pressure (Nillni & Sevarino, 1999;Heuer et al, 1999).

Two TRH receptors have been characterised: TRH-R1 and TRH-R2. The binding properties and intracellular signalling pathways are the same for both receptors. TRH-R1 is found in the hypothalamus and the anterior pituitary (Heuer et al, 1999) while TRH-R2 is expressed in the spino- thalamic tract and the spinal cord (Heuer et al, 2000).

TRH release from the median eminence is primarily regulated via negative feedback by circulating thyroid hormones acting at the level of the hypothalamus (Segerson et al, 1987). However, TRH synthesis and release is also regulated by a number of other signals, including catecholamines (Grimm & Reichlin, 1973), NPY (Fekete, 2001), leptin (Legradi et al, 1997) and glucocorticoids (Luo et al, 1995), and the regulation of TRH by circulating thyroid hormones may in part be mediated indirectly by these signals (Chiamolera & Wondisford, 2009).

1.4.3.2.2.2 PITUITARY CONTROL OF THE HPT AXIS TSH is a glycoprotein hormone comprised of a heterodimer of two non-covalently linked α and β subunits. The α subunit is common to the two other pituitary glycoprotein hormones, LH and FSH, while the β subunit is specific to TSH (Shupnik et al, 1989). TSH synthesis and release is stimulated by TRH originating from the hypothalamus, and inhibited by DA and somatostatin (Harris et al, 1978). Circulating thyroid hormones also feedback to reduce the synthesis and release of TSH from the anterior pituitary (Shupnik et al, 1985).

TSH released into the circulation stimulates the release of thyroxine (T4) and triiodothyronine (T3) from the thyroid gland via the TSH receptor, a GPCR expressed on the surface of thyroid follicular cells (Szkudlinski et al, 2002).

1.4.3.2.2.3 THYROID HORMONES The thyroid hormones T4 and T3 are iodinated derivatives of tyrosine. T4 is the main secretory product of the thyroid gland and plasma T4 levels are usually 40-fold higher than T3 levels. The majority of thyroid hormone in the circulation is bound to plasma proteins including thyroxine binding globulin and albumin (Larsen et al, 1981). Approximately 0.03% of total plasma T4 and 0.3% of total plasma T3 is present in unbound form. Only free thyroid hormone can enter target cells and elicit a biological response. T3 is more biologically active than T4, with a much higher affinity for the thyroid hormone receptors (Larsen et al, 1981). Once thyroid hormones are inside the cell, the iodothyronine deiodinase enzymes, D1, D2, and D3, regulate the activity of thyroid hormone via removal of specific iodine moieties from T4. D2 generates the active form of thyroid hormone T3 via deiodination of T4 so the cytoplasmic pool of T3 includes both T3 from the plasma and T3 generated by D2. D3 inactivates T3 and, to a lesser extent, prevents T4 from being activated to decrease local T3 concentrations (Oppenheimer, 1979).

Thyroid hormones are required for the normal functioning of all tissues and play a critical role in development, growth, reproduction and metabolism, specifically in the regulation of oxygen consumption and metabolic rate (Yen, 2001). Reduced exposure to thyroid hormones during development leads to severe mental retardation, and neurological and skeletal abnormalities. Thyroid hormones enter target cells by passive diffusion and active transport across plasma membranes (Mooradian et al, 1985;Samson et al, 1993). The thyroid hormone receptors (TRα1 and TRβ1, TRβ2 and TRβ3) are nuclear receptors that are ubiquitously expressed, although with tissue specific isoforms. T3 and T4 mediate their effects by binding to these receptors and regulating expression of target genes.

1.4.3.2.3 THE HYPOTHALAMO-PITUITARY ADRENAL AXIS An organism’s ability to respond to stress is dependent on the functioning of the hypothalamo- pituitary-adrenal (HPA) axis. This axis regulates stress related processes such as metabolism, energy expenditure, the immune system, mood and emotions (Selye, 1936). Its importance is reflected in its high level of conservation between species (Yao & Denver, 2008). The hypothalamus processes information from higher cortical centres in addition to detecting immune insult and alterations to whole-body homeostasis (Herman et al, 1996). Such signals result in activation of the sympathetic nervous system and release of the HPA axis hormones CRH, ACTH and glucocorticoids. Dysregulation of the HPA axis can result in Addison’s disease (Addison, 1855), i.e. adrenal insufficiency leading to low cortisol, or Cushing’s syndrome, characterised by excess cortisol (Cushing, 1932).

1.4.3.2.3.1 HYPOTHALAMIC CONTROL OF THE HPA AXIS CRH is a 41 amino acid peptide synthesised by neurons in the pPVN and released by nerve terminals in the median eminence into the hypophyseal portal system (Vale et al, 1983). CRH is transported to the anterior pituitary where it stimulates the release of ACTH and maintains the structure of corticotrophs (Vale et al, 1981). AVP, a nonapeptide also synthesised in the pPVN is a potent synergistic factor with CRH in the stimulation of ACTH secretion (Antoni, 1993); however, AVP has little ACTH secretagogue activity alone (Lamberts et al, 1984). There is a reciprocal positive interaction between CRH and AVP at the level of the hypothalamus whereby each neuropeptide induces release of the other. In the absence of stress, CRH and AVP are secreted in a circadian, pulsatile manner. In humans, the largest pulses are in the early morning, resulting in peak circulating ACTH and cortisol levels at this time (Horrocks et al, 1990). Acute stress, including inflammatory mediators, increases the amplitude and frequency of CRH and AVP secretory pulses in the portal circulation (Tsigos & Chrousos, 1994). CRH and AVP release are regulated by glucocorticoids acting directly at the hypothalamus (Beyer et al, 1988). Two GPCR CRH receptors have been identified: CRH-R1 and CRH-R2 (Turnbull & Rivier, 1997). CRH-R1 is more abundant and expressed in the anterior pituitary and widely throughout the brain (Wong et al, 1994). CRH-R2 is expressed in the brain and in peripheral tissues.

In addition to its effect on the release of ACTH, other central CRH pathways are involved in the behavioural, autonomic and endocrine responses to stress (Fisher, 1993), including regulation of energy homeostasis. CRH also suppresses the reproductive, thyroid and growth axes (Tsigos & Chrousos, 2002).

1.4.3.2.3.2 PITUITARY CONTROL OF THE HPA AXIS

ACTH is a 39 amino acid anterior pituitary peptide hormone formed by post-translational processing of the POMC precursor molecule. Pulsatile ACTH secretion is stimulated by CRH binding to the CRH-R1 receptor on pituitary corticotrophs and subsequent stimulation of intracellular adenylate cyclase and cyclic adenosine monophosphate (cAMP) dependent protein kinase (Aguilera et al, 1986). CRH-induced secretion of ACTH is attenuated by elevated circulating glucocorticoid concentrations and enhanced by a reduction in circulating glucocorticoid levels (McEwen, 1979). ACTH release is also stimulated by inflammatory cytokines including IL-6 acting via the IL-6 receptor at the anterior pituitary (Gautron et al, 2003). ACTH released into the general circulation binds to the MC2-R on the adrenal gland and stimulates the synthesis and release of glucocorticoids (Simpson & Waterman, 1988).

1.4.3.2.3.3 GLUCOCORTICOIDS Glucocorticoids are the final effectors of the HPA axis and participate in the regulation of whole body homeostasis and an organism’s response to stress. Glucocorticoids are steroid hormones synthesised and secreted in response to circulating ACTH from cells in the zona fasciculata of the adrenal cortex. The major human glucocorticoid is cortisol. The major rat glucocorticoid is corticosterone. Glucocorticoids up-regulate expression of anti-inflammatory proteins and down-regulate expression of pro-inflammatory proteins. Glucocorticoids inhibit the HPA axis in a negative feedback loop at the pituitary, hypothalamus and higher centres of the brain, including limbic structures such as the hippocampus (Keller-Wood & Dallman, 1984). Metabolically, glucocorticoids increase protein catabolism, hepatic glycogenolysis and gluconeogenesis and lipolysis. These actions result in the mobilisation of energy stores which allow an organism to deal with stress. Glucocorticoids mediate their effects via the ubiquitous glucocorticoid receptor (GR), to which they bind with low affinity, and the mineralocorticoid receptor (MR), expressed in the kidney, colon, heart, CNS, brown adipose tissue and sweat glands, to which they bind with much higher affinity (Nussey & Whitehead, 2001). Both the GR and the MR are nuclear receptors. Glucocorticoids circulate at 100- 1000 fold higher concentrations than mineralocorticoids and yet bind with similar affinity to the MR (Nussey & Whitehead, 2001). To prevent unwanted activation of the MR by circulating glucocorticoids, certain tissues including the kidney express 11-β-dehydrogenase isoenzyme 2 (11βHSD2), an enzyme which oxidises the glucocorticoid cortisol to the inactive metabolite cortisone (Albiston et al, 1994).

1.4.3.2.4 THE HYPOTHALAMO-PITUITARY-GONADAL AXIS The release of reproductive hormones, and thus control of puberty and reproductive behaviour in mammals, is mediated by the pulsatile release of GnRH from specific neurons of the hypothalamus. GnRH is released into the hypophyseal portal system from where it can access the anterior pituitary gland. Here it acts on gonadotrophs, stimulating the release of the gonadotrophins, LH and FSH into the general circulation. LH and FSH act on the ovaries in females and the testes in males to control the release of sex steroids, and to stimulate spermatogenesis in males and menstrual cycling in females. The HPG axis is regulated by negative feedback effects of both the gonadal sex steroids and the pituitary gonadotrophins acting at the level of the pituitary and hypothalamus (Figure 1.3).

1.4.3.2.4.1 HYPOTHALAMIC CONTROL OF THE HPG AXIS GnRH is a decapeptide first isolated from porcine hypothalamus (Amoss et al, 1971). The amino acid sequence is identical across almost all mammalian species examined (Jimenez-Linan et al, 1997). GnRH-releasing neurons are found dispersed throughout the anterior hypothalamic nuclei, including a large proportion in the preoptic area, and the medial basal areas (Silverman et al, 1987). There are only a small number of GnRH neurons in most mammals, approximately 800-2000 (Hoffman G.E. et al, 1992). GnRH is generated from a precursor polypeptide by enzymatic processing and packaged into storage granules that are transported down axons to the external zone of the median eminence (Silverman et al, 1994). The hormone is then released in synchronised pulses from the nerve endings into the hypophyseal portal system every 30-120 minutes to stimulate the biosynthesis and secretion of LH and FSH from pituitary gonadotrophs (Fink, 1988).

The mechanism underlying GnRH pulsatility is unclear. It has been observed that cultured GnRH neurons release GnRH in a pulsatile manner in the absence of glial cells or other neuronal types, suggesting an inherent ‘pulse generator’ within the GnRH cells themselves (Wetsel et al, 1992). The pulsatility of GnRH release is critical for the correct functioning of the HPG axis (Knobil, 1990). Gonadal feedback, stress and nutrition also influence GnRH neuron activity (Clarke & Pompolo, 2005). Many neuropeptides and hormones have been shown to effect GnRH secretion and the reproductive axis and may mediate the effects of these influences on GnRH neurons. These include kisspeptin (Thompson et al, 2004), leptin (Barash et al, 1996), products of the POMC gene (Stanley et al, 2003), galanin (Sahu et al, 1987) and GALP (Matsumoto et al, 2001) (section 3.1.2).

Excitatory Input Inhibitory Input

(+) (-) Hypothalamus Pre-optic area

(+/-) GnRH (-) (-)

Median Eminence

Negative/positive feedback Negative/positive GnRH Negative feedback Negative

(+/-) LH/FSH (-)

LH/FSH

Ovaries Testes

Estrogen Testosterone Progesterone

Female Male

FIGURE 1.3 Schematic diagram of the hypothalamo-pituitary-gonadal (HPG) axis in males and females. Gonadotrophin releasing hormone (GnRH) stimulates the release of luteinising hormone (LH) and follicle stimulating hormone (FSH) from the pituitary. LH and FSH then stimulate the release of sex steroids from the gonads. In males testosterone negatively feeds back at both the hypothalamus and pituitary level. In females, depending on the phase of the oestrus cycle, oestrogen and progesterone feed back on the hypothalamus and pituitary in either a stimulatory or inhibitory manner. In both sexes, LH and FSH also feed back negatively on the hypothalamus to inhibit GnRH release.

1.4.3.2.4.2 PITUITARY GLAND CONTROL OF HPG AXIS The primary function of GnRH is regulation of the release of gonadotrophins from pituitary gonadotrophs. Gonadotroph cells are found in the anterior lobe of the pituitary and are usually located adjacent to lactotrophs (Ooi et al, 2004). They are the site of synthesis, storage and release of the gonadotrophins LH and FSH. Hypothalamic GnRH binds to and activates GnRH receptors on gonadotrophs to stimulate LH and FSH release (Karges et al, 2003). The GnRH receptor is a GPCR which is highly homologous between species (Kakar et al, 2004).

The importance of GnRH in gonadotrophin release is illustrated by the reduction of both LH and FSH mRNA and serum levels observed in response to experimental disruption of the GnRH/GnRH receptor system caused by endogenous GnRH immunoneutralisation, surgical hypothalamus-pituitary disconnection or antagonist mediated GnRH receptor blockade (Hamernik & Nett, 1988;Wierman et al, 1989). The release of LH and FSH is also regulated by gonadal steroids and members of the TGFβ family, activin and inhibin, which enhance and down-regulate FSH synthesis and release respectively (Carroll et al, 1991).

LH and FSH belong to a family of structurally related glycoprotein hormones which also includes TSH (Stockell & Renwick, 1992). These hormones consist of two distinct glycosylated subunits, a common α- and a specific β-subunit which confers biological activity (Pierce & Parsons, 1981). LH and FSH are generally expressed within the same cells, although monohormonal gonadotrophs do exist (Childs, 1997). Both LH and FSH are synthesised and intermittently secreted from gonadotrophs in response to the pulsatile release of GnRH. However, different GnRH pulse frequencies may favour different intracellular signal transduction mechanisms which stimulate the synthesis of particular gonadotrophin subunits (Burger et al, 2004).

The pulse amplitude and frequency of LH release is sexually dimorphic, and depends on the stage of pubertal development, circadian rhythms, and in the female, the stage of the menstrual/oestrus cycle (Matsumoto & Bremner, 1984). LH acts via the GPC LH receptor (LH-R) and FSH binds to and activates the GPC FSH receptors FSH-R (McFarland et al, 1989). Gonadal steroids feedback to regulate LH and FSH synthesis and release (McNeilly et al, 2003).

1.4.3.2.4.3 GONADS AND CONTROL OF THE HPG AXIS LH-R expression is limited in males to the Leydig cells of the testes (Bhalla et al, 1992). Here, LH regulates the synthesis and secretion of androgens, primarily testosterone, and thus maintains the endocrine (extra testicular) and paracrine (sperm production) effects of androgens. LH is also required for the maintenance of Leydig cell structure and function. Hypophysectomy or inhibition of LH secretion causes Leydig cells to atrophy and lose their ability to secrete testosterone (Russell et al, 1992). In female ovaries, the LH-R is expressed in theca, interstitial, differentiated granulosa and luteal cells (Bukovsky et al, 1993). LH stimulates secretion of testosterone from theca cells which is then converted into estrogens by neighbouring granulosa cells. LH also triggers ovulation and maintains progesterone production of the corpus luteum (Huhtaniemi, 2000).

In males, FSH is an important trophic hormone which regulates Sertoli cell proliferation and function (Almiron & Chemes, 1988), initiates spermatogenesis during pubertal development (Russell et al, 1987) and supports normal spermatogenesis in adults (Matsumoto et al, 1986). In the female, FSH stimulates follicular maturation and oestrogen production by granulosa cells in the ovary (Huhtaniemi, 2000).

The gonadal steroids exert negative feedback actions on the hypothalamo-pituitary axis. GnRH secretion is increased following orchidectomy or ovariectomy (Damassa et al, 1976;Clayton, 1993;Goodman & Daniel, 1985). Gonadal steroids predominantly suppress LH secretion by acting at the hypothalamus (Tilbrook & Clarke, 2001) but also have direct effects at the pituitary. Both androgen and estrogen receptors are expressed in the hypothalamus (Apostolinas et al, 1999;Shughrue et al, 1997). However, it has been reported that endogenous GnRH neurons do not express either of these receptors, suggesting that sex steroids act on other neurons to indirectly regulate GnRH release (Tilbrook & Clarke, 2001).

1.5 THE GALANIN PEPTIDE FAMILY The galanin peptide family consists of galanin and galanin-message-associated peptide (GMAP) (derived from the same peptide precursor gene product as galanin), galanin-like peptide (GALP) (encoded by a distinct gene) and alarin, which is encoded by a recently discovered splice variant of the GALP gene.

The galanin receptor family currently consists of three known members, GalR1, GalR2 and GalR3 which are all GPCRs. Evidence suggests that other, as yet uncharacterised members of this receptor family may exist (Branchek et al, 2000).

1.5.1 GALANIN MESSAGE ASSOCIATED PEPTIDE GMAP, the 59 amino acid C-terminal fragment of galanin precursor protein (Rokaeus & Brownstein, 1986) is highly conserved across species. Its physiological role is unclear. GMAP is present in dorsal root ganglion cells, dorsal roots and the dorsal horn and is upregulated in sensory afferent neurons following peripheral nerve injury (Xu et al, 1995b). Intrathecal administration of GMAP has been shown to inhibit spinal nociception, although the effect of GMAP on spinal cord excitability is variable depending on the intact or severed status of neurons (Andell-Jonsson et al, 1997;Xu et al, 1995a;Hao et al, 1999). It is interesting that while GMAP acts similarly to galanin in some pharmacological functions, including spinal nociception, it also appears to have some distinct functions, suggesting that it may have its own specific receptor (Xu et al, 1995a). GMAP is only weakly able to displace I125galanin from binding sites on rat spinal cord membrane (Andell-Jonsson et al, 1997) and does not bind to GalR2 or GalR3 expressing membranes in vitro (Wang et al, 1997c). However, a specific GMAP receptor has not yet been identified.

More recently, GMAP has been described as having antimicrobial properties. It inhibits the growth of the fungus Candida Albicans and suppresses the transition from budded to hyphal form, reducing its pathogenicity (Rauch et al, 2007). This suggests a novel role for galanin-related peptides in the innate immune response.

FIGURE 1.4 Organisation of the preprogalanin gene. Exon 1 encodes only the 5’ untranslated region. Exon 2 starts with the translation initiation codon of the signal peptide and terminates before the proteolytic site preceding the mature galanin peptide. The first 13 amino acids of galanin are encoded by exon 3; the remaining 16 amino acids and most of GMAP by exons 4 and 5. The remaining portion of GMAP and the polyadenylation site are located in exon 6. Arrows indicate endopeptidase cleavage sites. Adapted from (Kofler et al, 1996).

1.5.2 GALANIN Galanin is generated by proteolytic processing of a 123-(porcine, human) or 124-(murine) amino acid precursor pro-peptide (Rokaeus & Brownstein, 1986). GMAP is also generated by processing of this precursor (section 1.5.1). This preprogalanin is encoded by a single-copy gene organised into 6 exons spanning about 6Kb of genomic DNA (Kofler et al, 1996) (Figure 1.4).

Galanin is a 29 amino acid (30 in humans) neuropeptide originally isolated from porcine intestine. It is so called due to its N-terminal glycine residue and C terminal alanine (Tatemoto et al, 1983). The first 15 N-terminal amino acids, which retain the biological activity of the full-length peptide in vivo and in vitro, and are known as the galanin receptor binding domain, are highly conserved across species. The C terminal portion displays greater variability (Wynick et al, 1998b). Human galanin lacks the C-terminal amidation present in all other species examined due to the presence of a serine residue at position 30 (Evans & Shine, 1991;Schmidt et al, 1991). The galanin sequence in other species is flanked by Gly-Lys-Arg at the C terminus, serving as amide donor (glycine) and dibasic proteolytic processing site (Lys-Arg) (Schmidt et al, 1991).

1.5.2.1 LOCALISATION OF GALANIN Galanin mRNA and galanin-IR have been detected in the CNS of all species examined, including the rat (Melander et al, 1986a), mouse (Cheung et al, 2001), primate (Kordower et al, 1992) and human (Gentleman et al, 1989). In the CNS, galanin mRNA is most abundant in the hypothalamus and brainstem of the rat (Jacobowitz et al, 2004;Ryan & Gundlach, 1996) and mouse (Cheung et al, 2001). Specifically, there are very high levels in the preoptic, periventricular and dorsomedial hypothalamic nuclei, and in the bed nucleus of the stria terminalis (BNST), and NTS. High levels of galanin-IR are also found in the external median eminence suggesting a role for galanin as a hypophysiotropic hormone (Lopez et al, 1991).

In addition to the CNS, galanin is also found in the periphery. Galanin is found in neuronal fibres of the gastrointestinal tract (Melander et al, 1985), in both the endocrine and exocrine pancreas (Dunning et al, 1986), in the skin, where it is detected both in nerves (Tainio et al, 1987) and also extra-neuronally (Ji et al, 1995), in nerves and other cells of bone and joint tissue (McDonald et al, 2003), in the adrenal medulla, genitourinary tract and respiratory tract, and in numerous other peripheral organ systems (Kaplan et al, 1988c).

Within the hypothalamus, galanin has been reported to co-localise with GHRH and tyrosine hydroxylase (Meister & Hokfelt, 1988), GnRH (Coen et al, 1990), oxytocin (Gaymann & Martin, 1989), CRH and AVP (Ceccatelli et al, 1989) and noradrenaline (Melander et al, 1986b) amongst others, suggesting a role for galanin in the regulation of neurosecretory function. In addition, galanin is coexpressed with neuropeptides known to be involved in the regulation of energy homeostasis, including CCK in the PVN (Meister et al, 1990b) and histamine-synthesizing cells in the TMN (Sherin et al, 1998). Galanin is also expressed in specific populations of GABAergic, serotonergic and catecholaminergic neurons throughout the CNS (Melander et al, 1986b).

1.5.2.2 GALANIN ACTIONS Reflective of its widespread distribution and co-localisation with many other neuropeptides and neurotransmitters, galanin is thought to regulate numerous and diverse physiological actions in the nervous system. The roles of galanin in energy homeostasis and neuroendocrine regulation will be discussed in chapters 2 and 3 respectively. Other important actions of galanin are briefly described below.

1.5.2.2.1 GALANIN AND AROUSAL/SLEEP REGULATION Neuroanatomical studies have revealed the presence of a population of galanin-expressing neurons originating in the ventrolateral preoptic nucleus and synapsing on neurons in the TMN, the major source of histamine in the brain important in the regulation of sleep and wakefulness (Haas & Panula, 2003). Galanin-expressing sleep-active neurons of the ventrolateral preoptic nucleus are proposed to provide inhibitory inputs to the cell bodies of histamine synthesising neurons of the TMN and other components of the ascending monoaminergic arousal system (Sherin et al, 1998).

1.5.2.2.2 GALANIN AND NOCICEPTION The presence of galanin in the dorsal spinal cord gave rise to the proposal of a physiological role for galanin in spinal pain modulation. Spinal administration (intrathecal) of galanin produces a biphasic effect on spinal nociception through activation of GalR1 (inhibitory) or GalR2 (excitatory) receptors. Furthermore, galanin mRNA expression is increased in sensory neurons following peripheral nerve injury (Villar et al, 1989).

1.5.2.2.3 GALANIN AND NEUROPROTECTION Galanin gene expression and peptide levels are potently and persistently elevated following experimental nerve injury in numerous different models (Hokfelt et al, 1987;Corts, 1990). This elevation in galanin-IR in dorsal root ganglion cells is associated with successful or attempted neural repair processes suggesting a trophic role for galanin. In accord with this, galanin has been demonstrated to act as a survival (Elliott-Hunt et al, 2004) and growth promoting factor (Holmes et al, 2000) for CNS and PNS neurons.

1.5.2.2.4 GALANIN AND EPILEPSY Galanin is able to inhibit glutamate but not GABA release in the hippocampus (Zini et al, 1993). This suggests that galanin may suppress excitatory tone without affecting inhibitory tone and may therefore possess anticonvulsant activity. Indeed, the GalR1 knockout mouse exhibits spontaneous seizure activity suggesting this receptor subtype may mediate such actions (Jacoby et al, 2002), while the

galanin overexpressing mouse has a higher threshold for seizure development (Kokaia et al, 2001). There is therefore great interest in developing selective galanin receptor agonists as antiepileptic agents (Robertson et al, 2010).

1.5.2.2.5 GALANIN AND LEARNING/MEMORY ICV injection of galanin impairs the performance of rodents in various cognitive tasks. This may be due to impairment of both learning and memory, mediated by an inhibition of acetylcholine release in the hippocampus (Fisone et al, 1987). Galanin receptor antagonists have been proposed as putative cognitive enhancers, and it has been suggested they may be of particular use in Alzheimer’s disease, which is characterised by degeneration of cholinergic/galaninergic neurons and a pathological, compensatory increase in activity of surviving galanin neurons (Chan-Palay, 1988). In post-mortem brains from Alzheimer’s patients, hippocampal galanin binding sites are significantly increased (Rodriguez-Puertas et al, 1997).

1.5.2.2.6 GALANIN AND ANXIETY/DEPRESSION Galanin is co-expressed in almost all noradrenaline-containing neurons of the locus coruleus (LC) and in approximately 70% of serotonergic neurons in the dorsal raphe nucleus (DRN). These nuclei are important in the regulation of mood. Overactivity of LC Noradrenergic neurons leads to suppression of DRN serotonergic neurons and the development of depression (Sulser, 1979). Serotonin and noradrenaline re-uptake inhibitors are effective therapeutic agents in the treatment of depression (Nelson, 1996). The use of these drugs is associated with an increase in galanin mRNA and GalR2 binding in the DRN, thought to be due to inhibition of the noradrenergic suppression of serotonin neurons (Lu et al, 2005a). In addition, studies have revealed that administration of selective GalR3 antagonists has antidepressant-like activity in animal models of depression (Swanson et al, 2005;Barr et al, 2006).

1.5.2.2.7 GALANIN AND ADDICTION Galanin activity in the amygdala appears to be associated with addictive behaviour such as alcohol intake. Animal behavioural studies suggest that central galanin administration increases ethanol intake (Lewis et al, 2004) and human genetic studies propose a link between galanin, the GalR3 and alcoholism (Belfer et al, 2006;Belfer et al, 2007).

1.5.2.2.8 GALANIN AND WATER BALANCE Galanin is co-expressed with AVP in magnocellular neurons of the PVN and SON (Skofitsch et al, 1989;Melander et al, 1986b;Rokaeus et al, 1988;Gaymann & Martin, 1989). These nuclei also have galanin binding sites (Melander et al, 1988;Skofitsch et al, 1986), suggesting an involvement of galanin in osmotic regulation. Indeed, dehydration or salt loading increases galanin mRNA in hypothalamic magnocellular neurons (suggesting increased synthetic activity) and reduces galanin peptide levels in the SON, PVN and posterior pituitary gland (suggesting increased release) (Skofitsch et al, 1989;Meister et al, 1990a). The same pattern of expression is seen in the chronically hyperosmolar, AVP deficient Brattleboro rat (Rokaeus et al, 1988).

Systemic galanin administration causes only a mild diuresis and a small increase in blood pressure in rats (Skofitsch et al, 1989). Salt loading and dehydration increase both AVP release and galanin mRNA expression in the hypothalamus and reduce galanin-IR in the posterior pituitary (Skofitsch et al, 1989). Galanin is then thought to act as a negative feedback modulator of AVP release via GalR1 activation in an autocrine/paracrine manner (Kondo et al, 1993a;Kondo et al, 1993b;Landry et al, 1995;Molnar et al, 2005). Magnocellular AVP neurons in PVN and SON express GalR1, and GalR1 mRNA levels in these hypothalamic nuclei are increased by osmotic challenge and in the Brattleboro rat (Landry et al, 1998;Landry et al, 1999).

ICV galanin also dose dependently reduces water consumption in water deprived rats (Brewer et al, 2005) and in vitro studies suggest a role for galanin in regulating activity of neurons in the sub fornical organ (SFO); a circumventricular structure important in the control of water intake. These data suggest that galanin may suppress water intake by inhibiting SFO neurons via the GalR1 (Kai et al, 2006).

1.5.2.3 GALANIN OVER-EXPRESSING AND KNOCKOUT MICE Galanin knockout mice are viable, grow normally, and can reproduce. The two main phenotypic abnormalities are a reduction in prolactin, associated with an inability to lactate, and an impaired response of sensory neurons to injury (Wynick et al, 1998b). Galanin over-expressing mice are healthy and normal when assessed using a variety of physiological and behavioural measures. The most apparent difference between these mutant mice and their wild-type littermates is a reduction in seizure susceptibility and reduced anxiety. There have been reports of deficits in learning and memory in galanin over-expressing mice (Crawley et al, 2002). Subtle differences in the energy homeostatic and neuroendocrine phenotypes of galanin knockout and galanin over-expressing mice will be discussed in chapters 2 and 3 respectively.

1.5.3 GALP GALP is a 60 amino acid peptide originally discovered as an endogenous ligand for galanin receptors present in the porcine hypothalamus and gastrointestinal tract (Ohtaki et al, 1999). The GALP gene comprises 6 exons and has a similar structural organisation to galanin. GALP (1-60) is processed from the 115-120 amino acid GALP precursor protein, preproGALP (Figure 1.5). The amino acid sequence of GALP (1-60) is highly conserved between humans, primates, rats, mice and pigs. (Ohtaki et al, 1999;Cunningham et al, 2002;Cunningham et al, 2002;Jureus et al, 2001). The amino acid sequence of GALP (9-21) is completely identical to that of galanin (1-13) and is known as the galanin receptor binding domain. There are two other significantly conserved regions of GALP which may be important mediators of its bioactivity: residues 1-8 and 38-54.

Despite being identified as an endogenous ligand for the GalR2, GALP (1-60) has the highest affinity for GalR3, followed by GalR2 and then GalR1. However the physiological consequences of GALP binding to GalR3 are unclear (Lang et al, 2005). Studies have reported that while GALP binds to the GalR3 with nanomolar affinity in membrane preparations, it is unable to activate intracellular signalling pathways. These findings may be artefacts of the low receptor density achieved following transfection of cell lines with GalR3 (Berger et al, 2004;Ohtaki et al, 1999).

It has also been suggested that GALP may act via an as yet unknown receptor to mediate some of its biological effects (Krasnow et al, 2004). GALP and galanin activate c-fos expression in different neuronal populations (Fraley et al, 2003;Lawrence et al, 2003) and have different biological effects in vivo (Fraley et al, 2004b).

1.5.3.1 GALP MRNA AND PEPTIDE DISTRIBUTION GALP mRNA has a much more restricted distribution in the CNS than galanin, and is only detected in the ARC of the rat, mouse and macaque hypothalami. GALP-IR cell bodies have been localised to the medial and caudal region of the ARC close to the third ventricle (Jureus et al, 2000;Takatsu et al, 2001). Similar expression patterns have also been shown in the mouse and the macaque (Jureus et al, 2001;Cunningham et al, 2002). ARC GALP cells send GALP-positive projections to several areas of the basal forebrain, including the anterior pPVN, the LHA, the mPOA, the BNST and the lateral septal nucleus (Takatsu et al, 2001).

Additionally, GALP mRNA and GALP-IR cell bodies have been detected in the median eminence, the infundibular stalk and in pituicytes of the posterior pituitary gland (Fujiwara et al, 2002;Takatsu et al, 2001;Shen et al, 2001;Jureus et al, 2000). GALP is absent from other hypothalamic nuclei and brain loci. Outside of the CNS, GALP mRNA has also been detected in the GI tract (Ohtaki et al, 1999;Berger et al, 2003) and the testes (unpublished observation Shen et al, 2002).

1.5.3.2 GALP ACTIONS The role of GALP in the regulation of feeding and reproduction has been relatively well-characterised and will be discussed in detail in chapters 2 and 3 respectively. GALP has also been implicated in regulating other neuroendocrine axes and water homeostasis (Lang et al, 2007). GALP is also able to inhibit inflammatory oedema formation in the skin by vasoconstriction and inhibition of blood flow (Schmidhuber et al, 2007). Interestingly, the GALP knockout mouse is for the most part phenotypically normal, although it does exhibit subtle differences in its response to alterations in nutritional status compared to wild-type littermates (Dungan Lemko et al, 2008).

1.5.4 ALARIN

Alternative splicing of mRNA allows many gene products with different functions to be produced from a single coding sequence. This is proposed as a mechanism by which greater biological diversity is generated (Brett et al, 2002), in addition to being an essential method for the control of tissue specific expression of related proteins. Although uncommon within regulatory peptide systems, one example is the calcitonin gene-related peptide (CGRP) which is alternatively spliced to form calcitonin or CGRP (Amara et al, 1982). Recently, the expression of a splice variant of GALP mRNA was observed in gangliocytes of human neuroblastic tumours (neuroendocrine neoplasms). This splice variant results in an exclusion of exon 3 and a frame shift after the signal peptide sequence of GALP, generating a peptide of 25 amino acids (Santic et al, 2006).

The presence of this splice variant of GALP in murine tissue has been confirmed using reverse- transcription polymerase-chain-reaction (RT-PCR) analysis using sets of primers spanning exons 1-6. Exclusion of exon 3 was predicted to result in a precursor protein which contains the signal sequence of preproGALP and the first 5 amino acids of the GALP peptide, followed by 20 amino acids which show no homology to any other known murine protein. The proteolytic cleavage site of GALP is encoded within exon 2 and thus is maintained in this splice variant, allowing the generation of a 25 amino acid neuropeptide (Santic et al, 2007), named alarin because of its N-terminal alanine and C- terminal serine.

Comparing the alarin splice variant between different species, a similar frame shift is predicted to occur in rats, macaques and humans, and alarin appears to be reasonably conserved between species. The alarin peptide lacks the galanin receptor binding domain, suggesting that it mediates its biological effects through alternative receptors. In support of this hypothesis, it has been reported that alarin (1- 25) does not bind to membrane preparations of either human GalR1 or GalR2-expressing neuroblastoma cells (Santic et al, 2007).

FIGURE 1.5 Organisation of the preproGALP gene. Exon 1 is noncoding. PreproGALP is encoded by exons 2-6 and the segment with galanin homology [GALP(9-21)] is contained in exon 3. The mature GALP (1-60) is encoded by exons 2-5. Post-transcriptional splicing leads to exclusion of exon 3 resulting in a frame shift and a novel precursor protein. This protein harbours the signal sequence of preproGALP and the first 5 amino acids of the mature GALP peptide followed by another 20 amino acids and proteolytic cleavage leads to alarin (1-25). Arrows indicate potential endopeptidase cleavage sites. Adapted from (Lang et al, 2007).

1.5.4.1 ALARIN LOCALISATION

Alarin-IR was initially detected specifically in cytoplasmic granules in ganglia of human ganglioneuromas and ganglioneuroblastomas, as well as in differentiated tumour cells of neuroblastoma tissues. Undifferentiated neuroblasts of these tumour tissues did not show alarin-IR or alarin-specific mRNA, suggesting alarin expression is a feature of ganglionic differentiation in neuroblastic tumour tissues (Santic et al, 2006).

Alarin mRNA has subsequently been detected in murine brain, skin and thymus by RT-PCR (Santic et al, 2007). Alarin-IR has been more specifically observed within the rat brain; mainly within the basal ganglia, but also in the amygdala and piriform cortex, in the CA1 region and the stratum lacunosum molecular of the hippocampus (Eberhard et al, 2007). Interestingly, relatively dense staining has also been observed in the hypothalamic TMN. Within the adult female murine brain, alarin-IR has been observed in cells of the mitral layer of the olfactory bulb, the dorsolateral cortex, the anterior olfactory nucleus (lateral), the piriform cortex, the pyramidal cell layer of the hippocampus, the LC, the facial nucleus, Purkinje cells of the cerebellum and the epithelial layer of the choroid plexus (Eberhard et al, 2008).

1.5.4.2 ALARIN ACTIONS

Galanin and GALP can inhibit substance P- and CGRP-induced oedema formation in the skin (Green et al, 1992;Schmidhuber et al, 2007). Alarin-IR has been detected in pericytes surrounding microvascular arterioles and venules in the dermis and in layers of smooth muscle cells. Alarin, GALP and galanin all demonstrate a similarly profound inhibitory effect on substance P- and CGRP- induced oedema formation. Alarin is able to inhibit the inflammatory oedema formation in a dose- dependent manner when co-injected locally into the cutaneous microvasculature at picomolar doses. Furthermore, it appears that this anti-inflammatory effect of alarin is mediated via a reduction of blood flow in the skin, suggesting potential vasoconstrictor properties of alarin (Santic et al, 2007).

FIGURE 1.6 Amino acid sequences of alarin, galanin-like peptide (GALP) and galanin peptides. Amino acids conserved between species are highlighted in grey. The 13 conserved residues between galanin and GALP which contains the galanin receptor binding domain are in red. The 5 amino acids common to both alarin and GALP are in blue. (Cunningham, 2004;Lundkvist et al, 1995;Santic et al, 2007;Schmidt et al, 1991;Tatemoto et al, 1983;Vrontakis et al, 1987).

1.6 AIMS

1) To investigate the in vivo effects of ICV alarin on food intake and behaviour, and to determine whether alarin is an endogenous regulator of food intake. 2) To investigate the effect of alarin in vivo and in vitro on the hypothalamo-pituitary axes. 3) To determine whether alarin binds to the three known galanin receptors 4) To investigate the effect of VTA administration of appetite regulating peptides

CHAPTER 2 ALARIN AND ENERGY HOMEOSTASIS

2.1 INTRODUCTION The galanin peptide family have long been implicated in the regulation of energy homeostasis. High concentrations of galanin and galanin receptors are present in hypothalamic nuclei known to be involved in food intake, and soon after the discovery of galanin, initial experiments were carried out to test the effect of ICV administration of galanin on feeding (Kyrkouli et al, 1986). The subsequent discovery of GALP (Ohtaki et al, 1999), with its restricted distribution in the ARC of the hypothalamus, reignited interest in this family of peptides, and has increased the complexity of the role of the galanin family of peptides in energy homeostasis.

2.1.1 GALANIN AND FOOD INTAKE Galanin has consistently been reported to acutely increase food intake in satiated and fasted rats following ICV injection (Kyrkouli et al, 1986;Kyrkouli et al, 1990b;Kyrkouli et al, 2006;Crawley et al, 1990;Barton et al, 1995;Barton et al, 1996;Schick et al, 1993;Tempel et al, 1988). Galanin has also been reported to stimulate feeding following central injection in mice (Hohmann et al, 2003), goldfish (de Pedro, 1995), squirrels (Boswell et al, 1993) and chicks (Tachibana et al, 2008).

Specific orexigenic effects are seen following microinjection of galanin into the rat PVN, LHA, DMN, VMN and amygdala (Corwin et al, 1993;Kyrkouli et al, 1986;Kyrkouli et al, 1990b;Schick et al, 1993). Lesioning the PVN abolishes the orexigenic effects of third ventricular galanin administration, suggesting that the PVN is necessary to mediate galanin’s stimulatory effects on feeding (Kyrkouli et al, 1989). Fourth ventricle administration and iNTS microinjection of galanin also stimulate feeding in rats, suggesting that galanin can act in the hindbrain to stimulate appetite. These effects are attenuated by iNTS or fourth ventricle administration of the non-specific GalR1 and GalR2 antagonist M40 (Koegler & Ritter, 1996). The effects of hindbrain injection of galanin on food intake are weak compared to those observed following ICV injection, suggesting that hindbrain galanin receptors may have a lesser role than hypothalamic receptors in the orexigenic effect of galanin. However, M40 is more effective at reducing fasting-induced re-feeding when injected into hindbrain sites compared to ICV administration, supporting a physiological role for hindbrain galanin signalling in satiety (Koegler et al, 1999). Interestingly, occlusion of the cerebral aqueduct does not effect the feeding response seen following either third or fourth ventricle galanin administration, suggesting that galanin can act in both the hypothalamus and the hindbrain to influence food intake (Koegler & Ritter, 1997). However, lesioning of the PVN enhances iNTS galanin-induced feeding in rats, suggesting there may be some interaction between these two sites of galanin action (Koegler & Ritter, 1998).

Infusion of galanin antisense oligonucleotides into the rat PVN inhibits feeding, suggesting a physiological role for galanin in the regulation of feeding (Akabayashi et al, 1994). Reports are contradictory regarding the effect of iPVN galanin receptor antagonist administration on food intake. Some studies report a reduction in food intake, and in particular fat ingestion (Adams et al, 2008), while others report no effect of a galanin receptor antagonist on food intake (Corwin et al, 1995). Chronic central administration of galanin to mice for six days significantly increases food intake and body weight (Hohmann et al, 2003). However a study administering lower doses of galanin for a two week period reported no significant change in body weight in rats, probably due to tachyphylaxis (Smith et al, 1994).

The mechanisms by which galanin increases food intake are unclear. NPY-IR nerve terminals synapse onto galanin-IR cell bodies and dendrites in the rat ARC and PVN (Horvath et al, 1996), suggesting that galanin may have a role in mediating NPY-induced feeding.

Galanin co-localises with noradrenaline in the PVN (Melander et al, 1986a) and hypothalamic administration of noradrenaline stimulates feeding (Grossman, 1962). Inhibition of noradrenaline synthesis, or pretreatment with an α2-adrenergic receptor antagonist, blocks galanin induced food intake in rats (Kyrkouli et al, 1990a), and iPVN administration of galanin to rats increases extracellular noradrenaline levels in the hypothalamus (Kyrkouli et al, 1992).

Galanin-IR fibres synapse onto β-endorphin containing (POMC mRNA expressing) neurons in the ARC (Horvath et al, 1995), and ARC POMC/CART neurons express both GalR1 and GalR2 mRNA (Bouret et al, 2000). Galanin may stimulate release of β-endorphin, which itself stimulates feeding via activation of the µ-opioid receptor (Morley, 1987). Galanin-stimulated feeding in satiated rats is reduced by co-administration of a µ-opioid receptor antagonist (Dube et al, 1994a;Barton et al, 1995;Barton et al, 1996). Studies examining the diurnal variation in galanin observed that the increases in hypothalamic galanin mRNA levels in the rat hypothalamus between 1100 and 1500 h coincide with increases in hypothalamic POMC expression, but lag slightly behind those in NPY expression. It has therefore been suggested that there is a hypothalamic NPY-galanin-β-endorphin pathway that stimulates feeding in the rat (Xu et al, 1999).

Early studies using pure macronutrient choice tests suggested that central administration of galanin preferentially increases fat consumption (Tempel et al, 1988). Galanin gene expression, peptide production and release from the pPVN and the external zone of the median eminence are specifically increased in response to fat ingestion, but not ingestion of carbohydrate or protein (Leibowitz et al,

1998). However, the hypothesis that galanin production is regulated by signals related to fatty acid metabolism remains debatable, and subsequent studies have shown that galanin administration also induces large increases in the consumption of mixed nutrient diets (Smith et al, 1997a). It has been proposed that the nutrient preference driven by galanin administration is dependent on the circadian cycle (Tempel & Leibowitz, 1990).

Transgenic mice lacking or over-expressing galanin in the brain do not display any noticeable alterations in feeding pattern or body weight (Steiner et al, 2001;Wynick et al, 1998b). These data suggest that while galanin administration may acutely regulate food intake, it does not regulate daily feeding or body weight. However, following more detailed phenotypic analysis, it has been suggested that the galanin knockout mouse is more sensitive to leptin administration (Hohmann et al, 2003) and more glucose intolerant than wild-type littermates (Ahren et al, 2004). Developmental compensation may mask more profound effects of the lack of galanin on energy homeostasis. However, linkage studies in humans have not revealed a role for the galanin gene in obesity (Schauble et al, 2005).

2.1.1.1 GALANIN REGULATION BY LEPTIN AND INSULIN The hypothalamic galanin system has been shown to interact with peripheral signals such as leptin and insulin. The leptin receptor is expressed on galanin-containing cell bodies within the ARC (Hakansson et al, 1998) and central administration of leptin decreases hypothalamic galanin mRNA expression (Sahu, 1998a). Central administration of insulin decreases galanin mRNA expression and galanin-IR in the anterior PVN (Wang & Leibowitz, 1997) and plasma insulin levels are inversely associated with galanin-IR and mRNA expression in the PVN of normal and diabetic rats (Akabayashi et al, 1994).

The reported effects of food deprivation (fasting) and food restriction on galanin gene expression are inconsistent. In Sprague-Dawley and Wistar rats, food deprivation has no effect on galanin mRNA levels in the ARC (Brady et al, 1990;Schwartz et al, 1993;O'Shea & Gundlach, 1991) or DMN (Schwartz et al, 1993;O'Shea & Gundlach, 1991), whereas chronic food restriction to 30% below ad- libitum for two weeks, reduces galanin mRNA expression in the ARC (Brady et al, 1990). In the Zucker rat, most groups report that acute food deprivation has no effect on galanin peptide levels in specific hypothalamic nuclei examined. However, the concentration of galanin in the pPVN and ARC of obese Zucker rats is much greater than in lean Zucker rats, while concentrations in the median eminence are much lower (Beck et al, 1993;Mercer et al, 1996;Jhanwar-Uniyal & Chua, 1993). Food deprivation in obese Zucker rats induces hypothalamic expression of galanin mRNA (Jhanwar-Uniyal & Chua, 1993). Interestingly, high fat feeding of Zucker rats has no effect on galanin gene expression in lean animals but significantly reduces galanin mRNA levels in diet induced obese Zucker rats (Mercer et al, 1996).

Clinical studies have reported that plasma galanin levels are higher in women with moderate obesity than in normal weight controls and that they correlate with leptin levels in these individuals (Baranowska et al, 1997;Baranowska et al, 2000). However, a study carried out by another group using similar methods reported no differences in plasma galanin levels (Invitti et al, 1995). The source of circulating galanin is unknown. It is not currently known whether alterations in circulating galanin concentrations contribute to the development of obesity or are a consequence of increased body weight. However, peripheral administration of galanin has no effect on food intake in rats, suggesting that circulating galanin does not influence food intake (Kyrkouli et al, 1986).

2.1.2 GALP AND ENERGY HOMEOSTASIS ICV administration of GALP to male rats causes a dose-dependent increase in food intake. The orexigenic effect of GALP is ten-fold more potent than that of galanin (Matsumoto et al, 2002) and is acute, lasting for only one hour. The orexigenic effect of GALP is exaggerated in diet induced obese rats fed on a high fat diet (Lawrence et al, 2002;Krasnow et al, 2003;Lawrence et al, 2003;Tan et al, 2005). The specific hypothalamic nuclei involved in the orexigenic action of GALP are unclear. Several groups report that microinjection of GALP into the PVN and MPOA potently stimulates food intake, while injection into the ARC, DMN or LHA has no effect on food intake (Patterson et al, 2006b;Seth et al, 2003;Taylor et al, 2009). However, one group suggests that while iDMN GALP stimulates feeding, injection into the PVN, LHA or ARC/VMH has no effect (Kuramochi et al, 2006). These discrepancies may be due to the slightly different co-ordinates used for intranuclear injection, or the different strains of rats used. It appears likely that GALP mediates its effect on food intake through multiple hypothalamic circuits.

Within the rat ARC, both NPY and orexin containing axons are in close apposition with GALP- containing cell bodies (Takenoya et al, 2002;Takenoya et al, 2003). Approximately 10% of GALP neurons in the rat ARC express the orexin-1 receptor, and in macaques, 42% express the NPY Y1 receptor (Takenoya et al, 2003;Cunningham, 2004). GALP-IR terminals are in direct contact with orexin and MCH containing neurons in the LHA (Takenoya et al, 2003;Takenoya et al, 2005). Kuramochi et al suggested that NPY containing neurons in the DMN may mediate the stimulatory effects of GALP on food intake, as the orexigenic effects of ICV GALP are attenuated in DMN lesioned rats and ICV GALP activates fos expression in NPY-containing neurons of the DMN. Furthermore, ICV anti-NPY IgG and NPY Y1 receptor antagonists block the increase in feeding observed following ICV GALP administration (Kuramochi et al, 2006). It has also been reported that GALP stimulates NPY release from static hypothalamic explants (Seth et al, 2003). Similar experiments suggest that orexin neurons within the LHA may also play a role in mediating the orexigenic effect of GALP. Again, Fos-IR was expressed in orexin neurons in the LHA following ICV GALP, and anti-orexin IgGs markedly inhibited GALP induced hyperphagia (Kageyama et al, 2006). It is possible that both of these mechanisms contribute to the acute orexigenic effect of central GALP administration.

Dopamine containing neurons of the MPOA have also been implicated in mediating the orexigenic effect of central GALP administration (Patterson et al, 2006b;Taylor et al, 2009). Specific elimination of dopaminergic neuronal inputs to the MPOA attenuates the effect of ICV GALP on food intake (Taylor et al, 2009).

Central GALP has also been reported to influence feeding in mice. However, in mice, GALP appears to inhibit food intake, albeit inconsistently, and reduce body weight (Hansen et al, 2003;Krasnow et al, 2003;Krasnow et al, 2004;Man & Lawrence, 2008a). Administration of GALP to mice was carried out under anaesthesia in these studies which may disguise any acute orexigenic effect of GALP. However, these anorectic effects may also be attributable to the impaired motor behaviour observed following administration of GALP to mice (Krasnow et al, 2003;Kauffman et al, 2005). Acute ICV administration of GALP to ob/ob mice induces a prolonged decrease in food intake and body weight lasting 4 days post-injection, while chronic ICV administration produces a sustained decrease in body weight (Hansen et al, 2003). A significant reduction in 24 hour food intake and body weight following ICV GALP administration has also been reported in rats (Krasnow et al, 2003;Lawrence et al, 2002;Taylor et al, 2009), although this has not been consistently observed (Kuramochi et al, 2006;Lawrence et al, 2003). It seems possible that the reported anorectic effects of GALP are secondary to non-specific behavioural effects, which may mask any orexigenic effect.

ICV GALP administration also causes a prolonged rise in core body temperature, mediated by prostaglandins in both rats and mice (Lawrence et al, 2002;Hansen et al, 2003;Man & Lawrence, 2008b). This effect is associated in ob/ob mice with an increase in uncoupling protein 1 mRNA and protein in brown adipose tissue compared to pair-fed control animals, suggesting an effect on thermogenesis (Hansen et al, 2003). An increase in metabolic rate as shown by increased oxygen consumption has also been reported in rats following GALP infusion (Rich et al, 2007).

The anorectic and febrile effects seen following central GALP administration in rodents have been likened to the responses seen in infection and inflammation; the prostaglandin mediated increase in core body temperature and anorexia induced by GALP are similar in intensity and timing to those produced by the cytokine interleukin-1 (IL-1). Man et al recently demonstrated that central GALP administration to rodents induces IL-1α and IL-1β expression in periventricular microglia, and that the anorectic and febrile effects of GALP are mediated by IL-1 acting via the IL-1 receptor 1 in the brain (Man & Lawrence, 2008a). The physiological or pathological relevance of these effects of GALP remain to be determined.

2.1.2.1 GALP REGULATION BY INSULIN The distribution of GALP containing neurons in the hypothalamus overlaps with the distribution of neurons expressing the insulin receptor and insulin receptor substrate-1, although no studies have specifically localised insulin receptors on GALP neurons. GALP may be regulated by insulin. Streptozotocin-induced diabetic rats, which have low circulating insulin, and diabetic fa/fa rats, which are insulin resistant, have reduced GALP mRNA expression in the ARC, and treatment with peripheral insulin restores GALP mRNA levels to those of controls (Fraley et al, 2004a;Saito et al, 2004). Food deprivation and treatment with 2-deoxy-D-glucose, an anti-metabolite which mimics a state of glucose deprivation, reduces GALP mRNA expression in the ARC of rats, an effect reversible by administration of insulin (Fraley et al, 2004a;Fraley, 2006). Circulating GALP-IR is also reduced by fasting in mice, in conjunction with a reduction in transport of GALP across the BBB. Administration of glucose increases GALP entry across the BBB consistent with an important role for GALP in regulating food intake (Kastin et al, 2001).

2.1.2.2 GALP REGULATION BY LEPTIN The distribution of GALP mRNA in the ARC overlaps with the distribution of leptin receptor mRNA, and co-localisation studies have revealed that approximately 85% of rat and 98% of macaque ARC GALP neurons express the leptin receptor (ObRb) (Cunningham et al, 2002;Jureus et al, 2000;Takatsu et al, 2001). Acute food deprivation and chronic food restriction induce a decrease in hypothalamic GALP mRNA in rats and macaques, which has been shown to be reversible by peripheral or central leptin administration in rats (Jureus et al, 2000;Cunningham et al, 2004b;Fraley et al, 2004a;Johansson et al, 2008). Furthermore, leptin deficient ob/ob mice have 70% less GALP mRNA expression in the hypothalamus compared to wild-type animals, and central (lateral ventricle) injection of leptin increases GALP mRNA content in the ARC five-fold in these animals (Jureus et al, 2001). This suggests that GALP mRNA expression is induced by leptin through a direct action on the brain. Obese fa/fa rats and db/db mice, which both have a dysfunctional leptin receptor, also have decreased hypothalamic GALP mRNA and peptide concentration, and fewer GALP positive cells in the ARC (Kumano et al, 2003;Shen & Gundlach, 2004;Saito et al, 2004). In another model of impaired leptin signalling, hypoleptinaemic (and hypoinsulinaemic) streptozotocin-induced diabetic rats also have reduced ARC GALP mRNA levels (Shen & Gundlach, 2004;Fraley et al, 2004a). In vitro studies reveal that leptin stimulates GALP release from male hypothalamic explants (Seth et al, 2004).

GALP may therefore be regulated by leptin. However, the effects of leptin on GALP appear counter- intuitive if GALP is orexigenic as experiments in rats suggest (Matsumoto et al, 2002). It is possible

that the regulation of GALP by leptin is related to a role for GALP in the reproductive axis, rather then in feeding. This aspect of GALP action will be discussed in detail in chapter 3. Alternatively, it is possible the reported anorectic effects of GALP discussed above reflect a physiological role in mediating the suppressive effects of leptin on appetite.

2.1.3 OTHER GALANIN RELATED PEPTIDES AND FOOD INTAKE

There have been no studies carried out investigating the role of central GMAP in energy homeostasis. At a time when the role of galanin in energy homeostasis was being explored, GMAP was not commercially available and is difficult to produce by solid phase peptide synthesis as it is such a large peptide (Xu et al, 1996).

While these studies were being conducted, there was no published data regarding the effects of alarin on energy homeostasis.

2.1.4 GALANIN RECEPTOR MEDIATING EFFECTS ON FEEDING The galanin receptor or receptors responsible for mediating the effects of galanin and GALP on food intake are unknown. GalR1 and GalR2 knockout mice have not been reported to display any marked energy homeostasis-related phenotype (Jacoby et al, 2002;Krasnow et al, 2004), but it has been suggested that GalR1-knockout mice are unable to adjust food intake in response to acute changes in dietary fat (Zorrilla et al, 2007). In addition, levels of GalR1 mRNA are increased in the PVN following glucose and fat deprivation (Gorbatyuk & Hokfelt, 1998a). Thus GalR1 may oppose positive energy balance or help to maintain neutral energy balance, although further studies are required to determine a mechanism for this effect of GalR1 signalling.

Central administration of the GalR2/3 agonist AR-M1896, or the GalR2 preferring ligand galanin 2– 29, has no effect on food intake in rats (Man & Lawrence, 2008b;Seth et al, 2003;Wang et al, 1998a), suggesting that the GalR1 or an unknown receptor is most likely to mediate the orexigenic effects of galanin and GALP.

GALP is ten times more potent than galanin for the stimulation of food intake (Lawrence et al, 2002). The affinity of galanin to the GalR1 receptor is about 40-fold higher than that of GALP; therefore, it is unlikely that the GalR1 mediates the effect of GALP on food intake. Since GALP has a high affinity for the GalR2 receptor, the GalR2 receptor could mediate GALP-induced feeding behaviour. However, the affinities of galanin and GALP to the GalR2 receptor are almost equal. Assuming that GalR2 mediates the effect of GALP, this does not explain the difference of potency in feeding between galanin and GALP. Additionally, although both galanin and GALP have an acute stimulatory effect on food intake in the rat, only GALP has a suppressive effect on feeding and body weight after 24 h (Lawrence et al, 2002) suggesting activation of different pathways by galanin and GALP.

These results suggest the possible existence of unknown receptors that mediate feeding by GALP and/or galanin.

2.2 HYPOTHESIS I propose that alarin functions as a hypothalamic neurotransmitter which regulates appetite and reproductive function.

2.2.1 AIMS Alarin, like other members of the galanin-family of peptides may influence energy homeostasis. Both galanin and GALP have orexigenic actions when administered centrally in rats. The mechanisms by which galanin and GALP are thought to stimulate feeding differ considerably. The effect of ICV administration of alarin on food intake has not been investigated. I hypothesise that central administration of alarin will influence food intake in rats. To test this hypothesis I will

1) Determine the effects of central administration of alarin on food intake in rats 2) Determine the effects of central administration of alarin on behaviour in rats 3) Investigate the mechanisms by which alarin mediates its effect on feeding in rats 4) Investigate whether alarin is a physiological regulator of appetite in the rat

2.3 MATERIALS AND METHODS

2.3.1 MATERIALS Rat alarin (used in all studies unless specified otherwise) was synthesised by BioMol International LP (Exeter, UK). The peptide was synthesised on a TentaGel® resin, using an Fmoc/t-butyl-based solid- phase synthesis strategy. The product was purified by reversed-phase preparative high performance liquid chromatography (HPLC) followed by lyophilisation. Analysis of the purified product by reverse-phase HPLC and by mass spectrometry showed above 90% purity (molecular weight 2820.8). The peptide was not C-terminally amidated. Angiotensin II, GALP, Neuromedin U (NMU), NPY and [Nle4,D-Phe7]-α-MSH (NDP-MSH) were purchased from Bachem UK Ltd. (Merseyside, UK). Cannulation materials were purchased from PlasticsOne, Inc. (Roanoke, VA). Reagents for explant experiments were purchased from BDH (Poole, UK) and Invitrogen Ltd (Paisley, UK). Alarin ELISA kit was purchased from Peninsula Laboratories, LLC. (Bachem Group, San Carlos, CA).

2.3.2 ANIMALS Adult male Wistar rats (Charles River, Bicester, UK) were maintained in individual cages under controlled temperature (21-23°C) and light (12 hours light, 12 hours dark, lights on at 7am) with ad- libitum access to food (pelleted rat chow, RM1 diet (SDS, UK Ltd, Witham, UK) and water. All animal procedures performed were approved by the British Home Office Animals (Scientific Procedures) Act 1986 (Project licence number 70/6402). For all studies rats were randomised into groups of approximately equal mean body-weight (within 1g). Body-weight and food intake were measured daily. Food was weighed on balances accurate to 0.01g (Adam Equipment, Milton Keynes, UK). Animals which were considered unwell, or had reduced bodyweight or low food intake were excluded from studies.

2.3.3 IN VIVO STUDIES

2.3.3.1 INTRACEREBROVENTRICULAR CANNULATION Animals were anaesthetised using injectable anaesthetic drugs. Animals were given an intraperitoneal (IP) injection of xylazine (Rompun 12mg/kg, Bayer UK Ltd, Bury St Edmonds, UK) and ketamine (Ketalar 60mg/kg, Parke-Davis, Pontypool, UK) in a 2:5 ratio. Prophylactic antibiotics were administered to prevent post-operative infection. An intraperitoneal injection of amoxycillin sodium (37.5 mg/kg) and flucloxacillin (37.5 mg/kg) was given prior to surgery. Animals were then placed in a Kopf stereotaxic frame (David Kopf instruments, supplied by Clark Electromedical Instruments, Kent, UK) with the incisor bar set at 3mm below the interaural

line. The head was cleaned with 10% w/v povidone/iodine solution (Betadine, Seton Scholl Healthcare, UK). A 1.5cm incision was made in the scalp and the skull surface exposed by removal of the periosteum. A hole was drilled 0.8mm posterior to the bregma using a handheld electric drill (David Kopf Instruments) and a permanent 22-gauge stainless steel cannula (Plastics One Inc) was stereotaxically implanted 6.5mm below the skull into the third cerebral ventricle. Three stainless steel jewellers’ screws were secured into the skull in three additional drill holes to anchor the dental cement (Associated Dental Products Ltd) used to seal the wound and hold the cannula in position. The rats were rehydrated by an i.p. injection of 0.9% saline (5 ml/rat). Animals received a single subcutaneous injection of buprenophrine (45 mg/kg, Schering-Plough Corp, Welwyn Garden City, UK) for analgesia post-operatively. A plastic-topped wire cap (Plastics One Inc.) was then inserted into the cannula to prevent blockage. Following a seven day recovery period, the animals were handled daily for one week to minimise the stress response following injection. Correct cannula placement was confirmed by a positive dipsogenic response to the administration of angiotensin II (50 ng per animal) (Epstein et al, 1970).

2.3.3.2 INTRACEREBROVENTRICULAR INJECTION In all ICV feeding studies, peptides were administered in a volume of 5 µl at a rate of 120 µl per hour to conscious, freely moving animals via a stainless steel injector projecting 1 mm beyond the tip of the cannula. The injector was connected by polythene tubing to a Hamilton syringe (Fisher Scientific, Leicestershire, UK) in a Harvard infusion pump (Harvard Apparatus, Massachusetts, USA). The tubing was filled with water and an air bubble drawn up to separate the experimental compound from the water. Each experimental group was injected by a single individual. This minimises cross- contamination of peptides between injections and allows all animals to be injected within a relatively short time period (< 1 hour), resulting in daily fluctuations in food intake having little effect. Each individual would typically inject up to 20 animals. Following injection, animals were returned to their home cages with a pre-weighed amount of chow and free access to water. The remaining food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body-weight was measured at 0 hour and 24 hours post-injection. Cannulated animals were used in multiple experiments, receiving a maximum of 10 injections. The minimum washout period between injections was 72 hours.

2.3.3.3 EFFECT OF ICV ALARIN ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS BEFORE THE EARLY DARK PHASE To observe whether alarin effects food intake during the natural feeding period of the rat, ad-libitum fed male Wistar rats were injected ICV with 0.9% saline, alarin (3, 10, 30 or 90 nmol), or 3 nmol [Nle4,D-Phe7]-α-MSH (NDP-MSH) (positive control) (Brown et al, 1998) before the onset of the dark phase (1900h) (n = 9-10 saline and alarin, n = 5 NDP-MSH).

2.3.3.4 EFFECT OF ICV ALARIN ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE Overnight fasted male Wistar rats received a single ICV injection of either 0.9% saline, alarin (3, 10, 30 or 90 nmol), or 3 nmol NDP-MSH (positive control) between 0900 and 1000h (n = 7-9 saline and alarin, n = 4 NDP-MSH).

2.3.3.5 EFFECT OF ICV ALARIN ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE

Groups of ad-libitum fed male Wistar rats were ICV injected with either 0.9% saline, alarin (3, 6, or 30 nmol), or 2.4 nmol NPY (positive control) (Levine & Morley, 1984) during the early light phase between 0900 and 1000h (n = 8-10 saline or alarin, n = 5 NPY).

2.3.3.6 EFFECT OF ICV ALARIN ON BEHAVIOUR IN AD-LIBITUM FED MALE RATS IN THE EARLY LIGHT PHASE Ad-libitum fed male Wistar rats received a single ICV injection of 0.9% saline, 30 nmol alarin, 1 nmol GALP or 3 nmol neuromedin U (NMU) (positive control) (Wren et al, 2002) (n = 10 saline, alarin and GALP, n = 5 NMU) in the early light phase (0900-1000h). The dose of alarin was chosen based on data from the feeding studies described in sections 2.3.3.3-2.3.3.5. Behavioural patterns were monitored continuously for 120 minutes after injection by observers blinded to the experimental treatment. Behaviour was classified into ten different categories: feeding, drinking, grooming, burrowing, rearing (defined as stationary with front paws elevated), locomotion (defined as moving around the cage with all four paws moving), head down, pica (defined as eating of non-food substances), tremor and sleeping, using a method adapted from (Fray et al, 1980). During the analysis, each rat was observed for 15 seconds every 5 minutes. This 15 second period was subdivided into three 5 second periods, and the behavior of the rat during each time period was noted. Each rat had a total of 36 behaviours recorded per hour. These methods have previously been used to detect abnormal behavior following central nervous system administration of appetite-effecting neuropeptides (Wren et al, 2002;Abbott et al, 2001). 92

2.3.4 IN VITRO STUDIES

2.3.4.1 EFFECT OF ALARIN ON NEUROPEPTIDE RELEASE FROM MEDIAL BASAL HYPOTHALAMIC EXPLANTS Hypothalamic explants were used to determine the effect of alarin on hypothalamic neuropeptide release using an established method (Beak et al, 1998). Adult male Wistar rats were maintained in cages of five under standard conditions as described in section 2.3.2. Rats were killed by decapitation. The brain was rapidly dissected and mounted, ventral side uppermost, onto a platform using superglue (Loctite). This was then placed in a vibrating microtome (Campden Instruments, Loughborough, UK) where the brain was bathed at 4°C in oxygenated artificial cerebrospinal fluid (aCSF) (appendix). A 1.9mm slice was taken from the base of the brain to include the PVN and the POA. The hypothalamic tissue was then dissected free, bordered anteriorly by the POAs, laterally by the hypothalamic fissures and at the posterior by the mammillary bodies, and transferred to a 12 x 75mm polypropylene tube containing 1ml aCSF equilibrated with

95% O2 and 5% CO2 and maintained on a static platform in a water bath at 22°C until all explants had been dissected. At the start of the experiment, the temperature of the water bath was increased to 37°C. The hypothalami were then pre-incubated for 120 minutes, with the aCSF replaced after 60 minutes. Tissues were then exposed to the test substance or to aCSF (basal period) for 45 minutes in 600 µl aCSF. Treatment was then reversed so tissues having received the test substance then underwent a basal period and vice versa for a further 45 minutes. Finally, the viability of the tissue was verified by a 45 minutes exposure to aCSF containing 56 mM KCl; isotonicity was maintained by substituting K+ for Na+. The aCSF was removed at the end of each incubation period and frozen at - 80°C until determination of release of NPY, αMSH, and CART by radioimmunoassay as described in section 2.3.5.1. Explants not showing an increase in peptide release following 56 mM KCl treatment were excluded from the analysis.

2.3.4.2 PRINCIPLES OF RADIOIMMUNOASSAY Radioimmunoassay (RIA) is a technique used for the measurement of a wide range of materials including hormones. The basic principle of the assay is based on competition between unlabelled and radioactively labelled antigen (peptide) for an antibody binding site. Specificity is dependent on the ability of the antibody to recognize subtle structural features of the antigen molecule. The most commonly used radiolabel is 125Iodine (125I), and antibodies are often obtained by immunising rabbits with antigen (often a peptide) plus adjuvant (though polyclonal antibodies from other species and monoclonal antibodies can be used). In the RIA both the labelled peptide and antibody are at specific concentrations. The concentration of antibody is limiting so antigen binding will be finite. The unlabelled peptide in a sample will compete with labelled peptide for antibody binding. Thus the amount of radiolabelled antigen bound to the antibody is inversely proportional to the amount of unlabelled antigen in the sample being examined, allowing the amount of unlabelled peptide in a sample to be determined. A ‘standard curve’ is determined using known concentrations of pure peptide to calculate the percentage of labelled peptide bound for each concentration of unlabelled pure peptide. Separation of the unbound radiolabelled antigen from the radiolabelled antigen-antibody complex and counting of the proportion of radiolabel present in the two fractions allows direct measurement of the amount of unlabelled antigen that has bound to the antibody. By reference to the standard curve, the unknown concentrations of peptide in the sample can be obtained by interpolation (Thorell & Larson, 1978). Various techniques exist which enable antibody-bound antigen to be distinguished from free antigen, allowing the distribution of the radioactive antigen between the two fractions to be determined. The two methods used in this work are separation by adsorption with charcoal (free radiolabelled antigen is contained in the charcoal pellet following centrifugation), or using a primary antibody/secondary antibody complex (free label is contained in the supernatant following centrifugation). For charcoal separation, dextran is added to a charcoal suspension (appendix) to block the larger holes in the porous charcoal. Suspension containing 4mg of charcoal/tube (250 µl) is then added to each RIA tube, where it traps the free radiolabelled antigen. The tubes are then centrifuged for 20 minutes at 1500g and the supernatant (containing antibody-bound complex) and carbon pellet (free radiolabelled antigen) are separated by aspiration, and the bound and free label counted in a gamma (γ) counter (model NE1600, Thermo Electron Corporation). Peptide concentrations in the samples were calculated using a non-linear plot (RIA Software, Thermo Electron Corporation) and results calculated in terms of the NIDDK standard preparations. With the secondary antibody separation method, the secondary antibody is derived from an animal species different from that used to generate primary antibody. For example, the LH primary antibody is raised in a rabbit, and separation is achieved using a sheep anti-rabbit secondary antibody. For all

the assays described in this report, the secondary antibody used is sheep anti-rabbit solid phase second antibody (Pharmacia Diagnostics, Uppsala, Sweden). The samples were pre-incubated for 60 minutes with 100 µl of secondary antibody. Immediately prior to centrifugation, 500 µl of 0.01% Triton-X- 100 solution, and 100 µl of 10% polyethylene glycol (appendix) was added to each tube. The samples were then centrifuged at 1500g at 4°C for 20 minutes. Bound and free label were then separated using a Pasteur pipette and both the pellet and supernatant counted for 180 seconds in a γ counter as described above. Each RIA has optimum conditions regarding type of buffer used, assay volume, antibody titre, incubation time, temperature and separation method used. The in-house departmental assays used are usually incubated at 4°C for 3-5 days. All samples were assayed in duplicate. Non-specific binding tubes which do not contain antibody were included at the beginning of the assay. Tubes containing half and twice the standard volume of added labeled antigen were also included to confirm the quality of the radiolabel. To measure and correct for baseline drift, tubes with no sample (zero tubes) were placed at regular intervals throughout the assay and standard curves set up at both the beginning and the end of each assay. The analytical sensitivity of each assay was determined by the smallest change in hormonal concentration that can be reliably detected, essentially governed by the drop in the standard curve and the error of a given known value on the curve. The analytical sensitivity was calculated as the smallest standard curve value measured which is 2 standard deviations from the zero standard, which contains no unlabelled peptide (95% confidence limits) (Thorell & Larson, 1978).

2.3.4.2.1 HYPOTHALAMIC NEUROPEPTIDE RIAS The peptides used were purchased from Phoenix Pharmaceuticals or Bachem. All other reagents and materials were supplied by Sigma (Poole, Dorset, UK) or BDH (Poole, Dorset, UK). Standard curves prepared for each assay used synthetic peptide made up to varying concentrations in assay buffer and added in duplicate at volumes of 1, 2, 3, 5, 10, 15, 20, 30, 50 and 100 µl. Peptides were iodinated using the iodogen method and purified by Prof. M. Ghatei (Owji et al, 1995). Reaction products were purified by high performance liquid chromatography (HPLC) (Gilson 321- H1) using a C18 column (Waters, Milford, CT, USA). Fractions were tested by RIA and used at 1500 counts per minute/tube (cpm/tube). Antisera were raised in rabbits immunized with each peptide conjugated to Freund’s adjuvant as described previously (White, 1963).

2.3.4.2.1.1 NPY RIA NPY peptide was purchased from Bachem (UK) Ltd. Standard curves prepared for the NPY assay were made up to 1 pmol/ml in assay buffer. The assay was carried out in 0.06 M phosphate buffer with 1% BSA and 0.02% Tween 20. Sample volume of hypothalamic aCSF was 20 µl and samples were assayed in duplicate in a total volume of 350 µl, containing a rabbit anti-NPY antibody at a final dilution of 1:120,000 and 1500cpm/tube of iodinated NPY. The antiserum showed full cross reactivity to synthetic NPY. The assays were incubated at 4°C for 72 hours, before free and antibody bound peptide were separated using a secondary antibody. The intra- and interassay variation was 7% and 8% respectively.

2.3.4.2.1.2 α-MSH RIA Alpha-MSH peptide was purchased from Bachem (UK) Ltd. Standard curves prepared for the α-MSH assay were made up to 0.2 pmol/ml in assay buffer. The assay was carried out in 0.06 M phosphate buffer containing 0.3% BSA. Sample volume of hypothalamic aCSF was 100 µl and samples were assayed in duplicate in a total volume of 400 µl, containing a rabbit anti-α-MSH antibody at a final dilution of 1:20000 and 1500cpm/tube of iodinated α-MSH. The antiserum showed full cross reactivity to synthetic α-MSH but no cross reactivity to any other POMC product. The assays were incubated at 4°C for 72 hours, before free and antibody bound peptide were separated by charcoal adsorption of the free fraction. The sensitivity of the assay was 1 fmol/ml. The intra- and interassay variation was 7% and 8% respectively.

2.3.4.2.1.3 CART RIA CART peptide was purchased from Bachem (UK) Ltd. Standard curves prepared for the CART assay were made up to 1 pmol/ml in assay buffer. The assay was carried out in 0.06 M phosphate buffer containing 0.3% BSA and 0.02% Tween 20. Sample volume of hypothalamic aCSF was 20 µl and samples were assayed in duplicate in a total volume of 350 µl, containing a rabbit anti-CART antibody at a final dilution of 1:80000 and 1500cpm/tube of iodinated CART. The assays were incubated at 4°C for 72 hours, before free and antibody bound peptide were separated by charcoal adsorption of the free fraction. The sensitivity of the assay was 1.25 fmol/tube. The intra- and interassay variation was 8% and 9% respectively.

2.3.4.3 THE EFFECT OF FASTING ON HYPOTHALAMIC ALARIN IMMUNOREACTIVITY

2.3.4.3.1 RAT HYPOTHALAMIC TISSUE Adult male Wistar rats were maintained in cages of five under standard conditions as described in section 2.3.2. Rats were either fasted for 24 hours, or ad-libitum fed prior to decapitation in the early light phase (n = 12-15 per group). The hypothalamus was rapidly dissected out, weighed and immediately snap frozen in liquid nitrogen and stored at -80°C until extraction.

2.3.4.3.2 ACETIC ACID EXTRACTION Extraction of peptides is carried out under acidic conditions as a number of proteolytic enzymes are inactivated at low pH. This method of extraction has been shown to give the highest yield of neuropeptides including NPY and VIP (El-Karim et al, 2003). Hypothalami were extracted by boiling for 15 minutes in 500 µl of 0.5M acetic acid (appendix). Extracts were stored at -80°C until assay for alarin.

2.3.4.3.3 ALARIN ELISA Alarin ELISA was used according to the manufacturer’s instructions. Varying concentrations of human alarin standard (0.04-25 ng/ml) (50 µl) or rat hypothalamic acetic acid extract (50 µl) was added to wells of an immunoplate, and antiserum to human alarin added to each well. Following one hour incubation at room temperature, a set concentration of biotinylated tracer was added to each well to compete for binding specifically to the antiserum, and samples were incubated for a further two hours. The immunoplate was then washed five times using an ELISA buffer before streptavidin- conjugated horseradish peroxidase (SA-HRP) was added to each well and samples were incubated for an hour. SA-HRP binds captured biotinylated tracer. After a further washing step with buffer, 3,3’,5,5’-tetramethyl benzidine dihydrochloride (TMB) was added to each well and the plate was incubated for 30 minutes. Addition of TMB produces a soluble coloured product. The reaction was terminated by addition of 2 N HCl. Absorbance was read at 450 nm within ten minutes using a plate reader (Labsystems Multiskan MS, Cambridge, UK). The concentration of alarin-like immunoreactivity in hypothalamic extract samples was determined using the standard curve. Cross reaction of peptide in this ELISA was 100% with alarin and 0% with GALP (human).

2.3.5 STATISTICS All data is presented as mean ± standard error of the mean (SEM). Data from the feeding studies were analysed using a one-way ANOVA (analysis of variance) with post-hoc Dunnett’s multiple comparison test (GraphPad Prism 5). As behavioural observation data were not normally distributed, Kruskal-Wallis one-way ANOVA on ranks was used for comparisons between treatment groups (Systat 11, San Jose, CA). Data from the hypothalamic explant studies were compared by paired Student t-test between the basal and the test period. For NPY, these data were pooled from three separate experiments in order to generate an n number of approximately 24 per group. In each individual experiment, explants act as their own control. In all cases, P<0.05 was considered to be statistically significant.

2.4 RESULTS

2.4.1 EFFECT OF ICV ALARIN ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS BEFORE THE EARLY DARK PHASE There was no significant effect of ICV alarin (3, 10, 30 or 90 nmol) administered before the onset of the dark phase on food intake 0-1 h post-injection in rats. NDP-MSH (3 nmol) significantly reduced 0-1h and 0-24h food intake. (0-1 h food intake/g: saline 2.2 ± 0.3, NDP-MSH (3 nmol) 0.3 ± 0.1 P<0.05. 0-24 h food intake/g: saline 23.0 ± 1.8, NDP-MSH (3 nmol) 8.5 ± 0.6 P<0.001, n = 9-10 saline and alarin, n = 5 NDP-MSH) (Figure 2.1A and B). There was no significant effect of alarin on food intake at any other dose or time point studied. There was no significant effect of alarin on body weight at 24h. The highest dose of alarin (90 nmol) caused several of the animals within this group to appear unwell immediately following the injection.

2.4.2 EFFECT OF ICV ALARIN ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE There was no significant effect of ICV alarin (3, 10, 30 or 90 nmol) on food intake 0-1 h post- injection in fasted rats. NDP-MSH (3 nmol) significantly reduced food intake. (0-1 h food intake/g: saline 4.9 ± 0.4, NDP-MSH 3 nmol 2.7 ± 0.1 P<0.05, n = 7-9 saline and alarin, n = 4 NDP-MSH) (Figure 2.2A). ICV alarin (90 nmol) significantly reduced food intake between 0-24 h post-injection (0-24 h food intake/g: saline 32.8 ± 1.8, alarin 90 nmol 23.8 ± 2.2 P<0.05, n = 7-9 saline and alarin, n = 4 NDP-MSH) (Figure 2.2B). There was no significant effect of alarin on food intake at any other dose or time point studied. There was no significant effect of alarin on body weight at 24 h. The highest dose of alarin (90 nmol) caused several of the animals within this group to appear unwell immediately following the injection.

2.4.3 EFFECT OF ICV ALARIN ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE ICV administration of alarin (30 nmol) and NPY (2.4 nmol) to ad-libitum fed male Wistar rats in the early light phase significantly increased food intake 0-1 h post injection compared to saline (0-1 h food intake/g: saline 0.6 ± 0.3, alarin (30 nmol) 3.1 ± 0.6 P<0.01, NPY 2.4 nmol 3.6 ± 1.1 P<0.01, n = 8-10 saline and alarin, n = 5 NPY) (Figure 2.3A). There was no significant effect of alarin on food intake at any other dose or time point studied (Figure 2.3B-F). There was no significant effect of alarin on body weight at 24 h. Alarin (30 nmol) was considered to be the most effective dose without any obvious adverse behavioural effects.

FIGURE 2.1 The effect of ICV injection of saline, alarin (3, 10, 30 or 90 nmol) (n = 9-10) or [Nle4,D-Phe7]- α-melanocyte stimulating hormone (NDP-MSH) (3 nmol) (positive control) (n = 5 NDP-MSH) on 0-1h (A) and 0-24h (B), food intake in ad-libitum fed male rats before the onset of the dark phase. *, P<0.05; ***, P<0.001 vs. saline. Results are mean ± SEM.

FIGURE 2.2 The effect of ICV injection of saline, alarin (3, 10, 30 or 90 nmol) (n = 7-9) or [Nle4,D-Phe7]-α- melanocyte stimulating hormone (NDP-MSH) (3 nmol) (positive control) (n = 4 NDP-MSH) on 0-1h (A) and 0- 24h (B), food intake in fasted male rats in the early light phase. *, P<0.05 vs. saline. Results are mean ± SEM.

100

FIGURE 2.3 The effect of ICV injection of saline, alarin (3, 6, or 30 nmol) (n = 8-10 per group) or neuropeptide Y (NPY) (2.4 nmol) (positive control) (n = 5) on 0-1h (A), 1-2h (B), 2-4h (C), 4-8h (D), 8-24h (E), and 0-24h (F) food intake in ad-libitum fed male rats in the early light phase. ***, P<0.001 vs. saline. Results are mean ± SEM. 101

2.4.4 EFFECT OF ICV ALARIN ON BEHAVIOUR IN AD-LIBITUM FED MALE RATS IN THE EARLY LIGHT PHASE

ICV administration of 30 nmol alarin had no significant effect on behaviours observed over a 2 hour period in ad-libitum fed male Wistar rats when injected in the early light phase compared to saline controls (n = 10 saline, alarin and GALP, n = 5 NMU) (Figure 2.4 and Table 2.1). Animals injected with 1 nmol GALP showed a significant reduction in grooming compared to saline injected animals in the 0-1 hour time period. NMU 3 nmol was used as a positive control. Animals that received NMU showed significant increases in grooming, locomotion and drinking and a significant decrease in rearing and sleeping compared to saline injected animals in the 0-1 hour time period (n = 10 saline, alarin and GALP, n = 5 NMU) (Table 2.1). Animals injected with alarin showed a significant increase in grooming, rearing and locomotive behaviour compared to GALP injected animals in the 0-1hour time period (Table 2.1). To estimate the time at which ICV alarin stimulates food intake within the first hour post-injection, the frequency of feeding behaviour observed following ICV administration of saline, alarin (30 nmol) and GALP (1 nmol) was analysed in 10 minute time bins. ICV alarin administration was associated with an increase in the frequency of feeding behaviour observed 20-30 and 30-40 minutes post- injection compared to saline injected rats (Figure 2.5).

FIGURE 2.4 The effect of ICV administration of saline (A) or alarin (30 nmol) (B) to ad-libitum fed male rats in the early light phase (n = 10 per group) on behaviour between 0-1h post injection. Animals were observed for 15 seconds every 5 minutes and this 15-second period was subdivided into three. The behaviour of the rat during each time period was scored. Data are presented as % of total behaviours observed.

102

FIGURE 2.5 The effect of ICV administration of saline, alarin (30 nmol), or galanin like peptide (GALP) (1 nmol) to ad-libitum fed male rats in the early light phase (n = 10 per group) on the frequency of feeding behaviour observed in each 10 minute time period between 0-1h post injection. Animals were observed for 15 seconds every 5 minutes and this 15-second period was subdivided into three. The behaviour of the rat during each time period was scored. Data are presented as % of total behaviours observed.

