Co-Amplification of a Novel Cyclophilin-Like Gene (PPIE) with L

Oncogene (1998) 17, 1019 ± 1026  1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Co-ampli®cation of a novel cyclophilin-like gene (PPIE) with L-myc in small cell lung cancer cell lines

Ju-Ock Kim1,3, Marion M Nau1, Kathrine A Allikian1, Tomi P MaÈ kelaÈ 2, Kari Alitalo2, Bruce E Johnson1 and Michael J Kelley1

1Lung Cancer Biology Section, Medicine Branch, Division of Clinical Sciences, National Cancer Institute, Bethesda, Maryland, 20889-5105 USA and 2Laboratory of Cancer Biology, Department of Virology and Pathology, University of Helsinki, 00290 Helsinki, Finland

Speci®c genetic alterations aecting proto-oncogenes of myc,N-myc, and L-myc) occurs in lung cancer both in the myc gene family are frequently detected in human the presence and absence of other detectable genetic lung cancer. Among 11 SCLC cell lines with L-myc gene alterations such as gene ampli®cation and genomic ampli®cation, four were found to have alteration of the rearrangement. In patients with small cell lung cancer RLF gene by Southern blot and RT ± PCR analyses. (SCLC), DNA ampli®cation of c-myc is more common One cell line, NCI-H378, contained aberrantly-sized L- in tumor cell lines established from treated than myc-hybridizing bands by Southern and Northern blot untreated patients' tumors (Johnson et al., 1996). hybridization but had no alteration of RLF. Some L- DNA ampli®cation of c-myc is also associated with myc-hybridizing cDNAs from NCI-H378 contained a the variant form of SCLC cell lines (Little et al., 1983), novel sequence with close homology to the cyclophilins which typically have greater cloning eciency in soft joined to antisense L-myc exon 2 sequence. Full length agar, shorter doubling time in vitro, altered in vitro and cDNAs isolated from human skeletal muscle containing in vivo morphology, and lower expression of markers only the novel sequence identify open reading frames of of neuroendocrine dierentiation compared to the 301 and 296 amino acids and dier in the C-terminal more common classic SCLC cell lines (Carney et al., region by 22 and 17 amino acids. This gene, tentatively 1985; Gazdar et al., 1985). In contrast, tumors with L- named PPIE (peptidyl-prolyl cis-trans isomerase E), has myc ampli®cation are most commonly of the classic 83% amino acid identity with the central conserved morphology (Johnson et al., 1996). In patients with region of cyclophilin A, is evolutionarily conserved by previously treated SCLC, the presence of c-myc DNA Southern blot, and exhibits dierential tissue expression ampli®cation is associated with shortened survival with highest levels found in muscle and brain. Co- (Johnson et al., 1996). ampli®cation of PPIE was observed in seven of eleven L- The human L-myc gene (also known as MYCL1) myc ampli®ed cell lines. Analysis of radiation hybrids was initially identi®ed in SCLC cell lines and tumors suggests that the gene order is RLF-PPIE-L-myc on because of DNA ampli®cation of sequences homo- chromosome 1p and pulse-®eld gel electrophoresis logous to but dierent from the human c-myc and N- localizes all three genes to an 800 megabase Mlu I myc genes (Nau et al., 1985) and consists of three fragment. The prognostic and functional consequences of exons spanning approximately 6.6 kb (Kaye et al., PPIE gene ampli®cation in SCLC can now be 1988) on chromosome 1p32 (Nau et al., 1985). L-myc determined. DNA ampli®cation is found in 18% of SCLC cell lines and 12% of SCLC tumors (Johnson, 1996). The Keywords: gene ampli®cation; L-myc; cyclophilin; small various sized L-myc transcripts, including 3.9 kb, cell lung cancer; tumor cell line; alternative splicing 3.6 kb, and smaller sized species, result from alternative transcription initiation and termination sites (Kaye et al., 1988), and all include exons 2 and 3 and a a predicted 364 amino acid protein (De Greve et al., Introduction 1988). Alternative translation initiation from a CTG start site in intron 1 and post-translational modifica- Speci®c chromosomal alterations including transloca- tion results in proteins with apparent molecular weight tions, inversions, deletions, and DNA ampli®cation of 60 to 66 kDa (Dosaka-Akita et al., 1991). have been identi®ed in a large number of tumor types. Observation of an abnormally-sized protein on L- Activation of proto-oncogenes of the myc family (c- Myc immunoblots of SCLC cell lines led to identifica- tion of the RLF (rearranged L-myc fusion) gene (MaÈ kelaÈ et al., 1991b), which is 310 kb centromeric to L-myc (Hellsten et al., 1995). Juxtaposition of the RLF and L-myc genes in SCLC cells results in Correspondence: M Kelley expression of a chimeric RLF-L-myc transcript 3Current address: Department of Internal Medicine; Chungnam National University Hospital; 640 Daesadong Jungku, Taejon, (MaÈ kelaÈ et al., 1991b). The resulting chimeric RLF- Korea 301-040 L-Myc protein, like the wild-type