High-Resolution Gene Maps of Horse Chromosomes 14 and 21: Additional Insights Into Evolution and Rearrangements of HSA5 Homologs in Mammals

Genomics 89 (2007) 89–112 www.elsevier.com/locate/ygeno

High-resolution gene maps of horse chromosomes 14 and 21: Additional insights into evolution and rearrangements of HSA5 homologs in mammals

Glenda Goh a,1, Terje Raudsepp a,1, Keith Durkin a, Michelle L. Wagner b, Alejandro A. Schäffer c, Richa Agarwala c, Teruaki Tozaki d, ⁎ James R. Mickelson b, Bhanu P. Chowdhary a,e,

a Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA b Department of Veterinary Biosciences, University of Minnesota, 295f AS/VM, St. Paul, MN 55108, USA c National Center for Biotechnology Information, National Institutes of Health, Department of Health and Human Services, Bethesda, MD 20894, USA d Molecular Genetics Section, Laboratory of Racing Chemistry, Tochigi 320-0851, Japan e Department of Animal Science, College of Agriculture and Life Science, Texas A&M University, College Station, TX 77843, USA Received 12 May 2006; accepted 19 June 2006 Available online 17 August 2006

Abstract

High-resolution physically ordered gene maps for equine homologs of human chromosome 5 (HSA5), viz., horse chromosomes 14 and 21 (ECA14 and ECA21), were generated by adding 179 new loci (131 gene-specific and 48 microsatellites) to the existing maps of the two chromosomes. The loci were mapped primarily by genotyping on a 5000-rad horse×hamster radiation hybrid panel, of which 28 were mapped by fluorescence in situ hybridization. The approximately fivefold increase in the number of mapped markers on the two chromosomes improves the average resolution of the map to 1 marker/0.9 Mb. The improved resolution is vital for rapid chromosomal localization of traits of interest on these chromosomes and for facilitating candidate gene searches. The comparative gene mapping data on ECA14 and ECA21 finely align the chromosomes to sequence/gene maps of a range of evolutionarily distantly related species. It also demonstrates that compared to ECA14, the ECA21 segment corresponding to HSA5 is a more conserved region because of preserved gene order in a larger number of and more diverse species. Further, comparison of ECA14 and the distal three-quarters region of ECA21 with corresponding chromosomal segments in 50 species belonging to 11 mammalian orders provides a broad overview of the evolution of these segments in individual orders from the putative ancestral chromosomal configuration. Of particular interest is the identification and precise demarcation of equid/Perissodactyl-specific features that for the first time clearly distinguish the origins of ECA14 and ECA21 from similar-looking status in the Cetartiodactyls. © 2006 Elsevier Inc. All rights reserved.

Keywords: Horse; ECA14; ECA21; HSA5; Gene mapping; Radiation hybrid map; FISH; Comparative map; Chromosome evolution

High-resolution gene maps are an essential component of species. The focus of current investigations in the horse is to use current efforts to analyze the genomes of a range of economic- the gene map for improving health, disease resistance, reproduc- ally and biologically important species, including livestock and tion/fertility—traits of vital significance to the entire equine companion/pet animals. These maps provide basic but crucial industry—by discovering and analyzing genes governing them. linear information on the physical organization of the genome Recent years have witnessed a rapid increase in gene mapping and serve as the backbone for some genomic research in these data in the horse (Equus caballus, ECA). To date, approximately 2000 loci have been mapped to the horse genome using a variety of techniques that provide whole-genome radiation hybrid (RH) ⁎ Corresponding author. Department of Veterinary Integrative Biosciences, and linkage maps [1–5] of moderate resolution. Attempts are College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA. being made to produce comprehensive high-resolution physi- E-mail address: [email protected] (B.P. Chowdhary). cally ordered maps for all equine chromosomes, such that, on 1 Both authors contributed equally to this work. average, one gene-specific marker is mapped every megabase of

0888-7543/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2006.06.012 90 G. Goh et al. / Genomics 89 (2007) 89–112 the genome. This density is approximately achieved in the DNA amplifications in the presence of control hamster DNA physically ordered RH and comparative gene maps reported and hence were selected for further analysis. The remaining recently for some horse chromosomes [6–9]. As an extension to 40 primer pairs were excluded due to weak amplification of this ongoing effort, we herein report the construction of a high- horse DNA, multiple PCR amplification products, or resolution radiation hybrid and comparative map for equine amplicons of equal sizes for both horse and hamster. homologs of human chromosome 5 (HSA5), namely, horse Sequence analysis of the amplification products led to the chromosome 14 (ECA14) and most of 21 (ECA21). exclusion of an additional 4 loci because of insufficient Human chromosome 5 comprises ∼6% of the human sequence correspondence with the anticipated human genes, genome and spans ∼181 Mb of DNA (Ensembl, http://www. thus leaving 131 primer pairs for genotyping on the RH ensembl.org/Homo_sapiens/mapview?chr=5). It contains panel. Optimization of primer pairs for 59 microsatellite ∼1000 genes [10] and has an average density of ∼5 genes markers on horse and hamster DNA provided 51 loci for every megabase along the length of the chromosome. Several further genotyping. earlier gene mapping and Zoo–fluorescence in situ hybridization (FISH) studies in the horse suggested that HSA5 Generation of a composite RH map corresponds to ECA14 and ECA21 [1,11–13]. A recent study, however, clarifies that only the distal three-quarters of ECA21, The RH genotyping data for 182 (131+51) markers were and not the entire chromosome, corresponds to part of HSA5 added to the genotyping data from previously published low- [7,14]. The other part of ECA21 is homologous to part of density maps for all of ECA14 (22 loci) and all of ECA21 (18 HSA19, for which there is already a high-resolution map. loci) and a dense map for the proximal part of ECA21 Before this study, only 17 equine orthologs of HSA5 genes and (another 18 loci). This resulted in a total of 240 markers: 137 23 microsatellite markers were mapped to ECA14 and ECA21 markers (88 Type I and 49 Type II) on ECA14 and 85 markers [1]. The average resolution provided by these markers (1 (55 Type I and 30 Type II) on distal ECA21 and 18 markers marker/6–7 Mb) on corresponding regions of the two chromo- recently mapped to the proximal part of ECA21 [7]. The somes is inadequate to map traits of interest and initiate searches likelihood of the presence of the new 182 markers on either for loci governing them. Moreover, lack of comparatively ECA14 or ECA21 was deduced by two-point analysis of mapped loci considerably reduces the possibility of using individual typing results against the first-generation RH map sequenced human, mouse, cattle, and dog maps for search of [1], http://equine.cvm.tamu.edu/cgi-bin/ecarhmapper.cgi. The candidate loci responsible for these traits. Hence, we undertook outcome of further analysis of all markers leading to the an organized expansion of the gene map of the two equine development of RH maps for individual equine chromosomes homologs of HSA5 such that the average density of markers on is provided below. A summary of the distribution of markers these chromosomes could be augmented to at least one marker that were finally included in the maps of the two chromo- every megabase, and a precise alignment between the horse and somes is provided below and presented in Table 1. the human chromosomes could be achieved. The detailed map thus produced is valuable in identifying the ECA14 putative mammalian ancestral configuration for these equine Analysis of the 137 markers assigned to ECA14 gave a chromosomes and the likely rearrangement steps in evolution single linkage group (lod threshold 7; Fig. 1a) comprising 128 leading to their present organization in equids/Perissodactyls markers (83 Type I and 45 Type II) and spanning an and other mammalian orders. estimated 1827.76 cR (see Supplementary Table 1 for map details in tabular form). The remaining 9 markers were Results deleted from further analysis because they segregated as singletons during analysis or could not be placed with any Developing equine gene-specific markers confidence. It is noteworthy that 65 of the markers in the final map were in the maximum likelihood (MLE)-consensus map, From a total of 175 gene-specific primer pairs designed for implying that the optimal marker order for all three equine orthologs of HSA5 genes, 135 gave horse-specific formulations of the MLE criterion in [25] is the same and