103

TABLE 2.1 The effect of ICV administration of saline, 30 nmol alarin, 1 nmol galanin-like peptide (GALP), or 3 nmol neuromedin U (NMU) to ad-libitum fed male rats in the early light phase (n = 5-10 per group) on behaviour. Animals were observed for 15 seconds every 5 minutes and this 15-second period was subdivided into three. The behaviour of the rat during each time period was scored. Data are presented as median (interquartile range). a P < 0.05 vs. saline aa P < 0.01 vs. saline aaa P < 0.001 vs. saline b P < 0.05 vs. GALP. 104

2.4.5 EFFECT OF ALARIN ON NEUROPEPTIDE RELEASE FROM HYPOTHALAMIC EXPLANTS IN VITRO Treatment with 100 nM alarin significantly increased NPY release from adult male rat hypothalamic explants in vitro compared with basal release (NPY: basal 100 ± 7.4%, 100 nM alarin 129.8 ± 10.2%, P<0.05, n = 16-24). At a lower dose (10 nM), or a higher dose (1000 nM), alarin did not significantly influence NPY release. Data are presented as a percentage of basal release. These data are pooled from three separate experiments (Figure 2.6A). Alarin had no statistically significant effect on αMSH or CART release from hypothalamic explants at any dose examined (Figure 2.6B and C).

FIGURE 2.6 The effect of alarin (10, 100 or 1000 nM) on Neuropeptide Y (NPY) (n = 16-24) (A), alpha- melanocyte stimulating hormone (αMSH) (n = 12-24) (B), or cocaine and amphetamine regulated transcript (CART) (n = 12-24) (C) release from hypothalamic explants from adult male rats. Data are presented as percentage of basal release, and are pooled from three separate experiments. *, P<0.05 Results are mean ± SEM.

105

2.4.6 THE EFFECT OF FASTING ON HYPOTHALAMIC ALARIN IMMUNOREACTIVITY There was no statistically significant difference between the levels of alarin-like IR in hypothalamic extracts from fed or fasted rats (hypothalamic alarin fmol/hypothalamus: fed 32.8 ± 5.2, fasted 33.5 ± 4.9, n = 12-15 per group) (Figure 2.7).

FIGURE 2.7 Alarin-like immunoreactivity in hypothalami taken from ad-libitum fed or 24 hour fasted male Wistar rats (n = 12-15 per group). Results are mean ± SEM.

106

2.5 DISCUSSION

Alarin stimulates food intake in ad-libitum fed male rats following ICV administration in the early light phase. This is in accord with the orexigenic effect observed following ICV injection of other members of the galanin peptide family to rats (Matsumoto et al, 2002;Kyrkouli et al, 1986).

While all doses of alarin administered to ad-libitum fed rats in the early light phase increased food intake at one hour post-injection, only the effect of the highest dose of 30 nmol of alarin reached statistical significance, with a mean food intake five fold greater than saline injected animals. Since rats are nocturnal, the light phase is not the natural feeding period and thus any stimulation of hunger circuits will be more apparent at this time. The orexigenic effect of alarin appears to be relatively weak compared to well characterised hypothalamic orexigenic neuropeptides such as NPY and GALP, which potently stimulate food intake at doses of 0.5 nmol and 0.3 nmol respectively (Levine & Morley, 1984;Matsumoto et al, 2002). Indeed, the orexigenic effect of alarin is not observed in experimental paradigms where rats have a natural drive to eat, such as at the onset of the dark phase (the normal feeding period of the rat), or following an overnight fast. ICV GALP administration (1.5 nmol) stimulates food intake in fasted rats, highlighting its more potent effect on food intake compared to alarin (Lawrence et al, 2002).

The high dose of alarin required to stimulate food intake may be due to the lack of a target receptor in the immediate region surrounding the third ventricle. It is also possible that alarin acts only as a weak ligand at the receptor which mediates its effect on food intake. However, the endogenous receptor for alarin is currently unknown, and it is therefore impossible to ascertain whether this is the correct explanation. GALP is a more potent stimulator of appetite than galanin (Lawrence et al, 2002;Matsumoto et al, 2002). GALP is reported to bind to all three galanin receptors with a lower affinity to the GalR1 and GalR2 than galanin, and a higher affinity than galanin for the GalR3 (Lang et al, 2005;Ohtaki et al, 1999;Smith et al, 1998). Evidence suggests that GALP also binds to one or more additional unknown receptors (Fraley et al, 2003;Lawrence et al, 2003;Seth et al, 2004). It is possible that alarin mediates its orexigenic effect via binding to the same unknown receptor as GALP. Therefore the discrepancy between the potency of GALP and alarin may be due to GALP binding at many receptors to mediate its effect on food intake, while alarin binds to only one receptor. I have carried out receptor binding studies determining whether alarin binds to the galanin receptors in chapter 4.

107

During the course of my studies, a paper was published reporting an orexigenic effect of lateral ventricle (LV) administration of alarin (Van Der Kolk et al, 2010a). In this study, LV administration of 1 and 5 nmol alarin significantly stimulated food intake between 0-30 minutes post-injection. At 2, 3 and 4 hours, all doses of alarin (0.1, 0.5, 1 and 5 nmol) significantly increased cumulative food intake compared to vehicle, although not dose dependently. The doses of alarin used in this study were much lower than the doses that my studies required for an orexigenic effect. It is possible that the lateral ventricle is anatomically closer than the third ventricle to the brain region(s) mediating the effect of alarin on food intake, and therefore lower doses of alarin are sufficient to elicit an orexigenic effect. Alternatively, the use of C-terminally amidated synthetic alarin in these studies may account for the difference in potency of alarin between this study and my data. Amidation of a synthetic peptide enhances its biological activity by increasing resistance to breakdown by aminopeptidases, blocking against synthetase activity, and increasing permeability of cells compared to non-amidated synthetic peptides. The importance of amidation for biological activity is highlighted by the observation that more than half of known mammalian peptide hormones are amidated (Eipper & Mains, 1988). However, there is no reason that endogenous alarin would be amidated. The C-terminal residue of alarin is a serine. Endogenous amidation is catalysed by the bifunctional enzyme, peptidylglycine α-amidating monooxygenase (PAM), which converts peptides with the structure -X-

Gly to the form -X-NH2 (Eipper & Mains, 1988;Bradbury et al, 1982).

My studies suggest that alarin increases food intake between 0-1 hour post injection, with no difference in food intake at any later time points studied. This is similar to the time course of food intake seen following ICV GALP injection, which has its maximal orexigenic effect at 30 – 60 minutes post-injection (Tan et al, 2005). Interestingly, a closer examination of the behavioural analysis shows evidence of a doubling in the frequency of feeding behaviour in alarin injected animals between 30 to 60 minutes post-injection compared to the frequency observed in saline injected animals. More specifically, alarin injected animals have a much greater incidence of feeding behaviour between 30-40 minutes post injection, suggesting that there may be a 30 minute delay before alarin stimulates feeding. There is little difference in the frequency of feeding behaviour between saline and alarin injected animals up to 30 minutes. This effect of alarin on food intake is rapid and suggests a site of action local to the point of administration (third cerebral ventricle). In support of a hypothalamic site of action for the orexigenic effect of alarin, LV alarin administration induces Fos-IR in hypothalamic nuclei known to be involved in energy homeostasis (Van Der Kolk et al, 2010a). Fos-IR cells were observed in the PVN, DMN, LHA and ARC of alarin (1 nmol) injected rats. This dose of alarin elicited a significant increase in food intake in this study. The acute orexigenic effect of alarin provides another reason why the orexigenic effect of alarin may not be

108

apparent in feeding studies where rats already have a drive to eat. Fasted rats or rats at the onset of the dark phase presented with food have a very high food intake for the first hour, which might mask any orexigenic effects of alarin.

My studies suggest that ICV alarin has no effect on cumulative food intake or body weight 24 hours after injection. This is in contrast to what has been reported regarding the effect of GALP, and more recently alarin, on body weight. LV alarin administration at a dose of 1 nmol, but not at any other dose, significantly increased body weight between 0-24 hours (Van Der Kolk et al, 2010a). The discrepancy between this study and my data may be due to differences in the route of administration of alarin, or the use of an amidated form of alarin used in these studies, as described above. Several studies have observed a significant reduction in 24 hour food intake, and almost all report a reduction in body weight following ICV GALP administration in rats (Krasnow et al, 2003;Lawrence et al, 2002;Taylor et al, 2009). It is possible that the reduction in body weight observed following ICV GALP administration is due to activation of a receptor at which alarin does not bind. However, ICV galanin has no effect on body weight at 24 hours, and it is therefore unlikely to be any of the known galanin receptors which mediate this effect of GALP (Lawrence et al, 2002). Recent data reports c- Fos protein expression in astrocytes surrounding the ventricles and periventricular regions following ICV GALP, a response not observed following ICV galanin (Lawrence et al, 2003). Astrocytes are involved in inflammatory responses to infection and injury in the brain and release cytokines such as interleukin-1 (IL-1) (Dong & Benveniste, 2001). Furthermore, ICV GALP (and galanin) administration has been associated with a prostaglandin mediated rise in core body temperature (Lawrence et al, 2002). ICV GALP administration induces IL-1 protein expression in the rat brain, and co-infusion of GALP with an IL-1 receptor antagonist partially reverses the reduction in food intake and body weight at 24 hours observed following ICV GALP administration to rats. Importantly, the IL-1 receptor antagonist had no effect on the acute orexigenic effect of GALP (Man & Lawrence, 2008a). These data suggest that the acute orexigenic effects and chronic catabolic effects of GALP are mediated by different mechanisms and that the chronic catabolic effects may reflect the activation by GALP of inflammatory pathways. It would be interesting to determine whether alarin has an effect on core body temperature and IL-1 release.

Due to the lack of subtype specific galanin receptor agonists and antagonists, the receptor(s) which mediate galanin and GALP’s effects on feeding are still unknown. The orexigenic potency of GALP is ten times that of galanin. The affinity of galanin to the GalR1 receptor is about 40-fold higher than that of GALP. It is therefore unlikely that the GalR1 mediates the effect of GALP on food intake. The affinities of galanin and GALP to the GalR2 receptor are almost equal. Assuming that GalR2

109

mediates the effect of GALP, this does not explain the difference of potency in feeding between galanin and GALP. Additionally, Wang et al. reported that galanin (1–16), a GalR1 and GalR2 selective ligand, has less potency than galanin for stimulating food intake, and ICV injection of galanin (2–29), which has a high affinity for GalR2 and GalR3, did not stimulate feeding behaviour. These results suggest the possible existence of as yet unidentified receptors that mediate feeding by GALP and/or galanin. However, it is also possible the in vitro pharmacodynamics of the galanin receptors do not reflect their in vivo activity. It is also possible that there are differences in the tissue availability of GALP and galanin following ICV administration.

Substances can suppress feeding by producing adverse physiological effects such as pain, or nausea, or may increase food intake as a secondary effect of increased arousal (Nachman & Ashe, 1973;Ida et al, 1999). Analysis of behaviour is often used to investigate the specificity of feeding effects. For example, an increase in grooming is often associated with the activation of central stress pathways (Dunn et al, 1987), and an increase in locomotor activity and a decrease in sleep is associated with arousal (Jones et al, 2001). Orexigenic effects may reflect the activation of arousal pathways, rather than specific feeding circuits (Sakurai, 2007). My studies demonstrate that ICV alarin at the effective dose administered in the feeding studies (30 nmol) does not significantly affect locomotive or sleeping behaviours. This suggests a direct effect of alarin on feeding rather than a secondary effect. ICV GALP administration did cause behavioural effects; significant decreases in rearing and grooming were observed compared to saline injected control animals. GALP administration has previously been associated with a reduction in locomotor activity, though this has only been reported in mice (Kauffman et al, 2005), and seems at odds with the stimulatory effect of GALP on the sympathetic nervous system (Hansen et al, 2003). Furthermore, unpublished data from within our group has shown a reduction in locomotor activity following ICV GALP administration to rats using data obtained by the Comprehensive Laboratory Animal Monitoring System (CLAMS) (Personal communication from Dr Nina Semjonous). However, behaviour analysis following alarin administration did not reveal any reduction in locomotive behaviours compared to saline injected animals; in fact there was significantly more rearing and locomotive behaviours following alarin administration compared to GALP administration. This suggests that there are differences in the effects of these two related peptides, which may reflect differences in receptor activation or in vivo pharmacokinetics.

I have shown that alarin (100 nM) stimulates NPY release from hypothalamic explants. Alarin had no significant effect on the release of other hypothalamic peptides known to be involved in the regulation of appetite α-MSH and CART. The orexigenic effect of alarin may therefore be mediated, at least in

110

part, by an increase in hypothalamic NPY release. It may be expected that an increase in NPY release would be accompanied by a decrease in αMSH release (Hahn et al, 1998). However alarin had no significant effect on αMSH release from hypothalamic explants. NPY is released from many nuclei of the hypothalamus, not all of which will inhibit αMSH. In a study of GALP-treated rat hypothalamic explants, GALP increased NPY release and also decreased CART release. In the same study GALP had no effect on α-MSH or AgRP release (Seth et al, 2003). It is interesting to note the discrepancies between alarin and GALP in the release of hypothalamic neuropeptides, as this may explain the difference in magnitude of their orexigenic effects. My data comparing alarin-IR in the hypothalami of fed and fasted rats suggests that alarin peptide levels are not altered by acute food restriction. A 24 hour fast will increase plasma leptin levels in rats (Vuagnat et al, 1998), and thus, this study suggests that leptin may not regulate hypothalamic alarin levels. However, isolating the whole hypothalamus and examining peptide levels in this brain region is not the most accurate method of investigating alterations in expression. A much more precise way to do this would be to take punch biopsies of different hypothalamic nuclei (Palkovits, 1986), as antagonistic changes in alarin in different areas would not be masked and potential nuclear specific changes would be measured at their magnitude. It would also be interesting to investigate the effect of fasting on alarin mRNA in addition to peptide expression as there is often a lack of correlation between mRNA and peptide expression (Gygi et al, 1999). The effect of fasting on alarin mRNA expression in specific hypothalamic nuclei could be investigated semi-quantitatively using in situ hybridisation of brain slices from fed and fasted rats.

The levels of alarin-IR observed in the hypothalami from fed and fasted rats are much lower than reported levels of hypothalamic GALP and galanin IR (Kumano et al, 2003). The method of extraction used to determine hypothalamic galanin and GALP is different to the extraction method used to determine hypothalamic alarin levels, and it is possible that the method of extraction used in my studies results in a lower yield of all peptides. It would be necessary to determine levels of galanin and GALP using the extraction protocol used in these studies to directly compare relative hypothalamic peptide levels.

The lack of alteration in hypothalamic alarin levels in response to fasting is in contrast to changes observed in GALP message. Acute food deprivation and chronic food restriction both induce a decrease in hypothalamic GALP mRNA in rats and macaques, which is reversible by either peripheral or central leptin administration in rats, demonstrating that leptin positively regulates hypothalamic GALP expression (Jureus et al, 2000;Cunningham et al, 2004b;Fraley et al, 2004a;Johansson et al, 2008). It is not known whether fasting also decreases hypothalamic GALP peptide levels. It is unusual

111

that leptin positively regulates GALP, an orexigenic peptide. It is possible that leptin-responsive GALP neurons regulate functions other than food intake for example, neuroendocrine functions (Matsumoto et al, 2001).

To determine whether alarin is a physiological regulator of feeding, it would be useful to examine the effect of ICV administration of alarin IgG. If a reduction in endogenous alarin signalling reduces food intake, this would suggest a physiological role for alarin in feeding. If the receptor at which alarin mediates its effects on feeding could be isolated, administration of an antagonist at this receptor could also be used to investigate the physiological role of alarin in the regulation of food intake. These data suggest that alarin, like other members of the galanin peptide family, stimulates food intake acutely following ICV injection. It is possible that alarin mediates its orexigenic effect via an increase in hypothalamic NPY. Given that the hypothalamus may be the site of action of the stimulatory effect of alarin on food intake, it would be interesting to investigate whether alarin has any effects on the neuroendocrine axes. Other members of the galanin peptide family are heavily implicated in the regulation of the hypothalamo-pituitary axes.

112

CHAPTER 3

ALARIN AND THE NEUROENDOCRINE AXES

113

3.1 INTRODUCTION

3.1.1 GALANIN PEPTIDE FAMILY AND THE NEUROENDOCRINE AXES There is extensive evidence suggesting that the galanin family of peptides regulate neuroendocrine function. Galanin has been implicated in the regulation of the HPG, HPA, HPT and growth axes, and in the neuroendocrine control of prolactin secretion (Merchenthaler, 2008). GALP has a relatively well-characterised role in the regulation of the HPG axis, while its roles in other neuroendocrine axes are not so well understood. The presence of galanin-IR in the hypothalamus and median eminence, and its co-localisation with known hypophysiotrophic hormones, suggests that galanin may regulate anterior pituitary function. The discrete distribution of GALP-IR in the ARC, median eminence and posterior lobe of the pituitary is suggestive of a role for GALP in the regulation of neuroendocrine axes. GALP and galanin expression is directly regulated by leptin (Jureus et al, 2000;Hakansson et al, 1998;Sahu, 1998b), suggesting that these neuropeptides may have an intermediary function, coupling the action of leptin to various endocrine control systems. There are currently no studies implicating alarin in the regulation of neuroendocrine function.

114

3.1.2 GALANIN PEPTIDE FAMILY AND THE HPG AXIS The neuropeptides regulating hypothalamic GnRH are not well-characterised. Many peptides reportedly regulate hypothalamic GnRH release including some of those involved in energy homeostasis. The activity of the reproductive axis is sensitive to the adequacy of nutrition and the stores of metabolic reserves. The adipocyte-derived hormone leptin is thought to reflect the state of nutrition and energy reserves and serve as a metabolic gate to the reproductive system. Leptin is believed to regulate this effect indirectly via altered release of hypothalamic neuropeptides. These neuropeptides may include members of the galanin peptide family.

3.1.2.1 GALANIN AND THE HPG AXIS Within the preoptic area of the rat hypothalamus, subpopulations of GnRH neurons co-express galanin mRNA (Rossmanith et al, 1996;Marks et al, 1992a) and immunoreactivity (Coen et al, 1990;Merchenthaler et al, 1990). Hypothalamic galanin expression is sexually dimorphic in rodents, and galanin-IR is positively regulated by oestrogen (Gabriel et al, 1990). More GnRH neurons co- express galanin in mature females than in mature males (Rajendren et al, 2000). The degree of this coexpression is oestrogen-dependent, with highest levels observed during the proestrus stage of the oestrus cycle in intact female rats (Marks et al, 1993;Marks et al, 1993;Merchenthaler et al, 1991). Galanin is released into the hypophyseal portal system in a pulsatile manner. The regulation of this release appears to be dependent on the stage of the oestrus cycle. The highest concentrations of galanin in the median eminence are seen during diestrus and proestrus when oestrogen levels are low, and the lowest concentrations of galanin are observed at oestrus when oestrogen levels are highest. Galanin pulses also coincide with GnRH release from the same vesicles in nerve terminals in the median eminence (Lopez et al, 1991;Liposits et al, 1995).

MPOA GnRH neurons express the GalR1 (Mitchell et al, 1999b), and galanin-IR nerve terminals are reported to be in close proximity to cell bodies of GnRH neurons in the mPOA and the diagonal band of Broca, suggesting a role for galanin in the regulation of hypothalamic GnRH (Merchenthaler et al, 1990;Rajendren & Li, 2001). Galanin stimulates GnRH release from incubated ARC-median eminence (ME) explants in vitro (Lopez & Negro-Vilar, 1990), and ICV administration of galanin stimulates the HPG axis (Sahu et al, 1987;Fraley et al, 2004b;Matsumoto et al, 2001;Seth et al, 2004). Administration of the non-specific galanin receptor antagonist galantide inhibits galanin-induced GnRH release from ARC-ME explants (Sahu et al, 1994). The physiological importance of galanin in reproduction is demonstrated by studies showing that ICV administration of galanin antagonists or IV administration of antisera against galanin can blunt the LH surge and ovulation in rats (Sahu et al, 1994;Lopez et al, 1993).

115

It has been proposed that in the rat, galanin contributes to the generation of GnRH, and subsequent LH, surges initiated by oestrogen via a positive feedback mechanism. However, rather than the galanin mRNA levels in GnRH neurons increasing before the LH surge, galanin expression in these neurons does not begin to rise until the time of the LH surge, peaking 8-12h later (Finn et al, 1998). This may reflect either the need to replenish galanin stores depleted during the preceding LH surge or the prolonged production of galanin required to serve physiological events occurring on the day of oestrus or thereafter.

In addition to galanin/GnRH interactions at the hypothalamic level, galanin is also synthesized locally in the rat anterior pituitary gland (Kaplan et al, 1988a;Marks et al, 1993). Galanin expression in the rat anterior pituitary is regulated by circulating levels of oestrogen, with highest levels seen at oestrus when oestrogen levels are highest (Kaplan et al, 1988b;Gabriel et al, 1990). Galanin is able to directly stimulate LH release from cultured rat anterior pituitary cells and potentiates GnRH-induced LH release in vitro (Leiva & Croxatto, 1994;Lopez et al, 1991;Peters et al, 2009). GalR2 and GalR3 are expressed in the rat anterior pituitary suggesting that galanin may directly control pituitary LH secretion via an endocrine or paracrine mechanism (Waters & Krause, 2000). Galanin-IR is detected in human fetal gonadotrophs, but in adults is found only in corticotrophs within the anterior pituitary (Reyes et al, 2008).

3.1.2.2 GALP AND THE HPG AXIS

GALP-IR fibres are abundant in the medial pre-optic nucleus (MPON) of the hypothalamus (a nucleus located within the preoptic area), and GALP-IR nerve terminals have been shown to be in close contact with BST and MPON GnRH-IR fibres (Takenoya et al, 2006). Central GALP injection induces Fos-IR in MPON neurons in rats (Fraley et al, 2003;Lawrence et al, 2003;Taylor et al, 2009). While it is estimated that only 6% of GnRH neurons in the MPON receive contacts from GALP containing neurons (Takatsu et al, 2001), 30% of GnRH neurons in the MPOA express c-fos following ICV GALP administration, suggesting both direct and indirect effects of GALP on GnRH neurons (Matsumoto et al, 2001).

Intraventricular administration of GALP stimulates LH secretion in male and female rats and mice, and in male macaques (Matsumoto et al, 2001;Uenoyama et al, 2008;Krasnow et al, 2003;Krasnow et al, 2004;Kauffman et al, 2005;Cunningham et al, 2004b). This effect is attenuated by administration of a GnRH antagonist, suggesting a hypothalamic rather than pituitary effect. Indeed, direct GALP 116

treatment of dispersed anterior pituitaries has no effect on LH or FSH release (Matsumoto et al, 2001), but GALP stimulates GnRH release from hypothalamic explants (Seth et al, 2004). GALP antiserum is able to block the stimulatory action of leptin on GnRH release from hypothalamic explants, suggesting GALP may mediate the effects of leptin on the HPG axis (Seth et al, 2004). Chronic GALP administration increases circulating LH and sexual behaviours in diabetic rats, which show reduced reproductive function. Insulin and leptin administration reverses the effect of diabetes on LH and sexual behaviour. This normalisation can be attenuated by administration of a GALP antibody, providing further evidence that GALP modulates the effects of leptin, and suggesting it may also mediate the effects of insulin, on reproductive function (Stoyanovitch et al, 2005). GALP has been suggested to provide a link between nutritional status and fertility (Seth et al, 2004). GALP may act to integrate energy and reproductive homeostasis. The brain has the ability to sense the status of metabolic fuel reserves and also governs the activity of the reproductive system. It appears to activate the HPG axis only when fuel stores are sufficient to support the energetic demands of reproduction. The ARC is the hub for this physiological interaction (Cone et al, 2001). It has been suggested that metabolically sensitive GALP neurons may be part of a circuit which relays information about fuel reserves to GnRH positive neurons and thereby regulates the activity of the reproductive axis (Gottsch et al, 2004).

The effects of GALP on LH release are sexually dimorphic and dependent on both sex hormone milieu and stage of sexual maturation. The increase in LH observed in female rats administered GALP ICV is dependent on the presence of oestrogen (Uenoyama et al, 2008). Pubertal rats, which express lower levels of GALP mRNA, are more sensitive to the stimulatory effect of GALP on LH release than adult animals (Castellano et al, 2006;Rich et al, 2007).

Whilst the pharmacological effects of GALP on the HPG axis have been extensively demonstrated, the physiological relevance of this action of GALP is less well understood. Immunoblockade of endogenous GALP reduces circulating levels of LH (Stoyanovitch et al, 2005). However, hypothalamic GALP mRNA expression in the rat is unchanged by sex steroid hormone manipulations such as castration and orchidectomy (Cunningham et al, 2004a), and levels do not vary across the oestrus cycle in the female macaque (Cunningham et al, 2004b). In addition, GALP knockout mice have a reproductive phenotype indistinguishable from wild-type littermate controls (Dungan Lemko et al, 2008).

Despite the reduced basal LH levels observed in fasted rats, fasting enhances the LH response to ICV GALP administration (Castellano et al, 2006). It is possible that this is secondary to a decrease in

117

endogenous GALP, caused by reduced leptin in response to fasting, or alternatively, it may represent alterations in pituitary sensitivity to GnRH following food deprivation.

In addition to activating the HPG axis, GALP has been reported to regulate sexual behaviour in rodents. Administration of GALP to both gonadally-intact and castrated male rats increases the occurrence of sexual behaviours (mounts, intromissions and ejaculations) and decreases the latency time for these behaviours to take place (Fraley et al, 2004b). In male rats, DA activity in the mPOA has been shown to facilitate the control of sexual behaviour (Hull et al, 1986), and lesions of DA neurons in the mPOA prevent ICV GALP from stimulating male sex behaviour (Taylor et al, 2009). Immunoblockade of endogenous GALP abolishes sexual behaviours in adult male rats, suggesting this is a physiological effect (Stoyanovitch et al, 2005). In mice, ICV GALP suppresses sexual behaviour in both males and females although this may be attributable to the acutely impaired locomotor activity reported following GALP administration to mice (Kauffman et al, 2005).

The receptor mediating the effects of GALP on the HPG axis is as yet unknown. GALP elicits a similar LH response in GalR1 knockout mice, GalR2 knockout mice and wild-type controls, suggesting that neither GalR1 or GalR2 is essential for mediating these effects of GALP (Krasnow et al, 2004). Interestingly, none of the cloned galanin receptors have been shown to be expressed on GT1-7 cells, an immortalised GnRH releasing cell line from which GALP stimulates the release of GnRH. Galantide, a potent non-subtype selective galanin receptor antagonist, is unable to attenuate this effect (Seth et al, 2004). These data suggest that an as yet unknown receptor which can be activated by GALP is responsible.

118

3.1.3 GALANIN PEPTIDE FAMILY AND THE HPT AXIS During fasting, thyroid hormone levels fall mainly due to an inhibition of TRH gene expression in PVN neurons, an effect mediated by reduced circulating leptin levels (Legradi et al, 1997). Leptin is believed to regulate this effect indirectly via altered release of arcuate neuropeptides. These neuropeptides may include members of the galanin peptide family.

3.1.3.1 GALANIN AND THE HPT AXIS ICV injection of galanin decreases plasma TSH, while ICV injection of galanin anti-serum causes an increase in plasma TSH in rats (Ottlecz et al, 1988). Galanin-IR axons densely innervate proTRH neurons in the pPVN, and the synapses of galanin-containing nerve terminals on TRH neurons are symmetric, suggesting an inhibitory role for galanin in the regulation of the HPT axis (Wittmann et al, 2004). These galaninergic axons innervating TRH neurons in the PVN are likely to arise from cell bodies in the DMN and the ARC, as well as extra-hypothalamic regions (Levin et al, 1987). Galanin administration directly into the PVN reduces circulating TSH and energy expenditure (Seth et al, 2003;Menndez, 1992), and incubation of hypothalamic explants with galanin in vitro reduces TRH release (Seth et al, 2003). These data suggest galanin may regulate the thyroid axis through the tonic inhibition of TRH release from neurons in the PVN. Galanin is present in pituitary thyrotrophs of male rats (Cimini, 2003) and monkeys (Niimi et al, 1993). Galanin alone has no effect on TSH release from anterior pituitary explants in vitro, but may potentiate TRH-induced TSH release from thyrotrophs (Ottlecz et al, 1988).

3.1.3.2 GALP AND THE HPT AXIS As a neuropeptide produced in the ARC and regulated by leptin, it is possible that GALP is involved in the regulation of the HPT axis. ICV GALP has been reported not to effect circulating TSH levels in rats (Matsumoto et al, 2001), but GALP injected directly into the PVN of rats reduces circulating TSH levels and GALP treatment of in vitro hypothalamic explants suppresses TRH release (Seth et al, 2003). GALP has no effect on TSH release from dispersed anterior pituitary explants (Matsumoto et al, 2001). Anatomically, GALP containing neurons in the PVN synapse onto only a small number of TRH neurons, thus any regulation of TRH secretion by GALP is likely to be an indirect effect (Wittmann et al, 2004). Thyroidectomy in rats reduces ARC GALP mRNA expression and is restored by thyroxine replacement, suggesting GALP may play a physiological role in the HPT axis (Cunningham et al, 2004a).

119

3.1.4 GALANIN PEPTIDE FAMILY AND THE GROWTH HORMONE AXIS

3.1.4.1 GALANIN AND THE GROWTH HORMONE AXIS Galanin increases plasma GH levels following peripheral and central injection in rats and peripheral infusion in humans (Ottlecz et al, 1986;Bauer et al, 1986;Ottlecz et al, 1988). Co-infusion of galanin to humans potentiates the stimulatory effect of GHRH on GH release (Davis et al, 1987). ICV injection of galanin antiserum dramatically reduces plasma GH levels in rats and alters GH pulsatility by reducing pulse amplitude and increasing pulse frequency, suggesting an important physiological role for galanin in the regulation of GH release (Ottlecz et al, 1988;Maiter et al, 1990). The coexpression of galanin mRNA in ARC GHRH neurons varies with the state of the somatotrophic axis. Galanin mRNA levels in ARC GHRH neurons are reduced in GH deficient dwarf rats and in hypophysectomised rats, and administration of GH can increase galanin levels back to those observed in intact controls (Chan et al, 1996b). However, while transgenic mice over-expressing galanin exhibit increased secretion of growth hormone (Perumal & Vrontakis, 2003), galanin knockout mice have normal growth rates and normal GH content in the pituitary (Wynick et al, 1998b).

The stimulatory action of galanin on GH is thought to be mediated by activation of the hypothalamic GHRH system and inhibition of the hypothalamic somatostatin system. Galanin is co-expressed with GHRH in a population of ARC neurons which project to the median eminence (Niimi et al, 1990), and administration of GHRH antisera significantly inhibits the galanin-induced increase in plasma GH (Murakami et al, 1987). Somatostatin neurons in the periventricular nucleus express galanin receptors and are innervated by galanin-IR nerve terminals (Liposits et al, 1993;Chan et al, 1996b). Galanin is able to stimulate the release of both GHRH and somatostatin from median eminence explants in vitro, although this is an effect seen with high doses of galanin, and may not reflect endogenous galanin activity (Aguila et al, 1992). Studies investigating a direct effect of galanin on GH release from the pituitary report either no effect or an increase in GH release. The differences observed may be due to the different techniques used in these studies. (Ottlecz et al, 1986;Ottlecz et al, 1988;Gabriel et al, 1988;Sato et al, 1991).

120

3.1.4.2 GALP AND THE GROWTH HORMONE AXIS There is little evidence to suggest that GALP has a physiological role in the regulation of GH secretion in rodents. GH deficient dwarf rats have similar GALP mRNA levels as controls and GH administration to dwarf rats has no effect on GALP mRNA expression (Cunningham et al, 2004a). ICV injection of GALP has no effect on plasma GH levels in rats (Matsumoto et al, 2001). In addition, GALP knockout mice exhibit normal growth rates when compared to wild-type control animals (Dungan Lemko et al, 2008). However, administration of GALP to prepubertal rat pups has been reported to increase plasma GH levels. GH secretion usually increases at the onset of puberty and so the GALP-induced GH increase may represent a secondary effect of GALP as opposed to direct regulation (Rich et al, 2007). Electrophysiological studies suggest GALP can directly influence the behaviour of ARC GHRH neurons in adult rats (Kuramochi et al, 2005). ICV administration of GALP to male rhesus monkeys has also been reported to acutely stimulate GH release (Shahab et al, 2005).

121

3.1.5 GALANIN PEPTIDE FAMILY AND PROLACTIN/DOPAMINE

3.1.5.1 GALANIN AND PROLACTIN/DOPAMINE ICV administration of galanin stimulates prolactin release in the male rat (Koshiyama et al, 1987;Melander et al, 1987;Ottlecz et al, 1988). It is likely that multiple mechanisms mediate this effect. Central galanin administration is associated with a reduction in hypothalamic dopamine synthesis and secretion (Melander et al, 1987). Galanin co-localises with tyrosine hydroxlyase (TH) in the ARC (Meister & Hokfelt, 1988), galanin-containing axons synapse onto ARC TH-IR neurons (Hrabovszky & Liposits, 1994) and ICV galanin decreases tuberoinfundibular dopaminergic neurone activity, although only under activated conditions (Gopalan et al, 1993).

ICV galanin increases vasoactive intestinal peptide (VIP)-IR in the CSF, suggesting a role for VIP in mediating the effects of galanin (Inoue et al, 1988). Galanin dose-dependently stimulates VIP release from rat hypothalamic fragments in vitro (Inoue et al, 1988), and immunoneutralisation with specific antiserum against VIP suppresses the stimulatory effect of galanin on plasma prolactin (Koshiyama et al, 1987). The stimulatory effect of central galanin on prolactin release is also partially blocked by administration of alpha-adrenergic antagonists (Koshiyama et al, 1990b), opioid antagonists (Koshiyama et al, 1990b) or non-selective 5-HT1 and 5-HT2 receptor antagonists (Koshiyama et al, 1990a). The effect of peripheral galanin on prolactin release is contentious. Studies report either no effect (Koshiyama et al, 1987;Ghigo et al, 1992;Giustina et al, 1992;Murakami et al, 1993;Arvat et al, 1995;Grottoli et al, 1996), or an increase in plasma prolactin levels following IV infusion of galanin in rats and humans (Invitti et al, 1993;Todd et al, 2000;Bauer et al, 1986;Carey, 1993). Galanin reportedly enhances arginine and TRH induced prolactin secretion in humans (Ghigo et al, 1992;Grottoli et al, 1996), and stimulates exaggerated prolactin release in anorexia nervosa patients (De Marinis et al, 2000) and patients with Cushing’s disease (Invitti et al, 1993).

There is anatomical evidence to suggest that galanin may directly regulate prolactin release from the pituitary. Galanin mRNA and galanin-IR are present in a subpopulation of lactotrophs, and galanin mRNA in lactotrophs is dramatically upregulated by oestrogen treatment (Hsu et al, 1990). Furthermore, within lactrotrophs galanin co-localises in the same secretory granules as prolactin following oestrogen administration (Hyde et al, 1991). Functional evidence of a role for galanin in the regulation of pituitary prolactin release is inconsistent. Studies have reported that galanin has no direct effect on prolactin release from anterior pituitary dispersed cells or explants in vitro (Inoue et al,

122

1988;Ottlecz et al, 1988;Xu, 1995), but galanin does stimulate prolactin release from a cultured lactrotroph cell line in vitro (Hammond et al, 1996).

Data suggests that galanin also has an autocrine/paracrine role in the regulation of lactotroph function. Oestrogen stimulates anterior pituitary galanin mRNA expression, which leads to an increase in prolactin release and increased lactotroph growth. These effects are completely abolished by treatment with galanin antiserum. (Wynick et al, 1993a;Cai et al, 1998). Specific over-expression of galanin in lactotrophs also stimulates prolactin synthesis and secretion, and acts as a growth factor in an oestrogen-dependent manner (Cai et al, 1999;Perumal & Vrontakis, 2003). Circulating prolactin then negatively feeds back at the level of the anterior pituitary and suppresses galanin gene expression (Hammond et al, 1997). Galanin knockout mice exhibit reduced pituitary prolactin mRNA and peptide, and female mutant mice fail to lactate after pregnancy. Furthermore, oestrogen administration to wildtype mice stimulates lactotroph proliferation and prolactin release, but these effects are absent in galanin knockout mice (Wynick et al, 1998a).

3.1.5.2 GALP AND PROLACTIN/DOPAMINE The role of GALP in the regulation of prolactin is less well-characterised than that of galanin. Anatomically, GALP-IR nerve fibres make direct contact on TH-containing neurons in the ARC of the rat, suggesting that GALP may regulate dopaminergic neurons (Kageyama et al, 2008). Interestingly, there may be species specific effects of GALP administration on prolactin release as ICV GALP suppresses prolactin release in monkeys, but not in rats (Matsumoto et al, 2001;Cunningham et al, 2004b). However, neuroendocrine regulation of pituitary function is different in many respects between rodents and primate species (Wheeler & Styne, 1988).

GALP mRNA expression in the ARC is not different between rats in diestrus and lactating rats (Cunningham et al, 2004a), though the number of GALP cells in the posterior pituitary of rats is increased during lactation (Cunningham et al, 2004a). Further studies are required to clarify the effects of GALP on prolactin secretion.

123

3.1.6 GALANIN PEPTIDE FAMILY AND THE HPA AXIS

3.1.6.1 GALANIN AND THE HPA AXIS Galanin is co-expressed with AVP and CRH in the hypothalamus PVN (Ceccatelli et al, 1989). Galanin nerve terminals contact CRH/AVP neurons in the PVN, galanin receptors are expressed in rat magnocellular and parvocellular PVN neurons (Mitchell et al, 1997;Mitchell et al, 1999a), and GalR1 mRNA co-localises with AVP in the rat PVN (Landry et al, 1998). ICV galanin administration to rodents increases Fos-IR in brain regions implicated in the stress response, including the PVN and the locus coruleus (Fraley et al, 2003;Bergonzelli, 2001).

The regulation of AVP release by galanin is well characterised and discussed in chapter 1, section 1.5.2.2.8. However, the data on the role of galanin in the regulation of hypothalamic CRH is more controversial. Galanin reportedly enhances CRH release from fetal rat hypothalamic neurons (Bergonzelli et al, 2001), suggesting stimulatory activity of galanin at the hypothalamic level of the HPA axis. However, under pathophysiological conditions, intraPVN administration of galanin to rats, and ICV administration of galanin to mice, attenuates stress-induced rises in plasma ACTH (Hooi et al, 1990a). In addition, ICV galanin antiserum administration to rats increases plasma ACTH concentration (Hooi et al, 1990b). This galanin-induced suppression of ACTH release is not seen following ICV injection of galanin to GalR1 knockout mice, suggesting that this receptor is critical for the regulation of the HPA axis by galanin. However, GalR1 knockout mice have basal plasma ACTH and corticosterone concentrations indistinguishable from wild-type littermates (Vrontakis, 1990).

Galanin mRNA and peptide are expressed in the pituitary corticotrophs of male and female humans and male rats (Vrontakis et al, 1990;Cimini et al, 1993;Cimini, 1996;Hsu et al, 1991). GalR2 and GalR3 mRNA, but not GalR1 mRNA, are expressed in the rat anterior pituitary (Waters & Krause, 2000). Galanin inhibits ACTH release from rat pituitary corticotrophs in vitro, and this effect is abolished by the immunoneutralisation of galanin (Cimini, 1996). Intravenous administration of galanin has been reported to reduce plasma ACTH and cortisol levels, and to blunt the ACTH response to CRH in humans (Giustina et al, 1994). However, another study reports a rise in plasma ACTH and corticosterone following acute subcutaneous (SC) injection of galanin to unstressed rats (Malendowicz et al, 1994).

124

3.1.6.2 GALP AND THE HPA AXIS GALP may play a role in the HPA axis. ICV injection of GALP induces c-fos expression in hypothalamic nuclei known to be involved in stress responses (ARC and DMN) (Fraley et al, 2003;Lawrence et al, 2003) and increases plasma levels of ACTH in rats (Onaka et al, 2005). However, Matsumoto et al report that ICV GALP has no effect on plasma ACTH (Matsumoto et al, 2001). It is likely that GALP mediates any stimulatory effect it has on ACTH release at the level of the hypothalamus, as GALP has no effect on ACTH release directly from the pituitary (Matsumoto et al, 2001). Whether this is a physiological action of GALP is unknown. Adrenalectomy has no effect on GALP expression in the ARC of rats (Cunningham et al, 2004a).

However GALP expression does appear to be regulated to some extent by stress. ARC GALP-IR neurons express Fos protein following an acute electric foot shock stressor (Onaka et al, 2005). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria and as such, is an endotoxin which induces a profound acute immune response. Peripheral LPS injection dramatically increases GALP gene expression in the ARC and the posterior pituitary. This effect is attenuated by pre-treatment with a prostaglandin inhibitor, suggesting that prostaglandins may induce posterior pituitary GALP expression (Saito et al, 2003;Saito et al, 2005). Other LPS-induced cytokines such as interleukin (IL)-1β and IL-6 may also be involved in the up-regulation of GALP expression. The acute inflammation induced by LPS injection increases plasma leptin levels (Mastronardi et al, 2001) and it is possible that the increase in leptin may cause the increased expression of GALP mRNA in the ARC. However, plasma GALP levels are not altered by LPS administration (Saito et al, 2005).

Stress appears to differentially regulate GALP mRNA expression in the ARC and in the posterior pituitary. Adjuvant arthritis, used as a model of chronic inflammatory stress, has no effect on GALP expression in the ARC, but significantly induces GALP mRNA expression in posterior pituicytes (Saito et al, 2003;Saito et al, 2005). Nociceptive stimuli (formalin) also induces GALP expression in the posterior pituitary (Saito et al, 2003;Kawasaki et al, 2007). Acute osmotic (hypertonic saline) and chronic osmotic (dehydration and salt loading) stimuli induce GALP mRNA expression only in the posterior pituitary, but have no effect on ARC GALP mRNA expression (Saito et al, 2003;Shen et al, 2001).

The galanin family of peptides play important roles in the regulation of the neuroendocrine axes. However, the exact physiological role of these peptides and the receptors mediating their effects has

125

not been determined. There have been no studies reporting a role for alarin on neuroendocrine function.

126

3.2 AIMS Members of the galanin peptide family are heavily implicated in the regulation of neuroendocrine axes, and particularly the reproductive axis. The effect of ICV administration of alarin on circulating hormone levels has not been investigated. I aim to investigate

1) The effects of central administration of alarin on circulating hormone concentrations in rats in vivo 2) The effect of alarin on neuropeptide release from hypothalamic explants and immortalised GnRH releasing GT1-7 cells in vitro 3) The effect of alarin on pituitary hormone release from anterior pituitary explants and immortalised LH releasing LβT2 cells in vitro 4) Whether alarin is a physiological regulator of reproductive hormones in the female rat

127

3.3 MATERIALS AND METHODS

3.3.1 MATERIALS Rat alarin (used in all studies unless specified otherwise) was synthesised by BioMol International LP (Exeter, UK). Murine alarin was purchased from Phoenix Pharmaceuticals Inc. Kisspeptin-10 was purchased from Peptide Institute Inc. (Osaka, Japan). All other peptides were purchased from Bachem (Merseyside,UK). Cannulation materials were purchased from PlasticsOne, Inc. (Roanoke, VA). Reagents for explant experiments were purchased from BDH (Poole, UK) and Invitrogen Ltd (Paisley, UK). Alarin ELISA was from Peninsula Laboratories, LLC. (Bachem Group, San Carlos, CA).

3.3.2 ANIMALS Adult male Wistar rats and female Sprague Dawley rats (Charles River, Bicester, UK) were maintained as described in section 2.3.2. For all studies rats were randomised into groups of approximately equal mean body-weight (within 1g). Body-weight and food intake were measured daily. Animals which were considered unwell, or had reduced bodyweight or low food intake were excluded from studies

3.3.3 IN VIVO STUDIES

3.3.3.1 INTRACEREBROVENTRICULAR CANNULATION Cannulation was performed using the same anaesthetic regime and equipment as described previously (section 2.3.3.1).

3.3.3.2 INTRACEREBROVENTRICULAR INJECTION Substances were administered to freely moving rats using a stainless steel injector projecting 1 mm below the cannula tip. Injections were carried out in a total volume of 5 µl and performed as previously described (section 2.3.3.2).

128

3.3.3.3 EFFECT OF ICV ALARIN ADMINISTRATION ON PLASMA HORMONES IN INTACT MALE RATS IN VIVO Adult male ad-libitum fed rats received a single ICV injection of either saline, 6 nmol alarin or 2 nmol kisspeptin-10 (positive control) (Thompson et al, 2004) in the early light phase (0900-1200 h). Rats were returned to their home cage without food and decapitated either 30 (n = 9-10 saline and alarin, n = 5 kisspeptin) or 60 minutes (n = 5 for each group) after injection. Trunk blood was collected in both lithium heparin tubes containing 4200 kallikrein inhibitor units aprotinin (Bayer Corp., Haywards Heath, UK), and tubes containing potassium EDTA (final concentration of 1.2-2mg EDTA/ml blood) (Starstedt). Plasma was separated by centrifugation at 2000g for 10 minutes, snap frozen on dry ice, and stored at -20°C until measurement of plasma hormones by RIA.

3.3.4 IN VITRO STUDIES

3.3.4.1 EFFECT OF ALARIN ON NEUROPEPTIDE RELEASE FROM MEDIAL BASAL HYPOTHALAMIC EXPLANTS The static hypothalamic explants incubation system was used as described previously (section 2.3.4.1). GnRH, CRH, and TRH levels in the aCSF were measured by RIA.

129

3.3.4.2 HYPOTHALAMIC FACTOR RIAS

3.3.4.2.1 GNRH RIA GnRH was purchased from Bachem (UK) Ltd. Standard curves prepared for the GnRH assay used synthetic GnRH made up to 1 pmol/ml in assay buffer and GnRH concentrations in aCSF/cell medium were determined by RIA using a rabbit anti-GnRH antibody donated by H.M. Fraser and used at a final dilution of 1:6000. The assay was carried out in 0.06 M phosphate buffer containing 0.3% bovine serum albumin (BSA). Sample volume of explant media was 150 µl and cell media was 200 µl. Samples were assayed in duplicate in a total volume of 350 µl for explants and 700 µl for cell study samples, each tube containing 1500cpm/tube of iodinated GnRH. The assays were incubated at 4°C for 72 hours, before free and antibody bound peptide were separated by charcoal adsorption as described in section 2.3.4.2.

3.3.4.2.2 TRH RIA

TRH peptide was purchased from Bachem (UK) Ltd. Standard curves prepared for the TRH assay were made up to 1.25 pmol/ml in assay buffer. TRH concentrations in aCSF were determined by RIA using a rabbit anti-TRH antibody used at a final dilution of 1:25000. The assay was carried out in 0.06 M phosphate buffer containing 0.3% BSA. Sample volume of hypothalamic explant media was 150 µl and samples were assayed in duplicate in a total volume of 350 µl, containing 1500cpm/tube of iodinated TRH. The assays were separated by charcoal adsorption of the free fraction as described in section 2.3.4.2.

3.3.4.2.3 CRH RIA CRH peptide was purchased from Bachem (UK) Ltd. Standard curves prepared for the CRH assay were made up to 2 pmol/ml in assay buffer. CRH concentrations in aCSF were determined by RIA using a rabbit anti-CRH antibody used at a final dilution of 1:21000. The assay was carried out in 0.06 M phosphate buffer containing 0.3% BSA and 0.02% Tween 20. Sample volume of explant media was 10 µl and samples were assayed in duplicate in a total volume of 350 µl, containing 1500cpm/tube of iodinated CRH. The assays were incubated at 4°C for 72 hours, before free and antibody bound peptide were separated using a secondary antibody as described in section 2.3.4.2.

130

3.3.4.3 EFFECT OF ALARIN ON GNRH RELEASE FROM GT1-7 CELLS Immortalised murine hypothalamic GnRH-producing neurons, GT1-7 cells (Mellon et al, 1990) were grown in Dulbecco’s modified eagle medium (DMEM) containing 4 mM L-glutamine (Invitrogen Ltd.), 25 mM glucose and 1 mM sodium pyruvate, supplemented with 10% (v/v) fetal calf serum (FCS) (Invitrogen Ltd.), penicillin (100 IU/ml) and streptomycin (100 µg/ml) (Invitrogen Ltd.) and maintained at 37°C in 5% CO2. GT1-7 cells were plated on poly-L-lysine coated 24 well plates (Nunc International, Roskilde, Denmark), and incubated for 24 hours before secretion experiments were performed, as described previously (Patel et al, 2008). For GnRH secretion experiments, cells were pre-incubated for 120 minutes in serum-free medium. Thereafter, the medium was discarded and the cells were incubated for 240 minutes in 0.5 ml serum-free medium (basal), serum-free medium containing alarin (1,10, 100, 1000 or 10000 nM), serum-free medium containing GALP (0.1, 1, 10, 100 or 1000 nM) or serum-free medium containing GLP-1 (100 nM) (positive control) (Beak et al, 1998) (n = 14-30). In a separate experiment, cells were incubated in 0.5 ml serum-free medium (basal), 0.5 ml serum-free medium containing murine alarin (10, 100 or 1000 nM) or serum-free medium containing GLP-1 (100 nM) (positive control) (n = 20-24 per group). This was to determine whether there is a difference in potency between mouse and rat alarin, since GT1-7s are a cell line of murine origin. The cells were incubated at 37°C with the test substance for 240 min after which the medium was removed and stored at -20°C until measurement of GnRH by RIA.

3.3.4.4 EFFECT OF ALARIN ON PITUITARY HORMONE RELEASE FROM PITUITARY EXPLANTS The pituitary explant system was used as described previously (Stanley et al, 2004). Group housed male rats (200-250g) were decapitated and the anterior pituitary gland removed immediately and divided into four pieces of approximately equal size. Single quarters were placed in the wells of a 48 well tissue plate (Nunc International) and incubated in 0.5 ml aCSF. They were maintained at 37°C in a humidified environment saturated with 95% O2 and 5% CO2 for 120 minute, with the medium changed each 60 minute. The segments were then incubated in 0.5 ml of aCSF alone (basal), aCSF containing alarin (10, 100 or 1000 nM), or aCSF containing GnRH (100 nM) (positive control) for 240 minute (n = 10-12). The aCSF was then collected and stored at -20°C until RIA for LH, FSH, TSH and PRL.

131

3.3.4.5 EFFECT OF ALARIN ON LH RELEASE FROM LβT2 CELLS Immortalized murine pituitary LH releasing LβT2 cells (Alarid et al, 1996;Thomas et al, 1996) were cultured and plated as the GT1-7 cells described above (section 3.3.4.1). Cells were incubated in 0.5 ml serum-free medium (basal), serum-free medium containing alarin (1, 10, 100, 1000 or 10000 nM), or serum-free medium containing GnRH (100 nM) (positive control) (n = 8-24) (Turgeon et al, 1996). Cells were incubated at 37°C with the test substance for 240 minutes after which the medium was removed and stored at -20°C until measurement of LH by RIA.

3.3.5 EFFECT OF ICV ALARIN ON PLASMA HORMONES IN INTACT MALE RATS FOLLOWING PRETREATMENT WITH CETRORELIX Adult male ad-libitum fed rats received a SC injection of either saline or 200 nmol cetrorelix (GnRH receptor antagonist) (Bokser et al, 1990). Animals had been SC injected with saline twice in the week prior to the study to acclimatize them to the procedure. Thirty minutes later, animals were ICV injected with either saline, 30 nmol alarin or 2 nmol kisspeptin-10 (positive control) (n = 9-11 saline and alarin, n = 5 kisspeptin) (Thompson et al, 2004). Rats were returned to their home cage and decapitated 30 min after ICV injection and trunk blood collected and stored as previously described (section 3.3.3.3).

3.3.6 PLASMA HORMONE RIAS

3.3.6.1 LH RIA The measurement of LH in aCSF and plasma was by RIA using a rabbit anti-LH antibody donated by H.M Fraser (Medical Research Centre Reproductive Biology Unit, Edinburgh, UK) and used at a final dilution of 1:800,000. Materials and methods provided by the NIDDK and the National Hormone and Pituitary Program (Dr. A. Parlow, Harbor University of California, Los Angeles Medical Centre). LH was iodinated using the Chloramine T method (Wood et al, 1981). LH assays were carried out in Kemteck buffer (0.06 M phosphate EDTA, pH7.4) (appendix). Standards were serially diluted to construct a standard curve ranging from 0.05-25 ng/ml. Samples were assayed in duplicate in a total volume of 400 µl, containing antibody and 1200 cpm/tube of iodinated LH. Plasma sample volumes were 150 µl and pituitary explant samples were 10 µl of a 1:10 dilution. The assays were incubated at 4°C for 72 hours. Free and antibody-bound LH were separated using a goat anti-rabbit secondary antibody as described in section 2.3.4.2.

132

3.3.6.2 FSH, TSH, PRL AND GH RIAS FSH, TSH, PRL and GH were assayed using a similar protocol as LH. All pituitary hormones were iodinated using the Chloramine T method, carried out in Kemteck buffer, incubated at 4°C for 72 hours and separated using secondary antibody. The sample plasma volumes for FSH, TSH, PRL and GH RIA were 150, 200, 50 and 25 µl respectively. The sample volumes from pituitary explant studies were 10 µl of a 1:10 dilution.

3.3.6.3 TOTAL TESTOSTERONE RIA Plasma total testosterone concentrations were measured using commercially available ‘Coat-A-Count’ solid-phase RIA kits (Siemens Medical Solutions Diagnostics) following the manufacturer’s instructions. Solid phase RIA relies on an antigen specific antibody immobilized to the wall of a polypropylene tube. The antibody is then incubated with 125I-labelled antigen and unlabelled antigen from the standard preparation or sample for a short-fixed time. The bound and free fractions are separated by decanting and the bound fraction is counted in a γ counter. The non-linear calibration curve is determined and the amount of testosterone in samples calculated in terms of the standard preparation. The calibrators and 125I labelled antigen were supplied ready to use in liquid form. Both calibrators and plasma samples were added to the total testosterone antibody coated tubes in 50 µl volumes. The 125I labelled total testosterone was added to each tube in 1 ml volumes. The tubes were then vortexed and incubated at 37°C for 180 minutes. Free and antibody bound 125I-labelled antigen were separated by decanting and the remaining radioactivity in the tubes counted for 60 seconds. The mean cpm were calculated for standard and samples and the mean cpm was then plotted against the total testosterone standards to construct a standard curve. The standard curve was used to determine the total testosterone concentrations for the unknown plasma samples

133

3.3.6.4 ACTH IMMUNORADIOMETRIC ASSAY FOR MEASUREMENT OF ACTH IN PLASMA A solid phase immunoradiometric assay (IRMA) (Euro-Diagnostica) was used for determination of levels of ACTH in plasma. Two polyclonal antibodies are used which recognize ACTH at two different binding sites. The first is a purified radio-labelled (125I) sheep IgG recognizing the amino- terminal of ACTH whereas the second antibody recognizes and binds non-competitively to the C- terminal of the molecule. The second antibody is immobilized and coupled to sheep anti-rabbit antibody coating the polypropylene tubes. Both antibodies react with the ACTH molecule and the resulting complex is bound to the tube wall. Following a short incubation, the remaining 125I labeled sheep anti-ACTH is decanted. The bound radioactivity in the tubes is proportional to the concentration of ACTH in the sample or standard. The calibrators, reference controls and 125I ACTH-antibody were supplied lysophilised and were reconstituted in GDW 30 minutes prior to use. Standard solutions, reference controls and samples were added in 200 µl (in duplicate) to numbered tubes followed by addition of 200 µl 125I ACTH- antibody. The tubes were vortexed gently and incubated overnight at room temperature. All tubes apart from the total counts tubes, were washed by addition of 2 ml wash solution into each tube and then decanted. This step was then repeated. Each tube was counted for 60 seconds in a γ counter. The mean cpm were calculated for standard, reference controls and samples and the mean cpm then plotted against the ACTH calibrators to construct a standard curve. The standard curve was used to interpolate the ACTH concentrations for the reference preparations and the unknown plasma samples.

3.3.6.5 CORTICOSTERONE RIA Corticosterone levels in plasma were determined by a commercial RIA kit (MP Biomedicals Inc.). Calibrators, buffer and reference preparations were supplied in liquid form, ready to use. The assay was performed in a phosphosaline gelatine buffer (pH 7) containing rabbit gamma globulins in a total volume of 500 µl. Samples were diluted 1:200 in buffer and diluted samples, calibrators and reference preparations were added at a volume of 100 µl to numbered tubes. Labeled 125I-corticosterone (200 µl, 50,000 cpm) was then added to all tubes followed by 200 µl of specific corticosterone antibody. All tubes were vortexed and incubated at room temperature for 120 minutes. The free and bound fractions were then separated by addition of 500 µl precipitant solution (goat anti-rabbit in TRIS buffer) followed by centrifugation at 1000g for 15 minutes. The pellet and supernatant were counted for 60 seconds in a γ counter. Peptide concentrations in the samples were then calculated using a non-linear plot and results calculated in terms of the standard preparations.

134

3.3.7 REGULATION OF HYPOTHALAMIC ALARIN BY THE OESTRUS CYCLE Fifty female Sprague-Dawley rats weighing 200–250 g were group housed as described in section 2.3.2. Stages of the oestrous cycle were determined by vaginal smearing (Hubscher et al, 2005). Rats were smeared daily for 14 consecutive days. Vaginal smears were taken once each day, between 0900h and 1200h. To obtain a sample, the tip of a 1 ml syringe was filled with approximately 100 µl of sterile water and inserted approximately 3–5 mm into the rat's vagina. Care was exercised not to insert the dropper too deeply, because inadvertent cervix stimulation can initiate pseudopregnancy (Freeman, 1994). Sterile water was quickly released from the dropper, then immediately drawn back into it. The sample containing cells was placed on an untreated glass microscope slide and viewed while still wet under a light microscope at 50× magnification (Nikon, Eclipse 50i). The cyclic differences in vaginal cytology occur in response to the morphological changes of the vaginal epithelium as cells desquamate. The 12–14 h proestrus stage is characterized by round nucleated cells of uniform size (Freeman, 1994;Long & Evans, 1922). The next stage, estrus, lasts 25– 27 h, and is distinguished by the appearance of irregularly shaped, un-nucleated cornified cells (Freeman, 1994;Long & Evans, 1922). During diestrus, which lasts 55–57 h, more than half of the cycle (Freeman, 1994), both leukocytes and nucleated cells are present. Regularity of oestrus cycling was confirmed by two consecutive regular cycles. Females not cycling regularly were excluded from the study (<25%). On the study day, females were smeared to determine their stage of the oestrus cycle and then decapitated and hypothalami rapidly dissected out, weighed and snap frozen in liquid nitrogen (n= 6-17 per stage). Trunk blood was collected as previously described (section 3.3.3.3) for assay of plasma LH and FSH levels. This was used to confirm stage of cycle. Hypothalami were acetic acid extracted as described in section 2.3.4.3.2 before hypothalamic alarin levels were measured using an alarin ELISA (Peninsula Laboratories) as described in section 2.3.4.3.3.

135

3.3.8 STATISTICS All data is presented as mean ± SEM. Data from in vivo neuroendocrine axis studies were analysed using a one-way ANOVA with post-hoc Tukey’s multiple comparison test (GraphPad Prism 5). Data from the pituitary explants study and cell studies were analysed using a one-way ANOVA with post- hoc Dunnett’s multiple comparison test (GraphPad Prism 5). The data from cell studies were pooled from separate experiments (as stated) in order to generate an n number of approximately 24 per group. Data from the hypothalamic explant studies were compared by paired Student t-test between the basal and the test period. For GnRH, these data were pooled from separate experiments (as stated) in order to generate an n number of approximately 24 per group. In each individual experiment, explants act as their own control. In all cases, P<0.05 was considered to be statistically significant. Data from the alarin ELISA was analysed using a one-way ANOVA with post-hoc Tukey’s multiple comparison test (GraphPad Prism 5).

136

3.4 RESULTS

3.4.1 EFFECT OF ICV ALARIN ADMINISTRATION ON PLASMA HORMONES IN INTACT MALE RATS IN VIVO ICV administration of alarin (6 nmol) significantly increased plasma LH by almost 50% in ad-libitum fed male Wistar rats 30 minutes after ICV injection (plasma LH ng/ml; saline 0.7 ± 0.1, 6 nmol alarin 1.0 ± 0.1, P<0.05, n = 9-10 saline and alarin, n = 5 kisspeptin) (Table 3.1 and Figure 3.1A). Alarin had no significant effect on FSH or testosterone at either 30 or 60 min after injection. ICV kisspeptin- 10 (2 nmol) was used as a positive control and resulted in a significant increase in plasma LH, FSH and testosterone at 30 min after injection (Figure 3.1B and C and Table 3.1). Alarin increased plasma ACTH at 30 min after injection, although this effect did not achieve statistical significance (Alarin 6 nmol, P=0.08 vs. saline) and alarin also increased plasma corticosterone at 30 min post injection although again, this was not statistically significant (Alarin 6 nmol, P=0.08 vs. saline) (n = 9-10 saline and alarin, n = 5 kisspeptin) (Table 3.1 and Figure 3.1D and E). Alarin had no significant effect on plasma prolactin, TSH or GH levels at either time point (Table 3.1).

30 minutes 60 minutes Kisspeptin Alarin Saline Alarin (6nmol) (2nmol) Saline (6nmol)

LH (ng/ml) 0.7 ± 0.1 1.0 ± 0.1* 7.7 ± 1.8*** 0.5 ± 0.2 1.0 ± 0.5 FSH (ng/ml) 10.3 ± 0.8 11.5 ± 0.9 17.3 ± 2.3*** 14.3 ± 1.2 11.6 ± 2.2 Testosterone (nmol/L) 4.6 ± 0.9 4.7 ± 0.9 12.3 ± 1.2** 11.0 ± 4.2 14.9 ± 7.0 ACTH (pg/ml) 25.8 ± 4.5 91.8 ± 34.1 22.1 ± 4.2 20.3 ± 1.6 17.7 ± 6.0 Corticosterone (ng/ml) 95.6 ± 25.7 244.1 ± 69.3 93.8 ± 39.7 98.9 ± 37.7 149.1 ± 68.0 TSH (ng/ml) 2.3 ± 0.3 2.3 ± 0.3 2.5 ± 0.2 1.8 ± 0.3 2.0 ± 0.3 GH (ng/ml) 25.7 ± 8.1 46.3 ± 15.7 31.4 ± 12.2 15.4 ± 4.6 15.2 ± 4.0 PRL (ng/ml) 7.1 ± 1.6 5.3 ± 1.2 5.5 ± 1.1 4.9 ± 1.6 3.8 ± 1.3

TABLE 3.1 The effect of ICV administration of saline, alarin (6 nmol), or kisspeptin (2 nmol) to ad-libitum fed intact male rats on plasma luteinising hormone (LH), follicle stimulating hormone (FSH), testosterone, adenocorticotrophic hormone (ACTH), corticosterone, thyroid stimulating hormone (TSH), growth hormone (GH), and prolactin (PRL) (n = 9-10 saline and alarin, n=5 kisspeptin). *, P<0.05 vs. saline; **, P<0.01 vs. saline; ***, P<0.001 vs. saline. Results are mean ± SEM.

137

FIGURE 3.1 The effect of ICV injection of saline, alarin (6 nmol) (n = 9-10 per group), or kisspeptin-10 (2 nmol) (positive control) (n = 5) on plasma luteinising hormone (LH) (A), follicle stimulating hormone (FSH) (B), testosterone (C), adenocorticotrophic hormone (ACTH) (D), and corticosterone (E) levels 30 and 60 min after administration in ad libitum fed intact male rats. *, P<0.05; ***, P<0.001 vs. saline (30 min). Results are mean ± SEM.

138

3.4.2 EFFECT OF ALARIN ON NEUROPEPTIDE RELEASE FROM MEDIAL BASAL HYPOTHALAMIC EXPLANTS Treatment with 100 nM alarin significantly increased GnRH release from adult male rat hypothalamic explants in vitro compared with basal release (GnRH basal 100 ± 10.6%, 100 nM alarin 135.4 ± 12.6%; P<0.01, (n = 24). At a lower dose (10 nM), or a higher dose (1000 nM), alarin did not significantly influence GnRH release. Data are presented as a percentage of basal release. These data are pooled from three separate experiments (Table 3.2 and Figure 3.2A). Hypothalamic explants incubated with increasing concentrations of alarin showed a dose dependent reduction in TRH release. However, this effect did not achieve statistical significance (alarin 1000 nM P=0.07 vs basal, n = 7-9 per group). Data are presented as a percentage of basal release (Table 3.2). Hypothalamic explants incubated with increasing concentrations of alarin showed an increase in CRH release, however this did not achieve statistical significance (alarin 100 nM P=0.08 vs. basal, n = 6-7 per group). Data are presented as a percentage of basal release (Table 3.2).

Basal Alarin 10nM Alarin 100nM Alarin 1000nM

GnRH (% of basal) 100.0 ± 10.6 93.0 ± 8.2 135.4 ± 12.6** 100.3 ± 6.4 CRH (% of basal) 100.0 ± 15.5 106.9 ± 13.1 144.9 ± 19.1 135.0 ± 20.1 TRH (% of basal) 100.0 ± 14.0 114.7 ± 26.1 90.4 ± 18.4 67.1 ± 16.9

TABLE 3.2 The effect of artificial cerebrospinal fluid (aCSF) (basal) or aCSF containing alarin (10, 100 or 1000 nM) on the release of gonadotrophin releasing hormone (GnRH), corticotrophin releasing hormone (CRH), and thyrotrophin releasing hormone (TRH) from hypothalamic explants from adult male rats (n = 24 per group for GnRH, n = 7-9 per group for TRH, n = 6-7 per group for CRH). Data are presented as percentage of basal release. **, P<0.01 vs. basal. Results are mean ± SEM.

139

3.4.3 EFFECT OF ALARIN ON GNRH RELEASE FROM GT1-7 CELLS Treatment with 1000 nM and 10000 nM alarin significantly increased GnRH release from GT1-7 cells 60 and 75% above basal respectively, after 240 minute incubation (fmol/ml: basal 75.8 ± 6.9, 1000 nM alarin 109.9 ± 11.8, 10000 nM alarin 121.1 ± 16.5 P<0.05, n = 38 basal, n = 31 1000 nM alarin, n = 14 10000 nM alarin). GALP 1000 nM also significantly increased GnRH release (fmol/ml: basal 75.8 ± 6.9, 1000 nM GALP 114.7 ± 16.5 P<0.05, n = 38 basal, n = 27 1000 nM GALP). GLP-1 100 nM, used as a positive control (Beak et al, 1998), significantly increased GnRH release to 270% of basal (fmol/ml: basal 75.8 ± 6.9, 100 nM GLP-1 187.6 ± 22.1 P<0.001, n = 38 basal, n = 39 100 nM GLP-1) These data are pooled from three separate experiments (Figure 3.2B). There was no difference in the potency of rat and mouse alarin on GnRH release from GT1-7 cells. Murine alarin significantly increased GnRH release from GT1-7 cells at a concentration of 1000 nM, but lower concentrations had no significant effect (n = 20-24 per group) (Table 3.3).

Treatment and dose % of basal Basal 100.0 ± 12.2 Rat alarin 1-25 10 nM 108.9 ± 12.3 Rat alarin 1-25 100 nM 125.3 ± 9.9 Rat alarin 1-25 1000 nM 159.5 ± 10.8* Murine alarin 1-25 10 nM 131.1 ± 14.8 Murine alarin 1-25 100 nM 127.5 ±12.2 Murine alarin 1-25 1000 nM 175.7 ± 11.7* Glucagon-like peptide-1 100 nM 272.3 ± 11.8***

TABLE 3.3 The effect of serum-free medium (basal), serum-free medium containing rat alarin (10, 100 or 1000 nM), serum-free medium containing murine alarin (10, 100 or 1000 nM) or serum-free medium containing glucagon-like peptide-1 (100 nM) on GnRH release from GT1-7 cells after a 240 minute incubation (n = 20-24 per group). Results are mean ± SEM. Data are presented as percentage of basal release and are pooled from three separate experiments. *, P<0.05 vs. basal release. ***, P<0.001 vs. basal release.

140

FIGURE 3.2 A) The effect of artificial cerebrospinal fluid (aCSF) (basal) or aCSF containing alarin (10, 100 or 1000 nM) on GnRH release from hypothalamic explants from adult male rats (n = 24 per group). Data are presented as percentage of basal release, and are pooled from three separate experiments. B) The effect on GnRH release from GT1-7 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing alarin (1, 10, 100, 1000, 10000 nM), serum-free medium containing galanin-like peptide (GALP) (0.1, 1, 10, 100, 1000 nM) or serum-free medium containing glucagon-like peptide-1 (GLP-1) (100 nM) (positive control) (n = 14-30 per group). *, P<0.05; **, P<0.01; ***, P<0.001 vs. basal release. Results are mean ± SEM.

141

3.4.4 EFFECT OF ALARIN ON HORMONE RELEASE FROM PITUITARY EXPLANTS There were no significant changes in LH release from anterior pituitary explants from adult male rats following treatment with alarin. GnRH 100 nM, the positive control, significantly stimulated LH release from pituitary explants (LH ng/ml: aCSF 182.3 ± 13.3, 100 nM GnRH 491.7 ± 51.2. P<0.001, n = 30 per group) (Table 3.4 and Figure 3.3A). Treatment of anterior pituitaries with GALP also had no effect on LH release and again GnRH 100 nM, the positive control, significantly stimulated LH release (LH ng/ml: aCSF 248.2 ± 23.5, 100 nM GnRH 625.7 ± 101.1 P<0.001, n = 10-12 per group) (Table 3.4). There was no effect of alarin or GALP on FSH release from anterior pituitary explants from adult male rats. Artificial CSF containing GnRH, the positive control, significantly increased FSH release compared to aCSF alone. (FSH ng/ml: aCSF 7.2 ± 1.9, 100 nM GnRH 16.3 ± 4.1 P<0.05, n = 10-12 per group) (Table 3.4 and Figure 3.3B). There was no significant effect of alarin on PRL release from anterior pituitary explants from adult male rats. GnRH the positive control (Denef & Andries, 1983), significantly stimulated prolactin release compared to basal treated controls (Prolactin ng/ml: aCSF 77.5 ± 13.3, 100 nM GnRH 235.3 ± 26.5 P<0.001, n = 10-12 per group). GALP 1000 nM significantly stimulated prolactin release compared to basal (Prolactin ng/ml: aCSF 133.9 ± 15.5, 1000 nM GALP 339.4 ± 71.6 P<0.01, 100 nM GnRH 342.2 ± 45.0 P<0.01, n = 10-12 per group). There was no effect of alarin at any dose on TSH release from anterior pituitary explants (Table 3.4).

142

Alarin Alarin Basal Alarin 10nM 100nM 1000nM GnRH 100nM

LH (ng/ml) 182.3 ± 13.3 214.8 ± 28.0 216.5 ± 19.3 217.4 ± 17.2 491.7 ± 51.2*** FSH (ng/ml) 7.2 ± 1.9 7.1 ± 1.2 8.7 ± 2.6 5.4 ± 1.3 16.3 ± 4.1* TSH (ng/ml) 3.1 ± 0.3 - 2.8 ± 0.3 3.3 ± 0.3 2.9 ± 0.2 PRL (ng/ml) 77.5 ± 13.3 130.3 ± 47.9 148.5 ± 22.6 164.7 ± 23.6 235.3 ± 26.5*** GALP GALP Basal GALP 10nM 100nM 1000nM GnRH 100nM

LH (ng/ml) 248.2 ± 23.5 287.9 ± 34.9 293.3 ± 35.9 290.5 ± 45.0 625.7 ± 101.1*** FSH (ng/ml) 7.2 ± 1.9 5.0 ± 0.7 4.9 ± 1.0 5.5 ± 1.0 16.3 ± 4.1* PRL (ng/ml) 133.9 ± 15.5 210.4 ± 20.7 152.6 ± 26.5 339.4 ± 71.6** 342.2 ± 45.0**

TABLE 3.4 The effect of artificial cerebrospinal fluid (aCSF) (basal), aCSF containing alarin (10, 100 or 1000 nM), aCSF containing galanin-like peptide (GALP) (10, 100 or 1000 nM) and aCSF containing gonadotrophin releasing hormone (GnRH) (100 nM) on the release of luteinising hormone (LH), follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH) and prolactin (PRL) from anterior pituitary explants from adult male rats (n = 30 per group for LH, n = 10-12 per group for FSH, TSH and PRL). *, P<0.05; **, P<0.01; ***, P<0.001 vs. basal release. Results are mean ± SEM.

3.4.5 EFFECT OF ALARIN AND GALP ON LH RELEASE FROM LβT2 CELLS

There were no significant changes in LH release from LβT2 cells after 240 minute incubation with alarin compared to basal. GALP at doses of 100 nM and 1000 nM significantly stimulated LH release from LβT2 cells after a 240 minute incubation compared to basal (LH ng/ml: basal 12.0 ± 0.9, 100 nM GALP 22.7 ± 3.1 P<0.05 vs. basal, 1000 nM GALP 29.7 ± 4.8 P< 0.001 vs. basal, n = 8 per group) (Figure 3.3C). GnRH 100 nM, the positive control, significantly stimulated LH release from LβT2 cells (LH ng/ml: basal 12.0 ± 0.9, 100 nM GnRH 36.5 ± 4.3 P<0.001 vs. basal, n = 8 per group).

143

FIGURE 3.3 The effect of artificial cerebrospinal fluid (aCSF) (basal), or aCSF containing alarin (10, 100 or 1000 nM) on luteinising hormone (LH) (A) and follicle stimulating hormone (FSH) (B) release from anterior pituitary explants from adult male rats (n = 10-12 per group). C) The effect on LH release from LβT2 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing alarin (1, 10, 100, 1000, 10000 nM), serum-free medium containing galanin-like peptide (GALP) (0.1, 1, 10, 100, 1000 nM) or serum- free medium containing gonadotrophin releasing hormone (GnRH) (100 nM) (positive control) (n = 8 per group). *, P<0.05; ***, P<0.001 vs. basal release. Results are mean ± SEM. 144

3.4.6 EFFECT OF ICV ALARIN ON PLASMA HORMONES IN MALE RATS AFTER PRETREATMENT WITH CETRORELIX

ICV administration of 30 nmol alarin significantly increased plasma LH by 70% in ad-libitum fed male Wistar rats 30 minutes after ICV injection compared to saline injected controls. This effect was blocked by pre-treatment with the GnRH receptor antagonist cetrorelix (200 nmol) (LH ng/ml; SC saline/ICV saline 0.6 ± 0.1, SC saline/ICV alarin 1.0 ± 0.2, P<0.05 vs. SC saline/ICV saline; SC cetrorelix/ICV alarin 0.4 ± 0.03, P<0.01 vs. SC saline/ICV alarin, n = 9-11 per group). There was a significant increase in plasma LH 30 minutes after ICV injection of 2 nmol kisspeptin-10, the positive control, compared to saline injected controls. This effect was also blocked by pre-treatment with cetrorelix (LH ng/ml; SC saline/ICV saline 0.6 ± 0.1, SC saline/ICV kisspeptin 3.0 ± 0.3, P<0.001 vs. SC saline/ICV saline; SC cetrorelix/ICV kisspeptin 0.6 ± 0.1, P<0.001 vs. SC saline/ICV kisspeptin, n = 11 saline, n = 5 kisspeptin) (Figure 3.4A). ICV administration of 30 nmol alarin had no significant effect on plasma FSH or testosterone compared to saline injected controls. Kisspeptin (2 nmol), the positive control, significantly increased plasma testosterone, an effect blocked by pretreatment with cetrorelix (testosterone ng/ml; SC saline/ICV saline 207.5 ± 46.4, SC saline/ICV kisspeptin 667.2 ± 353.8, P<0.01 vs. SC saline/ICV saline; SC cetrorelix/ICV kisspeptin 181.0 ± 66.8, P<0.05 vs. SC saline/ICV kisspeptin, n = 11 saline, n = 5 kisspeptin) (Figure 3.4B and C). There was no effect of ICV administration of alarin 30 nmol on plasma ATCH, corticosterone, TSH or prolactin compared to ICV saline injected controls (Table 3.5).

145

FIGURE 3.4 The effect of ICV administration of saline (S), alarin (A) (30 nmol) or kisspeptin-10 (K) (2 nmol) 30 minutes after subcutaneous (SC) pre-treatment with 200 nmol cetrorelix (C) or saline (S) in ad-libitum fed adult male rats on plasma luteinising hormone (LH) (A), follicle stimulating hormone (FSH) (B) and testosterone (C) levels (n = 9-11 alarin and saline, n = 5 kisspeptin) 30 min after ICV injection. *, P<0.05 vs. saline/saline. **, P<0.01 vs saline/saline. ***, P<0.001 vs saline/saline. #, P<0.05 vs saline/kisspeptin. ##, P<0.01 vs saline/alarin. ###, P<0.001 vs. saline/kisspeptin. Results are mean ± SEM.

146

SC Saline SC Cetrorelix SC Saline SC Cetrorelix ICV Saline ICV Saline ICV Alarin ICV Alarin

LH (ng/ml) 0.6 ± 0.1 0.4 ± 0.04 1.0 ± 0.2* 0.4 ± 0.03## FSH (ng/ml) 17.7± 2.9 9.9 ± 3.0 13.9 ± 3.0 14.7 ± 2.6 Testosterone (ng/L) 207.5 ± 46.4 123.5 ± 23.8 190.8 ± 32.1 165.7 ± 25.0 ACTH (pg/ml) 24.9 ± 3.4 26.9 ± 4.5 40.0 ± 10.8 31.5 ± 6.6 Corticosterone (ng/ml) 89.7 ± 14.7 161.0 ± 41.2 100.8 ± 25.6 104.5 ± 35.8 TSH (ng/ml) 4.2 ± 0.4 3.1 ± 0.3 3.6 ± 0.4 3.9 ± 0.5 PRL (ng/ml) 5.5 ± 0.5 5.4 ± 0.3 5.6 ± 0.8 5.7 ± 0.3

TABLE 3.5 The effect of ICV administration of saline or alarin (30 nmol) 30 min after subcutaneous pretreatment with 200 nmol cetrorelix or saline in ad-libitum fed intact adult male rats on plasma luteinising hormone (LH), follicle stimulating hormone (FSH), testosterone, adenocorticotrophic hormone (ACTH), corticosterone, thyroid stimulating hormone (TSH), and prolactin (PRL) 30 min after ICV injection. *, P<0.05 vs. saline/saline. **, P<0.01 vs saline/saline. ##, P<0.01 vs saline/alarin. Results are mean ± SEM.

147

3.4.7 REGULATION OF HYPOTHLALAMIC ALARIN BY THE OESTRUS CYCLE There was no significant difference in the hypothalamic peptide levels of alarin between female rats at different stages of the oestrus cycle as determined by vaginal smearing (alarin fmol/hypothalamus: diestrus one 23.4 ± 8.5, diestrus two 16.7 ± 3.4, proestrus 11.1 ± 3.3, oestrus 13.7 ± 2.6, n = 6-18 per group). Plasma LH and FSH were significantly increased in rats in the oestrus phase of the cycle (LH ng/ml: diestrus one 0.3 ± 0.1, diestrus two 0.3 ± 0.1, proestrus 0.3 ± 0.0, oestrus 0.4 ± 0.0, P<0.01. FSH ng/ml: diestrus one 4.8 ± 1.0, diestrus two 7.9 ± 2.5, proestrus 6.9 ± 0.7, oestrus 11.8 ± 1.5, P<0.05, n = 6-18 per group) (Figure 3.5).

FIGURE 3.5 Hypothalamic alarin-like immunoreactivity (A), plasma luteinising hormone (LH) levels (B), and plasma follicle stimulating hormone (FSH) levels (C) from female Sprague Dawley rats at different stages of the oestrus cycle; diestrus 1 (D1), diestrus 2 (D2), proestrus (P) and oestrus (O) (n= 6-18 per group). *, P<0.05 vs. D1; **, P<0.01 vs. all other groups. Results are mean ± SEM.

148

3.5 DISCUSSION

The galanin family of peptides are known to play a role in the regulation of the HPG axis (Merchenthaler, 2008;Gottsch et al, 2004). I have shown that ICV administration of 6 nmol alarin significantly increased plasma LH levels by nearly 50%, 30 minutes after injection. LH levels were still elevated 60 minutes after injection of alarin, but this did not achieve statistical significance. Plasma LH levels peak at the same time point (30 minutes) after ICV injection of 5 nmol galanin-like peptide (Matsumoto et al, 2001). The time course of alarin’s actions on plasma LH suggests that alarin may be having a direct effect on hypothalamic GnRH neurons rather than diffusing to a more distant site such as the pituitary to elicit this effect. My data suggest that ICV alarin administration has no effect on FSH or testosterone release. Similarly, ICV GALP administration has no effect on plasma FSH concentration in male rats (Matsumoto et al, 2001) but has been shown to increase plasma testosterone levels in mice (Krasnow et al, 2003). Exogenous administration of neuropeptides that stimulate GnRH release often show a more potent effect on LH release than on FSH release. For example, central administration of kisspeptin appears to have a more potent effect on LH release than FSH release (Patterson et al, 2006a;Thompson et al, 2004;Tena-Sempere, 2010). Changes in GnRH pulse pattern differentially affect the synthesis and release of LH and FSH. Higher GnRH pulse frequencies and amplitude favour LH release, while slower frequencies stimulate FSH release (Marshall et al, 1991;Bedecarrats & Kaiser, 2003). Alarin administration studies are unlikely to exactly replicate the effects of endogenous alarin at the GnRH neuron, and the physiological role of alarin on differential LH and FSH release is therefore currently unknown. It is possible that alarin- responsive GnRH neurons fire at a higher frequency and so favour release of LH over FSH. In addition, other factors such as inhibin and activin, can influence circulating FSH levels (Gregory & Kaiser, 2004). These factors may modulate the actions of alarin on circulating FSH concentrations. Studies acutely blocking alarin signalling with specific antibodies, or alarin receptor antagonists may be useful to investigate these possibilities.

