DOCSLIB.ORG

Detection of Chromosomal Rearrangements 29 March 2011. 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Detection of Chromosomal Rearrangements 29 March 2011. 1 Detection of chromosomal rearrangements 29 March 2011. 1. Supporting Online Material for: Genome-wide detection of chromosomal rearrangements, indels and mutations in circular chromosomes by short read sequencing. Ole Skovgaard1,3, Mads Bak2, Anders Løbner-Olesen1, Niels Tommerup2 1 Dept. Of Science, Systems and Models, Roskilde University 2 Wilhelm Johannsen Centre for Functional Genome Research, Department of Cellular and Molecular Medicine, University of Copenhagen, Denmark. 3 Corresponding author, Email: [email protected] This PDF file includes: Supplemental Table S1. Read alignment statistics Supplemental Table S2. Detected mutations Supplemental Table S3. PCR primers Detection of chromosomal rearrangements 29 March 2011. 2. Supplemental Table S1. Read alignment statistics hsm-1 hsm-2 hsm-3 hsm-4 hsm-5 hsm-6 hsm-7 hsm-8 MG1655 MG1655 ALO1917 ALO2415 ALO2416 ALO2417 ALO2418 ALO2419 ALO2420 ALO2421 Growth status stationary exponential stationary stationary stationary stationary exponential exponential exponential exponential Doubling time τ na 34 na na na na 50 45 47 43 (min.) Total reads 12085372 13187790 5845568 6903081 5973710 7490823 6360766 8793402 6764655 5567779 Perfectly 6897112 6938427 4274678 4910682 4058162 3661412 3419797 4035418 3268120 3468234 matching readsa Low quality 2346095 3256605 533700 943716 962986 3090791 2028364 4589439 2599609 493038 reads b Single mutation 448944 457668 153551 149664 139841 80456 109761 22390 102729 219301 readsc Double mutation 280658 271909 79613 73197 71884 38571 57803 4776 54252 130191 readsc InDel readsd 382095 357827 118609 111219 95096 54303 81781 8898 67249 230436 Orphan readse 1730468 1905354 685417 714603 645741 565290 663260 132481 672696 1026579 Detection of chromosomal rearrangements 29 March 2011. 3. a All reads were 35 nucleotides long and were aligned with the reference sequence of MG1655. Reads that matched perfectly were then subtracted from the pool of reads. b The remaining reads were quality filtered with the rule that the first 30 nucleotides should be called with an average quality of at least 35. We used the Illumina raw quality, which is phred-like value; the maximum value for one nucleotide is 40. c The remaining reads were aligned with the reference sequence allowing for one or two misfits. At least one of the misfits must have a quality score of 35 or is discarded. This reduces general noise and calls of mutations at difficult to sequence positions. d The remaining reads were aligned so that 15 or more nucleotides at either end match the reference sequence perfectly. These reads mark putative insertions, deletions or chromosomal break points. e Orphan reads failed any of the above attempts to be aligned. Detection of chromosomal rearrangements 29 March 2011. 4. Supplemental Table S2. Detected mutations Position a Strains affected Gene Nucleotide Protein 299.443 b hsm-2 - hsm-8 yagR C -> T point mutation Gly Asp mutation. 547.694 All ylbE pseudogene A -> G point mutation Silent mutation (Leu Leu) 547.832 All ylbE pseudogene Insertion of one extra G in a “GGGG” run. Frame shift h 712.036 hsm-1 ybfF-seqA intergenic Deletion of 2 T’s in a 7 T run 1.397.470 c All fnr Duplication of 18 bp between two 5-mer Duplication of amino acids CTGGC repeats 21-26 of FNR 1.976.527 – 1.977.303 d All insAB Deletion of an IS1 element. 2.616.100 – 2.616.850 hsm-1 - hsm-8 hda::cat insertion. Gene cat (chloramphenicol acetylase) is Intended deletion of hda used for hda knock-out. 2.658.123 hsm-5 iscU C -> A point mutation Cys Phe mutation. 