L-Myc protein, The opinions or assertions contained herein are the private views of inhibits dierentiation in murine embryonic stem cells the authors and are not to be construed as ocial or as re¯ecting the (MacLean-Hunter et al., 1994). Characterization of 126 views of the Department of the Navy or the Department of Defense. SCLC cell lines at NCI has identi®ed 11 (9%) with L- This is a U.S. government work. There are no restrictions on its use. Received 9 January 1998; revised 25 March 1998; accepted 26 March myc ampli®cation (Johnson et al., 1996). We studied 1998 these eleven L-myc-ampli®ed cell lines and have Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1020 identi®ed a novel cyclophilin-like gene located at ampli®ed cell lines was performed using probes from chromosome 1p32. Co-ampli®cation on this cyclophi- L-myc exon 2 and exon 3 (Figure 1). The abundant L- lin-like gene with L-myc in SCLC cell lines occurs more myc transcript observed in NCI-H378 by hybridization commonly than co-ampli®cation of RLF with L-myc with either an exon 2 or exon 3 probe was slightly and can result in expression of chimeric transcripts. smaller (*3.6 kb) compared with the expected bands (*3.9 and 3.7 kb) (Figure 1). Expected-sized transcripts were observed in the other 10 L-myc ampli®ed cell lines. In addition, aberrantly-sized transcripts of Results approximately 3.2 kb were observed in both NCI-H889 and NCI-H1836 (Figure 1). No L-myc mRNA was Characterization of RLF in L-myc ampli®ed cell lines detected in NCI-H289, suggesting that L-myc gene Southern blot analysis of SstI-digested genomic DNA ampli®cation is not invariably associated with over- from the L-myc-ampli®ed cell line, NCI-H378, has expression of mRNA. previously been found to detect a slightly smaller DNA To determine if RLF rearrangement was responsible band (3.5 kb) compared to normal genomic DNA for these aberrantly-sized transcripts, Northern blot when hybridized with an exon 2 L-myc probe (Johnson analysis was performed using a probe containing RLF et al., 1987; Nau et al., 1985). To determine if aberrant- exon 1 and 2 sequence. This analysis detected sized transcripts are present in this cell line, Northern transcripts only in NCI-H889 and NCI-H1836 blot analysis of NCI-H378 and 10 additional L-myc- (Figure 1). RT ± PCR using an L-myc exon 3-speci®c oligonucleotide (MK60; Table 1) as primer for the RT reaction and an oligonucleotide from RLF exon 1 (MK59; Table 1) and L-myc exon 2 (MK53; Table 1) as PCR primers was also performed on the eleven L- myc ampli®ed cell lines. Using this technique, chimeric RLF-L-myc transcripts were detected in three of eleven L-myc-ampli®ed cell lines (NCI-H889, NCI-H1836, and NCI-H1994; data not shown) and con®rmed by direct sequencing of the PCR products to contain RLF exon 1 and L-myc exon 2 sequence (MaÈ kelaÈ et al., 1991a). However, no RLF-L-myc chimeric transcript was detected in NCI-H378. Therefore, the aberrantly- sized L-myc transcript in NCI-H378 did not result from a RLF-L-myc gene rearrangement. To determine the frequency of RLF gene amplification in the NCI L-myc-ampli®ed cell lines, Southern blot analysis of SstI-digested genomic DNA from SCLC cell lines using a full length RLF cDNA as probe was performed (Figure 2). Four bands [*15 kb, Figure 1 Northern blot analysis of L-myc ampli®ed cell lines 12 kb, 5 kb (doublet), and 3.8 kb] were detected in all using probes from L-myc (exon 2 and 3) and RLF. Approximately 20 mg of total cellular RNA was subjected to Northern blot eleven L-myc-ampli®ed cell lines, as well as in a human analysis as described in Materials and methods and hybridized B lymphoblastoid cell line (NCI-B1184); a L-myc- sequentially with 32P-radiolabeled probes from exon 2 and 3 of L- overexpressing, non-L-myc ampli®ed cell line (NCI- myc and an RLF probe containing exon 1 and 2 sequence (300 bp H209); a c-myc-ampli®ed cell line (NCI-H211); a non- EcoRI-HindIII fragment of plasmid a8-1.2). A rat GAPDH L-myc overexpressing, non-MYC ampli®ed cell line cDNA fragment served as a control probe (lower panel). The B lymphoblastoid cell line, B1184, was included as a negative (NCI-H345); and an N-myc-ampli®ed cell line (NCI- control H526) (Figure 2a). Using the control probe (GRP) to