Table 1 A summary of the number and type of markers mapped to regions of ECA14 and ECA21 that share homology with HSA5 Horse RH-mapped loci FISH-mapped loci Comparative chromosome loci (RH+FISH) On map Type I Type II Total New Total New HSA19 loci Total New Total (genes) RH anchors New (genes) Total New ECA14 128 106 83 73 0 45 33 37 (31) 30 16 (16) 88 73 ECA21 90 71 64 56 13 26 15 24 (19) 20 12 (11) 66 55 Total 218 a 177 b 147 129 13 71 48 61 (50) 50 28 (27) 154 128 a In addition to the 218 markers, 11 more markers (mapped exclusively by FISH) are present on the overall map. Consequently, the total number of mapped markers is 229, of which AHT020–a microsatellite-is shown only on the FISH map. b Of the 11 loci, 2 FISH-mapped loci are new (SSTK and INSL3). Hence the total number of new loci on the overall map is 177+2=179. G. Goh et al. / Genomics 89 (2007) 89–112 91 no alternate order of the 65 markers has a log-likelihood was used (cattle [27,29],pig[28], cat [30,31]). A regional within 0.25 units of the best order. disagreement of ∼2 Mb in the gene order is not considered a “rearrangement” because of the imperfections of RH genotyp- ECA21 ing and map construction. Conserved gene order across Analysis of the 103 markers assigned to ECA21 gave two mammals is represented by rectangular light green shading, linkage groups (lod threshold 7; Fig. 1b) containing 90 (64 while chromosomal segments conserved across vertebrates Type I and 26 Type II) markers. The remaining 13 markers (threshold of at least four loci) are shown by rectangles with red were deleted from further analysis due to reasons described margins (Figs. 1a and b). above. The proximal group comprising 24 markers spans Briefly, the distal three-quarters of ECA21 corresponds to 278.07 cR and corresponds primarily to HSA19 but also the entire short arm and ∼15% of the proximal part of the long includes 6 genes from HSA5. The distal RH group comprising arm of HSA5. These regions essentially constitute a contiguous 66 markers completely corresponds to HSA5 and spans chromosomal segment in chimpanzee and dog and, surprisingly, 752.70 cR (see Supplementary Table 1 for map details in even in mouse. Rat is the only sequenced mammal in which the tabular form). A total of 41 markers were in the MLE- corresponding segment is distributed on two different chromo- consensus map and were therefore ordered with confidence. somes. Chicken, an evolutionarily distantly related vertebrate, Retention frequency for the 128 markers on ECA14 ranged shows the same loci to be located primarily on two chromo- from 9.78 (BNIP1 and TKY1053) to 26.09% (FLJ36090), somes, of which one is the sex chromosome (Z). Compared to with an average of 17.16% (Fig. 2a). The corresponding this, ECA14 corresponds to the remaining part of HSA5 (distal percentages for the 90 markers on ECA21 ranged from 7.61 85% of the long arm). Except for human, chimpanzee, and cat, (FLJ13611 and TKY806) to 27.17% (UBA52), with an this equine chromosome shares similarity with parts of two or average of 15.01% (Fig. 2b). The overall retention frequency more chromosomes in other compared species, viz., mouse, rat, of markers was not extreme in any region on the two dog, chicken, cattle, and pig. Evidently, conserved synteny as chromosomes. well as conserved linkage is less pronounced for this equine chromosome, compared to that seen for ECA21. Screening BAC libraries and FISH mapping

BAC clones isolated for 28 loci (27 genes and 1 micro- Discussion satellite) were mapped by FISH on metaphase and interphase chromatin using single or double color hybridizations (Fig. 3). High-resolution physical map of ECA14 and ECA21 This led to mapping of 16 gene-specific loci on ECA14 and 11 on ECA21. Of the gene-specific markers on ECA21, 5 are on the This study provides dense physically ordered maps of ∼5–6 Mb region that corresponds to HSA19 [7]. The physical gene-specific and microsatellite markers for horse chromo- order of closely located markers was delineated using two- or somes 14 and 21. Additionally the maps serve as a template three-color FISH on metaphase and/or interphase chromosomes for comprehensive comparison of the two equine chromo- (Fig. 3). somes with human chromosome 5 and corresponding chromosomes from a range of evolutionarily diverged Comparative mapping mammals and chicken. Incorporation of a total of 179 new markers (177 by RH and 2 exclusively by FISH) in this study Comparative maps for the two equine chromosomes were increased the overall density of mapped markers on both developed using precise megabase locations of equine orthologs chromosomes by approximately fivefold over the previously in draft/finished sequences of various species or by using published map [1]. Further, the number of gene-specific available gene mapping information. The ECA14 comparative markers increased from 17 to 147 (approx eightfold map (Fig. 1a) comprised 88 loci, of which 81 were mapped by improvement), while the number of microsatellite markers RH analysis and 7 were “placed” based on FISH data and the increased from 23 to 71 (approx threefold improvement) location of markers in relation to adjacent loci mapped by RH compared to the first-generation RH map [1]. The estimated analysis. The ECA21 comparative map (Fig. 1b) comprised 66 size for ECA14 and ECA21 is approximately 120 and 80 Mb, loci, of which 63 were mapped by RH analysis and 3 were placed respectively. The 218 markers currently RH mapped on the as described above. Two loci on ECA14 (LOC153195 and two chromosomes provide an average resolution of 1 marker/ SOD2ps) and one on ECA21 (LOC134146) could not be added 0.9 Mb, which represents a sixfold improvement over the to the map because their comparative information was not previous resolution of 1 marker/5.5 Mb [1]. available. The success rate of designing primers for equine orthologs As described earlier [1], maximally contiguous chromoso- of HSA5 genes and mapping them onto ECA14 and ECA21 mal regions with identical gene content and order—referred to maps was ∼74%. Thus, comparative genome sequence as conserved linkages—were identified by clustering the information available for humans and other mammalian contiguous megabase locations of individual loci in human/ species was extremely useful in rapid development of the chimpanzee, mouse, rat, dog, and chicken (Figs. 1a and b). In map for the two chromosomes. Primers were designed for other species, only comparative data for mapped equine genes genes at approximately megabase intervals on HSA5, except 92 G. Goh et al. / Genomics 89 (2007) 89–112 G. Goh et al. / Genomics 89 (2007) 89–112 93

Fig. 1. (a and b) High-resolution RH and comparative maps of horse chromosomes 14 and 21 (ECA14 and ECA21). On the far left is a color bar showing regions of HSA5 (demarcated in megabases on the human genomic sequence) that correspond to ECA14 and the distal three-quarters of ECA21. Next, the G-banded idiograms of the equine chromosomes show all the FISH-mapped loci (right). The 28 newly FISH-mapped loci are shown in bold with an asterisk. Next to the FISH-mapped markers are the RH maps—one on ECA14 and two on ECA21. On ECA21, the upper three-quarters of the proximal linkage group relates to the region that shares synteny with part of HSA19p, while the remaining part and the large distal linkage group relate to the region sharing synteny with HSA5. The RH groups are demarcated at 50-cR intervals. The MLE-consensus markers (framework) are shaded in light yellow, with those having a lod score ≥3.0 shown in bold font. The remaining markers (unshaded) were placed on this framework. Markers shown in italic were placed at a lod score ≤0.5 and can therefore have alternative adjacent locations. Markers with the same physical/cR position have a vertical bar on the left and are connected by a common line to the map. Markers with identical vectors have a bracket on the right. Gene-specific markers in red font represent FISH-mapped loci that were tentatively placed in the map on the basis of the RH-map location of adjacent FISH-mapped markers. “?” indicates disagreement between FISH and RH assignments. Next to the RH map are the megabase locations for human (HSA), chimpanzee (PTR), mouse (MMU), rat (RNO), dog (CFA), and chicken (GGA) orthologs of the mapped horse genes (http://genome.ucsc.edu/cgi-bin/hgGateway). Vertical rectangles on Mb positions of genes within each species essentially show conserved gene order in relation to the derived order in the horse. The light green shaded horizontal rectangles show conserved linkage across sequenced mammals. The red horizontal rectangles depict putative conserved linkages across vertebrates. A status of the comparative mapped loci in cattle (BTA), pig (SSC), and cat (FCA) is provided for orthologs with available mapping information. These data are supplemented with recently published results in cattle and pigs [27–29]. Arrows (cattle and pig) indicate putative order of loci in these species. Distinct rearrangements are evident in cattle for segments corresponding to ECA14. 94 G. Goh et al. / Genomics 89 (2007) 89–112

Fig. 2. (a and b) Distribution of retention frequency of mapped markers on (a) ECA14 and (b) ECA21. G. Goh et al. / Genomics 89 (2007) 89–112 95

Fig. 3. Partial horse metaphase spreads showing (arrows) single- and double-color FISH results for selected loci. (a) CRSP9 (green)—ECA14q15, (b) HK3 (red)— ECA14q13 and RARS (green)—ECA14q14, (c) SMAD5 (red) and KIF3A (green)—ECA14q21 and CHSY2 (red)—ECA14q22.1, (d) CCNB1 (red)—ECA21q13– q14, (e) DNAH5 (green)—ECA21q18 and SDHA (red)—ECA21q19.2, (f) GMIP (green) and CCNB1 (red)—ECA21q13–q14 and ADAMTS6 (green)— ECA21q14. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