2796.315 hsm-3 stpA TCAGCTTTCA 10 bp duplication between Frame shift two TCAGCT repeats ~ 3.129.000 - ~ 3.650.000 hsm-7 Inversion between two IS5 elements 3.360.045 – 3.360.049 e wt gltF – yhcA intergenic Presumably insertion of an IS5 element. 3.880.708 f hsm-2 dnaA A -> C point mutation h Phe Val mutation. 3.881.400 – 3.881.474 g hsm-4 dnaA Deletion of 75 bp h in frame deletion of 25 amino acids 3.957.957 All Upstream ppiC C -> T point mutation. 4025.046 – 4025.438 hsm-6 fre Deletion Deletion of the C-terminal part of the flavin reductase ~4.034.000 – ~ 4.207.000 hsm-8 rrnA rrnE Duplication Detection of chromosomal rearrangements 29 March 2011. 5. a With reference to the first strand in the reference sequence. b The yagR mutation at position 299.443 is common to hsm-2 to hsm-8 only and must have arisen in the host strain before isolation of these hsm mutations since hsm-2 – hsm-8 were isolated during an experiment separate from the isolation of hsm-1. c The 18 bp duplication in the fnr gene at base 1.397.493 causes an in frame duplication of the amino acids number 21 through 26 near the amino-terminal end of the FNR protein. The transcription factor FNR senses O2 and controls the switch between aerobic and anaerobic metabolism (Green and Paget 2004). 2+ 2+ The duplicated amino acids include Cys-23, important for ligating a [4Fe-4S] cluster and Ser-24, important for sensing O2 by converting this [4Fe-4S] cluster to [2Fe-2S]2+ (Jervis et al. 2009). This duplication is not related to the deletion in the fnr gene observed in some isolates of MG1655 from the Coli Genetic Stock Center (Soupene et al. 2003) and FNR is functional with this duplication since our isolate of MG1655 grows anaerobically (data not shown). d Deletion of an IS1 element upstream of flhD. One copy of the flanking duplicated sequence CATAAATG is present. This deletion was also reported by Barker et al. (2004). e A sequence beginning with GGAAGGTGCGAATAAGCGGG and ending with TGTTCGCACCTTC is inserted while duplicating the sequence CTTAA . The beginning and ending sequences match the ends of the IS5 element. This insertion is unique in MG1655 and must have arisen during propagation of this culture. f In hsm-2 we detected the point mutation in the dnaA gene reported earlier (Riber et al. 2006) g In hsm-4 we detected a 75 bp deletion in the variable region of the dnaA gene. This deletion occurs between two 14 bp GC-rich repeats with one misfit and results in an in frame deletion of 25 amino acids of the DnaA protein. This same deletion was independently identified as a suppressor of defects caused by deleting the seqA gene in a recent study (Molt et al. 2009). This region resides in the variable region of the DnaA protein believed to constitute a hinge between domain I and domain III-IV of the protein and several insertions and deletions in this region having little or no effect on the activity of the DnaA protein have been characterized previously (Messer et al. 1999; Nozaki and Ogawa 2008). h The hsm-1, hsm-2 and hsm-4 mutants were characterized further by Charbon et al. (2011). Detection of chromosomal rearrangements 29 March 2011. 6. Supplemental Table S3. PCR primers Name a Position b Strand Sequence yghO 3128060 - 3128081 + CAGACAAATGCTCGTTGCGTTC yghQ 3129642 - 3129663 - CTCGTGCAGCACAGTGTTGGTG yhiS 3649963 - 3649984 + ATATGACAGGACAGAACCTGTC slp 3651902 - 3651924 - CTGATTCTGAGGTGATATGCCTG A-fw 4033044 - 4033069 + GATCAAGCTGATTATGAAGATGTCAG A-bw 4035148 - 4035171 - ACAAGCCTGTAGAGGTTTTACTGC E-fw 4205755 - 4205778 + CATTGATGATTGTGGATAACTCTGT E-bw 4207761 - 4207784 - TTCGCAAGACGCCTTGCTTTTCAC a Names as shown in Figure 2 and Figure 3. b Position relative to accession no. U00096 Detection of chromosomal rearrangements 29 March 2011. 