Table 1 Sequence of oligonucleotides used Name Gene Exon Orientation Sequence MK53 L-myc 2 antisense CACCAGCTCGAATTTCTTCC MK60 L-myc 3 antisense GAATACCCAGAGACTGCCTC MK88 L-myc 3 sense TCATCTCAATCCTTGAGCGG MK89 L-myc 3 antisense GAAGCAAGTCCACCTTCTGG MK75 PPIE 6Aa sense AGCCAAAGCAGAAGGTGATC MK77 PPIE 6Aa antisense TAAGAGCCACACTGGTAGTC MK55 PPIE 6Ba sense CAATTACCAGCCAGCCAAGG MK57 PPIE 6Ba antisense GACAAATGTGCTCATCAGGG MK59 RLF 1 sense CATCTTTGAACTACTGCCGG 2583b RLF 6 ± CCTTCTGAAGCAGATCCCTGT 2584b RLF 6 ± GGAGGCTGAACTCTCTTACACTG G3PD2R GAPDH ± antisense GATACATGACAAGGTGCGGC G3PD1F GAPDH ± sense TCGTGGAAGGACTCATGACC G3PD1R GAPDH ± antisense ACATGGCAACTGTGAGGAGG aProvisional assignment of exon number to segments of the PPIE cDNA is based on homology with PPIA intron/exon structure (Haendler and Hofer, 1990) and the assumption of an additional 3' alternatively spliced exon. bSequence based on Hellsten et al. (Hellsten et al., 1995) Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1021 normalize band intensities to that of the lymphoblastoid DNA, ampli®cation of RLF was found in four of 11 (36%) L-myc ampli®ed cell lines and none of four non-L-myc ampli®ed lines (Figure 2a). In two of these RLF-ampli®ed cell lines, NCI-H889 and NCI-H1836, only the 15 kb band was ampli®ed while all four RLF bands were ampli®ed in NCI-H298 and NCI-H1994. A 3' fragment of the RLF probe, which lacks RLF exon 1 sequence, detected three bands of approximately 12 kb, 5 kb and 3.8 kb (Figure 2b), indicating that the 15 kb band detected with the full length RLF cDNA probe (Figure 2a) contains RLF exon 1 sequence and that the Figure 2 Southern blot analysis of RLF in L-myc ampli®ed cell lines. SstI-digested genomic DNAs from eleven L-myc ampli®ed ampli®cation of RLF in NCI-H889 and NCI-H1836 cell lines were transferred to a nylon ®lter (Hybond-N+) and was limited to exon 1. hybridized with full length cDNA probe a8-1.2 (a) or a probe (EcoRI-HindIII fragment of a8-1.2) without RLF exon 1 sequence (b). Approximately equal amounts of DNA were present in each Isolation of L-myc cDNA from NCI-H378 lane as determined by ethidium bromide staining (data not shown) and hybridization with the control GRP probe (data not To further characterize the aberrant L-myc transcripts shown). The position of migration of HindIII fragments of in NCI-H378, an L-myc exon 2 probe (Nau et al., lambda phage DNA are indicated on the right 1985) was used to screen a cDNA library from NCI- H378. Two cDNA clones (6930 and 6931) containing L-myc exon 2 sequences that did not hybridize with an L-myc exon 1 probe were isolated. DNA sequence analysis of these clones revealed the presence of 213 bp and 94 bp of L-myc exon 2 sequence, respectively. In both clones, the L-myc sequence was in the antisense orientation at the 5' end of the cDNA and terminating at nucleotide 27 of L-myc exon 2 (Kaye et al., 1988). The inverse complement of nucleotides 26 to 29 of L- myc exon 2 is TGGT, suggestive of a potential mRNA splice site at this point. The 3' portion of these cDNAs consisted of 575 bp and 536 bp of novel sequence and were identical to each other except for a 39 bp in-frame deletion in the smaller clone (clone 6931; Figure 3). Figure 3 Schematic diagram of chimeric L-myc cDNAs isolated Clones 6930 and 6931 both contained poly(A) tails and from NCI-H378. Arrows represent orientation of transcription of sequence of the native genes. The site of presumed splicing of 39 were predicted to encode proteins of 136 and 145 nucleotides from the sequence of clone 6931 relative to 6930 is amino acids, respectively. The 39 bp in-frame deletion indicated with a notch

Figure 4 Characterization of novel cyclophilin-like gene, PPIE.(a) Southern blot analysis of BamHI-digested genomic DNA from human, monkey, horse, mouse, chicken, and Xenopus laevis was hybridized with a probe from the 3'-end of PPIE (see Figure 3). (b) Northern blot analysis of RNAs from various human tissues using a full length cDNA probe corresponding to the splice variant of Figure 5b (exon 6B). A single band was detected in each lane upon subsequent hybridization of the stripped ®lter with a GAPDH radiolabeled fragment (data not shown) Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1022 in clone 6931 removed the termination codon predicted for the open reading frame of clone 6930, thus resulting in a larger predicted protein from the smaller cDNA. The N-terminal 31 amino acids of each putative protein are derived from L-myc exon 2 antisense sequence. A database search identi®ed three expressed sequence tag (EST) clones (81575, 83130 and 97971) with greatest sequence identity (495%) to the novel sequence of clones 6930 and 6931. Lesser degrees of sequence identity (*60 to 80%) were found to segments of the cyclophilin type of peptidyl-prolyl isomerase (PPIase) genes from human, rat drosophila, yeast, Arapidopsis, and other organisms. Thus, the gene giving rise to the novel sequence of clones 6930 and 6931 is designated PPIE to re¯ect this sequence similarity to PPIases, a ubiquitous class of enzymes thought to assist in protein folding by catalyzing the cis-trans isomerization of peptides and proteins. Southern blot hybridization of BamHI-digested human, monkey, horse, chicken, and Xenopus laevis genomic DNAs was performed using a probe from the 3' end of the novel sequence (PPIE 3' probe; Figure 3). This probe sequence was selected to avoid cross- hybridization with known PPIase gene sequences. Evolutionary conservation of PPIE was con®rmed by the detection of a hybridizing band(s) in all species using high stringency conditions (Figure 4a).