To investigate the mechanism by which alarin stimulates the HPG axis, I examined the effects of alarin on hypothalamic explants and an immortalised GnRH releasing GT1-7 cell line in vitro. Alarin (100 nM) significantly stimulated GnRH release from hypothalamic explants. Previous studies have determined that both GALP and galanin at the same dose of 100 nM also stimulate GnRH release from hypothalamic explants (Seth et al, 2004). There was no dose response in the effect of alarin on GnRH since alarin 1000 nM did not significantly affect GnRH release from hypothalamic explants. This could be due to receptor desensitisation caused by excess ligand, or dimerisation of alarin at this high dose. It might also reflect the activation of different receptors with minimal effects at higher doses. Alarin, at doses of 1000 and 10000 nM, was able to stimulate GnRH release from GT1-7 cells. 149

There is a ten-fold difference in the effective dose necessary for a GnRH response between the hypothalamic explants and the GT1-7 cell line, and this is possibly due to differences in sensitivity between these two in vitro systems. Hypothalamic explants contain many different cell types through which alarin may act to increase GnRH release either directly or indirectly. There may only be a small direct effect of alarin on GnRH releasing neurons themselves. Such in vitro systems are typically less sensitive than in vivo responses to the administration of neuropeptides (Wren et al, 2002). Thus relatively high concentrations and n numbers are often required to cause a significant effect, even with very potent factors (Thompson et al, 2004).

I also incubated pituitary explants and immortalised LH releasing LβT2 cells with alarin to identify any direct effect of alarin on gonadotrophin release. However, even very high concentrations of alarin had no effect on LH or FSH release from pituitary segments, or LH release from LβT2 cells. These results suggest that alarin stimulates the HPG axis via an effect on hypothalamic GnRH. The effects of ICV alarin on LH are blocked by pre-treatment with the GnRH antagonist cetrorelix, providing further evidence that this effect of alarin is mediated via hypothalamic GnRH. In this study, I used a higher dose of alarin (30 nmol) than in the previous experiment. This was to ensure that alarin had a stimulatory effect on LH, as pre-treatment with a SC injection has been reported to cause physical stress sufficient to suppress LH secretion (Li et al, 2004). However, the basal LH levels observed in this study were similar to those seen in the first ICV study and the stimulatory effect of ICV alarin on LH levels was retained in this experiment. The effect of ICV alarin on circulating LH is small, and there appears to be little difference between the magnitude of the LH response to 6 or 30 nmol alarin, suggesting perhaps a threshold effect of alarin on the HPG axis rather than a dose response.

During the course of my studies, a paper investigating the role of alarin on LH release was published. Van Der Kolk et al reported no effect of LV administration of alarin (1 nmol) on plasma LH in intact male rats. In contrast, LV alarin (1 nmol) stimulated LH release in castrated male rats (Van Der Kolk et al, 2010a). It is unusual that alarin stimulates LH levels only when circulating levels are already elevated in castrated rats, although these animals may have altered sensitivity to hormones which stimulate the reproductive axis. It is likely that the dose used in intact male rats in these studies, 1 nmol, was insufficiently high to elicit a detectable LH response. Despite a difference in the strain of rats being used between my study and this report, Wistar v Sprague Dawley, there are no notable differences in the reproductive function between these two strains (Wilkinson et al, 2000). It is possible that the third ventricle is closer then the lateral ventricle to the alarin responsive neurons which mediate the effect of alarin on GnRH release.

150

Interestingly, central alarin administration (1 nmol) is not associated with any increase in Fos IR in the mPOA, an area rich in GnRH cell bodies (Van Der Kolk et al, 2010a), suggesting that perhaps alarin mediates its effect on LH release via other brain regions. However this dose of alarin does not increase LH levels in intact male rats (Van Der Kolk et al, 2010a). It would be interesting to determine whether a dose of alarin which stimulates LH (6 or 30 nmol) induces Fos in the mPOA.

GALP has been shown to stimulate the HPG axis via hypothalamic GnRH release in vivo (Matsumoto et al, 2001), and to stimulate the release of GnRH from hypothalamic explants in vitro (Seth et al, 2004). The stimulatory effect of GALP on the HPG axis in vivo is observed following the administration of relatively low doses: 1-5 nmol (Castellano et al, 2006;Matsumoto et al, 2001). The principal galanin receptor expressed in GnRH neurons is the GalR1 (Mitchell et al, 1999b), which may mediate the effects of galanin and GALP on the HPG axis. However, I have shown, in agreement with a previous study, that GALP also stimulates the release of GnRH from GT1-7 cells which do not express GalR1 or the other known galanin receptors (Seth et al, 2004). I compared the effects of GALP and alarin on GnRH release from GT1-7 cells, and they appear to have similar potency. Both significantly stimulated GnRH release at a dose of 1000 nM while lower doses had no significant effect. The difference in potency between alarin and GALP in vivo may be due to their different binding affinities at a novel receptor and/or the activation of different receptors. Alarin may be specific for only one receptor, whereas GALP is known to bind to at least three receptors (GalR1, GalR2 and GalR3) (Lang et al, 2005).

GALP has been reported to have no direct effect on LH release from pituitary explants (Matsumoto et al, 2001), and my results confirm this finding. However, I have shown that GALP dose dependently stimulates LH release from cultured LH releasing LβT2 cells. It is not known through which receptor GALP mediates this effect. LβT2 cells express mRNA for the GalR3 (chapter 4). Messenger RNAs for the galanin receptors, GalR2 and GalR3, have been detected in the anterior pituitary (Waters & Krause, 2000). However, the identity of the pituitary cells which express these receptors has, to date, not been reported. While the LβT2 cell line provides a very useful model of highly differentiated gonadotrophs (Thomas et al, 1996), some physiological responses differ from those in pituitary gonadotrophs (Eertmans et al, 2007).

My data suggests that hypothalamic alarin is not regulated by sex steroids in rats, since there is no difference in alarin peptide levels across the different stages of the oestrus cycle. However, there was a trend towards a reduction in hypothalamic alarin-like IR in the oestrus stage of the cycle, when

151

oestrogen levels are highest. The n numbers in this study are relatively small and there was variation in the number of rats in each stage of the cycle. It is possible that with increased n numbers, a statistically significant effect of sex steroid milieu on hypothalamic alarin-like IR would be observed. It would be interesting to compare hypothalamic alarin levels between sexes of the same strain of rat. Data comparing hypothalamic alarin-IR in ovariectomised females to intact females would help to establish whether or not alarin levels were regulated by sex steroids. The experiment I carried out investigated modulations in hypothalamic alarin peptide levels. It would be useful to determine whether or not alarin mRNA expression is affected by sex steroid milieu since message and peptide expression are not always related (Gygi et al, 1999). The expression of GALP mRNA in the ARC is unaffected by sex steroids in both the rat and macaque (Cunningham et al, 2004a;Cunningham et al, 2004b) and it therefore seems unlikely that either alarin or GALP mediate the effects of gonadal steroids on reproductive behaviour.

ICV alarin administration had no effect on circulating prolactin concentrations in rats. However, there was a non-significant, dose dependent stimulation of prolactin release following direct administration of alarin to anterior pituitary explants. GALP has previously been reported to have no effect on pituitary explants (Matsumoto et al, 2001), and therefore this small stimulation of prolactin by alarin may be an effect of alarin which is distinct from the actions of GALP. However, I observed a significant increase in prolactin release from pituitary explants following treatment with GALP (1000 nM). The previous study reports no effect of GALP from 1 to 1000 nM doses on the release of pituitary hormones from dispersed pituitary cells (Matsumoto et al, 2001). The difference between my results and those shown previously may be due to the different experimental models used: anterior pituitary explants compared to dispersed pituitary cells. Intercellular communication exists in the anterior pituitary such that cells produce substances which can affect the secretory activities of neighbouring cells. This natural organisation is disrupted when using a dispersed pituitary cell model and this can effect overall pituitary hormone output (Hu & Lawson, 1995). The Matsumoto study also had smaller n numbers (n = 4) compared to my study. In vitro systems often require larger n numbers to see an effect due to their relative insensitivity compared to in vivo models.

Prolactin is often released from cells other than lactotrophs in the pituitary, including somatotrophs and gonadotrophs (Simmons et al, 1990;Losinski et al, 1989). It is therefore possible that alarin and GALP stimulate the release of another pituitary hormone which is associated with the co-release of prolactin. My studies suggest that alarin has no effect on gonadotrophin release from anterior pituitary explants. It would be interesting to determine whether alarin has a direct effect on prolactin release from the prolactin-releasing GH3 rat pituitary tumour cell line. This cell line expresses GalR1 and

152

GalR2 mRNA (Fathi et al, 1997), and reportedly releases prolactin in response to galanin (Drouhault et al, 1994). It would be useful to examine the direct effect of alarin on GH release from pituitary explants. ICV alarin (6 nmol) administration non-significantly increased plasma GH levels in rats. GALP has been reported to have no effect on plasma GH concentrations in rats, but increases GH levels in monkeys following ICV administration (Matsumoto et al, 2001;Shahab et al, 2005).

Central alarin administration had no effect on plasma TSH levels in rats. However, incubation of hypothalamic explants with increasing concentrations of alarin (10 nM to 1000 nM) gave the appearance of a dose-dependent suppressive effect on TRH release, although this did not reach statistical significance. Interestingly, alarin (1 nmol) administered centrally to rats has been associated with a non-significant reduction in oxygen consumption, an indirect measure of metabolic rate compared to vehicle treated rats (Van Der Kolk et al, 2010a). Suppression of the thyroid axis at the level of the hypothalamus is associated with a decreased basal metabolic rate (Silva, 1995). GALP has previously been reported to inhibit TRH release from hypothalamic explants (Seth et al, 2003). In addition, iPVN GALP (1 nmol) administration reduces circulating TSH at 10 minutes post-injection (Seth et al, 2003), though ICV administration of GALP (5 nmol) has been reported to have no effect on plasma TSH in rats (Matsumoto et al, 2001). These data suggest that the effect of GALP on plasma TSH is likely to be mediated via receptors in the PVN, an area rich in TRH neurons (Van Der Kolk et al, 2010b). Central administration of alarin induces Fos-IR in the PVN, although the exact phenotype of the activated cells has not yet been established (Van Der Kolk et al, 2010a). It is possible that ICV administration of alarin suppresses circulating TSH levels, but that the thirty minute time point I used was not the optimal point at which to detect this change. However, ICV administration of known modulators of TRH release such as AgRP and NDP-MSH have a maximal effect on plasma TSH levels between 20 and 40 minutes post-injection (Kim et al, 2000b). Alternatively, higher doses of alarin administered ICV may be required for sufficient peptide to reach the PVN to elicit an effect at receptors located here. Further studies examining direct administration of alarin into the PVN, are required to investigate the role of alarin in the regulation of the HPT axis.

ICV administration of alarin (6 nmol) caused a 400% increase in circulating ACTH concentration above saline, 30 minutes post-injection, although this effect was not statistically significant. Plasma corticosterone levels were also non-significantly elevated at this time point. However, in the second ICV alarin administration study, where rats were given a SC injection 30 minutes prior to ICV administration of alarin (30 nmol), only a smaller, 150% increase in plasma ACTH was observed. A SC injection is likely to activate the HPA axis in a rat irrespective of previous sham injections. Therefore, when rats receive an ICV injection of alarin thirty minutes later, rats may be less

153

responsive to a repeated stress inducer. Interestingly, the basal plasma ACTH and corticosterone levels do not differ much between studies, though it is possible that the sensitivity of stress hormone responsive pathways does vary. My in vitro studies reveal a small, non-significant increase in CRH release from hypothalamic explants incubated with alarin. The n number for this study was small with only 6-7 in each group. Increasing the n numbers of this study would determine whether alarin does stimulate CRH neurons from hypothalamic explants. Since the majority of CRH producing neurons in the brain are located in the PVN (Hashimoto et al, 1982), and alarin increases Fos IR in this nucleus (Van Der Kolk et al, 2010a), it would be useful to administer alarin directly into the PVN to establish any effect of alarin on the HPA axis at the level of the hypothalamus.

Central administration of GALP (1 nmol) has been reported to increase plasma ACTH levels, with a maximal effect five minutes post-injection, and ACTH concentrations returning to pre-injection levels after thirty minutes (Onaka et al, 2005). However, an earlier study by a separate group suggested that ICV injection of 5 nmol GALP had no effect on plasma ACTH at any time point measured, which included ten, twenty and thirty minutes post-injection (Matsumoto et al, 2001). The reason for this discrepancy is unknown as the methods used by both groups are very similar.

Activation of the HPA axis occurs readily in response to non-specific stressors. It is difficult to differentiate a direct effect of ICV administration of a peptide on the HPA axis from a non-specific effect of ICV peptide administration which activates the HPA axis e.g. nausea. Central injection of alarin might act as a non-specific stressor to secondarily stimulate increases in the stress hormones. There is a well-recognized pattern of pituitary hormone secretion in response to stress. Typically, non- specific stress raises ACTH, corticosterone and PRL. However, ICV alarin does not cause any significant behavioural abnormalities, which are often seen in non-specifically stressed animals, and alarin caused a small increase in CRH release from hypothalamic explants in vitro.

In summary, these studies demonstrate that ICV alarin stimulates the HPG axis in rats, and the stimulatory effect of alarin on circulating LH is likely mediated via GnRH. Other effects of alarin on neuroendocrine axes are less definite, and further studies are required to determine whether alarin plays a role in the regulation of the HPT and HPA axes.

154

CHAPTER 4

INVESTIGATING THE RECEPTOR MEDIATING THE BIOLOGICAL EFFECTS OF ALARIN

155

4.1 INTRODUCTION

4.1.1 GALANIN RECEPTORS The first autoradiographic binding profiles derived from I125labelled-galanin suggested the presence of multiple galanin receptor subtypes (Bartfai et al, 1993;Wynick et al, 1993b). Subsequently three distinct galanin receptors have been cloned and characterised in rats, mice and humans: GalR1, GalR2 and GalR3 (Burgevin et al, 1995;Fathi et al, 1997;Howard et al, 1997;Smith et al, 1998). All three are membrane bound GPCRs. Receptors of each subtype are highly conserved between species, while the different receptor subtypes have relatively low sequence similarities (Kolakowski, Jr. et al, 1998b). The three subtypes have distinct but overlapping patterns of expression in the CNS and in the periphery. GalR1 and GalR3 act via different intracellular signalling pathways to GalR2 (Wang et al, 1998b;Smith et al, 1998).

GalR1 and GalR2 demonstrate similar affinities for full-length galanin (Wang et al, 1997c;Borowsky et al, 1998). However, the affinity of both rat and human GalR3 for galanin is lower (Smith et al, 1998). In contrast, GALP binds with greatest affinity to GalR3, followed by GalR2, and then GalR1 (Lang et al, 2005).

FIGURE 4.1 Galanin receptor subtypes signalling pathways. Abbreviations: AC, adenylate cyclase; CaCC, Ca2+-dependent chloride channel; cAMP, 3′,5′-cyclic adenosine monophosphate; (p)CREB, (phosphorylated) cAMP response element binding protein; 3′,5′-cAMP response element-binding protein; DAG, diacylglycerol; IP3, inositol triphosphate; MEK, mitogen-induced extracellular kinase; PDK-1, phosphoinosotide-dependent protein-kinase 1; PIP2, phosphatidylinositol bisphosphate; PIP3, phosphatidylinositol trisphosphate; PI3K, phosphatidylinositol 3-kinase; PKB, protein kinase B; PLC, phospholipase C. Taken from (Lang et al, 2007). 156

4.1.1.1 GALANIN RECEPTOR 1 The GalR1 was originally isolated from the human Bowes melanoma cell line (Habert-Ortoli et al, 1994) and has subsequently been cloned from human colon (Lorimer & Benya, 1996), rat insulinoma cells (Parker et al, 1995), rat brain (Burgevin et al, 1995) and mouse brain (Wang et al, 1997d). Human GalR1 cDNA encodes a protein of 349 amino acids (Habert-Ortoli et al, 1994) while the rat homologue is a 346 amino acid protein with 92% homology to the human receptor (Parker et al, 1995). The mouse GalR1 is 348 amino acids in size and shows 91% and 94% homology to the human and rat GalR1 receptors respectively (Wang et al, 1997d).

This galanin receptor subtype signals via pertussis-toxin sensitive Gi/o proteins to inhibit adenylate cyclase, reduce cAMP-responsive element binding (CREB) protein phosphorylation and hyperpolarise cells via opening of ATP-sensitive K+ channels (Wang et al, 1998b). The GalR1 hyperpolarisation response is consistent with the inhibition of exocytosis and suggests that this receptor might act to inhibit release of neurotransmitters or hormones.

The GalR1 mRNA is widely and abundantly expressed in the mammalian CNS (Habert-Ortoli et al, 1994). The highest levels are observed in the hypothalamus, amygdala, ventral hippocampus, thalamus, brain stem (medulla oblongata, locus coruleus and lateral parabrachial nucleus) and spinal cord (dorsal horn) (Gustafson et al, 1996;Burgevin et al, 1995;Parker et al, 1995). A detailed study of the distribution of GalR1 mRNA in the hypothalamus using cRNA probes has revealed high levels of expression in the MPOA, SON, and the posterior magnocellular and medial parvocellular divisions of the PVN (Mitchell et al, 1997). The distribution of 125I-galanin binding sites as shown in autoradiograph experiments correlates with that of GalR1 mRNA in rat and mouse brain (Jungnickel & Gundlach, 2005) suggesting a more limited and lower level of GalR2/3 expression and/or lower affinity of galanin for these subtypes. GalR1 expression in the periphery is controversial. While some groups report expression of GalR1 throughout the GI tract with greatest expression in the duodenum (Lorimer & Benya, 1996;Parker et al, 1995;Habert-Ortoli et al, 1994), other groups report no expression of this receptor subtype outside of the CNS (Waters & Krause, 2000).

Expression of GalR1 mRNA is regulated by metabolic signals (Gorbatyuk & Hokfelt, 1998b), reproductive hormone levels (Faure-Virelizier et al, 1998), inflammatory mediators (Benya et al, 1998) and other signals suggestive of the diverse effects of galanin mediated via this receptor subtype.

A GalR1 knockout mouse (GalR1-/-) has been generated and extensive phenotypic analysis undertaken (Jacoby et al, 2002). Interestingly, there is no difference in galanin and GalR2 expression

157

in these knockout mice, but there is an slight increase in GalR3 expression in the spinal cord and a decrease in GalR3 expression in the brain of GalR1-/- mice compared to wild type littermates (Jacoby et al, 2002;Blakeman et al, 2003). The GalR3 also signals via Gi/o proteins. GalR1-/- mice are viable and exhibit normal growth, body weight and reproductive capabilities (Jacoby et al, 2002). However, they do exhibit a spontaneous seizure phenotype (Jacoby et al, 2002). These seizures occur with variable severity in response to stressful environmental triggers and are associated with impaired synaptic inhibition in hippocampal neurons (Fetissov et al, 2003;McColl et al, 2006;Mazarati et al, 2004b).

Initial studies suggested that GalR1-/- mice didn’t display any marked phenotype relating to energy homeostasis, and GalR1-/- mice show normal responses to the feeding and reproductive effects of GALP administration (Krasnow et al, 2004). However, Zorilla et al propose that GalR1-/- mice have an impaired ability to adapt to acute changes in dietary fat content, suggesting a role for the GalR1 in maintaining neutral energy balance (Zorrilla et al, 2007). GalR1-/- mice display significantly reduced circulating IGF-1 levels, implicating GalR1 in basal regulation mechanisms associated with IGF-1 synthesis or secretion, either directly or through regulation of GH secretion (Jacoby et al, 2002). Whilst there are no differences in basal ACTH and corticosterone levels between GalR1-/- and wild type mice (Mitsukawa et al, 2009), GalR1-/- mice show a test-specific increase in anxiety behaviour and fail to respond to galanin-induced inhibition of stress-related responses (hyperthermia, locomotion, ACTH and corticosterone levels). These data suggest that the GalR1 plays an important role in the anxiolytic-like effects of galanin under conditions of relatively high stress (Holmes et al, 2003;Mitsukawa et al, 2009).

Regarding a role for the GalR1 in the regulation of nociception, GalR1-/- mice exhibit a slight hyperalgesia in response to tissue injury and inflammation, but otherwise appear to have unaltered pain responses compared to wild type animals (Malkmus et al, 2005;Blakeman et al, 2003). GalR1-/- mice are also reported to have only very subtle test-specific alterations in their performances in learning and memory tasks, suggesting that galanin’s effects on cognition are mostly mediated via an alternative galanin receptor (Badie-Mahdavi et al, 2005;Rustay et al, 2005;Wrenn et al, 2004).

158

4.1.1.2 GALANIN RECEPTOR 2 The second galanin receptor subtype to be cloned was originally isolated from a rat hypothalamus cDNA library simultaneously by several groups, and was revealed as a 372 amino acid protein (Smith et al, 1997b;Howard et al, 1997;Wang et al, 1997a;Fathi et al, 1997). The rat GalR2 shares only 38- 40% homology to the rat GalR1 (Howard et al, 1997;Wang et al, 1997a;Smith et al, 1997b) but is highly conserved between species, with 85-87% homology to human GalR2, a 387 amino acid protein (Borowsky et al, 1998;Fathi et al, 1998), and 94% homology to the mouse GalR2, a 370 amino acid protein (Pang et al, 1998).

GalR2 signals through multiple classes of G-proteins and thus stimulates a number of intracellular pathways. The most commonly reported pathway involves activation of phospholipase C which increases inositol phosphate hydrolysis, mediating the release of intracellular Ca2+ into the cytoplasm and the opening of Ca2+-dependent chloride channels (Borowsky et al, 1998;Pang et al, 1998;Smith et al, 1997b). This effect of GalR2 activation is pertussis-toxin insensitive, suggesting that GalR2 may act through Gq/11-type G proteins. GalR2 is also reported to inhibit cAMP production, an effect sensitive to pertussis toxin and suggestive of coupling of GalR2 to the inhibition of adenylate cyclase via Gi-type G proteins (Fathi et al, 1998;Wang et al, 1997a). There is also evidence that GalR2 is couples to Go-type G proteins activating MAPK in a pertussis toxin sensitive PKC dependent fashion (Hawes et al, 2006).

The GalR2 has a wider distribution in the brain than the GalR1 and is also present in the pituitary gland and peripheral tissues (Wang et al, 1997a;Fathi et al, 1997). Within the CNS, in situ hybridisation has revealed moderately high GalR2 mRNA expression levels in the hypothalamus, hippocampus, entorhinal and piriform cortex, amygdala, dentate gyrus (Fathi et al, 1997;Xu et al, 1998). Specifically, all major hypothalamic nuclei express GalR2 mRNA, with highest levels observed in the lateral mammillary bodies, the TMN, and the magnocellular neurons of the SON, and lower levels in the PVN and the ARC (Depczynski et al, 1998).

Peripherally, GalR2 mRNA is expressed in lactotrophs, somatotrophs, gonadotrophs and thyrotrophs of the anterior pituitary, suggesting that this receptor may regulate hypothalamic-pituitary secretion (Depczynski et al, 1998). GalR2 mRNA is also highly expressed in the GI tract, spleen, lung, skeletal muscle, heart, kidney, liver, ovary, uterus, vas deferens, prostate gland and testis (Fathi et al, 1997;Smith et al, 1997b;Howard et al, 1997).

159

GalR2 signalling has been implicated in the mediation of numerous and diverse effects of galanin, including emotion, memory, nociception, cellular growth, pancreatic islet function, cardiovascular tone, peripheral metabolism, reproduction, jejunal contraction, stimulation of growth hormone and prolactin secretion, myometrial contraction, seizure susceptibility, peripheral nerve regeneration, and hippocampal neuroprotection (Lu et al, 2005a;Elliott-Hunt et al, 2007;Liu et al, 2001;Badie-Mahdavi et al, 2005;Burazin & Gundlach, 1998;Mazarati et al, 2004a;Wang et al, 1998a;Woll & Rozengurt, 1989;Ottlecz et al, 1988;Depczynski et al, 1998;Niiro et al, 1998).

Several different methods have been used to generate GalR2 knockout mice (GalR2-/-) (Hobson et al, 2006;Krasnow et al, 2004;Shi et al, 2006). Despite detailed phenotypic analysis, GalR2-/- mice do not appear to differ significantly from their wild-type controls with respect to growth, reproductive and metabolic physiology, locomotor activity, seizure susceptibility and basic behaviours (Gottsch et al, 2005;Bailey et al, 2007). It is possible that either GalR2 plays no role in the physiological functions tested, or that adaptation to congenital absence of GalR2 occurs through developmental compensation (Gottsch et al, 2005). However, there is no significant alteration in galanin or GalR1 mRNA expression in these animals (Hobson et al, 2006).

GalR2-/- mice do have a significant developmental loss of dorsal root ganglion neurons likely to be nociceptors (Shi et al, 2006;Hobson et al, 2006). Studies carried out by Shi et al have revealed no changes in pain behaviour between GalR2-/- mice and wild type littermates in several models of neuropathic pain (Shi et al, 2006), yet Hobson et al propose that their GalR2-/- mouse does have deficits in neuropathic and inflammatory pain behaviours (Hobson et al, 2006). A possible explanation for these discordant results is that the GalR2-/- mice used in these two studies have been generated from different genetic backgrounds and that the model of neuropathic pain used differs between studies. GalR2-/- mice are also reported to have an attenuated response to the protective effects of exogenous galanin following neuronal injury, implicating the GalR2 in mediating the neuroprotective effects of galanin (Elliott-Hunt et al, 2007). Detailed behavioural phenotyping of the GalR2-/- mouse revealed a test-specific anxiety-like phenotype of the GalR2-/- mouse in the elevated plus maze (EPM) (Bailey et al, 2007). However, this effect is likely to be strain specific as normal behaviour in the EPM has been reported in other GalR2-/- mouse models (Lu et al, 2008). This cohort of mice also exhibited a more persistent depressive-like phenotype, suggesting an anti-depressant role of GalR2 signalling (Lu et al, 2008). These studies indicate that GalR2-/- mice do not show profound changes in anxiety-like behaviour.

160

4.1.1.3 GALANIN RECEPTOR 3

The third galanin receptor subtype was first cloned from rat, and the cDNA encodes a protein of 370 residues (Wang et al, 1997b;Wang et al, 1997c). Rat GalR3 shows only 36% and 55% sequence similarity to rat GalR1 and rat GalR2 respectively (Mennicken et al, 2002). Human GalR3 was cloned from a human genomic library based on structural similarity to human GalR1 and GalR2 and is a 368 amino acid protein with 90% homology to rat GalR3 (Kolakowski, Jr. et al, 1998a;Kolakowski, Jr. et al, 1998b). Mouse GalR3 is 370 amino acids (Kolakowski, Jr. et al, 1998b).

Like the GalR1, GalR3 stimulates a pertussis toxins sensitive activation of inward K+ current consistent with coupling to Gi/o-type G proteins (Smith, 1998). GalR3 signalling is therefore capable of producing a hyperpolarisation response consistent with the inhibition of exocytosis and thus may also act to inhibit neurotransmitter or hormone release.

In the CNS, GalR3 transcripts are expressed at a relatively low level, but detected with highest abundance in the hypothalamus and at lower levels in discrete regions of the CNS, including the olfactory bulb, cerebral cortex, medulla oblongata, caudate putamen, cerebellum and spinal cord (Smith, 1998). Within the hypothalamus, GalR3 mRNA is expressed predominantly in the MPOA and the DMN, with lower expression in the LHA, VMN and premammillary nuclei (Mennicken et al, 2002).

Peripherally, GalR3 has been detected with highest levels in the pituitary, but is also expressed in the heart, liver, kidney, stomach, testis, adrenal cortex, lung, adrenal medulla, spleen, pancreas and in the microvasculature of the skin (Smith et al, 1998;Schmidhuber et al, 2007;Wang et al, 1997c). Functionally, the GalR3 has been implicated in depression and anxiety (Barr et al, 2006;Swanson et al, 2005), and in mediating the alcohol-related actions of galanin (Belfer et al, 2007) and the effect of galanin on inflammatory oedema formation within the microvasculature (Schmidhuber et al, 2008). No GalR3 knockout mouse has been developed to date.

161

4.1.2 GALANIN RECEPTOR AGONISTS AND ANTAGONISTS

4.1.2.1 NON-SPECIFIC GALANIN RECEPTOR AGONISTS Galnon and Galmic are non-peptide galanin receptor agonists (Saar et al, 2002;Bartfai et al, 2004). Whilst both compounds are substantially more resistant to degradation than endogenous galanin, they are low affinity, non-receptor subtype selective, and have been shown to interact with other pharmacologically important targets.

4.1.2.2 NON-SPECIFIC GALANIN RECEPTOR ANTAGONISTS The commonly used high affinity chimeric galanin receptor antagonists C7 (galanin(1-12)-Pro- spantide-amide) (Xu et al, 1995c), M15 (galantide (galanin(1-12)-Pro-substanceP(5-11)-amide)) (Bartfai et al, 1991), M32 (galanin (1-13) NPY (25-36)-amide) (Xu et al, 1995c), M40 (galanin(1– 13)-Pro2-(Ala-Leu)2-Ala- amide) (Crawley et al, 1993) and M35 (galanin(1-12)-Pro-bradykinin(2-9)-amide) (Ogren et al, 1992) are not receptor subtype selective, and furthermore, can behave as partial agonists at higher concentrations (Lu et al, 2005c).

162

4.1.2.3 SUBTYPE SELECTIVE GALANIN RECEPTOR AGONISTS/ANTAGONISTS

4.1.2.3.1 GALR1 There are currently no known agonists or antagonists which bind with significantly greater affinity to the GalR1 than to either of the other galanin receptors and which could be utilised to investigate the physiological role of the GalR1.

4.1.2.3.2 GALR2 Modifications and truncations to the N-terminus of galanin have been reported to confer specificity to the GalR2. [D-Trp2] galanin exhibits significant selectivity for GalR2 over GalR1 and GalR3, and acts as an agonist at this receptor (Smith et al, 1997b;Smith, 1998). Galanin (2-29) binds with greater affinity to the GalR2 than the other galanin receptors (Wang et al, 1997c). Galanin (2-11) (or AR- M1896) has been used extensively as a GalR2 selective agonist (Liu et al, 2001), but has recently been reported to bind to the GalR3 and has subsequently been termed a non-GalR1 ligand (Lu et al, 2005b). No specific GalR2 antagonists have been reported to date.

4.1.2.3.3 GALR3

There have been recent advances in the development of GalR3 specific agonists and antagonists. A non-peptide 3-arylimino-2-indolone known as compound 9 has been reported to be a potent and selective GalR3 ligand (IC50 = 15 nM) with no detectable binding to the GalR1 or GalR2 when used in in vitro receptor binding assays. In vitro functional assays have demonstrated that it acts as an antagonist at the GalR3 (Konkel et al, 2006). Two small molecule GalR3 antagonists, SNAP 37889 and SNAP 398299, have also been reported to exhibit high affinity at the GalR3 in receptor binding studies and no binding to the GalR1 or GalR2 subtypes. These molecules antagonise galanin in functional assays in vitro and in vivo (Swanson et al, 2005). Peripheral administration of either SNAP 37889 or the 3-arylimino-2-indolone has antidepressant-like effects in rats and mice. Administration of SNAP 37889 also has anxiolytic properties in rats (Swanson et al, 2005;Barr et al, 2006).

163

4.1.3 A GALP SPECIFIC RECEPTOR? There is evidence to suggest that galanin and GALP activate different receptor systems. GALP and galanin induce different patterns of Fos expression in the rat forebrain following central injection, suggesting that the two peptides activate different neuronal populations (Fraley et al, 2003;Lawrence et al, 2003). GALP, but not galanin, stimulates GnRH secretion from GT1-7 cells, which do not appear to express any of the known galanin receptor subtypes (Seth et al, 2004). Pretreatment with M15, a nonspecific galanin receptor antagonist that displays activity at all three identified galanin receptor subtypes, does not block GALP's ability to stimulate GnRH release from GT1-7 cells, and only partially attenuates GALP's stimulatory effect on GnRH secretion from hypothalamic explants (Seth et al, 2004). Fraley et al. have documented a pronounced stimulatory effect of central GALP treatment on sexual behavior in male rats (Fraley et al, 2004b). In contrast, ICV galanin suppresses sexual behavior in male rats (Fraley et al, 2004b). Although both galanin and GALP have an acute stimulatory effect on food intake in the rat, only GALP has a suppressive effect on feeding and body weight after 24 h (Lawrence et al, 2002). These observations collectively point toward galanin and GALP signalling through different receptors.

There is also evidence to suggest that GALP does signal through galanin receptors in vivo. In addition to the structural and pharmacological similarities between galanin and GALP, the two neuropeptides have several biological effects in common, which may indicate a shared receptor mechanism. These include stimulation of food intake acutely following ICV injection, inhibition of the secretion of thyroid-stimulating hormone after iPVN injection (Seth et al, 2003), and stimulation of GnRH secretion from hypothalamic explants, amongst others (Seth et al, 2004). These observations suggest that the similar actions of galanin and GALP may be mediated by galanin receptor signalling and are consistent with GALP interacting with galanin receptors in vivo.

164

4.2 AIMS There is evidence to suggest that alarin does not bind to membrane preparations expressing GalR1 or GalR2. The receptor through which alarin mediates its effects has not yet been determined. I aim to:

1) Determine whether alarin binds to the three known galanin receptors 2) Investigate whether alarin and galanin share a common receptor 3) Investigate the effect of truncated forms of alarin on bioactivity in vitro and in vivo

165

4.3 MATERIALS AND METHODS

4.3.1 MATERIALS Alarin 1-25 and alarin 3-25 were synthesised by BioMol International LP (Exeter, UK) as described previously (section 2.3.1). Alarin 6-25 was purchased from Phoenix pharmaceuticals. All other peptides were purchased from Bachem UK Ltd. (Merseyside, UK). GalR3 expressing membrane was purchased from BioXtal (Mundolsheim, France).

4.3.2 CELL CULTURE OF GALANIN RECEPTOR EXPRESSING CELLS Chinese Hamster Ovary (CHO)-GalR1 and CHO-GalR2 expressing cells were maintained in F12 nutrient mixture containing 1 mM L-glutamine (Invitrogen Ltd.) and supplemented with 10% (v/v) fetal bovine serum (Invitrogen), penicillin (100 IU/ml) and streptomycin (100 µg/ml) (Invitrogen) under the same conditions as GT1-7 cells described in section 3.3.4.3.

4.3.3 CONFIRMATION OF GALANIN RECEPTOR EXPRESSION BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-PCR)

4.3.3.1 TOTAL RNA EXTRACTION – THE TRI REAGENT METHOD Materials Tri-Reagent (Helena Biosciences, Sunderland UK) 1-Bromo-Chloro-Propane (Sigma-Aldrich) Propan-2-ol (VWR) Ethanol (VWR)

Method Total RNA was extracted using Tri-reagent according to the manufacturer’s protocol. Cells cultured in T175 flasks had the medium removed and 10ml Tri-reagent was added to the flask. Following 2 minutes incubation, the mixture was transferred to silanised Corex tubes and incubated for a further 5 minutes at room temperature. To separate the mixture into aqueous and organic phases, 0.1 volumes of 1-bromo-chloro-propane was added and mixed vigorously. The mixture was incubated for 5 minutes at room temperature before being centrifuged at 12000g for 15 minutes at 4°C (centrifuge 5417 C/R, Eppendorf, Hamburg, Germany). The upper, aqueous phase containing RNA was then transferred to a new Corex tube, precipitated with 0.5 volumes propan-2-ol for 10 minutes at room temperature and then centrifuged at 12000g for 10 minutes at 4°C. The supernatant was removed and the pellet washed with 75% ethanol

166

before being centrifuged at 12000g for 10 minutes at 4°C. The supernatant was then removed and the pellet allowed to air dry before being re-suspended in 400 µl GDW. RNA concentration was determined spectrophotometrically. The RNA was diluted 1:100 in GDW and 1ml placed into a quartz cuvette. The absorbance was read at 260 and 280nm (UV-160 spectrophotometer, Shimadzu, Kyoto, Japan). The reading at 280nm gives an indication of the purity of the sample as phenol absorbs more strongly at 280nm than RNA. The concentration of RNA was calculated using the following formula:

Concentration (µg/ml) = Abosrbance260 x dilution factor) x 40. The viability of the RNA was checked by running it on a denaturing 1% formaldehyde gel.

4.3.3.2 DENATURING FORMALDEHYDE GEL TO CHECK VIABILITY OF TOTAL RNA Materials Agarose, type II-A medium EEO (Sigma-Aldrich) Formaldehyde (VWR) 20 x MOPS pH7 (appendix) Ethidium bromide (VWR) DENAT (appendix) Gel loading buffer (appendix) 100 x Tirs-EDTA (TE) pH7.5 (appendix) 2M Sodium Acetate (NaAc) pH5.2 (appendix) Ethanol (VWR) Method A 1% agarose denaturing gel was prepared in 1 x MOPS buffer with 7.5% formaldehyde (v/v). Following quantification of RNA in the spectrophotometer, the RNA samples were ethanol precipitated with 0.1 volumes 2M NaAc pH 5.2 and 2.5 volumes ice cold ethanol. The samples were precipitated at -20°C for a minimum of 1 hour and centrifuged at 12000g for 7 minutes. The supernatant was removed and the pellet vacuum dried for 10 minutes to ensure all ethanol was removed. The pellet was re-suspended in an appropriate volume of PCR GDW to give a 5 mg/ml solution. One microlitre of this solution was added to 12 µl DENAT and the samples were denatured at 65°C for 5 minutes and 3 µl gel loading buffer added. The samples were then loaded onto the gel and run in 1 x MOPS buffer with 7.5% formaldehyde (v/v) at 150 volts for approximately 40 minutes until the gel front had run 10cm. The gel was then stained in 1 x TE with 0.01% ethidium bromide (v/v) on a shaking platform for 30 minutes. The gel was then de-stained overnight in 1 x TE to allow visualization under ultraviolet light of the 18s and 28s ribosomal bands and to ensure that the RNA had not degraded.

167

4.3.3.3 REVERSE TRANSCRIPTION (RT) Materials RNA (5 mg/ml) – CHO-GalR1, CHO-GalR2, GT1-7 or LβT2 10 mM dNTPs (Amersham Biosciences, Little Chalfont, UK) 5 x reverse transcriptase buffer (Promega, Madison WI) Avian myoblastoma virus reverse transcriptase (RT) 10 U/µl (Promega) Oligo dT (12-18) 200 ng/µl (Amersham Biosciences)

Method The reaction was set up in a final volume of 20 µl containing the following: 1 mg/ml RNA, 1 x RT buffer, 1 mM dNTPs and 10 mg/ml oligo dT. The solution was heated to 65°C for 5 minutes and allowed to cool to room temperature for 30 minutes. 10 U RT was added and the reaction incubated at 42°C for 60 minutes. The reaction was then used in polymerase chain reaction.

4.3.3.4 POLYMERASE CHAIN REACTION (PCR) Materials 10 x Taq buffer (Sigma-Aldrich) 20 µM oligonucleotide primers (Eurogentec) Taq DNA polymerase (5U/µl) (Sigma-Aldrich) 10 mM dNTPs (Amersham Biosciences)

Method Riboprobe cDNA fragments were amplified using primers corresponding to sequences published in Nucleotide (http://www.ncbi.nlm.nih.gov/nuccore). Half of the RT reaction generated in 4.3.2.3 was added to a tube containing 1 x Taq buffer, 0.2 mM dNTPs, 200 nM oligonucleotide primers. The reaction was heated to 95°C for 5 minutes and then 5 U Taq DNA polymerase added. The reaction was cycled 25 times through the following temperatures: 95°C for 30s, 55°C for 30s and 72°C for 30s. After completion of the reaction, 10 µl of the PCR products were visualized by gel electrophoresis on a 1% TAE/agarose gel.

168

ACCESSION 5' PRIMER 3' PRIMER BP NUMBER GalR1 CCAAGGTTCTCAATCATCTGC AGAACCGAATAGATACCCCG 357 NM 012958.2 GalR2 CACACCTCGAAACGCGCTGGC CCCGCACTTCCCAACTGCAC 673 NM 019172.4 GalR3 CTCATCTTCCTGTTGGGCATG CGGTACATCTGCTCATCTAC 234 NM 019173.1 LH-R TCACAAGCTTTCAGGGGACT ATCCCTTGGAAAGCATTCCC 390 NM 013582.2

TABLE 4.1 Primer sequences used in polymerase chain reaction (PCR), and the expected size of product in base pairs (BP). LH-R, luteinizing hormone receptor.

4.3.3.5 VISUALISATION OF PCR PRODUCTS Materials Agarose, type II-A medium EEO (Sigma-Aldrich) 50x Tris-acetate-EDTA buffer (TAE) (appendix) Ethidium bromide (10mg/ml) (VWR) DNA marker (BRL 1Kb ladder, Invitrogen) Gel loading buffer (appendix) Method A 1% (w/v) agarose gel was prepared by dissolving the agarose in 1 x TAE using a microwave oven (Panasonic, NNE205W). The gel was cooled to 45°C and ethidium bromide added to a final concentration of 0.5 µg/ml. Once set, the gel was placed into an electrophoresis tank containing 0.5x TAE.

169

4.3.4 MEMBRANE PREPARATIONS

4.3.4.1 PREPARATION OF MEMBRANES FROM GALANIN RECEPTOR EXPRESSING CELLS AND GT1-7 CELLS Membranes for receptor binding studies were prepared by differential centrifugation as described previously (Coppock et al, 1999;Bhogal et al, 1993). At least 40 confluent T175 flasks were used for each membrane preparation. Cells were washed with ice-cold PBS and scraped into 1 mM HEPES pH 7.4 (appendix) containing 30 µg/ml aprotinin, 0.5 µg/ml pepstatin, 0.25 µg/ml leupeptin, 0.25 µg/ml antipain, 0.1 mg/ml benzamidine and 10 µg/ml soybean trypsin inhibitor, using an Ultra Turrax T25 homogeniser (IKA Labortechnik, Staufen, Germany). Homogenates were centrifuged at 1500g for 20 minutes at 4°C (Beckman J2-21, rotor JS-13.1) and the supernatant centrifuged at 100000g at 4°C for 60 minutes (Sorvall Ultracentrifuge OTD55B, rotor A-841, Cambridgeshire, UK). Pellets were then homogenised using a Potter-Elvehjem tissue grinder (Jencons, East Grinstead, West Sussex, UK) and re-suspended in 50 mM HEPES (appendix). The protein concentration in the membrane preparation was measured by Biuret assay (Gornall et al., 1949) and the preparations stored at -70°C.

4.3.4.2 PREPARATION OF MEMBRANES FROM RAT HYPOTHALAMIC TISSUE Membranes were prepared by homogenisation and differential centrifugation. Twenty four hypothalami were collected from rats and stored at -70oC. Hypothalami were homogenised (Ultra- Turrax T25) in ice cold homogenisation buffer containing sucrose (appendix) at 4oC. The homogenates were centrifuged at 1500g (Beckman J2-21, rotor JS-13.1) for 15 minutes at 4°C, and supernatants were then centrifuged at 100000g (Sorvall Ultracentrifuge OTD55B, rotor A-841, Cambridgeshire, UK) for 60 minutes at 4oC. Pellets were removed and re-suspended in 10 volumes of the homogenisation buffer without sucrose using a Potter-Elvehjem tissue grinder (Jencons, East Grinstead, West Sussex, UK), and re-centrifuged at 100000g for 60 minutes at 4oC as before. Finally, pellets were re-suspended in approximately 15 ml 50 mM homogenisation buffer and stored at -70oC in 500 µl aliquots. Protein concentration was measured by Biuret assay and the preparations stored at -70°C.

170

4.3.4.3 BIURET ASSAY TO DETERMINE PROTEIN CONCENTRATION OF MEMBRANES Protein concentrations of membranes were assessed by Biuret assay (Gornall et al., 1949). A standard curve was constructed using 10 mg/ml BSA standard, with a 1-5 mg/ml curve, and a zero tube containing GDW with no BSA. Membrane was added to tubes at 20 µl or 200 µl, and all tubes made up to a volume of 500 µl using GDW. Biuret reagent (2.5 ml) (Sigma, USA) was added to each tube, and all tubes were incubated at room temperature and out of direct sunlight for 30 minutes. The absorbance at 540nm was then measured on a spectrophotometer (WPA Ltd, Cambridge, UK), zeroing the spectrophotometer reference using the 0 mg/ml standard. Membrane protein content was then calculated by linear regression of the absorbance values of the sample membrane, using the standard curve (GraphPad Prism 5 program).

4.3.5 IODINATION OF GALANIN AND GLP-1

Porcine galanin was iodinated using the chloramine-T method as previously described (Wood et al, 1981). Porcine galanin is labelled with 125I at Tyr26 and is widely used as a radioligand in receptor membrane binding studies (Mazarati et al, 2004b;Wang et al, 1997c) and autoradiography (Skofitsch et al, 1986). It is preferred to 125I-human galanin, which is labelled at Tyr9, and may have altered ligand binding properties (Kolakowski, Jr. et al, 1998b). Galanin (2 µg) in 20 µl of 0.5M phosphate buffer was iodinated with 0.5 mCi of Na125I (IMS30 Amersham International) using Chloramine T (1.4µg/10µl) (Sigma) and the reaction stopped 15 seconds later with sodium metabisulphite (4.8µg/10µl) (VWR). The iodinated peptide was purified by reversed-phase HPLC using an acetonitrile (ACN)/H2O/0.05% trifluoroacetic acid (TFA) gradient. Fractions of 0.5 ml were collected and activity tested. The direct iodogen method was used to iodinate GLP-1 as described previously (Wynick et al, 1993c). Three nanomoles of GLP-1 in 10 µl of 0.2 M phosphate buffer pH 7.2 were reacted with 37 MBq of 125I-Na (Amersham) and 23 nM (10 µg) of 1,3,4,6,-tetrachloro-3α, 6α-diphenylglycoluril (Iodogen reagent, Pierce Chemical Co, Perbio Science UK Ltd., Cramlington, UK) for 4 minutes at 22°C. The radiolabelled 125I-GLP-1 was purified by reversed-phase HPLC using an acetonitrile

(ACN)/H2O/0.05% trifluoroacetic acid (TFA) gradient.

171

4.3.6 COMPETITIVE RECEPTOR BINDING ASSAYS

4.3.6.1 GALANIN RECEPTOR EXPRESSING MEMBRANES GalR1 and GalR2 expressing membranes (60 µg) were incubated for 45 minutes in siliconised polypropylene tubes together with 125I porcine galanin (1000 Bq) and unlabelled competing peptides

(as specified), at 22°C in binding buffer (20 mM HEPES [pH 7.4], 5 mM MgCl2, 1% BSA) (appendix) in a final assay volume of 0.5 ml (Wynick et al, 1993b). The reaction was centrifuged (15,874g, 3 minutes, 4°C) (Sigma Laboratory Centrifuges 3, rotor K18) to separate bound and free label. The pellets were then washed with assay buffer (0.5 ml, ice cold) and centrifuged (15,874g, 3 minutes, 4°C). GalR3 expressing membrane was purchased from BioXtal (Mundolsheim, France), and was incubated according to the manufacturer’s instructions. Membrane (1.5 µg) was incubated for 90 minutes in siliconised polypropylene tubes together with 125I porcine galanin (1000 Bq) and unlabelled competing peptides (as specified), at room temperature in binding buffer (50 mM Tris HCl [pH 7.5], 5 mM MgSO4, 1mM EDTA and 1% BSA) in a final assay volume of 0.2 ml. Bound radioactivity was measured by counting in a -counter for 240 seconds. Specific binding was calculated as the difference between the number of radioactive counts in 240 seconds in the absence (total binding) and presence (nonspecific binding) of 400 nM (1 mM for GalR3 membrane) unlabelled galanin. Equilibrium competition curves were constructed with increasing amounts of unlabelled peptide (1 x 10-13 – 10-3 M).

All curves were performed with points in triplicate. IC50 values were calculated from nonlinear regression analysis using the GraphPad Prism 5 program (GraphPad Software Inc., San Diego, CA).

4.3.6.2 HYPOTHALAMIC MEMBRANE Hypothalamic membrane (10 µg) was incubated with 125I galanin (1000 Bq) and increasing concentrations of unlabelled competing peptide (as specified) in 20 mM HEPES buffer (appendix) under the conditions described for GalR1 and GalR2 expressing membranes in section 4.3.6.1.

4.3.6.3 GT1-7 MEMBRANE Binding of GLP-1 and galanin at the GT1-7 membrane was carried out under the conditions described in section 4.3.6.1. GT1-7 membrane (60 µg) was incubated with either 125I GLP-1 (1000 Bq) and increasing concentrations of unlabelled GLP-1, or 125I galanin (1000 Bq) and increasing concentrations of unlabelled galanin in 20 mM HEPES binding buffer (appendix).

172

4.3.7 GALANIN RECEPTOR ANTAGONIST STUDIES C7 (galanin(1-12)-Pro-spantide-amide) is a high affinity galanin receptor antagonist which has been reported to inhibit galanin-induced effects in vivo and in vitro (Crawley et al, 1993;Xu et al, 1995c). C7 binds to all three galanin receptors, with greatest affinity for the GalR3 in vitro (Smith et al, 1998).

4.3.7.1 COMPETITIVE RECEPTOR BINDING OF C7 TO MEMBRANES EXPRESSING GALR1, GALR2 AND GALR3 Competition receptor binding assays were carried out as previously described in section 4.3.6.1 for each of the galanin receptor expressing membranes. The cold-ligand used in these experiments was C7 (500 nM).

4.3.7.2 EFFECT OF GALANIN ON GNRH RELEASE FROM GT1-7 CELLS GT1-7 cells were maintained and plated as described in section 3.3.4.3. Cells were incubated for 240 minutes in 0.5 ml serum-free medium (basal), serum-free medium containing galanin (10, 100, or 1000 nM), or serum-free medium containing GLP-1 (100 nM) (positive control) (n = 9-10 per group).

4.3.7.3 EFFECT OF C7 ON ALARIN INDUCED GNRH RELEASE FROM GT1-7 CELLS GT1-7 cells were maintained and plated as described in section 3.3.4.3. Cells were incubated for 240 minutes in 0.5 ml serum-free medium (basal), serum-free medium containing alarin (1000 nM), serum-free medium containing C7 (100 nM), serum-free medium containing alarin (1000 nM) and C7 (100nM) or serum-free medium containing GLP-1 (100 nM) (positive control) (n = 10-12 per group).

4.3.7.4 EFFECT OF GALANIN AND C7 ON LH RELEASE FROM LβT2 CELLS LβT2 cells were maintained and plated as described in section 3.3.4.5. Cells were incubated for 240 minutes in 0.5 ml serum-free medium (basal), serum-free medium containing galanin (10, 100 or 1000 nM), or serum-free medium containing GnRH (100 nM) (positive control) (n = 10-14 per group).

In a separate experiment, cells were incubated in 0.5 ml serum-free medium (basal), serum-free medium containing C7 (100 nM), serum-free medium containing galanin (1000 nM), serum-free medium containing galanin (1000 nM) and C7 (100 nM), or serum-free medium containing GnRH (100 nM) (positive control) (n = 7-8 per group).

173

4.3.7.5 EFFECT OF C7 ON GALP INDUCED LH RELEASE FROM LβT2 CELLS LβT2 cells were maintained and plated as described in sections 3.3.4.5. Cells were incubated for 240 minutes in 0.5 ml serum-free medium (basal), serum-free medium containing GALP (1000 nM), serum-free medium containing C7 (100 nM), serum-free medium containing GALP (1000 nM) and C7 (100nM) or serum-free medium containing GnRH (100 nM) (positive control) (n = 7-8 per group).

174

4.3.8 THE EFFECT OF N TERMINAL TRUNCATION ON ALARIN BIOACTIVITY

4.3.8.1 IN VIVO STUDIES

ALARIN 3-25 There is a putative enzymatic cleavage site between amino acids two and three of alarin (Pro-Ala). Di- peptidyl peptidase IV (DPP-IV) selectively cleaves two amino acids from peptides which have proline or alanine in the second position. The second amino acid of alarin is proline, making it susceptible to DPP-IV degradation (Baum et al, 2003). To determine whether alarin peptide fragments lacking N- terminal amino acids have altered bioactivity in vivo, alarin 3-25 was administered ICV to rats and food intake and plasma hormone levels measured.

4.3.8.1.1 ICV CANNULATION AND ICV INJECTION Male Wistar rats were ICV cannulated as described in section 2.3.3.1 and injections carried out as described in section 2.3.3.2.

4.3.8.1.2 EFFECT OF ICV ADMINISTRATION OF ALARIN 3-25 ON FOOD INTAKE IN AD-LIBITUM FED RATS IN THE EARLY LIGHT PHASE

Groups of ad-libitum fed male Wistar rats received a single ICV injection of either 0.9% saline, alarin 3-25 (30 nmol), or 2.4 nmol NPY (positive control) during the early light phase between 0900 and 1000h (n = 10-11 saline or alarin, n = 5 NPY). Following injection, animals were returned to their home cages with a pre-weighed amount of chow and free access to water. The remaining food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body-weight was measured at 0 and 24 hours post-injection.

4.3.8.1.3 EFFECT OF ICV ADMINISTRATION OF ALARIN 3-25 ON PLASMA LH AND CORTICOSTERONE IN INTACT MALE RATS Groups of intact male Wistar rats were ICV injected with either 0.9% saline, alarin 3-25 (30 nmol), or 1 nmol kisspeptin-10 (positive control) during the early light phase between 0900 and 1000h (n = 10 saline, n = 4-5 alarin 3-25 and kisspeptin). Rats were decapitated 30 minutes after injection. Trunk blood was collected in both lithium heparin tubes containing 4200 kallikrein inhibitor units aprotinin (Bayer Corp., Haywards Heath, UK), and tubes containing potassium EDTA (final concentration of 1.2-2mg EDTA/ml blood) (Starstedt). Plasma was separated by centrifugation, frozen on dry ice, and stored at -20°C until measurement of LH and corticosterone by RIA.

175

4.3.8.2 IN VITRO STUDIES

ALARIN 6-25 The first 5 amino acids of alarin are identical to the first five amino acids of GALP. These residues may therefore be important in mediating the common effects of alarin and GALP. To determine whether this sequence is critical to biological activity, I looked at the effect of alarin 6-25 on GT1-7 cells in vitro.

4.3.8.2.1 EFFECT OF ALARIN 3-25 AND ALARIN 6-25 ON GNRH RELEASE FROM GT1-7 CELLS GT1-7 cells were maintained as described previously and secretion experiments performed as described in section 3.3.4.3. Cells were incubated in 0.5 ml serum-free medium (basal), serum-free medium containing alarin 1-25 (10, 100, or 1000 nM), serum-free medium containing alarin 3-25 (10, 100 or 1000 nM) or serum-free medium containing GLP-1 (100 nM) (positive control) (n = 14-19 per group). In a separate experiment, GT1-7 cells were incubated in 0.5 ml serum-free medium (basal), serum- free medium containing alarin 6-25 (10, 100 or 1000 nM) or serum-free medium containing GLP-1 (100 nM) (positive control) (n = 21-23 per group).

4.3.8.2.2 COMPETITIVE RECEPTOR BINDING OF ALARIN 3-25 AND ALARIN 6-25 TO MEMBRANES EXPRESSING GALR1, GALR2 AND GALR3

Competitive receptor binding assays for galanin receptor expressing membranes were carried out with alarin 3-25 and alarin 6-25 as the cold ligands under the conditions described in section 4.3.5.1.

4.3.9 STATISTICS

All data is presented as mean ± SEM. Data from in vivo HPG axis studies were analysed using a one- way ANOVA with post-hoc Tukey’s multiple comparison test. Data from the feeding study and cell release studies were analysed using a one-way ANOVA with post-hoc Dunnett’s multiple comparison test (GraphPad Prism 5). In all cases, P<0.05 was considered to be statistically significant.

176

4.4 RESULTS

4.4.1 CONFIRMATION OF GALANIN RECEPTOR EXPRESSION BY RT-PCR CHO-GalR1 expressing cells expressed GalR1 mRNA as shown by RT-PCR. A band of approximately 357 base pairs was seen when compared to a 1Kb ladder (Figure 4.2A). CHO-GalR2 expressing cells expressed GalR2 mRNA as shown by RT-PCR. A band of approximately 673 base pairs was seen when compared to a 1Kb ladder (Figure 4.2B).

FIGURE 4.2 A) Galanin receptor 1 (GalR1) mRNA expression in CHO-GalR1 cell line as determined by reverse transcription-polymerase chain reaction (RT-PCR). R1-, CHO GalR1 RNA without reverse transcriptase enzyme (RT); R1+, CHO-GalR1 RNA with RT; L, 1-Kb ladder. The size of the expected PCR product for GalR1 was 357 base pairs. B) Galanin receptor 2 (GalR2) mRNA expression in CHO-GalR2 cell line as determined by RT-PCR. R2-, CHO GalR2 RNA without RT; R2+, CHO-GalR2 RNA with RT; L, 1-Kb ladder. The size of the expected PCR product for GalR2 was 673 BP.

177

4.4.2 COMPETITIVE RECEPTOR BINDING ASSAYS

4.4.2.1 GALANIN RECEPTOR EXPRESSING MEMBRANES 125 Alarin was unable to displace I galanin binding at the GalR1, GalR2, or GalR3 (IC50 values: alarin, > 1000 nM for all membranes). Galanin and GALP, the positive controls, were able to displace I125 galanin binding at the GalR1 (specific binding 91.6 ± 1.5%) (IC50 values: galanin, 1.4 ± 0.0 nM;

GALP, 45.0 ± 0.1 nM), GalR2 (specific binding 63.0 ± 2.7%) (IC50 values: galanin 1.9 ± 0.1 nM:

GALP, 18.7 ± 0.2 nM), and GalR3 (specific binding 47.1 ± 1.8%) (IC50 values: galanin, 108.4 ± 0.3 µM; GALP, 1.5 ± 0.2 µM; alarin >1000 µM). Results are pooled from two independent experiments performed in triplicate (n = 4–6 per point) (Figure 4.3A, B and C).

4.4.2.2 HYPOTHALAMIC MEMBRANE 125 Alarin was unable to displace I galanin binding at hypothalamic membrane (IC50 value: alarin > 1000 nM). Galanin and GALP, the positive controls, were able to displace I125 galanin binding at the hypothalamic membrane (specific binding 75.8 ± 2.1%) (IC50 values: galanin, 0.1 ± 0.1 nM; GALP, 36.9 ± 0.1 nM). Results are from two independent experiments performed in triplicate (n = 4–6 per point) (Figure 4.3D).

178

FIGURE 4.3 Competitive receptor binding of I125 radiolabelled galanin binding with increasing concentrations of unlabelled galanin (○), GALP (□) and alarin (∆) to membranes prepared from A) CHO cells transfected with

GalR1 (IC50 values: galanin, 1.4 ± 0.0; GALP, 45.0 ± 0.1; alarin >1000 nM), B) CHO cells transfected with

GalR2 (IC50 values: galanin, 1.9 ± 0.1; GALP, 18.7 ± 0.2; alarin >1000 nM), C) GalR3 expressing membrane

(IC50 values: galanin, 108.4 ± 0.3; GALP, 1.5 ± 0.2; alarin >1000 µM), D) male rat hypothalamus (IC50 values: galanin, 0.06 ± 0.1; GALP, 36.9 ± 0.1; alarin >1000 nM). Results are mean ± SEM from two independent experiments performed in triplicate (n = 4–6 per point).

179

4.4.3 DETERMINING GALANIN RECEPTOR EXPRESSION IN GT1-7 AND LβT2 CELLS GT1-7 cells do not express detectable levels of mRNA for any of the galanin receptors (Figure 4.4A). GT1-7 cells do express mRNA for the LH receptor confirming the viability of the RNA (Lei & Rao, 1994) (Figure 4.4B). LβT2 cells express mRNA for the GalR3 receptor, but not for the GalR1 or GalR2 receptors (Figure 4.4A).

FIGURE 4.4 A) Galanin receptor mRNA expression in LβT2 and GT1-7 cell lines as determined by reverse transcription-polymerase chain reaction (RT-PCR). R1, GalR1 specific primers; R2, GalR2 specific primers; R3, GalR3 specific primers; + reverse transcriptase (RT) enzyme; - RT enzyme; L, 1-Kb+ ladder. The size of the expected PCR product for GalR1 was 357 base pairs (BP), GalR2 was 673BP and GalR3 was 234BP. B) Luteinising hormone receptor (LH-R) mRNA expression in the GT1-7 cell line as determined by RT-PCR. LH- R, LH-R specific primers; L, 1-Kb+ ladder. The size of the expected PCR product for LH-R was 390BP.

180

4.4.4 COMPETITIVE RECEPTOR BINDING ASSAYS AT GT1-7 MEMBRANE I125 labelled GLP-1 was able to bind to GT1-7 membrane, and was displaced with increasing concentrations of unlabelled GLP-1 (specific binding 30.0 ± 2.4%) (IC50 value 1.7 ± 0.1 nM), confirming the receptor bioactivity of the membrane prep (n = 3 per point) (Figure 4.5A). I125 labelled galanin was unable to bind to GT1-7 membrane (specific binding less than 3%) (n = 3 per point) (Figure 4.5B).

FIGURE 4.5 A) Competitive receptor binding of I125 radiolabelled glucagon-like peptide (GLP-1) binding with increasing concentrations of unlabelled GLP-1 to membrane prepared from GT1-7 cells (IC50 value 1.7 ± 0.1 nM) (n = 3 per point). B) Competitive receptor binding of I125 radiolabelled galanin binding with increasing concentrations of unlabelled galanin to membrane prepared from GT1-7 cells (specific binding <3%) (n = 3 per point). Results are mean ± SEM.

181

4.4.5 GALANIN RECEPTOR ANTAGONIST STUDIES

4.4.5.1 COMPETITIVE RECEPTOR BINDING OF C7 AT MEMBRANES EXPRESSING GALR1, GALR2 AND GALR3 The non-specific galanin receptor antagonist C7 (500 nM) was able to displace I125 labelled galanin binding to membranes expressing GalR1, GalR2 and GalR3.

GalR1 GalR2 GalR3 Cold peptide (% of total) (% of total) (% of total) Total 100.0 ± 3.0 100.0 ± 0.4 100.0 ± 4.0 C7 500 nM 19.7 ± 0.4 56.4 ± 2.1 32.2 ± 0.6

TABLE 4.2 Competitive receptor binding of I125 radiolabelled galanin binding with no cold peptide (total), or galanin receptor antagonist, C7 (500 nM), to membranes prepared from GalR1, GalR2 and GalR3 expressing cells (n = 3 per group). Results are mean ± SEM.

4.4.5.2 EFFECT OF GALANIN ON GNRH RELEASE FROM GT1-7 CELLS Incubation of GT1-7 cells with galanin (10, 100 or 1000 nM) had no effect on GnRH release compared to basal. Incubation with GLP-1 (100 nM) significantly stimulated GnRH release; P<0.001 vs. basal (n = 9-10 per group).

Treatment and dose GnRH release (% of basal) Basal 100.0 ± 6.3 Galanin 10 nM 89.8 ± 3.4 Galanin 100 nM 95.0 ± 4.5 Galanin 1000 nM 110.8 ± 9.3 GLP-1 100 nM 168.2 ± 8.4***

TABLE 4.3 The effect on GnRH release from GT1-7 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing galanin (10, 100, 1000 nM), or serum-free medium containing glucagon-like peptide 1 (GLP-1) (100 nM) (positive control) (n = 9-10 per group). ***, P<0.001 vs. basal release. Results are mean ± SEM. 182

4.4.5.3 EFFECT OF C7 ON ALARIN INDUCED GNRH RELEASE FROM GT1-7 CELLS Treatment with alarin (1000 nM) significantly stimulated GnRH release from GT1-7 cells compared to basal; P<0.01, n = 10-12). Treatment with C7 (100 nM) alone had no effect on GnRH release from GT1-7 cells, and had no effect on the alarin-induced increase in GnRH. Incubation with GLP-1 (100 nM) significantly stimulated GnRH release; P<0.001 vs. basal, n = 10-12 per group).

Treatment and dose GnRH release (% of basal) Basal 100.0 ± 7.0 C7 100 nM 100.2 ± 8.5 Alarin 1-25 1000 nM 132.2 ± 9.3** Alarin 1-25 1000 nM + C7 1000 nM 131.2 ± 8.9** GLP-1 100 nM 153.4 ± 7.2***

TABLE 4.4 The effect on GnRH release from GT1-7 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing C7 (100 nM), serum-free medium containing alarin (1000 nM), serum-free medium containing C7 (100 nM) and alarin (1000 nM) or serum-free medium containing glucagon- like peptide 1 (GLP-1) (100 nM) (positive control) (n = 10-12 per group). **, P<0.01 vs. basal release ***, P<0.001 vs. basal release. Results are mean ± SEM.

4.4.5.4 EFFECT OF GALANIN AND C7 ON LH RELEASE FROM LβT2 CELLS

Treatment with 1000 nM galanin significantly increased LH release from LβT2 cells compared to basal. GnRH 100 nM, the positive control, significantly stimulated LH release from LβT2 cells (LH ng/ml: basal 6.1 ± 0.4, 1000 nM galanin 11.4 ± 1.1 P<0.001 vs. basal, 100 nM GnRH 11.0 ± 1.1 P<0.001 vs. basal, n = 10-14 per group) (Figure 4.6A).

Incubation of LβT2 cells with C7 alone had no effect on LH release compared to basal. When LβT2 cells were incubated with both C7 and galanin together, the galanin-induced increase in LH release was attenuated (LH ng/ml: basal 6.2 ± 0.7, 1000 nM galanin 14.4 ± 1.2 P< 0.001 vs. basal, 100 nM C7 and 1000nM galanin 9.6 ± 1.3 P< 0.05 vs. 1000 nM galanin, 100 nM GnRH 14.7 ± 1.3 P<0.001 vs. basal, n = 7-8 per group) (Figure 4.6B).

183

4.4.5.5 EFFECT OF C7 ON GALP INDUCED LH RELEASE FROM LβT2 CELLS Treatment with 1000 nM GALP significantly increased LH release from LβT2 cells compared to basal. GnRH 100 nM, the positive control, significantly stimulated LH release from LβT2 cells. Incubation with C7 alone had no significant effect on LH release from LβT2 cells compared to basal. The GALP-induced increase in LH release was attenuated by co-incubation with C7 (LH ng/ml: basal 4.2 ± 0.4, 1000 nM GALP 7.1 ± 1.3 P< 0.05 vs. basal, 100 nM C7 and 1000nM galanin 4.4 ± 0.5 P< 0.05 vs. 1000 nM GALP, 100 nM GnRH 7.7 ± 1.2 P<0.01 vs. basal, n = 7-8 per group) (Figure 4.6B).

184

FIGURE 4.6 A) The effect on luteinising hormone (LH) release from LβT2 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing galanin (10, 100, 1000 nM), or serum-free medium containing gonadotrophin releasing hormone (GnRH) (100 nM) (positive control) (n = 10-14 per group). B) The effect on LH release from LβT2 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing C7 (100 nM), serum-free medium containing galanin (1000 nM), serum- free medium containing C7 (100 nM) and galanin (1000 nM), or serum-free medium containing GnRH (100 nM) (n = 7-8 per group). C) The effect on LH release from LβT2 cells of a 240 minute incubation with serum- free medium (basal), serum-free medium containing C7 (100 nM), serum-free medium containing galanin-like peptide (GALP) (1000 nM), serum-free medium containing C7 (100 nM) and GALP (1000 nM), or serum-free medium containing GnRH (100 nM) (n = 7-8 per group). *, P<0.05 vs. basal release **, P<0.01 vs. basal release ***, P<0.001 vs. basal release. #, P<0.05 vs. galanin/GALP release. Results are mean ± SEM.

185

4.4.6 THE EFFECT OF N TERMINAL TRUNCATION ON ALARIN BIOACTIVITY

4.4.6.1 IN VIVO STUDIES

4.4.6.1.1 EFFECT OF ICV ADMINISTRATION OF ALARIN 3-25 ON FOOD INTAKE IN AD-LIBITUM FED RATS IN THE EARLY LIGHT PHASE ICV alarin 3-25 (30 nmol) administration and ICV NPY 2.4 nmol administration (positive control) significantly increased food intake between 0-2h post-injection compared to saline injected controls (0-2h food intake/g: saline 1.1 ± 0.4, alarin 3-25 30 nmol 2.6 ± 0.4 P<0.05, NPY 2.4 nmol 7.6 ± 1.8 P<0.001, n = 10-11 saline and alarin 3-25, n = 5 NPY). There was no significant effect of alarin 3-25 on food intake at any other time point studied. There was no significant effect of alarin 3-25 on body weight at 24h (Figure 4.7).

FIGURE 4.7 The effect of ICV injection of saline, alarin 3-25 (30 nmol) (n = 10-11) or neuropeptide Y (NPY) (2.4 nmol) (positive control) (n = 5) on 0-1h (A), 1-2h (B), and 0-2h (C) food intake in ad-libitum fed male rats in the early light phase. *, P<0.05; ***, P<0.001 vs. saline. Results are mean ± SEM.

186

4.4.6.1.2 EFFECT OF ICV ADMINISTRATION OF ALARIN 3-25 ON PLASMA LH IN INTACT MALE RATS

ICV administration of alarin 3-25 (30 nmol) had no significant effect on plasma LH concentration 30 minutes after injection in intact male rats. ICV kisspeptin-10 (1 nmol), the positive control, significantly stimulated plasma LH compared to saline injected controls (plasma LH ng/ml; saline 0.7 ± 0.1, 30 nmol alarin 3-25 0.7 ± 0.2, 1 nmol kisspeptin 5.3 ± 0.7 P<0.001, n = 10 saline, n = 4-5 alarin 3-25 and kisspeptin) (Figure 4.8A).

4.4.6.1.3 EFFECT OF ICV ADMINISTRATION OF ALARIN 3-25 ON PLASMA CORTICOSTERONE IN INTACT MALE RATS ICV alarin 3-25 administration significantly increased plasma corticosterone at 30 minutes post injection (plasma corticosterone ng/ml; saline 178.6 ± 37.9, 30 nmol alarin 3-25 323.7 ± 127.0 P<0.05, n = 9 saline, n = 5 alarin 3-25) (Figure 4.8B).

FIGURE 4.8 A) The effect of ICV injection of saline, alarin 3-25 (30 nmol) or kisspeptin-10 (1 nmol) (n = 10 saline, n = 4-5 alarin 3-25 and kisspeptin) on plasma luteinising hormone (LH) levels 30 minutes after administration in ad-libitum fed intact male rats. ***, P<0.001 vs. saline. B) The effect of ICV injection of saline or alarin 3-25 (30 nmol) (n = 9 saline, n= 5 alarin) on plasma corticosterone levels 30 minutes after administration in ad-libitum fed intact male rats. *, P<0.05 vs. saline. Results are mean ± SEM.

187

4.4.6.2 IN VITRO STUDIES

4.4.6.2.1 EFFECT OF ALARIN 3-25 AND ALARIN 6-25 ON GNRH RELEASE FROM GT1-7 CELLS Treatment with 1000 nM alarin 3-25 significantly increased GnRH release from GT1-7 cells compared to basal after 240 minute incubation (P<0.05, n = 14-19 per group). Treatment with 1000 nM alarin 1-25 significantly increased GnRH release from GT1-7 cells compared to basal after 240 minute incubation (P<0.01, n = 14-19 per group). There was no significant effect of any lower doses of alarin 1-25 or alarin 3-25 on GnRH release, and there was no significant difference in GnRH release following treatment between treatment with alarin 1-25 (1000 nM) and alarin 3-25 (1000 nM). Incubation with GLP-1 (100 nM) significantly stimulated GnRH release; P<0.001 vs. basal, n = 14-19 per group).

Treatment and dose GnRH release (% of basal) Basal 100 ± 12.8 Alarin 1-25 10 nM 118.1 ± 10.4 Alarin 1-25 100 nM 115.3 ± 9.3 Alarin 1-25 1000 nM 157.5 ± 11.6** Alarin 3-25 10 nM 120.3 ± 11.5 Alarin 3-25 100 nM 141.2 ± 11.1 Alarin 3-25 1000 nM 149.4 ± 7.3* GLP-1 100 nM 168.6 ± 14.1***

TABLE 4.5 The effect on GnRH release from GT1-7 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing alarin 1-25 (10, 100, 1000 nM), serum-free medium containing alarin 3-25 (10, 100, 1000 nM), or serum-free medium containing glucagon-like peptide 1 (GLP-1) (100 nM) (positive control) (n = 14-19 per group). *, P<0.05 vs. basal release; **, P<0.01 vs. basal release; ***, P<0.001 vs. basal release. Results are mean ± SEM.

188

Incubation with alarin 6-25 had no significant effect on GnRH release from GT1-7 cells compared to basal.

Treatment and dose GnRH release (% of basal) Basal 100 ± 12.2 Alarin 6-25 10 nM 129.5 ± 12.2 Alarin 6-25 100 nM 103.8 ± 9.7 Alarin 6-25 1000 nM 105.4 ± 10.7 Glucagon-like peptide-1 100 nM 172.5 ± 12.0**

TABLE 4.6 The effect on GnRH release from GT1-7 cells of a 240 minute incubation with serum-free medium (basal), serum-free medium containing alarin 6-25 (10, 100, 1000 nM), or serum-free medium containing glucagon-like peptide 1 (GLP-1) (100 nM) (positive control) (n = 21-23 per group). **, P<0.01 vs. basal release. Results are mean ± SEM.

4.4.6.2.2 COMPETITVE RECEPTOR BINDING OF ALARIN 3-25 AND ALARIN 6-25 AT GALANIN RECEPTOR EXPRESSING MEMBRANES Alarin 3-25 and alarin 6-25 were unable to displace radiolabelled galanin from binding to any of the three galanin receptor expressing membranes.

GalR1 GalR2 GalR3 Cold peptide (% of total) (% of total) (% of total) Total 100.0 ± 1.4 100.0 ± 1.0 100.0 ± 0.8 Galanin 400 nM 13.3 ± 0.7 53.3 ± 1.4 50.5 ± 2.7 Alarin 3-25 1000 nM 105.1 ± 1.5 101.6 ± 2.3 96.4 ± 2.0 Alarin 6-25 1000 nM 103.1 ± 0.5 101.8 ± 2.2 98.4 ± 1.4

TABLE 4.7 Competitive receptor binding of I125 radiolabelled galanin binding with no cold peptide (total), galanin (400 nM), alarin 3-25 (1000 nM) or alarin 6-25 (1000 nM), to membranes prepared from GalR1, GalR2 and GalR3 expressing cells (n = 3 per group). Results are mean ± SEM.

189

4.5 DISCUSSION Alarin lacks the galanin receptor binding domain which is thought to be responsible for the binding of galanin and GALP to the three known galanin receptors (Bloomquist et al, 1998;Land et al, 1991;Lang et al, 2005;Smith et al, 1998). It has previously been reported that alarin is unable to bind to membrane preparations of human GalR1- or GalR2-expressing neuroblastoma cells (Santic et al, 2007). My results support this finding, demonstrating that alarin is unable to compete with the binding of radiolabelled galanin to membranes from CHO cells expressing the GalR1 or GalR2, and I have also shown that alarin is unable to compete with the binding of radiolabelled galanin to membranes expressing GalR3. Galanin and GALP were able to dose dependently displace galanin binding at all three receptors, confirming the viability of the membranes.

The IC50 values I obtained for my receptor binding studies using the GalR1 and GalR2 expressing membranes are in keeping with those reported previously (Lang et al, 2005;Ohtaki et al, 1999). Galanin binds with the greatest affinity to the GalR1, then the GalR2, and with much weaker affinity to the GalR3. GALP binds preferentially to the GalR2, over the GalR1. The GalR3 showed a much greater preference for GALP binding compared to galanin, although the IC50 values I recorded suggest much weaker binding of both galanin and GALP to the GalR3 than those documented in previous studies (Lang et al, 2005;Smith et al, 1998). This may be due to differences in receptor density within membrane preparations, or differences in the conditions used for the receptor binding studies resulting in poorer sensitivity. Transfection of cell lines with GalR3 has been reported to yield very low receptor expression, which may account for the variability between recorded IC50 values (Lang et al, 2005;Ohtaki et al, 1999).

The hypothalamus expresses all three galanin receptors (Seth et al, 2004). My data suggests that alarin does not compete with radiolabelled galanin binding to male rat hypothalamic membranes. Again, GALP was able to compete with radiolabelled galanin in this experiment. This suggests that it is unlikely that the hypothalamus expresses a receptor to which both alarin and galanin bind. Previous studies suggest that none of the known galanin receptors are expressed in GT1-7 cells (Seth et al, 2004) and galanin has no effect on GnRH release from GT1-7 cells (Seth et al, 2004). I have repeated these findings, and demonstrated using receptor binding studies that radiolabelled galanin is unable to bind to GT1-7 cell membranes. GLP-1 was able to bind to GT1-7 membrane and was displaced by increasing concentrations of unlabelled GLP-1, confirming the viability of this membrane. The release of GnRH from GT1-7 cells in response to alarin and GALP therefore strongly suggests that an as yet unidentified receptor mediates this effect, and that this unidentified receptor is unable to bind galanin.

190

There is evidence to suggest that GALP mediates some of its biological effects in vivo via a receptor or receptors distinct from the three known galanin receptors (Krasnow et al, 2004;Lawrence et al, 2003;Matsumoto et al, 2001;Seth et al, 2004). It is possible that alarin may act as a ligand for the same unidentified receptor or receptors. It is difficult to determine whether GALP and alarin bind to the same receptors. GALP has been reported to be very adhesive (Lang et al, 2005) and I125 labelled GALP shows high non-specific binding to receptor membranes. Radiolabelling alarin would be useful to determine whether alarin binds to GT1-7 membrane, and whether it could be displaced by GALP, suggesting a common alarin/GALP receptor.

GT1-7 cells express mRNA for receptors of peptides involved in the regulation of the HPG axis and energy homeostasis (Yang et al, 2005b). It is possible that GALP, instead of binding to an as yet unknown receptor, acts as a ligand at a characterised receptor. This receptor, expressed by GT1-7 cells, may already be implicated in the regulation of GnRH release and/or energy homeostasis. GPR54 is the kisspeptin receptor, which is structurally similar to the galanin receptors, sharing 45% homology with the GalR1 and GalR3, and 44% homology with the GalR2 (Lee et al, 1999). Despite this similarity in structure, galanin does not bind to GPR54 (Ohtaki et al, 2001). It would be interesting to investigate whether GALP or alarin binds to this receptor. Acting as a ligand at the GPR54, kisspeptin potently stimulates the HPG axis by increasing GnRH release (Thompson et al, 2004). GPR54 mRNA is expressed in GT1-7 cells (Quaynor et al, 2007) and it is possible that GALP and/or alarin binds to this receptor to stimulate the HPG axis.

I have shown that galanin and GALP, but not alarin, stimulate LH release from LβT2 cells, a cell line resembling mature gonadotrophs. LβT2 cells express the GalR3, but not GalR1 or GalR2. There are contradictory reports on the role of galanin in the direct regulation of pituitary LH release. Galanin has been reported to stimulate LH release and potentiate GnRH-induced LH release from male and proestrus female rat pituitary cells in vitro (Lopez et al, 1991;Leiva & Croxatto, 1994;Peters et al, 2009). However, a study using very similar methods observed a suppression of GnRH-induced LH release from proestrus female rat pituitaries, following incubation with galanin (Todd et al, 1998). There was no effect of galanin alone on LH release, or on GnRH-induced LH release from pituitaries harvested at any other stage of the oestrus cycle (Todd et al, 1998). Galanin has also been reported to have no effect on LH release from male rat isolated anterior pituitary cells (Billiard, 1996). These studies suggest that the modulatory effects of galanin on pituitary LH release may be oestrous cycle- dependent and sex specific.

191

GALP also stimulates LH release from LβT2 cells, and this is the first time that a biological effect of GALP, likely mediated via the GalR3, has been reported. GALP binds to the GalR3 in binding assays, but has not been shown to activate any intracellular signalling pathways in functional assays in vitro (Lang et al, 2005). The stimulatory effects of GALP and galanin on LH release were blocked by co- incubation with the non-specific galanin receptor antagonist, C7. It is possible that GalR1 and GalR2 transcripts are expressed in LβT2 cells, although at very low levels. It would be useful to directly compare the potency of galanin and GALP on LH release from LβT2 cells, as GALP binds with higher affinity than galanin at the GalR3 (Lang et al, 2005;Smith et al, 1998). The presence of a novel galanin receptor in the anterior pituitary has been suggested based on the ability of galanin(3–29), a peptide which does not show high-affinity binding to either GalR1, GalR2 or GalR3 (Smith et al, 1998), to increase prolactin (Wynick et al, 1993b) and decrease gonadotrophin (Todd et al, 1998) release in dispersed pituitary cells.

The first two amino acids of alarin (pro-ala) may be cleaved by the proteolytic enzyme DPP-IV, resulting in a receptor agonist with different receptor affinities and biological functions, as observed for other neuropeptides like NPY (Ghersi et al, 2001). To test this hypothesis, I used alarin 3-25 in both in vivo and in vitro experimental paradigms where I have observed a biological effect of full- length alarin. Alarin 3-25 (30 nmol) displayed some biological effects similar to those seen with alarin 1-25: ICV administration of alarin 3-25 (30 nmol) significantly stimulated food intake between 0-2 hours post-injection and also increased plasma corticosterone levels in vivo. Unlike ICV administration of full-length alarin, alarin 3-25 (30 nmol) had no effect on plasma LH levels. The effect of alarin 3-25 on food intake appears less potent than that seen with full-length alarin, but a dose comparison of their effects is required to determine their relative potencies. It is interesting that alarin 3-25 had no effect on plasma LH. This could suggest that multiple receptors mediate the effects of alarin, and that alarin 3-25 is unable to bind to the receptor responsible for its effect on the reproductive axis. However, alarin 3-25 stimulates GnRH release from GT1-7 cells in vitro with a similar potency to alarin 1-25. Alternatively, given that alarin significantly increased stress hormones in this study, and that basal corticosterone levels were relatively high, this may have been sufficient to mask any effect of alarin 3-25 on LH release. In addition, the effect of full-length alarin on LH is not powerful, and this lack of effect may reflect a lower potency of alarin 3-25. I have confirmed that alarin 3-25, like full-length alarin, does not bind to any of the three known galanin receptors.

Since alarin and GALP have the first five amino acids in common, GALP may also be susceptible to enzymatic cleavage by DPP-IV. GALP (3-60) has been described as more potent than GALP (1-60) at stimulating LH release and at reducing 24 hour food intake and body weight in mice, although this

192

difference is not statistically significant (Krasnow et al, 2004). Data from receptor binding studies demonstrates that removal of the first two amino acids from GALP (1-32) generates a GALP variant (3-32) which has a higher affinity for GalR1 and GalR2 than full-length GALP (1-60) or GALP (1- 32). This suggests that removal of the first two amino acids via post-translational processing may be important for the biological activity and receptor interaction of GALP (Lang et al, 2005).