7. References Barker CS, Pruss BM, Matsumura P. 2004. Increased motility of Escherichia coli by insertion sequence element integration into the regulatory region of the flhD operon. J Bacteriol 186: 7529-7537. Charbon G, Riber L, Cohen M, Skovgaard O, Fujimitsu K, Katayama T, Lobner-Olesen A. 2011. Suppressors of DnaA(ATP) imposed overinitiation in Escherichia coli. Mol Microbiol 79: 914-928. Green J, Paget MS. 2004. Bacterial redox sensors. Nat Rev Microbiol 2: 954-966. Jervis AJ, Crack JC, White G, Artymiuk PJ, Cheesman MR, Thomson AJ, Le Brun NE, Green J. 2009. The O2 sensitivity of the transcription factor FNR is controlled by Ser24 modulating the kinetics of [4Fe-4S] to [2Fe-2S] conversion. Proc Natl Acad Sci U S A 106: 4659-4664. Messer W, Blaesing F, Majka J, Nardmann J, Schaper S, Schmidt A, Seitz H, Speck C, Tungler D, Wegrzyn G, Weigel C, Welzeck M, Zakrzewska-Czerwinska J. 1999. Functional domains of DnaA proteins. Biochimie 81: 819-825. Molt KL, Sutera VA, Jr., Moore KK, Lovett ST. 2009. A role for nonessential domain II of initiator protein, DnaA, in replication control. Genetics 183: 39-49. Nozaki S, Ogawa T. 2008. Determination of the minimum domain II size of Escherichia coli DnaA protein essential for cell viability. Microbiology 154: 3379-3384. Riber L, Olsson JA, Jensen RB, Skovgaard O, Dasgupta S, Marinus MG, Løbner-Olesen A. 2006. Hda- mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome. Genes Dev 20: 2121- 2134. Soupene E, van Heeswijk WC, Plumbridge J, Stewart V, Bertenthal D, Lee H, Prasad G, Paliy O, Charernnoppakul P, Kustu S. 2003. Physiological studies of Escherichia coli strain MG1655: growth defects and apparent cross-regulation of gene expression. J Bacteriol 185: 5611-5626. .
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Figure S1. DMD Module Network. the Network Is Formed by 260 Genes from Disgenet and 1101 Interactions from STRING. Red Nodes Are the Five Seed Candidate Genes
    Figure S1. DMD module network. The network is formed by 260 genes from DisGeNET and 1101 interactions from STRING. Red nodes are the five seed candidate genes. Figure S2. DMD module network is more connected than a random module of the same size. It is shown the distribution of the largest connected component of 10.000 random modules of the same size of the DMD module network. The green line (x=260) represents the DMD largest connected component, obtaining a z-score=8.9. Figure S3. Shared genes between BMD and DMD signature. A) A meta-analysis of three microarray datasets (GSE3307, GSE13608 and GSE109178) was performed for the identification of differentially expressed genes (DEGs) in BMD muscle biopsies as compared to normal muscle biopsies. Briefly, the GSE13608 dataset included 6 samples of skeletal muscle biopsy from healthy people and 5 samples from BMD patients. Biopsies were taken from either biceps brachii, triceps brachii or deltoid. The GSE3307 dataset included 17 samples of skeletal muscle biopsy from healthy people and 10 samples from BMD patients. The GSE109178 dataset included 14 samples of controls and 11 samples from BMD patients. For both GSE3307 and GSE10917 datasets, biopsies were taken at the time of diagnosis and from the vastus lateralis. For the meta-analysis of GSE13608, GSE3307 and GSE109178, a random effects model of effect size measure was used to integrate gene expression patterns from the two datasets. Genes with an adjusted p value (FDR) < 0.05 and an │effect size│>2 were identified as DEGs and selected for further analysis. A significant number of DEGs (p<0.001) were in common with the DMD signature genes (blue nodes), as determined by a hypergeometric test assessing the significance of the overlap between the BMD DEGs and the number of DMD signature genes B) MCODE analysis of the overlapping genes between BMD DEGs and DMD signature genes.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Mir-29C Is Downregulated in Gastric Carcinomas and Regulates Cell