for the centromeric region spanning 45–50 Mb. This led to a verified the identity of the amplified product, and unambigu- relatively uniform and fine alignment of the two equine ously localized it to the proximal part of ECA21. The FISH chromosomes with the entire HSA5. The approach demon- assignment of SLC6A3 [32] and RASA1 [33] to ECA14 strated the efficient use of map information from sequenced using goat BAC clones as probes is not in agreement with the genomes (e.g., human, mouse, and rat) to develop gene maps current map. Fine comparative alignment obtained between in species like horse, cat, sheep, and goat for which map HSA5 and the equine homologs in this study suggests that information is currently limited. SLC6A3 most likely maps to the distal end of ECA21q and The 28 new FISH assignments reported in this study (16 RASA1 to the distal part of ECA14q, contrary to the earlier on ECA14 and 12 on ECA21) increase the number of published results. cytogenetically mapped markers on the two chromosomes to 37 and 24, respectively. Of the 12 new markers localized Comparative map by FISH to ECA21, 5 originate from HSA19 and are located on the proximal part of the short arm of ECA21 The addition of 131 new gene-specific markers on ECA14 (21q12–q14). The orders of cytogenetically mapped markers and ECA21 is a major improvement over the mere 17 genes on both chromosomes essentially corroborate the physical previously mapped jointly on the two chromosomes [1].On order of markers obtained in the RH map and serve as average, one gene-associated marker is now mapped at every excellent anchor points to align and orient different linkage 1.37-Mb interval along the length of both chromosomes. This groups. marker density is comparable to that recently reported by us The three FISH–RH mapping discrepancies observed by in high-resolution maps for some of the equine chromosomes us involve INSL3, SLC6A3, and RASA1. INSL3 was (ECA17 [17], ECAX [6], ECA22 [8], HSA19 homologs [7], previously assigned to ECA7q17–q18 in [32] by performing HSA2 homologs [9]). FISH using an equine BAC containing the gene. We designed The improved density of gene-specific markers on the new horse-specific primers for the gene, sequenced and two equine chromosomes shows that the distal three-quarters 96 G. Goh et al. / Genomics 89 (2007) 89–112 of ECA21 share similarity with the 0–68.5 Mb region of HSA5. These syntenic blocks essentially have the same gene HSA5, which corresponds to the short arm and part of the order as seen in horse/human. In cats, however, ECA14/ long arm of the human chromosome (5pter–q13.2). ECA21 equates to a single chromosome—FCAA1 (cat Compared to this, ECA14 shares similarity with the 70.9– chromosomes have a unique nomenclature: rather than 180.2 Mb region of the human chromosome, which being numbered 1, 2, …, they are named A1, A2, A3, …, corresponds to the rest of the long arm (5q13–qter). It is B1, …). Next, comparison of the available gene order in evident from these observations that the evolutionary break/ chicken with the order obtained in the horse shows that a fusion point for horse–human comparisons does not fall on considerable part of ECA14/ECA21 (HSA5) primarily the centromere, but is in the proximal region of the long corresponds to the distal ∼30-Mb region of the short arm arm of HSA5, somewhere between 68.5 and 70.9 Mb on the of the chicken Z chromosome (GGAZ), followed largely by sequence map. This confirms and markedly refines the loci from GGA2 and GGA13. As expected, extensive comparative information reported previously using whole rearrangements are evident within the chicken syntenic blocks chromosome or microdissected arm-specific HSA5 paints compared with corresponding segments in horses and other [11–13] in which we proposed that ECA14 corresponds to mammals. HSA5q13–qter and the entire ECA21 corresponds to HSA5p Comprehensive gene mapping and comparative informa- and proximal part of HSA5q. tion recently published for cattle [27,29] enables one to relate Comparison of the gene order between ECA14/ECA21 and the two cattle chromosomes—BTA7 and BTA20—to ECA14/ HSA5 shows that despite minor differences in regions with ECA21 (HSA5). While ECA14 corresponds largely to parts densely mapped markers, there is an overall conserved of BTA7 and to a lesser extent to parts of BTA10 and linkage observed between the two species as indicated by BTA20, the segments are inverted and rearranged compared contiguous vertical boxes over the megabase position of with horse and human. In contrast to this, a large part of human orthologs (Figs. 1a and 1b). On ECA14, the gene BTA20 that equates to the short arm and the subcentromeric order is inverted with respect to HSA5. The proximal region part of the long arm of HSA5 shows conserved linkage with of the horse chromosome corresponds to the telomeric region the distal three-quarters segment of ECA21. Last, the of the long arm of HSA5 (∼180.2 Mb), while the telomeric comparative data between horse and pig indicate that the region corresponds to the putative evolutionary break/fusion proximal two-thirds of ECA14 corresponds to the middle part point on the long arm of the human chromosome. A similar of SSC16 and the distal two-thirds to the long arm of SSC2, inverted arrangement is also observed between HSA5 and while the majority of ECA21 (distal three-quarters)—which ECA21 (Fig. 1b). equates to the 0–70 Mb segment of HSA5p/q—corresponds Comparison of the gene order for HSA5 homologs between to the proximal and distal parts SSC16. Our findings horse (ECA14/ECA21) and chimpanzee chromosome 4 (PTR4) corroborate and refine previous pig–human comparative led to the identification of four distinct blocks. Two of the blocks painting and gene mapping data [28,34,35]. on ECA14 correspond to (in order) ∼187→ 104 and ∼20→45 Mb segments, while the two blocks on ECA21 correspond to ∼47→99 and 18→0 Mb segments of PTR4. This Comparative organization of HSA5 homologs in evolutionarily arrangement of loci is unique to chimpanzee and is attributed to diverged species an ∼80-Mb inversion and additional rearrangements discovered between HSA5 and PTR4 involving a segment corresponding to In this study, we analyzed the comparative status of HSA5 HSA5p14–q15 [10]. homologs in the karyotypes of 50 species belonging to 11 Comparison of the gene order on ECA14 and ECA21 with the mammalian orders (Fig. 4; Supplementary Table 2). To this, we sequence data in the rodents presents a familiar situation in which added information from chicken—a distantly related vertebrate. the rat and mouse genomes are found to be considerably The overall observations summarized in Fig. 5 suggest that the rearranged in relation to other mammals. Consequently, a number chromosome corresponding to HSA5 was most likely a single of rodent chromosomes are found to share synteny with the two acrocentric chromosome in the eutherian mammal ancestor that equine chromosomes (and hence also to HSA5; Figs. 1a and b). (i) remained conserved as a single segment in some of the Among these rodent chromosomes, the most conspicuous are species, (ii) resulted in the formation of two rather evolutiona- chromosomes 11, 13, 15, and 18 in the mouse and chromosomes rily conserved segments in a range of evolutionarily distantly 2, 10, and 18 in the rat. Of considerable interest is the fact that the related species—a state most commonly observed [13,36–46], gene order observed on ECA21 shows conserved linkage in or (iii) underwent more fission events leading to three to six horse, human (HSA5), and rat (RNO2), but not in the mouse, in segments in a few other groups of species [47–51] (details which it is present on two separate chromosomes, MMU13 and provided in Fig. 4). In the following paragraphs we will MMU15. However, on ECA14, the rat and mouse chromosomes summarize the current knowledge of chromosomes or chromo- share four similar segments of conserved linkage and synteny that somal segments corresponding to ECA14/ECA21 or HSA5 in are visible as vertical blocks on megabase positions of mouse and different species. This background information will provide a rat homologs of the equine genes (Fig. 1a). basistounderstandtheevolutionofthesesegmentsin Five dog chromosomes (CFA2, CFA3, CFA4, CFA11, and Perissodactyls and compare it with observations made in CFA34) correspond to ECA14 and ECA21 and hence also to other distantly related species. .Ghe l eois8 20)89 (2007) 89 Genomics / al. et Goh G. – 112

Fig. 4. A complete overview of comparative painting data for HSA5 homologs in a range of species belonging to 11 mammalian orders, which provided the basis for Fig. 5. A summary of contributing references is provided in Supplementary Table 2. Data for chicken represent information derived from gene mapping and sequence information. Comparative information regarding HSA19p is included mainly to assess its neighborhood with segments corresponding to HSA5. A phylogenetic relationship between the 11 mammalian orders from which available Zoo-FISH data were examined is shown in a box (top right). 97 98 G. Goh et al. / Genomics 89 (2007) 89–112

Fig. 5. A representative summary of the organization of chromosomal segments corresponding to HSA5 (outer circle) in species belonging to 11 evolutionarily diverse mammalian orders. The available Zoo-FISH data from species within each order were compared to identify the most prevalent configuration that has evolved following evolution from a putative ancestral HSA5 chromosomal segment (central circle). In addition to the commonly observed configurations seen in each of the mammalian orders, alternatives of the same segment observed in some of the species are also shown. Perissodactyls show two distinct chromosomal segments corresponding to HSA5. However, these segments differ from those seen in, e.g., the Cetartiodactyls, in which the two segments evolved differently, probably with more rearrangements. The neighborhood of segment corresponding to HSA19p and HSA5 was included to get an overview of the prevalence of this combination in other species/orders.