Isolation of cyclophilin-like cDNAs To further characterize the novel sequence, a probe from the 5' end of the novel sequence was used to screen a human skeletal muscle cDNA library. Seven clones were isolated and sequenced. The sequence of ®ve of these seven clones formed a 1266 bp consensus cDNA with a 903 bp open reading frame (ORF) predicted to encode a 301 amino acid protein (Figure 5a). No upstream, in-frame stop codon was present but the ATG at nucleotides 12 to 14 conforms to the consensus initiation codon. Two of the seven clones had the same divergent sequence beginning at nucleotide 849 of the consensus sequence, suggesting alternative splicing of a 3' exon (tentatively designated exon 6B; Figure 5b). The divergent sequence of these two clones was the same as that found in clones 6930 and 6931 from NCI-H378 and could encode 17 amino acids. The analogous alternative sequence, tentatively designated exon 6A, encodes 22 amino acids. A polyadenylation signal (nucleotides 1245 ± 1250, Figure 5a; and nucleotides 1033 to 1038, Figure 5b) and polyadenylation site were present in both types of cDNAs. There was striking similarity between the Figure 5 Nucleotide and deduced amino acid sequences of PPIE. predicted skeletal muscle cDNA ORF and the human (a) Consensus nucleic acid sequence of ®ve PPIE cDNAs isolated cyclophilin A (PPIA), cyclophilin B (PPIB), cyclophilin from human skeletal muscle. The predicted protein translation is shown below the cDNA sequence. A putative polyadenylation C(PPIC), cyclophilin D (PPID) and cyclophilin-like signal is underlined. The arrow after nucleotide 848 indicates the (PPIL1) protein sequences (Figure 5c). In the central point of divergence of the sequence in two additional skeletal conserved region of the cyclophilins (corresponding to muscle cDNAs (putatively designated exon 6A. (b) Nucleic acid PPIA amino acids 29 to 132), there was 83, 69, 67 and and predicted amino acid sequence of the putative exon 6B found 56% identity of the predicted ORF with PPIA, PPIB, in two of seven skeletal muscle cDNAs after the point of sequence divergence (arrow in a). A putative polyadenylation signal is PPIC, and PPIL1, respectively, including conservation underlined. (c) Alignment of putative amino acid sequence of of residues thought to be functionally important for PPIE with four other members of the human cyclophilin family. PPIase activity (Zydowsky et al., 1992). Thus, the Shaded amino acids are identical to PPIE; boxed areas are novel sequence of the chimeric L-myc-containing identical amino acids shared by at least four of the ®ve sequences. A hyphen indicates that a gap has been introduced into the cDNAs from NCI-H378 appear to be derived from sequence. A putative RNP-1 RNA binding consensus sequence is an undescribed peptidyl-prolyl isomerase gene, PPIE. underlined in PPIE Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1023 Northern blot analysis of RNA from various human analysis using a medium resolution radiation hybrid tissues using a cDNA probe corresponding to the panel to further localize PPIE showed linkage to the alternative splice pattern of Figure 5b detected bands anonymous DNA marker, D1S1598 (lod score=5.47 at of bands of approximately 1.8 and 1.4 kb in all tissues examined (Figure 4b). a

Analysis of PPIE in L-myc-ampli®ed cell lines Southern blot analysis of BamHI- and EcoRI-digested genomic DNAs was performed using the PPIE 3' probe. A single band of approximately 1.8 kb was detected in the BamHI digested DNA of each cell line. Using the intensity of the signal from a control gene (GRP) to normalize signals between samples, seven of 11 (64%) L-myc-ampli®ed cell lines had between ®vefold to 24-fold ampli®cation of PPIE compared to a B lymphoblastoid cell line (Figure 6a). A similar analysis using EcoRI-digested genomic DNA from these cell lines detected two bands (approximately 20 kb and 18 kb) hybridizing with the PPIE probe (Figure 6a). Interestingly, ampli®cation of the 20 kb b and 18 kb PPIE-hybridizing EcoRI fragments can occur independently of each other since the 18 kb band was over represented in NCI-H510 and the 20 kb band was over represented in NCI-H889 (Figure 6a). Both the 20 and 18 kb bands were ampli®ed in the other cell lines with ampli®cation of PPIE except NCI- H378 which contains only a very intense 18 kb band but no detectable 20 kb band (Figure 6). No ampli®cation of PPIE was observed in four cell lines without L-myc ampli®cation (Figure 6a).