    Matsuo et al. Molecular Cancer 2013, 12:15 http://www.molecular-cancer.com/content/12/1/15 RESEARCH Open Access MiR-29c is downregulated in gastric carcinomas and regulates cell proliferation by targeting RCC2 Mitsuhiro Matsuo1†, Chisato Nakada1†, Yoshiyuki Tsukamoto1*, Tsuyoshi Noguchi2, Tomohisa Uchida1, Naoki Hijiya1, Keiko Matsuura1 and Masatsugu Moriyama1 Abstract Background: Previously, using miRNA microarray, we have found that miR-29c is significantly downregulated in advanced gastric carcinoma. In the present study, we investigated whether miR-29c functions as a tumor- suppressor miRNA in gastric carcinoma cells. For this purpose, we verified the downregulation of miR-29c in gastric carcinoma tissues, and assessed the biological effect of miR-29c on gastric carcinoma cells. Results: In miR-29c-transfected cells, both proliferation and colony formation ability on soft agar were significantly decreased. Although apoptosis was not induced, BrdU incorporation and the proportion of cells positive for phospho-histone H3 (S10) were significantly decreased in miR-29c-transfected cells, indicating that miR-29c may be involved in the regulation of cell proliferation. To explain the mechanism of growth suppression by miR-29c, we explored differentially expressed genes (>2-fold) in miR-29c-transfected cells in comparison with negative control transfected cells using microarray. RCC2, PPIC and CDK6 were commonly downregulated in miR-29c-transfected MKN45, MKN7 and MKN74 cells, and all of the genes harbored miR-29c target sequences in the 3’-UTR of their mRNA. RCC2 and PPIC were actually upregulated in gastric carcinoma tissues, and therefore both were identified as possible targets of miR-29c in gastric carcinoma.
    [Show full text]
  • Cross-Species Single-Cell Analysis of Pancreatic Ductal Adenocarcinoma Reveals Antigen-Presenting Cancer-Associated Fibroblasts
    Author Manuscript Published OnlineFirst on June 13, 2019; DOI: 10.1158/2159-8290.CD-19-0094 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Cross-species single-cell analysis of pancreatic ductal adenocarcinoma reveals antigen-presenting cancer-associated fibroblasts Ela Elyada1,2, Mohan Bolisetty3,4,14, Pasquale Laise5,14, William F. Flynn3,14, Elise T. Courtois3, Richard A. Burkhart6, Jonathan A. Teinor6, Pascal Belleau1, Giulia Biffi1,2, Matthew S. Lucito1,2, Santhosh Sivajothi3, Todd D. Armstrong6, Dannielle D. Engle1,2,7, Kenneth H. Yu8, Yuan Hao1, Christopher L. Wolfgang6, Youngkyu Park1,2, Jonathan Preall1, Elizabeth M. Jaffee6, Andrea Califano5,9-12, Paul Robson3,13 and David A. Tuveson1,2. 1Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA 2Lustgarten Foundation Pancreatic Cancer Research Laboratory, Cold Spring Harbor, NY 11724, USA. 3The Jackson Laboratory for Genomic Medicine, Farmington, CT, USA 4Bristol-Myers Squibb, Pennington, NJ, USA 5Department of Systems Biology, Columbia University Irving Medical Center, New York, NY, USA 6Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, MD, USA. 7Salk institute for Biological Studies, La Jolla, CA 92037 8Memorial Sloan Kettering Cancer Center, New York, NY, USA 9Herbert Irving Comprehensive Cancer Center, Columbia University, New York, NY, USA 10J.P. Sulzberger Columbia Genome Center, Columbia University, New York, NY 10032, USA 11Department of Biomedical Informatics, Columbia University, New York, NY 10032, USA 12Department of Biochemistry and Molecular Biophysics, Columbia University, New York, NY 10032, USA 13Department of Genetics and Genome Sciences, Institute for Systems Genomics, University of Connecticut, Farmington, CT, USA 14Equal contribution Running title Antigen-presenting CAFs in PDAC Keywords Single-cell analysis, pancreatic cancer, CAFs, MHC class II, heterogeneity *Co-corresponding authors: David A.