HSA5 is present as: three distinct syntenic segments in some of the species ·belonging to Xenarthra (tree anteater) and Artiodactyla a single chromosome or chromosomal segment (putatively (cattle, goat); and ·ancestral configuration) in a very divergent group of four to seven segments in some of the species belonging to mammals belonging to Afrotheria (aardvark, elephants, ·Eulipotyphla (long-eared hedgehog), Rodentia (rat and golden mole, elephant shrew), Carnivora (felids—cat, mouse), and Carnivora (dog, Japanese raccoon dog, red fox, mustelids—American mink and ferret, ursids—giant Arctic fox, crab eating fox). panda, pinnipeds—harbor seal), Rodentia (sciurids—tree squirrels, flying squirrels, and chipmunks), Cetartiodactyla The two chromosomal equivalents of HSA5 seen in horses (Cetacea—Atlantic bottlenose dolphin), and Primates (e.g., and other Perissodactyls appear to be contiguous derivatives humans); of an ancestral chromosome similar to HSA5 (assuming two distinct chromosomes or chromosomal segments in centromere at pter), with a breakpoint at ∼69–70 Mb in the ·Perissodactyla (horse, donkey, and zebras) and a number of sequence map of the human chromosome, at around band species belonging to Artiodactyla (bovids—sheep, river 5q13.2. While one of the units of this putative fission led to buffalo, gayal, antelope, etc.; cervids—Indian and Chinese the formation of ECA14, the other unit corresponding to the muntjacs, forest musk deer; suids—pig), Chiroptera (a range 0–69 Mb region of HSA5 fused with the ∼5 Mb region of of bats), Eulipotyphla (common shrew, Asiatic short-tailed HSA19 (15–20 Mb region in HSA5 sequence map), resulting shrew, and shrew-hedgehog), Lagomorpha (rabbit), Pholidota in ECA21. These events seemed to have occurred in the (pangolin), and Xenarthra (two-toed sloth); equid/Perissodactyl ancestor because the specific HSA5/ G. Goh et al. / Genomics 89 (2007) 89–112 99

HSA19p combination is also seen in donkey and zebras these genes were individually aligned with available sequence data for hitherto studied. Though a combination of the two human mouse, rat, pig, cow, or other mammalian orthologs (http://www.ddbj.nig.ac. jp/search/clustalw-e.html). Multiple alignments were used to identify sites for chromosomes is also reported in Cetartiodactyls (bovids, primer design that could specifically amplify sequences within equine cervids, suids, and cetaceans), a couple of noteworthy features orthologs of the corresponding human genes in a mixed horse/hamster DNA distinguish the derivative chromosome in the two groups of pool [6,15–17]. Primers were designed using the Primer3 software (http:// species. First, the part of HSA19p in the Cetartiodactyl frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and were optimized derivative originates from the 0–19.5 Mb in the bovids and using hamster and horse genomic DNA to ensure horse-specific amplification. All equine PCR products were verified by sequencing and were probably the whole short arm in the cervids and suids, analyzed using BLASTn [18] to confirm their identity in relation to the compared to the 15–20 Mb region seen in the equids. Second, corresponding human gene. Additionally, primer pairs for 51 microsatellite the part of HSA5q in the Cetartiodactyls is the 70–180 Mb markers were obtained from various sources using approaches previously segment compared to the 0–70 Mb segment seen in the described [19–23]. Detailed information on all markers including primer equids. Froenicke et al. [39] and Yang et al. [46] recently sequence, PCR condition, etc., is presented in Table 2A (ECA14) and Table 2B (ECA21). suggested that HSA5/HSA19 associations seen in Cetartio- dactyla and Perissodactyls most likely have an independent origin. Our observations, together with those made by Everts- Genotyping markers on the equine RH panel, data analysis, and van der Wind et al. in cattle [27], provide clear evidence to computation of maps support this line of thought. Genotyping of the markers generated above was carried out by PCR on the 5000-rad horse×hamster RH panel comprising 93 hybrid cell lines [1,24]. Concluding remarks Briefly, all markers were typed in duplicate using 50 ng DNA as template; 1× buffer (Sigma Aldrich); 0.3 pmol of each primer; 0.2 mM dNTPs; 1.5, 2.0, or

3.0 mM MgCl2; and 0.25 units JumpStart REDTaq DNA polymerase (Sigma The high-resolution physically ordered RH and compara- Aldrich) in a 10-μl PCR as described earlier [7]. The PCR amplification tive maps for equine homologs of HSA5, viz., ECA14 and products were resolved on 2% agarose gels containing 25 μg/ml ethidium the majority of the distal part of ECA21, generated in this bromide and scored manually. study are important tools for annotating/aligning recently Radiation hybrid maps were computed with the goal of optimizing the MLE criterion. Maps were generated using the rh_tsp_map ([25]; ftp://ftp. generated 2× sequence data in horses (Horse Genome Project, ncbi.nih.gov/pub/agarwala/rhmapping/rh_tsp_map.tar), CONCORDE ([26]; http://www.uky.edu/Ag/Horsemap/) and to assign traits of http://www.isye.gatech.edu/~wcook/rh/), and Qsopt (http://www.isye.gatech. interest precisely on the two chromosomes. The fine edu/~wcook/qsopt) software packages as previously described [7,9]. The map alignment of the maps with gene/sequence maps for for the lower part of ECA21 was computed in conjunction with the map for corresponding chromosomes in other mammals will serve as upper ECA21 reported in [7]. The only pertinent methodological details that may differ are the lod score threshold used for making linkage groups, the a foundation for rapid discovery of candidate loci associated number of linkage groups, and the number of singletons dropped. When with these traits. While comparative analysis of the mapping making linkage groups by single linkage clustering based on pair-wise lod data shows a high degree of conserved linkage between scores, a lod score threshold of 7.0 was used for both ECA14 and ECA21. ECA14 and the 70–180 Mb region of HSA5, rearrangements Two singletons each for ECA14 and ECA21 were dropped while generating are evident for these segments in most of the other the final map. The order and orientation of linkage groups were confirmed by FISH data. evolutionarily diverged species. In contrast to this, the ECA21 segment that equates to the 0–70 Mb region of HSA5 clearly shows greater conservation. The latter is BAC library screening and FISH mapping evident from the preservation of gene order for this segment in more species than is seen for ECA14. The precise Two equine BAC libraries (TAMU and CHORI-241) were screened for megabase demarcation of the two equine chromosomes in ECA14 and ECA21 markers using hierarchical PCR screening of superpools, relation to HSA5, and its comparison with corresponding plate pools, and row/column pools to isolate pertinent BAC clones. The clones were individually labeled with biotin and/or digoxigenin using the chromosomal segments in a range of mammals, provided an BIO- or DIG-Nick Translation Mix (Roche Molecular Biochemicals). Labeled improved overview of their evolution from the putative probes were hybridized either separately or in pairs/triplets to horse ancestral configuration. In particular it enabled the identifica- metaphase chromosome spreads or interphase chromatin to determine their tion of equid/Perissodactyl-specific features that clearly location and relative physical order. DNA labeling, in situ hybridization, distinguish their origins from similar-looking status in the signal detection, microscopy, and image analysis were performed as previously described [1]. Cetartiodactyls.

Comparative map Material and methods A comparative map of ECA14 and ECA21 was developed using precise Marker development megabase locations of human, chimpanzee, mouse, rat, dog, and chicken orthologs of the equine genes from the most updated sequence data (http:// Sequence data for HSA5 available through NCBI build 35.1 (http://www. genome.ucsc.edu/cgi-bin/hgGateway). Comparative map information for ncbi.nlm.nih.gov/mapview/maps.cgi?taxid=9606&chr=5) and Ensembl v37 corresponding loci in cattle, pig, and cat were obtained from published (http://www.ensembl.org/Homo_sapiens/mapview?chr=5) were used to select information and databases (NCBI, http://www.ncbi.nlm.nih.gov/Genomes/ genes at ∼1-Mb intervals along the length of the chromosome. Sequences of index.html; ArkDB, http://iowa.thearkdb.org/ [27,28]). 100

Table 2 Detailed information about individual gene-specific and microsatellite markers mapped to (A) ECA14 and (B) ECA21 by RH analysis and/or FISH

Marker Name Horse locus Primers (5′−3′) PCR Ta MgCl2 Reference Accession Human product size (mM) No. Accession No. (A) ADRB2 Adrenergic, β2-receptor, surface 14q15–q16 F: CTCGTCCATCGTGTCCTTCT 202 58 2.0 [1] AF130746, NM_000024 R: GGCTTTGTGTTCCTTCAAGC AY011303, AY008768 AHT029 Microsatellite 14q13 F: ACTCATTCATTCACAAATCCCC 270–292 58 2.0 [1] AJ271514 R: AGAAAATTCCCTCCTGTCCC

AHT083 Microsatellite 14 F: CTGACTATCCCCCAAAACACA 102–114 58 2.0 [1] AJ507700 89 (2007) 89 Genomics / al. et Goh G. R: ATGGCATTGCTTACATATCCTG ALDH7A1 Aldehyde dehydrogenase 7 14q22.1 F: GAAGATCCAAGTACTAGGAAGCT 1045 58 1.5 This study NM_001182 family, member A1 R: ATCCACGTACTCCTGAACTTCT ANXA6 Annexin A6 F: TGAGAAGTGCCTCATTGAGATC 1032 58 1.5 This study NM_001155 R: TCTTCTGGAAGTGGCCAGAG BNIP1 BCL2/adenovirus F: AATTTAAGTCCATGTCGGGG 132 58 1.5 This study NM_001205 E1B 19-kDa-interacting protein 1 R: CAATATAGAGGACTGTCGCAAGA C1QTNF2 C1q and tumor F: AGCTTTCTCGGTGGCAGTG 158 58 1.5 This study NM_031908 necrosis factor-related protein 2 R: GCGTGATGTCGTAGGTGAAGTAG C5orf7 Jumonji domain-containing 1B 14q21 F: TATGGCACATCTATGCAGCC 388 58 1.5 This study NM_016604 R: GAATTGGGTCATGATCAGGG CAMK4 Calcium/calmodulin-dependent 14q23–q24 F: CCCTTTCTCAGGGCAGAAG 199 58 2.0 [1] AF115747, NM_001744 –