If alarin and GALP do bind to a common receptor, it is likely that the first five amino acids are important in activating this receptor. I have observed that alarin (6-25) has no effect on GnRH release from GT1-7 cells, which suggests that the first five amino acids of alarin are essential for the stimulation of GnRH from GT1-7 cells in vitro. There are no published studies investigating the biological effects of GALP (6-60), although ICV GALP (22-60) administration has no effect on food intake or LH release in mice (Krasnow et al, 2004) and GALP (19–37), unlike full-length GALP, does not effect oedema formation following intradermal administration to mice (Schmidhuber et al, 2007). However, both these forms of GALP also lack the galanin receptor binding domain.

Further studies are now required to determine whether GALP and alarin mediate any of their biological effects through a shared receptor, and therefore whether alarin has utility as a specific ligand at a novel receptor.

193

CHAPTER 5 THE ROLE OF THE VENTRAL TEGMENTAL AREA IN THE REGULATION OF FEEDING

194

5.1 INTRODUCTION

5.1.1 THE VENTRAL TEGMENTAL AREA (VTA) The VTA is part of the mesencephalon (midbrain). Anatomically, the VTA lies adjacent to the floor of the midbrain close to the midline. It is located caudal to the posterior hypothalamus and mammillary bodies, medial to the red nucleus and rostral to the pons and the hindbrain. The substantia nigra lies laterally to the VTA.

5.1.1.1 VTA STRUCTURE The VTA is difficult to distinguish from the substantia nigra, which is why it was first identified by Tsai in 1925 in animals with a less developed substantia nigra. It was designated as an area rather than a single nucleus due to the heterogeneous nature of its cytoarchitecture and the lack of clear borders from other structures. There is great similarity between VTA nuclei across many mammalian species (Oades & Halliday, 1987).

The VTA has been defined in several different ways. Most commonly, it is divided into four major zones: the paranigral nucleus (PN), the parabrachial pigmented area (PBP), the parafasciculus retroflexus area (PFR) and the ventral tegmental tail (VTT) (Swanson, 1982). Some definitions of the VTA include the midline nuclei (the interfascicular nucleus, rostral linear nucleus and central linear nucleus) (Oades & Halliday, 1987). The PN and PBP are dopaminergic cell-body rich zones which make up the middle two-thirds of the VTA, while the PFR and VTT have only a low density of tyrosine hydroxylase (TH) positive cell bodies (Hokfelt et al, 1984;Swanson, 1982).

The PN contains TH positive cells which are relatively homogeneous, medium in size and medium to dark in staining (Halliday & Tork, 1986). The PBP comprises the rest of the dopamine rich zone. The PBP has undefined borders and lies dorsolateral to the PN. The TH positive cells in this nucleus are heterogeneous, large or medium sized and intensely stained (Halliday & Tork, 1986). The VTT is found posterior to the PN and its few TH-positive cells are small and moderately stained. The PFR lies anterior to the PN and its TH-positive cells are small or medium sized and moderate in staining, and are continuous with TH-positive cells in the posterior hypothalamic area. Studies suggest that 50- 60% of all neurons in the VTA are dopaminergic (Swanson, 1982). There is also a large population of GABAergic neurons and a smaller population of glutamatergic neurons (Ikemoto, 2007;Pierce & Kumaresan, 2006).

195

FIGURE 5.1 Schematic coronal section of the rat brain highlighting ventral tegmental area nuclei and the substantia nigra. Abbreviations: PN, paranigral nucleus; PIF, parafasciculus nucleus, PBP, parabrachial pigmented nucleus; SNCM, substantia nigra, compacta part medial tier; SNCV, substantia nigra compacta part, ventral tier; SNCD, substantia nigra, compacta part, dorsal tier; SNR, substantia nigra, reticular part; SNL, substantia nigra lateral part. This section is 6.0mm posterior from the bregma. Adapted from (Paxinos & Watson, 2007).

5.1.1.2 VTA PROJECTIONS Five VTA systems of efferent fibres have been described. The two primary efferent fibre projections of the VTA are the mesocortical and the mesolimbic pathways. In addition, the mesostriatal pathway projects to the anteromedial striatum, the mesodiencephalic pathway projects to several thalamic and hypothalamic nuclei, and the mesorhombencephalic pathway projects to the superior colliculus, reticular formation and the periaqueductal grey. The mesocortical pathway projects to the prefrontal and insular cortices, while the mesolimbic pathway projects to the limbic cortex, the septo- hippocampal complex, the nucleus accumbens (NAc) and the amygdala (Van den Heuvel, 2008) (Figure 5.2). A large proportion of the mesolimbic projections from the VTA are to the NAc, and lesions of the VTA result in an 85-95% decrease in NAc DA content (Simon et al, 1980). The cell bodies from which these projections originate are widely distributed throughout the VTA (Swanson, 1982), although VTA neurons projecting to lateral parts of the NAc originate predominantly from the PBP, and medial regions receive abundant projections from the PIF and the PN (Phillipson & Griffiths, 1985).

Almost all areas receiving efferent projections from the VTA are the origin of afferent projections back to the VTA (Phillipson, 1979). Excitatory glutamatergic afferents arising from all of these areas, except the NAc and the lateral septum, project to the VTA, and regulate VTA cell firing. When glutamatergic neurons are activated, the firing rate of the DA neurons in the VTA increases and burst

196

firing is induced. Burst firing by DA neurons results in release of DA into synapses within target regions (Zweifel et al, 2009). Subpallidal inputs to the VTA are predominantly GABAergic and thus inhibitory. There are also abundant intrinsic connections between, and within, nuclei of the VTA (Phillipson, 1979).

FIGURE 5.2 Schematic diagram of the circuitry of the mesolimbic dopamine system in the rat brain highlighting the major inputs to the nucleus accumbens (NAc) and ventral tegmental area (VTA). Glutamatergic projections, blue; dopaminergic projections, red; GABAergic projections, orange; orexinergic projections, green. Abbreviations: AMG, amygdala; BNST, bed nucleus of the stria terminalis; LDTg, laterodorsal tegmental nucleus; LH, lateral hypothalamus; PFC, prefrontal cortex; VP, ventral pallidum. Taken from (Kauer & Malenka, 2007).

197

5.1.2 DOPAMINE The most studied of all brain substrates for mediating reward are the DA projections from the substantia nigra and VTA to forebrain structures. Mesolimbic DA has been suggested to serve as a critical neurotransmitter for reward of most kinds sought by animals and humans (Berridge & Robinson, 1998).

5.1.2.1 DA SYNTHESIS AND RELEASE DA is synthesized from the amino acid tyrosine, which is taken up into the brain and subsequently into dopaminergic neurons by amino acid transporters. Tyrosine is intracellularly converted to L- dihydroxyphenylalanine (L-DOPA) by the cytosolic enzyme tyrosine hydroxylase (TH). TH conversion of tyrosine to L-DOPA is the rate limiting step in DA biosynthesis. Dopamine decarboxylase enzyme in the cytosol then converts L-DOPA to DA (Elsworth & Roth, 1997).

DA is sequestered from the cytoplasm into storage vesicles where it is concentrated to levels 10-1000 times higher than the levels found in the cytoplasm. Following arrival of an action potential, calcium ions enter the neuron, stimulating the fusion of DA-containing vesicles with the neuronal membrane. Vesicles discharge their DA content into the synapse (Kelly, 1993), an event dependent on the rate and pattern of neuronal firing, with increased release in response to burst firing (Grace & Bunney, 1995).

5.1.2.2 DA SIGNALLING DA can be released from a neuron in a tonic or phasic manner. Tonic release is when neurons fire a slow irregular spike mode and low levels of DA are released into the synapse. Phasic release is when neurons fire action potentials in bursts giving rise to elevated DA levels in the synapse. These different patterns of DA release are thought to activate distinct signal transduction cascades through the activation of postsynaptic inhibitory and excitatory GPCRs (Elsworth & Roth, 1997). Phasic DA is proposed to activate excitatory, low-affinity DA D1-like receptors post-synaptically, stimulating adenyl cyclase activity to mediate its downstream effects. Conversely, tonic DA release is proposed to act on high-affinity DA D2 receptors to modulate post-synaptic DA signalling via interaction with the D1 receptor (Zweifel et al, 2009;Usiello et al, 2000).

198

5.1.2.3 DA METABOLISM Dopaminergic nerve terminals contain transporters critical in terminating transmitter action and maintaining transmitter homeostasis. Uptake of DA from the synapse is carried out by a high affinity membrane carrier protein, dopamine active transporter (DAT), capable of transporting DA in either direction depending on concentration gradients (Giros et al, 1996). Following DA release into the synaptic cleft, transporters actively pump extracellular DA back into the nerve terminal. In addition to the uptake of DA into DA neurons, there is evidence that glia and non-dopaminergic neurons may also, to a limited extent, take up and metabolise extracellular DA (Youdim et al, 2006).

As a result of alternative splicing, the D2 gene of the DA receptor family exists in two isoforms, a short form and a long form. Activation of autoreceptors (the short isoform D2-like receptors) on the DA neuron itself is considered the principal mechanism responsible for the regulation of dopaminergic neuronal function (Khan et al, 1998). Terminals of all DA neurons possess DA-release modulating autoreceptors. Autoreceptors are present on most parts of a DA neuron and so are responsive to both terminal and dendritic DA release. Stimulation of DA autoreceptors on nerve terminals results in an inhibition of DA synthesis and/or release (Carlsson, 1975).

The main enzymes responsible for the metabolism of DA include the monamine oxidases A and B (MAOA and MAOB), and catechol-O-methyltransferase (COMT). The relative abundance and activity of these enzymes varies between cell type, brain region and species (Karoum et al, 1977). The monoamine oxidases catalyse the conversion of DA to 3,4-dihydroxyphenylacetic acid (DOPAC), and COMT catalyses the conversion of DA to 3-methoxy-4-hydroxyphenylacetic acid (HVA). The major end point of DA metabolism in the rat brain is DOPAC, which is generated from the conversion of DA in a reaction catalysed by the monoamine oxidase enzyme MAOA (Youdim et al, 2006;Waldmeier, 1987).

199

FIGURE 5.3 The pathway of dopamine synthesis proceeds from tyrosine via tyrosine hydroxylase (TH) catalysis to levodopa (L-DOPA), and subsequent decarboxylation by dopa decarboxylase (DDC) to dopamine. Dopamine is metabolized by intraneuronal monoamine oxidase A (MAOA), and by glial and astrocyte MAOA and MAOB. Dopamine is also metabolised extraneuronally by catechol-O-methyltransferase (COMT). D1, D2, dopamine receptors. Adapted from (Youdim et al, 2006).

200

5.1.3 ROLE OF VTA DOPAMINERGIC NEURONS IN DRUG ADDICTION Dopaminergic neurons of the VTA are important for the rewarding and reinforcing properties of numerous drugs of abuse (Wise, 1996). All drugs of abuse have been shown to increase DA neurotransmission (Kauer & Malenka, 2007). Most studies have examined DA release in the major terminal target regions of the VTA dopaminergic neurons - the NAc and the prefrontal cortex - and have revealed that drugs of abuse increase the DA concentrations in these regions (Di Chiara & Imperato, 1988;Di Chiara & Imperato, 1986). Drugs of abuse increase dopaminergic neurotransmission by increasing the firing rate of VTA DA neurons, by blocking DA reuptake, or by reversing DAT activity in terminal regions (Pierce & Kumaresan, 2006).

The opioid system is one of the best characterised systems involved in modulating the mesolimbic dopaminergic system at the level of the VTA to mediate its rewarding effects. Mu-opioids have been shown to disinhibit the firing of VTA DA neurons by inhibiting VTA GABAergic neurons. These GABAergic neurons normally inhibit local DA neurons (Johnson & North, 1992), thus the overall result is an increase in DA release in the NAc (Leone et al, 1991). The habit forming properties of nicotine are also thought to be mediated via the VTA. Nicotine receptors are present on VTA DA neurons themselves (Clarke & Pert, 1985) and systemic nicotine increases NAc DA levels by directly stimulating dopaminergic cell firing in rats (Mereu et al, 1987). Other drugs of abuse, including the stimulants amphetamine and cocaine, are thought to mediate their rewarding properties at the level of the NAc. Both drugs increase extracellular DA concentration in the NAc of rats (Di Chiara & Imperato, 1988) and their habit forming properties can be blocked by DA antagonists or a depletion of DA levels in the NAc (Koob & Swerdlow, 1988).

Food restriction and fasting enhance the addictive or reinforcing properties of drugs of abuse (Carroll et al, 1979;Carroll & Meisch, 1984), suggesting that the neural circuits regulating food intake are linked to the circuits underlying the rewarding effects of drugs of abuse. However, there is also strong evidence that the VTA is involved in the normal regulation of food intake by mediating the rewarding properties of foods.

201

5.1.4 ROLE OF THE VTA IN FEEDING The neural mechanisms mediating food reward are believed to be similar, if not identical, to those driving drug reward (Carelli, 2002;Kelley & Berridge, 2002). Food intake is at least partly driven by its rewarding properties, which involve activation of the mesolimbic DA pathway. The repeated stimulation of DA reward pathways is thought to result in neurobiological adaptation of the neuronal mechanisms that mediate reward, including DA neurotransmission and downstream circuits. This can result in increasingly compulsive behaviour and the loss of control over food intake (Blumenthal & Gold, 2010). This neurobiological adaptation has been hypothesised to be due to either counter adaptation and/or sensitisation of reward (Koob & Le Moal, 1997). Counter adaptation is the development of hedonic tolerance, where there is a decrease in dopaminergic neurotransmission in the NAc in the absence of rewarding stimulus i.e. food (Weiss et al, 1992). Sensitisation is the progressive increase in the effect of a rewarding stimulus with repeated exposure (Robinson & Berridge, 2001).

The reward circuits can promote food intake unconnected to hunger, but may also be used to drive the hunger felt after food restriction. Chronic, but not acute, food restriction increases mRNA levels of TH and DAT in the VTA, effects not observed after acute food deprivation (Lindblom et al, 2006). Food restriction has also been reported to reduce levels of extracellular DA in the rat NAc (Pothos et al, 1995), which may reflect the upregulated DAT in the VTA. It is possible that this reduction in NAc DA stimulates the increased VTA TH mRNA in a feedback loop. Postsynaptic DA receptor signalling in the NAc is increased by food restriction in rats (Carr et al, 2003). It has been suggested that depletion of long-term energy stores activates neuronal circuitry which upregulates the DAT in mesolimbic DA neurons, leading to accumulation of presynaptic DA in the NAc and an increased clearance of DA in the NAc. This in turn leads to a sensitization of postsynaptic DA receptors (Carr et al, 2003).

Current research into the role of the reward circuitry in feeding focuses on alterations in the mesolimbic pathway at the level of the terminal DA projections in the NAc and PFC. Studies using positron-emission-tomography (PET) scans have demonstrated a reduction in striatal D2 DA receptor (D2R) availability in severely obese humans compared to normal weight controls. The level of D2R availability negatively correlates with BMI, suggesting an association between low D2R levels in obese individuals and higher BMI. (Wang et al, 2001). However, this study does not reveal whether reduced D2R levels are the cause or the effect of obesity; i.e. whether lower levels of striatal D2R predispose an individual to addictive behaviours, or alternatively whether the reduction in D2R levels represents a compensation for constant overstimulation of the reward system caused by excessive

202

food intake. A recent study revealed that D2R availability is increased in female patients with weight loss following Roux-en-Y gastric bypass surgery, and that this increase in receptor availability is approximately proportional to the amount of weight lost (Steele et al, 2010). This suggests that D2R levels may be reduced in response to overeating and can be normalised by a chronic reduction in food intake.

The receptors for many neuropeptides and hormones known to be involved in the regulation of appetite are expressed in the VTA (Figlewicz et al, 2003;Hommel et al, 2006;Mountjoy et al, 1994;Naleid et al, 2005). It is therefore possible that in addition to regulating the homeostatic control of food intake in the hypothalamus, these factors also have a role in the regulation of the mesolimbic dopaminergic reward pathway. Cell bodies of VTA neurons are in close contact with the BBB, suggesting that peripheral factors may be able to affect VTA neurons (Halliday & Tork, 1986). However there have been no reports confirming that circulating factors directly access VTA neurons without crossing the BBB.

203

5.1.4.1 FOOD REWARD IN FED/FASTED STATES Early studies investigating motivation and reward used an experimental setting where rats have to press a lever for the delivery of a food pellet. The task requires that rats increase, within each session, the amount of effort (lever presses) expended for subsequent food reinforcers. Food deprived rats will expend greater effort to secure food than ad-libitum fed rats (Hull, 1952). It is thought that measures of performance in this task provide an index of ‘motivation' to work for food, and thus, food deprived rats have increased motivation to work for food compared to ad-libitum fed rats.

Negative energy balance is associated with low levels of leptin and insulin and it has been suggested that low levels of these hormones may be associated with an increased drive to obtain rewards and a heightened reward response. Conversely, increased leptin and insulin may be sufficient to attenuate the drive for reward and reduce the reward response. Self-administration of rewarding electrical stimulation to specific brain regions including the LHA can be used to assess the state of brain reward circuitry (Olds & Milner, 1954). Chronic food restriction enhances self-stimulation in rats (Blundell & Herberg, 1968) and this rewarding effect can be blocked with ICV leptin or insulin administration (Fulton et al, 2000;Carr et al, 2000;Figlewicz et al, 2006). Food restriction also modifies performance in a conditioned place preference (CPP) paradigm in rats. Chronic SC leptin administration or ICV insulin administration to food restricted rats attenuates the expression of a CPP to high fat diet, suggesting that low leptin and/or insulin levels during states of negative energy balance cause behavioural adaptation to food reward (Figlewicz et al, 2001;Figlewicz et al, 2004). ICV administration of leptin or insulin reduces motivation for sucrose in rats, a behavioural task dependent on intact DA signalling (Figlewicz et al, 2006;Sipols et al, 2000). Interestingly, this effect was not observed in rats fed a high fat diet for five weeks, which exhibit a degree of leptin and insulin resistance, suggesting that the reward circuitry in the CNS may be affected by insulin/leptin resistance (Figlewicz et al, 2006).

These data suggest that leptin and insulin, in addition to their role in promoting satiety as part of a homeostatic circuit, also suppress the incentive value of food and other rewards. The effects of leptin and insulin on the rewarding value of food are thought to be mediated via modulation of components of the mesolimbic DA system.

204

5.1.5 PERIPHERAL HORMONES AND FOOD REWARD

5.1.5.1 LEPTIN The leptin receptor is expressed by more than half of the DA-containing neurons in the VTA of the rat (Figlewicz et al, 2003;Hommel et al, 2006;Hay-Schmidt et al, 2001) and peripheral, ICV or intraVTA (iVTA) leptin administration activates the JAK-STAT signalling pathway in midbrain DA neurons in rats (Hommel et al, 2006;Morton et al, 2009;Fulton et al, 2006). Peripheral leptin injection also induces pSTAT3 expression in a smaller population of VTA GABAergic neurons (Fulton et al, 2006). A population of VTA pSTAT3-positive neurons project to the NAc, suggesting that VTA leptin- regulated neurons innervate the NAc and these neurons may mediate the effect of leptin on reward (Fulton et al, 2006). However, a recent study in mice reports that leptin receptor expressing VTA neurons project solely to the central amygdala, an area implicated in anxiety and the behavioural response to aversive stimuli, where they innervate CART expressing neurons and regulate expression of CART mRNA. This study found no leptin receptor expressing neurons projecting from the VTA to the NAc, although this may be due to the different species used in these studies (Leshan et al, 2010).

Direct administration of leptin into the VTA acutely reduces food intake for up to 24 hours in rats (Hommel et al, 2006;Morton et al, 2009). RNAi-mediated knockdown of the leptin receptor in the VTA resulted in increased food intake, although it did not increase body weight (Hommel et al, 2006). Rats with VTA leptin receptor knockdown exhibited an increase in sensitivity to highly palatable food; they consumed more sucrose than control animals, and their food intake was acutely increased following presentation of a high-fat diet compared to controls.

IntraVTA pre-administration with a JAK-2 inhibitor blocks the anorectic effect of iVTA leptin in rats (Morton et al, 2009). However, ICV or iVTA leptin administration does not activate the IRS-PI3 kinase or mTOR signal transduction pathways in the VTA suggesting that different intracellular signalling systems may relate the anorectic effects of hypothalamic and VTA leptin-sensitive pathways (Morton et al, 2009).

Electrophysiological studies suggest that IV administration of leptin decreases the firing rate of rat VTA DA neurons in vivo. This may be a secondary effect of direct action at the hypothalamus. However, leptin also directly reduced the frequency of DA neuron action potentials from VTA slices in vitro (Hommel et al, 2006). These data support the hypothesis that leptin inhibits the firing of VTA DA neurons leading to a decrease in NAc DA release and a reduction in the rewarding value of food.

205

Leptin deficient ob/ob mice have reduced TH protein levels in the VTA and NAc, and reduced DA signalling in the NAc compared to wild type mice. Peripheral leptin infusion increases levels of TH in these regions (Fulton et al, 2006). This suggests leptin may have a physiological role in the regulation of the mesolimbic dopaminergic system. Hyperleptinaemic mice fed on a high fat diet have reduced leptin receptor mRNA expression in the VTA (Blendy et al, 2005).

A recent paper has also reported that leptin can act in the LHA to modulate the mesolimbic dopaminergic system to suppress feeding (Leinninger et al, 2009).

5.1.5.2 INSULIN Insulin has been implicated as an endogenous regulator of DA synthesis and reuptake. DAT is the protein responsible for the active uptake of DA from synapses (Giros et al, 1996). Streptozotocin- induced diabetic rats, which exhibit hypoinsulinaemia, have reduced levels of DAT mRNA in the VTA (Figlewicz et al, 1996), while conversely, obese Zucker fa/fa rats, characterised by hyperinsulinaemia, have increased VTA DAT mRNA expression (Figlewicz et al, 1998). ICV administration of insulin to normal rats increases DAT mRNA levels in the VTA (Figlewicz et al, 1994). Fasted rats, which have low circulating insulin, also have reduced DAT mRNA expression in the VTA and reduced activity of DAT in the striatum (Patterson et al, 1998).

Anatomical evidence supports a role for insulin in modulating the DA reward circuitry. The insulin receptor is extensively co-expressed with TH in VTA neurons (Figlewicz et al, 2003;Werther et al, 1987). Insulin receptor substrate 2 (IRS-2), a key component of the insulin signal transduction mechanism, has also been detected in DA VTA neurons (Pardini et al, 2006).

Despite all the evidence suggesting that alterations in insulin levels can modulate food reward behaviours and influence the function of the mesolimbic DA pathway, the effect of direct VTA insulin administration on food intake has not previously been reported.

206

5.1.5.3 GHRELIN The VTA expresses the GHS-R in relatively large concentrations, suggesting that ghrelin may modulate the reward circuitry (Zigman et al, 2006;Guan et al, 1997). Specifically, the GHS-R is expressed by approximately 50-60% of TH-IR cells, and 30% of GABAergic cells in the VTA of rats and mice (Zigman et al, 2006;Abizaid et al, 2006).

Ghrelin binds to rat brain slices containing the VTA in a distribution pattern similar to that of the expression of GHS-R (Abizaid et al, 2006), and electrophysiological studies have demonstrated that ghrelin acts directly on VTA DA containing neurons and increases the firing rate of these neurons in rodents. Ghrelin does not effect the firing rate of DA neurons from GHS-R knockout mice (Abizaid et al, 2006).

Ghrelin administered directly into the VTA stimulates feeding in rats (Abizaid et al, 2006;Naleid et al, 2005), while pharmacological blockade of the GHS-R in the VTA reduces fasting-induced re- feeding in mice and blocks the feeding response elicited by peripheral injection of ghrelin in rats (Abizaid et al, 2006). The latter experiment suggests that circulating ghrelin can reach the VTA to stimulate food intake, although there is no evidence to confirm this. The VTA is thought to be protected by the BBB, and thus relatively inaccessible to circulating hormones. It is possible that the VTA is primarily targeted by central ghrelin signals, or that there are specific transport mechanisms allowing ghrelin to access the VTA. Ghrelin may also stimulate VTA DA neuron activity via an indirect method e.g. via lateral hypothalamic neurons.

It is proposed that ghrelin acts at the VTA to stimulate food intake by modulating DA release in the NAc. Peripheral, ICV and iVTA administration of ghrelin increases extracellular DA concentration in the NAc of rodents (Jerlhag et al, 2006;Jerlhag et al, 2007;Quarta et al, 2009). This effect is exaggerated in ghrelin knockout mice and absent in GHS-R knockout mice (Abizaid et al, 2006). Peripheral ghrelin infusion in humans is associated with increased hunger and an increased feeding response (Wren et al, 2001a), and enhances the activity in regions downstream of the VTA including the amygdala and NAc as measured by functional magnetic resonance imaging (fMRI) (Malik et al, 2008b). These studies suggest that ghrelin may be increasing food intake by increasing activity of the mesolimbic dopaminergic system and enhancing the incentive value of food.

207

5.1.6 HYPOTHALAMIC PEPTIDES AND FOOD REWARD The homeostatic control system for the regulation of adiposity and body weight impinges on most of the brain through widely projecting neurons originating from hypothalamic nuclei including the ARC, PVN and LHA (Berthoud, 2002). The VTA DA system has been shown to play a role in the effects of peripheral hormones such as leptin and ghrelin on food intake. As some of the appetite related effects of leptin and ghrelin are mediated through secondary hypothalamic peptide effector systems, including the melanocortins and orexin, it is possible that these factors themselves may regulate the DA reward system. Pharmacological studies have outlined functional roles for some of these hypothalamic factors in the modulation of drug-taking behaviour. However it is not known whether VTA DA neurons are a target for many of the neural or endocrine factors that are implicated in energy homeostasis.

5.1.6.1 LATERAL HYPOTHALAMIC NEUROPEPTIDES AND FOOD REWARD The LHA is well positioned to integrate homeostatic satiety and reward related feeding in the regulation of appetite. The LHA has long been recognised as a common region implicated in both reward and food intake. This nucleus contains neurons that potently stimulate food intake and is supplied by fibres from the ARC and other crucial hypothalamic areas for energy homeostasis. The VTA receives abundant neuronal inputs from the LHA, including projections from orexin A and B- containing neurons, and MCH-containing neurons (Bittencourt et al, 1992;Fadel & Deutch, 2002).

5.1.6.1.1 OREXIN Orexin receptor 1 and 2 are expressed by both dopaminergic and GABAergic VTA neurons in rodents, and electrophysiology studies have determined that orexins directly excite dopaminergic neurons in the VTA of the rat (Korotkova et al, 2003;Narita et al, 2006;Uramura et al, 2001;Marcus et al, 2001). Orexin A increases the intracellular Ca2+ concentration in rat VTA DA neurons in vitro via phosphatidylcholine-specific phospholipase C (PLC) (Uramura et al, 2001). Administration of orexin A or B directly into the VTA of rats increases levels of DA and the major DA metabolite, DOPAC in the NAc (Narita et al, 2006). Interestingly, iVTA administration of orexin has been shown to have no effect on food intake in rats (Sweet et al, 1999).

The orexins are implicated in morphine induced reward. Morphine induced physical dependence and withdrawal are thought to be, at least in part, regulated by orexin neurons as these behaviours are attenuated in prepro-orexin knockout mice (Georgescu et al, 2003). Prepro-orexin knockout mice also exhibit a lack of place preference following morphine administration, and a suppression of the morphine-induced increase in DA levels in the NAc. Furthermore, morphine-induced place preference

208

is suppressed by iVTA administration of an orexin receptor antagonist in rats (Narita et al, 2006). Administration of µ-opioid receptor agonists into the NAc is known to profoundly stimulate high fat diet intake in satiated rats (Will et al, 2003). Pre-treatment with an iVTA orexin receptor antagonist almost completely abolishes the orexigenic effect the µ-opioid receptor agonist (Zheng et al, 2007). These data suggest that activation of the mesolimbic DA system by µ-opioid receptor agonists may be regulated by the orexin system.

5.1.6.1.2 MELANIN CONCENTRATING HORMONE (MCH) There is little data available regarding the role of MCH in food reward despite the anatomical connection between MCH neurons in the LHA and their projections to the VTA (Bittencourt et al, 1992). MCH1 receptor (MCHR1) mRNA is expressed at a low level in the VTA but is much more strongly expressed in the ventral striatum, the terminal field of the mesolimbic dopaminergic neurons (Hervieu et al, 2000;Pissios et al, 2008). MCH failed to have any effect on the firing pattern of dopaminergic and non-dopaminergic VTA neurons in brain slice recordings, suggesting that MCH does not modulate the reward pathway at the level of the VTA (Korotkova et al, 2003).

Several studies have investigated the role of the MCH system in modulating the mesolimbic DA pathway. One reports dysregulation of the mesolimbic dopaminergic system in MCH-R1 knockout mice. These mice exhibit an upregulation of mesolimbic DA receptors, and heightened sensitivity to the effects of amphetamine and a D1 receptor agonist (Smith et al, 2005).

Mice lacking MCH also have enhanced sensitivity to amphetamine injections. These mice have increased expression of DAT in the NAc, but DAT mRNA expression is unaltered in the VTA. There is evidence that the increased DAT-mediated reuptake of DA in MCH knockout mice is compensation for increased DA release in the NAc. Interestingly, MCH knockout mice did not display acute hyperphagia, as seen in wild type mice, when presented with a high fat, palatable diet (Pissios et al, 2008).

209

5.1.6.2 ARCUATE NEUROPEPTIDES AND FOOD REWARD

5.1.6.2.1 NPY Central NPY administration to satiated rats increases the amount of work (lever presses) expended to obtain a food pellet compared to saline injected rats in a test where increasing lever presses are required for each subsequent pellet of food. This implies that NPY increases motivation for food (Jewett et al, 1995). Y1, Y2 and Y5 receptors, which mediate the effects of NPY, are expressed in the VTA (Parker & Herzog, 1999). Electrophysiological studies report that NPY inhibits both dopaminergic and GABAergic VTA cells, reducing firing rate and inducing hyperpolarisation. These effects of NPY were preserved in the presence of the voltage-gated sodium channel blocker tetrodotoxin (TTX), suggesting a direct post-synaptic effect of NPY on these neurons (Korotkova et al, 2003).

Most reports on the rewarding properties of NPY focus on its action in the NAc. The NAc contains the highest levels of NPY-IR in the mammalian brain after the hypothalamus, and the greatest density of neurons containing NPY mRNA in the human brain (Hendry, 1993). NPY administration into the NAc can induce a CPP to a previously neutral environmental cue and this effect can be blocked by iNAc injection of the DA receptor antagonist α-flupenthixol (Josselyn & Beninger, 1993), suggesting that NPY mediates its effects on reward behaviours via dopaminergic mechanisms.

A recent study has implicated the Y1R in regulating NAc-induced food intake. Injection of the µ opioid receptor agonist DAMGO into the NAc stimulates high fat intake (Will et al, 2003). This effect is completely abolished by lateral ventricular pretreatment with a specific Y1R antagonist, suggesting that downstream Y1R-signaling in areas accessible to lateral ventricular diffusion of the drug is necessary for the orexigenic effect of DAMGO (Zheng et al, 2010).

ICV NPY injection increases on-going heroin self-administration, and induces a reinstatement of extinguished heroin-seeking behaviour in rats, suggesting that NPY can modulate the rewarding and conditioned reinforcing effects of drugs of abuse (Maric et al, 2008).

210

5.1.6.2.2 CART CART was originally discovered as an mRNA transcript upregulated in the rodent brain following psychostimulant exposure (Douglass et al, 1995), and thus the role of CART in modulating the reward and reinforcing effects of psychostimulants has been extensively investigated. Studies report that CART mRNA expression is also upregulated in the NAc by other drugs of abuse such as methamphetamine (MDMA) and ethanol (Salinas et al, 2006;Jean et al, 2007). Post-mortem tissues from humans victims of cocaine overdose reveal an increase in NAc, and a decrease in VTA, CART mRNA expression (Albertson et al, 2004;Tang et al, 2003).

Administration of CART peptide into the NAc reduces cocaine self-administration (Jaworski et al, 2003b) and blocks the locomotor effects associated with cocaine and amphetamine administration in rats (Kim et al, 2003;Jaworski et al, 2003a). These studies suggest that CART in the NAc may act to blunt the effects of increased DA activity. CART-containing cell bodies in the NAc express DA receptors and receive TH-immunoreactive nerve terminals, implying direct dopaminergic input to CART containing neurons (Hunter et al, 2006;Hubert & Kuhar, 2006). These CART containing neurons have been reported to project to the substantia nigra rather than to the VTA (Dalllvechia- Adams & Smith, 2001).

The VTA contains no CART mRNA-containing cell bodies or CART peptide-IR cell bodies, but nerve terminals containing CART peptide have been detected and are associated with both DA- and GABA-synthesizing neurons (Dalllvechia-Adams et al, 2002b;Dalllvechia-Adams et al, 2002a). CART may therefore modulate DA activity in the VTA through either a direct effect on dopaminergic neurons or an indirect effect on DA neurons via CART-mediated alterations in GABA release. The latter appears more likely, but this hypothesis is challenged by a study reporting no effect of CART on the firing rate of dopaminergic or GABAergic neurons in vitro (Korotkova et al, 2003). Retrograde tracing studies show that many CART containing neurons in the LHA project to the VTA, suggesting an anatomical CART circuit may link the effects of CART on feeding and drug-related reward.

Interestingly, ICV and iVTA injection of CART peptide increases DA and DOPAC in the NAc (Yang et al, 2004;Shieh, 2003;Kuhar et al, 2005). Intra-VTA injection of CART peptide causes psychostimulant-like effects: increased locomotor activity and promotion of CPP in rats. This CART- induced increase in activity can be blocked in a dose-dependent manner by the DA receptor antagonist haloperidol, supporting a dopaminergic-mediated mechanism (Kimmel et al, 2000a).

211

There is far less data concerning the role of CART in the rewarding effects of food intake. Administration of CART peptide into the NAc reduces feeding (Yang et al, 2005a), suggesting that this region may be part of the anorectic CART circuitry. There are no reports to date of the effect of iVTA administration of CART peptide on food intake.

5.1.6.2.3 MELANOCORTINS

There is substantial anatomical overlap between components of the melanocortin system and the mesolimbic dopaminergic system. Melanocortin receptors 3 and 4 are expressed in the VTA (Mountjoy et al, 1994;Roselli-Rehfuss et al, 1993;Kishi et al, 2003). The VTA receives projections from POMC-IR neurons originating from both the ARC and the NTS (Joseph & Michael, 1988;Haskell-Luevano et al, 1999;Bagnol et al, 1999), and AgRP-IR and αMSH-IR have been detected in the VTA (Jacobowitz & O'Donohue, 1978;Broberger et al, 1998b;Bagnol et al, 1999).

MC4 receptor expression in the VTA, as measured by autoradiographic binding, is down-regulated in genetically obese OLETF rats compared to controls (Lindblom et al, 2000), suggesting that the MC4 receptor in the VTA may have a physiological role in appetite regulation.

Electrophysiology studies measuring whole-cell current-clamp recordings in VTA slices reported no effect of AgRP on the firing rate or membrane potential of either dopaminergic or GABAergic neurons. Similarly, αMSH had no effect on the activity of dopaminergic neurons, but was reported to excite a small proportion of VTA GABAergic neurons in single cell recordings (Korotkova et al, 2003).

There is evidence to suggest that the melanocortin system is able to interact with the mesolimbic DA system. Chronic ICV infusion of the melanocortin receptor agonist MTII causes an up-regulation of D2-like receptors in the VTA, and an up-regulation of D1-like receptors in the NAc. (Lindblom et al, 2002). IntraVTA administration of melanocortin receptor agonists increases the levels of DA and the DA metabolite, DOPAC, in the NAc of rats (Torre & Celis, 1988;Lindblom et al, 2001). Pre- treatment with the MC4 receptor antagonist HS131 blocked this effect, suggesting that αMSH mediates its effect on NAc DA by activating the MC4 receptor (Lindblom et al, 2001).

A recent paper highlights the involvement of the melanocortin receptors in food reward (Atalayer et al, 2010). In a food demand protocol, MC4R knockout mice were hyperphagic at low unit costs for food (2-10 nose pushes for a pellet of food), due primarily to increased meal size. However, at higher 212

costs (50 nose pushes for a pellet of food) their intake dropped to below that of WT and MC3R knockout mice. This effect has been shown to be an effect of genotypic origin, using DIO mice with body weights similar to MC4R knockout mice as controls. These data suggest that MC4R signaling plays a role in the motivation for food reward in rats.

213

5.2 AIMS The VTA is a major centre for the brain’s reward circuitry. The links between the hypothalamic systems and peripheral hormones regulating energy homeostasis and the reward circuitry are unclear. I aim to

1. Investigate the effect on food intake of iVTA administration of neuropeptides and hormones known to be involved in energy homeostasis in rats. 2. Characterise the neurons expressing melanocortin receptors in the VTA 3. Investigate the mechanisms by which the melanocortin system acts in the VTA to influence food intake.

214

5.3 MATERIALS AND METHODS

5.3.1 MATERIALS AgRP (86-132) used in study 5.3.6.3.4 was supplied by Peptide Institute (Japan), and AgRP (83-132) used in studies in section 5.3.8 was supplied by R&D Systems (Minneapolis, USA). Cis-(Z)-

Flupenthixol dihydrochloride, a D2 receptor antagonist, and bicuculline methiodide, a GABAA receptor antagonist, were supplied by Sigma-Aldrich. All other peptides used were supplied by Bachem (St Helens, UK).

5.3.2 ANIMALS Adult male Wistar rats (Charles River) were maintained in individual cages as described in section 2.3.2.

5.3.3 VTA CANNULATION Animals were either anaesthetised by injectable anaesthetic or by inhalation anaesthesia. Anaesthesia induced by injectable anaesthetic drugs was carried out as described in section 2.3.3.1. For inhalational anaesthesia, animals were placed in an induction chamber with an inflow of 2 L/min oxygen and 4% isofluorane until they lost the pedal reflex. Animals were then maintained on 2% isofluorane with an inflow of 2 L/min oxygen throughout the surgery. Cannulation surgery for studies in section 5.3.6 was carried out using injectable anaesthetics, but this protocol was superseded by the use of inhalational anaesthetics to reduce anaesthetic mortality in animals cannulated for studies in section 5.3.8. All animals in each individual study were anaesthetised using the same method. Cannulation surgery was carried out as described in section 2.3.3.2 except that for VTA cannulation, a 26 gauge stainless steel cannula (PlasticsOne) and different cannulation co-ordinates were used. The cannula was directed to the DA-rich PBP nucleus of the VTA and was therefore implanted 6mm posterior from bregma, 0.5 mm lateral to bregma and projecting 9.5 mm below the surface of the skull. These co-ordinates were generated from the rat brain atlas (Paxinos & Watson, 2007).

5.3.4 INTRA-VTA ADMINISTRATION OF FACTORS INVOLVED IN ENERGY HOMEOSTASIS Peptides were administered in a volume of 1 µl to conscious freely moving animals via a stainless steel, 28 gauge injector projecting 1 mm below the tip of the cannula at a rat of 120 µl/hour. Otherwise, injections were carried out as described in section 2.3.3.2.

215

5.3.5 VERIFICATION OF INTRA-VTA CANNULA LOCATION

5.3.5.1 INDIA INK INJECTION AND TISSUE PROCESSING Animals were killed by decapitation and 1 µl India ink was immediately injected into the iVTA cannula, using the injection procedure described in section 2.3.3.2. Brains were then removed, immediately stored in 25 ml 4% formaldehyde (appendix) and kept at 4°C. Twenty-four hours later, brains were transferred into 30% sucrose solution (appendix) and stored at room temperature for several days until dehydrated. Brains were then removed, frozen in isopentane and stored at -80°C until they were sliced on a freezing sled microtome (Shandon Southern Products Ltd, Runcorm, Cheshire, UK) into 20 µm coronal sections. The location of ink was verified by comparing to The Rat Brain Atlas (Paxinos and Watson 1998).

5.3.5.2 HAEMOTOXYLIN STAINING Materials Poly-l-lysine coated slides (VWR) Xylene (VWR) Ethanol (VWR) Haematoxylin (Vector Labs) DPX (Thermo Fisher Scientific)

Method Brain sections containing India ink were placed on poly-l-lysine coated slides and allowed to dry for at least four hours. Slides were dehydrated from 50% through to 100% ethanol for 2 minutes each, and then delipidated in xylene overnight. Slides were then rehydrated from 100% ethanol through to GDW for 2 minutes each, before staining for 4 minutes in haemotoxylin. Slides were briefly rinsed in GDW, and then dehydrated through ascending ethanol concentrations (50 through to 100%). Brain sections were then delipidated in xylene for 5 minutes before mounting with DPX and coverslips. Animals with ink more than 0.2 mm outside the VTA when viewed under the microscope (Nikon, Eclipse 50i) were not included in analysis of results.

216

5.3.6 INTRA-VTA FEEDING STUDIES

5.3.6.1 THE EFFECT OF iVTA ADMINISTRATION OF PERIPHERAL FACTORS ON FOOD INTAKE IntraVTA administration of leptin has previously been reported to reduce food intake in rats (Hommel et al, 2006;Morton et al, 2009) and iVTA administration of ghrelin has been reported to increase food intake in rats (Abizaid et al, 2006;Naleid et al, 2005). No studies have described an effect of iVTA insulin administration on food intake in rats. Since there is substantial evidence supporting a role for insulin in modulating the VTA DA circuitry, the effect of iVTA insulin administration on food intake was examined in rats at the onset of the dark phase, the natural feeding period of the rat, and also in the early light phase to investigate any differences in sensitivity to insulin in different nutritional states. Studies investigating the effect of insulin administration on reward related behaviours elicit an effect using 5mU of insulin (Figlewicz et al, 2008;Figlewicz et al, 2006). Administration of 0.1, 1, 10 or 40 mU insulin reduces food intake following iPVN administration (Menêndez, 1991).

5.3.6.1.1 EFFECT OF iVTA ADMINISTRATION OF INSULIN ON FOOD INTAKE IN AD LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline, insulin (0.1, 1 or 10 mU) or ghrelin (0.3 nmol) (positive control) (Naleid et al, 2005) (n = 5-10 per group, n = 5 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.6.1.2 EFFECT OF iVTA ADMINISTRATION OF INSULIN ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline, insulin (0.1, 1 or 10 mU) or ghrelin (0.3 nmol) (positive control) (n = 7-10 for each group, n = 5 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post- injection.

217

5.3.6.2 THE EFFECT OF IVTA ADMINISTRATION OF LHA NEUROPEPTIDES ON FOOD INTAKE

5.3.6.2.1 EFFECT OF iVTA ADMINISTRATION OF OREXIN AND MCH ON FOOD INTAKE IN AD LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline, orexin (1 nmol), MCH (1 nmol) or ghrelin (0.3 nmol) (positive control) (n = 8-11 per group, n = 4 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post- injection.

5.3.6.3 THE EFFECT OF IVTA ADMINISTRATION OF ARC NEUROPEPTIDES ON FOOD INTAKE Evidence suggests that CART is an ARC neuropeptide likely to be involved in the VTA DA pathway regulating food intake due to its well-characterised role in modulating the dopaminergic effects of drugs of abuse. ICV CART (55-102) administration has an anorectic effect in rats (Kristensen et al, 1998), while direct intranuclear injection of CART into the SON, PVN, VMN, DMN, ARC or LHA of the hypothalamus stimulates food intake (Abbott et al, 2001). The effect of iVTA administration of CART was therefore examined in fasted rats, where any anorectic effect of CART would be detectable, and in ad-libitum fed rats, where any orexigenic effect of CART could be identified. ICV administration of 0.2 nmol CART is associated with locomotor abnormalities and tremor (Kristensen et al, 1998). In contrast, iARC administration of 0.4 nmol CART is not associated with any behavioural abnormalities (Abbott et al, 2001). Since the sensitivity of the VTA to any appetite related effects of CART is unknown, several doses of CART (55-102) were administered in these studies to allow any specific effects of iVTA CART on food intake to be established.

5.3.6.3.1 EFFECT OF iVTA ADMINISTRATION OF CART (55-102) ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE Groups of overnight fasted male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline, CART (55-102) (0.04, 0.2 or 0.6 nmol) or ghrelin (0.3 nmol) (positive control) (n = 6-10 saline and CART, n = 4 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

218

5.3.6.3.2 EFFECT OF iVTA ADMINISTRATION OF CART (55-102) ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline, CART (55-102) (0.04, 0.2 or 0.6 nmol) or ghrelin (0.3 nmol) (positive control) (n = 7-9 saline and CART, n = 5 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.6.3.3 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline, NDP-MSH (1 nmol) or leptin (0.06 nmol) (positive control) (Hommel et al, 2006) (n = 8-10 saline and NDP-MSH, n = 6 leptin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.6.3.4 EFFECT OF iVTA ADMINISTRATION OF NPY AND AGRP ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline, NPY (1 nmol), AgRP (1 nmol) or ghrelin (0.3 nmol) (positive control) (n = 8- 10 per group, n = 7 ghrelin). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post- injection.

219

5.3.7 CHARACTERISATION OF MELANOCORTIN RECEPTOR-EXPRESSING NEURONS IN THE VTA Melanocortin receptor 3 and 4 mRNA have been detected in the VTA (Mountjoy et al, 1994;Roselli- Rehfuss et al, 1993;Bagnol et al, 1999). The identity of the neurons expressing these receptors is unknown. The VTA contains large populations of dopaminergic and GABAergic neurons, and a much smaller population of glutamatergic neurons (Ikemoto, 2007). GABA is synthesised in the brain from glutamate by the glutamic acid decarboxylase (GAD) enzymes and requires pyridoxal pyruvate as a cofactor. The brain contains at least two forms of GAD which differ in molecular size, amino acid sequence, antigenicity, cellular and subcellular location. These forms, GAD65 and GAD67, derive from two separate genes (Martin, 1993). In situ hybridisation was used to detect tyrosine hydroxylase and GAD65/67 mRNA expression and immunocytochemistry (ICC) to detect the MC3R and MC4R in the rat VTA. There are currently no reports of the presence of the MC3R and MC4R in the VTA using ICC.

220

5.3.7.1 PRODUCTION OF GAD65 AND TYROSINE HYDROXYLASE PROBES

The GAD67 probe was generated by Dr T. Ambepitiya using the methods described below.

5.3.7.1.1 REVERSE TRANSCRIPTION AND PCR Reverse transcription, PCR and agarose gel electrophoresis were carried as described in section 4.3.3.3 - 4.3.3.5. Rat hypothalamic RNA was used in all RT reactions. The primers used for the PCR are described in the table below.

ACCESSION RESTRICTION 5' PRIMER 3' PRIMER BP NUMBER ENZYMES

GCAGCTTGCCAC ACCACCACCCC EcoR1 and GAD65 310 NM008078 AGCCACTT ACTGGTTTT BamHI

TTGAACCGTAGA CTTCAGTGAGA GAD67 1917 NM008077 NotI and Hind GACCCCAA TGGCCTAGA TGCTGTTCTCAAC CTTCAGCTCCCC EcoR1 and TH 910 NM012740 CTGCTCT ATTCTGTT BamH1

TABLE 5.1 Primer sequences used in polymerase chain reaction (PCR) to detect gluatamic acid decarboxylase 65 and 67 (GAD65 and GAD67), and tyrosine hydroxylase (TH). The expected size of the product is in base pairs (BP). Accession numbers refer to those published in the Nucleotide Sequence Database.

5.3.7.1.2 PURIFICATION OF PCR PRODUCTS Materials Phenol chloroform (VWR) Ethanol (VWR) 2M sodium acetate (NaAc) pH5.2 (appendix)

Method PCR products were phenol chloroform extracted by addition of an equal volume of phenol chloroform. Solutions were thoroughly mixed before centrifugation at 12300g for 3 minutes. The supernatant was carefully removed and precipitated with the addition of 1/10 volume of NaAC and 2.5 volumes of ice-cold ethanol for more than an hour at -20°C. Following precipitation, suspensions were centrifuged at 12300g for 7 minutes and the supernatant decanted. Pellets were re-suspended in 100 µl PCR GDW (appendix).

221

5.3.7.1.3 RESTRICTION ENDONUCLEASE DIGESTION OF PCR PRODUCTS AND PLASMIDS Purified PCR products and the plasmid into which they were inserted were cut with the same restriction endonucleases in order for the plasmid and the PCR fragment to be joined in a ligation reaction. Restriction endonucleases were originally isolated from bacteria and recognise and cleave specific target sequences within target DNA (Roberts, 2005).

Materials Purified PCR products Plasmid DNA (pBluescript) Restriction endonucleases: BamHI and EcoR1 (New England Biolabs, Herts. UK) 10x restriction buffer (New England Biolabs) 100x bovine specific albumin (BSA) (New England Biolabs) Shrimp alkaline phosphatase (for plasmid digestion only) (New England Biolabs)

Method Reactions were set up in a total volume of 100 µl containing the following: 10 µg DNA (either PCR product or plasmid), restriction endonucleases in equal proportion to make up to 8% of total volume, restriction buffer and BSA were added to a final concentration of 1x by diluting with PCR GDW. The reaction was placed in a water bath at 37°C for 1.5-2 hours. Digested DNA was then purified by phenol chloroform extraction followed by ethanol precipitation as described in section 5.3.8.1.2 and re-suspended in 20 µl PCR GDW.

5.3.7.1.4 ELECTROELUTION OF DNA FRAGMENTS This procedure was used to purify the fragment of interest and remove any contaminating fragments. Purification of plasmids following restriction endonuclease digestion is particularly important as any closed circular DNA remaining can affect the efficiency of transformation. The DNA was separated on an agarose gel and the appropriate fragments electroeluted.

Materials 1% TAE (tris, acetic acid and EDTA) agarose gel (appendix) Dialysis tubing DNA marker (Invitrogen) 50x TAE (appendix) Gel loading buffer (appendix)

222

Methods A 1% TAE (tris, acetic acid and EDTA)/agarose gel was prepared as described in section 4.3.2.5. Precipitated DNA was added to 0.3 volumes gel loading buffer. DNA marker was dissolved 1:10 in PCR GDW and added to 0.3 volumes gel loading buffer. Samples were loaded onto the gel and electrophoresed at 120 volts. DNA was visualised by ultraviolet illumination and the band of interest excised from the gel and placed in dialysis tubing with 400 µl 0.5x TAE. This was sealed with clips and electrophoresed at 200 volts for 20 minutes, the current was then reversed and the gel fragment electrophoresed for another 40 seconds. The TAE in the tubing was removed and DNA purified by ethanol precipitation. The DNA pellet was re-suspended in 20 µl PCR GDW.

5.3.7.1.5 LIGATION OF PCR PRODUCTS INTO PLASMIDS Ligation of DNA fragment requires DNA ligase, a virus-derived enzyme which catalyses the formation of covalent phosphodiester bonds between the 3’ hydroxyl end of one nucleotide and the 5’ phosphate end of another.

Materials T4 DNA ligase, 6U/µl (New England Biolabs) 10x ligase buffer (New England Biolabs)

Methods Twenty nanograms of plasmid were added to a fourfold molar excess of insert. Ligase buffer was added to a final concentration of 1x, 6 U ligase enzyme was added and the final volume made up to 10 µl with PCR GDW. This was incubated at 16°C overnight.

5.3.7.1.6 PREPARATION OF PLASMIDS

5.3.7.1.6.1 PRODUCTION OF COMPETENT BACTERIA In order to allow entry of plasmids, gram negative bacteria such as E. Coli must be rendered competent to take up DNA. Although several methods exist to produce competent bacteria, treatment with cations was used for the studies in this thesis. This method was originally described by Hanahan et al. in 1983 (Wilkinson, 2010a), although several adaptations have been made since.

223

Materials Lysogeny Broth (LB) (appendix) Tetracycline (Sigma-Aldrich) Transformation Buffer I (TFB I) (appendix) Transformation Buffer II (TFB II) (appendix) XL1B cells (ATCC, Middlesex, UK)

Method

One hundred millilitres of LB supplemented with 5 mg/ml tetracycline (LBtet) was inoculated with a colony of XL1B cells and incubated overnight at 37°C with vigorous shaking. One millilitre of this culture was taken and incubated in LBtet at 37°C with vigorous shaking, until the bacteria were in log phase growth (OD550 = 0.4-0.5). The bacteria were recovered by centrifugation for 15 minutes at 800g. Bacteria were resuspended in 40 ml ice cold TFBI and incubated on ice for 40 minutes. The bacteria were then recovered by centrifugation, as above, and resuspended in 4 ml TFBII, then incubated on ice for 4 minutes. Aliquots (50 µl) were prepared, frozen on ethanol in dry ice and stored at -70°C until use.

5.3.7.1.6.2 TRANSFORMATION OF COMPETENT BACTERIA Once treated with cations, bacteria are able to take up DNA. However, further steps are required to optimise entry of DNA into the cells. Methods for transformation of cells include heat shock and electroporation. Heat shock transformation was used for preparation of these probes. Incubation on ice allows attachment of the plasmid to the bacterial cell membrane. The heat shock step allows efficient transport of the plasmid into the bacteria and the incubation following the heat shock promotes expression of the resistance genes before exposure to the antibiotic. Materials LB (appendix) LB ampicillin plates Competent bacteria (XL1B cells)

Method An aliquot of competent bacteria was thawed on ice, 10 ng of plasmid added and the mixture incubated on ice for 20 minutes. The reaction was then incubated at 42˚C for 2 minutes, followed by incubation on ice for 2 minutes. LB was added (200 µl) and the reaction incubated at 37˚C for thirty minutes. Agar plates supplemented with ampicillin were dried and 100 µl of the transformed bacteria was added to the plate and incubated at 37˚C overnight. 224

5.3.7.1.6.3 SMALL SCALE PREPARATION OF PLASMID DNA Plasmids were initially grown using small scale culture to allow analysis of several clones simultaneously. In order to isolate plasmids from within bacterial cells the cell wall must be disrupted to release intracellular contents and plasmid DNA separated from other unwanted components such as genomic DNA, protein and RNA. The method described in this thesis involves lysis of the cell with alkaline sodium dodecyl sulphate (SDS) and precipitation of cellular debris using NaAc. This removes protein and genomic DNA components which are anchored to the cell wall. Removal of RNA is carried out by treatment with RNase at a later stage. The correct clones were selected for large scale amplification by digestion with restriction enzymes. Digestion with EcoR1 and BamHI allows the size of the gene of interest to be confirmed.

Materials LB (appendix) Ampicillin (Sigma-Aldrich) Glucose-tris-EDTA (GTE): (appendix) 25mM Tris-HCl, pH8 10mM EDTA 50mM glucose Alkaline SDS (appendix) 5M potassium acetate (KAc) (appendix) Phenol/chloroform (VWR) Propan-2-ol (VWR) RNase A (GE Healthcare)

Methods A single bacterial colony was picked from the agar plate using sterile technique. This was placed in 2 ml LB supplemented with 0.5 mg/ml ampicillin and was incubated overnight at 37°C with vigorous shaking. From this, 1.5 ml was removed and centrifuged at 12,300g for 3 minutes to pellet the bacterial cells and the remainder stored at 4°C for future use. The supernatant was removed and the bacterial pellet resuspended in 100 µl GTE. Alkaline SDS (200 µl) was added to the resuspended bacteria and the mixture left on ice for 5 minutes, before 150 µl KAc was then added and the mixture left on ice for a further 5 minutes. The mixture was centrifuged at 12,300g for 5 minutes and 350 µl supernatant was removed to a fresh tube separate from the remaining bacterial debris. Phenol chloroform extraction was carried out and the DNA precipitated by adding 0.6 volumes propan-2-ol 225

and incubating at room temperature for 10 minutes. This was centrifuged at 12,300g for 7 minutes to pellet the DNA. Following removal of the supernatant, DNA was resuspended in 100 µl GDW. Ethanol precipitation was carried out to further purify the DNA. Restriction endonuclease digestion was carried out to verify which clones contained the correct plasmid insert. Purified DNA was resuspended in 10 µl GDW. From this 1 µl was digested with EcoR1 and BamHI with the addition of 0.5 µg/µl RNaseA, and visualised by agarose gel electrophoresis. Clones containing the correct insert were selected for large scale purification.

5.3.7.1.6.4 LARGE SCALE PRODUCTION OF PLASMID DNA

Materials LB (appendix) Ampicillin (Sigma-Aldrich) GTE (appendix) Alkaline SDS (appendix) 5M KAc (appendix) Lysozyme (Sigma-Aldrich) Propan-2-ol (VWR) RNase A (GE Healthcare) Tris-EDTA (TE) (appendix) Phenol chloroform (VWR)

Methods Using sterile techniques, 50 µl LB containing the clone of interest was added to 500 ml warmed LB containing 0.5 mg/ml ampicillin. This was incubated overnight at 37°C with vigorous shaking. The mixture was centrifuged for 8 minutes at 2500g, the supernatant removed and each bacterial pellet resuspended in 12.5 ml GTE supplemented with 2 mg/ml lysozyme. The resuspended bacterial pellets were incubated at room temperature for 5 minutes before the addition of 25 ml alkaline SDS to each. Tubes were mixed and incubated on ice for 5 minutes. To neutralise the alkalinity, 19 ml 5M KAc was added to each tube. Tubes were then incubated on ice for 10 minutes before being centrifuged at 8000g for 10 minutes. The supernatant was filtered through nylon gauze into separate tubes to remove remaining cell debris and 36 ml propan-2-ol added to each. Tubes were incubated on ice for 15 minutes before being centrifuged at 8000g for 15 minutes. Supernatant was removed and pellets resuspended in 5 ml 1x TE and united in one tube. To remove any remaining RNA, 100 µl 10 mg/ml RNaseA was added and samples were incubated at 37°C for one hour. Phenol chloroform extraction

226

followed by propan-2-ol precipitation using 5M NaAc was carried out to purify and precipitate the DNA.

5.3.7.1.6.5 CAESIUM CHLORIDE GRADIENT PURIFICATION OF PLASMID DNA This technique was used to purify plasmid DNA from other DNA components. The buoyancy of different types of DNA varies depending on their binding to ethidium bromide. Ethidium bromide binds less effectively to closed circular DNA than to linear (genomic) DNA or nicked plasmids;, consequently, intact plasmid DNA has a lower buoyant density. This allows separation of plasmids on a caesium chloride density gradient.

Materials N-Tris(hydroxymethyl)methyl-2-aminoethanesulfonicd acid (TES) (appendix)

Caesium Chloride (CsCl2)

CsCl2 /isopropanol (appendix) Ethidium bromide (VWR)

Methods The DNA obtained from large scale plasmid production of plasmid DNA was recovered by centrifugation for 20 minutes at 24,000g at 4°C and dissolved in 8.25 ml TES. Then 8.4 g CsCl2 and 150 µl ethidium bromide was added and the solution mixed. This mixture was transferred to two poly- alumina centrifuge tubes and centrifuged overnight at 50,000g. DNA was collected immediately after the centrifuge stopped and the correct band was removed using a hypodermic needle under ultraviolet light. Removal of ethidium bromide was carried out by adding equal volumes of CsCl2/isopropanol and removing the upper phase. Ethanol was used to precipitate the DNA and the pellet resuspended in 1 ml PCR GDW. Concentration was verified using a spectrophotometer.

5.3.7.1.6.6 DETERMINATION OF DNA CONCENTRATION BY SPECTROPHOTOMETRY The DNA was diluted 1:100 in PCR GDW and 1 ml transferred to a quartz cuvette. The absorbance was read at 260 and 280 nm (UV-160 Spectrophotometer, Shimadzu, Kyoto, Japan). The reading at 280 is used to give an indication of the purity of the sample because phenol absorbs more strongly than DNA at this wavelength. The concentration of DNA was calculated using the following formula:

Concentration (µg/ml) = (Absorbance260 x Dilution Factor) x 50 Sequencing of DNA was carried out by Imperial College sequencing service, Genomics Core Laboratory, MRC Clinical Sciences Centre to confirm the correct nucleotide sequence was present in each probe produced.

227

5.3.7.2 IN SITU HYBRIDISATION FOR GAD65, GAD67 AND TH In situ hybridisation is a technique which allows detection of mRNA within a tissue whilst maintaining structural integrity. In situ hybridisation takes advantage of the specific annealing of complementary nucleic acids which can be DNA and/or RNA, through hydrogen bonds formed between bases attached to a sugar-phosphate backbone: adenine (A) anneals with thymine (T in DNA) or uracil (U in RNA), and cytosine (C) anneals with guanine (G). This base pairing underlies the formation of a double stranded complex. Any nucleic acid sequence can therefore be specifically detected by use of a probe that is the ‘antisense’ reverse complementary sequence. The complementary probe is hybridised to sectioned tissue mounted on poly-lysine coated slides. Probes can be labelled with radioactive labels which are detected by autoradiography, or non-radioactive antigen labels e.g. digoxygenin (DIG) which are detected by ICC. Non-radioactive labelling has several assets including safety, high stability, rapid results and a single cell resolution (Wilkinson, 2010b). To determine the localisation of TH mRNA expressing neurons and GAD65/67 mRNA expressing neurons in the rat midbrain, in situ hybridisation was carried out using a DIG labelled riboprobe specific for TH or GAD65/67. A combined GAD65/67 probe has been used previously to identify GABAergic neurons in the brain (Wang & Morales, 2008). Each GAD probe is produced separately before sections are hybridised with both probes simultaneously.

228

5.3.7.2.1 PRODUCTION OF DIG-LABELLED RNA PROBE FOR IN SITU HYBRIDISATION – GAD65, GAD67 AND TH

Materials Template plasmid (200 µg/µl) linearised by digestion with restriction enzymes (BamHI (NotI for GAD67) for antisense riboprobe or EcoRI (Hind for GAD67) for sense riboprobe) 100mM dithiothreitol (DTT) (Promega) 30U/µl RNase inhibitor (Invitrogen) T3 or T7 RNA polymerase (Promega) 10x DIG RNA labelling mix (Roche) 5x polymerase buffer (Promega) DNase I (Invitrogen) 10x DNase buffer (appendix)

Ammonium acetate (NH4Ac) (appendix) Ethanol (VWR) 100xTE (appendix)

Methods The DIG-labelled template probe was produced using an in vitro transcription reaction. Two hundred nanograms of template (TH-PBluescript, GAD65-PBluescript or GAD67-PBluescript) was added to a reaction containing 5 mM DTT, 1x polymerase buffer, 30 U RNase inhibitor and 1x DIG labelling mix in a total volume of 19 µl. Finally, 20 U RNA polymerase was added (T3 to the anti-sense reaction and T7 to the sense reaction) and this was incubated at 37°C for 2 hours. After incubation, 3 µl DNase buffer and 7.5 U DNaseI were added and the reaction incubated for a further 15 minutes at

37°C. The reaction was precipitated by adding 12 µl NH4Ac and 80 µl ice cold ethanol. After one hour at -20°C the reaction was centrifuged at 8000g, the supernatant removed and the pellet resuspended in 100 µl 1 x TE. The concentration of DIG-labelled probe was determined spectrophotometrically (UV-160 spectrophotometer, Shimadzu, Kyoto, Japan).

229

5.3.7.2.2 IN SITU HYBRIDISATION FOR TH AND GAD 65/67 ON FRESH FROZEN RAT BRAIN SECTIONS Initial in situ hybridisation was carried out on fresh frozen sections. Cryostat-cut sections are more sensitive to detection as these sections are relatively thick and thus have greater mRNA signal. In addition, paraffin embedding is thought to reduce signal as the mRNA is less accessible due to the wax.

Materials Optimum Cutting Temperature (OCT) embedding compound (Bright Instruments, Huntingdon, UK) Poly-lysine coated slides (VWR) 40% (v/v) Formaldehyde (VWR) 0.01M phosphate buffered saline (PBS) (appendix) 0.1M triethanolamine pH8.0 (TEA) (appendix) 100% acetic anhydride (VWR) Ethanol (VWR) Chloroform (VWR) Hybridisation buffer (appendix): Formamide (FMM) (Sigma) 5M sodium chloride (NaCl) (appendix) 100x Denhardts solution (appendix) 1M Tris/HCl pH8 0.5M EDTA pH8 50% (w/v) dextran sulphate (Sigma-Aldrich) 100mM DTT 10mg/ml yeast tRNA (Sigma-Aldrich) 20x salt sodium citrate (SSC) (appendix) 1x RNase buffer (Promega) RNaseA (Promega) (appendix) Blocking solution: (appendix) 0.1M Tris 0.15M NaCl Fetal bovine serum (FBS) (Invitrogen) 1:10 Triton X (VWR) Anti-DIG-AP, Fab fragments (Roche) Tris-NaCl buffer (appendix) 230

4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indoyl-phosphate, 4-toluidine salt kit (BCIP/NBT alkaline phosphatase substrate kit) (Vector Labs) Xylene (VWR) Wax pen (Vector Labs) DPX mountant (Thermo Fisher Scientific)

Methods

Rats were killed by CO2 asphyxiation. Brains were removed immediately, mounted onto cork discs with OCT embedding compound and rapidly frozen in isopentane at -150°C. They were stored at - 80°C until use. Rat brains were sliced on a cryostat (Bright Instruments) at -25°C into 12 µm sections. The sections were mounted onto poly-lysine coated slides and stored at -80°C until use. Sections were fixed in 0.01 M PBS containing 4% formaldehyde on ice for 20 minutes. Slides were washed twice in 0.01 M PBS for 5 minutes each, in 0.1 M TEA for 2 minutes and then acetylated in 0.25% (v/v) acetic anhydride in 0.1 M TEA for 10 minutes. Slides were washed twice for 2 minutes in 0.01 M PBS before dehydration through 50%, 70%, 95% and 100% ethanol for 3 minutes each. Finally, slides were delipidated in chloroform for 5 minutes and allowed to air dry for several hours. Hybridisation buffer was supplemented with 2.5ng/µl DIG labelled TH, or 1ng/µl of each DIG- labelled GAD65 and DIG-labelled GAD67, and 80 µl added to each slide. Slides were coverslipped and hybridised overnight at 60°C in a humid environment. Slides were washed in a series of washes with decreasing salt content to remove non-specifically bound probe. Slides were washed in 4x SSC at room temperature and the cover slips removed. Slides were then washed a further four times in 4x SSC at room temperature for 5 minutes each, before RNase treatment by incubation in 1x RNase buffer containing 100µg/ml RNaseA for 30 minutes at 37°C. Slides were washed twice in 10 mM DTT/2x SSC for 5 minutes, once in each of 10 mM DTT/1x SSC and 10 mM DTT/0.5x SSC for 10 minutes each, and once for 30 minutes in 10 mM DTT/0.1M SSC at 60°C, before rinsing in room temperature 10 mM DTT/0.1x SSC. Sections were then subjected to two hours of blocking with FBS before incubation for two hours in a humidified chamber with blocking solution containing anti-DIG-AP, Fab fragments at a 1:2000 concentration. Individual sections were isolated using a hydrophobic wax pen prior to incubation with anti-DIG-AP. Slides were then washed in Tri-NaCl buffer pH7.5 and Tris-NaCl buffer pH9.5 for five minutes each, before immersion into development solution containing 2 drops of reagents 1,2 and 3 per 5 ml Tris- NaCl buffer pH9.5. Slides were incubated in this solution in the dark and development was monitored microscopically over the following 1-2 hours. Following sufficient development, slides were washed in Tris-NaCl buffer pH9.5 before dehydration through 50%, 70%, 95% and 100% ethanol each for 3 minutes. Finally slides were immersed in xylene for 2 x 5 minutes and mounted using DPX.

231

Sections were observed under the microscope (Nikon, Eclipse 50i) and photographs taken using a GXCAM camera (GX Optical, Haverhill, UK) and Tsview software (Tsview 6.0).

5.3.7.2.3 IN SITU HYBRIDISATION FOR TH AND GAD65/67 ON PARAFFIN EMBEDDED RAT BRAIN SECTIONS The use of paraffin embedded tissue for in situ hybridisation has several advantages including the better preservation of tissue morphology and the ability to cut thinner sections. For dual ISH/ICC, paraffin sections are much more resilient than frozen sections. However an effective fixation protocol is essential for detection of mRNA.

5.3.7.2.3.1 BRAIN TISSUE FIXATION AND PROCESSING Materials Pentobarbitone (Merial) 0.01M PBS (appendix) Formaldehyde (VWR) Poly-lysine coated slides (VWR)

Methods Adult female Wistar rats were terminally anaesthetised with an IP injection of a lethal dose of pentobarbitone (Merial Animal Health Ltd, UK). Once the withdrawal reflex was no longer present, the heart of the rat was exposed. A 21 gauge needle was inserted into the apex of the left ventricle and slightly advanced towards the aorta. A small nick was made in the right atrium and the animal was perfused with 0.01 M PBS pH7.4 (see appendix) from a 1m height under gravitational pressure until body fluid was running clear (approximately 100 ml). The rat was then perfusion fixed with approximately 500 ml 4% formaldehyde in phosphate buffered hypertonic (1.5%) saline solution pH 6.5 (appendix) from a 1m height under gravitational pressure. After 2 hours, the brain was dissected out and divided coronally into four sections, before immersion in the same fixative solution for 24h at 4°C. Following transfer of sections into 70% ethanol, each coronal segment of the brain was then paraffin embedded, and 3 µm sections were sectioned using a rotary microtome (Leitz, Wetzlar, Germany), and mounted on polylysine-coated slides.

232

5.3.7.2.3.2 IN SITU HYBRIDISATION Due to the differences in tissue processing for paraffin embedded sections, the protocol for in situ hybridisation is slightly different to that described for frozen tissue in section 5.3.7.2.2.

Materials 0.01M PBS (appendix) 0.01 M citrate buffer (appendix) Ethanol (VWR) Hybridisation buffer (appendix): Deionised FMM (Sigma-Aldrich) 20 x SSC (appendix) 100 x Denhardts solution (Sigma-Aldrich) 1M Tris/HCl pH7.5 0.5M EDTA pH8 10% (w/v) dextran sulphate (Sigma-Aldrich) 10mg/ml yeast tRNA (Sigma-Aldrich) 10% SDS Maleic buffer (Roche) Blocking solution: (appendix) Maleic buffer (appendix) 1x commercial block (Roche) 10% FBS (Invitrogen) Anti-DIG-AP, Fab fragments (Roche) DIG wash (Roche) Detection buffer: (appendix) 0.1M NaCl 0.05MTris-HCl, pH9.8

0.05M MgCl2 4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indoyl-phosphate, 4-toluidine salt kit (BCIP/NBT alkaline phosphatase substrate kit) (Vector Laboratories, Burlingame, CA) Xylene (VWR) DPX mountant (Thermo Fisher Scientific) Wax pen (Vector Labs)

Methods

233

Paraffin sections were dewaxed in two changes of xylene (5 minutes each) and rehydrated through graduated ethanol washes (2 x 100%, 1 x 70%, 1 x 50%) for 3 minutes each before rinsing in distilled water and then 0.01 M PBS. Antigen retrieval was carried out on the sections by boiling for 20 minutes in a microwave oven in pre-boiled 0.01 M citrate buffer pH6 (appendix), after which, sections were allowed to cool for a further 15 minutes before rinsing in PCR GDW. Slides were then dehydrated through 50%, 70%, and 100% ethanol for 3 minutes each, and individual sections were isolated using a hydrophobic wax pen, before slides were allowed to air dry. Pre-hybridisation of sections was carried out using hybridisation buffer not containing any DIG-labelled probe. Slides were incubated in this solution for 1 hour at 57°C in a humidified chamber. Fifteen minutes before hybridisation, probes were added to hybridisation buffer and denatured at 75°C for 15 minutes, before cooling on ice for 5 minutes. Hybridisation buffer containing 2.5ng/µl DIG labelled TH, or 1ng/µl of each DIG-labelled GAD65 and DIG-labelled GAD67 (80 µl) was added to each slide, and sections were hybridised overnight at 57°C in a humid environment. Slides were washed in a series of washes with decreasing salt content to remove non-specifically bound probe. Slides were washed in 5x SSC at 60°C for 10 minutes, before a series of increasing stringency washes at 60°C in 50% FMM/2 x SSC for 30 minutes, 2 x SSC for 30 minutes, and twice in 0.2x SSC for 30 minutes each. Slides were then incubated in maleic buffer at room temperature for 5 minutes before undergoing blocking in a blocking solution containing FBS for 30 minutes at room temperature. Sections were then subjected to two hours incubation in a humidified chamber with blocking solution containing anti-DIG-AP, Fab fragments at a 1:2000 concentration. Slides were then washed in DIG wash twice for 15 minutes each at room temperature. Sections were briefly rinsed in detection buffer for 5 minutes before incubation in detection buffer, an equal volume of 10% polyvinyl acetate, and 2 drops of reagents 1, 2 and 3 (BCIP-NBT kit) per 5 ml detection buffer. Slides were incubated in this solution in the dark and development was monitored microscopically over the following 1-2 hours. Following sufficient development, slides were washed in water three times for 5 minutes each, before dehydration through 50%, 70% and 100% ethanol each for 15 seconds. Finally slides were immersed in xylene for 30 seconds and mounted using DPX. Sections were observed under the microscope (Nikon, Eclipse 50i) and photographs taken using a GXCAM-3 camera (GX Optical, Haverhill, UK) and Tsview software (Tsview 6.0).

5.3.7.3 IMMUNOCYTOCHEMISTRY FOR MELANOCORTIN RECEPTORS IN THE VTA The MC3R antibody used was an affinity purified goat polyclonal antibody raised against a peptide mapping at the C-terminus of MC3-R of human origin (MC3R (C20) sc-6878 Santa Cruz Biotechnology,Inc.). The MC4R antibody used was an affinity purified goat polyclonal antibody

234

raised against a peptide mapping at the C-terminus of MC4-R of rat origin (MC4R (R-19) sc-6880 Santa Cruz Biotechnology,Inc.).

5.3.7.3.1 BRAIN TISSUE FIXATION AND PROCESSING Adult female Wistar rats were terminally anaesthetised with pentobarbitone. Animals were fixed, and brain tissue was processed as described in section 5.3.7.2.3.1.

5.3.7.3.2 MELANOCORTIN RECEPTOR ICC Materials Polylysine coated slides (VWR) Ethanol (VWR) Xylene (VWR) 0.01M PBS/PBST (appendix) 0.01M citrate buffer pH6 (appendix) Fetal calf serum (FCS) (Invitrogen) Antibody diluent: (appendix) Tris buffered saline (appendix) Bovine serum albumin (BSA) Sodium azide (VWR) Biotinylated donkey anti-goat (Jackson Labs) Avidin Biotin Complex (ABC) (Vector Labs) Imidazole (Sigma-Aldrich) Diaminobenzidinetetrahydrochloride hydrate (DAB) (Sigma-Aldrich) Copper sulphate solution (appendix) DPX mountant (Thermo Fisher Scientific) Wax pen (Vector Labs)

Methods Paraffin sections were dewaxed in two changes of xylene (5 minutes each) and rehydrated through graduated ethanol washes (2 x 100%, 1 x 70%, 1 x 50%) for 3 minutes each before rinsing in distilled water and then 0.01M PBS. Antigen retrieval was carried out on the sections by boiling for 20 minutes in a microwave oven in pre-boiled 0.01 M citrate buffer pH6, after which, sections were allowed to cool for a further 15 minutes before rinsing in 0.01 M PBS. Endogenous peroxidase activity was blocked by incubation in 0.01 M PBS containing 1.6% hydrogen peroxide for 10 minutes. Following a 5 minute wash in water, sections were incubated for 30 minutes at room

235

temperature with 10% fetal calf serum in antibody diluent. The MC3R antibody was diluted 1:100 in antibody diluent and incubated on the sections overnight at room temperature. The MC4R antibody was diluted 1:100 in antibody diluent and incubated on the sections overnight at room temperature. Control sections were routinely processed by omitting the primary antiserum. Sections were then washed in 0.01 M PBS containing 0.05% Tween-20 (PBST), incubated in biotinylated donkey anti- goat (1:400 dilution) for 30 minute at room temperature before being washed in PBST, and incubated with avidin-biotin complex horseradish peroxidase at room temperature for 30 minutes. After a final wash in 0.01 M PBS, the antigen-antibody complex was visualised by incubation in PBS containing imidazole (final concentration 0.1 M), 0.04% 3,3'-diaminobenzidine (DAB), and 0.015% hydrogen peroxide. The pH of the chromogenic solution was adjusted to 7.4 with HCl. Following DAB staining for 5-10 minutes, sections were rinsed in PBS and then water. DAB staining was enhanced by incubation in copper sulphate for 4 minutes. Sections were then rinsed in water before being dehydrated though ascending ethanol concentrations (50-100%) for 3 minutes each and 2 x 5 minutes in xylene. Slides were mounted using DPX and coverslips. Sections were visualised under the microscope (Nikon, Eclipse 50i) and photographs taken using a GXCAM-3 camera (GX Optical, Haverhill, UK) and Tsview software (Tsview 6.0). As no immunostaining was observed at 1:100 dilution, the MC4R antibody was diluted to a range of concentrations (1:10, 1:25, 1:50, 1:100, 1:200, 1:400, 1:800, 1:1600, 1:4000, 1:8000, 1:16000 and 1:32000) in antibody diluent and incubated on the sections overnight at room temperature. Control sections were processed by omitting the primary antiserum.

5.3.7.4 DUAL IN SITU HYBRIDISATION/IMMUNOCYTOCHEMISTRY FOR GAD65/67 OR TH MRNA AND MC3R-IR In situ hybridation for TH and GAD65/67 was carried out on paraffin sections as described in section 5.3.7.2.3. Following development in chromagen containing detection solution, slides were rinsed in PCR GDW for 5 minutes and then washed in 0.01 M PBS for 2 x 5 minutes. Sections were then incubated overnight at room temperature in antibody diluent containing 1:100 MC3R antibody. The ICC protocol was then carried out as described in section 5.3.7.3.2.

236

5.3.8 STUDIES INVESTIGATING THE MECHANISMS BY WHICH iVTA MELANOCORTINS MEDIATE THEIR EFFECTS ON FOOD INTAKE IntraVTA administration of the melanocortin receptor agonist NDP-MSH reduced food intake to 10% of saline injected controls in the first hour following injection in study 5.3.6.3.3, while iVTA AgRP profoundly increased food intake over 24 hours and resulted in a body weight gain of approximately 15g at 24h post-injection compared to the 2g gain of saline injected controls in study 5.3.6.3.4. These studies suggest the presence of a melanocortin tone in the VTA. However, the 1 nmol doses of NDP- MSH and AgRP used in the previous studies are relatively high for an intranuclear injection. Further studies were carried out to investigate the role of the melanocortin system in the regulation of VTA mediated food intake. To determine the sensitivity of the VTA to the anorectic effect of melanocortin receptor agonists, lower doses of NDP-MSH were administered.

5.3.8.1 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline or NDP-MSH (0.1, 0.3 or 1 nmol) (n = 6). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.8.2 EFFECT OF iVTA ADMINISTRATION OF LOWER DOSES OF NDP-MSH ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline or NDP-MSH (0.01, 0.03 or 0.1 nmol) (n = 6-7 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post- injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.8.3 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE The effect of NDP-MSH was investigated in fasted rats to determine whether the melanocortin tone in the VTA is affected by alterations in energy states. Groups of overnight fasted male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline or NDP-MSH (0.03, 0.1 or 1 nmol) (n = 6-7 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post- injection. Body weight was measured at 0 and 24 hours post-injection.

237

IntraVTA administration of AgRP at low doses was carried out to investigate the sensitivity of the VTA to the orexigenic effects of melanocortin receptor blockade. The doses of AgRP used in this study were the same as the lowest doses of NDP-MSH which had an anorectic effect in study 5.3.8.2.

5.3.8.4 EFFECT OF iVTA ADMINISTRATION OF LOW DOSES OF AGRP ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline or AgRP (0.01, 0.03 or 0.1 nmol) (n = 5-7 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.8.5 EFFECT OF iVTA ADMINISTRATION OF AGRP ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Higher doses of AgRP were used in this study to determine the lowest dose of AgRP with a significant effect on food intake. Groups of ad-libitum fed male Wistar rats were injected into the VTA during the early light phase with either 0.9% saline or AgRP (0.3 or 1 nmol) (n = 7-9 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.8.6 EFFECT OF iVTA ADMINISTRATION OF γ-MSH ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE NDP-MSH binds with high affinity to both the MC3R and the MC4R (Adan et al, 1999). To determine whether the MC3R plays a role in the anorectic effect of iVTA NDP-MSH, the relatively selective MC3R antagonist, γ-MSH, was used (Oosterom et al, 1999).

Groups of ad-libitum fed male Wistar rats were injected into the VTA at the onset of the dark phase with either 0.9% saline or γ-MSH (0.03, 0.1 or 1 nmol) (n = 6-7 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post-injection. Body weight was measured at 0 and 24 hours post-injection. Behaviour was observed between 0-1 and 1-2 hours post-injection by an observer blinded to the experimental treatments. This was carried out as described in section 2.4.3.6.

238

5.3.8.7 EFFECT OF IP PRETREATMENT WITH THE GABA RECEPTOR ANTAGONIST BICUCULLINE-METHIODIDE BEFORE iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS BEFORE THE EARLY DARK PHASE The VTA contains large populations of both dopaminergic and GABAergic neurons (Oades & Halliday, 1987;Ikemoto, 2007). The melanocortin receptors identified in the VTA co-localise with GABAergic neurons. To investigate whether the mechanism by which iVTA melanocortin administration mediates its anorectic effect is dependent on GABA signalling, a GABA receptor antagonist was administered before iVTA injection of NDP-MSH.

Bicuculline-methiodide is a more stable and soluble salt of bicuculline, a potent GABAA receptor antagonist (Olsen et al, 1976). The dose of bicuculline methiodide used in this study (3 mg/kg) has previously been shown to have no effect on food intake (Zarrindast et al, 1989). The dose of NDP- MSH used in this study has been shown in earlier studies to significantly reduce food intake. Groups of ad-libitum fed male Wistar rats were IP injected 15 minutes before the onset of the dark phase with either 0.9% saline or bicuculline-methiodide (3 mg/kg). Fifteen minutes later, rats were injected iVTA with either 0.9% saline or NDP-MSH (0.03 nmol) (n = 6-7 per group). Rats were immediately returned to their home cages and food was reweighed at 1, 2, 4, 8 and 24 hours post- injection. Body weight was measured at 0 and 24 hours post-injection.