Pulsed ®eld gel electrophoresis (PFGE) Southern blot hybridization of MluI-digested genomic DNA from a B lymphoblastoid cell line subjected to PFGE showed that probes from PPIE,L-myc,and RLF each hybridized to a fragment of approximately 800 kb (Figure 6b), suggesting that these three genes are located on the same 800 kb Mlu fragment. Similar analysis was performed on L-myc-ampli®ed and non-L- myc ampli®ed cell lines (Figure 6b). In addition to the 800 kb band found in the lymphoblastoid cell line, the MluI fragments hybridizing with PPIE and L-myc probes were of similar size in each of the L-myc- Figure 6 Ampli®cation of PPIE in SCLC cell lines. Southern blot ampli®ed cell lines (Figure 6b). The size of the MluI analysis was performed using genomic DNA from a human B lymphoblastoid cell line (NCI-B1184); 11-L-myc ampli®ed cell lines fragments cohybridized by the L-myc and PPIE probes (NCI-H298 to NCI-H2552); an L-myc-overexpressing, non-L-myc varied between 100 kb and 1 MB in the L-myc- ampli®ed cell line (NCI-H209); a c-myc-ampli®ed cell line (NCI- ampli®ed cell lines. In NCI-H1836, the PPIE probe H211); a non-L-myc overexpressing, non-MYC ampli®ed cell line also hybridized to three bands of approximately 300, (NCI-H345); and an N-myc-ampli®ed cell line (NCI-H526). 250 and 100 kb that were not recognized by the L-myc Position of migration of size standards is indicated on the left. (a) Genomic DNA was digested with BamHI (upper panel) and probe. Southern blot hybridization of SstII-digested EcoRI (lower panel). A fragment from the 3' end of PPIE (see genomic DNA revealed a single band for all cell lines Figure 3) was used as probe. Approximately equal amounts of using a PPIE probe, L-myc probe, and RLF probe DNA were present in each lane as determained by ethidium (data not shown). As expected, no alterations of these bromide staining (data not shown) and cohybridization with the control GRP probe. The fold ampli®cation of PPIE sequences was three genes were detected in Southern blots of MluIor estimated by calculating the ratio of the signal intensity from the SstII digested DNA from the four cell lines without L- PPIE probe in BamHI-digested DNA and correcting for the myc ampli®cation (Figure 6b). intensity of the control GRP probe. Signal intensities were measured using a PhosphorImager and ImageQuant software (Molecular Dynamics). The position of migration of fragments Chromosomal localization of PPIE hybridizing with PPIE and GRP are indicated with arrows. (b) Cells were digested with MluI and subjected to pulse ®eld gel PCR analysis of genomic DNA's from a panel of electrophoresis as described in Materials and methods. After somatic cell hybrids using two oligonucleotide pairs transfer to a nylon membrane, Southern blot hybridization was from the apparent alternately spliced 3' exons of PPIE performed using a 3' PPIE probe (see Figure 3), an L-myc exon 2 probe, and a full length RLF cDNA probe. The arrow head in each (MK75, MK77 and MK55, MK57; Table 1) assigned panel represents the position of the 800 kb fragment hybridizing PPIE to chromosome 1 (data not shown). Similar with each of the three probes in DNA from NCI-B1184 Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1024

*32 cR10000 and 6.11 at *24 cR10000, respectively). ampli®cation of the PPIE gene in SCLC cell lines is Analysis of this radiation hybrid panel with an RLF neither necessary (NCI-N691) nor sucient (NCI-H298 exon 6 oligonucleotide pair (2583 and 2584; Table 1) and NCI-H1694) for PPIE expression in SCLC cells. and an L-myc exon 3 oligonucleotide pair (MK88 and MK89; Table 1) also showed linkage to D1S1598 (lod

score=6.87 at *17 cR10000 and 4.92 at *39 cR10000, Discussion respectively). Multipoint linkage analysis indicated that the most likely order is RLF-D1S1598-PPIE-L-myc. Analysis of the genetic alterations that occur during the multistep carcinogenic process is expected to lead to a better understanding of the biology of lung cancer and PPIE expression in L-myc-ampli®ed cell lines to suggest novel therapeutic strategies. In this paper, Abundant transcripts hybridizing to a PPIE probe we have used an approach analogous to that of derived from the sequence of clone 6930 were detected MaÈ kelaÈ et al. (1991b) to identify a previously in four of the 11 (36%) L-myc ampli®ed cell lines, uncharacterized cyclophilin-like gene, PPIE, co-ampli- NCI-H378, NCI-H510, NCI-H889 and NCI-H1836 ®ed with L-myc in human SCLC tumor cell lines. The (Figure 7, middle panel). These four cell lines each presence of chimeric transcripts of L-myc antisense had gene ampli®cation of PPIE. A transcript similar in sequence and sense PPIE sequence suggests that L-myc size to that found in normal tissues (1.4 kb) was and PPIE are oriented in a head-to-head orientation detected in each of these cell lines. Additional bands, with PPIE 