    [Show full text]
  • Supplementary Material Contents
    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
    [Show full text]
  • The Long-Term Prognostic Significance of Circulating Tumor
    cancers Article The Long-Term Prognostic Significance of Circulating Tumor Cells in Ovarian Cancer—A Study of the OVCAD Consortium Eva Obermayr 1,* , Angelika Reiner 2 , Burkhard Brandt 3,4 , Elena Ioana Braicu 5, Alexander Reinthaller 1 , Liselore Loverix 6, Nicole Concin 7, Linn Woelber 8, Sven Mahner 8,9, Jalid Sehouli 5, Ignace Vergote 6 and Robert Zeillinger 1 1 Department of Obstetrics and Gynecology, Medical University of Vienna, 1090 Vienna, Austria; [email protected] (A.R.); [email protected] (R.Z.) 2 Department of Pathology, Klinikum Donaustadt, 1090 Vienna, Austria; [email protected] 3 Institute of Tumor Biology, University Medical Center Hamburg-Eppendorf, 20251 Hamburg, Germany; [email protected] 4 Institute of Clinical Chemistry, University Medical Center Schleswig-Holstein, Campus Kiel, 24105 Kiel, Germany 5 Department of Gynecology, European Competence Center for Ovarian Cancer, Campus Virchow Klinikum, Charité, Universitätsmedizin Berlin, 13353 Berlin, Germany; [email protected] (E.I.B.); [email protected] (J.S.) 6 Division of Gynecological Oncology, Department of Obstetrics and Gynecology, University Hospitals Leuven, Katholieke Universiteit Leuven, 3000 Leuven, Belgium; [email protected] (L.L.); [email protected] (I.V.) 7 Department of Obstetrics and Gynecology, Innsbruck Medical University, 6020 Innsbruck, Austria; Citation: Obermayr, E.; Reiner, A.; [email protected] 8 Brandt, B.; Braicu, E.I.; Reinthaller, A.; Department of Gynecology and Gynecologic Oncology, University Medical Center Hamburg-Eppendorf, Loverix, L.; Concin, N.; Woelber, L.; 20246 Hamburg, Germany; [email protected] (L.W.); [email protected] (S.M.) 9 Department of Obstetrics and Gynecology, University Hospital, LMU Munich, 81377 Munich, Germany Mahner, S.; Sehouli, J.; et al.
    [Show full text]
  • Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience-Dependent Cortical Plasticity
    New Research Development Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience- Dependent Cortical Plasticity Milo R. Smith1,2,3,4,5,6,7,8, Poromendro Burman1,3,4,5,8, Masato Sadahiro1,3,4,5,6,8, Brian A. Kidd,2,7 Joel T. Dudley,2,7 and Hirofumi Morishita1,3,4,5,8 DOI:http://dx.doi.org/10.1523/ENEURO.0240-16.2016 1Department of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 2Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 3Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 4Department of Ophthalmology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 5Mindich Child Health and Development Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 6Graduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 7Icahn Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, and 8Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029 Visual Abstract Throughout childhood and adolescence, periods of heightened neuroplasticity are critical for the development of healthy brain function and behavior. Given the high prevalence of neurodevelopmental disorders, such as autism, identifying disruptors of developmental plasticity represents an essential step for developing strategies for prevention and intervention. Applying a novel computational approach that systematically assessed connections between 436 transcriptional signatures of disease and multiple signatures of neuroplasticity, we identified inflammation as a common pathological process central to a diverse set of diseases predicted to dysregulate Significance Statement During childhood and adolescence, heightened neuroplasticity allows the brain to reorganize and adapt to its environment.