5.3.9 STATISTICS All data from iVTA feeding studies were analysed using one-way ANOVA and Dunnett’s post hoc test with all groups compared to saline (GraphPad Prism 5). Data points more than two standard deviations above or below the group mean were removed as outliers. This removed animals with low food intake due to sickness and normalised the data for analysis. In all cases P<0.05 was considered statistically significant.

239

5.4 RESULTS

5.4.1 CONFIRMATION OF CANNULA PLACEMENT Eighty-four percent of cannulae in studies described in section 5.3.6 were directed within or less than 0.2mm outside the VTA. A representative ink injection in the parabrachial pigmented nucleus of the VTA is shown in Figure 5.4.

FIGURE 5.4 A) A representative coronal section of a rat brain following 1 µl India Ink injection into the parabrachial pigmented nucleus (PBP) of the ventral tegmental area. B) A corresponding coronal section of a rat brain atlas diagram. Abbreviations: AQ, aqueduct; cp, cerebral peduncle; IPL, interpeduncular nucleus, lateral subnucleus; IPR, interpenduncular nucleus, rostral subnucleus; PBP, parabrachial pigmented nucleus; PIF, parafasciculus nucleus, PN, paranigral nucleus; SNC/M, substantia nigra, compacta part medial tier. This section is 6.0mm posterior from the bregma. Adapted from (Paxinos & Watson, 2007).

240

5.4.2 INTRA-VTA ADMINISTRATION OF FACTORS INVOLVED IN ENERGY HOMEOSTASIS

5.4.2.1 THE EFFECT OF IVTA ADMINISTRATION OF PERIPHERAL FACTORS ON FOOD INTAKE

5.4.2.1.1 EFFECT OF iVTA ADMINISTRATION OF INSULIN ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE There was no significant effect of iVTA insulin administration on food intake at any dose or time point studied. Ghrelin (0.3 nmol) the positive control significantly stimulated food intake one hour post-injection (P<0.01) and increased 0-24h body weight (P<0.05) compared to saline, n = 7-10 saline and insulin, n = 5 ghrelin (Table 5.2).

Time period saline 0.1 mU insulin 1 mU insulin 10 mU insulin ghrelin (0.3nmol) 0-1 (g) 0.9 ± 0.2 1.4 ± 0.5 1.8 ± 0.7 1.5 ± 0.7 4.5 ± 0.4** 1-2 (g) 1.5 ± 0.6 1.3 ± 0.5 1.3 ± 0.5 0.7 ± 0.5 3.0 ± 0.5 2-4 (g) 0.2 ± 0.1 0.5 ± 0.3 0.2 ± 0.0 0.1 ± 0.0 1.0 ± 0.8 4-8 (g) 0.7 ± 0.3 0.5 ± 0.2 0.3 ± 0.1 1.4 ± 0.7 0.2 ± 0.0 8-24 (g) 26.7 ± 1.4 26.7 ± 1.1 27.4 ± 1.0 25.9 ± 1.0 25.1 ± 2.4 0-24 (g) 30.0 ± 1.0 30.4 ± 1.0 30.9 ± 1.5 29.7 ± 1.6 33.9 ± 1.4 BW change (g) -5.1 ± 1.9 -5.1 ± 1.5 -0.8 ± 1.1 -2.5 ± 1.0 -1.0 ± 2.3*

TABLE 5.2 The effect of intra-VTA injection of saline, insulin (0.1, 1 and 10 mU) or ghrelin (0.3 nmol) (positive control) (n = 7-10 saline and insulin, n= 5 ghrelin) on food intake and 24h body weight (BW) change in ad-libitum fed male rats in the early light phase. *, P<0.05 vs. saline; **, P<0.01 vs. saline. Results are mean ± SEM.

5.4.2.1.2 EFFECT OF iVTA ADMINISTRATION OF INSULIN ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE There was no significant effect of iVTA insulin administration at any dose or time point studied (n = 5-10 saline and insulin, n = 5 leptin). IntraVTA leptin administration had no significant effect on food intake, although there was a trend towards a reduction in food intake between 8-24 h post-injection (P=0.06), and cumulative 0-24 h food intake (P= 0.08) compared to saline injected controls (Table 5.3).

241

Time Period saline 0.1 mU insulin 1 mU insulin 10 mU insulin leptin (0.06 nmol) 0-1 (g) 3.5 ± 0.4 2.8 ± 0.5 3.0 ± 0.5 3.2 ± 0.4 4.1 ± 0.6 1-2 (g) 2.3 ± 0.4 2.4 ± 3.0 1.9 ± 0.4 2.0 ± 0.3 2.2 ± 0.3 2-4 (g) 5.0 ± 0.7 5.2 ± 3.3 5.9 ± 0.6 4.5 ± 0.5 4.2 ± 0.8 4-8 (g) 5.2 ± 1.0 6.2 ± 3.9 7.3 ± 0.8 7.6 ± 0.8 4.3 ± 0.8 8-24 (g) 11.7 ± 0.7 10.8 ± 4.5 11.0 ± 0.8 11.7 ± 0.9 8.5 ± 1.1 0-24 (g) 27.7 ±1.4 27.4 ± 3.9 29.1 ± 0.9 29.1 ± 0.8 23.3 ± 1.8 BW change (g) -9.3 ± 1.7 -10.8 ± 10.8 -7.8 ± 0.9 -4.8 ± 1.7 -13.6 ± 1.4

TABLE 5.3 The effect of intra-VTA injection of saline, insulin (0.1, 1 and 10 mU) or leptin (0.06 nmol) (positive control) (n = 5-10 saline and insulin, n = 5 leptin) on food intake and 24h body weight (BW) change in ad-libitum fed male rats in the early dark phase. Results are mean ± SEM.

242

5.4.2.2 THE EFFECT OF IVTA ADMINISTRATION OF LHA NEUROPEPTIDES ON FOOD INTAKE

5.4.2.2.1 EFFECT OF iVTA ADMINISTRATION OF OREXIN AND MCH ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE There was no significant effect of iVTA administration of either orexin or MCH on food intake at any time point measured or on body weight at 24 h. IntraVTA ghrelin (0.3 nmol), the positive control, significantly stimulated food intake between 0-1h (P<0.01) compared to saline (n = 8-11 for each group, n = 4 for ghrelin) (Table 5.4).

Time Period saline orexin (1 nmol) MCH (1 nmol) ghrelin (0.3 nmol) 0-1 (g) 1.0 ± 0.3 1.0 ± 0.3 1.2 ± 0.4 3.4 ± 1.3** 1-2 (g) 0.6 ± 0.3 1.3 ± 0.4 0.5 ± 0.2 1.4 ± 0.8 2-4 (g) 0.5 ± 0.2 0.6 ± 0.2 0.5 ± 0.2 0.3 ± 0.0 4-8 (g) 0.5 ± 0.1 1.1 ± 0.3 0.6 ± 0.2 0.4 ± 0.0 8-24 (g) 28.9 ± 1.0 27.5 ± 1.2 26.9 ± 0.9 27.1 ± 2.7 0-24 (g) 31.7 ±1.2 31.5 ± 1.5 29.7 ± 1.0 32.7 ± 1.9 BW change (g) +1.6 ± 1.0 +2.4 ± 0.7 +0.1 ± 1.2 +2.3 ± 3.2

TABLE 5.4 The effect of intra-VTA injection of saline, orexin A (1 nmol), melanin concentrating hormone (MCH) (1 nmol) or ghrelin (0.3 nmol) (positive control) (n = 8-11 for each group, n = 4 ghrelin) on food intake and 24h body weight (BW) change in ad-libitum fed male rats in the early light phase. **, P<0.01 vs. saline. Results are mean ± SEM.

5.4.2.3 THE EFFECT OF IVTA ADMINISTRATION OF ARC NEUROPEPTIDES ON FOOD INTAKE

5.4.2.3.1 EFFECT OF iVTA ADMINISTRATION OF CART ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE Administration of 0.6 nmol CART (55-102) into the VTA of overnight fasted rats significantly reduced food intake between 0-1h, and 0-24 hours post-injection (0-1h food intake/g: saline 7.1 ± 1.1, CART (55-102) 0.6 nmol 3.2 ± 0.8 P<0.001. 0-24h food intake/g: saline 41.7 ± 1.0, CART (55- 102) 0.6 nmol 33.3 ± 1.5 P<0.01, n = 6-10 saline and CART). Food intake was significantly increased between 2-4 hours post-injection following administration of 0.6nmol CART (55-102) (2-4h food 243

intake/g: saline 0.8 ± 0.5, CART (55-102) 0.6nmol 4.4 ± 0.7 P<0.001, n = 6-10 saline and CART). (Figure 5.5) Administration of 0.6nmol CART (55-102) caused tremors in a few animals. No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

5.4.2.3.2 EFFECT OF iVTA ADMINISTRATION OF CART ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Administration of 0.6nmol CART (55-102) into the VTA of ad-libitum fed rats significantly reduced food intake between 8-24h and 0-24 hours post-injection (8-24h food intake/g: saline 30.5 ± 0.8, CART (55-102) 0.6nmol 20.7 ± 1.6 P<0.001. 0-24h food intake/g: saline 32.7 ± 1.1, CART (55-102) 0.6nmol 23.7 ± 1.5 P<0.001, n = 7-9 saline and CART). (Figure 5.6) Administration of 0.6nmol CART (55-102) caused tremors in a few animals. No significant differences in food intake were detected at any other time points measured. CART (55-102) There was a significant reduction in body-weight at 24 hours post-injection following administration of 0.6nmol CART (55-102) (BW change/g: saline 1.4 ± 1.5, CART (55-102) 0.6nmol -9.8 ± 2.4 P<0.01, n = 7-9 saline and CART).

244

FIGURE 5.5 The effect of intra-ventral tegmental area injection of saline, cocaine- and amphetamine- regulated transcript (CART 55-102) (0.04, 0.2 and 0.6 nmol), or ghrelin (0.3 nmol) (positive control) (n = 6-10 saline and CART, n = 4 ghrelin) on (A) 0-1h, (B) 2-4h, and (C) 0-24h food intake in fasted male rats in the early light phase. **, P<0.01 vs. saline; ***, P<0.001 vs. saline. Results are mean ± SEM.

245

FIGURE 5.6 The effect of intra-ventral tegmental area injection of saline, cocaine and amphetamine regulated transcript (CART 55-102) (0.04, 0.2 and 0.6 nmol), or ghrelin (0.3 nmol) (positive control) (n = 7-9 saline and CART, n= 5 ghrelin) on (A) 0-1h and (B) 8-24h food intake in ad-libitum fed male rats in the early light phase. ***, P<0.001 vs. saline. Results are mean ± SEM.

246

5.4.2.3.3 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Administration of NDP-MSH (1 nmol) into the VTA of rats at the onset of the dark phase significantly inhibited food intake between 0-1h and 1-2h compared to saline injected animals and increased food intake between 8-24h (0-1h food intake/g: saline 4.0 ± 0.5, NDP-MSH 1 nmol 0.4 ± 0.1 P<0.001, leptin 0.06 nmol 4.3 ± 0.7. 1-2h food intake/g: saline 3.1 ± 0.5, NDP-MSH 1 nmol 0.3 ± 1.1 P<0.001, leptin 0.06 nmol 3.3 ± 0.4. 8-24h food intake/g: saline 9.2 ± 0.6, NDP-MSH 1 nmol 12.2 ± 2.1 P<0.05, leptin 0.06 nmol 7.3 ± 1.3, n= 8-10 saline and NDP-MSH, n= 6 positive control) (Figure 5.7). Leptin (0.06 nmol), the positive control, inhibited food intake at 4-8h and cumulatively at 0-24h post- injection (4-8h food intake/g: saline 8.5 ± 0.8, NDP-MSH 1 nmol 9.1 ± 1.7, leptin 0.06 nmol 3.0 ± 1.1 P<0.001. 0-24h food intake/g: saline 28.9 ± 1.1, NDP-MSH 1 nmol 26.2 ± 1.3, leptin 0.06 nmol 21.9 ± 2.6 P<0.05, n= 8-10 saline and NDP-MSH, n= 6 positive control).

5.4.2.3.4 EFFECT OF iVTA ADMINISTRATION OF NPY AND AGRP ON FOOD INTAKE IN AD LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE IntraVTA NPY administration (1 nmol) significantly stimulated food intake between 0-1h and 1-2h post injection (0-1h food intake/g: saline 0.6 ± 0.2, NPY 1 nmol 4.9 ± 0.8 P<0.001, AgRP 1 nmol 0.7 ± 0.3, ghrelin 0.3 nmol 2.6 ± 0.5. 1-2h food intake/g: saline 0.3 ± 0.1, NPY 1 nmol 2.0 ± 0.5 P<0.05, AgRP 1 nmol 1.2 ± 0.5, ghrelin 0.3 nmol 1.9 ± 0.5 n= 8-10 per group, n= 7 positive control) (Figure 5.8). Administration of AgRP (1 nmol) significantly increased food intake between 4-8h post injection compared to saline injected controls (4-8h food intake/g: saline 1.4 ± 0.3, NPY 1 nmol 0.4 ± 0.1, AgRP 1 nmol 3.6 ± 0.7 P<0.01, ghrelin 0.3 nmol 0.3 ± 0.02). AgRP also significantly increased cumulative 24h food intake and body weight compared to saline injected control animals (0-24h food intake/g: saline 30.9 ± 0.8, NPY 1 nmol 33.7 ± 0.9, AgRP 1 nmol 37.6 ± 1.8 P<0.01, ghrelin 0.3 nmol 31.0 ± 1.6. 24h body weight gain/g: saline 1.3 ± 1.5, NPY 1 nmol 2.4 ± 1.4, AgRP 1 nmol 15.1 ± 2.1 P<0.001, ghrelin 0.3 nmol 0.5 ± 5.0 n= 8-10 per group, n= 7 positive control) (Figure 5.8).

247

FIGURE 5.7 The effect of intra-ventral tegmental area injection of saline, [Nle4,D-Phe7]-α-melanocyte stimulating hormone (NDP-MSH) (1 nmol), or leptin (0.06 nmol) (positive control) (n = 8-10 saline and NDP- MSH, n = 6 leptin) on (A) 0-1h, (B) 1-2h, (C) 4-8h, (D) 8-24h and (E) 0-24h food intake in ad-libitum fed male rats in the early dark phase. *, P<0.05 vs. saline; **, P<0.01 vs. saline; ***, P<0.001 vs. saline. Results are mean ± SEM.

248

FIGURE 5.8 The effect of intra-ventral tegmental area injection of saline, agouti-related peptide (AgRP) (1 nmol), neuropeptide Y (NPY) (1 nmol) or ghrelin (0.3 nmol) (positive control) (n = 8-10 per group, n = 7 ghrelin) on (A) 0-1h, (B) 1-2h, (C) 4-8h, and (D) 0-24h food intake and (E) 0-24h body weight change in ad- libitum fed male rats in the early light phase. *, P<0.05 vs. saline; **, P<0.01 vs. saline; ***, P<0.001 vs. saline. Results are mean ± SEM.

249

5.4.3 CHARACTERISATION OF MELANOCORTIN RECEPTOR-EXPRESSING NEURONS IN THE VTA

5.4.3.1 EXPRESSION OF TH AND GAD65/67 MRNA IN THE RAT VTA

5.4.3.1.1 PRODUCTION OF GAD65 AND TYROSINE HYDROXYLASE PROBES Rat brain tissue expressed TH mRNA as shown by RT-PCR. A band of approximately 910 base pairs was observed when compared to a 1Kb ladder (Figure 5.9A). TH was cloned into P.Bluescript plasmid using the enzymes BamH1 and EcoR1 (Figure 5.9B). Sequencing of DNA following large scale preparation of the plasmid confirmed correct probe generation.

FIGURE 5.9 A) Tyrosine hydroxylase (TH) mRNA expression in rat hypothalmus as determined by reverse transcription-polymerase chain reaction (RT-PCR); L, 1-Kb ladder. The size of the expected PCR product for TH was 910 base pairs. B) Tyrosine hydroxylase following large scale preparation of plasmid DNA in P.Bluescript and digestion with EcoR1 and BamHI restriction enzymes; L, 1-Kb ladder.

250

Rat brain tissue expressed GAD65 mRNA as shown by RT-PCR. A band of approximately 310 base pairs was observed when compared to a 1Kb ladder (Figure 5.10A). TH was cloned into P.Bluescript plasmid using the enzymes BamH1 and EcoR1 (Figure 5.10B). Sequencing of DNA following large scale preparation of the plasmid confirmed correct probe generation.

FIGURE 5.10 A) Glutamic acid decarboxylase (GAD) 65 mRNA expression in rat hypothalamus as determined by reverse transcription-polymerase chain reaction (RT-PCR); L, 1-Kb ladder. The size of the expected PCR product for GAD65 was 310 base pairs. B) GAD65 after large scale preparation of plasmid DNA in P.Bluescript following digestion with EcoR1 and BamHI restriction enzymes; L, 1-Kb ladder.

251

5.4.3.1.2 EXPRESSION OF TYROSINE HYDROXYLASE MRNA IN FROZEN RAT BRAIN SECTIONS Using a DIG-labelled TH antisense probe, TH mRNA expression was detected in the VTA and substantia nigra in the midbrain sections used (Figure 5.11). The signal for TH mRNA was not detected when brains sections were hybridised with the corresponding DIG-labelled sense probe.

FIGURE 5.11 Expression of tyrosine hydroxylase (TH) mRNA in a coronal rat midbrain frozen section (12 µm thickness) hybridized with antisense dixogigenin TH riboprobe seen under 20x magnification. Expression of TH (blue dots) is seen in the ventral tegmental area (VTA) and substantia nigra (SN). Bregma -6 mm.

252

5.4.3.1.3 EXPRESSION OF TYROSINE HYDROXYLASE MRNA IN FIXED PARAFFIN EMBEDDED RAT BRAIN SECTIONS

The pattern of TH mRNA expression detected using paraffin sections was very similar to the pattern seen in frozen midbrain sections (Figure 5.12A). TH mRNA was detected in the VTA and substantia nigra and no expression was detected when sections were hybridised with a DIG labelled TH sense probe (Figure 5.12B).

FIGURE 5.12 A) Expression of tyrosine hydroxylase (TH) mRNA in a coronal rat midbrain paraffin embedded section (3 µm thickness) hybridized with antisense digoxigenin TH riboprobe seen under 20x magnification. Expression is seen in the ventral tegmental area (VTA) and substantia nigra (SN). B) No expression of tyrosine hydroxylase mRNA is observed in sections hybridized with sense dixogigenin TH riboprobe seen under 20x magnification. This section is counterstained with haematoxylin to allow the brain section to be visualised. AQ, aqueduct. Bregma -6 mm.

253

5.4.3.1.4 EXPRESSION OF GAD65/67 MRNA IN FROZEN RAT BRAIN SECTIONS Using a DIG-labelled GAD65/67 antisense probe, GAD65/67 mRNA expression was abundant throughout the midbrain sections used, including the VTA (Figure 5.13). Signal for GAD65/67 mRNA was not detected when brains sections were hybridised with the corresponding DIG-labelled sense probe.

FIGURE 5.13 Expression of glutamic acid decarboxylase 65 and glutamic acid decarboxylase 67 (GAD65/67) mRNA in a coronal rat midbrain frozen section (12 µm thickness) hybridized with antisense digoxigenin GAD65/67 riboprobe seen under 20x magnification. Expression is widespread throughout the brain section. Abbreviations: AQ, aqueduct ; VTA, ventral tegmental area. Bregma -6 mm.

254

5.4.3.1.5 EXPRESSION OF GAD65/67 MRNA IN FIXED PARAFFIN EMBEDDED RAT BRAIN SECTIONS The pattern of GAD65/67 mRNA expression detected using paraffin sections was comparable to expression observed in frozen midbrain sections (Figure 5.14A). GAD65/67 mRNA was widespread throughout the brain and no expression was detected when sections were hybridised with a DIG labelled GAD65/67 sense probe (Figure 5.14B).

FIGURE 5.14 A) Expression of glutamic acid decarboxylase 65 and glutamic acid decarboxylase 67 (GAD65/67) mRNA in a coronal rat midbrain paraffin embedded section (3 µm thickness) hybridized with antisense digoxigenin GAD65/67 riboprobe seen under 50x magnification. Expression is widespread throughout the brain section. B) No expression of GAD65/67 mRNA is observed in sections hybridized with sense dixogigenin GAD65/67 riboprobe seen under 20x magnification. This section is counterstained with haematoxylin to allow the brain section to be visualised. Abbreviations: AQ, aqueduct; VTA, ventral tegmental area. Bregma -6 mm.

255

5.4.3.2 LOCALISATION OF MELANOCORTIN RECEPTORS IN THE RAT BRAIN

5.4.3.2.1 LOCALISATION OF MELANOCORTIN RECEPTOR 3 IMMUNOREACTIVITY IN THE RAT BRAIN Staining of coronal sections of the rat midbrain with an affinity purified anti-MC3R antibody revealed MC3R-IR in the VTA (Figure 5.15A). MC3R–IR was also observed in cortical regions (Figure 5.15B). The MC3R-IR was localised around the periphery of cell bodies and extending up the axon in a pattern in agreement with a previous study (Nyan et al, 2008).

FIGURE 5.15 Melanocortin 3 receptor (MC3R) immunoreactive (IR) neurons in coronal rat midbrain paraffin embedded sections (3 µm thickness) seen under 50x magnification. MC3R-IR (brown) is detected in the ventral tegmental area (A) and in the cortex (B). MC3R-IR is localised to the periphery of cell bodies and along axon processes. Sections are counterstained with haematoxylin (blue). Bregma -6 mm.

5.4.3.2.2 LOCALISATION OF MELANOCORTIN RECEPTOR 4 IMMUNOREACTIVITY IN THE RAT BRAIN Staining of coronal sections of the rat midbrain with an affinity purified anti-MC4R antibody was unable to detect specific MC4R-IR in any brain region examined at any dilution of primary and secondary antibody tested.

256

5.4.3.3 DUAL IN SITU HYBRIDISATION/IMMUNOCYTOCHEMISTRY FOR GAD65/67 OR TH MRNA AND MC3R-IR Dual-labelling ISH/ICC revealed co-expression of MC3R-IR with GAD65/67 mRNA expressing neurons in the VTA (Figure 5.16A, B and C) and in the cortex (Figure 5.16D and E).

There was no co-expression of MC3R-IR with TH mRNA expressing neurons in the VTA.

FIGURE 5.16 Melanocortin 3 receptor (MC3R) immunoreactive (IR) neurons and GAD65/67 mRNA expressing neurons in coronal rat midbrain paraffin embedded sections (3 µm thickness). A) MC3R-IR (brown) is found solely on GABAergic cells (blue) in the ventral tegmental area (VTA) as seen under 50x magnification. B) and C) Higher magnification (100x magnification) images of VTA neurons co-expressing GAD65/67 mRNA and MC3R-IR. D) Higher magnification (100x magnification) image of cortical neurons co-expressing GAD65/67 mRNA and MC3R-IR. E) Non-GABAergic MC3R-IR cortical neurons and GABAergic MC3R-IR cortical neurons seen under 100x magnification. Bregma -6 mm.

257

5.4.4 STUDIES INVESTIGATING THE MECHANISMS BY WHICH iVTA MELANOCORTINS MEDIATE THEIR EFFECTS ON FOOD INTAKE

5.4.4.1 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Administration of all doses of NDP-MSH (0.1, 0.3 or 1 nmol) iVTA significantly reduced food intake between 0-1h, 1-2h and 2-4h post-injection. (0-1h food intake/g: saline 2.3 ± 0.3, NDP-MSH (0.1 nmol) 0.4 ± 0.1 P<0.001, NDP-MSH (0.3 nmol) 0.4 ± 0.1 P<0.001, NDP-MSH (1 nmol) 0.2 ± 0.0 P<0.001. 1-2h food intake/g: saline 2.8 ± 0.3, NDP-MSH (0.1 nmol) 1.0 ± 0.3 P<0.001, NDP-MSH (0.3 nmol) 0.4 ± 0.1 P<0.001, NDP-MSH (1 nmol) 0.8 ± 0.3 P<0.001. 2-4h food intake/g: saline 4.6 ± 0.7, NDP-MSH (0.1 nmol) 0.9 ± 0.3 P<0.001, NDP-MSH (0.3 nmol) 0.8 ± 0.3 P<0.001, NDP-MSH (1 nmol) 2.0 ± 0.7 P<0.01, n = 6 per group) (Figure 5.17). No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

5.4.4.2 EFFECT OF iVTA ADMINISTRATION OF LOWER DOSES OF NDP-MSH ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Administration of NDP-MSH (0.03 and 0.1 nmol) iVTA significantly reduced food intake between 0- 1h and 2-4h post-injection. (0-1h food intake/g: saline 2.2 ± 0.2, NDP-MSH (0.03 nmol) 0.9 ± 0.4 P<0.05, NDP-MSH (0.1 nmol) 0.5 ± 0.2 P<0.01. 2-4h food intake/g: saline 4.0 ± 0.8, NDP-MSH (0.03 nmol) 1.5 ± 0.9 P<0.05, NDP-MSH (0.1 nmol) 1.3 ± 0.8 P<0.05, n = 6-7 per group). Administration of NDP-MSH (0.03 nmol) significantly reduced food intake between 4-8h and caused a significant reduction in cumulative 0-24h food intake (4-8h food intake/g: saline 8.2 ± 0.8, NDP- MSH (0.03 nmol) 3.4 ± 1.2 P<0.05. 0-24h food intake/g: saline 27.4 ± 0.8, NDP-MSH (0.03 nmol) 18.2 ± 2.7 P<0.05, n = 6-7 per group) (Figure 5.18). No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

258

FIGURE 5.17 The effect of intra-ventral tegmental area injection of saline, or [Nle4,D-Phe7]-α-melanocyte stimulating hormone (NDP-MSH) (0.1, 0.3 or 1 nmol), (n = 6-7 per group) on (A) 0-1h, (B) 1-2h, and (C) 2-4h food intake in ad-libitum fed male rats in the early dark phase. **, P<0.01 vs. saline; ***, P<0.001 vs. saline. Results are mean ± SEM.

259

FIGURE 5.18 The effect of intra-ventral tegmental area injection of saline, or [Nle4,D-Phe7]-α-melanocyte stimulating hormone (NDP-MSH) (0.01, 0.03 or 0.1 nmol), (n = 6-7 per group) on (A) 0-1h and (B) 2-4h on food intake in ad-libitum fed male rats in the early dark phase. *, P<0.05 vs. saline; **, P<0.01 vs. saline. Results are mean ± SEM.

260

5.4.4.3 EFFECT OF iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN FASTED MALE RATS DURING THE EARLY LIGHT PHASE Administration of NDP-MSH iVTA had no significant effect on 0-1h or 1-2h food intake compared to saline. All doses of NDP-MSH significantly reduced food intake between 2-4h post-injection. (2-4h food intake/g: saline 3.8 ± 1.1, NDP-MSH (0.03 nmol) 1.2 ± 0.5 P<0.05, NDP-MSH (0.1 nmol) 0.6 ± 0.5 P<0.05, NDP-MSH (1 nmol) 0.8 ± 0.4 P<0.05, n = 6-7 per group) (Figure 5.19). No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

FIGURE 5.19 The effect of intra-ventral tegmental area injection of saline, or [Nle4,D-Phe7]-α-melanocyte stimulating hormone (NDP-MSH) (0.03, 0.1 or 1 nmol) (n = 6-7 per group) on (A) 0-1h, (B) 1-2h and (C) 2-4h food intake in fasted male rats in the early light phase. *, P<0.05 vs. saline. Results are mean ± SEM.

261

5.4.4.4 EFFECT OF iVTA ADMINISTRATION OF LOW DOSES OF AGRP ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Intra VTA administration of low doses of AgRP had no significant effect on food intake at any dose or time point measured. There was a trend toward increased food intake between 1-2h, 2-4h and 4-8h post-injection compared to saline injected rats (1-2h food intake/g: saline 0.9 ± 0.5, AgRP (0.01 nmol) 1.8 ± 0.6, AgRP (0.03 nmol) 2.3 ± 0.3, AgRP (0.1 nmol) 1.6 ± 0.7. 2-4h food intake/g: saline 0.2 ± 0.1, AgRP (0.01 nmol) 0.5 ± 0.4, AgRP (0.03 nmol) 1.3 ± 0.7, AgRP (0.1 nmol) 0.6 ± 0.3. 4-8h food intake/g: saline 1.2 ± 0.4, AgRP (0.01 nmol) 0.7 ± 0.5, AgRP (0.03 nmol) 1.2 ± 0.4, AgRP (0.1 nmol) 1.8 ± 0.5, n = 5-6 per group) (Figure 5.20). No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

FIGURE 5.20 The effect of intra-ventral tegmental area injection of saline, or agouti-related peptide (AgRP) (0.01, 0.03 or 0.1 nmol), (n = 5-6 per group) on (A) 1-2h, (B) 2-4h and (C) 4-8h food intake in ad-libitum fed male rats in the early light phase. Results are mean ± SEM.

262

5.4.4.5 EFFECT OF iVTA ADMINISTRATION OF AGRP ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY LIGHT PHASE Administration of the top dose of AgRP (1 nmol) significantly stimulated food intake between 0-1h compared to saline. Administration of 0.3 nmol AgRP iVTA significantly stimulated food intake between 0-2h and 0-24h (0-1h food intake/g: saline 1.2 ± 0.4, AgRP (0.3 nmol) 1.9 ± 0.5, AgRP (1 nmol) 2.7 ± 0.3, P<0.05 vs. saline. 0-2h food intake/g: saline 2.8 ± 0.5, AgRP (0.3 nmol) 5.0 ± 0.9, P<0.05 vs. saline, AgRP (1 nmol) 4.7 ± 0.4. 0-24h food intake/g: saline 29.4 ± 0.7, AgRP (0.3 nmol) 33.6 ± 1.5, P<0.05 vs. saline, AgRP (1 nmol) 30.8 ± 1.1, n = 7-9 per group) (Figure 5.21A,B and C). Administration of 0.3 nmol AgRP iVTA also significantly increased body weight at 24h post- injection (BW change/g: saline 7.2 ± 1.8, AgRP (0.3 nmol) 18.1 ± 1.8, P<0.001 vs. saline, AgRP (1 nmol) 11.3 ± 1.2, n = 7-9 per group) (Figure 5.21D).

FIGURE 5.21 The effect of intra-ventral tegmental area injection of saline, or agouti-related peptide (AgRP) (0.3 or 1 nmol) (n = 7-9 per group) on (A) 0-1h, (B) 0-2h, (C) 0-24h food intake, and (D) 0-24h body weight change in ad-libitum fed male rats in the early light phase. *, P<0.05 vs. saline. ***, P<0.001 vs. saline. Results are mean ± SEM. 263

5.4.4.6 EFFECT OF iVTA ADMINISTRATION OF γ-MSH ON FOOD INTAKE IN AD- LIBITUM FED MALE RATS DURING THE EARLY DARK PHASE Administration of γ-MSH iVTA had no significant effect on 0-1h or 1-2h food intake compared to saline, although there was a trend towards a reduction in food intake 0-1 h post injection with all doses administered (Figure 5.22A). Gamma-MSH (0.03 nmol) significantly reduced cumulative food intake between 0-2h post-injection. (0-2h food intake/g: saline 5.5 ± 0.6, γ-MSH (0.03 nmol) 3.4 ± 0.6 P<0.05, n = 6-7 per group) (Figure 5.22B). No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection. There was no effect of iVTA γ-MSH administration on any observed behaviour compared to iVTA saline injected animals.

FIGURE 5.22 The effect of intra-ventral tegmental area injection of saline, or gamma-melanocyte stimulating hormone (gamma-MSH) (0.03, 0.1 or 1 nmol), (n = 6-7 per group) on (A) 0-1h and (B) 0-2h food intake in ad- libitum fed male rats during the early dark phase. *, P<0.05 vs. saline. Results are mean ± SEM.

264

5.4.4.7 EFFECT OF IP PRETREATMENT WITH THE GABA RECEPTOR ANTAGONIST BICUCULLINE-METHIODIDE BEFORE iVTA ADMINISTRATION OF NDP-MSH ON FOOD INTAKE IN AD-LIBITUM FED MALE RATS BEFORE THE EARLY DARK PHASE IntraVTA NDP-MSH significantly reduced food intake between 0-2h post-injection. Pretreatment with an IP injection of the GABAA receptor antagonist bicuculline (3 mg/kg) blocked this effect (0-2h food intake/g: saline/saline 4.2 ± 0.6, saline/NDP-MSH (0.03 nmol) 1.9 ± 0.6 P<0.05 vs. saline, bicuculline/NDP-MSH 3.3 ± 0.6 n = 6-7 per group) (Figure 5.23). No significant differences in food intake were detected at any other time points measured. No significant differences in body-weight change were detected between any groups at 24 hours post-injection.

FIGURE 5.23 The effect of intra-ventral tegmental area injection of saline (SAL), or [Nle4,D-Phe7]-α- melanocyte stimulating hormone (NDP) (0.03 nmol) 15 minutes after an intraperitoneal injection with either saline (SAL) or the γ-aminobutyric acid (GABA) receptor antagonist bicuculline (BIC) (3 mg/kg) (n = 6-7 per group) on food intake in ad-libitum fed male rats in the early dark phase. *, P<0.05 vs. saline/saline. Results are mean ± SEM

265

5.5 DISCUSSION

Factors known to regulate energy homeostasis at the level of the hypothalamus may also modulate the mesolimbic DA reward pathway. Direct administration of some, but not all, appetite related peptides into the VTA of rats significantly influences food intake, suggesting that reward circuits may contribute to the effects of neuropeptides and hormones on feeding. The melanocortin system is likely involved in the regulation of VTA output: the MC3R is found on GABAergic neurons in the VTA and administration of melanocortin receptor agonists and antagonists into the VTA profoundly affects feeding in rats.

Recent studies have recognised that peripheral factors involved in appetite regulation, such as leptin and ghrelin, directly modulate the activity of VTA neurons, altering downstream DA release in the NAc and influencing feeding (Abizaid et al, 2006;Hommel et al, 2006). There is convincing evidence implicating insulin in food reward via modulation of the mesolimbic DA pathway too. Central administration of insulin suppresses several different DA dependent aspects of reward or motivation, such as acute sucrose licking (Sipols et al, 2000), conditioning of a place preference relating to food (Figlewicz et al, 2004), and sucrose self-administration (Figlewicz et al, 2006) in rats fed ad libitum chow. Functional insulin receptors are expressed on TH-containing neurons in the rat VTA (Figlewicz et al, 2003;Figlewicz et al, 2007), suggesting that insulin may modulate DA activity at the level of the VTA. However, my data suggests that iVTA administration of insulin has no significant effect on food intake in ad-libitum fed rats in either the early light phase or at the onset of the dark phase. It has previously been reported that iVTA insulin administration has no effect on basal sucrose intake (Figlewicz et al, 2007). Feeding can be stimulated by iVTA administration of the µ-opioid agonist DAMGO, and this feeding is DA-dependent (MacDonald et al, 2004). IntraVTA administration of insulin has been shown to block this iVTA DAMGO induced feeding (Figlewicz et al, 2008). It is possible that the effect of insulin on food reward may only be relevant when there is adequate stimulation or drive within the VTA.

The lateral hypothalamus has long been recognised as an important region in both food intake and reward processing. My studies suggest that iVTA administration of orexin (1 nmol) has no significant effect on food intake in rats. This is in agreement with a previous study which also reports no effect of iVTA orexin (500 pmol) administration on food intake in rats (Sweet et al, 1999). This study used different co-ordinates for their VTA injections, targeting the rostral VTA, while my cannulations targeted the parabrachial pigmented nucleus of the VTA. Both areas are rich in DA neurons but VTA DA neurons exhibit considerable heterogeneity regarding projection targets and pharmacological

266

properties (Bolaos et al, 2003;Ikemoto, 2007). It is interesting that despite anatomical evidence to suggest a role for orexin in VTA mediated food reward (Fadel & Deutch, 2002;Korotkova et al, 2003;Marcus et al, 2001;Narita et al, 2006;Uramura et al, 2001), there is no detectable effect of iVTA orexin administration on food intake. Intra-VTA infusion of orexin A increases the time that rats spend awake and grooming, and these behaviours may mask any specific effects of orexin on food intake (Vittoz & Berridge, 2006).

There is evidence to suggest that orexin is activated by reward-associated stimuli such as morphine and cocaine administration, and that orexin drives reward-seeking behaviour (such as reinstatement of an extinguished place preference) when activated by these stimuli (Harris et al, 2005). However, not all reward cues activate LHA orexin neurons (Harris et al, 2005). It is likely that orexin modulates the rewarding response to specific stimuli such as morphine, cocaine and fasting, but has no effect on reward seeking behaviour in the absence of an appropriate stimulus. In both my study and the study carried out by Sweet et al, the rats were ad-libitum fed. It would be interesting to investigate whether iVTA administration of an orexin receptor antagonist suppresses re-feeding in fasted rats.

My data also suggest that iVTA administration of MCH has no significant effect on food intake in rats. This is in keeping with a lack of effect of MCH on the firing rate of VTA neurons (Korotkova et al, 2003), and the very low level of MCH1R expression in the VTA (Hervieu et al, 2000;Pissios et al, 2008). It is likely that the documented effects of the MCH system on reward behaviour (Pissios et al, 2008;Smith et al, 2005;Chung et al, 2009) are mediated by a direct action at the level of the NAc or other regions of the mesolimbic system.

Neuropeptides of the ARC have a well-characterised role in the regulation of energy homeostasis. These neuropeptides have projections to many extra-hypothalamic brain regions, but studies investigating their roles in appetite regulation have tended to focus on hypothalamic circuitry. CART is perhaps the best candidate ARC neuropeptide to regulate VTA neurons and modulate food intake via the reward pathway. There is substantial evidence that CART is involved in reward and reinforcement systems (Rogge et al, 2008;Kimmel et al, 2000b). However, there has been little work carried out investigating the involvement of CART in these systems in relation to the control of food intake.

Intra-VTA administration of 0.6 nmol CART (55-102) in satiated animals significantly reduced food intake between 8 and 24 hours post-injection, resulting in significantly reduced food intake over 24 hours. In fasted animals, iVTA administration of 0.6 nmol CART (55-102) significantly reduced food

267

intake in the first hour post-injection, followed by a significant increase in food intake between 2 and 4 hours post-injection. In both fed and fasted studies, administration of this dose of CART (55-102) was associated with some behavioural abnormalities, mainly tremors, in a number of animals. Tremors and seizure like activity have been previously reported following intra-VTA administration of higher doses of CART (55-102) (Kimmel et al, 2000a). Significant increases in locomotor activity have also been reported following intra-VTA administration of CART (55-102) at doses similar to those shown to influence food intake in my studies (Kimmel et al, 2002). It is difficult to determine whether CART injection into the VTA specifically influences food intake, or whether the anorectic effects of CART are secondary to alterations in locomotor activity and tremors. If injection of CART antiserum into the VTA increased food intake, this would provide evidence that the VTA CART system has a physiological role in the regulation of food intake.

My studies suggest that iVTA administration of NPY significantly stimulates food intake in ad- libitum fed rats. Y1 and Y5 receptors, which mediate the orexigenic effects of NPY, are expressed in the VTA providing a possible mechanism mediating this effect (Parker & Herzog, 1999). The dose used in this study is relatively high for intranuclear injection; a dose of 100 pmol NPY is sufficient to stimulate food intake when administered into the PVN (Stanley & Leibowitz, 1985). It is possible that NPY may have diffused to, and mediated its orexigenic effect via, neighbouring brain regions rather than having a specific orexigenic effect in the VTA. Further studies using lower doses of NPY and Y receptor antagonists are required to establish whether NPY signalling in the VTA has a physiological role in food intake. It is possible that NPY mediates at least a part of its potent orexigenic effect via the dopaminergic reward pathway as iNAc NPY administration can produce a CPP to a previously neutral environmental cue and this effect can be blocked by a DA receptor antagonist (Josselyn & Beninger, 1993).

IntraVTA administration of NDP-MSH (1 nmol) to ad-libitum fed rats profoundly reduced 0-1h food intake to 10% of that of saline injected control rats, while iVTA administration of the melanocortin receptor antagonist AgRP significantly increased food intake and caused a large increase in body weight. These studies suggest the presence of endogenous melanocortin tone in the VTA, disruption of which affects food intake. Doses of NDP-MSH as low as 0.03 nmol significantly reduced food intake following iVTA administration in ad-libitum fed rats. It would be interesting to compare the sensitivity of the VTA to the anorectic effect of NDP-MSH with the sensitivity of the hypothalamus. However, a previous study investigating the effect of intranuclear NDP-MSH administration on food intake has only looked in fasted rats (Kim et al, 2000a). In this study, intranuclear NDP-MSH (0.1 nmol) administration into the PVN, DMN and mPOA of fasted rats significantly reduced food intake

268

to 50% of saline injected controls between 0-1h post-injection (Kim et al, 2000a). My studies show that in ad-libitum fed rats in the dark phase 0.03 nmol NDP-MSH suppressed 0-1h food intake to approximately 40% of that of saline injected animals, while the comparable dose of 0.1 nmol NDP- MSH reduced food intake to 20% of that of saline injected animals. These data suggest that perhaps the VTA is more sensitive than the hypothalamus to the effects of melanocortin administration. There was no reduction in 24 hour body weight following administration of even the highest dose of NDP-MSH into the VTA in these studies. This is in contrast to reports of a reduction in body weight following ICV injection of the melanocortin receptor agonist MTII (0.01 nmol) in rats (Thiele et al, 1998), and following ICV injection of NDP-MSH (10 nmol) in mice (Kim et al, 2005). It is possible that VTA melanocortin circuits exert only a short term suppression of food intake before hypothalamic circuits are activated and override manipulations of the reward pathway, stimulating rebound feeding and thus maintaining body weight.

My studies found that administration of NDP-MSH into the VTA of fasted rats had no significant effect on food intake for the first two hours post injection. There was a reduction in food intake between 2-4 hours post-injection but no effects at any other time point measured. This delay in the anorectic effect of melanocortin receptor agonists has not previously been reported. The time at which ICV α-MSH administration is suggested to mediate its effects on feeding is between 30 minutes and 6 hours post-injection (Semjonous et al, 2009). The reduction in food intake observed with iVTA NDP- MSH administration after an overnight fast was less significant than the iVTA NDP-MSH induced suppression of night-time feeding, although rats tend to eat more in the first few hours of re-feeding following a fast than in the first few hours of the dark phase. These data suggest that there are differential effects of melanocortin signalling in the VTA between fed and fasted states.

It is tempting to speculate that the importance of the reward circuitry differs under different physiological conditions. In the fasted state, the melanocortin tone in the VTA hedonic circuitry may be less responsive to administration of melanocortins because it is overridden by the homeostatic drive to eat. In freely feeding rats, it is possible that the hedonic VTA circuitry is more sensitive to the anorectic effect of melanocortin administration as the homeostatic feeding pathways are not activated. In support of this hypothesis, iVTA administration of ghrelin to fasted rats had no effect on food intake. The orexigenic effect of a peptide is often less pronounced in fasting induced re-feeding settings, but ICV ghrelin injection has been reported to have a more enhanced orexigenic effect in fasted rats than in ad-libitum fed rats (Bagnasco et al, 2003;Tung et al, 2005). This is proposed to be due to a lack of inhibition by leptin and insulin, levels of which are reduced in fasting (Tung et al, 2001).

269

IntraVTA administration of AgRP stimulates food intake in ad-libitum fed rats. However, the pattern of the orexigenic effect of AgRP is inconsistent in my studies. In the early feeding study, 1 nmol AgRP had no significant effect on food intake up to 4 hours post-injection, after which it dramatically increased food intake, lasting up to 24 hours and resulted in a large gain in body weight at 24 hours post-injection. In the later studies, iVTA AgRP injection (0.3 and 1 nmol) mediated its orexigenic effect between 0-4 hours post-injection, with no significant effect at later time points. The effect of AgRP on cumulative 24h food intake and 24h body weight was retained in this study, although only significantly at the lower (0.3 nmol) dose. The reason for these discordant results is not known. The AgRP used in these two studies was supplied by different manufacturers and differed by three amino acids in length. The AgRP used in the earlier study was 86-132, and the AgRP used in the later study was AgRP83-132. Both forms should similarly antagonise the MC3R and MC4R (Joseph et al, 2003;Kim et al, 2002), so it is possible, but unlikely that these differences in the peptide may account for these different timing of the orexigenic effect of iVTA AgRP. It is also possible that the effects seen in the second study reflect the greater susceptibility to spurious effects of experiments using lower n numbers, and that larger groups would result in similar outcomes.

The increase in body weight observed following iVTA AgRP administration is profound, with an increase of 15-18g across studies. This is not accountable solely by the increase in food intake over the same period and is more likely due to an increase in water intake or retention. Previous studies report an increase in body weight, independent of food intake of approximately 5-10g 24 hours following ICV administration of AgRP (Small et al, 2001;Small et al, 2003), and an even greater increase (20g) following administration of the long-acting AgRP analogue, SHU9119 (Grill et al, 1998). ICV administration of SHU9119 stimulates water intake in rats (Grill et al, 1998). However, the increase in body weight has also been attributed to reduced energy expenditure (Small et al, 2003). The exact mechanisms mediating the increased body weight following VTA melanocortin receptor blockade remain to be elucidated.

Alpha-MSH mediates its central biological effects via the MC3R and the MC4R. MC3R and MC4R are both expressed in the VTA (Mountjoy et al, 1994;Roselli-Rehfuss et al, 1993). The effect of iVTA administration of γ-MSH was carried out to attempt to elucidate which melanocortin receptor mediates the anorectic effect of iVTA NDP-MSH administration. Gamma-MSH is an endogenous agonist of the MC3R, with 50 fold higher affinity for the MC3R over the MC4R (Oosterom et al, 1999). IntraVTA γ-MSH administration caused a less potent suppression of food intake compared to iVTA administration of NDP-MSH. While all doses reduced food intake, only the lowest dose (0.03 nmol) resulted in a statistically significant reduction in food intake between 0-2h post-injection. This

270

study suggests that activation of the MC3R in the VTA can have anorectic effects. It is important to note that the synthetic melanocortin receptor antagonist NDP-MSH is structurally engineered to bind the melanocortin receptors with higher affinity and may be cleared less readily than endogenous melanocortin peptides, including γ-MSH (Sawyer et al, 1980). It is possible that following a higher dose of γ-MSH administered into the VTA, a more significant anorectic effect would be observed.

Additionally, the γ-MSH used in this study was γ2-MSH,, a non-amidated form of γ-MSH with weaker affinity for the MC3R compared to amidated γ1-MSH (Oosterom et al, 1999). IntraVTA administration of a specific MC4R agonist would help to clarify whether the VTA mediated anorectic effect of the melanocortins is via this receptor.

Interestingly, it has previously been reported that ICV administration of γ1-MSH or γ2-MSH has no effect on fasting-induced re-feeding in rats (Abbott et al, 2000;Kask et al, 2000), although other studies observe a small reduction in food intake following ICV γ2-MSH administration to fasted rats (Millington et al, 2001).

IntraVTA administration of the melanocortins αMSH and γ-MSH has previously been associated with an increase in grooming behaviour, an effect mediated by alterations in VTA DA neuronal activity (Klusa et al, 1999;Torre & Celis, 1988). There was no effect of iVTA γ-MSH administration on grooming, or any other observed behaviour in my studies. The reason for this discrepancy may be that the dose of γ-MSH used in the previous study was much higher (3 nmol) than the dose used in my study (1 nmol). It is possible that the anorectic effect of iVTA MSH administration is secondary to alterations in other behaviours. However, no significant behavioural effects were observed following iVTA administration of γ-MSH in these studies, and iVTA administration of the melanocortin receptor antagonist AgRP stimulates food intake, suggesting a physiological role for the VTA melanocortin system in the regulation of food intake.

Expression of MC3R mRNA is more abundant in the VTA than in most other brain regions, including some hypothalamic nuclei (ARC and LHA) (Roselli-Rehfuss et al, 1993). The phenotype of the neurons on which the MC3R is expressed has not previously been reported. My studies suggest that the MC3R co-localises with GAD65/67 in the VTA but is not expressed by any VTA TH-containing neurons. All MC3R-IR neurons in the VTA were GABAergic. These neurons were located primarily in the lateral part of the PBP nucleus, with little MC3R-IR observed in other VTA nuclei.

Unfortunately I was unable to detect MC4R in any brain region using ICC. Receptor ICC can be difficult as receptor levels are often much lower than the levels of neuropeptides. Further studies

271

examining the co-localisation of MC4R mRNA, which has been previously detected in the VTA, with TH and GAD expressing neurons, are essential to further characterise the VTA melanocortin system. The downstream mediators of melanocortin receptor signalling in the VTA are currently unknown. The VTA contains large populations of dopaminergic and GABAergic neurons and a much smaller population of glutamatergic neurons. The majority of the GABAergic neurons in the VTA are interneurons which synapse onto local dopamine neurons, modulating their function (Steffensen et al, 1998). There are also populations of GABAergic neurons which project to the nucleus accumbens and the cortex (Steffensen et al, 1998). Pre-administration with a GABA receptor antagonist partially blocked the anorectic effect of iVTA NDPMSH, suggesting that GABA signalling is an important mediator of the effects of NDP-MSH on food intake. It is possible that melanocortin receptor signalling in the VTA activates GABAergic neurons which act locally to suppress the firing of VTA DA neurons, resulting in a reduction in NAc DA release. Alternatively GABAergic neurons expressing melanocortin receptors may project to the NAc and inhibit DA release from VTA nerve terminals. Pre-administration of bicuculline directly into the VTA or the NAc, before iVTA NDP- MSH would provide more precise information of the downstream pathways mediating the anorectic effect of iVTA melanocortin administration. In addition, it would be useful to determine where MC3R-IR GABAergic VTA neurons project to.

It would be interesting to pre-administer a DA receptor antagonist prior to iVTA AgRP injection. If a DA receptor antagonist were to block the orexigenic effect of iVTA AgRP, this would provide convincing evidence that the endogenous melanocortin tone in the VTA directly interacts with the mesolimbic DA circuitry. Furthermore, activation of c-fos in downstream targets of the reward pathway, including the NAc and the prefrontal cortex, following AgRP injection into the VTA would strongly suggest enrolment of the reward circuitry in the mediation of AgRP’s orexigenic effect.

272

CHAPTER 6

GENERAL DISCUSSION

273

6.1 INTRODUCTION

Neuropeptides play an important role in the regulation of food intake and reproduction. Food intake is regulated by homeostatic systems designed to maintain a constant body weight, and also by the brain’s reward circuitry. The regulation of energy homeostasis is closely linked to the HPG axis to ensure that sufficient energy reserves are available for reproduction. The studies described in this thesis have investigated the effects of the novel hypothalamic neuropeptide alarin on food intake and the HPG axis, and the role of the melanocortin system in the mesolimbic reward system.

6.2 THE ROLE OF ALARIN IN THE REGULATION OF ENERGY HOMEOSTASIS AND REPRODUCTION Alarin is a recently discovered splice variant of the galanin-like peptide (GALP) gene (Santic et al, 2006). GALP has a well-characterised hypothalamic role in the integration of energy and reproductive homeostasis (Matsumoto et al, 2001;Matsumoto et al, 2002). Alarin is a highly conserved 25 amino acid peptide which shares its first 5 amino acids with GALP, but lacks the galanin receptor binding domain, suggesting that it mediates its biological effects through alternative receptors. Alarin mRNA has been detected in the brain and within specific nuclei of the hypothalamus (Eberhard et al, 2007;Santic et al, 2007).

My studies suggest that alarin is an orexigenic neuropeptide, in agreement with a recent paper published after the completion of my studies (Van Der Kolk et al, 2010a). ICV administration of alarin to rats stimulated food intake acutely. Alarin stimulated the release of the orexigenic NPY from hypothalamic explants, suggesting that the orexigenic effect of alarin may be mediated by increased hypothalamic NPY release. However, hypothalamic alarin levels do not appear to be altered between fed and fasted states, suggesting that alarin may not be an endogenous regulator of energy homeostasis. As the receptor through which alarin mediates its orexigenic effect is currently unknown, it is not possible to investigate whether the expression of this putative receptor is altered by changes in nutritional status.

The orexigenic effect of alarin appears to be relatively weak compared to well characterised hypothalamic orexigenic neuropeptides such as NPY and GALP (Levine & Morley, 1984;Matsumoto et al, 2002). Alarin did not stimulate food intake following ICV administration to rats in fasted or early dark phase experimental paradigms, and a relatively high dose (30 nmol) of alarin was required to significantly increase food intake in satiated rats. It has been reported that administration of doses as low as 1 nmol of c-terminally amidated alarin into the LV were sufficient to elicit an orexigenic

274

response in rats (Van Der Kolk et al, 2010a). It is important to determine whether the endogenous form of alarin is amidated, and thus whether this endogenous alarin has more potent effects in vivo than my studies have revealed. However, there is no reason that endogenous alarin would be amidated as the C-terminal residue of alarin is a serine. Endogenous amidation is catalysed by the enzyme

PAM, which converts peptides with the structure -X-Gly to the form -X-NH2 (Eipper & Mains, 1988;Bradbury et al, 1982). It is possible that the orexigenic effect of alarin is a pharmacological effect only stimulated by exogenous alarin administration. However, alarin-IR has been detected in hypothalamic nuclei known to be involved in the regulation of energy homeostasis (Eberhard et al, 2007), and central alarin administration to rats induces fos activity in hypothalamic nuclei implicated in the control of food intake, including the PVN, DMN and LHA (Van Der Kolk et al, 2010a).

My in vivo studies have shown that ICV alarin stimulates plasma LH levels in intact male rats in vivo. My in vitro studies demonstrate that alarin stimulates gonadotrophin releasing hormone (GnRH) release from hypothalamic explants from male rats and from an immortalised GnRH releasing cell line. Pre-treatment with a GnRH antagonist, cetrorelix, blocked the increase in plasma LH levels following central administration of alarin in vivo, providing further evidence that ICV alarin activates the HPG axis via GnRH.

Though the role of GnRH is well-characterised, the endogenous neuropeptides operating upstream of GnRH to regulate the HPG axis are less well characterised. Numerous peptides are known to influence hypothalamic GnRH release, including several also involved in energy homeostasis such as NPY and GALP (Kalra & Kalra, 1996;Matsumoto et al, 2001). The focus of much current research is to tease out the precise physiological functions of the neuronal circuits upstream of the GnRH neuron. The sheer number of neurotransmitters known to regulate GnRH release suggests that there is redundancy built into the system, which makes sense from an evolutionary perspective, but can make it more difficult to demonstrate the physiological role of a single signal. However, with the genetic and pharmacological tools currently available, biology is beginning to establish the anatomical circuits and the hierarchy of signals responsible for regulating reproduction under different physiological conditions. The activity of the reproductive axis is sensitive to the adequacy of nutrition and the stores of metabolic reserves. Circulating levels of adipocyte-derived hormone leptin are thought to reflect the state of nutrition and energy reserves, and thus to serve as a metabolic signal to the reproductive system (Barash et al, 1996). However, the leptin receptor has not been identified on GnRH neurons in vivo (Hakansson et al, 1998), and the intermediaries in the signal transduction pathway between leptin and GnRH are yet to be conclusively established. There is evidence that the potent GnRH-releasing neuropeptide kisspeptin may play a role in mediating this link between energy

275

homeostasis and reproduction (Fernandez-Fernandez et al, 2006). In addition, galanin family peptides may be involved. Hypothalamic GALP peptide and mRNA expression are up-regulated by leptin (Jureus et al, 2001), and GALP antiserum blocks leptin-induced GnRH release from hypothalamic explants (Seth et al, 2004), supporting the hypothesis that GALP may mediate the actions of leptin on the HPG axis. Alarin may also play a role in integrating metabolic state with HPG axis function, although further studies are required to confirm this hypothesis.

Alarin lacks the galanin receptor binding domain which is thought to be responsible for the binding of galanin and GALP to the three known galanin receptors (Bloomquist et al, 1998;Land et al, 1991;Lang et al, 2005;Smith et al, 1998). My results confirm that alarin is unable to bind to the GalR1 or GalR2 in agreement with a previous study (Santic et al, 2007), and demonstrate for the first time that alarin is also unable to bind to the GalR3. My data also suggests that alarin does not bind to any receptor at which galanin is also able to bind, and that this receptor is expressed by GT1-7 cells, supporting previous evidence that there are as yet uncharacterised galanin peptide family receptors (Fraley et al, 2003;Fraley et al, 2004b;Lawrence et al, 2002;Lawrence et al, 2003;Seth et al, 2004). GALP is thought to mediate some of its biological effects via a receptor or receptors distinct from the three known galanin receptors (Krasnow et al, 2004;Lawrence et al, 2003;Matsumoto et al, 2001;Seth et al, 2004). It is possible that alarin may act as a ligand for the same unidentified receptor or receptors. Alarin and GALP have similar biological effects in vivo and in vitro, and alarin (6-25), which lacks the five amino acids which it has in common with GALP, is unable to elicit a biological effect in vitro.

There is interest in the development of GALP as a therapy in the treatment of obesity or reproductive disorders (Nonaka et al, 2008;Gundlach, 2002). However, due to the promiscuity of GALP binding to all of the galanin receptors, concerns regarding side-effects have hampered progress in its development. Although the in vivo potency of alarin appears to be relatively low compared to GALP, if alarin is a specific ligand for a particular novel receptor, it may provide a tool to investigate and manipulate the specific neural pathways mediating the different actions of the galanin peptide family. Further work is thus required to identify and characterise the receptor or receptors through which alarin mediates its biological effects, and to establish the potential of alarin as a pharmacological and/or medicinal tool.

The studies described in this thesis demonstrate the pharmacological effects of alarin in vitro and in vivo. There is still much to be determined regarding the physiology of galanin peptide family. There has been a sustained interest in this family of peptides for the past thirty years, but as yet no drugs

276

targeting this system have been developed. My research has focussed on the central role of alarin in the regulation of energy homeostasis and reproduction. I have demonstrated that alarin has orexigenic effects and regulates the HPG axis via hypothalamic GnRH. However there are other important areas in which alarin may have effects. In particular, roles for alarin in the skin and in tumourigenesis have been suggested but not fully investigated (Santic et al, 2006). The most important discovery regarding alarin, however, will likely be the identification of an alarin receptor. This will allow a better understanding of the alarin system and potentially allow us to elucidate the receptors mediating specific GALP effects. It may even provide a therapeutic target.

6.3 THE ROLE OF THE VTA MELANOCORTIN SYSTEM IN THE REGULATION OF FEEDING The VTA is the origin of DA neurons which project to the NAc and mediate the rewarding properties of palatable food. Recent work suggests that this reward pathway is regulated by appetite regulating signals such as leptin and ghrelin (Abizaid et al, 2006;Hommel et al, 2006). My data suggest that some, but not all, factors with known roles in energy homeostasis are able to affect food intake following iVTA administration.

Despite evidence of anatomical interactions between insulin signalling and the VTA DA circuitry (Figlewicz et al, 2003;Pardini et al, 2006), and reports of regulation of DA-related behaviours by insulin (Figlewicz et al, 2004;Figlewicz et al, 2008;Figlewicz et al, 2006), there was no significant effect of iVTA insulin on food intake. The orexigenic LHA peptides, orexin A and MCH, were also unable to affect food intake following iVTA administration. These studies were carried out in the absence of any reward related stimulus. It is possible that these factors play a role in modifying VTA neuronal activity when the reward pathway is already activated by an appropriate stimulus. Alternatively, these factors may affect the mesolimbic VTA DA pathway without influencing food intake.

All ARC neuropeptides tested altered food intake when administered iVTA. The anorectic effect of iVTA CART may be due to increases in locomotor activity and tremors observed post-injection rather than a direct effect on food intake. IntraVTA administration of NPY at a relatively high dose stimulated food intake and it is likely that NPY mediates its orexigenic effect, at least in part, by increasing the rewarding value of food (Jewett et al, 1995). Further studies are required to investigate physiological importance of the VTA NPY system, and the downstream signalling mediating the orexigenic effect of iVTA NPY.

277

The data in this thesis suggest that the melanocortin system may be involved in the hedonic regulation of appetite in addition to its well characterised role in homeostatic regulation of appetite. Administration of NDP-MSH into the VTA reduced food intake, and iVTA administration of the melanocortin receptor antagonist AgRP increased food intake, suggesting the presence of an endogenous VTA melanocortin tone. IntraVTA administration of NDP-MSH at doses as low as 0.03 nmol significantly reduced food intake, suggesting that the VTA may be more sensitive to the anorectic effects of melanocortins than the hypothalamus. However the sensitivity of the VTA to melanocortins appears to vary with altered nutritional status; iVTA administration of NDP-MSH to fasted animals resulted in a delayed and less significant reduction in food intake than that following iVTA injection in ad-libitum fed rats. These data support the hypothesis that in the fasted state, the melanocortin tone in the VTA hedonic circuitry may be less responsive to administration of melanocortins due to an overriding homeostatic drive to eat, while in ad-libitum fed rats, the hedonic VTA circuitry is more sensitive to the anorectic effect of melanocortin administration as homeostatic feeding pathways are not activated.

The downstream pathways mediating the anorectic effect of iVTA melanocortin administration may involve the MC3R. This receptor co-localises exclusively with GABAergic neurons in the VTA and administration of a GABA receptor antagonist attenuates the anorectic effect of iVTA NDP-MSH. It is not yet known whether the GABAergic neurons expressing MC3R-IR are local interneurons modulating VTA DA neuron activity, or whether these GABAergic neurons project to other brain regions such as the NAc. Administration of a DA receptor antagonist prior to iVTA AgRP injection would be a useful study to determine whether the melanocortins influence mesolimbic DA release to mediate their effects on feeding. The MC4R may also play a role in mediating the anorectic effects of iVTA NDP-MSH. Further studies which successfully localise the MC4R in the VTA and identify the phenotype of these neurons are essential to characterise the VTA melanocortin system.

The studies in this thesis have identified an endogenous melanocortin tone in the VTA and characterised, in part, the mechanisms by which VTA melanocortins mediate their effects on food intake. The importance of hedonistic control of eating from an evolutionary perspective is clear. In a society like ours, with plentiful food, hedonistic drives to eat may play a more important role in over- consumption than homeostatic drives. There is a large body of evidence focussing on the mechanisms underlying homeostatic appetite regulation, yet there is currently little information available regarding how reward pathways interact with appetite. Recent studies have used functional neuroimaging such as fMRI to provide insights into food-reward regulation by allowing the simultaneous assessment of brain activity concurrent with external stimuli, appetitive ratings, physiological and metabolic changes

278

and eating itself. These studies can evaluate the brain specific effects of appetite regulating factors and illustrate changes in the reward system in obese humans compared to normal weight controls (Neary & Batterham, 2010).

Neural responses to food images have been assessed using fMRI in human subjects before and after weight loss, with and without leptin replacement (Rosenbaum et al, 2008), and in leptin deficient subjects before and after leptin replacement (Farooqi et al, 2007). Following weight loss, brain activity was altered in areas implicated in reward processing such as the NAc, the amygdala and the frontal cortex. Many of these changes in activity were reversed by leptin replacement. These results may provide an explanation as to why maintaining weight loss is difficult; decreased leptin levels result in enhanced activation of reward circuits, driving behaviour towards consumption of highly palatable foods.

Administration of the anorectic gut hormone PYY3-36 to fasted human volunteers has been reported to modulate brain activity in both homeostatic (hypothalamic and brainstem) and non-homeostatic regions including the amygdala, orbitofrontal cortex (OFC), VTA and the ventral striatum (Batterham et al, 2007). This study also observed that following saline infusion, when endogenous PYY3-36 levels are low, activity in the hypothalamus predicted subsequent caloric intake, whereas in the presence of high PYY3-36 levels, activity in the OFC predicted subsequent caloric intake. There was also a negative correlation between OFC activation and meal pleasantness ratings. These findings suggest that PYY enhances discrimination of rewarding foods and reduces reward-motivated drives to eat in the fed state.

Ghrelin infusion to satiated humans alters neural response to images of food in regions such as the amygdala, VTA, and OFC (Malik et al, 2008a). The effects of ghrelin on the amygdala and OFC response were correlated with self-rated hunger ratings, demonstrating that metabolic signals such as ghrelin may increase food consumption by enhancing the hedonic and incentive responses to food- related cues.

It is important to note that much of the in vivo data obtained is open to ambiguous interpretation. A reduction in the responsiveness of reward circuits can be used as evidence that obese individuals will need to eat more to obtain reward, and an over-responsive reward pathway can be used to support the case that obese individuals obtain increased reward from eating and therefore eat more. However, it seems unlikely that both paradigms are correct. More precise mechanistic data is required to delineate

279

the precise circuits underlying the reward system before it can be effectively targeted as a therapy for obesity.

The cannabinoid receptor inverse agonist Rimonabant has previously been used as a therapy for obesity. Rimonabant is thought to act at least in part by targeting the reward system. Despite reducing body weight in obese patients, Rimonabant has been withdrawn due to its side effects of severe depression and suicidal thoughts. As CB1 receptors are found throughout the CNS, it is not currently understood where exactly Rimonabant is acting to cause these side-effects. However, it certainly seems possible that it may be the effects of this drug on the reward system that drive them. This highlights that while targeting the reward system can be effective in the treatment of obesity, it may also result in unwanted side-effects. It is possible that with a better understanding of the neural circuitry regulating food reward, we will be able to manipulate very specific components of the reward system, and that this may prove an effective therapy for the treatment of obesity.

In support of my hypothesis, I have provided evidence that the alarin system regulates appetite and reproductive function. Alarin has been shown to fulfil some of the criteria expected of a neurotransmitter. It is found in synapses in dense core vesicles (Santic et al, 2006). Electrophysiological studies are required to determine whether alarin is released from nerve terminals in response to calcium dependent presynaptic depolarisation. Alarin likely operates through a specific receptor system, most likely a GPCR- based system, like other galanin family peptides. However, no receptor for alarin has yet been identified. My studies suggest that GT1-7 cells express an alarin receptor. If the receptor could be isolated from this cell line, it would provide further evidence that alarin operates as a neurotransmitter. My studies have mainly concerned the functions of alarin in the hypothalamus and pituitary gland, particularly with regards to the regulation of appetite and the hypothalamo-pituitary axes. I have demonstrated that ICV administration of alarin stimulates food intake and the HPG axis.

VTA administration of specific appetite regulating factors influenced food intake, supporting my hypothesis, though not all factors investigated had an effect on feeding. My data suggests that the ARC neuropeptides, and in particular the melanocortin system, modulate the mesolimbic dopaminergic reward pathway to regulate food intake. My studies have widened the known roles of the melanocortins from the relatively well-characterised homeostatic regulation of feeding to encompass a novel role in the modulation of food-related reward.

280

References

Abbott,C.R., Monteiro,M., Small,C.J., Sajedi,A., Smith,K.L., Parkinson,J.R.C., Ghatei,M., & Bloom,S. (2005a) The inhibitory effects of peripheral administration of peptide YY(3-36) and glucagon- like peptide-1 on food intake are attenuated by ablation of the vagal-brainstem- hypothalamic pathway. Brain Research, 1044, 127-131.

Abbott,C.R., Rossi,M., Kim,M.S., AlAhmed,S.H., Taylor,G.M., Ghatei,M.A., Smith,D.M., & Bloom,S.R. (2000) Investigation of the melanocyte stimulating hormones on food intake: Lack of evidence to support a role for the melanocortin-3-receptor. Brain Research, 869, 203-210.

Abbott,C.R., Rossi,M., Wren,A.M., Murphy,K.G., Kennedy,A.R., Stanley,S.A., Zollner,A.N., Morgan,D.G., Morgan,I., Ghatei,M., Small,C.J., & Bloom,S.R. (2001) Evidence of an orexigenic role for cocaine- and amphetamine-regulated transcript after administration into discrete hypothalamic nuclei. Endocrinology, 142, 3457-3463.

Abbott,C.R., Small,C.J., Kennedy,A.R., Neary,N.M., Sajedi,A., Ghatei,M., & Bloom,S. (2005b) Blockade of the neuropeptide Y Y2 receptor with the specific antagonist BIIE0246 attenuates the effect of endogenous and exogenous peptide YY(3-36) on food intake. Brain Research, 1043, 139-144.

Abizaid,A., Liu,Z.W., Andrews,Z.B., Shanabrough,M., Borok,E., Elsworth,J.D., Roth,R.H., Sleeman,M.W., Picciotto,M.R., Tschop,M.H., Gao,X.B., & Horvath,T.L. (2006) Ghrelin modulates the activity and synaptic input organization of midbrain dopamine neurons while promoting appetite. J.Clin.Invest, 116, 3229-3239.

Adams,A.C., Clapham,J.C., Wynick,D., & Speakman,J.R. (2008) Feeding behaviour in galanin knockout mice supports a role of galanin in fat intake and preference. Journal of neuroendocrinology, 20, 199-206.

Adan,R.A., Cone,R.D., Purbach,J.P., & Gispen,W.H. (1994) Differential effects of melanocortin peptides on neural melanocortin receptors. Molecular pharmacology, 46, 1182.

Adan,R.A., Szklarczyk,A.W., Oosterom,J., Brakkee,J.H., Nijenhuis,W.A.J., Schaaper,W.M.M., Meloen,R.H., & Gispen,W.H. (1999) Characterization of melanocortin receptor ligands on cloned brain melanocortin receptors and on grooming behavior in the rat. European Journal of Pharmacology, 378, 249-258.

Addison,T. On the constitutional and local effects of diseases of the supra-renal capsules. 1855. Ref Type: Generic

Adrian,T.E., Besterman,H.S., Cooke,T.J., Bloom,S.R., Barnes,A.J., & Russell,R.C. (1977) Mechanism of pancreatic polypeptide release in man. The Lancet, 1, 161-163.

Adrian,T.E., Ferri,G.L., Bacarese-Hamilton,A.J., Fuessi,H.S., Polak,J.M., & Bloom,S.R. (1985) Human distribution and release of a putative new gut hormone, peptide YY. Gastroenterology, 89, 1070.

281

Adrian,T.E., Greenberg,G.R., FitzPatrick,M.L., & Bloom,S.R. (1981) Lack of effect of pancreatic polypeptide in the rate of gastric emptying and gut hormone release during breakfast. Digestion, 21, 214-218.

Aguila,M.C., Marubayashi,U., & McCann,S.M. (1992) The effect of galanin on growth hormone- releasing factor and somatostatin release from median eminence fragments in vitro. Neuroendocrinology, 56, 889.

Aguilera,G., Wynn,P.C., Harwood,J.P., Hauger,R.L., Millan,M.A., Grewe,C., & Catt,K.J. (1986) Receptor-mediated actions of corticotropin-releasing factor in pituitary gland and nervous system. Neuroendocrinology, 43, 79-88.

Ahlman,H. & Nilsson,O. (2001) The gut as the largest endocrine organ in the body. Annals of Oncology, 12 Suppl 2, S63-S68.

Ahren,B., Pacini,G., Wynick,D., Wierup,N., & Sundler,F. (2004) Loss-of-function mutation of the galanin gene is associated with perturbed islet function in mice. Endocrinology, 145, 3190- 3196.

Air,E., Benoit,S., & Blake-Smith,K. (2002) Acute third ventricular administration of insulin decreases food intake in two paradigms. Pharmacology, biochemistry and behavior, 72, 423-429.

Airaksinen,M.S., Alanen,S., Szabat,E., Visser,T.J., & Panula,P. (1992) Multiple Neurotransmitters in the Tuberomammillary Nucleus - Comparison of Rat, Mouse, and Guinea-Pig. Journal of comparative neurology, 323, 103-116.

Ajika,K. & Hokfelt,T. (1973) Ultrastructural identification of catecholamine neurones in the hypothalamic periventricular-arcuate nucleus-median eminence complex with special reference to quantitative aspects. Brain Research, 57, 97-117.

Akabayashi,A., Koenig,J.I., Watanabe,Y., Alexander,J.T., & Leibowitz,S.F. (1994) Galanin-containing neurons in the paraventricular nucleus: a neurochemical marker for fat ingestion and body weight gain. Proceedings of the National Academy of Sciences of the United States of America, 91, 10375-10379.

Alarid,E.T., Windle,J.J., Whyte,D.B., & Mellon,P.L. (1996) Immortalization of pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice. Development, 122, 3319- 3329.

Albertson,D., Pruetz,B., Schmidt,C., Kuhn,D., Kapatos,G., & Bannon,M. (2004) Gene expression profile of the nucleus accumbens of human cocaine abusers: evidence for dysregulation of myelin. Journal of neurochemistry, 88, 1211-1219.

Albiston,A.L., Obeyesekere,V.R., Smith,R.E., & Krozowski,Z.S. (1994) Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Molecular and Cellular Endocrinology, 105, R11-R17.

Allen,J.M., Yeats,J.C., Adrian,T.E., & Bloom,S.R. (1984) Radioimmunoassay of neuropeptide Y. Regul.Pept., 8, 61-70.

282

Almiron,I. & Chemes,H. (1988) Spermatogenic onset. II. FSH modulates mitotic activity of germ and Sertoli cells in immature rats. Int.J Androl, 11, 235-246.

Alonso,J.R., Sanchez,F., Arevalo,R., Carretero,J., Vazquez,R., & Aijon,J. (1992) Partial coexistence of NADPH-diaphorase and somatostatin in the rat hypothalamic paraventricular nucleus. Neuroscience Letters, 148, 101.

Amara,S.G., Jonas,V., Rosenfeld,M.G., Ong,E.S., & Evans,R.M. (1982) Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products. Nature, 298, 240-244.

Amoss,M., Burgus,R., Blackwell,R., Vale,W., Fellows,R., & Guillemin,R. (1971) Purification, amino acid composition and N-terminus of the hypothalamic luteinizing hormone releasing factor (LRF) of ovine origin. Biochem.Biophys.Res.Commun., 44, 205-210.

Anand,B.K. & Brobeck J.R. (1951) Localization of a "feeding center" in the hypothalamus of the rat. Proc.Soc.Exp Biol.Med, 77, 323-324.

Andell-Jonsson,S., Xu,I.S., Bartfai,T., Xu,X.J., & Weisenfield-Hallin,Z. (1997) The effect of naturally occurring fragments of galanin message-associated peptide on spinal cord excitability in rats. Neuroscience Letters, 235, 154-156.

Antoni,F.A. (1993) Vasopressinergic Control of Pituitary Adrenocorticotropin Secretion Comes of Age. Frontiers in Neuroendocrinology, 14, 76-122.

Antoni,F.A. (1986) Hypothalamic control of adrenocorticotropin secretion: advances since the discovery of 41-residue corticotropin-releasing factor. Endocr.Rev., 7, 351-378.

Apostolinas,S., Rajendren,G., Dobrjansky,A., & Gibson,M.J. (1999) Androgen receptor immunoreactivity in specific neural regions in normal and hypogonadal male mice: effect of androgens. Brain Res., 817, 19-24.

Aravich,P.F. & Sclafani,A. (1983) Paraventricular hypothalamic lesions and medial hypothalamic knife cuts produce similar hyperphagia syndromes. Behavioral neuroscience, 97, 970.

Arvat,E., Gianotti,L., Ramunni,J., Grottoli,S., Brossa,P.C., Bertagna,A., Camanni,F., & Ghigo,E. (1995) Effect of galanin on basal and stimulated secretion of prolactin, gonadotropins, thyrotropin, adrenocorticotropin and cortisol in humans. European journal of endocrinology, 133, 300- 304.

Asakawa,A., Inui,A., Ueno,N., Fujimiya,M., Fujino,M.A., & Kasuga,M. (1999) Mouse pancreatic polypeptide modulates food intake, while not influencing anxiety in mice. Peptides, 20, 1445-1448.

Asakawa,A., Inui,A., Yuzuriha,H., Ueno,N., Katsuura,G., Fujimiya,M., Fujino,M., Niijima,A., Meguid,M., & Kasuga,M. (2003) Characterization of the effects of pancreatic polypeptide in the regulation of energy balance. Gastroenterology, 124, 1325-1336.

Ashby,D., Ford,H., Wynne,K., Wren,A.M., Murphy,K., Busbridge,M., Brown,E., Taube,D., Ghatei,M., & Tam,F. (2009) Sustained appetite improvement in malnourished dialysis patients by daily ghrelin treatment. Kidney International, 76, 199-206. 283

Aston-Jones,G., Smith,R.G., Moorman,D., & Richardson,K. (2009) Role of lateral hypothalamic orexin neurons in reward processing and addiction. Neuropharmacology, 56 Suppl 1, 112-121.

Atalayer,D., Robertson,K.L., Haskell-Luevano,C., Andreasen,A., & Rowland,N.E. (2010) Food demand and meal size in mice with single or combined disruption of melanocortin type 3 and 4 receptors. AJP - Regulatory, Integrative and Comparative Physiology, ajpregu.

Badie-Mahdavi,H., Lu,X., Behrens,M.M., & Bartfai,T. (2005) Role of galanin receptor 1 and galanin receptor 2 activation in synaptic plasticity associated with 3',5'-cyclic AMP response element-binding protein phosphorylation in the dentate gyrus: studies with a galanin receptor 2 agonist and galanin receptor 1 knockout mice. Neuroscience, 133, 591-604.

Baggio,L.L., Huang,Q., Brown,T.J., & Drucker,D.J. (2004b) Oxyntomodulin and glucagon-like peptide-1 differentially regulate murine food intake and energy expenditure. Gastroenterology, 127, 546-558.

Baggio,L.L., Huang,Q., Brown,T.J., & Drucker,D.J. (2004a) A recombinant human glucagon-like peptide (GLP)-1-albumin protein (albugon) mimics peptidergic activation of GLP-1 receptor- dependent pathways coupled with satiety, gastrointestinal motility, and glucose homeostasis. Diabetes, 53, 2492-2500.

Bagnasco,M., Tulipano,G., Melis,M.R., Argiolas,A., Cocchi,D., & Muller,E.E. (2003) Endogenous ghrelin is an orexigenic peptide acting in the arcuate nucleus in response to fasting. Regulatory Peptides, 111, 161-167.

Bagnol,D., Lu,X.Y., Kaelin,C.B., Day,H.E.W., Ollmann,M., Gantz,I., Akil,H., Barsh,G.S., & Watson,S.J. (1999) Anatomy of an Endogenous Antagonist: Relationship between Agouti-Related Protein and Proopiomelanocortin in Brain. Journal of Neuroscience, 19, 26RC.

Bai,F.L., Yamano,M., Shiotani,Y., Emson,P.C., Smith,A.D., Powell,J.F., & Tohyama,M. (1985) An arcuato-paraventricular and -dorsomedial hypothalamic neuropeptide Y-containing system which lacks noradrenaline in the rat. Brain Research, 331, 172-175.

Bailey,K., Pavlova,M., Rohde,A., Hohmann,J.G., & Crawley,J.N. (2007) Galanin receptor subtype 2 (GalR2) null mutant mice display an anxiogenic-like phenotype specific to the elevated plus- maze. Pharmacology, biochemistry and behavior, 86, 8-20.

Bale,T.L., Contarino,A., Smith,G.W., Chan,R., Gold,L.H., Sawchenko,P.E., Koob,G.F., Vale,W.W., & Lee,K.F. (2000) Mice deficient for corticotropin-releasing hormone receptor-2 display anxiety-like behaviour and are hypersensitive to stress. Nature Genetics, 24, 410-414.

Banks,W.A. (2006) Blood-brain barrier and energy balance. Obesity, 14 Suppl 5, 234S-237S.

Baptista,T., Parada,M., & Hernandez,L. (1987) Long term administration of some antipsychotic drugs increases body weight and feeding in rats. Are D2 dopamine receptors involved? Pharmacology, biochemistry and behavior, 27, 399-405.

Baranowska,B., Radzikowska,M., Wasilewska-Dziubinska,E., Roguski,K., & Borowiec,M. (2000) Disturbed release of gastrointestinal peptides in anorexia nervosa and in obesity. Diabetes, obesity & metabolism, 2, 99-103.

284

Baranowska,B., Wasilewska-Dziubinska,E., Radzikowska,M., Pilonowski,A., & Roguski,K. (1997) Neuropeptide Y, galanin, and leptin release in obese women and in women with anorexia nervosa. Metabolism, clinical and experimental, 46, 1384-1389.

Barash,I.A., Cheung,C.C., Weigle,D.S., Ren,H., Kabigting,E.B., Kuijper,J.L., Clifton,D.K., & Steiner,R.A. (1996) Leptin is a metabolic signal to the reproductive system. Endocrinology, 137, 3144- 3147.

Barr,A.M., Kinney,J., Hill,M., Lu,X., Biros,S., Rebek,J., & Bartfai,T. (2006) A novel, systemically active, selective galanin receptor type-3 ligand exhibits antidepressant-like activity in preclinical tests. Neuroscience Letters, 405, 111-115.

Bartfai,T., Bedecs,K., Land,T., Langel,U., Bertorelli,R., Girotti,P., Consolo,S., Xu,X.J., Wiesenfeld- Hallin,Z., Nilsson,S., Pieribone,V.A., & Hokfelt,T. (1991) M-15: high-affinity chimeric peptide that blocks the neuronal actions of galanin in the hippocampus, locus coeruleus, and spinal cord. Proceedings of the National Academy of Sciences of the United States of America, 88, 10961.

Bartfai,T., Langel,U., Bedecs,K., Andell,S., Land,T., Gregersen,S., Ahren,B., Girotti,P., Consolo,S., Corwin,R., Crawley,J., Xu,X., Weisenfield-Hallin,Z., & Hokfelt,T. (1993) Galanin-receptor ligand M40 peptide distinguishes between putative galanin-receptor subtypes. Proceedings of the National Academy of Sciences of the United States of America, 90, 11287-11291.

Bartfai,T., Lu,X., Badie-Mahdavi,H., Barr,A.M., Mazarati,A., Hua,X.Y., Yaksh,T., Haberhauer,G., Ceide,S.C., Trembleau,L., Somogyi,L., Krock,L., & Rebek,J. (2004) Galmic, a nonpeptide galanin receptor agonist, affects behaviors in seizure, pain, and forced-swim tests. Proceedings of the National Academy of Sciences of the United States of America, 101, 10470-10475.

Barton,C., Lin,L., York,D.A., & Bray,G.A. (1995) Differential effects of enterostatin, galanin and opioids on high-fat diet consumption. Brain Research, 702, 55-60.

Barton,C., York,D.A., & Bray,G.A. (1996) Opioid receptor subtype control of galanin-induced feeding. Peptides, 17, 237-240.

Baskin,D.G., Breininger,J.F., & Schwartz,M.W. (1999a) Leptin receptor mRNA identifies a subpopulation of neuropeptide Y neurons activated by fasting in rat hypothalamus. Diabetes, 48, 828-833.