5' of L-myc. Since RLF is located *310 kb possibly due to DNA rearrangements, activation of 5' of L-myc (Hellsten et al., 1995), the two possible alternative promoter sequences, or alternative mRNA gene orders are RLF-PPIE-L-myc or PPIE-RLF-L- splicing, were detected in NCI-H378 (1.9 and 3.8 kb), myc. Coampli®cation of PPIE with L-myc was detected NCI-H889 (1.9 and 3.8 kb), and NCI-H1836 (0.5, 2.8, in at least three cell lines without detectable alteration and 3.0 kb). Using a probe from the 3' alternative of RLF, a ®nding that strongly suggests L-myc is closer sequence found in 5 of the 7 skeletal muscle cDNAs, a to PPIE than it is to RLF. Therefore, the most likely single band of approximately 1.8 kb was detected in six gene order is RLF-PPIE-L-myc, the order best cell lines, NCI-378, NCI-H510, NCI-N691, NCI- supported by our radiation hybrid analysis. Another H1836, NCI-H1994, and NCI-H2552 (Figure 7, top gene previously mapped to the region between RLF panel). No PPIE mRNA was detected with either and L-myc is PPT (Hellsten et al., 1995), mutations of probe in two of the seven cell lines with PPIE gene which are responsible for infantile neuronal ceroid ampli®cation (NCI-H298 and NCI-H1694). Thus, lipofuscinosis (Vesa et al., 1995). The chimeric L-myc-PPIE transcript found in NCI- H378 presumably results after activation of an antisense L-myc promoter. Such an antisense promoter has been previously described for c-myc (Celano et al., 1992; Spicer and Sonenshein, 1992). The 5' end of the cyclophilin-like sequence of the NCI-H378 chimeric transcript is homologous to the 5' end of exon 3 of PPIA and, as previously noted, the 3' end of the L-myc sequence contains a possible splice site sequence. These observations suggest that mRNA splicing occurs to generate this transcript. However, whether activation of an antisense L-myc promoter following L-myc amplification is sucient for expression of the chimeric L-myc- PPIE transcript or gene rearrangement resulting in juxtaposition of L-myc and PPIE is also required has not been addressed by the current study. The biological signi®cance of expression of PPIE sequences in SCLC cells, either as full length cDNA or L-myc-chimeric transcripts, remains to be determined. Immunophilins (cyclophilins and FK506 binding proteins) are the protein receptors for potent immunosuppressants, including cyclosporin A, FK506, and rapamycin (Schreiber, 1991) and have peptidyl-prolyl cis-trans isomerase activity (Marks, 1996). Recently, the product of PPID (cyclophilin-40) Figure 7 Northern blot analysis of 11 L-myc ampli®ed cell lines. was implicated in protein folding in conjunction with Northern blot hybridization was performed as described in heat shock proteins, Hsp90 and Hsp70 (Freeman et al., Materials and methods using 20 mg of total RNA from each of 1996). However, the functional role of the individual the 11 cell lines. The blots were hybridized with radiolabeled cyclophilins is poorly understood. The tissue expression DNA fragments from the two putative 3' alternatively spliced exons (6A and 6B). DNA fragments de®ned by oligonucleotides pattern of PPIE suggests that it may be involved in MK75 and MK77 (putative PPIE exon 6A, upper panel), and muscle-and brain-speci®c processes. The segment of MK55 and MK57 (corresponding to sequence of clones 6930, PPIE extending N-terminal of the central conserved 6931 and putative PPIE exon 6B, middle panel) were radiolabeled region is longer than the N-terminal region in PPIA with 32P-a-dCTP using random primer extension. A rat GAPDH probe was used as control for RNA loading and transfer (lower and is unique among the cyclophilins in containing an panel) RNP-1 consensus sequence at amino acids 52 to 59 Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1025 (Figure 5c), suggesting that it may bind RNA fractionated by 0.8% agarose gel electrophoresis. For (Bandziulis et al., 1989; Dreyfuss et al., 1988). Northern blot hybridizations, 20 mg of total cellular RNA The observation of two bands on Southern blot was fractionated through denaturing (1% formaldehyde) analysis of EcoRI-digested DNA using a 3' PPIE agarose gels. The human multiple tissue Northern blot was probe suggests that there may be two genomic obtained from Clontech. Nucleic acid transfer to nylon membranes (Hybond N+; Amersham), hybridization, and sequences hybridizing with this probe. This is washing were performed according to the manufacturer's supported by the absence of an EcoRI recognition recommendations. L-myc exon 2- and exon 3-speci®c site within the probe; the presence of a single band of probes consisted of appropriate subclones from a 1.9 kb the predicted size ampli®ed from human genomic DNA SmaI-EcoRI L-myc genomic fragment (Nau et al., 1985). using oligonucleotides that de®ne the PPIE probe (data The control gastrin releasing peptide (GRP) probe