protein kinase IV R: CCTTTGTGTGTCCAGCAATG AF115748 112 CANX Calnexin 14 R. Brandon personal communication 300 TD60 3.0 [1] NM_001746 CAST Calpastatin F: AAGACGGAAAGCCTGTGGA 566 58 1.5 This study NM_015576 R: TCACCAAGTTTCTCACGATCC CD14 CD14 antigen F: CTCAACTTGTCCTTCGCTGGG 132 58 1.5 This study BI961829, NM_000591 R: CAGATTACTCACCACGGGCAG AF200416 CD74 CD74 antigen F: GCACAGATTAACAACGCAGG 201 58 1.5 This study BI961752, NM_004355 R: GCAAATGTGTTGGACTTGGG AB032166 CGMP-a Similar to phosphodiesterase 6A, F: AGAGAAAAGAGAGTGTGG 211 58 1.5 B. Brenig, AY008801, NM_000440 cGMP-specific, rod, α R: GAATCTGCATTGTAACAAGG personal AY008799 commun. CHD1 Chromodomain helicase DNA F: GCAGATGGACCATAGAGCTT 135 58 1.5 This study NM_001270 binding protein 1 R: TCCGACTACTCCAGGTATGC CHSY2 Chondroitin synthase 2 14q22.1 F: GGAAATCCTCCCACTGATGA 112 58 1.5 This study HSA578034 R: CACCTGCACCTAGAAGATCA COR002 Microsatellite 14 F: CTTGAGCACCCAGTAACACC 224–232 58 2.0 [1] AF083445 R: CCAGGAATCTTCTCTACCGA COR103 Microsatellite 14q12–q13 F: GGGAGTGTGTCCAGTTTGTC 167–169 58 2.0 [1] R: CCABATAAAGCCCAAATCCT COR104 Microsatellite 14q12–q13 F: GGGAGTGTGTCCAGTTTGTC 177–178 58 2.0 [1] R: CCAGATAAAGCCCAAATCCT CRSP9 Cofactor required for Sp1 transcriptional 14q15 F: CATCCTATGCAGTTTGATCAC 400 58 1.5 This study NM_004270 activation, subunit 9, 33 kDa R: TCTGTCCAGTACAATTGTTGC

CSF1R Colony-stimulating factor 1 receptor, formerly 14 F: GAGTTTATGAAGGAGGTG 174 60 2.0 B. Brenig, AF115749 NM_005211 McDonough feline sarcoma viral (v-fms) R: GTGTGAGAGTGATGTTAG personal oncogene homolog commun., [52] CSF2 Colony-stimulating 14 F: CAGCATGTGGATGCCATC 927 60 1.5 [52] AF115750 NM_000758 factor 2 (granulocyte–macrophage) R: GTACAGCTTCAGGCGAGTCTG CSNK1G3 Casein kinase 1, ã3 F: GGCAACATATCTTCGTTATGTAA 998 TD60 1.5 This study NM_004384 R: CTGGTTTTTGGATTGTTGCA CSPG2 Chondroitin sulfate proteoglycan 2 14q26–q27 F: TTCGCTTACAAGAAAGGCCTGA 282 58 3.0 [1] NM_004385 (versican) R: CAGCATTCATACATGAACATTCAAAAC CYFIP2 Cytoplasmic FMR1-interacting protein 2 F: TCTCTGGCTATCTTCGCTACAG 156 58 1.5 This study NM_014376 R: ACATGGTGCAGTAGTGCCTG DMGDH Dimethylglycine dehydrogenase, 14q27 F: AGTACACTGAGGCCAAAGCAA 506 58 1.5 This study NM_013391 mitochondrial precursor R: AGAGCCCACTGACTCGTTGA DMXL1 Dmx-like 1 F: AGTAGCTTATAAGCAGCCTG 306 60 1.5 This study NM_005509

R: GATCCAATTCCTACAGTCAG 89 (2007) 89 Genomics / al. et Goh G. DPYSL3 Dihydropyrimidinase-like 3 14q15–q16 F: GTTTCCCAAGCCTTCTCCCTTA 114 TD60 4.0 [1] NM_001387 R: GCTACCACAGATCACAGGGAGATAG DTR Diphtheria toxin receptor (heparin-binding F: CCCAAGGTGCTGATGTCAAAG 235 58 1.5 This study BI961907 NM_001945 epidermal growth factor-like growth factor) R: GATTATCCTCTGCTGCGCTGA DUSP1 Dual-specificity F: CTGCGAACTGTCCCAACCAT 716 58 1.5 This study NM_004417 phosphatase 1 R: TTGGGGGAGATGATGCTTCT EBF Early B cell factor F: GAGGTTGGATTCTGCTACAGAG 173 58 1.5 This study NM_024007 R: TTAACCAACACCCTGCACTT ENTH Epsin 4 (epsin-related protein) (epsinR) F: ATGGCCCCTCTTGGAAAT 140 58 1.5 This study NM_014666 (enthoprotin) (clathrin-interacting protein R: GTTCCAGAAGTCATGGCTAAGT localized in the trans-Golgi region) (Clint) FBN2 Fibrillin 2 (congenital contractural F: CTAACCGAGGGGATGTTCTT 1003 55 1.5 This study NM_001999

arachnodactyly) R: CTTTCCTCCATGTCTAGAGCA – 112 FBXL17 F-box and leucine- 14q24 F: TTGGGCGATACAGCATGACA 119 58 1.5 This study NM_022824 rich repeat protein 17 R: CATCAGCCCCAAATATCTCAGA FEM1C Fem-1 homolog c F: TTCTTAAGCTGCATCCAAGG 292 58 1.5 This study NM_020177 (Caenorhabditis elegans) R: TCCAGCAAGTCACTAGCAGTT FGF18 Fibroblast growth F: GCAAGGAGTGTGTGTTCATC 159 58 1.5 This study NM_003862 factor 18 R: GCTTCATGAAATGCACGTCC FLJ21940 YTH domain-containing 2 F: GACAGAAGTGGCATAGCTTA 180 58 1.5 This study NM_022828 R: GCTCTTCTGAAGACATAGGC FLJ23654 SH3 domain-containing ring finger 2 F: CTCCGGGAAGCCTGAACAG 133 58 1.5 This study NM_152550 R: CCTCCGGAGGTCTGTCTGC FLJ36090 Hypothetical F: CCTTCAGAAATCCAGACAGAG 681 58 1.5 This study NM_153223 protein FLJ36090 R: CTTCTGCAAGAGCTTGCATA (continued on next page) 101 102

Table 2 (continued)

Marker Name Horse Primers (5′−3′) PCR Ta MgCl2 Accession Human locus product size (mM) No. Accession No. (A) FLJ39389 Hypothetical F: GGCCACGCGTCGACTAGTAC ∼400 58 1.5 This study BI395242 AK096708 protein FLJ39389 R: CTGTTTGAGCGGATGAAGGTGAA HEXB Hexosaminidase B (β polypeptide) 14q27 F: ACGCTGTGGCTTACCATTTT 137 TD60 3.0 [1] AF115752, NM_000521 R: TCATGAATGCTTCAGGTCTCC AF115753 HK3 Hexokinase 3 14q13 F: AGTGGGGCTCCTTCAGTGAT 656 58 1.5 This study NM_002115 (white cell) R: CACCAGCTCACCCAGGTACA HMB1 Microsatellite F: GTGTGTATGCTTCCCAACCCTT 118 58 2.0 This study Y07729 R: GTTATAAAGCACTATGATCTCA –

HMGCR 3-Hydroxy-3-methylglutaryl 14q27 F: TGTGGCCAGCACTAACAGAG 193 58 2.0 [1] AY008793 NM_000859 89 (2007) 89 Genomics / al. et Goh G. coenzyme A reductase R: CCACCAAGCTGCCAGAGTAT HMMR Hyaluronan-mediated motility receptor F: AAGTATTGAAAGGACCAGTATCC 890 50 1.5 This study NM_012484 R: CTTAACTTTTCTAGCTGAAGCAG HSD17B4 Hydroxysteroid (17β) dehydrogenase 4 F: TGGGTCTTCTGGGCCTTTCA 96 58 1.5 This study NM_000414 R: TCAACCGTGATCCAGCTTGA HSPA4 Heat shock 70-kDa protein 4, isoform b F: GAACAAGCAGAGTCTGACCA 458 58 1.5 This study NM_002154 (heat shock protein, 110 kDa) R: TCAGGAAGCTTCTTGTCTGA HTG29 Microsatellite 14 F: CTATTTCCAGTCTTTGTGTGT 110 58 3.0 [1] R: CCATAATAAAACATTAAAGATCAG HTR4 5-Hydroxytryptamine (serotonin) receptor 4 F: GAGCATGCCCACCAGATC 139 58 1.5 This study AY263357 NM_000870 R: AACCCATGATGATGCACAGG IL12B Interleukin 12B (natural killer cell stimulatory F: TCTTAGGCTCTGGCAAAACCT 114 58 1.5 This study NM_002187