Baskin,D.G., Schwartz,M.W., Seeley,R.J., Woods,S.C., Porte,D., Jr., Breininger,J.F., Jonak,Z., Schaefer,J., Krouse,M., Burghardt,C., Campfield,L.A., Burn,P., & Kochan,J.P. (1999b) Leptin receptor long-form splice-variant protein expression in neuron cell bodies of the brain and co-localization with neuropeptide Y mRNA in the arcuate nucleus. The journal of histochemistry and cytochemistry, 47, 353-362.

Bassareo,V. & Di Chiara,G. (1999) Differential responsiveness of dopamine transmission to food- stimuli in nucleus accumbens shell/core compartments. Neuroscience, 89, 637.

Bassareo,V. & Di Chiara,G. (1997) Differential influence of associative and nonassociative learning mechanisms on the responsiveness of prefrontal and accumbal dopamine transmission to food stimuli in rats fed ad libitum. The journal of neuroscience, 17, 851-861. 285

Batterham,R.L., Cohen,M.A., Ellis,S., Le Roux,C., Withers,D., Frost,G., Ghatei,M., & Bloom,S.R. (2003a) Inhibition of food intake in obese subjects by peptide YY3-36. New England Journal of Medicine, The, 349, 941-948.

Batterham,R.L., Cowley,M.A., Small,C.J., Herzog,H., Cohen,M.A., Dakin,C.L., Wren,A.M., Brynes,A., Low,M., Ghatei,M., & Bloom,S.R. (2002) Gut hormone PYY(3-36) physiologically inhibits food intake. Nature, 418, 650-654.

Batterham,R.L., ffytche,D.H., Rosenthal,J.M., Zelaya,F.O., Barker,G.J., Withers,D.J., & Williams,S.C.R. (2007) PYY modulation of cortical and hypothalamic brain areas predicts feeding behaviour in humans. Nature, 450, 106-109.

Batterham,R.L., Le Roux,C., Cohen,M.A., Park,A.J., Ellis,S.M., Patterson,M., Frost,G.S., Ghatei,M.A., & Bloom,S.R. (2003b) Pancreatic polypeptide reduces appetite and food intake in humans. The Journal of clinical endocrinology and metabolism, 88, 3989-3992.

Bauer,F.E., Venetikou,M., Burrin,J.M., Ginsberg,L., Mackay,D.J., & Bloom,S.R. (1986) Growth hormone release in man induced by galanin, a new hypothalamic peptide. The Lancet, 2, 192-195.

Baum,O., Reutter,W., & Bermpohl,F. (2003) Dipeptidyl Aminopeptidases in Health and Disease, pp. 19-27. Springer US.

Baumann,G. (2001) Growth hormone binding protein 2001. The Journal of pediatric endocrinology, 14, 355-375.

Baura,G.D., Foster,D.M., Porte,D., Jr., Kahn,S.E., Bergman,R.N., Cobelli,C., & Schwartz,M.W. (1993) Saturable transport of insulin from plasma into the central nervous system of dogs in vivo. A mechanism for regulated insulin delivery to the brain. Journal of Clinical Investigation, 92, 1824-1830.

Beak,S.A., Heath,M.M., Small,C.J., Morgan,D.G., Ghatei,M.A., Taylor,A.D., Buckingham,J.C., Bloom,S.R., & Smith,D.M. (1998) Glucagon-like peptide-1 stimulates luteinizing hormone- releasing hormone secretion in a rodent hypothalamic neuronal cell line. J.Clin.Invest, 101, 1334-1341.

Beck,B., Burlet,A., Nicolas,J.P., & Burlet,C. (1993) Galanin in the hypothalamus of fed and fasted lean and obese Zucker rats. Brain Research, 623, 124-130.

Bedecarrats,G.Y. & Kaiser,U.B. (2003) Differential Regulation of Gonadotropin Subunit Gene Promoter Activity by Pulsatile Gonadotropin-Releasing Hormone (GnRH) in Perifused L{beta}T2 Cells: Role of GnRH Receptor Concentration. Endocrinology, 144, 1802-1811.

Beglinger,C., Degen,L., Matzinger,D., D'Amato,M., & Drewe,J. (2001) Loxiglumide, a CCK-A receptor antagonist, stimulates calorie intake and hunger feelings in humans. American journal of physiology.regulatory, integrative and comparative physiology, 280, R1149-R1154.

Beinfeld,M.C., Meyer,D.K., Eskay,R.L., Jensen,R.T., & Brownstein,M.J. (1981) The distribution of cholecystokinin immunoreactivity in the central nervous system of the rat as determined by radioimmunoassay. Brain Research, 212, 51-57.

286

Belfer,I., Hipp,H., Bollettino,A., McKnight,C., Evans,C., Virkkunen,M., Albaugh,B., Max,M.B., Goldman,D., & Enoch,M.A. (2007) Alcoholism is associated with GALR3 but not two other galanin receptor genes. Genes Brain Behav., 6, 473-481.

Belfer,I., Hipp,H., McKnight,C., Evans,C., Buzas,B., Bollettino,A., Albaugh,B., Virkkunen,M., Yuan,Q., Max,M.B., Goldman,D., & Enoch,M.A. (2006) Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations. Molecular Psychiatry, 11, 301- 311.

Bellinger,L.L. & Bernardis,L.L. (2002) The dorsomedial hypothalamic nucleus and its role in ingestive behavior and body weight regulation: lessons learned from lesioning studies. Physiology & behavior, 76, 431-442.

Bennett,H.P.J. (1986) Biosynthetic fate of the amino-terminal fragment of pro-opiomelanocortin within the intermediate lobe of the mouse pituitary. Peptides, 7, 615-622.

Benoit,S., Air,E., Coolen,L., Strauss,R., Jackman,A., Clegg,D., Seeley,R.J., & Woods,S.C. (2002) The catabolic action of insulin in the brain is mediated by melanocortins. The journal of neuroscience, 22, 9048-9052.

Benya,R.V., Matkowskyj,K., Danilkovich,A., & Hecht,G. (1998) Galanin causes Cl- secretion in the human colon. Potential significance of inflammation-associated NF-kappa B activation on galanin-1 receptor expression and function. Annals of the New York Academy of Sciences, 863, 64-77.

Berger,A., Kofler,B., Santic,R., Zipperer,E., Sperl,W., & Hauser-Kronberger,C. (2003) 125I-labeled galanin binding sites in congenital innervation defects of the distal colon. Acta Neuropathol., 105, 43-48.

Berger,A., Lang,R., Moritz,K., Santic,R., Hermann,A., Sperl,W., & Kofler,B. (2004) Galanin receptor subtype GalR2 mediates apoptosis in SH-SY5Y neuroblastoma cells. Endocrinology, 145, 500- 507.

Bergonzelli,G.E. (2001) Interplay between galanin and leptin in the hypothalamic control of feeding via corticotropin-releasing hormone and neuropeptide Y. Diabetes, 50, 2666-2672.

Bergonzelli,G.E., Pralong,F.P., Glauser,M., Cavados,C., Grouzmann,E., & Gaillard,R.C. (2001) Interplay between galanin and leptin in the hypothalamic control of feeding via corticotropin- releasing hormone and neuropeptide Y. Diabetes, 50, 2666-2672.

Bernardis,L.L. & Bellinger,L.L. (1993) The lateral hypothalamic area revisited: neuroanatomy, body weight regulation, neuroendocrinology and metabolism. Neuroscience and biobehavioral reviews, 17, 141.

Bernardis,L.L. & Bellinger,L.L. (1987) The dorsomedial hypothalamic nucleus revisited: 1986 update. Brain Research, 434, 321-381.

Berridge,K.C. & Robinson,T.E. (1998) What is the role of dopamine in reward: hedonic impact, reward learning, or incentive salience? Brain Research Reviews, 28, 309-369.

287

Berridge,K.C., Ho,C.Y., Richard,J.M., & DiFeliceantonio,A.G. The tempted brain eats: Pleasure and desire circuits in obesity and eating disorders. Brain Research, In Press, Accepted Manuscript.

Bertagna,X. (1994) Proopiomelanocortin-derived peptides. Endocrinology and metabolism clinics of North America, 23, 467-485.

Bertherat,J., Dournaud,P., Berod,A., Normand,E., Bloch,B., Rostene,W., Kordon,C., & Epelbaum,J. (1992) Growth hormone-releasing hormone-synthesizing neurons are a subpopulation of somatostatin receptor-labelled cells in the rat arcuate nucleus: a combined in situ hybridization and receptor light-microscopic radioautographic study. Neuroendocrinology, 56, 25.

Berthoud,H.R. (2002) Multiple neural systems controlling food intake and body weight. Neuroscience & Biobehavioral Reviews, 26, 393-428.

Bewick,G.A., Gardiner,J., Dhillo,W., Kent,A., White,N., Webster,Z., Ghatei,M., & Bloom,S.R. (2005) Post-embryonic ablation of AgRP neurons in mice leads to a lean, hypophagic phenotype. The FASEB journal, 19, 1680-1682.

Beyer,H.S., Matta,S.G., & Sharp,B.M. (1988) Regulation of the Messenger Ribonucleic Acid for Corticotropin-Releasing Factor in the Paraventricular Nucleus and Other Brain Sites of the Rat. Endocrinology, 123, 2117-2123.

Bhalla,V.K., Behzadian,M.A., George,P.E., Howard,E.F., Mahesh,V.B., & Abney,T.O. (1992) Cell specific distribution of LH/hCG receptor messenger ribonucleic acid in rat testicular Leydig cells. Endocrinology, 131, 2485-2487.

Bhogal,R., Smith,D.M., Purkiss,P., & Bloom,S.R. (1993) Molecular identification of binding sites for calcitonin gene-related peptide (CGRP) and islet amyloid polypeptide (IAPP) in mammalian lung: species variation and binding of truncated CGRP and IAPP. Endocrinology, 133, 2351- 2361.

Bi,S., Ladenheim,E.E., Schwartz,G.J., & Moran,T.H. (2001) A role for NPY overexpression in the dorsomedial hypothalamus in hyperphagia and obesity of OLETF rats. American journal of physiology.regulatory, integrative and comparative physiology, 281, R254-R260.

Bi,S., Robinson,B., & Moran,T.H. (2003) Acute food deprivation and chronic food restriction differentially affect hypothalamic NPY mRNA expression. American journal of physiology.regulatory, integrative and comparative physiology, 285, R1030-R1036.

Bi,S., Scott,K., Kopin,A.S., & Moran,T.H. (2004) Differential roles for cholecystokinin a receptors in energy balance in rats and mice. Endocrinology, 145, 3873-3880.

Biebermann,H., Castaneda,T.R., van Landeghem,F., von Deimling,A., Escher,F., Brabant,G., Hebebrand,J., Hinney,A., Tschop,M.H., Gruters,A., & Krude,H. (2006) A role for [beta]- melanocyte-stimulating hormone in human body-weight regulation. Cell metabolism, 3, 141- 146.

Billiard,J. (1996) Functional heterogeneity of pituitary gonadotropes in response to a variety of neuromodulators. Molecular and Cellular Endocrinology, 123, 163-170. 288

Bittencourt,J.C., Presse,F., Arias,C., Peto,C., Vaughan,J., Nahon,J.L., Vale,W., & Sawchenko,P.E. (1992) The melanin-concentrating hormone system of the rat brain: an immuno- and hybridization histochemical characterization. Journal of comparative neurology, 319, 218.

Blakeman,K.H., Hao,J.X., Xu,X.J., Jacoby,A.S., Shine,J., Crawley,J.N., Iismaa,T., & Wiesenfeld-Hallin,Z. (2003) Hyperalgesia and increased neuropathic pain-like response in mice lacking galanin receptor 1 receptors. Neuroscience, 117, 221-227.

Blendy,J., Strasser,A., Walters,C., Perkins,K., Patterson,F., Berkowitz,R., & Lerman,C. (2005) Reduced nicotine reward in obesity: cross-comparison in human and mouse. Psychopharmacology, 180, 306-315.

Blevins,J.E., Stanley,B.G., & Reidelberger,R.D. (2000) Brain regions where cholecystokinin suppresses feeding in rats. Brain Research, 860, 1-10.

Bloch,B., Brazeau,P., Ling,N., Bohlen,P., Esch,F., Wehrenberg,W.B., Benoit,R., Bloom,F., & Guillemin,R. (1983) Immunohistochemical detection of growth hormone-releasing factor in brain. Nature, 301, 607-608.

Blomqvist,A.G. & Herzog,H. (1997) Y-receptor subtypes--how many more? Trends in Neurosciences, 20, 294-298.

Bloomquist,B.T., Beauchamp,M.R., Zhelnin,L., Brown,S.E., Gore-Willse,A.R., Gregor,P., & Cornfield,L.J. (1998) Cloning and expression of the human galanin receptor GalR2. Biochem.Biophys.Res.Commun., 243, 474-479.

Blumenthal,D.M. & Gold,M.S. (2010) Neurobiology of food addiction. Current Opinion in Clinical Nutrition & Metabolic Care.

Blundell,J.E. & Herberg,L.J. (1968) Relative effects of nutritional deficit and deprivation period on rate of electrical self-stimulation of lateral hypothalamus. Nature, 219, 627.

Bokser,L., Bajusz,S., Groot,K., & Schally,A.V. (1990) Prolonged inhibition of luteinizing hormone and testosterone levels in male rats with the luteinizing hormone-releasing hormone antagonist SB-75. Proceedings of the National Academy of Sciences of the United States of America, 87, 7100-7104.

Bolaos,C., Perrotti,L., Edwards,S., Eisch,A., Barrot,M., Olson,V., Russell,D., Neve,R., & Nestler,E. (2003) Phospholipase Cgamma in distinct regions of the ventral tegmental area differentially modulates mood-related behaviors. The journal of neuroscience, 23, 7569-7576.

Borg,M.A., Sherwin,R.S., Borg,W.P., Tamborlane,W.V., & Shulman,G.I. (1997) Local ventromedial hypothalamus glucose perfusion blocks counterregulation during systemic hypoglycemia in awake rats. Journal of Clinical Investigation, 99, 361-365.

Borg,W.P., During,M.J., Sherwin,R.S., Borg,M.A., Brines,M.L., & Shulman,G.I. (1994) Ventromedial hypothalamic lesions in rats suppress counterregulatory responses to hypoglycemia. Journal of Clinical Investigation, 93, 1677-1682.

Borg,W.P., Sherwin,R.S., During,M.J., Borg,M.A., & Shulman,G.I. (1995) Local ventromedial hypothalamus glucopenia triggers counterregulatory hormone release. Diabetes, 44, 180. 289

Borowsky,B., Walker,M.W., Huang,L.Y., Jones,K.A., Smith,K.E., Bard,J., Branchek,T.A., & Gerald,C. (1998) Cloning and characterization of the human galanin GALR2 receptor. Peptides, 19, 1771-1781.

Boswell,T., Richardson,R.D., Schwartz,M.W., D'Alessio,D.A., Woods,S.C., Sipols,A.J., Baskin,D.G., & Kenagy,G.J. (1993) NPY and galanin in a hibernator: hypothalamic gene expression and effects on feeding. Brain Research Bulletin, 32, 379.

Bouret,S., Prevot,V., Croix,D., Howard,A., Habert-Ortoli,E., Jegou,S., Vaudry,H., Beauvillain,J.C., & Mitchell,V. (2000) Expression of GalR1 and GalR2 galanin receptor messenger ribonucleic acid in proopiomelanocortin neurons of the rat arcuate nucleus: effect of testosterone. Endocrinology, 141, 1780-1794.

Bradbury,A.F., Finnie,M.D.A., & Smyth,D.G. (1982) Mechanism of C-terminal amide formation by pituitary enzymes. Nature, 298, 686-688.

Brady,L.S., Smith,M.A., Gold,P.W., & Herkenham,M. (1990) Altered expression of hypothalamic neuropeptide mRNAs in food-restricted and food-deprived rats. Neuroendocrinology, 52, 441.

Branchek,T.A., Smith,K.E., Gerald,C., & Walker,M.W. (2000) Galanin receptor subtypes. Trends Pharmacol Sci., 21, 109-117.

Bray,G.A. (1992) Pathophysiology of obesity. Am J Clin Nutr, 55, 488S-494S.

Bray,G.A., York,D.A., Lavau,M., & Hainault,I. (1991) Adrenalectomy in the Zucker fatty rat: effect on m-RNA for malic enzyme and glyceraldehyde 3-phosphate dehydrogenase. International Journal of Obesity, 15, 703-709.

Brett,D., Pospisil,H., Valcarcel,J., Reich,J., & Bork,P. (2002) Alternative splicing and genome complexity. Nat Genet, 30, 29-30.

Brewer,A., Langel,U., & Robinson,J.K. (2005) Intracerebroventricular administration of galanin decreases free water intake and operant water reinforcer efficacy in water-restricted rats. Neuropeptides, 39, 117-124.

Broberger,C. (1999) Hypothalamic cocaine- and amphetamine-regulated transcript (CART) neurons: histochemical relationship to thyrotropin-releasing hormone, melanin-concentrating hormone, orexin/hypocretin and neuropeptide Y. Brain Research, 848, 101-113.

Broberger,C., de Lecea,L., Sutcliffe,J.G., & Hokfelt,T. (1998a) Hypocretin/orexin- and melanin- concentrating hormone-expressing cells form distinct populations in the rodent lateral hypothalamus: relationship to the neuropeptide Y and agouti gene-related protein systems. Journal of comparative neurology, 402, 460-474.

Broberger,C., Johansen,J., Johansson,C., Schalling,M., & Hokfelt,T. (1998b) The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proceedings of the National Academy of Sciences of the United States of America, 95, 15043-15048.

290

Brown,A.M., Mayfield,D.K., Volaufova,J., & Argyropolous,G. (2001) The gene structure and minimal promoter of the human agouti related protein. Gene, 277, 231-238.

Brown,K.S., Gentry,R.M., & Rowland,N.E. (1998) Central injection in rats of alpha-melanocyte- stimulating hormone analog: effects on food intake and brain Fos. Regulatory Peptides, 78, 89-94.

Bruning,J.C., Gautaum,D., Burks,D.J., Gillette,J., Schubert,M., Orban,P.C., Klein,R., Krone,W., Muller- Wieland,D., & Kahn,C.R. (2000) Role of brain insulin receptor in control of body weight and reproduction. Science, 289, 2122-2125.

Bukovsky,A., Chen,T.T., Wimalasena,J., & Caudle,M.R. (1993) Cellular localization of luteinizing hormone receptor immunoreactivity in the ovaries of immature, gonadotropin-primed and normal cycling rats. Biol.Reprod., 48, 1367-1382.

Bunney,B.S., Walters,J.R., Roth,R.H., & Aghajanian,G.K. (1973) Dopaminergic neurons: effect of antipsychotic drugs and amphetamine on single cell activity. The Journal of pharmacology and experimental therapeutics, 185, 560-571.

Burazin,T.C. & Gundlach,A.L. (1998) Inducible galanin and GalR2 receptor system in motor neuron injury and regeneration. Journal of neurochemistry, 71, 879-882.

Burger,L.L., Haisenleder,D.J., Dalkin,A.C., & Marshall,J.C. (2004) Regulation of gonadotropin subunit gene transcription. J Mol.Endocrinol, 33, 559-584.

Burgevin,M.C., Loquet,I., Quarteronet,D., & Habert-Ortoli,E. (1995) Cloning, pharmacological characterization, and anatomical distribution of a rat cDNA encoding for a galanin receptor. J Mol.Neurosci, 6, 33-41.

Burton,K.A. (1992) Growth hormone receptor messenger ribonucleic acid distribution in the adult male rat brain and its colocalization in hypothalamic somatostatin neurons. Endocrinology, 131, 958.

Butler,A.A., Kesteson,R.A., Khong,K., Cullen,M.J., Pelleymounter,M.A., Dekoning,J., Baetscher,M., & Cone,R.D. (2000) A unique metabolic syndrome causes obesity in the melanocortin-3 receptor-deficient mouse. Endocrinology, 141, 3518-3521.

Butler,J. (1969) The identity of chemical and hormonal properties of the thyrotropin releasing hormone and pyroglutamyl-histidyl-proline amide. Biochemical and biophysical research communications, 37, 705.

Cabanac,M. (1989) Palatability of food and the ponderostat. Annals of the New York Academy of Sciences, 575, 340.

Cai,A., Bowers,R.C., Moore,J.P., & Hyde,J.F. (1998) Function of galanin in the anterior pituitary of estrogen-treated Fischer 344 rats: autocrine and paracrine regulation of prolactin secretion. Endocrinology, 139, 2452-2458.

Cai,A., Hayes,D., Patel,N., & Hyde,J.F. (1999) Targeted overexpression of galanin in lactotrophs of transgenic mice induces hyperprolactinemia and pituitary hyperplasia. Endocrinology, 140, 4955-4964. 291

Carelli,R.M. (2002) Nucleus accumbens cell firing during goal-directed behaviors for cocaine vs. [`]natural' reinforcement. Physiology & behavior, 76, 379-387.

Carey,D.G. (1993) Potent effects of human galanin in man: growth hormone secretion and vagal blockade. The Journal of clinical endocrinology and metabolism, 77, 90.

Carlsson,A. (1975) Receptor-mediated control of dopamine metabolism. Pre- and Post-synaptic Receptors (ed. by E. Usdin & W. Bunney), pp. 49-65. Marcel Dekker InC., New York.

Caro,J.F. & Kolaczynski,J.W. (1996) Decreased cerebrospinal-fluid/serum leptin ratio in obesity: a possible mechanism for leptin resistance. The Lancet, 348, 159-161.

Carr,K.D., Kim,G.Y., & Cabeza de Vaca,S. (2000) Hypoinsulinemia may mediate the lowering of self- stimulation thresholds by food restriction and streptozotocin-induced diabetes. Brain Research, 863, 160-168.

Carr,K.D., Tsimberg,Y., Berman,Y., & Yamamoto,N. (2003) Evidence of increased dopamine receptor signaling in food-restricted rats. Neuroscience, 119, 1157-1167.

Carroll,M.E., France,C.P., & Meisch,R.A. (1979) Food deprivation increases oral and intravenous drug intake in rats. Science, 205, 319-321.

Carroll,M.E. & Meisch,R.A. (1984) Increased drug-reinforced behavior due to food deprivation. Advances in behavioral pharmacology (ed. by T. Thompson, P. B. Dews, & J. E. Barrett), pp. 47-88. Academic Press, New York.

Carroll,R.S., Kowash,P.M., Lofgren,J.A., Schwall,R.H., & Chin,W.W. (1991) In vivo regulation of FSH synthesis by inhibin and activin. Endocrinology, 129, 3299-3304.

Castellano,J.M., Navarro,V.M., Fernandez-Fernandez,R., Roa,J., Vigo,E., Pineda,R., Steiner,R.A., Aguilar,E., Pinilla,L., & Tena-Sempere,M. (2006) Effects of galanin-like peptide on luteinizing hormone secretion in the rat: sexually dimorphic responses and enhanced sensitivity at male puberty. Am.J.Physiol Endocrinol.Metab, 291, E1281-E1289.

Ceccatelli,S., Eriksson,M., & Hokfelt,T. (1989) Distribution and coexistence of corticotropin-releasing factor-, neurotensin-, enkephalin-, cholecystokinin-, galanin-and vasoactive intestinal polypeptide/peptide histidine isoleucine-like peptides in the parvocellular part of the paraventricular nucleus. Neuroendocrinology, 49, 309.

Chan,Y.Y., Clifton,D.K., & Steiner,R.A. (1996a) Role of NPY neurones in GH-dependent feedback signalling to the brain. Hormone Research in Paediatrics, 45 Suppl 1, 12-14.

Chan,Y.Y., Grafstein-Dunn,E., Delemarre-van de Waal,H.A., Burton,K.A., Clifton,D.K., & Steiner,R.A. (1996b) The role of galanin and its receptor in the feedback regulation of growth hormone secretion. Endocrinology, 137, 5303.

Chan-Palay,V. (1988) Galanin hyperinnervates surviving neurons of the human basal nucleus of Meynert in dementias of Alzheimer's and Parkinson's disease: a hypothesis for the role of galanin in accentuating cholinergic dysfunction in dementia. Journal of comparative neurology, 273, 543.

292

Chaudhri,O.B., Parkinson,J.R.C., Kuo,Y.T., Druce,M.R., Herlihy,A.H., Bell,J.D., Dhillo,W.S., Stanley,S.A., Ghatei,M.A., & Bloom,S.R. (2006) Differential hypothalamic neuronal activation following peripheral injection of GLP-1 and oxyntomodulin in mice detected by manganese-enhanced magnetic resonance imaging. Biochemical and biophysical research communications, 350, 298-306.

Chee,M.J.S., Myers,M.G., Jr., Price,C.J., & Colmers,W.F. (2010) Neuropeptide Y suppresses anorexigenic output from the ventromedial nucleus of the hypothalamus. The journal of neuroscience, 30, 3380-3390.

Chemelli,R.M., Willie,J.T., Sinton,C.M., Elmquist,J.K., Scammell,T., Lee,C., Richardson,J.A., Williams,S.C., Xiong,Y., Kisanuki,Y., Fitch,T.E., Nakazato,M., Hammer,R.E., Saper,C.B., & Yanagisawa,M. (1999) Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell, 98, 437-451.

Cheung,C.C., Clifton,D.K., & Steiner,R.A. (1997) Proopiomelanocortin neurons are direct targets for leptin in the hypothalamus. Endocrinology, 138, 4489-4492.

Cheung,C.C., Hohmann,J.G., Clifton,D.K., & Steiner,R.A. (2001) Distribution of galanin messenger RNA-expressing cells in murine brain and their regulation by leptin in regions of the hypothalamus. Neuroscience, 103, 423-432.

Chiamolera,M.I. & Wondisford,F.E. (2009) Thyrotropin-Releasing Hormone and the Thyroid Hormone Feedback Mechanism. Endocrinology, 150, 1091-1096.

Childs,G.V. (1997) Cytochemical studies of multifunctional gonadotropes. Microscopy research and technique, 39, 114-130.

Chowen,J.A., Frago,L.M., & Argente,J. (2004) The regulation of GH secretion by sex steroids. European journal of endocrinology, 151, U95-100.

Chronwall,B.M., DiMaggio,D.A., Massari,V.J., Pickel,V.M., Ruggiero,D.A., & O'Donohue,T.L. (1985) The anatomy of neuropeptide-Y-containing neurons in rat brain. Neuroscience, 15, 1159- 1181.

Chua,S.C., Brown,A.W., Kim,J., Hennessey,K.L., Leibel,R.L., & Hirsch,J. (1991) Food deprivation and hypothalamic neuropeptide gene expression: effects of strain background and the diabetes mutation. Molecular brain research, 11, 291-299.

Chung,S., Hopf,F.W., Nagasaki,H., Li,C.Y., Belluzzi,J.D., Bonci,A., & Civelli,O. (2009) The melanin- concentrating hormone system modulates cocaine reward. Proceedings of the National Academy of Sciences, 106, 6772-6777.

Cimini,V. (2003) Neuropeptides in anterior pituitary development. International Journal of Developmental Neuroscience, 21, 291-301.

Cimini,V. (1996) Galanin inhibits ACTH release in vitro and can be demonstrated immunocytochemically in dispersed corticotrophs. Experimental cell research, 228, 212-215.

293

Cimini,V., Van Noorden,S., Timson,C.M., & Polak,J.M. (1993) Modulation of galanin and neuromedin U-like immunoreactivity in rat corticotropes after alteration of endocrine status. Cell and Tissue Research, 272, 137-146.

Clark,J.T., Kalra,P.S., Crowley,W.R., & Kalra,S.P. (1984) Neuropeptide Y and human pancreatic polypeptide stimulate feeding behavior in rats. Endocrinology, 115, 427-429.

Clarke,I.J. & Pompolo,S. (2005) Synthesis and secretion of GnRH. Anim Reprod.Sci., 88, 29-55.

Clarke,P. & Pert,A. (1985) Autoradiographic evidence for nicotine receptors on nigrostriatal and mesolimbic dopaminergic neurons. Brain Research, 348, 355.

Clayton,R.N. (1993) Regulation of gonadotrophin subunit gene expression. Hum.Reprod., 8 Suppl 2, 29-36.

Clement,K., Vaisse,C., Lahlou,N., Cabrol,S., Pelloux,V., Cassuto,D., Gourmelen,M., Dina,C., Chambaz,J., Lacorte,J.M., Basdevant,A., Bougneres,P., Lebouc,Y., Froguel,P., & Guy-Grand,B. (1998) A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature, 392, 398-401.

Clemmons,D.R. & Underwood,L.E. (1991) Nutritional Regulation of IGF-I and IGF Binding Proteins. Annual Review of Nutrition, 11, 393-412.

Coen,C.W., Montagnese,C., & Opacka-Juffry,J. (1990) Coexistence of gonadotropin-releasing hormone and galanin: immunohistochemical and functional studies. Journal of neuroendocrinology, 2, 112.

Cohen,M.A., Ellis,S., Le Roux,C., Batterham,R.L., Park,A., Patterson,M., Frost,G., Ghatei,M., & Bloom,S.R. (2003) Oxyntomodulin suppresses appetite and reduces food intake in humans. The Journal of clinical endocrinology and metabolism, 88, 4696-4701.

Colditz,G.A., Willett,W.C., Stampfer,M.J., Manson,J.E., Hennekens,C.H., Arky,R.A., & Speizer,F.E. (1990) Weight as a risk factor for clinical diabetes in women. American Journal of Epidemiology, 132, 501-513.

Cone,R.D., Cowley,M.A., Butler,A.A., Fan,W., Marks,D.L., & Low,M.J. (2001) The arcuate nucleus as a conduit for diverse signals relevant to energy homeostasis. Int.J Obes Relat Metab Disord., 25 Suppl 5, S63-S67.

Considine,R.V., Sinha,M.K., Heiman,M.L., Kriauciunas,A., Stephens,T.W., Nyce,M.R., Ohannesian,J.P., Marco,C.C., Mckee,L.J., Bauer,T.L., & Caro,J.F. (1996) Serum immunoreactive-leptin concentrations in normal-weight and obese humans. New England Journal of Medicine, The, 334, 292-295.

Contreras,R.J., Kosten,T., & Bird,E. (1984) Area postrema: part of the autonomic circuitry of caloric homeostasis. Fed.Proc., 43, 2966-2968.

Coppock,H.A., Owji,A.A., Austin,C., Upton,P.D., Jackson,M.L., Gardiner,J.V., Ghatei,M.A., Bloom,S.R., & Smith,D.M. (1999) Rat-2 fibroblasts express specific adrenomedullin receptors, but not calcitonin-gene-related-peptide receptors, which mediate increased intracellular cAMP and inhibit mitogen-activated protein kinase activity. Biochem.J., 338 ( Pt 1), 15-22. 294

Corts,R. (1990) Effects of central nervous system lesions on the expression of galanin: a comparative in situ hybridization and immunohistochemical study. Proceedings of the National Academy of Sciences of the United States of America, 87, 7742-7746.

Corwin,R.L., Robinson,J.K., & Crawley,J.N. (1993) Galanin antagonists block galanin-induced feeding in the hypothalamus and amygdala of the rat. The European journal of neuroscience, 5, 1528.

Corwin,R.L., Rowe,P.M., & Crawley,J.N. (1995) Galanin and the galanin antagonist M40 do not change fat intake in a fat-chow choice paradigm in rats. AJP - Regulatory, Integrative and Comparative Physiology, 269, R511-R518.

Cowley,M.A., Smart,J.L., Rubinstein,M., Cerdan,M.G., Diano,S., Horvath,T.L., Cone,R.D., & Low,M.J. (2001) Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature, 411, 480-484.

Crawley,J.N., Austin,M.C., Fiske,S.M., Martin,B., Consolo,S., Berthold,M., Langel,U., Fisone,G., & Bartfai,T. (1990) Activity of centrally administered galanin fragments on stimulation of feeding behavior and on galanin receptor binding in the rat hypothalamus. J Neurosci, 10, 3695-3700.

Crawley,J.N., Mufson,E.J., Hohmann,J.G., Teklemichael,D.N., Steiner,R.A., Holmberg,K., Xu,Z., Blakeman,K.H., Xu,X.J., Weisenfield-Hallin,Z., Bartfai,T., & Hokfelt,T. (2002) Galanin overexpressing transgenic mice. Neuropeptides, 36, 145-156.

Crawley,J.N., Robinson,J.K., Langel,U., & Bartfai,T. (1993) Galanin receptor antagonists M40 and C7 block galanin-induced feeding. Brain Research, 600, 268.

Criscione,L., Rigollier,P., Batzl-Hartmann,C., Rueger,H., Stricker-Krongrad,A., Wyss,P., Brunner,L., Whitebread,S., Yamaguchi,Y., Gerald,C., Heurich,R.O., Walker,M.W., Chiesi,M., Schilling,W., Hofbauer,K.G., & Levens,N. (1998) Food intake in free-feeding and energy-deprived lean rats is mediated by the neuropeptide Y5 receptor. Journal of Clinical Investigation, 102, 2136- 2145.

Crosby,E.C. & Woodburne,R.T. (1949) The comparative anatomy of the pre-optic area and the hypothalamus. Proc.Assoc.Res.Nervous Mental Dis., 20, 52-169.

Cummings,D.E., Purnell,J.Q., Frayo,R.S., Schmidova,K., Wisse,B.E., & Weigle,D.S. (2001) A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes, 50, 1714- 1719.

Cunningham,M.J. (2004) Galanin-like peptide as a link between metabolism and reproduction. J.Neuroendocrinol., 16, 717-723.

Cunningham,M.J., Krasnow,S.M., Gevers,E.F., Chen,P., Thompson,C.K., Robinson,I.C., Smith,M.S., Clifton,D.K., & Steiner,R.A. (2004a) Regulation of galanin-like peptide gene expression by pituitary hormones and their downstream targets. J Neuroendocrinol., 16, 10-18.

Cunningham,M.J., Scarlett,J.M., & Steiner,R.A. (2002) Cloning and distribution of galanin-like peptide mRNA in the hypothalamus and pituitary of the macaque. Endocrinology, 143, 755-763.

295

Cunningham,M.J., Shahab,M., Grove,K.L., Scarlett,J.M., Plant,T.M., Cameron,J.L., Smith,M.S., Clifton,D.K., & Steiner,R.A. (2004b) Galanin-like peptide as a possible link between metabolism and reproduction in the macaque. Journal of Clinical Endocrinology Metabolism, 89, 1760-1766.

Cushing,H. (1932) The Basophil Adenomas of the Pituitary Body and Their Clinical Manifestations (Pituitary Basophilism1)*. Journal of Neurosurgery, 21, 318-347.

Dakin,C.L., Gunn,I., Small,C.J., Edwards,C.M., Hay,D.L., Smith,D.M., Ghatei,M.A., & Bloom,S.R. (2001) Oxyntomodulin inhibits food intake in the rat. Endocrinology, 142, 4244-4250.

Dakin,C.L., Small,C.J., Batterham,R.L., Neary,N.M., Cohen,M.A., Patterson,M., Ghatei,M., & Bloom,S.R. (2004) Peripheral oxyntomodulin reduces food intake and body weight gain in rats. Endocrinology, 145, 2687-2695.

Dale,H.H. (1906) On some physiological actions of ergot. J.Physiol, 34, 163-206.

Dallaporta,M., Perrin,J., & Orsini,J.C. (2000) Involvement of adenosine triphosphate-sensitive K+ channels in glucose-sensing in the rat solitary tract nucleus. Neuroscience Letters, 278, 77- 80.

Dalllvechia-Adams,S., Kuhar,M.J., & Smith,Y. (2002a) Cocaine- and amphetamine-regulated transcript peptide projections in the ventral midbrain: colocalization with gamma- aminobutyric acid, melanin-concentrating hormone, dynorphin, and synaptic interactions with dopamine neurons. Journal of comparative neurology, 448, 360-372.

Dalllvechia-Adams,S., Kuhar,M.J., & Smith,Y. (2002b) Cocaine- and amphetamine-regulated transcript peptide projections in the ventral midbrain: colocalization with gamma- aminobutyric acid, melanin-concentrating hormone, dynorphin, and synaptic interactions with dopamine neurons. Journal of comparative neurology, 448, 360-372.

Dalllvechia-Adams,S. & Smith,Y. (2001) CART peptide-immunoreactive projection from the nucleus accumbens targets substantia nigra pars reticulata neurons in the rat. Journal of comparative neurology, 434, 29-39.

Damassa,D.A., Kobashigawa,D., Smith,E.R., & Davidson,J.M. (1976) Negative feedback control of LH by testosterone: a quantitative study in male rats. Endocrinology, 99, 736-742.

Date,Y., Kojima,M., Hosoda,H., Sawaguchi,A., Mondal,M.S., Suganuma,T., Matsukura,S., Kangawa,K., & Nakazato,M. (2000) Ghrelin, a novel growth hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts of rats and humans. Endocrinology, 141, 4255-4261.

Date,Y., Murakami,N., Toshinai,K., Matsukura,S., Niijima,A., Matsuo,H., Kangawa,K., & Nakazato,M. (2002) The role of the gastric afferent vagal nerve in ghrelin-induced feeding and growth hormone secretion in rats. Gastroenterology, 123, 1120-1128.

Date,Y., Ueta,Y., Yamashita,H., Yamaguchi,H., Matsukura,S., Kangawa,K., Sakurai,T., Yanagisawa,M., & Nakazato,M. (1999) Orexins, orexigenic hypothalamic peptides, interact with autonomic, neuroendocrine and neuroregulatory systems. Proceedings of the National Academy of Sciences of the United States of America, 96, 748-753. 296

Davidson,M.B. (1987) Effect of Growth Hormone on Carbohydrate and Lipid Metabolism. Endocrine reviews, 8, 115-131.

Davis,T.M.E., Burrin,J.M., & Bloom,S.R. (1987) Growth hormone (GH) release in response to GH- releasing hormone in man is 3-fold enhanced by galanin. The Journal of clinical endocrinology and metabolism, 65, 1248. de Lecea,L. (1998) The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proceedings of the National Academy of Sciences of the United States of America, 95, 322- 327.

De Marinis,L., Mancini,A., Valle,D., Bianchi,A., Gentililla,R., Milardi,D., Mascardri,C., & Giustina,A. (2000) Effects of galanin on growth hormone and prolactin secretion in anorexia nervosa. Metabolism, clinical and experimental, 49, 155-159. de Pedro,N. (1995) The galanin-induced feeding stimulation is mediated via alpha 2-adrenergic receptors in goldfish. Regulatory Peptides, 57, 77-84.

Delgado,J.M.R. & Anand,B.K. (1953) Increase of food intake induced by electrical stimulation of the lateral hypothalamus. American journal of physiology, 172, 162-168.

Denef,C. & Andries,M. (1983) Evidence for Paracrine Interaction between Gonadotrophs and Lactotrophs in Pituitary Cell Aggregates. Endocrinology, 112, 813-822.

Depczynski,B., Nichol,K., Fathi,Z., Iismaa,T., Shine,J., & Cunningham,A. (1998) Distribution and characterization of the cell types expressing GALR2 mRNA in brain and pituitary gland. Ann.N.Y.Acad.Sci., 863, 120-128.

Di Chiara,G. & Imperato,A. (1986) Preferential stimulation of dopamine release in the nucleus accumbens by opiates, alcohol, and barbiturates: studies with transcerebral dialysis in freely moving rats. Annals of the New York Academy of Sciences, 473, 367.

Di Chiara,G. & Imperato,A. (1988) Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proceedings of the National Academy of Sciences of the United States of America, 85, 5274-5278.

Dierickx,K. & Vandesande,F. (1979) Immunocytochemical demonstration of separate vasopressin- neurophysin and oxytocin-neurophysin neurons in the human hypothalamus. Cell and Tissue Research, 196, 203-212.

Doknic,M., Pekic,S., Zarkovic,M., Medic-Stojanoska,M., Dieguez,C., Casanueva,F., & Popovic,V. (2002) Dopaminergic tone and obesity: an insight from prolactinomas treated with bromocriptine. European journal of endocrinology, 147, 77-84.

Dong,Y. & Benveniste,E.N. (2001) Immune function of astrocytes. GLIA, 36, 180-190.

Douglass,J., McKinzie,A.A., & Couceyro,P. (1995) PCR differential display identifies a rat brain mRNA that is transcriptionally regulated by cocaine and amphetamine. The journal of neuroscience, 15, 2471-2481.

297

Drouhault,R., Guerineau,N.C., Molard,P., Cadoret,M.A., Corcuff,J.B., Vacher,A.M., & Vilayleck,N. (1994) Prolactin and growth hormone release and calcium influx are stimulated by galanin within a ΓÇÿwindowΓÇÖrange of concentrations in pituitary GH3 B6 cells. Neuroendocrinology, 60, 179.

Dube,M.G., Horvath,T.L., Leranth,C., Kalra,P.S., & Kalra,S.P. (1994a) Naloxone reduces the feeding evoked by intracerebroventricular galanin injection. Physiology & behavior, 56, 811.

Dube,M.G., Kalra,P.S., & Kalra,S.P. (1999) Food intake elicited by central administration of orexins/hypocretins: identification of hypothalamic sites of action. Brain Research, 842, 473- 477.

Dube,M.G., Xu,B., Crowley,W.R., Kalra,P.S., & Kalra,S.P. (1994b) Evidence that neuropeptide Y is a physiological signal for normal food intake. Brain Research, 646, 341.

Dumont,Y., Fournier,A., St-Pierre,S., & Quirion,R. (1995) Characterization of neuropeptide Y binding sites in rat brain membrane preparations using [125I][Leu31,Pro34]peptide YY and [125I]peptide YY3-36 as selective Y1 and Y2 radioligands. The Journal of pharmacology and experimental therapeutics, 272, 673-680.

Dungan Lemko,H.M., Clifton,D.K., Steiner,R.A., & Fraley,G.S. (2008) Altered response to metabolic challenges in mice with genetically targeted deletions of galanin-like peptide. AJP - Endocrinology and Metabolism, 295, E605-E612.

Dunn,A.J., Berridge,C.W., Lai,Y.I., & Yachabach,T.L. (1987) CRF-induced excessive grooming behavior in rats and mice. Peptides, 8, 841-844.

Dunning,B.E., Ahren,B., Veith,R.C., Bottcher,G., Sundler,F., & Taborsky,G.J., Jr. (1986) Galanin: a novel pancreatic neuropeptide. Am J Physiol, 251, E127-E133.

Eberhard,N., Holub B, Wagner A, Bauer H.C., & Kofler,B. (2008) Distribution of alarin in adult murine brain.

Eberhard,N., Schmidhuber,S.M., Rauch,I., Sperk G, & Kofler,B. (2007) Immunohistochemical distribution of the novel peptide alarin in the adult rat brain. FEBS Journal, 274, 204.

Edvell,A. (1999) Initiation of increased pancreatic islet growth in young normoglycemic mice (Ume+Ñ ?). Endocrinology, 140, 778-783.

Eertmans,F., Wever,O., Dhooge,W., Berghe,W., Bogaert,V., Bracke,M., Haegerman,G., Cornhaire,F., & Kaufman,J.M. (2007) Estrogen receptor signaling is an unstable feature of the gonadotropic LbetaT2 cell line. Molecular and Cellular Endocrinology, 273, 16-24.

Eipper,B.A. & Mains,R.E. (1988) Peptide alpha-amidation. Annual Review of Physiology, 50, 333-344.

El-Karim,I., Lundy,F.T., Linden,G.J., & Lamey,P.-J. (2003) Extraction and radioimmunoassay quantitation of neuropeptide Y (NPY) and vasoactive intestinal polypeptide (VIP) from human dental pulp tissue. Archives of Oral Biology, 48, 249-254.

298

Elias,C.F., Lee,C., Kelly,J., Aschkenasi,C., Ahima,R.S., Couceyro,P.R., Kuhar,M.J., Saper,C.B., & Elmquist,J.K. (1998a) Leptin activates hypothalamic CART neurons projecting to the spinal cord. Neuron, 21, 1375-1385.

Elias,C.F., Saper,C.B., Maratos-Flier,E., Tritos,N.A., Lee,C., Kelly,J., Tatro,J.B., Hoffman,G.E., Ollmann,M., Barsh,G.S., Sakurai,T., Yanagisawa,M., & Elmquist,J.K. (1998b) Chemically defined projections linking the mediobasal hypothalamus and the lateral hypothalamic area. Journal of comparative neurology, 402, 442-459.

Elliott-Hunt,C., Marsh,B., Bacon,A., Pope,R., Vanderplank,P., & Wynick,D. (2004) Galanin acts as a neuroprotective factor to the hippocampus. Proceedings of the National Academy of Sciences of the United States of America, 101, 5105-5110.

Elliott-Hunt,C., Pope,R., Vanderplank,P., & Wynick,D. (2007) Activation of the galanin receptor 2 (GalR2) protects the hippocampus from neuronal damage. Journal of neurochemistry, 100, 780-789.

Elmquist,J.K., Bjorbek,C., Ahima,R.S., Flier,J.S., & Saper,C.B. (1998) Distributions of leptin receptor mRNA isoforms in the rat brain. Journal of comparative neurology, 395, 535-547.

Elmquist,J.K., Elias,C.F., & Saper,C.B. (1999) From lesions to leptin: hypothalamic control of food intake and body weight. Neuron, 22, 221-232.

Elsworth,J.D. & Roth,R.H. (1997) Dopamine synthesis, uptake, metabolism, and receptors: relevance to gene therapy of Parkinson's disease. Experimental Neurology, 144, 4-9.

Epstein,A.N., Fitzsimons,J.T., & Rolls,B.J. (1970) Drinking induced by injection of angiotensin into the brain of the rat. The Journal of physiology, 210, 457-474.

Erickson,J.C., Clegg,K.E., & Palmiter,R.D. (1996) Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature, 381, 415-421.

Ericson,H. (1991) Origin of neuronal inputs to the region of the tuberomammillary nucleus of the rat brain. Journal of comparative neurology, 311, 45.

Ericson,H., Blomqvist,A., & Kohler,C. (1989) Brain-Stem Afferents to the Tuberomammillary Nucleus in the Rat-Brain with Special Reference to Monoaminergic Innervation. Journal of comparative neurology, 281, 169-192.

Ericson,H., Kohler,C., & Blomqvist,A. (1991) Gaba-Like Immunoreactivity in the Tuberomammillary Nucleus - An Electron-Microscopic Study in the Rat. Journal of comparative neurology, 305, 462-469.

Evans,H.F. & Shine,J. (1991) Human galanin: molecular cloning reveals a unique structure. Endocrinology, 129, 1682.

Everitt,B.J. & Hokfelt,T. (1989) The coexistence of neuropeptide Y with other peptides and amines in the central nervous system. Neuropeptide Y (ed. by V. Mutt, K. Fuxe, T. Hokfelt, & J. Lundberg), pp. 61-72. Raven Press, New York.

299

Fadel,J. & Deutch,A.Y. (2002) Anatomical substrates of orexin-dopamine interactions: lateral hypothalamic projections to the ventral tegmental area. Neuroscience, 111, 379-387.

Fain,J.N., KOVACEV,V.P., & SCOW,R.O. (1966) Antilipolytic Effect of Insulin in Isolated Fat Cells of the Rat. Endocrinology, 78, 773-778.

Farooqi,I.S., Bullmore,E., Keogh,J., Gillard,J., O'Rahilly,S., & Fletcher,P.C. (2007) Leptin Regulates Striatal Regions and Human Eating Behavior. Science, 317, 1355.

Farooqi,I.S., Jebb,S.A., Langmack,G., Lawrence,E., Cheetham,C.H., Prentice,A.M., Hughes,I.A., McCamish,M.A., & O'Rahilly,S. (1999) Effects of recombinant leptin therapy in a child with congenital leptin deficiency. New England Journal of Medicine, The, 341, 879-884.

Fathi,Z., Battaglino,P.M., Iben,L.G., Li,H., Baker,E., Zhang,D., McGovern,R., Mahle,C.D., Sutherland,G.R., Iismaa,T.P., Dickinson,K.E., & Zimanyi,I.A. (1998) Molecular characterization, pharmacological properties and chromosomal localization of the human GALR2 galanin receptor. Molecular brain research, 58, 156-169.

Fathi,Z., Cunningham,A.M., Iben,L.G., Battaglino,P.B., Ward,S.A., Nichol,K.A., Pine,K.A., Wang,J., Goldstein,M.E., Iismaa,T.P., & Zimanyi,I.A. (1997) Cloning, pharmacological characterization and distribution of a novel galanin receptor. Brain Res Mol.Brain Res, 51, 49-59.

Faure-Virelizier,C., Croix,D., Bouret,S., Prevot,V., Reig,S., Beauvillain,J.C., & Mitchell,V. (1998) Effects of estrous cyclicity on the expression of the galanin receptor Gal-R1 in the rat preoptic area: a comparison with the male. Endocrinology, 139, 4127-4139.

Fehmann,H.C., Goke,R., & Goke,B. (1995) Cell and molecular biology of the incretin hormones glucagon-like peptide-I and glucose-dependent insulin releasing polypeptide. Endocrine reviews, 16, 390.

Fehmann,H.C., Jiang,J., Schweinfurth,J., Wheeler,M.B., Boyd,A.E., & Goke,B. (1994) Stable expression of the rat GLP-I receptor in CHO cells: activation and binding characteristics utilizing GLP-I (7- 36)-amide, oxyntomodulin, exendin-4, and exendin (9-39). Peptides, 15, 453.

Fekete,C. (2001) Neuropeptide Y has a central inhibitory action on the hypothalamic-pituitary- thyroid axis. Endocrinology, 142, 2606-2613.

Fernandez-Fernandez,R., Martini,A.C., Navarro,V.M., Castellano,J.M., Dieguez,C., Aguilar,E., Pinilla,L., & Tena-Sempere,M. (2006) Novel signals for the integration of energy balance and reproduction. Molecular and Cellular Endocrinology, 254-255, 127-132.

Fetissov,S., Jacoby,A.S., Brumovsky,P., Shine,J., Iismaa,T., & Hokfelt,T. (2003) Altered hippocampal expression of neuropeptides in seizure-prone GALR1 knockout mice. Epilepsia, 44, 1022- 1033.

Figlewicz,D.P., Bennett,J., Aliakbari,S., Zavosh,A., & Sipols,A.J. (2008) Insulin acts at different CNS sites to decrease acute sucrose intake and sucrose self-administration in rats. American journal of physiology.regulatory, integrative and comparative physiology, 295, R388-R394.

Figlewicz,D.P., Bennett,J., Naleid,A., Davis,C., & Grimm,J. (2006) Intraventricular insulin and leptin decrease sucrose self-administration in rats. Physiology & behavior, 89, 611-616. 300

Figlewicz,D.P., Bennett,J.L., MacDonald Naleid,A., Davis,C., & Grimm,J.W. (2004) Intraventricular insulin and leptin reverse place preference conditioned with high-fat diet in rats. Behavioral neuroscience, 118, 479.

Figlewicz,D.P., Brot,M.D., McCall,A.L., & Szot,P. (1996) Diabetes causes differential changes in CNS noradrenergic and dopaminergic neurons in the rat: a molecular study. Brain Research, 736, 54-60.

Figlewicz,D.P., Evans,S.B., Murphy,J., Hoen,M., & Baskin,D.G. (2003) Expression of receptors for insulin and leptin in the ventral tegmental area/substantia nigra (VTA/SN) of the rat. Brain Research, 964, 107-115.

Figlewicz,D.P., Higgins,M.S., Ng-Evans,S.B., & Havel,P.J. (2001) Leptin reverses sucrose-conditioned place preference in food-restricted rats. Physiology & behavior, 73, 229-234.

Figlewicz,D.P., Naleid,A.M., & Sipols,A.J. (2007) Modulation of food reward by adiposity signals. Physiology & behavior, 91, 473-478.

Figlewicz,D.P., Patterson,T.A., Johnson,L.B., Zavosh,A., Israel,P.A., & Szot,P. (1998) Dopamine transporter mRNA is increased in the CNS of Zucker fatty (fa/fa) rats. Brain Research Bulletin, 46, 199-202.

Figlewicz,D.P., Szot,P., Chavez,M., Woods,S.C., & Veith,R.C. (1994) Intraventricular insulin increases dopamine transporter mRNA in rat VTA/substantia nigra. Brain Research, 644, 331.

Fink,G. (1988) Oestrogen and progesterone interactions in the control of gonadotrophin and prolactin secretion. J Steroid Biochem., 30, 169-178.

Finlayson,G., King,N., & Blundell,J.E. (2007) Liking vs. wanting food: Importance for human appetite control and weight regulation. Neuroscience & Biobehavioral Reviews, 31, 987-1002.

Finn,P.D., Steiner,R.A., & Clifton,D.K. (1998) Temporal patterns of gonadotropin-releasing hormone (GnRH), c-fos, and galanin gene expression in GnRH neurons relative to the luteinizing hormone surge in the rat. The journal of neuroscience, 18, 713-719.

Fisher,L.A. (1993) Central actions of corticotropin-releasing factor on autonomic nervous activity and cardiovascular functioning. Ciba Foundation symposium, 172, 243-253.

Fisone,G., Wu,C.F., Consolo,S., Nordstrom,O., Brynne,N., Bartfai,T., Melander,T., & Hokfelt,T. (1987) Galanin inhibits acetylcholine release in the ventral hippocampus of the rat: histochemical, autoradiographic, in vivo, and in vitro studies. Proceedings of the National Academy of Sciences of the United States of America, 84, 7339-7343.

Fliers,E., Noppen,N.W.A.M., Wiersinga,W.M., Visser,T.J., & Swaab,D.F. (1994) Distribution of thyrotropin-releasing hormone (TRH)-containing cells and fibers in the human hypothalamus. Journal of comparative neurology, 350, 311.

Flint,A., Raben,A., Ersboll,A.K., Holst,J.J., & Astrup,A. (2001) The effect of physiological levels of glucagon-like peptide-1 on appetite, gastric emptying, energy and substrate metabolism in obesity. International Journal of Obesity, 25, 781-792.

301

Fong,T.M., Mao,C., MacNeil,T., Kalyani,R., Smith,T., Weinberg,D., Tota,M.R., & Van Der Ploeg,L.H. (1997) ART (protein product of agouti-related transcript) as an antagonist of MC-3 and MC-4 receptors. Biochemical and biophysical research communications, 237, 629-631.

Fraley,G.S. (2006) Immunolesions of glucoresponsive projections to the arcuate nucleus alter glucoprivic-induced alterations in food intake, luteinizing hormone secretion, and GALP mRNA, but not sex behavior in adult male rats. Neuroendocrinology, 83, 97-105.

Fraley,G.S., Scarlett,J.M., Shimada,I., Teklemichael,D.N., Acohido,B.V., Clifton,D.K., & Steiner,R.A. (2004a) Effects of diabetes and insulin on the expression of galanin-like peptide in the hypothalamus of the rat. Diabetes, 53, 1237-1242.

Fraley,G.S., Shimada,I., Baumgartner,J.W., Clifton,D.K., & Steiner,R.A. (2003) Differential patterns of Fos induction in the hypothalamus of the rat following central injections of galanin-like peptide and galanin. Endocrinology, 144, 1143-1146.

Fraley,G.S., Thomas-Smith,S.E., Acohido,B.V., Steiner,R.A., & Clifton,D.K. (2004b) Stimulation of sexual behavior in the male rat by galanin-like peptide. Horm.Behav., 46, 551-557.

Fray,P.J., Sahakian,B.J., Robbins,T.W., Koob,G.F., & Iversen,S.D. (1980) An observational method for quantifying the behavioural effects of dopamine agonists: contrasting effects of d- amphetamine and apomorphine. Psychopharmacology (Berl), 69, 253-259.

Frederich,R.C., Hamann,A., Anderson,S., Lollmann,B., Lowell,B.B., & Flier,J.S. (1995a) Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nature Medicine, 1, 1311.

Frederich,R.C., Lollmann,B., Hamann,A., Napolitano-Rosen,A., Kahn,B.B., Lowell,B.B., & Flier,J.S. (1995b) Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity. Journal of Clinical Investigation, 96, 1658-1663.

Freeman,M.E. The neuroendocrine control of the ovarian cycle of the rat. The Physiology of Reproduction, E Knobil, JD Neill , 613-658. 1994. New York, Raven Press. Ref Type: Generic

Friedman,J.M. & Halaas,J.L. (1998) Leptin and the regulation of body weight in mammals. Nature, 395, 763-770.

Fujiwara,K., Adachi,S., Usui,K., Maruyama,M., Matsumoto,H., Ohtaki,T., Kitada,C., Onda,H., Fujino,M., & Inoue,K. (2002) Immunocytochemical localization of a galanin-like peptide (GALP) in pituicytes of the rat posterior pituitary gland. Neurosci Lett., 317, 65-68.

Fulton,S., Pissios,P., Manchon,R., Stiles,L., Frank,L., Pothos,E.N., Maratos-Flier,E., & Flier,J. (2006) Leptin regulation of the mesoaccumbens dopamine pathway. Neuron, 51, 811-822.

Fulton,S., Woodside,B., & Shizgal,P. (2000) Modulation of brain reward circuitry by leptin. Science, 287, 125-128.

Funakoshi,A., Miyasaka,K., Shinozaki,H., Masuda,M., Kawanami,T., Takata,Y., & Kono,A. (1995) An animal model of congenital defect of gene expression of cholecystokinin (CCK)-A receptor. Biochemical and biophysical research communications, 210, 787-796. 302

Gabriel,S.M., Koenig,J.I., & Kaplan,L.M. (1990) Galanin-like immunoreactivity is influenced by estrogen in peripubertal and adult rats. Neuroendocrinology, 51, 168.

Gabriel,S.M., Milbury,C.M., Nathanson,J.A., & Martin,J.B. (1988) Galanin stimulates rat pituitary growth hormone secretion in vitro. Life Sciences, 42, 1981-1986.

Gautron,L., Lafon,P., Tramu,G., & Lay+®,S. (2003) In vivo Activation of the Interleukin-6 Receptor/gp130 Signaling Pathway in Pituitary Corticotropes of Lipopolysaccharide-Treated Rats. Neuroendocrinology, 77, 32-43.

Gaymann,W. & Martin,R. (1989) Immunoreactive galanin-like material in magnocellular hypothalamo-neurohypophysial neurones of the rat. Cell Tissue Res., 255, 139-147.

Geisler,S. & Zahm,D.S. (2005) Afferents of the ventral tegmental area in the rat-anatomical substratum for integrative functions. Journal of comparative neurology, 490, 270-294.

Gentleman,S.M., Falkai,P., Bogerts,B., Herrero,M.T., Polak,J.M., & Roberts,G.W. (1989) Distribution of galanin-like immunoreactivity in the human brain. Brain Res, 505, 311-315.

Georgescu,D., Sears,R.M., Hommel,J.D., Barrot,M., Bolaos,C., Marsh,D., Bednarek,M., Bibb,J., Maratos-Flier,E., Nestler,E., & DiLeone,R.J. (2005) The hypothalamic neuropeptide melanin- concentrating hormone acts in the nucleus accumbens to modulate feeding behavior and forced-swim performance. The journal of neuroscience, 25, 2933-2940.

Georgescu,D., Zachariou,V., Barrot,M., Meida,M., Willie,J., Eisch,A., Yanagisawa,M., Nestler,E., & DiLeone,R.J. (2003) Involvement of the lateral hypothalamic peptide orexin in morphine dependence and withdrawal. The journal of neuroscience, 23, 3106-3111.

Ghersi,G., Chen,W.T., Lee,E.W., & Zukowska,Z. (2001) Critical role of dipeptidyl peptidase IV in neuropeptide Y-mediated endothelial cell migration in response to wounding. Peptides, 22, 453-458.

Ghigo,E., Maccario,M., Arvat,E., Valetto,M.R., Valente,F., Nicolosi,M., Mazza,E., Martina,V., Cocchi,D., & Carmanni,F. (1992) Interactions of galanin and arginine on growth hormone, prolactin, and insulin secretion in man. Metabolism, clinical and experimental, 41, 85.

Gibbs,J., Young,R.C., & Smith,G.P. (1973) Cholecystokinin decreases food intake in rats. The Journal of comparative and physiological psychology, 84, 488-495.

Gibson,S., Crosby,S.R., Stewart,M.F., Jennings,A.M., McCall,E., & White,A. (1994) Differential release of proopiomelanocortin-derived peptides from the human pituitary: evidence from a panel of two-site immunoradiometric assays. Journal of Clinical Endocrinology Metabolism, 78, 835-841.

Gillard,E.R., Dang,D.Q., & Stanley,B.G. (1993) Evidence that neuropeptide Y and dopamine in the perifornical hypothalamus interact antagonistically in the control of food intake. Brain Research, 628, 128.

Giros,B., Jaber,M., Jones,S.R., Wightman,R.M., & Caron,M.G. (1996) Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature, 379, 606-612. 303

Giustina,A., Girelli,A., Licini,M., Schettino,M., & Negro-Vilar,A. (1992) Thyrotropin and prolactin secretion are not affected by porcine and rat galanin in normal subjects. Hormone and metabolic research, 24, 351-352.

Giustina,A., Licini,M., Schettino,M., Doga,M., Pizzocolo,G., & Negro-Vilar,A. (1994) Physiological role of galanin in the regulation of anterior pituitary function in humans. American journal of physiology: endocrinology and metabolism, 266, E57.

Glass,G.B. (1980) Comprehensive Endocrinology: Gastrointestinal Hormones, Raven Press, New York.

Glover,I.D., Barlow,D.J., Pitts,J.E., Wood,S.P., Tickle,I.J., Blundell,T.L., Tatemoto,K., Kimmel,J.R., Wollmer,A., Strassburger,W., & Zhang,Y.S. (1984) Conformational studies on the pancreatic polypeptide hormone family. European journal of biochemistry, 142, 379.

Goodman,R.L. & Daniel,K. (1985) Modulation of pulsatile luteinizing hormone secretion by ovarian steroids in the rat. Biol.Reprod., 32, 217-225.

Gopalan,C., Tian,Y., Moore,K.E., & Lookingland,K.J. (1993) Neurochemical evidence that the inhibitory effect of galanin on tuberoinfundibular dopamine neurons is activity dependent. Neuroendocrinology, 58, 287.

Gorbatyuk,O. & Hokfelt,T. (1998a) Effect of inhibition of glucose and fat metabolism on galanin-R1 receptor mRNA levels in the rat hypothalamic paraventricular and supraoptic nuclei. Neuroreport, 9, 3565-3569.

Gorbatyuk,O. & Hokfelt,T. (1998b) Effects of antimetabolites to glucose and fatty acids on galanin-1 receptor mRNA levels in the hypothalamic paraventricular and supraoptic nuclei. Annals of the New York Academy of Sciences, 863, 430-431.

Gottsch,M.L., Clifton,D.K., & Steiner,R.A. (2004) Galanin-like peptide as a link in the integration of metabolism and reproduction. Trends Endocrinol.Metab, 15, 215-221.

Gottsch,M.L., Zeng,H., Hohmann,J.G., Weinshenker,D., Clifton,D.K., & Steiner,R.A. (2005) Phenotypic analysis of mice deficient in the type 2 galanin receptor (GALR2). Mol.Cell Biol., 25, 4804- 4811.

Grace,A. & Bunney,B. (1995) Electrophysiological properties of midbrain dopamine neurons. Psychopharmacology: The Fourth Generation of Progress (ed. by F. Bloom & D. Kupfer), pp. 163-177. Raven Press, New York.

Graham,M., Shutter,J.R., Sarmiento,U., Sarosi,I., & Stark,K.L. (1997) Overexpression of Agrt leads to obesity in transgenic mice. Nature Genetics, 17, 273.

Grandison,L. & Guidotti,A. (1977) Stimulation of food intake by muscimol and beta endorphin. Neuropharmacology, 16, 533-536.

Grandt,D. (1993) [Proteolytic processing by dipeptidyl aminopeptidase IV generates receptor selectivity for peptide YY (PYY)]. Medizinische Klinik, 88, 143-145.

Gray H (1980) Gray's Anatomy, 36 edn.

304

Green,P.G., Basbaum,A.I., & Levine,J.D. (1992) Sensory neuropeptide interactions in the production of plasma extravasation in the rat. Neuroscience, 50, 745-749.

Gregory,S.J. & Kaiser,U.B. (2004) Regulation of Gonadotropins by Inhibin and Activin. Semin Reprod Med, 22, 253-267.

Grill,H.J., Ginsberg,A.B., Seeley,R.J., & Kaplan,J.M. (1998) Brainstem Application of Melanocortin Receptor Ligands Produces Long-Lasting Effects on Feeding and Body Weight. Journal of Neuroscience, 18, 10128-10135.

Grill,H.J., Schwartz,M.W., Kaplan,J.M., Foxhall,J., Breininger,J.F., & Baskin,D.G. (2002) Evidence that the caudal brainstem is a target for the inhibitory effect of leptin on food intake. Endocrinology, 143, 239-246.

Grill,H.J. & Smith,G.P. (1988) Cholecystokinin decreases sucrose intake in chronic decerebrate rats. American journal of physiology.regulatory, integrative and comparative physiology, 254, 853.

Grimm,Y. & Reichlin,S. (1973) Thyrotropin-releasing hormone (TRH): neurotransmitter regulation of secretion by mouse hypothalamic tissue in vitro. Endocrinology, 93, 626.

Grossman,S.P. (1962) Direct adrenergic and cholinergic stimulation of hypothalamic mechanisms. American journal of physiology, 202, 872-882.

Grottoli,S., Arvat,E., Gianotti,L., Ramunni,J., Di Vito,L., Maccagno,B., Ciccarelli,E., Camanni,F., & Ghigo,E. (1996) Galanin positively modulates prolactin secretion in normal women. Journal of endocrinological investigation, 19, 739-744.

Guan,X.M., Yu,H., Palyha,O.C., McKee,K.K., Feighner,S.D., Sirinathsinghji,D.J.S., Smith,R.G., Van der Ploeg,L.H.T., & Howard,A.D. (1997) Distribution of mRNA encoding the growth hormone secretagogue receptor in brain and peripheral tissues. Molecular brain research, 48, 23-29.

Gundlach,A.L. (2002) Galanin/GALP and galanin receptors: role in central control of feeding, body weight/obesity and reproduction? Eur.J.Pharmacol., 440, 255-268.

Gustafson,E.L., Smith,K.E., Durkin,M.M., Gerald,C., & Branchek,T.A. (1996) Distribution of a rat galanin receptor mRNA in rat brain. Neuroreport, 7, 953-957.

Gygi,S.P., Rochon,Y., Franza,B.R., & Aebersold,R. (1999) Correlation between Protein and mRNA Abundance in Yeast. Molecular and Cellular Biology, 19, 1720-1730.

Haas,H. & Panula,P. (2003) The role of histamine and the tuberomamillary nucleus in the nervous system. Nature Reviews.Neuroscience, 4, 121-130.

Habert-Ortoli,E., Amiranoff,B., Loquet,I., Laburthe,M., & Mayaux,J.F. (1994) Molecular cloning of a functional human galanin receptor. Proc.Natl.Acad.Sci.U.S.A, 91, 9780-9783.

Hahn,T.M., Breininger,J.F., Baskin,D.G., & Schwartz,M.W. (1998) Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat.Neurosci., 1, 271-272.

305

Hakansson,M.L., Brown,H., Ghilardi,N., Skoda,R.C., & Meister,B. (1998) Leptin receptor immunoreactivity in chemically defined target neurons of the hypothalamus. The journal of neuroscience, 18, 559-572.

Halaas,J.L., Boozer,C., Blair-West,J., Fidahusein,N., Denton,D.A., & Friedman,J.M. (1997) Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proceedings of the National Academy of Sciences of the United States of America, 94, 8878- 8883.

Halaas,J.L., Gajiwala,K.S., Maffei,M., Cohen,S.L., Chait,B.T., Rabinowitz,D., Lallone,R.L., Burley,S.K., & Friedman,J.M. (1995) Weight-reducing effects of the plasma protein encoded by the obese gene. Science, 269, 543-546.

Halliday,G.M. & Tork,I. (1986) Comparative anatomy of the ventromedial mesencephalic tegmentum in the rat, cat, monkey and human. Journal of comparative neurology, 252, 423-445.

Hamernik,D.L. & Nett,T.M. (1988) Gonadotropin-releasing hormone increases the amount of messenger ribonucleic acid for gonadotropins in ovariectomized ewes after hypothalamic- pituitary disconnection. Endocrinology, 122, 959-966.

Hammond,P.J., Khandan-Nia,N., Withers,D.J., Jones,P.M., Ghatei,M.A., & Bloom,S.R. (1997) Regulation of anterior pituitary galanin and vasoactive intestinal peptide by oestrogen and prolactin status. The Journal of endocrinology, 152, 211.

Hammond,P.J., Smith,D.M., Akinsanya,K.O., Mufti,W.A., Wynick,D., & Bloom,S.R. (1996) Signalling pathways mediating secretory and mitogenic responses to galanin and pituitary adenylate cyclase-activating polypeptide in the 235-1 clonal rat lactotroph cell line. Journal of neuroendocrinology, 8, 457.

Hansen,K.R., Krasnow,S.M., Nolan,M.A., Fraley,G.S., Baumgartner,J.W., Clifton,D.K., & Steiner,R.A. (2003) Activation of the sympathetic nervous system by galanin-like peptide--a possible link between leptin and metabolism. Endocrinology, 144, 4709-4717.

Hao,J.X., Shi,T.J., Xu,I.S., Kaupilla,T., Xu,X.J., Hokfelt,T., Bartfai,T., & Wiesenfeld-Hallin,Z. (1999) Intrathecal galanin alleviates allodynia-like behaviour in rats after partial peripheral nerve injury. The European journal of neuroscience, 11, 427-432.

Harris,A.R.C., Christianson,D., Smith,M.S., Braverman,L.E., & Vagenakis,A.G. (1978) The physiological role of thyrotropin-releasing hormone in the regulation of thyroid-stimulating hormone and prolactin secretion in the rat. Journal of Clinical Investigation, 61, 441-448.

Harris,G., Wimmer,M., & Aston-Jones,G. (2005) A role for lateral hypothalamic orexin neurons in reward seeking. Nature, 437, 556-559.

Hartman,M.L., Clayton,P.E., Johnson,M.L., Celniker,A., Perlman,A.J., Alberti,K.G., & Thorner,M.O. (1993) A low dose euglycemic infusion of recombinant human insulin-like growth factor I rapidly suppresses fasting-enhanced pulsatile growth hormone secretion in humans. Journal of Clinical Investigation, 91, 2453-2462.

306

Hashimoto,K., Ohno,N., Aoki,Y., Kageyama,J., Takahara,J., & Ofuji,T. (1982) Distribution and characterization of corticotropin-releasing factor and arginine vasopressin in rat hypothalamic nuclei. Neuroendocrinology, 34, 32.

Haskell-Luevano,C., Chen,P., Li,C., Chang,K., Smith,M.S., Cameron,J.L., & Cone,R.D. (1999) Characterization of the neuroanatomical distribution of agouti-related protein immunoreactivity in the rhesus monkey and the rat. Endocrinology, 140, 1408-1415.

Hatton,G.I., Hutton,U.E., Hoblitzell,E.R., & Armstrong,W.E. (1976) Morphological evidence for two populations of magnocellular elements in the rat paraventricular nucleus. Brain Res., 108, 187-193.

Hawes,J.J., Narasimhaiah,R., & Picciotto,M.R. (2006) Galanin attenuates cyclic AMP regulatory element-binding protein (CREB) phosphorylation induced by chronic morphine and naloxone challenge in Cath.a cells and primary striatal cultures. Journal of neurochemistry, 96, 1160- 1168.

Hay-Schmidt,A., Helboe,L., & Larsen,P.J. (2001) Leptin receptor immunoreactivity is present in ascending serotonergic and catecholaminergic neurons of the rat. Neuroendocrinology, 73, 215-226.

Hendry,S.H.C. (1993) Organization of neuropeptide Y neurons in the mammalian central nervous system. The Biology of Neuropeptide Y and Related Peptides (ed. by W. F. Colmers & C. Wahlestedt), pp. 65-156. Humana Press, New Jersey.

Herman,J.P., Prewitt,C.M., & Cullinan,W.E. (1996) Neuronal circuit regulation of the hypothalamo- pituitary-adrenocortical stress axis. Critical reviews in neurobiology, 10, 371-394.

Hervieu,G.J., Cluderay,J.E., Harrison,D., Meakin,J., Maycox,P., Nasir,S., & Leslie,R.A. (2000) The distribution of the mRNA and protein products of the melanin-concentrating hormone (MCH) receptor gene, slc-1, in the central nervous system of the rat. The European journal of neuroscience, 12, 1194-1216.

Hetherington A.W. & Ranson S.W. (1940) Hypothalamic lesions and adiposity in the rat. Nutrition Classics.The Anatomical Record, 78, 124-127.

Heuer,H., Schafer,M.K., & Bauer,K. (1999) Thyrotropin-releasing hormone (TRH), a signal peptide of the central nervous system. Acta medica Austriaca, 26, 119-122.

Heuer,H., Schafer,M.K., O'Donnell,D., Walker,P., & Bauer,K. (2000) Expression of thyrotropin- releasing hormone receptor 2 (TRH-R2) in the central nervous system of rats. Journal of comparative neurology, 428, 319-336.

Heymsfield,S.B., Greenbers,A.S., Fujioka,K., Dixon,R.M., Kushner,R., Hunt,T., Lubina,J.A., Patane,J., Self,B., Hunt,P., & McCamish,M. (1999) Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. JAMA, 282, 1568-1575.

Hobson,S.A., Holmes,F.E., & Kerr,N.C. (2006) Mice deficient for galanin receptor 2 have decreased neurite outgrowth from adult sensory neurons and impaired pain-like behaviour. Journal of neurochemistry, 99, 1000-1010.

307

Hoffman G.E., Lee W-S., & Wray S (1992) Gonadotrophin releasing hormone (GnRH). Neuroendocrinology (ed. by Nemeroff C.B.).

Hohmann,J.G., Krasnow,S.M., Teklemichael,D.N., Clifton,D.K., Wynick,D., & Steiner,R.A. (2003) Neuroendocrine profiles in galanin-overexpressing and knockout mice. Neuroendocrinology, 77, 354-366.

Hokfelt,T., Johansson,O., & Goldstein,M. (1984) Chemical anatomy of the brain. Science, 225, 1326- 1334.

Hokfelt,T., Wiesenfeld-Hallin,Z., Villar,M., & Melander,T. (1987) Increase of galanin-like immunoreactivity in rat dorsal root ganglion cells after peripheral axotomy. Neuroscience Letters, 83, 217.

Holmes,A., Kinney,J., Wrenn,C.C., Li,Q., Yang,R.J., Ma,L., Vishwanath,J., Saavedra,M., Innerfield,C., Jacoby,A.S., Shine,J., Iismaa,T., & Crawley,J.N. (2003) Galanin GAL-R1 receptor null mutant mice display increased anxiety-like behavior specific to the elevated plus-maze. Neuropsychopharmacology, 28, 1031-1044.

Holmes,F.E., Mahoney,S., King,V.R., Bacon,A., Kerr,N.C.H., Pchnis,V., Curtis,R., Priestley,J.V., & Wynick,D. (2000) Targeted disruption of the galanin gene reduces the number of sensory neurons and their regenerative capacity. Proceedings of the National Academy of Sciences of the United States of America, 97, 11563-11568.

Holst,J.J. (2007) The Physiology of Glucagon-like Peptide 1. Physiological reviews, 87, 1409-1439.

Hommel,J.D., Trinko,R., Sears,R.M., Georgescu,D., Liu,Z.W., Gao,X.B., Thurmon,J.J., Marinelli,M., & DiLeone,R.J. (2006) Leptin receptor signaling in midbrain dopamine neurons regulates feeding. Neuron, 51, 801-810.

Hooi,S.C., Maiter,D.M., Martin,J.B., & Koenig,J.I. (1990a) Galaninergic Mechanisms Are Involved in the Regulation of Corticotropin and Thyrotropin Secretion in the Rat. Endocrinology, 127, 2281-2289.

Hooi,S.C., Maiter,D.M., Martin,J.B., & Koenig,J.I. (1990b) Galaninergic Mechanisms Are Involved in the Regulation of Corticotropin and Thyrotropin Secretion in the Rat. Endocrinology, 127, 2281-2289.

Horrocks,P.M., Jones,A.F., Ratcliffe,W.A., Holder,G., White,A., Holder,R., Ratcliffe,J.G., & London,D.R. (1990) Patterns of ACTH and cortisol pulsatility over twenty-four hours in normal males and females. Clinical endocrinology, 32, 127.

Horst,G.J., De Boer,P., Luiten,P.G.M., & Van Willigen,J.D. (1989) Ascending projections from the solitary tract nucleus to the hypothalamus. A Phaseolus vulgaris lectin tracing study in the rat. Neuroscience, 31, 785.

Horvath,T.L., Kalra,S.P., Naftolin,F., & Leranth,C. (1995) Morphological evidence for a galanin-opiate interaction in the rat mediobasal hypothalamus. Journal of neuroendocrinology, 7, 579.

308

Horvath,T.L., Naftolin,F., Leranth,C., Sahu,A., & Kalra,S.P. (1996) Morphological and pharmacological evidence for neuropeptide Y-galanin interaction in the rat hypothalamus. Endocrinology, 137, 3069.

Howard,A.D., Tan,C., Shiao,L.L., Palyha,O.C., McKee,K.K., Weinberg,D.H., Feighner,S.D., Cascieri,M.A., Smith,R.G., Van Der Ploeg,L.H., & Sullivan,K.A. (1997) Molecular cloning and characterization of a new receptor for galanin. FEBS Lett., 405, 285-290.

Hrabovszky,E. & Liposits,Z. (1994) Galanin-containing axons synapse on tyrosine hydroxylase- immunoreactive neurons in the hypothalamic arcuate nucleus of the rat. Brain Research, 652, 49.

Hsu,D.W., el-Azouzi,M., Black,P.M., Chin,W.W., Hedley-Whyte,E.T., & Kaplan,L.M. (1990) Estrogen increases galanin immunoreactivity in hyperplastic prolactin-secreting cells in Fisher 344 rats. Endocrinology, 126, 3159-3167.

Hsu,D.W., Hooi,S.C., Hedley-Whyte,E.T., Strauss,R.M., & Kaplan,L.M. (1991) Coexpression of galanin and adrenocorticotropic hormone in human pituitary and pituitary adenomas. The American Journal of Pathology, 138, 897-909.

Hu,L. & Lawson,D.M. (1995) In vitro prolactin release from pituitaries of ovariectomized, estradiol- treated holtzman rats: A direct comparison of dispersed cells and tissue explants. Life Sciences, 58, 229-237.

Hubert,G. & Kuhar,M.J. (2006) Colocalization of CART peptide with prodynorphin and dopamine D1 receptors in the rat nucleus accumbens. Neuropeptides, 40, 409-415.

Hubscher,C.H., Brooks,D.L., & Johnson,J.R. (2005) A quantitative method for assessing stages of the rat estrous cycle. Biotechnic & histochemistry, 80, 79.

Huhtaniemi,I. (2000) The Parkes lecture. Mutations of gonadotrophin and gonadotrophin receptor genes: what do they teach us about reproductive physiology? J Reprod.Fertil., 119, 173-186.

Hull,C.L. (1952) A Behaviour System, Yale University Press, New Haven.

Hull,E.M., Bitran,D., Pehek,E.A., Warner,R.K., Band,L.C., & Holmes,G.M. (1986) Dopaminergic control of male sex behavior in rats: effects of an intracerebrally-infused agonist. Brain Research, 370, 73.

Hunter,R.G., Jones,D.N., Vicentic,A., Hue,G., Rye,D., & Kuhar,M.J. (2006) Regulation of CART mRNA in the rat nucleus accumbens via D3 dopamine receptors. Neuropharmacology, 50, 858-864.

Hunter,W.M., FRIEND,J.A.R., & STRONG,J.A. (1966) THE DIURNAL PATTERN OF PLASMA GROWTH HORMONE CONCENTRATION IN ADULTS. Journal of Endocrinology, 34, 139-146.

Huszar,D., Lynch,C.A., Fairchild-Huntress,V., Dunmore,J.H., Fang,Q., Berkemeier,L.R., Gu,W., Kesteson,R.A., Boston,B.A., Cone,R.D., Smith,F.J., Campfield,L.A., Burn,P., & Lee,F. (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell, 88, 131- 141.

309

Hyde,J.F., Engle,M.G., & Maley,B.E. (1991) Colocalization of galanin and prolactin within secretory granules of anterior pituitary cells in estrogen-treated Fischer 344 rats. Endocrinology, 129, 270.

Ida,T., Nakahara,K., Katayama,T., Murakami,N., & Nakazato,M. (1999) Effect of lateral cerebroventricular injection of the appetite-stimulating neuropeptide, orexin and neuropeptide Y, on the various behavioral activities of rats. Brain Res., 821, 526-529.

Ikemoto,S. (2007) Dopamine reward circuitry: Two projection systems from the ventral midbrain to the nucleus accumbens-olfactory tubercle complex. Brain Research Reviews, 56, 27-78.

Inoue,T., Kato,Y., Koshiyama,H., Yanaihara,N., & Imura,H. (1988) Galanin stimulates the release of vasoactive intestinal polypeptide from perifused hypothalamic fragments in vitro and from periventricular structures into the cerebrospinal fluid in vivo in the rat. Neuroscience Letters, 85, 95.

Invitti,C., Brunani,A., Pasqualinotto,L., Dubini,A., Bendinelli,P., Maroni,P., & Cavagnini,F. (1995) Plasma galanin concentrations in obese, normal weight and anorectic women. International Journal of Obesity, 19, 347.

Invitti,C., Pecori Giraldi,F., Tagliaferri,A., Scacchi,M., Dubini,A., & Cavagnini,F. (1993) Enhanced prolactin responsiveness to galanin in patients with Cushing's disease. Clinical endocrinology, 39, 213.

Irwig,M., Fraley,G.S., Smith,J., Acohido,B.V., Popa,S., Cunningham,M.J., Gottsch,M.L., Clifton,D.K., & Steiner,R.A. (2004) Kisspeptin activation of gonadotropin releasing hormone neurons and regulation of KiSS-1 mRNA in the male rat. Neuroendocrinology, 80, 264-272.

Ishikawa,K., Taniguchi,Y., Inoue,K., Kurosumi,K., & Suzuki,M. (1988) Immunocytochemical delineation of thyrotrophic area: origin of thyrotropin-releasing hormone in the median eminence. Neuroendocrinology, 47, 384-388.