    [Show full text]
  • High-Resolution Gene Maps of Horse Chromosomes 14 and 21: Additional Insights Into Evolution and Rearrangements of HSA5 Homologs in Mammals
    Genomics 89 (2007) 89–112 www.elsevier.com/locate/ygeno High-resolution gene maps of horse chromosomes 14 and 21: Additional insights into evolution and rearrangements of HSA5 homologs in mammals Glenda Goh a,1, Terje Raudsepp a,1, Keith Durkin a, Michelle L. Wagner b, Alejandro A. Schäffer c, Richa Agarwala c, Teruaki Tozaki d, ⁎ James R. Mickelson b, Bhanu P. Chowdhary a,e, a Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA b Department of Veterinary Biosciences, University of Minnesota, 295f AS/VM, St. Paul, MN 55108, USA c National Center for Biotechnology Information, National Institutes of Health, Department of Health and Human Services, Bethesda, MD 20894, USA d Molecular Genetics Section, Laboratory of Racing Chemistry, Tochigi 320-0851, Japan e Department of Animal Science, College of Agriculture and Life Science, Texas A&M University, College Station, TX 77843, USA Received 12 May 2006; accepted 19 June 2006 Available online 17 August 2006 Abstract High-resolution physically ordered gene maps for equine homologs of human chromosome 5 (HSA5), viz., horse chromosomes 14 and 21 (ECA14 and ECA21), were generated by adding 179 new loci (131 gene-specific and 48 microsatellites) to the existing maps of the two chromosomes. The loci were mapped primarily by genotyping on a 5000-rad horse×hamster radiation hybrid panel, of which 28 were mapped by fluorescence in situ hybridization. The approximately fivefold increase in the number of mapped markers on the two chromosomes improves the average resolution of the map to 1 marker/0.9 Mb.
    [Show full text]
  • Supplemental Table 1
    Supplemental Data Supplemental Table 1. Genes differentially regulated by Ad-KLF2 vs. Ad-GFP infected EC. Three independent genome-wide transcriptional profiling experiments were performed, and significantly regulated genes were identified. Color-coding scheme: Up, p < 1e-15 Up, 1e-15 < p < 5e-10 Up, 5e-10 < p < 5e-5 Up, 5e-5 < p <.05 Down, p < 1e-15 As determined by Zpool Down, 1e-15 < p < 5e-10 Down, 5e-10 < p < 5e-5 Down, 5e-5 < p <.05 p<.05 as determined by Iterative Standard Deviation Algorithm as described in Supplemental Methods Ratio RefSeq Number Gene Name 1,058.52 KRT13 - keratin 13 565.72 NM_007117.1 TRH - thyrotropin-releasing hormone 244.04 NM_001878.2 CRABP2 - cellular retinoic acid binding protein 2 118.90 NM_013279.1 C11orf9 - chromosome 11 open reading frame 9 109.68 NM_000517.3 HBA2;HBA1 - hemoglobin, alpha 2;hemoglobin, alpha 1 102.04 NM_001823.3 CKB - creatine kinase, brain 96.23 LYNX1 95.53 NM_002514.2 NOV - nephroblastoma overexpressed gene 75.82 CeleraFN113625 FLJ45224;PTGDS - FLJ45224 protein;prostaglandin D2 synthase 21kDa 74.73 NM_000954.5 (brain) 68.53 NM_205545.1 UNQ430 - RGTR430 66.89 NM_005980.2 S100P - S100 calcium binding protein P 64.39 NM_153370.1 PI16 - protease inhibitor 16 58.24 NM_031918.1 KLF16 - Kruppel-like factor 16 46.45 NM_024409.1 NPPC - natriuretic peptide precursor C 45.48 NM_032470.2 TNXB - tenascin XB 34.92 NM_001264.2 CDSN - corneodesmosin 33.86 NM_017671.3 C20orf42 - chromosome 20 open reading frame 42 33.76 NM_024829.3 FLJ22662 - hypothetical protein FLJ22662 32.10 NM_003283.3 TNNT1 - troponin T1, skeletal, slow LOC388888 (LOC388888), mRNA according to UniGene - potential 31.45 AK095686.1 CONFLICT - LOC388888 (na) according to LocusLink.