is not shown) indicating that no intron interrupts the derived from nucleotides 263 to 490 of the cDNA probe sequence; and the presence of two bands in sequence (GenBank accession number K02054) cloned samples from 15 of 16 individuals indicating that the into pGEM11zf(7) (Promega). DNA fragments were bands are unlikely to represent allelic variants. If two radiolabeled with 32P using the Random Primers DNA PPIE-like sequences are present in the human genome, Labeling System (Life Technologies) per manufacturers recommendations. The ®nal wash was 0.16SSC and 0.1% both are likely to be located near L-myc,on SDS at 508Cfor15to20min. chromosome 1p32 since both EcoRI bands observed by Southern blot can be ampli®ed in L-myc-ampli®ed cell lines. In addition to these questions, further study RT ± PCR will be required to determine the prognostic and One microgram of total RNA was annealed with 100 ng of functional signi®cance of PPIE ampli®cation and an appropriate antisense oligonucleotide (MK60, Table 1) expression in SCLC. and 100 ng of the control GAPDH oligonucleotide (G3PD2R, Table 1) in 10 ml by heating to 708Cfor2min followed by cooling to room temperature. RT was performed Materials and methods in 22 ml containing 16 ®rst strand buer (Life Technolo- gies), 10 mM DTT (Life Technologies), 50 mM dNTPs Cell lines and nucleic acid isolation (Perkin Elmer), 40 U of RNasin (Promega), and 200 U of MMLV reverse transcriptase (Life Technologies) at 428Cfor SCLC cell lines with L-myc DNA ampli®cation, NCI- 1 h prior to inactivation of the RT for 5 min at 708C. One H298, H378, H462, H510, N691, H889, H1694, H1836, microliter of the RT reaction was used as template for PCR H1994, H2107 and H2552 (Johnson et al., 1996), and cell using the GeneAmp kit (Perkin Elmer) and 40 cycles of 15 s lines without L-myc ampli®cation, NCI-H345 (no MYC at 948C, 30 s at 558C, 30 s at 728C, in a Perkin Elmer model gene ampli®cation), NCI-H526 (N-myc ampli®cation), 9600 thermocycler. The sequence of oligonucleotides used NCI-H209 (high level L-myc expression without gene for PCR (MK59, MK53; and G3PD1F, G3PD1R) are listed ampli®cation), NCI-H211 (c-myc DNA ampli®cation), in Table 1. For DNA sequence analysis, PCR products were and NCI-B1184 (B cell lymphoblastoid line) were grown ligated into the pT7Blue plasmid (Novagen) and insert- in appropriate culture medium (Phelps et al., 1996) and containing plasmids sequenced on both strands using harvested for nucleic acid isolation during log phase Sequenase (US Biochemical). growth. Genomic DNA was isolated from cell lines using the DNA extraction kit (Stratagene). Total cellular RNA was isolated with the Rapid total RNA isolation kit (5 Chromosomal localization prime-3 prime) and integrity of the RNA was con®rmed by PCR of genomic DNA from somatic cell hybrids (BIOS the presence of 28S and 18S rRNA bands by denaturing gel Laboratories) or radiation hybrids (Stanford G3 panel, electrophoresis and a single band upon hybridization of Research Genetics) was performed as described above. Northern blots with a rat GAPDH probe. Linkage to framework markers was determined using the Stanford Human Genome Center's Radiation Hybrid server cDNA libraries (http://www-shgc.stanford.edu/RH/index.html). Linkage analysis was performed using RHMAP version 3.0 A cDNA library was constructed in the Charon 4A vector (Boehnke et al., 1991). from NCI-H378 poly(A)-selected RNA primed with oligo(dT)12 (Kaye et al., 1988). Plaques were screened using a 1.9 kb SmaI-EcoRI L-myc genomic fragment Pulsed ®eld gel electrophoresis containing exons 2 and 3. Inserts of clones hybridizing to Cells were embedded in 0.5% low melting point agarose at this fragment but not hybridizing to a L-myc exon 1 probe 2 million cells per ml, treated with 0.5 M EDTA, 1% were subcloned into plasmid vectors. A human skeletal sarcosyl, and 0.5 mg/ml proteinase K at 508Cfor2days, muscle cDNA library (Clontech) was screened according to followed by washing with 10 mM TrisHCl(pH7.4),1mM the manufacturer's recommendations. Inserts from hybri- EDTA, and 1 mM phenylmethylsulfonyl ¯uoride (Sigma). dizing phage were subcloned into pGEM11zf(7)(Prome- Agarose blocks were digested with appropriate restriction ga). DNA sequence analysis was performed by the enzymes for 12 h and electrophoresis was performed in 1% dideoxynucleotide chain termination technique in a agarose (Pulsed Field Certi®ed Agarose, Bio-Rad Labora- thermocycler using the fmol cycle sequencing kit tories) with CHEF mapper (Bio-Rad Laboratories) at 6 V/ (Promega). DNA database comparisons were performed cm with pulse time 3 min 25 s for 18 h in 0.56Tris-borate using the BLAST network service at National Center for EDTA buer. Blotting and hybridization were performed Biotechnology Information, National Institutes of Health as described above. (Altschul et al., 1990).