factor 2, cytotoxic lymphocyte maturation R: TGTGAAGCAGCAGGTGAGAA – 112 factor 2, p40) IRF1 Interferon regulatory factor 1 F: GTGAATCCTGTTCCCAAAGA 236 58 1.5 This study BI961569 NM_002198 R: GCTTAGCGGAGACGTTAGTG KIAA0372 KIAA0372 protein F: ATTTGAAAGCTGGTCAGCAT 1077 58 1.5 This study NM_014639 R: CACTGTATATGGATTCTGGGTTC KIAA1281 KIAA1281 protein F: AAGGACCATCTCAGCAAGAAT 164 55 1.5 This study XM_114432 R: AAAGTGCTGCACTCCATCCT KIF3A Kinesin family 14q21 F: TTGCATATGGACAAACCGGA 358 58 1.5 This study NM_007054 member 3A R: AACCTTTGTGTCTGATCCTTGC KPNB2 Transportin 1 F: GCAACATTGAACAGCTGGTA 215 TD60 1.5 This study NM_002270 R: CATGCTGAAAGCAAGCTTTT LCP2 Lymphocyte cytosolic protein 2 (SH2 domain- F: CCTTGCCACTTCCAAACAAA 702 58 1.5 This study NM_005565 containing leukocyte protein of 76 kDa) R: TGGTCGGGTAATATAAGAAACG LEX043 Microsatellite 14q13–q14 F: CATTAAGCAACAAAAAGCATC 238–246 TD60 3.0 [1] AF075645 R: GGAAAAGCATGACAAGACACT LEX047 Microsatellite 14 F: TATAATAATGTGTCTTGGTGTG 237–245 58 3.0 [1] AF075649 R: TGTTAATCAGGGTTCTCC LEX078 Microsatellite 14q27 F: TGTGCGCATTTAACCACTGT 230 60 1.5 [1] AF213364 R: TTCATGCACTCCACTTCAGC LMAN2 Lectin, mannose-binding 2 F: ATGACACCTTCCTGGCTGTG 247 58 1.5 This study NM_006816 R: AGGCTCCAAAGTAGTAGCCG

LOC153195 40S ribosomal protein S14 F: CAGGTGGCTGAAGGAGAAAATG 856 65 1.5 This study BI961565 NM_005617 R: GAGTTTGATGTGGAGGGCAGTG LOC91137 Hypothetical protein LOC91137 F: TCATTACATCATCAGCTCAG 399 58 1.5 This study NM_138773 R: TTGGTAATCTGTAAAACAGC MASS1 Monogenic, audiogenic seizure F: TCAAAGCTAGTGATCATCCA 1205 58 1.5 This study NM_032119 susceptibility 1 homolog (mouse) R: GGACACTGTTCTAAATTCCG MAT2B DTDP-4-keto-6-deoxy-D-glucose 4-reductase 14q14 F: TTCATTGGTCTGGCAACGAA 663 58 1.5 This study NM_013283 R: TCAAGCTGAGCATTTCTTGGA MCCC2 Methylcrotonoyl–coenzyme A F: TAGGAAGGTTGTGAGGAATCTA 216 50 1.5 This study NM_022132 carboxylase 2 (β) R: GCACCAACTATTCCATACAAT MEF2C MADS box transcription enhancer factor 2, F: CCAACTTTGAGATGCCAGTCT 169 58 1.5 This study NM_002397 polypeptide C (myocyte enhancer factor 2C) R: TTACCTGCACTTGGAGGTCG MEGF10 MEGF10 protein F: CCATTGCAGGCATCATCATT 121 58 1.5 This study NM_032446 R: GCAGGGGTGTAGGTAACTGCT MFAP3 Microfibrillar- 14q16 F: AAACCATGGAGTTTGCTCGT 234 58 1.5 This study NM_005927

associated protein 3 R: CATCTGAATCTCCTCCTGGT 89 (2007) 89 Genomics / al. et Goh G. MGC33214 Hypothetical protein MGC33214 F: GTTTACTCTGAATTACCATCAGC 202 50 1.5 This study NM_153354 R: ATGCCACAGTCAGATACTGG MYOT Titin immunoglobulin domain protein F: ATGAAGCTGGAGTGACCACA 315 50 1.5 This study NM_006790 R: AAAGTTGGTCGGACACGTAA NR2F1 Nuclear receptor subfamily 2, F: CCTGTCCGGCTACATCTCG 373 62 1.5 This study NM_005654 group F, member 1 R: CTTCTCCACCTGCTCCTGG NR3C1 Nuclear receptor F: CCTTTCTGTGTGCACCTTACC ∼100 58 1.5 This study AY392091, NM_000176 subfamily 3, group C, member 1 R: TCCATCARCATTTCTTTGACC AY392092, (glucocorticoid AY394747 receptor) PAM Peptidylglycine F: TACCAAGAATGCCAGGTTCC ∼200 62 1.5 This study NM_000919 α-amidating R: CGTGATGGAAGAAGAGGACTG –

monooxygenase 112 PCSK1 Proprotein convertase subtilisin/kexin type 1 14q26 F: GGTTGTCTGGACCTCTGAGTAT 153 58 1.5 This study NM_000439 R: ACACTGCTCCAGGTCCTG PDE6A Phosphodiesterase 14 F: GGGCCAAGGTCATCTCAGAC 137 58 2.0 [1] AY008799 NM_000440 6A, cGMP-specific, R: AGCCTGCAGATTCTCCTGAA rod, α PPIC Peptidylprolyl F: TTGGAGACAAAGATGTTGGC 577 50 1.5 This study NM_000943 isomerase C R: CCTTGATGACACGATGAAACT (cyclophilin C) PPP2CA Serine/threonine R. Brandon, personal communication 340 58 3.0 This study NM_002715 protein phosphatase 2A, catalytic subunit, α isoform RARS Arginyl-tRNA 14q14 F: CCATAGTAAAATCAGATGGAGGT 111 58 1.5 This study NM_002887 synthetase R: CATTGTCCACAACATAGATAATCA RGNEF Rho-guanine F: TAATGCAAACAGAGATGCATC 156 50 1.5 This study XM_376405 nucleotide exchange R: AGAAGAAATGCCTGTGGATT factor (continued on next page) 103 104

Table 2 (continued)

Marker Name Horse Primers (5′−3′) PCR Ta MgCl2 Accession Human locus product size (mM) No. Accession No. (A) SEMA6A Semaphorin 6A1 F: TGGAGATGAACACATCGCGT 186 50 1.5 This study NM_020796 R: GCTCGGAGCGAACTGGTACA SIAT8D Sialyltransferase 8D (α-2, 8- 14q25 F: AGTTTGCTGCAGATGTGGGA 172 58 1.5 This study NM_005668 polysialyltransferase) R: CCTCCTTTGACCATGAAAGCA

SMAD5 SMAD, mothers 14q21 F: CATCTGTACTATGTTGGTGGA 214 58 1.5 This study NM_005903 against DPP homolog 5 (Drosophila) R: GCTCATATACTGCCTCAAAC α

SNCAIP Synuclein, - F: ACAGCTGATGCAGAGGTCAC 145 58 1.5 This study NM_005460 89 (2007) 89 Genomics / al. et Goh G. interacting protein R: GCTTTCTGCGCTGTCCATAC (synphilin) SOD2ps Equine pseudogene 14q22.3–q23 F: GACAAACCTGAGCCCCAAT 148 58 2.0 [1] AF130781 R: CTTATTGAAGCCGAGCCAAC SOX30 SRY (sex determining F: GTTTGGGCAAGGATCCAC 100 62 2.0 This study AY008814 NM_178424 region Y)-box 30 R: AGTTTGTTCCACTCTAACCCGA isoform a SPARC Secreted protein, 14q15–q16 F: ACCCACTAACGGTCCCATTT 199 58 2.0 [1] AF115756 NM_003118 acidic, cysteine rich R: CTGGCAGCCAATACCCTAAA (osteonectin) SV2C Synaptic vesicle F: CAAGACGGGATGTCAGATTACC 634 58 1.5 This study XM_043493 protein 2C R: GAAACAGCTGATCCCCGAA

TAF7 TAF7 RNA 14q21 F: AGATGCTTGTCTCCACAGTT 377 58 1.5 This study NM_005642 – 112 polymerase II, TATA box binding protein- R: CTCGTCATGTTCTAGTGAGTCA associated factor, 55 kDa THBS4 Thrombospondin 4 F: ACATCGACAGTTACCCCGAC 342 TD60 1.5 This study NM_003248 R: GCCATCTCTGTCTGCATCTTCT TKY435 Microsatellite F: GTTCGTCTGTTTCTAGCCTC 205 58.0 2.0 Tozaki AB103653 R: TATCTCCACATGGTACTCTC et al., unpublished TKY438 Microsatellite 14 F: TCCCGAGAAAGGTGTGAGAC 277–295 58 1.5 [22] AB103656 R: AAAACTGTCACAGGGCAGGT TKY440 Microsatellite 14 F: TTCCTATCTTCGAGGCCAGA 221–231 58 1.5 [22] AB103658 R: CTTGCCAACACCCATTCTCT TKY491 Microsatellite 14 F: CCTCTTGGGACAGAGGACAG 256–268 58 1.5 [22] AB103709 R: TCTCTCAGGAGCCTGTGTTG TKY527 Microsatellite F: AGGGGTGTCAAATGCAGTC 149 58.0 2.0 Tozaki AB103745 R: ACAATTCCTTTCACTGGGTG et al., unpublished TKY787 Microsatellite F: AAAACAGTCCCTACCTTGAG 234 58.0 2.0 Tozaki AB104005 R: TGTGTGTGATTTAGCTAGCA et al., unpublished TKY841 Microsatellite F: ATCACTGATAGTCACCAAAGTG 148 58.0 2.0 Tozaki AB104059 R: ATGTGGATTAAGATAGAGCTGC et al., unpublished