    [Show full text]
  • Immunosuppression by Cyclosporine Cyclophilin A-Deficient Mice Are
    Cyclophilin A-Deficient Mice Are Resistant to Immunosuppression by Cyclosporine John Colgan, Mohammed Asmal, Bin Yu and Jeremy Luban This information is current as J Immunol 2005; 174:6030-6038; ; of October 2, 2021. doi: 10.4049/jimmunol.174.10.6030 http://www.jimmunol.org/content/174/10/6030 References This article cites 53 articles, 28 of which you can access for free at: Downloaded from http://www.jimmunol.org/content/174/10/6030.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision http://www.jimmunol.org/ • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: by guest on October 2, 2021 http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Cyclophilin A-Deficient Mice Are Resistant to Immunosuppression by Cyclosporine1 John Colgan,2* Mohammed Asmal,* Bin Yu,* and Jeremy Luban3*† Cyclosporine is an immunosuppressive drug that is widely used to prevent organ transplant rejection. Known intracellular ligands for cyclosporine include the cyclophilins, a large family of phylogenetically conserved proteins that potentially regulate protein folding in cells.
    [Show full text]
  • Structural and Functional Insights Into Human Nuclear Cyclophilins
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 2 November 2018 doi:10.20944/preprints201811.0037.v1 Peer-reviewed version available at Biomolecules 2018, 8, 161; doi:10.3390/biom8040161 1 Review 2 Structural and Functional Insights into Human 3 Nuclear Cyclophilins 4 Caroline Rajiv12 and Tara L. Davis13,* 5 1 Department of Biochemistry and Molecular Biology, Drexel University College of Medicine, 6 Philadelphia PA USA 19102. 7 2 Janssen Pharmaceuticals, Inc., 22-21062, 1400 McKean Rd, Spring House, PA 19477; 8 [email protected] 9 3 FORMA Therapeutics, 550 Arsenal St. Ste. 100, Boston, MA 02472; [email protected] 10 11 * Correspondence: [email protected]; Tel.: +01-857-209-2342 12 13 Abstract: The peptidyl-prolyl isomerases of the cyclophilin type are distributed throughout human 14 cells, including eight found solely in the nucleus. Nuclear cyclophilins are involved in complexes 15 that regulate chromatin modification, transcription, and pre-mRNA splicing. This review collects 16 what is known about the eight human nuclear cyclophilins: PPIH, PPIE, PPIL1, PPIL2, PPIL3, PPIG, 17 CWC27, and PPWD1. Each “spliceophilin” is evaluated in relation to the spliceosomal complex in 18 which it has been studied, and current work studying the biological roles of these cyclophilins in 19 the nucleus are discussed. The eight human splicing complexes available in the RCSB are analyzed 20 from the viewpoint of the human spliceophilins. Future directions in structural and cellular biology, 21 and the importance of developing spliceophilin-specific inhibitors, are considered. 22 23 Keywords: Peptidyl-prolyl isomerases; nuclear cyclophilins; spliceophilins; alternative splicing; 24 spliceosomes; NMR; x-ray crystallography 25 26 27 1.
    [Show full text]