Jacob,R.J., Dziura,J., Medwick,M.B., Leone,P., Caprio,S., During,M., Shulman,G.I., & Sherwin,R.S. (1997) The effect of leptin is enhanced by microinjection into the ventromedial hypothalamus. Diabetes, 46, 150.

Jacobowitz,D.M., Kresse,A., & Skofitsch,G. (2004) Galanin in the brain: chemoarchitectonics and brain cartography--a historical review. Peptides, 25, 433-464.

Jacobowitz,D.M. & O'Donohue,T.L. (1978) alpha-Melanocyte stimulating hormone: immunohistochemical identification and mapping in neurons of rat brain. Proceedings of the National Academy of Sciences of the United States of America, 75, 6300-6304.

Jacoby,A.S., Hort,Y.J., Constantinescu,G., Shine,J., & Iismaa,T.P. (2002) Critical role for GALR1 galanin receptor in galanin regulation of neuroendocrine function and seizure activity. Brain Res Mol.Brain Res, 107, 195-200.

Jaworski,J.N., Kozel,M.A., Philpot,K.B., & Kuhar,M.J. (2003a) Intra-Accumbal Injection of CART (Cocaine-Amphetamine Regulated Transcript) Peptide Reduces Cocaine-Induced Locomotor Activity. Journal of Pharmacology and Experimental Therapeutics, 307, 1038-1044.

310

Jaworski,J.N., Vicentic,A., Hunter,R.G., Kimmel,H.L., & Kuhar,M.J. (2003b) CART peptides are modulators of mesolimbic dopamine and psychostimulants. Life Sci., 73, 741-747.

Jean,A., Conductier,G., Manrique,C., Bouras,C., Berta,P., Hen,R., Charnay,Y., Bockaert,J., & Compan,V. (2007) Anorexia induced by activation of serotonin 5-HT4 receptors is mediated by increases in CART in the nucleus accumbens. Proceedings of the National Academy of Sciences of the United States of America, 104, 16335-16340.

Jerlhag,E., Egecioglu,E., Dickson,S.L., Andersson,M., Svensson,L., & Engel,J.A. (2006) Ghrelin stimulates locomotor activity and accumbal dopamine-overflow via central cholinergic systems in mice: implications for its involvement in brain reward. Addiction biology, 11, 45.

Jerlhag,E., Egecioglu,E., Dickson,S.L., Douhan,A., Svensson,L., & Engel,J.A. (2007) Ghrelin administration into tegmental areas stimulates locomotor activity and increases extracellular concentration of dopamine in the nucleus accumbens. Addiction biology, 12, 6.

Jewett,D.C., Cleary,J., Levine,A.S., Schaal,D.W., & Thompson,T. (1995) Effects of neuropeptide Y, insulin, 2-deoxyglucose, and food deprivation on food-motivated behavior. Psychopharmacology, 120, 267-271.

Jhanwar-Uniyal,M. & Chua,S.C. (1993) Critical effects of aging and nutritional state on hypothalamic neuropeptide Y and galanin gene expression in lean and genetically obese Zucker rats. Molecular brain research, 19, 195.

Ji,R.R., Zhang,X., Zhang,Q., Dagerlind,A., Nilsson,S., Wiesenfeld-Hallin,Z., & Hokfelt,T. (1995) Central and peripheral expression of galanin in response to inflammation. Neuroscience, 68, 563- 576.

Jimenez-Linan,M., Rubin,B.S., & King,J.C. (1997) Examination of guinea pig luteinizing hormone- releasing hormone gene reveals a unique decapeptide and existence of two transcripts in the brain. Endocrinology, 138, 4123-4130.

Johansson,A., Fredriksson,R., Winnergren,S., Hulting,A.L., Schith,H., & Lindblom,J. (2008) The relative impact of chronic food restriction and acute food deprivation on plasma hormone levels and hypothalamic neuropeptide expression. Peptides, 29, 1588-1595.

Johnson,P.M. & Kenny,P.J. (2010) Dopamine D2 receptors in addiction-like reward dysfunction and compulsive eating in obese rats. Nature Neuroscience, 13, 635-641.

Johnson,S.W. & North,R.A. (1992) Opioids excite dopamine neurons by hyperpolarization of local interneurons. The journal of neuroscience, 12, 483-488.

Jones,D.N., Gartlon,J., Parker,F., Taylor,S.G., Routledge,C., Hammati,P., Munton,R.P., Ashmeade,T.E., Hatcher,J.P., Johns,A., Porter,R.A., Hagan,J.J., Hunter,A.J., & Upton,N. (2001) Effects of centrally administered orexin-B and orexin-A: a role for orexin-1 receptors in orexin-B- induced hyperactivity. Psychopharmacology, 153, 210-218.

Joseph,C.G., Bauzo,R.M., Xiang,Z., Shaw,A.M., Millard,W.J., & Haskell-Luevano,C. (2003) Elongation studies of the human agouti-related protein (AGRP) core decapeptide (Yc[CRFFNAFC]Y) results in antagonism at the mouse melanocortin-3 receptor. Peptides, 24, 263-270.

311

Joseph,S.A. & Michael,G.J. (1988) Efferent ACTH-IR opiocortin projections from nucleus tractus solitarius: a hypothalamic deafferentation study. Peptides, 9, 193.

Joseph,S.A., Pilcher,W.H., & Knigge,K.M. (1985) Anatomy of the corticotropin-releasing factor and opiomelanocortin systems of the brain. Federation proceedings, 44, 100-107.

Josselyn,S.A. & Beninger,R.J. (1993) Neuropeptide Y: Intraaccumbens injections produce a place preference that is blocked by cis-flupenthixol. Pharmacology Biochemistry and Behavior, 46, 543-552.

Jungnickel,S.R. & Gundlach,A.L. (2005) [125I]-Galanin binding in brain of wildtype, and galanin- and GalR1-knockout mice: strain and species differences in GalR1 density and distribution. Neuroscience, 131, 407-421.

Jureus,A., Cunningham,M.J., Li,D., Johnson,L.L., Krasnow,S.M., Teklemichael,D.N., Clifton,D.K., & Steiner,R.A. (2001) Distribution and regulation of galanin-like peptide (GALP) in the hypothalamus of the mouse. Endocrinology, 142, 5140-5144.

Jureus,A., Cunningham,M.J., McClain,M.E., Clifton,D.K., & Steiner,R.A. (2000) Galanin-like peptide (GALP) is a target for regulation by leptin in the hypothalamus of the rat. Endocrinology, 141, 2703-2706.

Kageyama,H., Kita,T., Toshinai,K., Guan,J.L., Date,Y., Takenoya,F., Kato,S., Matsumoto,H., Ohtaki,T., Nakazato,M., & Shioda,S. (2006) Galanin-like peptide promotes feeding behaviour via activation of orexinergic neurones in the rat lateral hypothalamus. J Neuroendocrinol., 18, 33-41.

Kageyama,H., Takenoya,F., Hori,Y., Yoshida,T., & Shioda,S. (2008) Morphological interaction between galanin-like peptide- and dopamine-containing neurons in the rat arcuate nucleus. Regulatory Peptides, 145, 165-168.

Kai,A., Ono,K., Kawano,H., Honda,E., Nakanishi,O., & Inenaga,K. (2006) Galanin inhibits neural activity in the subfornical organ in rat slice preparation. Neuroscience, 143, 769-777.

Kakar,S.S., Malik,M.T., Winters,S.J., & Mazhawidza,W. (2004) Gonadotropin-Releasing Hormone Receptors: Structure, Expression, and Signaling Transduction. Vitamins & Hormones (ed. by L. Gerald), pp. 151-207. Academic Press.

Kalra,S.P., Dube,M.G., Pu,S., Xu,B., Horvath,T.L., & Kalra,P.S. (1999) Interacting Appetite-Regulating Pathways in the Hypothalamic Regulation of Body Weight. Endocrine reviews, 20, 68-100.

Kalra,S.P. & Kalra,P.S. (1996) Nutritional infertility: the role of the interconnected hypothalamic neuropeptide Y-galanin-opioid network. Frontiers in Neuroendocrinology, 17, 371.

Kamegai,J., Tamura,H., Shimizu,T., Ishii,S., Sugihara,H., & Wakabayashi,I. (2001) Chronic central infusion of ghrelin increases hypothalamic neuropeptide Y and Agouti-related protein mRNA levels and body weight in rats. Diabetes, 50, 2438-2443.

Kanatani,A., Ishihara,A., Asahi,S., Tanaka,T., Ozaki,S., & Ihara,M. (1996) Potent neuropeptide Y Y1 receptor antagonist, 1229U91: blockade of neuropeptide Y-induced and physiological food intake. Endocrinology, 137, 3177. 312

Kanse,S.M., Kreymann,B., Ghatei,M.A., & Bloom,S.R. (1988) Identification and characterization of glucagon-like peptide-1 7-36 amide-binding sites in the rat brain and lung. FEBS letters, 241, 209-212.

Kaplan,L.M., Gabriel,S.M., Koenig,J.I., Sunday,M.E., Spindel,E.R., Martin,J.B., & Chin,W.W. (1988a) Galanin is an estrogen-inducible, secretory product of the rat anterior pituitary. Proc.Natl.Acad.Sci.U.S.A, 85, 7408-7412.

Kaplan,L.M., Gabriel,S.M., Koenig,J.I., Sunday,M.E., Spindel,E.R., Martin,J.B., & Chin,W.W. (1988b) Galanin is an estrogen-inducible, secretory product of the rat anterior pituitary. Proceedings of the National Academy of Sciences of the United States of America, 85, 7408-7412.

Kaplan,L.M., Spindel,E.R., Isselbacher,K.J., & Chin,W.W. (1988c) Tissue-specific expression of the rat galanin gene. Proc.Natl.Acad.Sci.U.S.A, 85, 1065-1069.

Karges,B., Karges,W., & de,R.N. (2003) Clinical and molecular genetics of the human GnRH receptor. Hum.Reprod.Update., 9, 523-530.

Karoum,F., Neff,N.H., & Wyatt,R.J. (1977) The dynamics of dopamine metabolism in various regions of rat brain. European Journal of Pharmacology, 44, 311-318.

Kask,A., Rago,L., Wikberg,J.E.S., & Schioth,H.B. (2000) Differential effects of melanocortin peptides on ingestive behaviour in rats: evidence against the involvement of MC3 receptor in the regulation of food intake. Neuroscience Letters, 283, 1-4.

Kastin,A.J., Akerstrom,V., & Hackler,L. (2001) Food deprivation decreases blood galanin-like peptide and its rapid entry into the brain. Neuroendocrinology, 74, 423-432.

Kauer,J.A. & Malenka,R.C. (2007) Synaptic plasticity and addiction. Nat Rev Neurosci, 8, 844-858.

Kauffman,A.S., Buenzle,J., Fraley,G.S., & Rissman,E.F. (2005) Effects of galanin-like peptide (GALP) on locomotion, reproduction, and body weight in female and male mice. Horm.Behav., 48, 141- 151.

Kawasaki,M., Saito,J., Hashimoto,H., Suzuki,H., Otsubo,H., Fujihara,H., Ohnishi,H., Nakamura,T., & Ueta,Y. (2007) Induction of the galanin-like peptide gene expression in the posterior pituitary gland after acute osmotic stimulus in rats. Neuroscience Letters, 419, 125-130.

Keller-Wood,M.E. & Dallman,M.F. (1984) Corticosteroid inhibition of ACTH secretion. Endocrine reviews, 5, 1-24.

Kelley,A.E. & Berridge,K.C. (2002) The neuroscience of natural rewards: relevance to addictive drugs. The journal of neuroscience, 22, 3306.

Kelly,J., Rothstein,J., & Grossman,S.P. (1979) GABA and hypothalamic feeding systems. I. Topographic analysis of the effects of microinjections of muscimol. Physiology & behavior, 23, 1123.

Kelly,R.B. (1993) Storage and release of neurotransmitters. Cell, 72, 43-53.

313

Khan,Z.U., Mrzljak,L., Gutierrez,A., de la Calle,A., & Goldman-Rakic,P.S. (1998) Prominence of the dopamine D2 short isoform in dopaminergic pathways. Proceedings of the National Academy of Sciences of the United States of America, 95, 7731-7736.

Kim,J.-H., Creekmore,E., & Vezina,P. (2003) Microinjection of CART peptide 55-102 into the nucleus accumbens blocks amphetamine-induced locomotion. Neuropeptides, 37, 369-373.

Kim,M.S., Rossi,M., Abbott,C.R., AlAhmed,S.H., Smith,D.M., & Bloom,S.R. (2002) Sustained orexigenic effect of Agouti related protein may be not mediated by the melanocortin 4 receptor. Peptides, 23, 1069-1076.

Kim,M.S., Rossi,M., Abusnana,S., Sunter,D., Morgan,D.G., Small,C.J., Edwards,C.M., Heath,M.M., Stanley,S.A., Seal,L.J., Bhatti,J.R., Smith,D.M., Ghatei,M.A., & Bloom,S.R. (2000a) Hypothalamic localization of the feeding effect of agouti-related peptide and alpha- melanocyte-stimulating hormone. Diabetes, 49, 177-182.

Kim,M.S., Small,C.J., Stanley,S.A., Morgan,D.G., Seal,L.J., Kong,W.M., Edwards,C.M., Abusnana,S., Sunter,D., Ghatei,M.A., & Bloom,S.R. (2000b) The central melanocortin system affects the hypothalamo-pituitary thyroid axis and may mediate the effect of leptin. Journal of Clinical Investigation, 105, 1005-1011.

Kim,R.Y., Shin,S.W., Kim,B.J., Lee,W., & Baik,J.H. (2005) Dynamic regulation of hypothalamic neuropeptide gene expression and food intake by melanocortin analogues and reversal with melanocortin-4 receptor antagonist. Biochemical and biophysical research communications, 329, 1178-1185.

Kimmel,H.L., Gong,W., Vechia,S.D., Hunter,R.G., & Kuhar,M.J. (2000b) Intra-ventral tegmental area injection of rat cocaine and amphetamine-regulated transcript peptide 55-102 induces locomotor activity and promotes conditioned place preference. J.Pharmacol.Exp.Ther., 294, 784-792.

Kimmel,H.L., Gong,W., Vechia,S.D., Hunter,R.G., & Kuhar,M.J. (2000a) Intra-ventral tegmental area injection of rat cocaine and amphetamine-regulated transcript peptide 55-102 induces locomotor activity and promotes conditioned place preference. J.Pharmacol.Exp.Ther., 294, 784-792.

Kimmel,H.L., Thim,L., & Kuhar,M.J. (2002) Activity of various CART peptides in changing locomotor activity in the rat. Neuropeptides, 36, 9-12.

Kishi,T., Aschkenasi,C., Choi,B., Lopez,M., Lee,C., Liu,H.X., Hollenberg,A., Friedman,J.M., & Elmquist,J.K. (2005) Neuropeptide Y Y1 receptor mRNA in rodent brain: distribution and colocalization with melanocortin-4 receptor. Journal of comparative neurology, 482, 217- 243.

Kishi,T., Aschkenasi,C., Lee,C., Mountjoy,K.G., Saper,C.B., & Elmquist,J.K. (2003) Expression of melanocortin 4 receptor mRNA in the central nervous system of the rat. Journal of comparative neurology, 457, 213-235.

Kissileff,H.R., Pi-Sunyer,F.X., Thornton,J., & Smith,G.P. (1981) C-terminal octapeptide of cholecystokinin decreases food intake in man. The American Journal of Clinical Nutrition, 34, 154-160. 314

Klusa,V., Svirskis,S., Opmane,B., Muceniece,R., & Wikberg,J.E. (1999) Behavioural responses of gamma-MSH peptides administered into the rat ventral tegmental area. Acta physiologica Scandinavica, 167, 99-104.

Knigge,K.M. & Scott,D.E. (1970) Structure and function of the median eminence. The American journal of anatomy, 129, 223-243.

Knobil,E. (1990) The GnRH pulse generator. Am J Obstet Gynecol, 163, 1721-1727.

Koda,S., Date,Y., Murakami,N., Shimbara,T., Hanada,T., Toshinai,K., Niijima,A., Furuya,M., Inomata,N., Osuye,K., & Nakazato,M. (2005) The role of the vagal nerve in peripheral PYY3- 36-induced feeding reduction in rats. Endocrinology, 146, 2369-2375.

Koegler,F.H. & Ritter,S. (1997) Aqueduct occlusion does not impair feeding induced by either third or fourth ventricle galanin injection. Obesity research, 5, 262-267.

Koegler,F.H. & Ritter,S. (1998) Galanin injection into the nucleus of the solitary tract stimulates feeding in rats with lesions of the paraventricular nucleus of the hypothalamus. Physiology & behavior, 63, 521-527.

Koegler,F.H. & Ritter,S. (1996) Feeding induced by pharmacological blockade of fatty acid metabolism is selectively attenuated by hindbrain injections of the galanin receptor antagonist, M40. Obesity research, 4, 329-336.

Koegler,F.H., York,D.A., & Bray,G.A. (1999) The effects on feeding of galanin and M40 when injected into the nucleus of the solitary tract, the lateral parabrachial nucleus, and the third ventricle. Physiology & behavior, 67, 259-267.

Kofler,B., Liu,M.L., Jacoby,A.S., Shine,J., & Iismaa,T.P. (1996) Molecular cloning and characterisation of the mouse preprogalanin gene. Gene, 182, 71-75.

Kohno,D., Gao,H., Muroya,S., Kikuyama,S., & Yada,T. (2003) Ghrelin directly interacts with neuropeptide-Y-containing neurons in the rat arcuate nucleus: Ca2+ signaling via protein kinase A and N-type channel-dependent mechanisms and cross-talk with leptin and orexin. Diabetes, 52, 948-956.

Kojima,M., Hosoda,H., Date,Y., Nakazato,M., Matsuo,H., & Kangawa,K. (1999) Ghrelin is a growth- hormone-releasing acylated peptide from stomach. Nature, 402, 656-660.

Kokaia,M., Holmberg,K., Nanobashvili,A., Xu,Z.Q., Kokaia,Z., Lendahl,U., Hilke,S., Theodorsson,E., Kahl,U., Bartfai,T., Lindvall,O., & Hokfelt,T. (2001) Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin. Proceedings of the National Academy of Sciences of the United States of America, 98, 14006-14011.

Kolaczynski,J.W., Considine,R.V., Ohannesian,J.P., Marco,C.C., Opentanova,I., Nyce,M.R., Myint,M., & Caro,J.F. (1996) Responses of leptin to short-term fasting and refeeding in humans: a link with ketogenesis but not ketones themselves. Diabetes, 45, 1511.

Khoshbouei,H., George,S.R., Smith,R.G., & O'Dowd,B.F. (1998a) Molecular characterization and expression of cloned human galanin receptors GALR2 and GALR3. J Neurochem., 71, 2239-2251.

Kolakowski,L.F., Jr., O'Neill,G.P., Howard,A.D., Broussard,S.R., Sullivan,K.A., Feighner,S.D., Sawzdargo,M., Nguyen,T., Kargman,S., Shiao,L.L., Hreniuk,D.L., Tan,C.P., Evans,J., Abramovitz,M., Chateauneuf,A., Coulombe,N., Ng,G., Johnson,M.P., Tharian,A., Khoshbouei,H., George,S.R., Smith,R.G., & O'Dowd,B.F. (1998b) Molecular characterization and expression of cloned human galanin receptors GALR2 and GALR3. J Neurochem., 71, 2239-2251.

Kondo,K., Murase,T., Otake,K., Ito,M., Kurimoto,F., & Oiso,Y. (1993b) Galanin as a physiological neurotransmitter in hemodynamic control of arginine vasopressin release in rats. Neuroendocrinology, 57, 224-229.

Kondo,K., Murase,T., Otake,K., Ito,M., Kurimoto,F., & Oiso,Y. (1993a) Galanin as a physiological neurotransmitter in hemodynamic control of arginine vasopressin release in rats. Neuroendocrinology, 57, 224-229.

Konkel,M.J., Lagu,B., Boteju,L.W., Jimenez,H., Noble,S., Walker,M.W., Chandrasena,G., Blackburn,T.P., Nikam,S.S., Wright,J.L., Kornberg,B.E., Gregory,T., Pugsley,T.A., Akunne,H., Zoski,K., & Wise,L.D. (2006) 3-arylimino-2-indolones are potent and selective galanin GAL3 receptor antagonists. J Med Chem., 49, 3757-3758.

Koob,G.F. (1996) Hedonic valence, dopamine and motivation. Molecular Psychiatry, 1, 186-189.

Koob,G.F. & Le Moal,M. (1997) Drug Abuse: Hedonic Homeostatic Dysregulation. Science, 278, 52- 58.

Koob,G.F. & Swerdlow,N.R. (1988) The functional output of the mesolimbic dopamine system. Annals of the New York Academy of Sciences, 537, 216.

Kopelman,P.G. (2000) Obesity as a medical problem. Nature, 404, 635-643.

Kopin,A.S., Beinborn,M., Lee,Y.M., McBride,E.W., & Quinn,S.M. (1994) The CCK-B/gastrin receptor. Identification of amino acids that determine nonpeptide antagonist affinity. Annals of the New York Academy of Sciences, 713, 67-78.

Kopin,A.S., Mathes,W.F., McBride,E.W., Nguyen,M., Al-Haider,W., Schmitz,F., Bonner-Weir,S., Kanarek,R., & Beinborn,M. (1999) The cholecystokinin-A receptor mediates inhibition of food intake yet is not essential for the maintenance of body weight. Journal of Clinical Investigation, 103, 383-391.

Kordower,J.H., Le,H.K., & Mufson,E.J. (1992) Galanin immunoreactivity in the primate central nervous system. J Comp Neurol., 319, 479-500.

Korotkova,T., Sergeeva,O., Eriksson,K., Haas,H., & Brown,R. (2003) Excitation of ventral tegmental area dopaminergic and nondopaminergic neurons by orexins/hypocretins. The journal of neuroscience, 23, 7-11.

316

Koshiyama,H., Kato,Y., Inoue,T., Murakami,Y., Ishikawa,Y., Yanaihara,N., & Imura,H. (1987) Central galanin stimulates pituitary prolactin secretion in rats: possible involvement of hypothalamic vasoactive intestinal polypeptide. Neuroscience Letters, 75, 49.

Koshiyama,H., Shimatsu,A., Assadian,H., Hattori,N., Ishikawa,Y., Tanoh,T., Yanaihara,N., Kato,Y., & Imura,H. (1990a) Galanin interacts with serotonin in stimulating prolactin secretion in the rat. Journal of neuroendocrinology, 2, 217.

Koshiyama,H., Shimatsu,A., Kato,Y., Assadian,H., Hattori,N., Ishikawa,Y., Tanoh,T., Yanaihara,N., & Imura,H. (1990b) Galanin-induced prolactin release in rats: pharmacological evidence for the involvement of alpha-adrenergic and opioidergic mechanisms. Brain Research, 507, 321-324.

Koylu,E.O., Couceyro,P.R., Lambert,P.D., & Kuhar,M.J. (1998) Cocaine- and amphetamine-regulated transcript peptide immunohistochemical localization in the rat brain. Journal of comparative neurology, 391, 115-132.

Krahn,D.D., Gosnell,B.A., Levine,A.S., & Morley,J.E. (1988) Behavioral effects of corticotropin- releasing factor: localization and characterization of central effects. Brain Research, 443, 63.

Krasnow,S.M., Fraley,G.S., Schuh,S.M., Baumgartner,J.W., Clifton,D.K., & Steiner,R.A. (2003) A role for galanin-like peptide in the integration of feeding, body weight regulation, and reproduction in the mouse. Endocrinology, 144, 813-822.

Krasnow,S.M., Hohmann,J.G., Gragerov,A., Clifton,D.K., & Steiner,R.A. (2004) Analysis of the contribution of galanin receptors 1 and 2 to the central actions of galanin-like peptide. Neuroendocrinology, 79, 268-277.

Kreymann,B., Ghatei,M.A., Burnet,P., Williams,G., Kanse,S.M., Diani,A.R., & Bloom,S.R. (1989) Characterization of glucagon-like peptide-1-(7-36)amide in the hypothalamus. Brain Research, 502, 325-331.

Kreymann,B., Williams,G., Ghatei,M.A., & Bloom,S.R. (1987) Glucagon-like peptide-1 7-36: a physiological incretin in man. The Lancet, 330, 1300.

Kristensen,P., Judge,M.E., Thim,L., Ribel,U., Christjansen,K.N., Wulff,B.S., Clausen,J.T., Jensen,P.B., Madsen,O.D., Vrang,N., Larsen,P.J., & Hastrup,S. (1998) Hypothalamic CART is a new anorectic peptide regulated by leptin. Nature, 393, 72-76.

Kuhar,M.J., Jaworski,J., Hubert,G., Philpot,K.B., & Dominguez,G. (2005) Cocaine- and amphetamine- regulated transcript peptides play a role in drug abuse and are potential therapeutic targets. The AAPS journal, 7, E259-E265.

Kumano,S., Matsumoto,H., Takatsu,Y., Noguchi,J., Kitada,C., & Ohtaki,T. (2003) Changes in hypothalamic expression levels of galanin-like peptide in rat and mouse models support that it is a leptin-target peptide. Endocrinology, 144, 2634-2643.

Kuramochi,M., Kohno,D., Onaka,T., Kato,S., & Yada,T. (2005) Galanin-like peptide and ghrelin increase cytosolic Ca2+ in neurons containing growth hormone-releasing hormone in the arcuate nucleus. Regul Pept., 126, 85-89.

317

Kuramochi,M., Onaka,T., Kohno,D., Kato,S., & Yada,T. (2006) Galanin-like peptide stimulates food intake via activation of neuropeptide Y neurons in the hypothalamic dorsomedial nucleus of the rat. Endocrinology, 147, 1744-1752.

Kurosumi,K., Matsuzawa,T., & Shibasaki,S. (1961) Electron microscope studies on the fine structures of the pars nervosa and pars intermedia, and their morphological interrelation in the normal rat hypophysis. General and comparative endocrinology, 1, 433.

Kyrkouli,S.E., Stanley,B.G., Hutchinson,R., Seirafi,R.D., & Leibowitz,S.F. (1990a) Peptide-amine interactions in the hypothalamic paraventricular nucleus: analysis of galanin and neuropeptide Y in relation to feeding. Brain Research, 521, 185-191.

Kyrkouli,S.E., Stanley,B.G., & Leibowitz,S.F. (1986) Galanin: stimulation of feeding induced by medial hypothalamic injection of this novel peptide. Eur J Pharmacol, 122, 159-160.

Kyrkouli,S.E., Stanley,B.G., & Leibowitz,S.F. (1992) Differential effects of galanin and neuropeptide Y on extracellular norepinephrine levels in the paraventricular hypothalamic nucleus of the rat: a microdialysis study. Life Sciences, 51, 203-210.

Kyrkouli,S.E., Stanley,B.G., Seirafi,R.D., & Leibowitz,S.F. (1989) Paraventricular hypothalamic lesions abolish galanin-induced feeding. (Abstract).Proceedings of the Eastern Psychological Association, 60, 24.

Kyrkouli,S.E., Stanley,B.G., Seirafi,R.D., & Leibowitz,S.F. (1990b) Stimulation of feeding by galanin: anatomical localization and behavioral specificity of this peptide's effects in the brain. Peptides, 11, 995-1001.

Kyrkouli,S.E., Strubbe,J., & Scheurink,A. (2006) Galanin in the PVN increases nutrient intake and changes peripheral hormone levels in the rat. Physiology & behavior, 89, 103-109. la Fera,M.A. (1979) CCK-octapeptide injected in CSF causes satiety in sheep. Annales de recherches v+®t+®rinaires, 10, 234-236. la-Zuana,O. (2002) Acute and chronic administration of melanin-concentrating hormone enhances food intake and body weight in Wistar and Sprague-Dawley rats. International Journal of Obesity, 26, 1289-1295.

Lacaze-Masmonteil,T., de Keyzer,Y., Luton,J.P., Kahn,A., & Bertagna,X. (1987) Characterization of proopiomelanocortin transcripts in human nonpituitary tissues. Proceedings of the National Academy of Sciences of the United States of America, 84, 7261-7265.

Lambert,P.D., Couceyro,P.R., McGirr,K.M., Dall Vechia,S.E., Smith,Y., & Kuhar,M.J. (1998) CART peptides in the central control of feeding and interactions with neuropeptide Y. Synapse, 29, 293.

Lambert,P.D., Phillips,P.J., Wilding,J.P.H., Bloom,S.R., & Herbert,J. (1995) c-fos expression in the paraventricular nucleus of the hypothalamus following intracerebroventricular infusions of neuropeptide Y. Brain Research, 670, 59-65.

318

Lambert,P.D., Wilding,J.P., al-Dokhayel,A.A., Bohuou,C., Comoy,E., Gilbey,S.G., & Bloom,S.R. (1993) A role for neuropeptide-Y, dynorphin, and noradrenaline in the central control of food intake after food deprivation. Endocrinology, 133, 29.

Lamberts,S.W.J., Verleun,T., Oosterom,R., de Jong,F., & Hackeng,W.H. (1984) Corticotropin-releasing factor (ovine) and vasopressin exert a synergistic effect on adrenocorticotropin release in man. The Journal of clinical endocrinology and metabolism, 58, 298.

Lancranjan,I., Audibert,A., & Marbach,P. (1980) The role of neuropeptides in modulating PRL and GH secretion. International journal of neurology, 14, 175-188.

Land,T., Langel,U., Low,M., Berthold,M., Unden,A., & Bartfai,T. (1991) Linear and cyclic N-terminal galanin fragments and analogs as ligands at the hypothalamic galanin receptor. Int.J.Pept.Protein Res., 38, 267-272.

Landry,M., Aman,K., Burlet,A., & Hokfelt,T. (1999) Galanin-R1 receptor mRNA expression in the hypothalamus of the Brattelboro rat. Neuroreport, 10, 2823-2827.

Landry,M., Aman,K., & Hokfelt,T. (1998) Galanin-R1 receptor in anterior and mid-hypothalamus: distribution and regulation. J.Comp Neurol., 399, 321-340.

Landry,M., Roche,D., & Calas,A. (1995) Short-term effects of centrally administered galanin on the hyperosmotically stimulated expression of vasopressin in the rat hypothalamus. An in situ hybridization and immunohistochemistry study. Neuroendocrinology, 61, 393-404.

Lang,R., Berger,A., Santic,R., Geisberger,R., Hermann,A., Herzog,H., & Kofler,B. (2005) Pharmacological and functional characterization of galanin-like peptide fragments as potent galanin receptor agonists. Neuropeptides, 39, 179-184.

Lang,R., Gundlach,A.L., & Kofler,B. (2007) The galanin peptide family: receptor pharmacology, pleiotropic biological actions, and implications in health and disease. Pharmacol Ther, 115, 177-207.

Lanning,N. & Carter-Su,C. (2006) Recent advances in growth hormone signaling. Reviews in Endocrine & Metabolic Disorders, 7, 225-235.

Larsen,P.J. & Kristensen,P. (1997) The neuropeptide Y (Y4) receptor is highly expressed in neurones of the rat dorsal vagal complex. Molecular brain research, 48, 1-6.

Larsen,P.J., Tang-Christensen,M., Holst,J.J., & Orskov,C. (1997) Distribution of glucagon-like peptide- 1 and other preproglucagon-derived peptides in the rat hypothalamus and brainstem. Neuroscience, 77, 257-270.

Larsen,P.R., Silva,J.E., & Kaplan,M.M. (1981) Relationships between circulating and intracellular thyroid hormones: physiological and clinical implications. Endocrine reviews, 2, 87.

Laviolette,S. & van der Kooy,D. (2004) The neurobiology of nicotine addiction: bridging the gap from molecules to behaviour. Nature Reviews.Neuroscience, 5, 55-65.

Lawrence,C.B., Baudoin,F.M., & Luckman,S.M. (2002) Centrally administered galanin-like peptide modifies food intake in the rat: a comparison with galanin. J Neuroendocrinol., 14, 853-860. 319

Lawrence,C.B., Williams,T., & Luckman,S.M. (2003) Intracerebroventricular galanin-like peptide induces different brain activation compared with galanin. Endocrinology, 144, 3977-3984.

Le Quellec,A., Kervran,A., Blache,P., Ciurana,A.J., & Bataille,D. (1992) Oxyntomodulin-like immunoreactivity: diurnal profile of a new potential enterogastrone. The Journal of clinical endocrinology and metabolism, 74, 1405.

Lee,D.K., Nguyen,T., O'Neill,G.P., Cheng,R., Liu,Y., Howard,A.D., Coulombe,N., Tan,C.P., Tang- Nguyen,A.T., George,S.R., & O'Dowd,B.F. (1999) Discovery of a receptor related to the galanin receptors. FEBS Lett., 446, 103-107.

Lee,M., Kim,A., Conwell,I., Hruby,V., Mayorov,A., Cai,M., & Wardlaw,S.L. (2008) Effects of selective modulation of the central melanocortin-3-receptor on food intake and hypothalamic POMC expression. Peptides, 29, 440-447.

Legradi,G., Emerson,C.H., Ahima,R.S., Flier,J.S., & Lechan,R.M. (1997) Leptin prevents fasting- induced suppression of prothyrotropin-releasing hormone messenger ribonucleic acid in neurons of the hypothalamic paraventricular nucleus. Endocrinology, 138, 2569-2576.

Lei,Z.M. & Rao,C.V. (1994) Novel presence of luteinizing hormone/human chorionic gonadotropin (hCG) receptors and the down-regulating action of hCG on gonadotropin- releasing hormone gene expression in immortalized hypothalamic GT1-7 neurons. Molecular endocrinology, 8, 1111-1121.

Leibel,R.L. (1990) Is obesity due to a heritable difference in 'set point' for adiposity? Western Journal of Medicine, 153, 429-431.

Leibowitz,S.F., Akabayashi,A., & Wang,J. (1998) Obesity on a high-fat diet: role of hypothalamic galanin in neurons of the anterior paraventricular nucleus projecting to the median eminence. J Neurosci, 18, 2709-2719.

Leinninger,G.M., Jo,Y.H., Leshan,R.L., Louis,G.W., Yang,H.Y., Barrera,J., Wilson,H., Opland,D.M., Faouzi,M., Gong,Y., Jones,J., Rhodes,C.J., Chua,S.C., Diano,S., Horvath,T.L., Seeley,R.J., Becker,J., & Munzberg,H. (2009) Leptin acts via leptin receptor-expressing lateral hypothalamic neurons to modulate the mesolimbic dopamine system and suppress feeding. Cell metabolism, 10, 89-98.

Leiva,L.A. & Croxatto,H.B. (1994) Comparison of the effect of hypothalamic neuropeptides upon luteinizing hormone secretion by cultured rat anterior pituitary cells. Biological research, 27, 113-121.

Lennard,D.E., Eckert,W.A., & Merchenthaler,I. (1993) Corticotropin-releasing hormone neurons in the paraventricular nucleus project to the external zone of the median eminence: a study combining retrograde labeling with immunocytochemistry. Journal of neuroendocrinology, 5, 175.

Leone,P., Pocock,D., & Wise,R.A. (1991) Morphine-dopamine interaction: ventral tegmental morphine increases nucleus accumbens dopamine release. Pharmacology, biochemistry and behavior, 39, 469-472.

320

Leshan,R.L., Opland,D.M., Louis,G.W., Leinninger,G.M., Patterson,C.M., Rhodes,C.J., Munzberg,H., & Myers,M.G., Jr. (2010) Ventral Tegmental Area Leptin Receptor Neurons Specifically Project to and Regulate Cocaine- and Amphetamine-Regulated Transcript Neurons of the Extended Central Amygdala. Journal of Neuroscience, 30, 5713-5723.

Levin,M.C., Sawchenko,P.E., Howe,P.R., Bloom,S.R., & Polak,J.M. (1987) Organization of galanin- immunoreactive inputs to the paraventricular nucleus with special reference to their relationship to catecholaminergic afferents. Journal of comparative neurology, 261, 562.

Levine,A.S. & Morley,J.E. (1984) Neuropeptide Y: a potent inducer of consummatory behavior in rats. Peptides, 5, 1025-1029.

Lewis,D.E., Shellard,L., Koeslag,D.G., Boer,D.E., McCarthy,H.D., McKibbin,P.E., Russell,J.C., & Williams,G. (1993) Intense exercise and food restriction cause similar hypothalamic neuropeptide Y increases in rats. American journal of physiology: endocrinology and metabolism, 264, E279.

Lewis,M., Johnson,D., Waldmann,D., Leibowitz,S.F., & Hoebel,B. (2004) Galanin microinjection in the third ventricle increases voluntary ethanol intake. Alcoholism: clinical and experimental research, 28, 1822-1828.

Li,B.H., Xu,B., Rowland,N.E., & Kalra,S.P. (1994) c-fos expression in the rat brain following central administration of neuropeptide Y and effects of food consumption. Brain Research, 665, 277-284.

Li,X.F., Edward,J., Mitchell,J.C., Shao,B., Bowes,J.E., Coen,C.W., Lightman,S.L., & O'Byrne,K.T. (2004) Differential effects of repeated restraint stress on pulsatile lutenizing hormone secretion in female Fischer, Lewis and Wistar rats. J.Neuroendocrinol., 16, 620-627.

Liddle,R.A., Goldfine,I.D., Rosen,M.S., Taplitz,R.A., & Williams,J.A. (1985) Cholecystokinin bioactivity in human plasma. Molecular forms, responses to feeding, and relationship to gallbladder contraction. Journal of Clinical Investigation, 75, 1144-1152.

Lindblom,J., Johansson,A., Holmgren,A., Grandin,E., Nedergard,C., Fredriksson,R., & Schith,H. (2006) Increased mRNA levels of tyrosine hydroxylase and dopamine transporter in the VTA of male rats after chronic food restriction. The European journal of neuroscience, 23, 180-186.

Lindblom,J., Kask,A., Hagg,E., Harmark,L., Bergstrom,L., & Wikberg,J.E. (2002) Chronic infusion of a melanocortin receptor agonist modulates dopamine receptor binding in the rat brain. Pharmacological Research, 45, 119-124.

Lindblom,J., Opmane,B., Mutulis,F., Mutule,I., Petrovska,R., Klusa,V., Bergstrom,L., & Wikberg,J.E. (2001) The MC4 receptor mediates alpha-MSH induced release of nucleus accumbens dopamine. Neuroreport, 12, 2155-2158.

Lindblom,J., Schioth,H.B., Watanobe,H., Suda,T., Wikberg,J.E.S., & Bergstrom,L. (2000) Downregulation of melanocortin receptors in brain areas involved in food intake and reward mechanisms in obese (OLETF) rats. Brain Research, 852, 180-185.

321

Liposits,Z., Merchenthaler,I., Reid,J.J., & Negro-Vilar,A. (1993) Galanin-immunoreactive axons innervate somatostatin-synthesizing neurons in the anterior periventricular nucleus of the rat. Endocrinology, 132, 917.

Liposits,Z., Reid,J.J., Negro-Vilar,A., & Merchenthaler,I. (1995) Sexual dimorphism in copackaging of luteinizing hormone-releasing hormone and galanin into neurosecretory vesicles of hypophysiotrophic neurons: estrogen dependency. Endocrinology, 136, 1987.

Liu,H.X., Brumovsky,P., Schmidt,R., Brown,W., Payza,K., Hodzic,L., Pou,C., Godbout,C., & Hokfelt,T. (2001) Receptor subtype-specific pronociceptive and analgesic actions of galanin in the spinal cord: selective actions via GalR1 and GalR2 receptors. Proc.Natl.Acad.Sci.U.S.A, 98, 9960-9964.

Long,J.A. & Evans,H.M. The oestrous cycle in the rat and its associated phenomena. Mem.Univ.California 6, 1-148. 1922. Ref Type: Generic

Lopez,F.J., Meade,E.H., Jr., & Negro-Vilar,A. (1993) Endogenous galanin modulates the gonadotropin and prolactin proestrous surges in the rat. Endocrinology, 132, 795-800.

Lopez,F.J., Merchenthaler,I., Ching,M., Wisniewski,M.G., & Negro-Vilar,A. (1991) Galanin: a hypothalamic-hypophysiotropic hormone modulating reproductive functions. Proc.Natl.Acad.Sci.U.S.A, 88, 4508-4512.

Lopez,F.J. & Negro-Vilar,A. (1990) Galanin stimulates luteinizing hormone-releasing hormone secretion from arcuate nucleus-median eminence fragments in vitro: involvement of an {alpha}-adrenergic mechanism. Endocrinology, 127, 2431.

Lopez,M., Seoane,L., Garcia,M., Diguez,C., & Sears,R.M. (2002) Neuropeptide Y, but not agouti- related peptide or melanin-concentrating hormone, is a target peptide for orexin-A feeding actions in the rat hypothalamus. Neuroendocrinology, 75, 34-44.

Lord,G.M., Matarese,G., Howard,J.K., Baker,R.J., Bloom,S.R., & Lechler,R.I. (1998) Leptin modulates the T-cell immune response and reverses starvation-induced immunosuppression. Nature, 394, 897-901.

Lorimer,D.D. & Benya,R.V. (1996) Cloning and quantification of galanin-1 receptor expression by mucosal cells lining the human gastrointestinal tract. Biochemical and biophysical research communications, 222, 379-385.

Losinski,N.E., Horvath,E., & Kovacs,K. (1989) Double-labeling immunogold electron-microscopic study of hormonal colocalization in nontumorous and adenomatous rat pituitaries. The American journal of anatomy, 185, 236-243.

Lu,X., Barr,A.M., Kinney,J., Sanna,P., Conti,B., & Behrens,M.M. (2005a) A role for galanin in antidepressant actions with a focus on the dorsal raphe nucleus. Proceedings of the National Academy of Sciences of the United States of America, 102, 874-879.

Lu,X., Lundstrom,L., & Bartfai,T. (2005b) Galanin (2-11) binds to GalR3 in transfected cell lines: limitations for pharmacological definition of receptor subtypes. Neuropeptides, 39, 165-167.

322

Lu,X., Lundstrom,L., Langel,U., & Bartfai,T. (2005c) Galanin receptor ligands. Neuropeptides, 39, 143.

Lu,X., Ross,B., Sanchez-Alavez,M., Zorrilla,E.P., & Bartfai,T. (2008) Phenotypic analysis of GalR2 knockout mice in anxiety- and depression-related behavioral tests. Neuropeptides, 42, 387- 397.

Ludwig,D.S., Tritos,N.A., Mastaitis,J.W., Kulkarni,R., Kokkotou,E., Elmquist,J., Lowell,B., Flier,J.S., & Maratos-Flier,E. (2001) Melanin-concentrating hormone overexpression in transgenic mice leads to obesity and insulin resistance. Journal of Clinical Investigation, 107, 379-386.

Lundkvist,J., Land,T., Kahl,U., Bedecs,K., & Bartfai,T. (1995) cDNA sequence, ligand biding, and regulation of galanin/GMAP in mouse brain. Neuroscience Letters, 200, 121-124.

Luo,L.G., Bruhn,T., & Jackson,I.M. (1995) Glucocorticoids stimulate thyrotropin-releasing hormone gene expression in cultured hypothalamic neurons. Endocrinology, 136, 4945.

Luquet,S., Perez,F.A., Hnasko,T.S., & Palmiter,R.D. (2005) NPY/AgRP neurons are essential for feeding in adult mice but can be ablated in neonates. Science's STKE, 310, 683.

MacDonald,A.F., Billington,C.J., & Levine,A.S. (2004) Alterations in food intake by opioid and dopamine signaling pathways between the ventral tegmental area and the shell of the nucleus accumbens. Brain Research, 1018, 78-85.

Maiter,D.M., Hooi,S.C., Koenig,J.I., & Martin,J.B. (1990) Galanin is a physiological regulator of spontaneous pulsatile secretion of growth hormone in the male rat. Endocrinology, 126, 1216-1222.

Makara,G.B., Palkovits,M., Antoni,F.A., & Kiss,J.Z. (1983) Topography of the somatostatin- immunoreactive fibers to the stalk-median eminence of the rat. Neuroendocrinology, 37, 1.

Makimura,H., Mizuno,T., Beasley,J., Silverstein,J., & Mobbs,C. (2003) Adrenalectomy stimulates hypothalamic proopiomelanocortin expression but does not correct diet-induced obesity. BMC physiology, 3, 4.

Malarkey,W.B. (1976) Recently discovered hypothalamic-pituitary hormones. Clinical Chemistry, 22, 5-15.

Malendowicz,L.K., Nussdorfer,G.G., Nowak,K.W., & Mazzocchi,G. (1994) The possible involvement of galanin in the modulation of the function of rat pituitary-adrenocortical axis under basal and stressful conditions. Endocrine research, 20, 307-317.

Malik,S., McGlone,F., Bedrossian,D., & Dagher,A. (2008b) Ghrelin modulates brain activity in areas that control appetitive behavior. Cell metabolism, 7, 400-409.

Malik,S., McGlone,F., Bedrossian,D., & Dagher,A. (2008a) Ghrelin modulates brain activity in areas that control appetitive behavior. Cell metabolism, 7, 400-409.

Malkmus,S., Lu,X., Bartfai,T., Yaksh,T.L., & Hua,X.Y. (2005) Increased hyperalgesia after tissue injury and faster recovery of allodynia after nerve injury in the GalR1 knockout mice. Neuropeptides, 39, 217-221.

323

Man,P.S. & Lawrence,C.B. (2008a) Interleukin-1 mediates the anorexic and febrile actions of galanin- like peptide. Endocrinology.

Man,P.S. & Lawrence,C.B. (2008b) The effects of galanin-like peptide on energy balance, body temperature and brain activity in the mouse and rat are independent of the GALR2/3 receptor. J Neuroendocrinol., 20, 128-137.

Marcus,J.N., Aschkenasi,C., Lee,C., Chemelli,R.M., Saper,C.B., Yanagisawa,M., & Elmquist,J.K. (2001) Differential expression of orexin receptors 1 and 2 in the rat brain. Journal of comparative neurology, 435, 6-25.

Margules,D.L. & Olds,J. (1962) Identical "feeding" and "rewarding" systems in the lateral hypothalamus of rats. Science, 135, 374-375.

Maric,T., Tobin,S., Quinn,T., & Shalev,U. (2008) Food deprivation-like effects of neuropeptide Y on heroin self-administration and reinstatement of heroin seeking in rats. Behavioural Brain Research, 194, 39-43.

Marks,D.L., Smith,M.S., Vrontakis,M., Clifton,D.K., & Steiner,R.A. (1993) Regulation of galanin gene expression in gonadotropin-releasing hormone neurons during the estrous cycle of the rat. Endocrinology, 132, 1836-1844.

Marks,D.L., Wiemann,J.N., Burton,K.A., Lent,K.L., Clifton,D.K., & Steiner,R.A. (1992a) Simultaneous visualization of two cellular mRNA species in individual neurons by use of a new double in situ hybridization method. Molecular and cellular neurosciences, 3, 395.

Marks,J.L., Li,M., Schwartz,M., Porte,D., Jr., & Baskin,D.G. (1992b) Effect of fasting on regional levels of neuropeptide Y mRNA and insulin receptors in the rat hypothalamus: an autoradiographic study. Molecular and cellular neurosciences, 3, 199.

Marks,J.L., Porte,D., Jr., Stahl,W.L., & Baskin,D.G. (1990) Localization of insulin receptor mRNA in rat brain by in situ hybridization. Endocrinology, 127, 3234.

Marsh,D., Weingarth,D., Novi,D., Chen,H., Trumbauer,M., Chen,A., Guan,X.M., Jiang,M., Feng,Y., Camacho,R., Shen,Z., Frazier,E., Yu,H., Metzger,J., Kuca,S., Shearman,L., Gopal-Truter,S., MacNeil,D., & Strack,A. (2002) Melanin-concentrating hormone 1 receptor-deficient mice are lean, hyperactive, and hyperphagic and have altered metabolism. Proceedings of the National Academy of Sciences of the United States of America, 99, 3240-3245.

Marshall,J.C., Dalkin,A.C., Haisenleder,D.J., Paul,S.J., Ortolano,G.A., & Kelch,R.P. (1991) Gonadotropin-releasing hormone pulses: regulators of gonadotropin synthesis and ovulatory cycles. Recent progress in hormone research, 47, 155-187.

Martin,D.L. (1993) Regulation of +¦-aminobutyric acid synthesis in the brain. Journal of neurochemistry, 60, 395.

Masaki,T., Yoshimatsu,H., Chiba,S., Watanabe,T., & Sakata,T. (2001) Targeted disruption of histamine H-1-receptor attenuates regulatory effects of leptin on feeding, adiposity, and UCP family in mice. Diabetes, 50, 385-391.

324

Mastronardi,C.A., Yu,W.H., Srivastava,V.K., Dees,W.L., & McCann,S.M. (2001) Lipopolysaccharide- induced leptin release is neurally controlled. Proceedings of the National Academy of Sciences of the United States of America, 98, 14720-14725.

Matsumoto,A.M. & Bremner,W.J. (1984) Modulation of pulsatile gonadotropin secretion by testosterone in man. Journal of Clinical Endocrinology Metabolism, 58, 609-614.

Matsumoto,A.M., Karpas,A.E., & Bremner,W.J. (1986) Chronic human chorionic gonadotropin administration in normal men: evidence that follicle-stimulating hormone is necessary for the maintenance of quantitatively normal spermatogenesis in man. Journal of Clinical Endocrinology Metabolism, 62, 1184-1192.

Matsumoto,H., Noguchi,J., Takatsu,Y., Horikoshi,Y., Kumano,S., Ohtaki,T., Kitada,C., Itoh,T., Onda,H., Nishimura,O., & Fujino,M. (2001) Stimulation effect of galanin-like peptide (GALP) on luteinizing hormone-releasing hormone-mediated luteinizing hormone (LH) secretion in male rats. Endocrinology, 142, 3693-3696.

Matsumoto,Y., Watanabe,T., Adachi,Y., Itoh,T., Ohtaki,T., Onda,H., Kurokawa,T., Nishimura,O., & Fujino,M. (2002) Galanin-like peptide stimulates food intake in the rat. Neurosci Lett., 322, 67-69.

Mazarati,A., Lu,X., Kilk,K., Langel,U., Wasterlain,C., & Bartfai,T. (2004a) Galanin type 2 receptors regulate neuronal survival, susceptibility to seizures and seizure-induced neurogenesis in the dentate gyrus. The European journal of neuroscience, 19, 3235-3244.

Mazarati,A., Lu,X., Shinmei,S., Badie-Mahdavi,H., & Bartfai,T. (2004b) Patterns of seizures, hippocampal injury and neurogenesis in three models of status epilepticus in galanin receptor type 1 (GalR1) knockout mice. Neuroscience, 128, 431-441.

McCann,M.J. & Rogers,R.C. (1992) Impact of antral mechanoreceptor activation on the vago-vagal reflex in the rat: functional zonation of responses. The Journal of physiology, 453, 401-411.

McColl,C., Jacoby,A.S., Shine,J., Iismaa,T., & Bekkers,J. (2006) Galanin receptor-1 knockout mice exhibit spontaneous epilepsy, abnormal EEGs and altered inhibition in the hippocampus. Neuropharmacology, 50, 209-218.

McDonald,A.C., Schuijers,J.A., Shen,P.J., Gundlach,A.L., & Grills,B.L. (2003) Expression of galanin and galanin receptor-1 in normal bone and during fracture repair in the rat. Bone, 33, 788-797.

McEwen,B.S. (1979) Influences of adrenocortical hormones on pituitary and brain function. Monographs on endocrinology, 12, 467-492.

McFarland,K.C., Sprengel,R., Phillips,H.S., Kohler,M., Rosemblit,N., Nikolics,K., Segaloff,D.L., & Seeburg,P.H. (1989) Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science, 245, 494-499.

McGowan,M.K., Andrews,K.M., Fenner,D., & Grossman,S.P. (1993) Chronic intrahypothalamic insulin infusion in the rat: behavioral specificity. Physiology & behavior, 54, 1031.

325

McGowan,M.K., Andrews,K.M., & Grossman,S.P. (1992) Chronic intrahypothalamic infusions of insulin or insulin antibodies alter body weight and food intake in the rat. Physiology & behavior, 51, 753.

McLaughlin,C.L., Baile,C.A., Della-Fera,M.A., & Kasser,T.G. (1985) Meal-stimulated increased concentrations of CCK in the hypothalamus of Zucker obese and lean rats. Physiology & behavior, 35, 215.

McMahon,L.R. & Wellman,P.J. (1998) PVN infusion of GLP-1-(7---36) amide suppresses feeding but does not induce aversion or alter locomotion in rats. American journal of physiology.regulatory, integrative and comparative physiology, 274, 23.

McNeilly,A.S., Crawford,J.L., Taragnat,C., Nicol,L., & McNeilly,J.R. (2003) The differential secretion of FSH and LH: regulation through genes, feedback and packaging. Reproduction.Supplement, 61, 463-476.

Meeran,K., O'Shea,D., Edwards,C.M., Turton,M.D., Heath,M.M., Gunn,I., Abusnana,S., Rossi,M., Small,C.J., Goldstone,A.P., Taylor,G.M., Sunter,D., Steere,J., Choi,S.J., Ghatei,M.A., & Bloom,S.R. (1999) Repeated Intracerebroventricular Administration of Glucagon-Like Peptide-1-(7-36) Amide or Exendin-(9-39) Alters Body Weight in the Rat. Endocrinology, 140, 244-250.

Meister,B., Cortes,R., Villar,M.J., Schalling,M., & Hokfelt,T. (1990a) Peptides and transmitter enzymes in hypothalamic magnocellular neurons after administration of hyperosmotic stimuli: comparison between messenger RNA and peptide/protein levels. Cell Tissue Res., 260, 279-297.

Meister,B. & Hokfelt,T. (1988) Peptide- and transmitter-containing neurons in the mediobasal hypothalamus and their relation to GABAergic systems: Possible roles in control of prolactin and growth hormone secretion. Synapse, 2, 585.

Meister,B., Villar,M.J., Ceccatelli,S., & Hokfelt,T. (1990b) Localization of chemical messengers in magnocellular neurons of the hypothalamic supraoptic and paraventricular nuclei: an immunohistochemical study using experimental manipulations. Neuroscience, 37, 603-633.

Melander,T., Fuxe,K., Harfstrand,A., Eneroth,P., & Hokfelt,T. (1987) Effects of intraventricular injections of galanin on neuroendocrine functions in the male rat. Possible involvement of hypothalamic catecholamine neuronal systems. Acta physiologica Scandinavica, 131, 25.

Melander,T., Hokfelt,T., & Rokaeus,A. (1986a) Distribution of galaninlike immunoreactivity in the rat central nervous system. J Comp Neurol., 248, 475-517.

Melander,T., Hokfelt,T., Rokaeus,A., Cuello,A.C., Oertel,W.H., Verhofstad,A., & Goldstein,M. (1986b) Coexistence of galanin-like immunoreactivity with catecholamines, 5-hydroxytryptamine, GABA and neuropeptides in the rat CNS. J Neurosci, 6, 3640-3654.

Melander,T., Hokfelt,T., Rokaeus,A., Fahrenkrug,J., Tatemoto,K., & Mutt,V. (1985) Distribution of galanin-like immunoreactivity in the gastro-intestinal tract of several mammalian species. Cell Tissue Res, 239, 253-270.

326

Melander,T., Kohler,C., Nilsson,S., Hokfelt,T., Brodin,E., Theodorsson,E., & Bartfai,T. (1988) Autoradiographic quantitation and anatomical mapping of 125I-galanin binding sites in the rat central nervous system. J.Chem.Neuroanat., 1, 213-233.

Mellon,P.L., Windle,J.J., Goldsmith,P.C., Padula,C.A., Roberts,J.L., & Weiner,R.I. (1990) Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron, 5, 1-10.

Menêndez,J. (1991) Insulin and the paraventricular hypothalamus: modulation of energy balance. Brain Research, 555, 193.

Menndez,J.A. (1992) Metabolic effects of galanin injections into the paraventricular nucleus of the hypothalamus. Peptides, 13, 323-327.

Mennicken,F., Hoffert,C., Pelletier,M., Ahmad,S., & O'Donnell,D. (2002) Restricted distribution of galanin receptor 3 (GalR3) mRNA in the adult rat central nervous system. J Chem.Neuroanat., 24, 257-268.

Mercer,J.G., Lawrence,C.B., & Atkinson,T. (1996) Regulation of galanin gene expression in the hypothalamic paraventricular nucleus of the obese Zucker rat by manipulation of dietary macronutrients. Molecular brain research, 43, 202-208.

Mercer,J.G., Moar,K.M., & Hoggard,N. (1998) Localization of leptin receptor (Ob-R) messenger ribonucleic acid in the rodent hindbrain. Endocrinology, 139, 29-34.

Mercer,J.G., Moar,K.M., Rayner,D.V., Trayhurn,P., & Hoggard,N. (1997) Regulation of leptin receptor and NPY gene expression in hypothalamus of leptin-treated obese (ob/ob) and cold-exposed lean mice. FEBS letters, 402, 185-188.

Merchenthaler,I. (2008) Galanin and the neuroendocrine axes. Cell Mol.Life Sci., 65, 1826-1835.

Merchenthaler,I. & Liposits,Z. (1994) Mapping of thyrotropin-releasing hormone (TRH) neuronal systems of rat forebrain projecting to the median eminence and the OVLT. Immunocytochemistry combined with retrograde labeling at the light and electron microscopic levels. Acta biologica Hungarica, 45, 361-374.

Merchenthaler,I., Lopez,F.J., Lennard,D.E., & Negro-Vilar,A. (1991) Sexual differences in the distribution of neurons coexpressing galanin and luteinizing hormone-releasing hormone in the rat brain. Endocrinology, 129, 1977-1986.

Merchenthaler,I., Lopez,F.J., & Negro-Vilar,A. (1990) Colocalization of galanin and luteinizing hormone-releasing hormone in a subset of preoptic hypothalamic neurons: anatomical and functional correlates. Proceedings of the National Academy of Sciences of the United States of America, 87, 6326-6330.

Merchenthaler,I., Setalo,G., Csontos,C., Petrusz,P., Flerko,B., & Negro-Vilar,A. (1989) Combined retrograde tracing and immunocytochemical identification of luteinizing hormone-releasing hormone- and somatostatin-containing neurons projecting to the median eminence of the rat. Endocrinology, 125, 2812-2821.

327

Mereu,G., Yoon,K.W., Boi,V., Gessa,G.L., Naes,L., & Westfall,T.C. (1987) Preferential stimulation of ventral tegmental area dopaminergic neurons by nicotine. European Journal of Pharmacology, 141, 395-399.

Miller,G.M., Alexander,J.M., Bikkal,H.A., Katznelson,L., Zervas,N.T., & Klibanski,A. (1995) Somatostatin receptor subtype gene expression in pituitary adenomas. The Journal of clinical endocrinology and metabolism, 80, 1386.

Millington,G.W.M., Tung,Y.C.L., Hewson,A.K., O'Rahilly,S., & Dickson,S.L. (2001) Differential effects of [alpha]-, [beta]- and [gamma]2-melanocyte-stimulating hormones on hypothalamic neuronal activation and feeding in the fasted rat. Neuroscience, 108, 437-445.

Minami,S., Kamegai,J., Sugihara,H., Suzuki,N., & Wakabayashi,I. (1999) Growth hormone inhibits its own secretion by acting on the hypothalamus through its receptors on neuropeptide Y neurons in the arcuate nucleus and somatostatin neurons in the periventricular nucleus. Endocrine Journal, 45, 19.

Mitchell,V., Bouret,S., Howard,A.D., & Beauvillain,J.C. (1999a) Expression of the galanin receptor subtype Gal-R2 mRNA in the rat hypothalamus. Journal of Chemical Neuroanatomy, 16, 265- 277.

Mitchell,V., Bouret,S., Prevot,V., Jennes,L., & Beauvillain,J.C. (1999b) Evidence for expression of galanin receptor Gal-R1 mRNA in certain gonadotropin releasing hormone neurones of the rostral preoptic area. J Neuroendocrinol., 11, 805-812.

Mitchell,V., Habert-Ortoli,E., Epelbaum,J., Aubert,J.P., & Beauvillain,J.C. (1997) Semiquantitative distribution of galanin-receptor (GAL-R1) mRNA-containing cells in the male rat hypothalamus. Neuroendocrinology, 66, 160-172.

Mitsukawa,K., Lu,X., & Bartfai,T. (2009) Bidirectional regulation of stress responses by galanin in mice: involvement of galanin receptor subtype 1. Neuroscience, 160, 837-846.

Moga,M.M. & Saper,C.B. (1994) Neuropeptide-immunoreactive neurons projecting to the paraventricular hypothalamic nucleus in the rat. Journal of comparative neurology, 346, 137- 150.

Molnar,A., Balaspiri,L., Galfi,M., Laszlo,F., Varga,C., Berko,A., & Laszlo,F.A. (2005) Inhibitory effects of different galanin compounds and fragments on osmotically and histamine-induced enhanced vasopressin secretion in rats. Eur.J.Pharmacol., 516, 174-179.

Montague,C.T., Farooqi,I.S., Whitehead,J.P., Soos,M.A., Rau,H., Wareham,N.J., Sewter,C.P., Digby,J.E., Mohammed,S.N., Hurst,J.A., Cheetham,C.H., Earley,A.R., Barnett,A.H., Prins,J.B., & O'Rahilly,S. (1997) Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature, 387, 903-908.

Mooradian,A.D., Schwartz,H.L., Mariash,C.N., & Oppenheimer,J.H. (1985) Transcellular and transnuclear transport of 3,5,3'-triiodothyronine in isolated hepatocytes. Endocrinology, 117, 2449-2456.

Moran,T.H., Norgren,R., Crosby,R.J., & McHugh,P.R. (1990) Central and peripheral vagal transport of cholecystokinin binding sites occurs in afferent fibers. Brain Research, 526, 95-102. 328

Morley,J.E. (1987) Neuropeptide regulation of appetite and weight. Endocrine reviews, 8, 256.

Morley,J.E. & Levine,A.S. (1982) Corticotrophin releasing factor, grooming and ingestive behavior. Life Sciences, 31, 1459-1464.

Morton,G.J., Blevins,J.E., Kim,F., Matsen,M., & Figlewicz,D.P. (2009) The action of leptin in the ventral tegmental area to decrease food intake is dependent on Jak-2 signaling. American journal of physiology: endocrinology and metabolism, 297, E202.

Mountjoy,K.G., Mortrud,M.T., Low,M.J., Simerly,R.B., & Cone,R.D. (1994) Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic control circuits in the brain. Molecular endocrinology, 8, 1298.

Murakami,Y., Kato,Y., Koshiyama,H., Inoue,T., Yanaihara,N., & Imura,H. (1987) Galanin stimulates growth hormone (GH) secretion via GH-releasing factor (GRF) in conscious rats. European Journal of Pharmacology, 136, 415-418.

Murakami,Y., Ohshima,K., Mochizuki,T., & Yanaihara,N. (1993) Effect of human galanin on growth hormone prolactin, and antidiuretic hormone secretion in normal men. The Journal of clinical endocrinology and metabolism, 77, 1436.

Myers,M.G., Jr., Cowley,M.A., & Munzberg,H. (2008) Mechanisms of leptin action and leptin resistance. Annual Review of Physiology, 70, 537-556.

Nachman,M. & Ashe,J.H. (1973) Learned taste aversions in rats as a function of dosage, concentration, and route of administration of LiCl. Physiol Behav., 10, 73-78.

Nakazato,M., Murakami,N., Date,Y., Kojima,M., Matsuo,H., Kangawa,K., & Matsukura,S. (2001) A role for ghrelin in the central regulation of feeding. Nature, 409, 194-198.

Naleid,A., Grace,M., Cummings,D.E., & Levine,A.S. (2005) Ghrelin induces feeding in the mesolimbic reward pathway between the ventral tegmental area and the nucleus accumbens. Peptides, 26, 2274-2279.

Narita,M., Nagumo,Y., Hashimoto,S., Narita,M., Khotib,J., Miyatake,M., Sakurai,T., Yanagisawa,M., Nakamachi,T., Shioda,S., & Suzuki,T. (2006) Direct involvement of orexinergic systems in the activation of the mesolimbic dopamine pathway and related behaviors induced by morphine. The journal of neuroscience, 26, 398-405.

Naslund,E., Bogefors,J., Skogar,S., Gryback,P., Jacobsson,H., Holst,J.J., & Hellstrom,P.M. (1999) GLP-1 slows solid gastric emptying and inhibits insulin, glucagon, and PYY release in humans. American journal of physiology.regulatory, integrative and comparative physiology, 277, 910.

Neary,M. & Batterham,R.L. (2010) Gaining new insights into food reward with functional neuroimaging. Forum Nutr, 63, 152-163.

Nelson,J.C. (1996) The synergistic benefits of serotonin and noradrenaline reuptake inhibition. European psychiatry, 11, 252s.

329

Niall,H.D. (1971) Revised primary structure for human growth hormone. Nature: New biology, 230, 90-91.

Nielsen,S., Chou,C.L., Marples,D., Christensen,E.I., Kishore,B.K., & Knepper,M.A. (1995) Vasopressin increases water permeability of kidney collecting duct by inducing translocation of aquaporin-CD water channels to plasma membrane. Proc.Natl.Acad.Sci.U.S.A, 92, 1013- 1017.

Niimi,M., Murao,K., Takahara,J., & Kawanishi,K. (1993) Identification of galanin-immunoreactive cells in the anterior pituitary of male monkeys (Macaca fascicularis). Endocrine Journal, 40, 231- 235.

Niimi,M., Takahara,J., Sato,M., & Kawanishi,K. (1990) Immunohistochemical identification of galanin and growth hormone-releasing factor-containing neurons projecting to the median eminence of the rat. Neuroendocrinology, 51, 572.

Niiro,N., Nishimura,J., Hirano,K., Nakano,H., & Kanaide,H. (1998) Mechanisms of galanin-induced contraction in the rat myometrium. Br.J.Pharmacol., 124, 1623-1632.

Nillni,E.A. & Sevarino,K.A. (1999) The biology of pro-thyrotropin-releasing hormone-derived peptides. Endocrine reviews, 20, 599-648.

Nishino,S., Ripley,B., Overeem,S., Lammers,G.J., & Mignot,E. (2000) Hypocretin (orexin) deficiency in human narcolepsy. The Lancet, 355, 39-40.

Nistic,G. (1987) Behavioural and electrocortical spectrum power effects of growth hormone releasing factor in rats. Neuropharmacology, 26, 75-78.

Nonaka,N., Farr,S.A., Kageyama,H., Shioda,S., & Banks,W.A. (2008) Delivery of galanin-like peptide to the brain: targeting with intranasal delivery and cyclodextrins. J.Pharmacol.Exp.Ther., 325, 513-519.

Nussey,S.S. & Whitehead,S.A. (2001) The pituitary gland. Endocrinology An integrated approach BIOS Scientific, Oxford.

Nyan,D.C., Anbazhagan,R., Hughes-Darden,C.A., & Wachira,S.J.M. (2008) Endosomal colocalization of melanocortin-3 receptor and [beta]-arrestins in CAD cells with altered modification of AKT/PKB. Neuropeptides, 42, 355-366.

O'Shea,R.D. & Gundlach,A.L. (1991) Preproneuropeptide Y messenger ribonucleic acid in the hypothalamic arcuate nucleus of the rat is increased by food deprivation or dehydration. Journal of neuroendocrinology, 3, 11.

Oades,R.D. & Halliday,G.M. (1987) Ventral tegmental (A10) system: neurobiology. 1. Anatomy and connectivity. Brain Research Reviews, 12, 117.

Ogren,S.O., Hokfelt,T., Kask,K., Langel,U., & Bartfai,T. (1992) Evidence for a role of the neuropeptide galanin in spatial learning. Neuroscience, 51, 1.

330

Ohtaki,T., Kumano,S., Ishibashi,Y., Ogi,K., Matsui,H., Harada,M., Kitada,C., Kurokawa,T., Onda,H., & Fujino,M. (1999) Isolation and cDNA cloning of a novel galanin-like peptide (GALP) from porcine hypothalamus. J Biol.Chem., 274, 37041-37045.

Ohtaki,T., Shintani,Y., Honda,S., Matsumoto,H., Hori,A., Kanehashi,K., Terao,Y., Kumano,S., Takatsu,Y., Masuda,Y., Ishibashi,Y., Watanabe,T., Asada,M., Yamada,T., Suenaga,M., Kitada,C., Usuki,S., Kurokawa,T., Onda,H., Nishimura,O., & Fujino,M. (2001) Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature, 411, 613-617.

Olds,J. & Milner,P. (1954) Positive reinforcement produced by electrical stimulation of septal area and other regions of rat brain. The Journal of comparative and physiological psychology, 47, 419-427.

Ollmann,M.M., Wilson,B.D., Yang,Y.K., Kerns,J.A., Chen,Y., Gantz,I., & Barsh,G.S. (1997) Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science, 278, 135.

Olney,J.W. (1969) Brain lesions, obesity, and other disturbances in mice treated with monosodium glutamate. Science, 164, 719-721.

Olsen,R.W., Ban,M., & Miller,T. (1976) Studies on the neuropharmacological activity of bicuculline and related compounds. Brain Research, 102, 283-299.

Onaka,T., Kuramochi,M., Saito,J., Ueta,Y., & Yada,T. (2005) Galanin-like peptide stimulates vasopressin, oxytocin and adrenocorticotropic hormone release in rats. Neuroreport, 16, 243-247.

Ooi,G.T., Tawadros,N., & Escalona,R.M. (2004) Pituitary cell lines and their endocrine applications. Mol.Cell Endocrinol, 228, 1-21.

Oomura,Y., Ooyama,H., Sugimori,M., Nakamura,T., & Yamada,Y. (1974) Glucose inhibition of the glucose-sensitive neurone in the rat lateral hypothalamus. Nature, 247, 284-286.

Oosterom,J., Nijenhuis,W.A., Schaaper,W.M., Slootstra,J., Meloen,R.H., Gispen,W.H., Burbach,J.P., & Adan,R.A. (1999) Conformation of the core sequence in melanocortin peptides directs selectivity for the melanocortin MC3 and MC4 receptors. The Journal of biological chemistry, 274, 16853.

Oppenheimer,J.H. (1979) Thyroid hormone action at the cellular level. Science, 203, 971-979.

Orskov,C., Rabenhoj,L., Wettergren,A., Kofod,H., & Holst,J.J. (1994) Tissue and plasma concentrations of amidated and glycine-extended glucagon-like peptide I in humans. Diabetes, 43, 535.

Ottlecz,A., Samson,W.K., & McCann,S.M. (1986) Galanin: evidence for a hypothalamic site of action to release growth hormone. Peptides, 7, 51-53.

Ottlecz,A., Snyder,G.D., & McCann,S.M. (1988) Regulatory role of galanin in control of hypothalamic- anterior pituitary function. Proc.Natl.Acad.Sci.U.S.A, 85, 9861-9865.

331

Overton,P.G. & Clark,D. (1997) Burst firing in midbrain dopaminergic neurons. Brain Research Reviews, 25, 312.

Owji,A.A., Smith,D.M., Coppock,H.A., Morgan,D.G., Bhogal,R., Ghatei,M.A., & Bloom,S.R. (1995) An abundant and specific binding site for the novel vasodilator adrenomedullin in the rat. Endocrinology, 136, 2127-2134.

Palkovits,M. (1986) Microdissection of Individual Brain Nuclei and Areas. General Neurochemical Techniques, pp. 1-17.

Palkovits,M. & Van Cuc,H. (1980) Quantitative light and electron microscopic studies on the lateral hypothalamus in rat. Cell and synaptic densities. Brain Research Bulletin, 5, 643-647.

Pang,L., Hashemi,T., Lee,H.J., Maguire,M.T., Graziano,M.P., Bayne,M., Hawes,B.E., Wong,G., & Wang,S. (1998) The mouse GalR2 galanin receptor: genomic organization, cDNA cloning, and functional characterization. Journal of neurochemistry, 71, 2252-2259.

Panula,P., Yang,H.Y., & Costa,E. (1984) Histamine-containing neurons in the rat hypothalamus. Proceedings of the National Academy of Sciences of the United States of America, 81, 2572- 2576.

Pardini,A., Nguyen,H., Figlewicz,D.P., Baskin,D.G., Williams,D.L., Kim,F., & Schwartz,M.W. (2006) Distribution of insulin receptor substrate-2 in brain areas involved in energy homeostasis. Brain Research, 1112, 169-178.

Parker,E.M., Izzarelli,D.G., Nowak,H.P., Mahle,C.D., Iben,L.G., Wang,J., & Goldstein,M.E. (1995) Cloning and characterization of the rat GALR1 galanin receptor from Rin14B insulinoma cells. Brain Res Mol.Brain Res, 34, 179-189.

Parker,R.M. & Herzog,H. (1999) Regional distribution of Y-receptor subtype mRNAs in rat brain. The European journal of neuroscience, 11, 1431-1448.

Patel,S.R., Murphy,K.G., Thompson,E.L., Patterson,M., Curtis,A.E., Ghatei,M.A., & Bloom,S.R. (2008) Pyroglutamylated RFamide peptide 43 stimulates the hypothalamic-pituitary-gonadal axis via gonadotropin-releasing hormone in rats. Endocrinology, 149, 4747-4754.

Patterson,M., Murphy,K.G., Thompson,E.L., Patel,S., Ghatei,M.A., & Bloom,S.R. (2006a) Administration of kisspeptin-54 into discrete regions of the hypothalamus potently increases plasma luteinising hormone and testosterone in male adult rats. J Neuroendocrinol., 18, 349- 354.

Patterson,M., Murphy,K.G., Thompson,E.L., Smith,K.L., Meeran,K., Ghatei,M.A., & Bloom,S.R. (2006b) Microinjection of galanin-like peptide into the medial preoptic area stimulates food intake in adult male rats. J Neuroendocrinol., 18, 742-747.

Patterson,T.A., Brot,M.D., Zavosh,A., Schenk,J.O., Szot,P., & Figlewicz,D.P. (1998) Food deprivation decreases mRNA and activity of the rat dopamine transporter. Neuroendocrinology, 68, 11- 20.

Paxinos,G. & Watson,C. (2007) The Rat Brain in Stereotaxic Coordinates, Academic Press, San Diego.

332

Pekary,A.E. (1998) Is Ps4 (prepro-TRH [160-169]) more than an enhancer for thyrotropin-releasing hormone? Thyroid, 8, 963-968.

Perumal,P. & Vrontakis,M. (2003) Transgenic mice over-expressing galanin exhibit pituitary adenomas and increased secretion of galanin, prolactin and growth hormone. The Journal of endocrinology, 179, 145-154.

Peters,E.E.M., Towler,K.L., Mason,D.R., & Evans,J.J. (2009) Effects of galanin and leptin on gonadotropin-releasing hormone-stimulated luteinizing hormone release from the pituitary. Neuroendocrinology, 89, 18-26.

Peyron,C., Faraco,J., Rogers,W., Ripley,B., Overeem,S., Charnay,Y., Nevsimalova,S., Aldrich,M., Reynolds,D., Albin,R., Li,R., Hungs,M., Pedrazzoli,M., Padigaru,M., Kucherlapati,M., Fan,J., Maki,R., Lammers,G.J., Bouras,C., Kucherlapati,R., Nishino,S., & Mignot,E. (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nature Medicine, 6, 991-997.

Phillipson,O.T. (1979) A Golgi study of the ventral tegmental area of Tsai and interfascicular nucleus in the rat. Journal of comparative neurology, 187, 99.

Phillipson,O.T. & Griffiths,A.C. (1985) The topographic order of inputs to nucleus accumbens in the rat. Neuroscience, 16, 275-296.

Pierce,J.G. & Parsons,T.F. (1981) Glycoprotein hormones: structure and function. Annu.Rev Biochem., 50, 465-495.

Pierce,R.C. & Kumaresan,V. (2006) The mesolimbic dopamine system: the final common pathway for the reinforcing effect of drugs of abuse? Neuroscience and biobehavioral reviews, 30, 215- 238.

Pissios,P., Frank,L., Kennedy,A., Porter,D., Marino,F., Liu,F.F., Pothos,E.N., & Maratos-Flier,E. (2008) Dysregulation of the mesolimbic dopamine system and reward in MCH-/- mice. Biological psychiatry, 64, 184-191.

Polonsky,K.S., Given,B.D., Hirsch,L., Shapiro,E.T., Tillil,H., Beebe,C., Galloway,J.A., Frank,B.H., Karrison,T., & Van Cauter,E. (1988) Quantitative study of insulin secretion and clearance in normal and obese subjects. Journal of Clinical Investigation, 81, 435-441.

Pothos,E.N., Creese,I., & Hoebel,B.G. (1995) Restricted eating with weight loss selectively decreases extracellular dopamine in the nucleus accumbens and alters dopamine response to amphetamine, morphine, and food intake. The journal of neuroscience, 15, 6640-6650.

Qu,D., Ludwig,D.S., Gammeltoft,S., Piper,M., Pelleymounter,M.A., Cullen,M.J., Mathes,W.F., Przypek,J., Kanarek,R., & Maratos-Flier,E. (1996) A role for melanin-concentrating hormone in the central regulation of feeding behaviour. Nature, 380, 243-247.

Quarta,D., Di Francesco,C., Melotto,S., Mangiarini,L., Heidbreder,C., & Hedou,G. (2009) Systemic administration of ghrelin increases extracellular dopamine in the shell but not the core subdivision of the nucleus accumbens. Neurochemistry International, 54, 89-94.

333

Quaynor,S., Hu,L., Leung,P.K., Feng,H., Mores,N., Krsmanovic,L.Z., & Catt,K.J. (2007) Expression of a functional g protein-coupled receptor 54-kisspeptin autoregulatory system in hypothalamic gonadotropin-releasing hormone neurons. Mol.Endocrinol., 21, 3062-3070.

Rajendren,G., Levenkova,N., & Gibson,M.J. (2000) Galanin immunoreactivity in mouse basal forebrain: sex differences and discrete projections of galanin-containing cells beyond the blood-brain barrier. Neuroendocrinology, 71, 27-33.

Rajendren,G. & Li,X. (2001) Galanin synaptic input to gonadotropin-releasing hormone perikarya in juvenile and adult female mice: implications for sexual maturity. Developmental brain research, 131, 161-165.

Rauch,I., Lundstrom,L., Hell,M., Sperl,W., & Kofler,B. (2007) Galanin message-associated peptide suppresses growth and the budded-to-hyphal-form transition of Candida albicans. Antimicrobial agents and chemotherapy, 51, 4167-4170.

Reaven,G.M. (1995) Pathophysiology of insulin resistance in human disease. Physiological reviews, 75, 473-486.

Reidelberger,R.D. & O'Rourke,M.F. (1989) Potent cholecystokinin antagonist L 364718 stimulates food intake in rats. American journal of physiology.regulatory, integrative and comparative physiology, 257, 1512.

Reyes,R., Valladares,F., Gutierrez,R., Gonzalez,M., & Bello,A.R. (2008) Immunohistochemical distribution of regulatory peptides in the human fetal adenohypophysis. Journal of anatomy, 212, 817-826.

Rich,N., Reyes,P., Reap,L., Goswami,R., & Fraley,G.S. (2007) Sex differences in the effect of prepubertal GALP infusion on growth, metabolism and LH secretion. Physiol Behav., 92, 814- 823.

Ritter,R.C., Slusser,P.G., & Stone,S. (1981) Glucoreceptors controlling feeding and blood glucose: location in the hindbrain. Science, 213, 451-452.

Rivest,S. & Richard,D. (1990) Hypothalamic paraventricular nucleus lesions do not prevent anorectic effect of exercise in male rats. American journal of physiology.regulatory, integrative and comparative physiology, 259, 579.

Roberts,R.J. (2005) How restriction enzymes became the workhorses of molecular biology. Proceedings of the National Academy of Sciences of the United States of America, 102, 5905- 5908.

Robertson,C., Scholl,E., Pruess,T., Green,B., & White (2010) Engineering galanin analogues that discriminate between GalR1 and GalR2 receptor subtypes and exhibit anticonvulsant activity following systemic delivery. Journal of medicinal chemistry, 53, 1871-1875.

Robinson,T.E. & Berridge,K.C. (2001) Incentive-sensitization and addiction. Addiction, 96, 103-114.

Rodriguez-Puertas,R., Nilsson,S., Pascual,J., Pazos,A., & Hokfelt,T. (1997) 125I-galanin binding sites in Alzheimer's disease: increases in hippocampal subfields and a decrease in the caudate nucleus. Journal of neurochemistry, 68, 1106-1113. 334

Rogge,G., Jones,D., Hubert,G.W., Lin,Y., & Kuhar,M.J. (2008) CART peptides: regulators of body weight, reward and other functions. Nat.Rev.Neurosci., 9, 747-758.

Rokaeus,A. & Brownstein,M.J. (1986) Construction of a porcine adrenal medullary cDNA library and nucleotide sequence analysis of two clones encoding a galanin precursor. Proc.Natl.Acad.Sci.U.S.A, 83, 6287-6291.

Rokaeus,A., Young,W.S., III, & Mezey,E. (1988) Galanin coexists with vasopressin in the normal rat hypothalamus and galanin's synthesis is increased in the Brattleboro (diabetes insipidus) rat. Neurosci.Lett., 90, 45-50.

Roselli-Rehfuss,L., Mountjoy,K.G., Robbins,L.S., Mortrud,M.T., Low,M.J., Tatro,J.B., Entwistle,M.L., Simerly,R.B., & Cone,R.D. (1993) Identification of a receptor for gamma melanotropin and other proopiomelanocortin peptides in the hypothalamus and limbic system. Proceedings of the National Academy of Sciences of the United States of America, 90, 8856-8860.

Rosenbaum,M., Sy,M., Pavlovich,K., Leibel,R.L., & Hirsch,J. (2008) Leptin reverses weight lossΓÇôinduced changes in regional neural activity responses to visual food stimuli. The Journal of Clinical Investigation, 118, 2583-2591.

Rossi,M., Kim,M.S., Morgan,D.G., Small,C.J., Edwards,C.M., Sunter,D., Abusnana,S., Goldstone,A.P., Russell,S.H., Stanley,S.A., Smith,D.M., Yagaloff,K., Ghatei,M.A., & Bloom,S.R. (1998) A C- terminal fragment of Agouti-related protein increases feeding and antagonizes the effect of alpha-melanocyte stimulating hormone in vivo. Endocrinology, 139, 4428-4431.

Rossmanith,W.G., Clifton,D.K., & Steiner,R.A. (1996) Galanin gene expression in hypothalamic GnRH- containing neurons of the rat: a model for autocrine regulation. Horm.Metab Res, 28, 257- 266.