TKY930 Microsatellite 14 F: TTTGGACTTGCTTGGCCAG 147 58.0 2.0 [22] AB104148 R: AGAGAAGCAAAACCAGTAGG TKY948 Microsatellite F: GATCGTCCCTCCACCTTG 102 58.0 2.0 Tozaki AB104166 R: CCTGCCAAACATCAGTATTC et al., unpublished TKY971 Microsatellite F: GTCGACAGAGCCAGGAAG 86 58.0 2.0 Tozaki AB104189 R: GGGACTGTCATTTAACCCTC et al., unpublished TKY1053 Microsatellite 14 F: ATACTGGCTTTACGTCACAG 92 58 2.0 [22] AB104271 R: ATCACCACCAGAGTTAATGG TKY1145 Microsatellite F: TGGCATCCCACATAAAACAG 257 58.0 2.0 Tozaki AB104363 R: ACTGATTTGCACAGAAGGAG et al., unpublished TKY1151 Microsatellite F: TCACGCAATTCCAATCTTTGG 259 58.0 2.0 Tozaki AB104369 R: TGCCTACCAATTTGTAGGTG et al., unpublished 89 (2007) 89 Genomics / al. et Goh G. TRIM36 Tripartite motif-containing 36 F: AGAATATCGAAAGGGAGCTC 161 50 1.5 This study NM_018700 R: TTGATTGGAGTTGTCTGATC UBE2D2 Ubiquitin-conjugating enzyme E2D2 isoform 1 F: TTTCACCCTTACATCCAGATAGA 545 58 1.5 This study NM_003339 R: TGTGACAAGCCAATTCTCCA UM010 Microsatellite 14q14 F: TACAGCCATTGGAAATCTAC 110–120 58 3.0 [1] AF195129 R: CACCATTACATTTTCCCAG UM016 Microsatellite 14 F: TTCCTCCACTATCTCTCCCTC ∼200 58 2.0 This study AF195134 R: GCAAAAATGCACAGCCTC UM032 Microsatellite 14q15–q16 F: AAATGGTCAGCCTCTCCTC 141–149 58 2.0 [1] R: TGTCTCTCTAGTCCCACTCCTC UMNe125 Microsatellite 14 F: TGGGTCCTGAGACCATAAGC 143 58 1.5 [21] AY391297

R: TCCTCCCTACCTCCTCACTG – UMNe154 Microsatellite F: CAGCAATCAAATTGACCAGC 143 58 1.5 This study AF536266 112 R: TGGCTCCTCTCAAGTTGAGC UMNe187 Microsatellite 14 F: GCTCCCTCCGCACTACTTC 108 58 2.0 [23] AF536277 R: CTCCTATTCCAGACAGTGGAGG UMNe194 Microsatellite 14 F: ACTGGATGCCTGGAATTGAG 120 58 2.0 [23] AF536281 R: GAATAAGTTGGGACCCCTCC UMNe227 Microsatellite 14 F: ATAATTTCCCTTGCCAACACC 186 58 2.0 [21] AY391323 R: CTGTAGACCCAAAGGAAGATGG UMNe234 Microsatellite 14 F: TATGCACAATTAAAGGCCTGG 189 58 2.0 [23] AF536306 R: AATGACCCAGAGACAGGCTG UMNe239 Microsatellite 14 F: ATCAAAGGTTCATCAGTTGGTG 171 58 2.0 [23] AF536309 R: TTCTTTCACTCAGCGTGGTG UMNe315 Microsatellite F: CAGGCAATAAAAATCTCCAACC 129 58 2.0 This study R: TCACAGACGCTCCATAAACG UMNe321 Microsatellite F: ATCATATGGTATTTGTCTTCCTCTG 178 62 1.5 This study R: CTCAAAAAGATAAATGCACCCC (continued on next page) 105 106

Table 2 (continued)

Marker Name Horse Primers (5′−3′) PCR Ta MgCl2 Accession Human locus product size (mM) No. Accession No. (A) UMNe406 Microsatellite 14 F: GGCAACAGATGTTAGCTCAGG 96 55 2.0 [20] AY464480 R: ATGTGCTCTCGAGATGAAAATT UMNe460 Microsatellite 14 F: CCATCAGTGATGTTGCAAATG 153 62 1.5 [20] AY464489 R: AGTGTCCATCAATGGATGAATG UMNe474 Microsatellite 14 F: CCAAAGGGTGGAAATTGATG 217 58 1.5 [53] AY731399 R: TTTTGCCTCTCTCACCATCC UMNe489 Microsatellite 14 F: ACACAAACCTAGCACGACTCG 307 58 1.5 [20] AY464502 R: TTGTTATAGCAGCCCAAATGG UMNe550 Microsatellite 14 F: GAGTATCACTGCTCCCAGGC 122 58 1.5 [53] AY731412

R: TTTTGGGGACTGTCATTTAACC 89 (2007) 89 Genomics / al. et Goh G. UMNe581 Microsatellite 14 F: TCATCAAGCCATGTTTTAGTGG 199 58 1.5 [19] AY735281 R: TTGCTGACAGTCAGGGTGAG UMNe584 Microsatellite 14 F: AAATTTGTCCCATGTAATTCCC 119 58 1.5 [19] AY735283 R: TCACTGTTGGGAAAGGAACC VHL162 Microsatellite F: GCTACTCTTTTACTCCTACTGC ∼100 1.5 62.0 This study R: CTCTCGATGTAAGTGCTTGTGC VHL204 Microsatellite 14 F: ACTGAAGTTGAGAATCATTAATGG ∼100 1.5 62.0 [2] R: ACTTCCTCGACATCCTTCCCT VHL209 Microsatellite 14 F: TCTTACATCCTTCCATTACAACTA 84–98 TD60 3.0 [1] Y08451 R: TGATACATATGTACGTGAAAGGAT ZFYVE16 Zinc finger FYVE domain-containing protein F: TAACAAGTATCAGAGGCCGA 819 55 1.5 This study NM_014733 16 (endofin) (endosome-associated FYVE R: CCCATTTCCATATGAATCAAC

domain protein) – 112 YIPF5 Yip1 domain family, member 5 14q21 F: GGAATCATTCTCACTGCTGG 139 58 1.5 This study NM_030799 R: TTAGGGCAAAGACTCCGTAT

(B) ADAMTS6 A disintegrin-like and metalloprotease 21q14 F: GCCTAGGAAATTTGATGTTGCT 635 58 1.5 This study NM_014273 (reprolysin type) with thrombospondin type R: AGCACAAGTAGCTGAGCATTCT 1 motif, 6 ADCY2 Adenylate cyclase 2 (brain) F: GAAGACCACGTGGCATTTTT 166 58 1.5 This study NM_020546 R: CGAAACACATGAACAAGTAGCC AHT078 Microsatellite 21 F: CCTCTCGCAGAAGCACAAAT 191–195 58 2.0 [1] AJ507695 R: GCTCCCTGCTGACTTCTGAG AKAP8 A kinase (PRKA) anchor protein 8 21q12 F: ACCAGCGTTTGGACATGATG 710 58 1.5 This study BI774186 NM_005858 R: ATAGTCGTAGCTGTAGCTGG BASP1 Brain-abundant, member attached signal 21q18 F: GGGTCCTGGATTTTAAAGATCAATG 302 58 3.0 [1] NM_006317 protein 1 R: TGGCATCGAGATACATGTGGATAG BRIX Ribosome biogenesis protein Brix F: AAGAAGATGCTGCTCTGGTA 403 58 1.5 This study NM_018321 R: CAGCTGTGATGGATCTTATG C1QTNF3 C1q and tumor necrosis factor-related protein 3 F: CAACCATGCAGTGCTGAAGC 115 58 1.5 This study NM_181435 R: GAAGAGCAGGAAGCCTGCAA C6 Complement F: CTAATAATGGCCGCCCCAC 1035 58 1.5 This study NM_000065 component 6 R: GGCTCCAGGAAGACCAACAA