Acknowledgements Southern and Northern blot hybridization The authors thank John Minna for support during For Southern hybridizations, 15 mg genomic (or 25.5 mg isolation of the NCI-H378 cDNA clones, Frederic Kaye from Xenopus laevis) DNA was digested with the for providing the L-myc genomic clone, and Shoshana appropriate restriction enzyme (Life Technologies) and Segal for critical reading of the manuscript. Co-amplification of PPIE with L-myc in SCLC J-O Kim et al 1026 References

Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ. Johnson BE, Russell E, Simmons AM, Phelps R, Steinberg (1990). J. Mol. Biol., 215, 403 ± 410. SM, Ihde DC and Gazdar AF. (1996). J. Cell. Biochem., Bandziulis RJ, Swanson MS and Dreyfuss G. (1989). Genes Suppl 24, 210 ± 217. Dev., 3, 431 ± 437. Kaye F, Battey J, Nau M, Brooks B, Seifter E, De Greve J, Boehnke M, Lange K and Cox DR. (1991). Am J Hum Birrer M, Sausville E and Minna J. (1988). Mol. Cell. Genet., 49, 1174 ± 1188. Biol., 8, 186 ± 195. Carney DN, Gazdar AF, Bepler G, Guccion JG, Marangos Little CD, Nau MM, Carney DN, Gazdar AF and Minna PJ, Moody TW, Zweig MH and Minna JD. (1985). Cancer JD. (1983). Nature, 306, 194 ± 196. Res., 45, 2913 ± 2923. MacLean-Hunter S, Makela TP, Grzeschiczek A, Alitalo K Celano P, Berchtold CM, Kizer DL, Weeraratna A, Nelkin and Moroy T. (1994). Oncogene, 9, 3509 ± 3517. BD, Baylin SB and Casero Jr, RA. (1992). J. Biol. Chem., MaÈ kelaÈ TP, Kere J, Winqvist R and Alitalo K. (1991a). Mol. 267, 15092 ± 15096. Cell. Biol., 11, 4015 ± 4021. De Greve J, Battey J, Fedorko J, Birrer M, Evan G, Kaye F, MaÈ kelaÈ TP, Saksela K, Evan G and Alitalo K. (1991b). Sausville E and Minna J. (1988). Mol. Cell. Biol., 8, 4381 ± EMBO J., 10, 1331 ± 1335. 4388. Marks AR. (1996). Physiol Rev., 76, 631 ± 649. Dosaka-Akita H, Rosenberg RK, Minna JD and Birrer MJ. Nau MM, Brooks BJ, Battey J, Sausville E, Gazdar AF, (1991). Oncogene, 6, 371 ± 378. Kirsch IR, McBride OW, Bertness V, Hollis GF and Dreyfuss G, Swanson MS and Pinol-Roma S. (1988). Minna JD. (1985). Nature, 318, 69 ± 73. Trends. Biochem. Sci., 13, 86 ± 91. Phelps RM, Johnson BE, Ihde DC, Gazdar AF, Carbone Freeman BC, Toft DO and Morimoto RI. (1996). Science, DP, McClintock PR, Linnoila RI, Matthews MJ, Bunn 274, 1718 ± 1720. PA, Carney D, Minna JD and Mulshine JL. (1996). J. Gazdar AF, Carney DN, Nau MM and Minna JD. (1985). Cell. Biochem., Suppl 24, 32 ± 91. Cancer Res., 45, 2924 ± 2930. Schreiber SL. (1991). Science, 251, 283 ± 287. Haendler B and Hofer E. (1990). Eur. J. Biochem., 190, 477 ± Spicer DB and Sonenshein GE. (1992). Mol. Cell. Biol., 12, 482. 1324 ± 1329. Hellsten E, Vesa J, Heiskanen M, Makela TP, Jarvela I, Vesa J, Hellsten E, Verkruyse LA, Camp LA, Rapola J, Cowell JK, Mead S, Alitalo K, Palotie A and Peltonen L. Santavuori P, Hofmann SL and Peltonen L. (1995). (1995). Genomics, 25, 404 ± 412. Nature, 376, 584 ± 587. Johnson BE. (1996). Lung Cancer: Principles and Practice. Zydowsky LD, Etzkorn FA, Chang HY, Ferguson SB, Stolz Pass HI, Mitchell JB, Johnson DH and Turrisi AT. (eds). LA, Ho SI and Walsh CT. (1992). Protein Sci., 1, 1092 ± Lippincott-Raven Publishers: Philadelphia, 83 ± 98. 1099. Johnson BE, Ihde DC, Makuch RW, Gazdar AF, Carney DN, Oie H, Russell E, Nau MM and Minna JD. (1987). J. Clin. Invest., 79, 1629 ± 1634.