Roth,J., Glick,S.M., Yalow,R.S., & Berson,S.A. (1963) Secretion of human growth hormone: physiologic and experimental modification. Metabolism, 12, 577-579.

Russell,L.D., Alger,L.E., & Nequin,L.G. (1987) Hormonal control of pubertal spermatogenesis. Endocrinology, 120, 1615-1632.

Russell,L.D., Corbin,T.J., Ren,H.P., Amador,A., Bartke,A., & Ghosh,S. (1992) Structural changes in rat Leydig cells posthypophysectomy: a morphometric and endocrine study. Endocrinology, 131, 498-508.

Rustay,N., Wrenn,C.C., Kinney,J., Holmes,A., Bailey,K., Sullican,T., Harris,A.R., Long,K., Saavedra,M., Starosta,G., Innerfield,C., Yang,R.J., Dreiling,J., & Crawley,J.N. (2005) Galanin impairs performance on learning and memory tasks: findings from galanin transgenic and GAL-R1 knockout mice. Neuropeptides, 39, 239-243.

Ryan,M.C. & Gundlach,A.L. (1996) Localization of preprogalanin messenger RNA in rat brain: identification of transcripts in a subpopulation of cerebellar Purkinje cells. Neuroscience, 70, 709-728.

Saar,K., Mazarati,A., Mahlapuu,R., Hallnemo,G., Soomets,U., Kilk,K., Hellberg,S., Pooga,M., Tolf,B.R., Shi,T.S., Hokfelt,T., Wasterlain,C., Bartfai,T., & Langel,U. (2002) Anticonvulsant activity of a

335

nonpeptide galanin receptor agonist. Proceedings of the National Academy of Sciences of the United States of America, 99, 7136-7141.

Sahu,A. (1998a) Evidence suggesting that galanin (GAL), melanin-concentrating hormone (MCH), neurotensin (NT), proopiomelanocortin (POMC) and neuropeptide Y (NPY) are targets of leptin signaling in the hypothalamus. Endocrinology, 139, 795-798.

Sahu,A. (1998b) Leptin decreases food intake induced by melanin-concentrating hormone (MCH), galanin (GAL) and neuropeptide Y (NPY) in the rat. Endocrinology, 139, 4739-4742.

Sahu,A., Crowley,W.R., Tatemoto,K., Balasubramaniam,A., & Kalra,S.P. (1987) Effects of neuropeptide Y, NPY analog (norleucine4-NPY), galanin and neuropeptide K on LH release in ovariectomized (ovx) and ovx estrogen, progesterone-treated rats. Peptides, 8, 921-926.

Sahu,A., Dube,M.G., Phelps,C.P., Sninsky,C.A., Kalra,P.S., & Kalra,S.P. (1995) Insulin and insulin-like growth factor II suppress neuropeptide Y release from the nerve terminals in the paraventricular nucleus: a putative hypothalamic site for energy homeostasis. Endocrinology, 136, 5718.

Sahu,A., Kalra,P.S., & Kalra,S.P. (1988) Food deprivation and ingestion induce reciprocal changes in neuropeptide Y concentrations in the paraventricular nucleus. Peptides, 9, 83.

Sahu,A., Xu,B., & Kalra,S.P. (1994) Role of galanin in stimulation of pituitary luteinizing hormone secretion as revealed by a specific receptor antagonist, galantide. Endocrinology, 134, 529- 536.

Saito,A., Sankaran,H., Goldfine,I.D., & Williams,J.A. (1980) Cholecystokinin receptors in the brain: characterization and distribution. Science, 208, 1155-1156.

Saito,J., Ozaki,Y., Kawasaki,M., Ohnishi,H., Okimoto,N., Nakamura,T., & Ueta,Y. (2004) Galanin-like peptide gene expression in the hypothalamus and posterior pituitary of the obese fa/fa rat. Peptides, 25, 967-974.

Saito,J., Ozaki,Y., Kawasaki,M., Ohnishi,H., Okimoto,N., Nakamura,T., & Ueta,Y. (2005) Induction of galanin-like peptide gene expression in the arcuate nucleus of the rat after acute but not chronic inflammatory stress. Molecular brain research, 133, 233-241.

Saito,J., Ozaki,Y., Ohnishi,H., Nakamura,T., & Ueta,Y. (2003) Induction of galanin-like peptide gene expression in the rat posterior pituitary gland during endotoxin shock and adjuvant arthritis. Molecular brain research, 113, 124-132.

Sakurai,T. (2007) The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci, 8, 171-181.

Sakurai,T., Amemiya,A., Ishii,M., Matsuzaki,I., Chemelli,R.M., Tanaka,H., Williams,S.C., Richardson,J.A., Kozlowski,G.P., Wilsom,S., Arch,J.R., Buckingham,R.E., Haynes,A.C., Carr,S.A., Annan,R.S., McNulty,D.E., Liu,W.S., Terrett,J.A., Elshourbagy,N.A., Bergsma,D.J., & Yanagisawa,M. (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell, 92, 1.

336

Salinas,A., Wilde,J., & Maldve,R. (2006) Ethanol enhancement of cocaine- and amphetamine- regulated transcript mRNA and peptide expression in the nucleus accumbens. Journal of neurochemistry, 97, 408-415.

Saltiel,A.R. & Kahn,C.R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature, 414, 799-806.

Samson,M., Osty,J., & Blondeau,J.P. (1993) Identification by photoaffinity labeling of a membrane thyroid hormone-binding protein associated with the triiodothyronine transport system in rat erythrocytes. Endocrinology, 132, 2470.

Santic,R., Fenninger,K., Graf,K., Schneider,R., Hauser-Kronberger,C., Schilling,F.H., Kogner,P., Ratschek,M., Jones,N., Sperl,W., & Kofler,B. (2006) Gangliocytes in neuroblastic tumors express alarin, a novel peptide derived by differential splicing of the galanin-like peptide gene. J Mol.Neurosci, 29, 145-152.

Santic,R., Schmidhuber,S.M., Lang,R., Rauch,I., Voglas,E., Eberhard,N., Bauer,J.W., Brain,S.D., & Kofler,B. (2007) Alarin is a vasoactive peptide. Proc.Natl.Acad.Sci.U.S.A, 104, 10217-10222.

Saper,C.B., Swanson,L.W., & Cowan,W.M. (1979) An autoradiographic study of the efferent connections of the lateral hypothalamic area in the rat. Journal of comparative neurology, 183, 689.

Sato,M., Takahara,J., Niimi,M., Tagawa,R., & Irino,S. (1991) Characterization of the stimulatory effect of galanin on growth hormone release from the rat anterior pituitary. Life Sciences, 48, 1639-1644.

Satoh,N., Ogawa,Y., Katsuura,G., Hayase,M., Tsuji,T., Imagawa,K., Yoshimasa,Y., Nishi,S., Hosoda,K., & Nakao,K. (1997) The arcuate nucleus as a primary site of satiety effect of leptin in rats. Neuroscience Letters, 224, 149-152.

Sawyer,T.K., Sanfilippo,P.J., Hruby,V.J., Engel,M.H., Heward,C.B., Burnett,J.B., & Hadley,M.E. (1980) 4-Norleucine, 7-D-phenylalanine-alpha-melanocyte-stimulating hormone: a highly potent alpha-melanotropin with ultralong biological activity. Proceedings of the National Academy of Sciences of the United States of America, 77, 5754-5758.

Schauble,N., Reichwald,K., Grassl,W., Bechstein,H., Mller,H.C., Scherag,A., Geller,F., Utting,M., Siegfried,W., Goldschmidt,H., Blundell,J.E., Lawton,C., Alam,R., Whybrow,S., Stubbs,J., & Platzer,M.H. (2005) Human galanin (GAL) and galanin 1 receptor (GALR1) variations are not involved in fat intake and early onset obesity. The Journal of Nutrition, 135, 1387-1392.

Schick,R.R. (1986) Intracerebroventricular injections of cholecystokinin octapeptide suppress feeding in ratsΓÇöpharmacological characterization of this action. Regulatory Peptides, 14, 277.

Schick,R.R., Reilly,W.M., Roddy,D.R., Yaksh,T.L., & Go,V.L. (1987) Neuronal cholecystokinin-like immunoreactivity is postprandially released from primate hypothalamus. Brain Research, 418, 20.

Schick,R.R., Samsami,S., Zimmermann,J.P., Eberl,T., Endres,C., Schusdziarra,V., & Classen,M. (1993) Effect of galanin on food intake in rats: involvement of lateral and ventromedial

337

hypothalamic sites. American journal of physiology.regulatory, integrative and comparative physiology, 264, 355.

Schioth,H.B., Bouifrouri,A.A., Rudzish,R., Muceniece,R., Watanobe,H., Wikberg,J.E.S., & Larhammar,D. (2002) Pharmacological comparison of rat and human melanocortin 3 and 4 receptors in vitro. Regulatory Peptides, 106, 7-12.

Schjoldager,B.T., Baldissera,F.G., Mortensen,P.E., Holst,J.J., & Christiansen,J. (1988) Oxyntomodulin: a potential hormone from the distal gut. Pharmacokinetics and effects on gastric acid and insulin secretion in man. European journal of clinical investigation, 18, 499.

Schmidhuber,S.M., Rauch,I., Kofler,B., & Brain,S.D. (2008) Evidence that the Modulatory Effect of Galanin on Inflammatory Edema Formation is Mediated by the Galanin Receptor 3 in the Murine Microvasculature. J.Mol.Neurosci.

Schmidhuber,S.M., Santic,R., Tam,C.W., Bauer,J.W., Kofler,B., & Brain,S.D. (2007) Galanin-like peptides exert potent vasoactive functions in vivo. J Invest Dermatol., 127, 716-721.

Schmidt,P.T., Naslund,E., Gryback,P., Jacobsson,H., Holst,J.J., Hilsted,L., & Hellstrom,P.M. (2005) A role for pancreatic polypeptide in the regulation of gastric emptying and short-term metabolic control. The Journal of clinical endocrinology and metabolism, 90, 5241-5246.

Schmidt,W.E., Kratzin,H., Eckart,K., Drevs,D., Mundkowski,G., Clemens,A., Katsoulis,S., Schafer,H., Gallwitz,B., & Creutzfeldt,W. (1991) Isolation and primary structure of pituitary human galanin, a 30-residue nonamidated neuropeptide. Proceedings of the National Academy of Sciences of the United States of America, 88, 11435-11439.

Schultz,W. (2006) Behavioral theories and the neurophysiology of reward. Annual Review of Psychology, 57, 87-115.

Schwartz,G.J. (2006) Integrative capacity of the caudal brainstem in the control of food intake. Philosophical transactions - Royal Society.Biological sciences, 361, 1275-1280.

Schwartz,J.C., Arrang,J.M., Garbarg,M., Pollard,H., & Ruat,M. (1991) Histaminergic transmission in the mammalian brain. Physiological reviews, 71, 1-51.

Schwartz,M.W., Peskind,E., Raskind,M., Boyko,E.J., & Porte,D., Jr. (1996a) Cerebrospinal fluid leptin levels: relationship to plasma levels and to adiposity in humans. Nature Medicine, 2, 589.

Schwartz,M.W., Seeley,R.J., Campfield,L.A., Burn,P., & Baskin,D.G. (1996b) Identification of targets of leptin action in rat hypothalamus. Journal of Clinical Investigation, 98, 1101-1106.

Schwartz,M.W., Seeley,R.J., Woods,S.C., Weigle,D.S., Campfield,L.A., Burn,P., & Baskin,D.G. (1997) Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes, 46, 2119.

Schwartz,M.W., Sipols,A.J., Grubin,C.E., & Baskin,D.G. (1993) Differential effect of fasting on hypothalamic expression of genes encoding neuropeptide Y, galanin, and glutamic acid decarboxylase. Brain Research Bulletin, 31, 361.

338

Schwartz,M.W., Sipols,A.J., Marks,J.L., Sanacora,G., White,J.D., Scheurink,A., Kahn,S.E., Baskin,D.G., Woods,S.C., & Figlewicz,D.P. (1992) Inhibition of hypothalamic neuropeptide Y gene expression by insulin. Endocrinology, 130, 3608.

Schwartz,M.W., Woods,S.C., Porte,D., Jr., Seeley,R.J., & Baskin,D.G. (2000) Central nervous system control of food intake. Nature, 404, 661-671.

Sclafani,A. (1971) Neural pathways involved in the ventromedial hypothalamic lesion syndrome in the rat. The Journal of comparative and physiological psychology, 77, 70-96.

Scrocchi,L.A., Brown,T.J., MaClusky,N., Brubaker,P.L., Auerbach,A.B., Joyner,A.L., & Drucker,D.J. (1994) Glucose intolerance but normal satiety in mice with a null mutation in the glucagons- like peptide 1 receptor gene. πüåπüäπéïπüÖ, 91, 2161.

Segerson,T.P., Kauer,J., Wolfe,H.C., Mobtaker,H., Wu,P., Jackson,I.M., & Lechan,R.M. (1987) Thyroid hormone regulates TRH biosynthesis in the paraventricular nucleus of the rat hypothalamus. Science, 238, 78-80.

Selye,H. (1936) A syndrome produced by diverse nocuous agents. Nature, 138, 32.

Semjonous,N.M., Smith,K.L., Parkinson,J.R.C., Gunner,D.J.L., Liu,Y.L., Murphy,K.G., Ghatei,M.A., Bloom,S.R., & Small,C.J. (2009) Coordinated changes in energy intake and expenditure following hypothalamic administration of neuropeptides involved in energy balance. Int J Obes, 33, 775-785.

Seth,A., Stanley,S., Dhillo,W., Murphy,K., Ghatei,M., & Bloom,S. (2003) Effects of galanin-like peptide on food intake and the hypothalamo-pituitary-thyroid axis. Neuroendocrinology, 77, 125- 131.

Seth,A., Stanley,S., Jethwa,P., Gardiner,J., Ghatei,M., & Bloom,S. (2004) Galanin-like peptide stimulates the release of gonadotropin-releasing hormone in vitro and may mediate the effects of leptin on the hypothalamo-pituitary-gonadal axis. Endocrinology, 145, 743-750.

Shahab,M., Cunningham,M.J., Steiner,R.A., & Plant,T.M. (2005) Galanin-Like peptide elicits a robust discharge of growth hormone in the rhesus monkey (Macaca mulatta). Neuroendocrinology, 81, 254-258.

Shen,J. & Gundlach,A.L. (2004) Galanin-like peptide mRNA alterations in arcuate nucleus and neural lobe of streptozotocin-diabetic and obese zucker rats. Further evidence for leptin-dependent and independent regulation. Neuroendocrinology, 79, 327-337.

Shen,J., Larm,J.A., & Gundlach,A.L. (2001) Galanin-like peptide mRNA in neural lobe of rat pituitary. Increased expression after osmotic stimulation suggests a role for galanin-like peptide in neuron-glial interactions and/or neurosecretion. Neuroendocrinology, 73, 2-11.

Sherin,J.E., Elmquist,J.K., Torrealba,F., & Saper,C.B. (1998) Innervation of histaminergic tuberomammillary neurons by GABAergic and galaninergic neurons in the ventrolateral preoptic nucleus of the rat. J Neurosci, 18, 4705-4721.

Shi,T.J., Hua,X.Y., Lu,X., Malkmus,S., Kinney,J., Holmberg,K., Wirz,S., Ceccatelli,S., Yaksh,T., Bartfai,T., & Hokfelt,T. (2006) Sensory neuronal phenotype in galanin receptor 2 knockout mice: focus 339

on dorsal root ganglion neurone development and pain behaviour. The European journal of neuroscience, 23, 627-636.

Shieh,K.R. (2003) Effects of the cocaine- and amphetamine-regulated transcript peptide on the turnover of central dopaminergic neurons. Neuropharmacology, 44, 940-948.

Shimada,M., Tritos,N.A., Lowell,B.B., Flier,J.S., & Maratos-Flier,E. (1998) Mice lacking melanin- concentrating hormone are hypophagic and lean. Nature, 396, 670-674.

Shimizu,I., Hirota,M., Ohboshi,C., & Shima,K. (1987a) Identification and localization of glucagon-like peptide-1 and its receptor in rat brain. Endocrinology, 121, 1076-1082.

Shimizu,N., Oomura,Y., Plata-Salaman,C.R., & Morimoto,M. (1987b) Hyperphagia and obesity in rats with bilateral ibotenic acid-induced lesions of the ventromedial hypothalamic nucleus. Brain Research, 416, 153-156.

Shughrue,P.J., Lane,M.V., & Merchenthaler,I. (1997) Comparative distribution of estrogen receptor- alpha and -beta mRNA in the rat central nervous system. J.Comp Neurol., 388, 507-525.

Shughrue,P.J., Lane,M.V., & Merchenthaler,I. (1996) Glucagon-like peptide-1 receptor (GLP1-R) mRNA in the rat hypothalamus. Endocrinology, 137, 5159.

Shupnik,M.A., Chin,W.W., Habener,J.F., & Ridgway,E.C. (1985) Transcriptional regulation of the thyrotropin subunit genes by thyroid hormone. The Journal of biological chemistry, 260, 2900.

Shupnik,M.A., Ridgway,E.C., & Chin,W.W. (1989) Molecular Biology of Thyrotropin. Endocrine reviews, 10, 459-475.

Shutter,J.R., Graham,M., Kinsey,A.C., Scully,S., Luthy,R., & Stark,K.L. (1997) Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice. Genes & development, 11, 593-602.

Silva,J.E. (1995) Thyroid hormone control of thermogenesis and energy balance. Thyroid, 5, 481-492.

Silver,I.A. & Erecinska,M. (1998) Glucose-induced intracellular ion changes in sugar-sensitive hypothalamic neurons. Journal of neurophysiology, 79, 1733-1745.

Silverman,A.J., Jhamandas,J., & Renaud,L.P. (1987) Localization of luteinizing hormone-releasing hormone (LHRH) neurons that project to the median eminence. J Neurosci, 7, 2312-2319.

Silverman,A.J., Livne I., & Witkin J.W. (1994) The Gonadotropin-Releasing Hormone (GnRH), Neuronal Systems:Immunocytochemistry and In Situ Hybridisation. The Physiology of Reproduction (ed. by Knobil E. & Neill J.D.).

Simmons,D.M., Voss,J.W., Ingraham,H.A., Holloway,J.M., Broide,R.S., Rosenfeld,M.G., & Swanson,L.W. (1990) Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes & development, 4, 695.

340

Simon,H., Scatton,B., & Le Moal,M. (1980) Dopaminergic A10 neurones are involved in cognitive functions. Nature, 286, 150-151.

Simpson,E.R. & Waterman,M.R. (1988) Regulation of the synthesis of steroidogenic enzymes in adrenal cortical cells by ACTH. Annual Review of Physiology, 50, 427-440.

Sinha,Y.N. & Jacobsen,B.P. (1994) Human growth hormone (hGH)-(44-191), a reportedly diabetogenic fragment of hGH, circulates in human blood: measurement by radioimmunoassay. Journal of Clinical Endocrinology Metabolism, 78, 1411-1418.

Sipe,J.C. & Moore,R.Y. (1977) The lateral hypothalamic area. An ultrastructural analysis. Cell and Tissue Research, 179, 177-196.

Sipols,A.J., Baskin,D.G., & Schwartz,M.W. (1995) Effect of intracerebroventricular insulin infusion on diabetic hyperphagia and hypothalamic neuropeptide gene expression. Diabetes, 44, 147.

Sipols,A.J., Stuber,G.D., Klein,S.N., Higgins,M.S., & Figlewicz,D.P. (2000) Insulin and raclopride combine to decrease short-term intake of sucrose solutions. Peptides, 21, 1361-1367.

Skofitsch,G., Jacobowitz,D.M., Amann,R., & Lembeck,F. (1989) Galanin and vasopressin coexist in the rat hypothalamo-neurohypophyseal system. Neuroendocrinology, 49, 419-427.

Skofitsch,G., Jacobowitz,D.M., & Zamir,N. (1985) Immunohistochemical localization of a melanin concentrating hormone-like peptide in the rat brain. Brain Research Bulletin, 15, 635-649.

Skofitsch,G., Sills,M.A., & Jacobowitz,D.M. (1986) Autoradiographic distribution of 125I-galanin binding sites in the rat central nervous system. Peptides, 7, 1029-1042.

Smagin,G.N., Howell,L.A., Ryan,D.H., De Souza,E.B., & Harris,R.B. (1998) The role of CRF2 receptors in corticotropin-releasing factor- and urocortin-induced anorexia. Neuroreport, 9, 1601-1606.

Small,C.J., Kim,M.S., Stanley,S.A., Mitchell,J.R.D., Murphy,K., Morgan,D.G.A., Ghatei,M.A., & Bloom,S.R. (2001) Effects of Chronic Central Nervous System Administration of Agouti- Related Protein in Pair-Fed Animals. Diabetes, 50, 248-254.

Small,C.J., Liu,Y.L., Stanley,S.A., Connoley,I.P., Kennedy,A., Stock,M.J., & Bloom,S.R. (2003) Chronic CNS administration of Agouti-related protein (Agrp) reduces energy expenditure. Int J Obes Relat Metab Disord, 27, 530-533.

Smith,A. & Funder,J.W. (1988) Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocrine reviews, 9, 159.

Smith,B.K., Berthoud,H.R., York,D.A., & Bray,G.A. (1997a) Differential effects of baseline macronutrient preferences on macronutrient selection after galanin, NPY, and an overnight fast. Peptides, 18, 207-211.

Smith,B.K., York,D.A., & Bray,G.A. (1994) Chronic cerebroventricular galanin does not induce sustained hyperphagia or obesity. Peptides, 15, 1267-1272.

341

Smith,D., Tzavara,E., Shaw,J., Luecke,S., Wade,M., Davis,R., Salhoff,C., Nomikos,G., & Gehlert,D. (2005) Mesolimbic dopamine super-sensitivity in melanin-concentrating hormone-1 receptor-deficient mice. The journal of neuroscience, 25, 914-922.

Smith,G.P., Jerome,C., Cushin,B.J., Eterno,R., & Simansky,K.J. (1981) Abdominal vagotomy blocks the satiety effect of cholecystokinin in the rat. Science, 213, 1036-1037.

Smith,K.E. (1998) Cloned human and rat galanin GALR3 receptors. The Journal of biological chemistry, 273, 23321.

Smith,K.E., Forray,C., Walker,M.W., Jones,K.A., Tamm,J.A., Bard,J., Branchek,T.A., Linemeyer,D.L., & Gerald,C. (1997b) Expression cloning of a rat hypothalamic galanin receptor coupled to phosphoinositide turnover. J Biol.Chem., 272, 24612-24616.

Smith,K.E., Walker,M.W., Artymyshyn,R., Bard,J., Borowsky,B., Tamm,J.A., Yao,W.J., Vaysse,P.J., Branchek,T.A., Gerald,C., & Jones,K.A. (1998) Cloned human and rat galanin GALR3 receptors. Pharmacology and activation of G-protein inwardly rectifying K+ channels. J Biol.Chem., 273, 23321-23326.

Solomon,J. & Mayer,J. (1973) The effect of adrenalectomy on the development of the obese- hyperglycemic syndrome in ob-ob mice. Endocrinology, 93, 510-512.

Spitz,M.R., Detry,M.A., Pillow,P., Hu,Y., Amos,C.I., Hong,W.K., & Wu,X. (2000) Variant alleles of the D2 dopamine receptor gene and obesity. Nutrition Research, 20, 371.

Staines,W.A., Yamamoto,T., Daddona,P.E., & Nagy,J.I. (1986) Neuronal Colocalization of Adenosine- Deaminase, Monoamine-Oxidase, Galanin and 5-Hydroxytryptophan Uptake in the Tuberomammillary Nucleus of the Rat. Brain Research Bulletin, 17, 351-365.

Stanley,B.G., Chin,A.S., & Leibowitz,S.F. (1985) Feeding and drinking elicited by central injection of neuropeptide Y: evidence for a hypothalamic site(s) of action. Brain Research Bulletin, 14, 521-524.

Stanley,B.G., Kyrkouli,S.E., Lampert,S., & Leibowitz,S.F. (1986) Neuropeptide Y chronically injected into the hypothalamus: a powerful neurochemical inducer of hyperphagia and obesity. Peptides, 7, 1189.

Stanley,B.G. & Leibowitz,S.F. (1985) Neuropeptide Y injected in the paraventricular hypothalamus: a powerful stimulant of feeding behavior. Proc.Natl.Acad.Sci.U.S.A, 82, 3940-3943.

Stanley,B.G. & Leibowitz,S.F. (1984) Neuropeptide Y: stimulation of feeding and drinking by injection into the paraventricular nucleus. Life Sciences, 35, 2635-2642.

Stanley,S.A., Davies,S., Small,C.J., Gardiner,J.V., Ghatei,M.A., Smith,D.M., & Bloom,S.R. (2003) gamma-MSH increases intracellular cAMP accumulation and GnRH release in vitro and LH release in vivo. FEBS Lett., 543, 66-70.

Stanley,S.A., Murphy,K.G., Bewick,G.A., Kong,W.M., Opacka-Juffry,J., Gardiner,J.V., Ghatei,M., Small,C.J., & Bloom,S.R. (2004) Regulation of rat pituitary cocaine- and amphetamine- regulated transcript (CART) by CRH and glucocorticoids. Am.J.Physiol Endocrinol.Metab, 287, E583-E590. 342

Steele,K., Prokopowicz,G., Schweitzer,M., Magunsuon,T., Lidor,A., Kuwabawa,H., Kumar,A., Brasic,J., & Wong,D. (2010) Alterations of central dopamine receptors before and after gastric bypass surgery. Obesity surgery, 20, 369-374.

Steffensen,S.C., Svingos,A.L., Pickel,V.M., & Henriksen,S.J. (1998) Electrophysiological Characterization of GABAergic Neurons in the Ventral Tegmental Area. Journal of Neuroscience, 18, 8003-8015.

Steiner,R.A., Hohmann,J.G., Holmes,A., Wrenn,C.C., Cadd,G., Jureus,A., Clifton,D.K., Luo,M., Gutshall,M., Ma,S.Y., Mufson,E.J., & Crawley,J.N. (2001) Galanin transgenic mice display cognitive and neurochemical deficits characteristic of Alzheimer's disease. Proc.Natl.Acad.Sci.U.S.A, 98, 4184-4189.

Stephens,T.W., Basinski,M., Bristow,P.K., Bue-Vallesky,J.M., Burgett,S.G., Craft,L., Hale,J., Hoffmann,J., Hsiung,H.M., Kriauciunas,A., MacKellar,W., Rosteck,P.R., Schoner,B., Smith,D., Tinsley,F.C., Zhang,X.-Y., & Helman,M. (1995) The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature, 377, 530-532.

Stockell,H.A. & Renwick,A.G. (1992) Molecular structures of glycoprotein hormones and functions of their carbohydrate components. Biochem.J, 287 ( Pt 3), 665-679.

Stoddard,S.L., Bergdall,V.K., Townsen,D.W., & Levin,B.E. (1986) Plasma catecholamines associated with hypothalamically-elicited defense behavior. Physiology & behavior, 36, 867.

Stoyanovitch,A.G., Johnson,M.A., Clifton,D.K., Steiner,R.A., & Fraley,G.S. (2005) Galanin-like peptide rescues reproductive function in the diabetic rat. Diabetes, 54, 2471-2476.

Strowski,M.Z. & Blake,A.D. (2008) Function and expression of somatostatin receptors of the endocrine pancreas. Molecular and Cellular Endocrinology, 286, 169-179.

Sulser,F. (1979) New perspectives on the mode of action of antidepressant drugs. Trends in Pharmacological Sciences, 1, 92-94.

Sun,Y., Butte,N., Garcia,J., & Smith,R. (2008) Characterization of adult ghrelin and ghrelin receptor knockout mice under positive and negative energy balance. Endocrinology, 149, 843-850.

Swaab,D.F., Pool,C.W., & Nijveldt,F. (1975) Immunofluorescence of vasopressin and oxytocin in the rat hypothalamo-neurohypophypopseal system. J.Neural Transm., 36, 195-215.

Swanson,C.J., Blackburn,T.P., Zhang,X., Zheng,K., Xu,Z.Q., Hokfelt,T., Wolinsky,T.D., Konkel,M.J., Chen,H., Zhong,H., Walker,M.W., Craig,D.A., Gerald,C.P., & Branchek,T.A. (2005) Anxiolytic- and antidepressant-like profiles of the galanin-3 receptor (Gal3) antagonists SNAP 37889 and SNAP 398299. Proc.Natl.Acad.Sci.U.S.A, 102, 17489-17494.

Swanson,L.W. (1982) The projections of the ventral tegmental area and adjacent regions: a combined fluorescent retrograde tracer and immunofluorescence study in the rat. Brain Research Bulletin, 9, 321.

Sweet,D.C., Levine,A.S., Billington,C.J., & Kotz,C.M. (1999) Feeding response to central orexins. Brain Research, 821, 535-538.

343

Szczypka,M.S., Rainey,M.A., Kim,D.S., Alaynick,W.A., Marck,B.T., Matsumoto,A.M., & Palmiter,R.D. (1999) Feeding behavior in dopamine-deficient mice. Proceedings of the National Academy of Sciences of the United States of America, 96, 12138-12143.

Szkudlinski,M.W., Fremont,V., Ronin,C., & Weintraub,B.D. (2002) Thyroid-Stimulating Hormone and Thyroid-Stimulating Hormone Receptor Structure-Function Relationships. Physiological reviews, 82, 473-502.

Tachibana,T., Mori,M., Khan,M.S.I., Ueda,H., Sugahara,K., & Hiramatsu,K. (2008) Central administration of galanin stimulates feeding behavior in chicks. Comparative biochemistry and physiology.Part A, Molecular & integrative physiology, 151, 637-640.

Tainio,H., Vaalasti,A., & Rechardt,L. (1987) The distribution of substance P-, CGRP-, galanin- and ANP-like immunoreactive nerves in human sweat glands. Histochem.J, 19, 375-380.

Takahashi,T., Okimura,Y., Yoshimura,K., Shigeyoshi,Y., Kaji,H., Abe,H., & Chihara,K. (1995) Regional distribution of growth hormone-releasing hormone (GHRH) receptor mRNA in the rat brain. Endocrinology, 136, 4721.

Takatsu,Y., Matsumoto,H., Ohtaki,T., Kumano,S., Kitada,C., Onda,H., Nishimura,O., & Fujino,M. (2001) Distribution of galanin-like peptide in the rat brain. Endocrinology, 142, 1626-1634.

Takekawa,S., Asami,A., Ishihara,Y., Terauchi,J., Kato,K., Shimomura,Y., Mori,M., Murakoshi,H., Kato,K., Suzuki,N., Nishimura,O., & Fujino,M. (2002) T-226296: a novel, orally active and selective melanin-concentrating hormone receptor antagonist. European Journal of Pharmacology, 438, 129-135.

Takenoya,F., Aihara,K., Funahashi,H., Matsumoto,H., Ohtaki,T., Tsurugano,S., Yamada,S., Katoh,S., Kageyama,H., Takeuchi,M., & Shioda,S. (2003) Galanin-like peptide is target for regulation by orexin in the rat hypothalamus. Neurosci Lett., 340, 209-212.

Takenoya,F., Funahashi,H., Matsumoto,H., Ohtaki,T., Katoh,S., Kageyama,H., Suzuki,R., Takeuchi,M., & Shioda,S. (2002) Galanin-like peptide is co-localized with alpha-melanocyte stimulating hormone but not with neuropeptide Y in the rat brain. Neurosci Lett., 331, 119-122.

Takenoya,F., Guan,J.L., Kato,M., Sakuma,Y., Kintaka,Y., Kitamura,Y., Kitamura,S., Okuda,H., Takeuchi,M., Kageyama,H., & Shioda,S. (2006) Neural interaction between galanin-like peptide (GALP)- and luteinizing hormone-releasing hormone (LHRH)-containing neurons. Peptides, 27, 2885-2893.

Takenoya,F., Hirayama,M., Kageyama,H., Funahashi,H., Kita,T., Matsumoto,H., Ohtaki,T., Katoh,S., Takeuchi,M., & Shioda,S. (2005) Neuronal interactions between galanin-like-peptide- and orexin- or melanin-concentrating hormone-containing neurons. Regul Pept., 126, 79-83.

Tan,C.P., Sano,H., Iwaasa,H., Pan,J., Hreniuk,D.L., Feighner,S.D., Palyha,O.C., Pong,S.S., Figueroa,D.J., Austin,C.P., Jiang,M.M., Yu,H., Ito,J., Ito,M., Ito,M., Guan,X.M., MacNeil,D.J., Kanatani,A., Van Der Ploeg,L.H., & Howard,A.D. (2002) Melanin-concentrating hormone receptor subtypes 1 and 2: species-specific gene expression. Genomics, 79, 785.

Tan,H.M., Gundlach,A.L., & Morris,M.J. (2005) Exaggerated feeding response to central galanin-like peptide administration in diet-induced obese rats. Neuropeptides, 39, 333-336. 344

Tang,W.-X., Fasulo,W., Mash,D., & Hemby,S. (2003) Molecular profiling of midbrain dopamine regions in cocaine overdose victims. Journal of neurochemistry, 85, 911-924.

Tang-Christensen,M., Holst,J.J., Hartmann,B., & Vrang,N. (1999) The arcuate nucleus is pivotal in mediating the anorectic effects of centrally administered leptin. Neuroreport, 10, 1183-1187.

Tartaglia,L.A., Dembski,M., Weng,X., Deng,N., Culpepper,J., Devos,R., Richards,G.J., Campfield,L.A., Clark,F.T., Deeds,J., Muir,C., Sanker,S., Moriarty,A., Moore,K.J., Smutko,J.S., Mays,G.G., Wool,E.A., Monroe,C.A., & Tepper,R.I. (1995) Identification and expression cloning of a leptin receptor, OB-R. Cell, 83, 1263-1271.

Tatemoto,K., Rokaeus,A., Jornvall,H., McDonald,T.J., & Mutt,V. (1983) Galanin - a novel biologically active peptide from porcine intestine. FEBS Lett., 164, 124-128.

Taylor,A., Madison,F.N., & Fraley,G.S. (2009) Galanin-like peptide stimulates feeding and sexual behavior via dopaminergic fibers within the medial preoptic area of adult male rats. J.Chem.Neuroanat., 37, 105-111.

Tempel,D.L., Leibowitz,K.J., & Leibowitz,S.F. (1988) Effects of PVN galanin on macronutrient selection. Peptides, 9, 309-314.

Tempel,D.L. & Leibowitz,S.F. (1990) Diurnal variations in the feeding responses to norepinephrine, neuropeptide Y and galanin in the PVN. Brain Res Bull., 25, 821-825.

Tempel,D.L. & Leibowitz,S.F. (1994) Adrenal Steroid Receptors. Interactions with Brain Neuropeptide Systems in Relation to Nutrient Intake and Metabolism. Journal of neuroendocrinology, 6, 479.

Tena-Sempere,M. (2010) Kisspeptin signaling in the brain: Recent developments and future challenges. Molecular and Cellular Endocrinology, 314, 164-169.

Terry,P., Gilbert,D.B., & Cooper,S.J. (1995) Dopamine receptor subtype agonists and feeding behavior. Obesity research, 3, 515.

Thiele,T.E., Van Dijk,G., Yagaloff,K.A., Fisher,S.L., Schwartz,M., Burn,P., & Seeley,R.J. (1998) Central infusion of melanocortin agonist MTII in rats: assessment of c-Fos expression and taste aversion. AJP - Regulatory, Integrative and Comparative Physiology, 274, R248-R254.

Thomas,P., Mellon,P.L., Turgeon,J., & Waring,D.W. (1996) The L beta T2 clonal gonadotrope: a model for single cell studies of endocrine cell secretion. Endocrinology, 137, 2979-2989.

Thompson,E.L., Patterson,M., Murphy,K.G., Smith,K.L., Dhillo,W.S., Todd,J.F., Ghatei,M.A., & Bloom,S.R. (2004) Central and peripheral administration of kisspeptin-10 stimulates the hypothalamic-pituitary-gonadal axis. J Neuroendocrinol., 16, 850-858.

Thompson,R.H., Canteras,N.S., & Swanson,L.W. (1996) Organization of projections from the dorsomedial nucleus of the hypothalamus: a PHA-L study in the rat. Journal of comparative neurology, 376, 143.

345

Thompson,R.H. & Swanson,L.W. (1998) Organization of inputs to the dorsomedial nucleus of the hypothalamus: a reexamination with Fluorogold and PHAL in the rat. Brain Research Reviews, 27, 89.

Thorell,J.I. & Larson,S.M. (1978) Radioimmunoassay and related techniques: methodology and clinical applications, Mosby, Saint Louis.

Tilbrook,A.J. & Clarke,I.J. (2001) Negative feedback regulation of the secretion and actions of gonadotropin-releasing hormone in males. Biol.Reprod., 64, 735-742.

Timofeeva,E. (1997) Functional Activation of CRH Neurons and Expression of the Genes Encoding CRH and Its Receptors in Food-Deprived Lean ( Fa/?) and Obese ( fa/ fa) Zucker Rats. Neuroendocrinology, 66, 327.

Todd,J.F., Edwards,C.M., Ghatei,M.A., & Bloom,S.R. (2000) The differential effects of galanin-(1-30) and -(3-30) on anterior pituitary hormone secretion in vivo in humans. American journal of physiology: endocrinology and metabolism, 278, E1060-E1066.

Todd,J.F., Small,C.J., Akinsanya,K.O., Stanley,S.A., Smith,D.M., & Bloom,S.R. (1998) Galanin Is a Paracrine Inhibitor of Gonadotroph Function in the Female Rat. Endocrinology, 139, 4222- 4229.

Tokita,S. (2001) Behavioral characterization of orexin-2 receptor (OX2R) knockout mice. Sleep, 24, A20.

Tong,Y. & Pelletier,G. (1992) Role of dopamine in the regulation of proopiomelanocortin(POMC) mRNA levels in the arcuate nucleus and pituitary gland of the female rat as studied by in situ hybridization. Molecular brain research, 15, 27.

Tonshoff,B. & Mehls,O. (1997) Interactions between glucocorticoids and the growth hormone- insulin-like growth factor axis. Pediatric transplantation, 1, 183-189.

Torre,E. & Celis,M.E. (1988) Cholinergic mediation in the ventral tegmental area of alpha- melanotropin induced excessive grooming: changes of the dopamine activity in the nucleus accumbens and caudate putamen. Life Sciences, 42, 1651-1657.

Tschop,M., Smiley,D.L., & Heiman,M.L. (2000) Ghrelin induces adiposity in rodents. Nature, 407, 908-913.

Tsigos,C. & Chrousos,G.P. (2002) Hypothalamic-pituitary-adrenal axis, neuroendocrine factors and stress. Journal of Psychosomatic Research, 53, 865-871.

Tsigos,C. & Chrousos,G.P. (1994) Physiology of the hypothalamic-pituitary-adrenal axis in health and dysregulation in psychiatric and autoimmune disorders. Clinics in endocrinology and metabolism, 23, 451.

Tsujii,S. & Bray,G.A. (1989) Acetylation alters the feeding response to MSH and beta-endorphin. Brain Research Bulletin, 23, 165-169.

346

Tung,Y.C., Hewson,A.K., Carter,R.N., & Dickson,S.L. (2005) Central responsiveness to a ghrelin mimetic (GHRP-6) is rapidly altered by acute changes in nutritional status in rats. Journal of neuroendocrinology, 17, 387-393.

Tung,Y.C., Hewson,A.K., & Dickson,A.L. (2001) Actions of leptin on growth hormone secretagogue- responsive neurones in the rat hypothalamic arcuate nucleus recorded in vitro. Journal of neuroendocrinology, 13, 209-215.

Turgeon,J.L., Kimura,Y., Waring,D.W., & Mellon,P.L. (1996) Steroid and pulsatile gonadotropin- releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol.Endocrinol., 10, 439-450.

Turnbull,A.V. & Rivier,C. (1997) Corticotropin-releasing factor (CRF) and endocrine responses to stress: CRF receptors, binding protein, and related peptides. Proceedings of the Society for Experimental Biology and Medicine, 215, 1-10.

Turton,M.D., O'Shea,D., unn,I., eak,S.A., dwards,C.M., eeran,K., hoi,S.J., aylor,G.M., eath,M.M., ambert,P.D., ilding,J.P., mith,D.M., hatei,M.A., erbert,J., & loom,S.R. (1996) A role for glucagon-like peptide-1 in the central regulation of feeding. Nature, 379, 69-72.

Ueno,N., Inui,A., Iwamoto,M., Kaga,T., Asakawa,A., Okita,M., Fujimiya,M., Nakajima,Y., Ohmoto,Y., Ohnaka,M., Nakaya,Y., Miyazaki,J.I., & Kasuga,M. (1999) Decreased food intake and body weight in pancreatic polypeptide-overexpressing mice. Gastroenterology, 117, 1427-1432.

Uenoyama,Y., Tsukamura,H., Kinoshita,M., Yamada,S., Iwata,K., Pheng,V., Sajapitak,S., Sakakibara,M., Ohtaki,T., Matsumoto,H., & Maeda,K.I. (2008) Oestrogen-dependent stimulation of luteinising hormone release by galanin-like peptide in female rats. J Neuroendocrinol., 20, 626-631.

Ulrich-Lai,Y.M. & Herman,J.P. (2009) Neural regulation of endocrine and autonomic stress responses. Nat Rev Neurosci, 10, 397-409.

Ungerstedt,U. (1971) Adipsia and aphagia after 6-hydroxydopamine induced degeneration of the nigro-striatal dopamine system. Acta physiologica Scandinavica.Supplementum, 367, 95-122.

Uramura,K., Funahashi,H., Muroya,S., Shioda,S., Takigawa,M., & Yada,T. (2001) Orexin-a activates phospholipase C-and protein kinase C-mediated Ca2+ signaling in dopamine neurons of the ventral tegmental area. Neuroreport, 12, 1885.

Usiello,A., Baik,J.H., Rouge-Pont,F., Picetti,R., Dierich,A., LeMeur,M., Piazza,P.V., & Borrelli,E. (2000) Distinct functions of the two isoforms of dopamine D2 receptors. Nature, 408, 199-203.

Vaccarino,F.J., Bloom,F.E., Rivier,J., Vale,W., & Koob,G.F. (1985) Stimulation of food intake in rats by centrally administered hypothalamic growth hormone-releasing factor. Nature, 314, 167- 168.

Vaisse,C., Clement,K., Guy-Grand,B., & Froguel,P. (1998) A frameshift mutation in human MC4R is associated with a dominant form of obesity. Nature Genetics, 20, 113-114.

347

Vale,W., Rivier,C., Brown,M.R., Spiess,J., Koob,G.F., Swanson,L.W., Bilezikjian,L., Bloom,F., & Rivier,J. (1983) Chemical and biological characterization of corticotropin releasing factor. Recent progress in hormone research, 39, 245-270.

Vale,W., Spiess,J., Rivier,C., & Rivier,J. (1981) Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science, 213, 1394- 1397.

Van den Heuvel,D.M.A. (2008) Getting connected in the dopamine system. Progress in Neurobiology, 85, 75-93.

Van Der Kolk,N., Madison,F.N., Mohr,M., Eberhard,N., Kofler,B., & Fraley,G.S. (2010a) Alarin stimulates food intake in male rats and LH secretion in castrated male rats. Neuropeptides, 44, 333-340.

Van Der Kolk,N., Madison,F.N., Mohr,M., Eberhard,N., Kofler,B., & Fraley,G.S. (2010b) Alarin stimulates food intake in male rats and LH secretion in castrated male rats. Neuropeptides, In Press, Corrected Proof.

Vaughan,J.M., Fischer,W.H., Hoeger,C., ivier,J., & ale,W. (1989) Characterization of melanin- concentrating hormone from rat hypothalamus. Endocrinology, 125, 1660.

Veening,J.G., Swanson,L.W., Cowan,W.M., Nieuwenhuys,R., & Geeraedts,L.M. (1982) The medial forebrain bundle of the rat. II. An autoradiographic study of the topography of the major descending and ascending components. Journal of comparative neurology, 206, 82.

Villar,M.J., Cortes,R., Theodorsson,E., Wiesenfeld-Hallin,Z., Schalling,M., Fahrenkrug,J., Emson,P.C., & Hokfelt,T. (1989) Neuropeptide expression in rat dorsal root ganglion cells and spinal cord after peripheral nerve injury with special reference to galanin. Neuroscience, 33, 587.

Vinuela,M.C. & Larsen,P.J. (2001) Identification of NPY-induced c-Fos expression in hypothalamic neurones projecting to the dorsal vagal complex and the lower thoracic spinal cord. Journal of comparative neurology, 438, 286-299.

Vittoz,N. & Berridge,C.W. (2006) Hypocretin/orexin selectively increases dopamine efflux within the prefrontal cortex: involvement of the ventral tegmental area. Neuropsychopharmacology, 31, 384-395.

Vrontakis,M.E. (1990) Presence of galanin-like immunoreactivity in nontumorous corticotrophs and corticotroph adenomas of the human pituitary. The Journal of clinical endocrinology and metabolism, 70, 747.

Vrontakis,M.E., Peden,L.M., Duckworth,M.L., & Friesen,H.G. (1987) Isolation and characterization of a complementary DNA (galanin) clone from estrogen-induced pituitary tumor messenger RNA. The Journal of biological chemistry, 262, 16755-16758.

Vrontakis,M.E., Sano,T., Kovacs,K., & Friesen,H.G. (1990) Presence of galanin-like immunoreactivity in nontumorous corticotrophs and corticotroph adenomas of the human pituitary. The Journal of clinical endocrinology and metabolism, 70, 747.

348

Vuagnat,B.A., Pierroz,D.D., Lalaoui,M., Englaro,P., Pralong,F.P., Blum,W.F., & Aubert,M.L. (1998) Evidence for a leptin-neuropeptide Y axis for the regulation of growth hormone secretion in the rat. Neuroendocrinology, 67, 291-300.

Waldmeier,P.C. (1987) Amine oxidases and their endogenous substrates (with special reference to monoamine oxidase and the brain). Journal of neural transmission.Supplementum, 23, 55- 72.

Wang,G.J., Volkow,N.D., Logan,J., Pappas,N.R., Wong,C.T., Zhu,W., Netusil,N., & Fowler,J.S. (2001) Brain dopamine and obesity. The Lancet, 357, 354-357.

Wang,H.L. & Morales,M. (2008) Corticotropin-releasing factor binding protein within the ventral tegmental area is expressed in a subset of dopaminergic neurons. Journal of comparative neurology, 509, 302-318.

Wang,J. & Leibowitz,K.L. (1997) Central insulin inhibits hypothalamic galanin and neuropeptide Y gene expression and peptide release in intact rats. Brain Res, 777, 231-236.

Wang,S., Ghibaudi,L., Hashemi,T., He,C., Strader,C., Bayne,M., Davis,H., & Hwa,J.J. (1998a) The GalR2 galanin receptor mediates galanin-induced jejunal contraction, but not feeding behavior, in the rat: differentiation of central and peripheral effects of receptor subtype activation. FEBS Lett., 434, 277-282.

Wang,S., Hashemi,T., Fried,S., Clemmons,A.L., & Hawes,B.E. (1998b) Differential intracellular signaling of the GalR1 and GalR2 galanin receptor subtypes. Biochemistry, 37, 6711-6717.

Wang,S., Hashemi,T., He,C., Strader,C., & Bayne,M. (1997a) Molecular cloning and pharmacological characterization of a new galanin receptor subtype. Mol.Pharmacol, 52, 337-343.

Wang,S., He,C., Hashemi,T., & Bayne,M. (1997b) Cloning and expressional characterization of a novel galanin receptor. Identification of different pharmacophores within galanin for the three galanin receptor subtypes. J Biol.Chem., 272, 31949-31952.

Wang,S., He,C., Hashemi,T., & Bayne,M. (1997c) Cloning and expressional characterization of a novel galanin receptor. Identification of different pharmacophores within galanin for the three galanin receptor subtypes. J Biol.Chem., 272, 31949-31952.

Wang,S., He,C., Maguire,M.T., Clemmons,A.L., Burrier,R.E., Guzzi,M.F., Strader,C.D., Parker,E.M., & Bayne,M.L. (1997d) Genomic organization and functional characterization of the mouse GalR1 galanin receptor. FEBS Lett., 411, 225-230.

Wank,S.A., Harkins,R., Jensen,R.T., Shapira,H., de Weerth,A., & Slattery,T. (1992) Purification, molecular cloning, and functional expression of the cholecystokinin receptor from rat pancreas. Proceedings of the National Academy of Sciences of the United States of America, 89, 3125-3129.

Watanabe,T. (1984) Distribution of the histaminergic neuron system in the central nervous system of rats; a fluorescent immunohistochemical analysis with histidine decarΓÿÉ ylase as a marker. Brain Research, 295, 13.

349

Waters,S.M. & Krause,J.E. (2000) Distribution of galanin-1, -2 and -3 receptor messenger RNAs in central and peripheral rat tissues. Neuroscience, 95, 265-271.

Weingarten,H.P., Chang,P.K., & McDonald,T.J. (1985) Comparison of the metabolic and behavioral disturbances following paraventricular- and ventromedial-hypothalamic lesions. Brain Res.Bull., 14, 551-559.

Weiss,F., Markou,A., Lorang,M.T., & Koob,G.F. (1992) Basal extracellular dopamine levels in the nucleus accumbens are decreased during cocaine withdrawal after unlimited-access self- administration. Brain Research, 593, 314-318.

Werther,G.A., Hogg,A., Oldfield,B.J., McKinley,M.J., Figdor,R., Allen,A.M., & Mendelsohn,F.A. (1987) Localization and characterization of insulin receptors in rat brain and pituitary gland using in vitro autoradiography and computerized densitometry. Endocrinology, 121, 1562.

Wetsel,W.C., Valenca,M.M., Merchenthaler,I., Liposits,Z., Lopez,F.J., Weiner,R.I., Mellon,P.L., & Negro-Vilar,A. (1992) Intrinsic pulsatile secretory activity of immortalized luteinizing hormone-releasing hormone-secreting neurons. Proc.Natl.Acad.Sci.U.S.A, 89, 4149-4153.

Wheeler,M.D. & Styne,D.M. (1988) The Nonhuman Primate as a Model of Growth Hormone Physiology in the Human Being. Endocrine reviews, 9, 213-246.

White,J.D. & Kershaw,M. (1990) Increased hypothalamic neuropeptide Y expression following food deprivation. Molecular and cellular neurosciences, 1, 41-48.

White,R.G. (1963) Factors affecting the antibody response. British Medical Bulletin, 19, 207-213.

Wiegand,S.J. (1980) Cells of origin of the afferent fibers to the median eminence in the rat. Journal of comparative neurology, 192, 1.

Wierman,M.E., Rivier,J.E., & Wang,C. (1989) Gonadotropin-releasing hormone-dependent regulation of gonadotropin subunit messenger ribonucleic acid levels in the rat. Endocrinology, 124, 272-278.

Wilding,J.P., Gilbey,S.G., Bailey,C.J., Batt,R.A., Williams,G., Ghatei,M.A., & Bloom,S.R. (1993) Increased neuropeptide-Y messenger ribonucleic acid (mRNA) and decreased neurotensin mRNA in the hypothalamus of the obese (ob/ob) mouse. Endocrinology, 132, 1939.

Wilkinson,D.G. (2010b) The theory and practice of in situ hybridisation. In Situ Hybridization A Practical Approach (ed. by D. G. Wilkinson), pp. 1-21. Oxford University Press, New York.

Wilkinson,D.G. (2010a) The theory and practice of in situ hybridisation. In Situ Hybridization A Practical Approach (ed. by D. G. Wilkinson), pp. 1-21. Oxford University Press, New York.

Wilkinson,J.M., Halley,S., & Towers,P.A. (2000) Comparison of male reproductive parameters in three rat strains: Dark Agouti, Sprague-Dawley and Wistar. Laboratory Animals, 34, 70-75.

Will,M.J., Franzblau,E.B., & Kelley,A.E. (2003) Nucleus Accumbens {micro}-Opioids Regulate Intake of a High-Fat Diet via Activation of a Distributed Brain Network. The journal of neuroscience, 23, 2882.

350

Williams,D.L., Kaplan,L.M., & Grill,H.J. (2000) The role of the dorsal vagal complex and the vagus nerve in feeding effects of melanocortin-3/4 receptor stimulation. Endocrinology, 141, 1332- 1337.

Winokur,A. & Utiger,R.D. (1974) Thyrotropin-releasing hormone: regional distribution in rat brain. Science, 185, 265-267.

Wise,R.A. (1996) Neurobiology of addiction. Current Opinion in Neurobiology, 6, 243-251.

Wittmann,G., Sarkar,S., Hrabovszky,E., Liposits,Z., Lechan,R.M., & Fekete,C. (2004) Galanin- but not galanin-like peptide-containing axon terminals innervate hypophysiotropic TRH-synthesizing neurons in the hypothalamic paraventricular nucleus. Brain Res, 1002, 43-50.

Woll,P.J. & Rozengurt,E. (1989) Multiple neuropeptides mobilise calcium in small cell lung cancer: Effects of vasopressin, bradykinin, cholecystokinin, galanin and neurotensin. Biochemical and biophysical research communications, 164, 66-73.

Wong,M.L., Licinio,J., Pasternak,K.I., & Gold,P.W. (1994) Localization of corticotropin-releasing hormone (CRH) receptor mRNA in adult rat brain by in situ hybridization histochemistry. Endocrinology, 135, 2275.

Wood,W.G., Wachter,C., & Scriba,P.C. (1981) Experiences using chloramine-T and 1, 3, 4, 6- tetrachloro-3 alpha, 6 alpha-diphenylglycoluril (Iodogen) for radioiodination of materials for radioimmunoassay. J.Clin.Chem.Clin.Biochem., 19, 1051-1056.

Woods,A.J. & Stock,M.J. (1996) Leptin activation in hypothalamus. Nature, 381, 745.

Woods,S.C., Figlewicz,D.P., Madden,L., Porte,D., Jr., Sipols,A.J., & Seeley,R.J. (1998) NPY and food intake: discrepancies in the model. Regulatory Peptides, 75-76, 403-408.

Woods,S.C., Lotter,E.C., McKay,L.D., & Porte,D., Jr. (1979) Chronic intracerebroventricular infusion of insulin reduces food intake and body weight of baboons. Nature, 282, 503.

Woods,S.C., Seeley,R.J., Baskin,D.G., & Schwartz,M.W. (2003) Insulin and the blood-brain barrier. Current Pharmaceutical Design, 9, 795.

World Health Organisation. Obesity and overweight fact sheet. World Health Organisation . 2006. Ref Type: Electronic Citation

Wortley,K., del Rincon,J.-P., Murray,J., Garcia,K., Iida,K., Thorner,M., & Sleeman,M.W. (2005) Absence of ghrelin protects against early-onset obesity. Journal of Clinical Investigation, 115, 3573-3578.

Wren,A.M., Seal,L.J., Cohen,M.A., Brynes,A.E., Frost,G.S., Murphy,K.G., Dhillo,W.S., Ghatei,M.A., & Bloom,S.R. (2001a) Ghrelin enhances appetite and increases food intake in humans. The Journal of clinical endocrinology and metabolism, 86, 5992.

Wren,A.M., Small,C.J., Abbott,C.R., Dhillo,W.S., Seal,L.J., Cohen,M.A., Batterham,R.L., Taheri,S., Stanley,S.A., Ghatei,M.A., & Bloom,S.R. (2001b) Ghrelin causes hyperphagia and obesity in rats. Diabetes, 50, 2540-2547.

351

Wren,A.M., Small,C.J., Abbott,C.R., Jethwa,P.H., Kennedy,A.R., Murphy,K.G., Stanley,S.A., Zollner,A.N., Ghatei,M.A., & Bloom,S.R. (2002) Hypothalamic actions of neuromedin U. Endocrinology, 143, 4227-4234.

Wren,A.M., Small,C.J., Ward,H.L., Murphy,K.G., Dakin,C.L., Taheri,S., Kennedy,A.R., Roberts,G.H., Morgan,D.G., Ghatei,M.A., & Bloom,S.R. (2000) The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology, 141, 4325-4328.

Wrenn,C.C., Kinney,J., Marriott,L., Holmes,A., Harris,A.R., Saavedra,M., Starosta,G., Innerfield,C., Jacoby,A.S., Shine,J., Iismaa,T., Wenk,G., & Crawley,J.N. (2004) Learning and memory performance in mice lacking the GAL-R1 subtype of galanin receptor. The European journal of neuroscience, 19, 1384-1396.

Wynick,D., Hammond,P.J., Akinsanya,K., & Bloom,S.R. (1993a) Galanin regulates basal and oestrogen-stimulated lactotroph function. Nature, 364, 529-532.

Wynick,D., Small,C.J., Bacon,A., Holmes,F.E., Norman,M., Ormandy,C.J., Kilic,E., Kerr,N.C., Ghatei,M.A., Talamantes,F., Bloom,S.R., & Pachnis,V. (1998a) Galanin regulates prolactin release and lactotroph proliferation. Proceedings of the National Academy of Sciences of the United States of America, 95, 12671-12676.

Wynick,D., Small,C.J., Bloom,S.R., & Pachnis,V. (1998b) Targeted disruption of the murine galanin gene. Ann N Y.Acad.Sci., 863, 22-47.

Wynick,D., Smith,D.M., Ghatei,M., Akinsanya,K., Bhogal,R., Purkiss,P., Byfield,P., Yanaihara,N., & Bloom,S.R. (1993c) Characterization of a high-affinity galanin receptor in the rat anterior pituitary: absence of biological effect and reduced membrane binding of the antagonist M15 differentiate it from the brain/gut receptor. Proc.Natl.Acad.Sci.U.S.A, 90, 4231-4235.

Wynick,D., Smith,D.M., Ghatei,M., Akinsanya,K., Bhogal,R., Purkiss,P., Byfield,P., Yanaihara,N., & Bloom,S.R. (1993b) Characterization of a high-affinity galanin receptor in the rat anterior pituitary: absence of biological effect and reduced membrane binding of the antagonist M15 differentiate it from the brain/gut receptor. Proc.Natl.Acad.Sci.U.S.A, 90, 4231-4235.

Wynne,K., Park,A., Small,C.J., Patterson,M., Ellis,S., Murphy,K., Wren,A.M., Frost,G., Meeran,K., Ghatei,M., & Bloom,S.R. (2005) Subcutaneous oxyntomodulin reduces body weight in overweight and obese subjects: a double-blind, randomized, controlled trial. Diabetes, 54, 2390-2395.

Xu,A., Kaelin,C.B., Morton,G.J., Ogimoto,K., Stanhope,K., Graham,J., Baskin,D.G., Havel,P., Schwartz,M.W., & Barsh,G.S. (2005) Effects of hypothalamic neurodegeneration on energy balance. PLoS biology, 3, e415.

Xu,B., Kalra,P.S., Farmerie,W.G., & Kalra,S.P. (1999) Daily changes in hypothalamic gene expression of neuropeptide Y, galanin, proopiomelanocortin, and adipocyte leptin gene expression and secretion: effects of food restriction. Endocrinology, 140, 2868-2875.

Xu,R.K. (1995) [Regulatory role of galanin on prolactin and beta-endorphin release from anterior pituitary lobe of rat]. sheng li xue bao, 47, 65-72.

352

Xu,X.J., Andell,S., Bartfai,T., & Wiesenfeld-Hallin,Z. (1995a) The effects of intrathecal galanin message-associated peptide (GMAP) on the flexor reflex in rats. Regulatory Peptides, 58, 19- 24.

Xu,X.J., Andell,S., Bartfai,T., & Wiesenfeld-Hallin,Z. (1996) Fragments of galanin message-associated peptide (GMAP) modulate the spinal flexor reflex in rat. European Journal of Pharmacology, 318, 301-306.

Xu,X.J., Andell,S., Zhang,X., Wiesenfeld-Hallin,Z., Langel,U., Bedecs,K., Hokfelt,T., & Bartfai,T. (1995b) Peripheral axotomy increases the expression of galanin message-associated peptide (GMAP) in dorsal root ganglion cells and alters the effects of intrathecal GMAP on the flexor reflex in the rat. Neuropeptides, 28, 299-307.

Xu,X.J., Wiesenfeld-Hallin,Z., Langel,U., Bedecs,K., & Bartfai,T. (1995c) New high affinity peptide antagonists to the spinal galanin receptor. British Journal of Pharmacology, 116, 2076-2080.

Xu,Z.Q., Shi,T.J., & Hokfelt,T. (1998) Galanin/. J.Comp Neurol., 392, 227-251.

Yang,S.C., Pan,J.T., & Li,H.Y. (2004) CART peptide increases the mesolimbic dopaminergic neuronal activity: a microdialysis study. European Journal of Pharmacology, 494, 179-182.

Yang,S.C., Shieh,K.R., & Li,H.Y. (2005a) Cocaine- and amphetamine-regulated transcript in the nucleus accumbens participates in the regulation of feeding behavior in rats. Neuroscience, 133, 841-851.

Yang,Y., Zhou,L., Liu,S., Tang,J., Li,F., Li,R., Song,H., & Chen,M. (2005b) Expression of feeding-related peptide receptors mRNA in GT1-7 cell line and roles of leptin and orexins in control of GnRH secretion. Acta pharmacologica Sinica (monthly), 26, 976-981.

Yao,M. & Denver,R.J. (2008) Regulation of vertebrate corticotropin-releasing factor genes. General and comparative endocrinology, 153, 200-216.

Yen,P.M. (2001) Physiological and molecular basis of thyroid hormone action. Physiological reviews, 81, 1097-1142.

Yeo,G.S., Farooqi,I.S., Aminian,S., Halsall,D.J., Stanhope,R.G., & O'Rahilly,S. (1998) A frameshift mutation in MC4R associated with dominantly inherited human obesity. Nature Genetics, 20, 111-112.

Yokote,R., Sato,M., Matsubara,S., Ohye,H., Niimi,M., Murao,K., & Takahara,J. (1998) Molecular Cloning and Gene Expression of Growth Hormone-Releasing Peptide Receptor in Rat Tissues. Peptides, 19, 15-20.

Youdim,M.B.H., Edmondson,D., & Tipton,K.F. (2006) The therapeutic potential of monoamine oxidase inhibitors. Nat Rev Neurosci, 7, 295-309.

Zarjevski,N., Cusin,I., Vettor,R., Rohner-Jeanrenaud,F., & Jeanrenaud,B. (1993) Chronic intracerebroventricular neuropeptide-Y administration to normal rats mimics hormonal and metabolic changes of obesity. Endocrinology, 133, 1753.

353

Zarrindast,M.R., Hosseini-Nia,T., & Allah-Maddadi,S. (1989) Food intake suppressant effect of baclofen in rats. General pharmacology, 20, 701-703.

Zhang,Y., Proenca,R., Maffei,M., Barone,M., Leopold,L., & Friedman,J.M. (1994) Positional cloning of the mouse obese gene and its human homologue. Nature, 372, 425-432.

Zheng,H., Patterson,L., & Berthoud,H.R. (2007) Orexin signaling in the ventral tegmental area is required for high-fat appetite induced by opioid stimulation of the nucleus accumbens. The journal of neuroscience, 27, 11075-11082.

Zheng,H., Townsend,R.L., Shin,A.C., Patterson,L.M., Phifer,C.B., & Berthoud,H.R. (2010) High-fat intake induced by mu-opioid activation of the nucleus accumbens is inhibited by Y1R- blockade and MC3/4R-stimulation. Brain Research, In Press, Corrected Proof.

Zhou,Q.Y. & Palmiter,R.D. (1995) Dopamine-deficient mice are severely hypoactive, adipsic, and aphagic. Cell, 83, 1197-1209.

Zigman,J., Jones,J., Lee,C., Saper,C.B., & Elmquist,J.K. (2006) Expression of ghrelin receptor mRNA in the rat and the mouse brain. Journal of comparative neurology, 494, 528-548.

Zigman,J., Nakano,Y., Coppari,R., Balthasar,N., Marcus,J.N., Lee,C., Jones,J., Deysher,A., Waxman,A., White,R.G., Williams,T., Lachey,J., Seeley,R.J., Lowell,B., & Elmquist,J.K. (2005) Mice lacking ghrelin receptors resist the development of diet-induced obesity. Journal of Clinical Investigation, 115, 3564-3572.

Zigmond,M.J. & Stricker,E.M. (1972) Deficits in feeding behavior after intraventricular injection of 6- hydroxydopamine in rats. Science, 177, 1211-1214.

Zini,S., Roisin,M.P., Langel,U., Bartfai,T., & Ben-Ari,Y. (1993) Galanin reduces release of endogenous excitatory amino acids in the rat hippocampus. European Journal of Pharmacology, 245, 1-7.

Zittel,T.T., Glatzle,J., Kreis,M.E., Starlinger,M., Eichner,M., Raybould,H.E., Becker,H.D., & Jehle,E.C. (1999) C-fos protein expression in the nucleus of the solitary tract correlates with cholecystokinin dose injected and food intake in rats. Brain Research, 846, 1-11.

Zorrilla,E.P., Brennan,M., Sabino,V., Lu,X., & Bartfai,T. (2007) Galanin type 1 receptor knockout mice show altered responses to high-fat diet and glucose challenge. Physiol Behav., 91, 479-485.

Zweifel,L.S., Parker,J.G., Lobb,C.J., Rainwater,A., Wall,V.Z., Fadok,J.P., Darvas,M., Kim,M.J., Mizumori,S.J.Y., Paladini,C.A., Phillips,P.E.M., & Palmiter,R.D. (2009) Disruption of NMDAR- dependent burst firing by dopamine neurons provides selective assessment of phasic dopamine-dependent behavior. Proceedings of the National Academy of Sciences, 106, 7281-7288.

354

APPENDIX I –SOLUTIONS USED IN THIS THESIS

0.5M acetic acid Add 15ml of glacial acetic acid (98%) to 500ml GDW

5M ammonium acetate

Dissolve 385g CH3.COONH4 in 600ml GDW and make up to 1L

100mg/ml ampicillin Dissolve 1g in 10ml GDW, sterilise by passage through a 0.2µm filter and distribute in 1ml aliquots

Artificial cerebrospinal fluid (aCSF) Make aCSF immediately before use. To make 500 ml aCSF mix 100ml 0.1M NaHCO , 100ml 0.63M 3

NaCl, 5ml 0.09M Na2HPO4.2H2O, 5ml 0.59M KCl, 5ml 0.09M MgSO4 7H2O, 450 mg glucose, 88 mg . ascorbic acid, 5ml aprotinin (Trasylol, Bayer Corp) and 270ml GDW. Saturate with 95% O2 and 5%

CO2. Add 10ml 0.07M CaCl2.2H2O after gassing.

56mM KCl (stimulatory) aCSF

Make aCSF immediately before use. To make 100ml 56mM KCl aCSF, mix 20ml 0.1M NaHCO3,

11.6ml 0.63M NaCl, 1ml 0.09M Na2HPO4.2H2O, 10ml 0.59M KCl, 1ml 0.09M MgSO4 7H2O, 90 mg . glucose, 17.6mg ascorbic acid, 1ml aprotinin (Bayer Corp) and 53.4ml GDW. Saturate with 95% O2

and 5% CO2. Add 2ml 0.07M CaCl2.2H2O after gassing. aCSF stock solutions:

0.09M disodium hydrogen orthophosphate dehydrate: Dissolve 1.56g Na2HPO4.2H2O in 100ml GDW

0.07M calcium chloride dehydrate: Dissolve 1.04g CaCl2.2H2O in 100ml GDW

0.09M magnesium sulphate heptahydrate: Dissolve 2.2g MgSO4 7H2O in 100ml GDW . 0.59M potassium chloride: Dissolve 4.42g KCl in 100ml GDW

0.1M sodium bicarbonate: Dissolve 4.62g NaHCO3 in 500ml GDW 0.63M sodium chloride: Dissolve 18.43g NaCl in 500ml GDW

355

Blocking solution (ISH) Dissolve 18.21g Trizma base and 13.14g NaCl in 440ml GDW. Add 30ml FBS and 7.5ml 1:10 Triton X and pH to 7.5

Caesium chloride saturated isopropanol

Mix 100g CsCl2, 100ml GDW and 100ml isopropanol and leave to settle

0.01M citrate buffer Dissolve 19.2g citric acid in 900ml GDW. pH to 6 and make up to 1L with GDW

1% Copper sulphate solution Dissolve 1g of copper sulphate in 100ml GDW

Deionised formamide Add 1g of amberlite MB6113 (indicator) mixed resin per 10ml formamide. Incubate for 1 hour in the 37°C shaker until indicator turns yellow. Pass through a sterile filter before use.

Denaturing solution (DENAT) Mix 1ml formamide, 300µl formaldehyde and 100µl 20 x MOPS

Denhart’s solution Dissolve 10g of each of ficoll, polyvinyl-pyrrolidone and BSA in 500ml GDW. Store in aliquots at - 20°C

Detection buffer

Mix 0.8ml 5M NaCl, 1.6ml MgCl2, 8ml 0.5M Tris-HCl pH9.8 and add 20mg levamisol. Make up to

20ml with GDW and add 20ml of 10% polyvinyl acetate. For development, omit the MgCl2 and add 2 drops of reagent 1, 2, and 3 per 5 ml detection buffer.

Dextran coated charcoal Add 2.4g charcoal and 0.24g dextran to 100ml phosphate buffer with gelatine and mix for 20 mins at 20°C

356

Dextran sulphate Dissolve 1g dextran sulphate on 1.5ml GDW. Warm at 60°C for 2-3 hours to dissolve and vortex before use

DNA loading buffer

Mix 3.125ml 80% glycerol, 50µl 0.5M CH14H2O8Na2.2H2O (EDTA) and 6.075ml GDW, add 10mg orange G

10 x DNAse buffer

Add 0.8 ml 1M tris/HCl, pH7.4, 120 µl 1M MgCl2 and 40 µl of CsCls2 to 99ml PCR GDW dNTP mix for PCR and reverse transcription Mix 20µl each of 100mM dGTP, dCTP,dATP and dTTP in 120µl filtered GDW.

0.5M ethylenediaminetetra-acetic acid (EDTA)

Dissolve 186.1g CH14H2O8Na2.2H2O (EDTA) in 800ml GDW and adjust pH to 8.0. Make up to 1L with GDW

4% formaldehyde solution Dissolve 100mls 40% formaldehyde in 1L GDW

4% formaldehyde in phosphate buffered 1.5% saline

15g of NaCl, 28.2g Na2HPO4.2H20 and 5.44g KH2PO4 were dissolved in 800mls H20. 100mls of 40% formaldehyde were added and the solution made up to 1L. Adjust to pH 6.5 using HCl.

Glucose-Tris-EDTA buffer (GTE)

Mix 2.5ml 1M Tris HCl pH8, 2ml 0.5M CH14H2O8Na2.2H2O (EDTA) and 5ml 18% glucose and make up to 100ml with GDW. Sterilise by passing through a 0.2µm filter

1M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) Add 238.3g HEPES to 450ml GDW. Adjust to pH 7.4 or 7.6 using HCl, and make up to 1L with GDW.

357

1mM HEPES pH 7.4 buffer (cell membrane preparation) Add 100µl 1M HEPES pH 7.4 and 1ml aprotinin to 99ml GDW. Add 100µl pepstatin (Sigma, USA), 100µl leupeptin (Sigma, USA), 100µl benzamidine (Sigma, USA), 100µl antipain (Sigma, USA) and 200µl soya bean trypsin inhibitor (SBTI) (Sigma, USA), and store on ice.

20mM HEPES binding buffer

Dissolve 0.74g MgCl2 and 0.204g of CaCl2 into 980ml GDW. Add 20ml 1M HEPES and adjust to pH 7.4. Add BSA as required at 3.3% v/v.

50mM HEPES pH 7.4 buffer (cell membrane preparation) Add 5ml 1M HEPES pH 7.4 and 1ml aprotinin to 94ml GDW. Add 100µl pepstatin, 100µl leupeptin, 100µl benzamidine, 100µl antipain and 200µl soya bean trypsin inhibitor (SBTI), and store on ice.

Homogenisation buffer (tissue membrane preparation) Add 5ml 1M HEPES pH 7.6, 100ul pepstatin, 100ul leupeptin, 100ul benzamidine, 100ul antipain and 200ul soya bean trypsin inhibitor (SBTI) to 95ml water. To 50ml buffer, add 8.55g sucrose. Put both the sucrose and non sucrose containing buffers on ice.

Hybridisation buffer (frozen sections) Add 1.25ml formamide, 300µl 5M NaCl, 50µl 100 x Denhardts Solution, 50µl 1M Tris pH8, 10µl 0.5M EDTA pH8, 1.34ml DEPC water and 1ml 50% dextran sulphate together and mix well. To 800µl hybridisation buffer, add 200µl probe mixture: 50µl 10mg/ml tRNA and 10µl 100mM DTT made up to 200µl with DEPC water, and mix well.

Hybridisation buffer (paraffin sections) Add 5ml deionised formamide, 2.5ml 20x SSC, 200µl 100 x Denhardts Solution, 100µl 1M Tris pH7.5, 250µl 10% SDS, 20µl 0.5M EDTA pH8, 1.25ml 10mg/ml tRNA, 680µl DEPC GDW, 1g dextran sulphate together and mix well.

Kemteck buffer (0.05M) (RIA buffer)

Dissolve 22.4g NaH2PO4.2H2O, 9.96g Na2HPO4.2H2O, 14.8g C10H14H2O8Na2.2H2O, 1g

C9H9HgNaO2S, 26.6ml of 30% BSA in 5L of glass distilled water (GDW) that has been boiled and allowed to cool. Adjust to pH 7.4 with sodium hydroxide. Store at 4°C.

358

Lysogeny broth (LB) Dissolve 10g NaCl, 10g tryptone and 5g yeast extract. Adjust pH to 7.5 and sterilise by autoclaving

LB agar Add 7g agar to 500ml LB and melt by autoclaving

1M magnesium chloride Dissolve 203.3g MgCl2 in 1L GDW

Maleic buffer Dissolve 116g maleic acid and 88g NaCl into 800ml GDW. pH to 7.5 with NaOH and make up to 1L with GDW

20x MOPS

Dissolve 83.6g 3-(N-Morpholino)propanesulphonic acid (MOPS), 8.1g sodium acetate, 7.4g

C10H14H2O8Na2.2H2O and 2.5ml formaldehyde to 800ml GDW. Adjust to pH 7.0 with 10M sodium hydroxide and make up to 1L.

PCR GDW PCR GDW is sterile. Autoclave 100ml ultrapure GDW in small aliquots. Keep sterile until use.

Phosphate buffer (0.06M) (RIA buffer)

Dissolve 48 g of Na2HPO4.2H2O, 4.13 g KHPO4, 18.61 g C10H14H2O8Na2.2H2O, 2.5 g NaN3 in 5 L of

GDW that has been boiled and allowed to cool. Measure the pH to confirm it is 7.4±0.1. Store at 4°C.

Phosphate buffer (0.06M) with gelatin The buffer is produced as above with 12.5 g of gelatin dissolved in the boiling GDW then cooled before the addition of the other ingredients.

Phosphate buffered saline (PBS) 10x PBS (0.1M)

Add 80g of NaCl, 2g KCl, 14.4g Na2HPO4, 2.4g KH2PO4 to 800ml GDW. Adjust volume to 1L with GDW, adjust pH to 7.4 and sterilise by autoclaving. 1x PBS (0.01M) Add 100ml 10x PBS to 900ml GDW. Sterilise by autoclaving. 359

Phosphate buffered saline containing Tween 0.05% (PBST) Add 1ml Tween 20 (VWR) to every 2L 0.01M PBS

10% Polyethylene glycol (RIA) Dissolve 100g of polyethylene glycol into 1L GDW

3M potassium acetate Dissolve 294.4g CH3COOK in 500ml GDW and add 115ml glacial acetic acid. Make up to 1L with GDW

10mg/ml RNase A Add 100mg RNAse A, 50µl 2M Tris and 30µl 5M NaCl to 9.92ml GDW, and boil for 15 minutes. Allow to cool and aliquot.

20 x salt sodium citrate (SSC)

Add 1.753g NaCl and 882g Na3C6H5O7.2H2O to 8L GDW, adjust to pH 7.0 and make up to 10L.

Sephadex G for iodination of pituitary hormones 50 Add 8g Sephadex G50 beads (Sigma) to 200ml GDW. Soak for 1 hour at room temperature. Heat for 20 minutes in a boiling water bath, and allow to cool overnight. To make columns, plug a 10ml pipette with glass wool, and slowly fill with cooled Sephadex gel. Allow gel to settle, and seal columns with parafilm to prevent drying out.

2M sodium acetate pH5.2 Dissolve 164.1g CH3CooNa in 800 ml GDW, adjust to pH 5.2 with glacial acetic acid and make up to 1L with GDW

5M sodium chloride Dissolve 292.2g NaCl in 1L GDW

20% sodium dodecyl sulphate (SDS) Add 200g SDS to 800 ml autoclaved water, heat to 60°C while stirring. Allow to cool and make up to 1L with water. To make 1% SDS, dilute 5ml 20% SDS into 95ml water.

360

10M sodium hydroxide Dissolve 400g of NaOH in 500ml GDW. Once dissolved, make up to 1L with GDW

0.2M sodium hydroxide/1%SDS Mix 2ml 10M sodium hydroxide, 5ml 20% SDS and 93ml autoclaved water

0.5M sodium phosphate pH6.8 Dissolve 71g Na2HPO4.2H20 in 1L GDW and 41.4g NaH2PO4.H20 in 600ml gdw and mix

30% sucrose solution Dissolve 300g of sucrose in 1L GDW

50 x Tris-acetate-EDTA (TAE) buffer Dissolve 242g Trizma base in 843ml GDW and mix in 57ml glacial acetic acid and 100ml 0.5M

C10H14H2O8Na2.2H2O.

TAE running buffer To 1L GDW, add 75µl ethidium bromide and 10ml 50 x TAE.

100 x TE

Dissolve 121.1g Trizma base and 3.7g C10H14H2O8Na2.2H2O in 800ml GDW and adjust to pH 7.5 with HCl. Make up to 1L.

1M TEA

Dissolve 7.42g C6H15NO3.HCl (triethanolamine-hydrochloride) in 30ml GDW, adjust to pH 8.0 with conc. NaOH and adjust the volume to 400ml with GDW. Tris-EDTA-Sodium chloride (TES) Buffer

Mix 25ml 1M Tris-HCl pH8, 5ml 5M NaCl and 5ml C10H14H2O8Na2.2H2O, make up to 500ml with distilled water.

Transformation buffer I (TFBI)

Dissolve 589g CH3.COOK, 2.4g RbCl, 1.979g CaCl2.2H2O and 438mg MnCl2.4H20 in GDW. Add 37.5ml 80% glycerol and make up to 200ml with GDW. Sterilise by passing through a 0.2µm filter.

361

Transformation buffer II (TFBII)

Dissolve 418g MOPS, 3.28g CaCl2.2H2O and 242mg RbCl in GDW. Add 37.5ml 80% glycerol and make up to 200ml with GDW. Sterilise by passing through a 0.2µm filter.

1M Tris-HCl pH7.5 Dissolve 121.1g Trizma base in 800ml GDW and adjust to pH 7.5 with HCl. Make up to 1L

2M Tris-HCl pH 8.0 Dissolve 121.1g Trizma base in 450ml GDW and adjust to pH 8.0 with HCl. Make up to 500ml.

0.1M Tris-NaCl buffer (ISH) Dissolve 12.14g Trizma base and 8.76g NaCl in 995ml GDW. Add 5ml Triton X 1;10 and pH to 9.5 or 7.5 as required.

Versene

Dissolve 16g NaCl, 0.4g KCl, 2.88g Na2HPO4.2H2O (di-sodium hydrogen orthophosphate), 1.2g

C10H14N2O8Na2.2H2O (EDTA) and 0.4g KH2PO4 (potassium dihydrogen orthophosphate) in 1l GDW, add 3ml phenol red (Sigma) and make up to 2L with GDW. Sterilise by autoclaving.

362

APPENDIX II – SUPPLIERS OF REAGENTS AND EQUIPMENT USED IN THIS THESIS

Amersham International plc, Little Chalfont, Buckinghamshire, UK. Associated Dental Products Ltd, Kemdent Works, Purton, Swindon, UK ATCC, Middlesex, UK Bachem St. Helens, UK Bayer UK, Bury St. Edmonds, UK BioXtal, Mundelsohm, France Bright Instruments, Huntingdon, UK Campden Instruments, Loughborough, UK Charles River, Bicester, UK. Clark Electromedial Instruments, Pangbourne, Reading, UK Fisher Scientific, Leicestershire, UK Gibco BRL (Life Technologies Ltd.), Paisley, Renfrewshire, UK. GraphPad, La Jolla, CA, USA Harvard Apparatus, Massachusetts, USA Helena Biosciences, Sunderland, UK Invitrogen, Paisley, UK Life Sciences Technology, Eggenstein, Germany New England Bioloabs, Hitchin, Herts, UK Parke-Davis, Pontypool, Gwent, UK. Peptide Institute, Kyoto, Japan. Perkin Elmer, Massachusetts, USA Pharmacia Biotechnology Ltd., St. Albans, Hertsfordshire, UK. Phoenix Pharmaceuticals Belmont, CA, USA Plastics One Inc, Roanoke, VA, USA. Promega, Southampton, UK Research Diets Inc, New Brunswick, NJ, USA Schering-Plough Corporation, Welwyn Garden City, Herts, UK Sigma-Aldrich Company Ltd., Poole, Dorset, UK. Systat Ltd., Evanston, Illinois, USA. VWR, Poole, UK

363

PUBLICATIONS

Boughton CK, Patterson M, Bewick GA, Tadross JA, Gardiner JV, Beale KEL, Chaudery F, Hunter G, Busbridge M, Leavy EM, Ghatei MA, Bloom SR, Murphy KG. 2010. Alarin stimulates food intake and gonadotrophin release in male rats. Accepted for publication in British Journal of Pharmacology

Gardiner JV, Beale KEL, Roy D, Boughton CK, Bataveljic A, Campbell DC, Bewick GA, Patel NA, Patterson M, Leavy EM, Ghatei MA, Bloom SR, Dhillo WS. 2010. Cerebellin1 is a novel orexigenic peptide. Accepted for publication in Diabetes, Obesity and Metabolism

Tadross JA, Patterson M, Suzuki K, Beale KE, Boughton CK, Smith KL, Moore S, Ghatei MA, Bloom SR. 2010. Augurin stimulates the hypothalamo-pituitary-adrenal axis via the release of corticotrophin-releasing factor in rats. British Journal of Pharmacology159 (8):1663-71.

364