C9 Complement 21q17 F: GTTGCTCGTTGTGGGTTTCT 196 58 2.0 [1] AF115746 NM_001737 component 9 R: CGCAAATTTTCTCCCTCTTTC CCNB1 Cyclin B1 21q13-q14 F: CAAAATACCTACTGGGTCGG 704 58 1.5 This study NM_031966 R: AATTTCTGGAGGGTACATTTCT CDH12 Cadherin 12, type 2 F: ATCAAAGGCTACAAGAAAATGATATG 196 50 1.5 This study NM_004061 (N-cadherin 2) R: CCAAACATGTCTGCCAAGACT CDH9 Cadherin 9, type 2 (T1-cadherin) F: GGATAGTGAGTCTGACACAAG 98 55 2.0 This study NM_016279 R: ACCTGTATACTCTTCCAACAAG CKN1 Cockayne syndrome WD-repeat protein CSA F: ATAGTCATCATATGTCTCCGGT 1150 58 1.5 This study NM_000082 (DNA excision repair protein ERCC-8) R: GTTGTACTTTGGGTCCTCTAGTA COMP Cartilage oligomeric matrix protein F: TCGTGCAAACAATGAACAGC 570 60 1.5 This study AF325902, NM_000095 R: TCCACATGACCACGTAGAAG AB040453 COR068 Microsatellite 21 F: AACCAATTGTGAGATTTTTGCT 144–156 58 2.0 [1] AF142605 R: GGCTAGTCCTGGATCATGTG COR073 Microsatellite 21 F: GCCAAGACATGGAAACAATC 180–198 58 2.0 [1] AF142610 R: GTTCTCAAGGTGCATCCCTA .Ghe l eois8 20)89 (2007) 89 Genomics / al. et Goh G. DAB2 Disabled homolog 2, mitogen-responsive F: ATCCTTTCCGTGACGATCCT 412 58 1.5 This study NM_001343 phosphoprotein (Drosophila) R: ATGGCTATGGAGTCATGTGG CTLA3 Granzyme A (granzyme 1, cytotoxic 21q14-q15 F1: CTGGCCACCTACATGGAAAC 204 58 2.0 [1] AF115751 NM_006144 T-lymphocyte-associated serine esterase 3) R1: GGAGACGAAGGATAGCCACA DDX4 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 F: ATGTTCATCGAATTGGGCGT 291 58 1.5 This study NM_019039 R: TTTCTTCCAACCATGCAGGA DNAH5 Dynein, axonemal, heavy polypeptide 5 21q18 F: AATGACCGACCTCACTGCTT 527 58 1.5 This study NM_001369 R: CCATATTGTCCAGAGCCCAG EDG4 Endothelial differentiation, lysophosphatidic F: CTCTTCCTCATGTTCCACACA 365 58 1.5 This study NM_004720 acid G-protein-coupled receptor, 4 R: ACAGCCACCATGAGCAGGAA ERBB2IP v-erb-b2 erythroblastic leukemia viral oncogene F: CCACAGTCTGCACCTCAAATA 164 58 1.5 This study NM_018695 homolog 2, neuro/glioblastoma-derived R: TGATTTTCTGTGCTCTCTGATCTAG

oncogene homolog (avian)-interacting protein – FBXL7 F-box and leucine-rich repeat protein 7 F: CCAAGTACTGCGGCAAGCTG 199 58 1.5 This study NM_012304 112 R: CAAGACTTGAGGCTGAGGCG FBXO4 F-box protein 4 F: CCGTCCTATGTATGGAGCTGTC 176 58 1.5 This study NM_012176 R: CATCAATCTGCCTCTGAGGC FKBP8 FK506 binding protein 8, 38 kDa F: AACTCCTACGACCTCGCCAT 642 60 1.5 This study NM_012181 R: GCCTTGATGTTGTCAGGCTG FLJ11193 Hypothetical protein F: TATACCGGGCCATAGGCTCA 109 55 1.5 This study NM_018356 FLJ11193 R: ACGGTGTCTGCTGGCATATT FLJ13611 Hypothetical protein F: GCAGGCATCATTAAGGGAGTA 1309 58 1.5 This study NM_024941 FLJ13611 R: CAGTATCTGGGATTGCCTCC FLJ14054 Hypothetical protein 21 F: GGGAGAAATTTGAATCAGCAG 103 50 4.0 [1] NM_024563 FLJ14054 R: GCCCTTTATTCCTTGTGCATA (continued on next page) 107 108

Table 2 (continued)

Marker Name Horse Primers (5′−3′) PCR Ta MgCl2 Accession Human locus product size (mM) No. Accession No. (B) FLJ21308 Hypothetical protein F: TCCTGCAAAGCCGTAACTTA 998 58 1.5 This study NM_024615 FLJ21308 R: TCTTGTGCAGACATGATCAGTA FLJ35954 Hypothetical protein F: TAACTTCTAACCGGCCTGAG 253 58 1.5 This study NM_152622 FLJ35954 R: GGAGGAAAGCTATCATCCAA FLJ39155 Hypothetical protein F: TCGCTCTGCACACTAACAGG 146 58 1.5 This study NM_152403 FLJ39155 R: CTGGTGTTACTTGGCTCCG FST Follistatin 21q16 F: TGCCCTGACAGTAAGTCTGAG 124 58 1.5 This study NM_006350 R: ATCCGGAATGCTTTACTTCC GDF1 Growth differentiation F: CTCAAGGTCCTGTATGCCA 124 58 1.5 This study NM_001492 factor 1 R: TGTACAGGAACCAGTAGAGG GDNF Glial-cell-derived F: TTTTCAGGTACTGCAGCGGC 141 55 1.5 This study NM_000514 89 (2007) 89 Genomics / al. et Goh G. neurotrophic factor R: GGTCGTCATCAAAGGCGATG GHR Growth hormone 21q16 F: TTGGCCTCAACTGGACTCTA 114 58 2.0 [1] AF097588, NM_000163 receptor R: CCAGGACTATCCACCCCTTC AF392878 GMIP Gem-interacting protein 21q13-q14 F: GTTATCCGCTCGCTGAAGA 460 58 1.5 This study NM_016573 R: ACAATGCCCAGGTTGTTGG GZMA Granzyme A precursor 21q14-q15 F2: ATGTGGCTATCCTTCGTCTC 402 58 1.5 [1] AF115751 NM_006144 R2: TTCCGGCACAAATCATATTC HCN1 Hyperpolarization-activated cyclic F: GATACAGTTTTCCTATTGGACCTG 146 58 1.5 This study NM_021072 nucleotide-gated potassium R: GGGATGGATGAGATGAAGTCA channel 1 HSA9761 Dimethyaldenosine transferase 21q13 F: CTTGACTTGAGTTTGAAACATTC ∼250 55 1.5 [33] AW735741 R: CTTGAATGACTAGTGTTAGGAG – HMGCS1 3-Hydroxy-3-methylglutaryl-coenzyme 21 F: ACTGGGCACGGATCTTTTT 147 65 2.0 [1] NM_002130 112 A synthase 1 R: GGACACATATGCAACATGCCT HSPB3 Heat shock 27-kDa F: AGTTTCAAGCTCGCGGTTTG 298 58 1.5 This study AJ550777 NM_006308 protein 3 R: TACTGTCGGGTGAAGCTTCTTG HTG10 Microsatellite 21q14 F: CAATTCCCGCCCCACCCCCGGCA 93 TD60 1.5 [1] AF169294 R: TTTTTATTCTGATCTGTCACATTT HTG32 Microsatellite 21 F: CCTGAAACCTCAGTAAACAGA 150–160 58 2.0 [1] R: TGTGGCTTTGGTGTGGAAAC IL7R Interleukin 7 receptor 21q17 F: TGGAGTGAATGGAGTCCAAGT 150 58 2.0 [1] AF115754, NM_002185 R: TATAGCCACACCACCCTGGA AF115755 JUND Jun D proto-oncogene F: ATCGACATGGACACTCAGGAG 210 58 1.5 This study NM_005354 R: GCTGAGGACCTTCTGCTTGA KIF2 Kinesin heavy chain F: AGGTTCAAGTGGTGGGATTA 548 50 1.5 This study NM_004520 member 2 R: CATGTAGTTTTCCTTTCCTTCTA KLF2 Kruppel-like factor 2 F: AGAAGCCCTACCACTGCAAC 173 58 1.5 This study NM_004831 (lung) R: CTACATGTGCCGCTTCATG LEX031 Microsatellite 21 F: CCCATTAAGAACTTTTCATCCTG 252–256 58 2.0 [1] AF075633 R: GGCAAGCCCCACAAAATTAT LEX037 Microsatellite 21 F: GGATTCCTCAACCTCCTAAA 189–197 58 3.0 [1] AF075639 R: AGGGATAAGTGACCACCAC LEX060 Microsatellite 21 F: TTGCAGAAGGAGCCAATC 145–161 58 3.0 [1] AF075667, R: AAGGCATTCGGAAATCTAAAT AF075666, AH006315 LOC134146 Hypothetical gene F: CGTGACAATCGTGTGGTG v ∼800 55 1.5 This study LOC375449 Similar to microtubule-associated testis-specific F: CTTGACCACATATTATCCCC 120 58 1.5 This study NM_198828 serine/threonine R: CTGTCTTCCATCCTCACTC protein kinase LSM4 LSM4 homolog, U6 small nuclear RNA 21 F: GGATGCCCGAGTGCTACATT 140 50 4.0 This study NM_012321 associated (Saccharomyces cerevisiae) R: GCCCTTCTGCTGCTTCTGCT MYO10 Myosin X F: GCCATCAAGATATTCAACTCCCT 136 55 1.5 This study NM_012334 R: TCTGCTTGATGAGCTGGCAG NNT Nicotinamide nucleotide transhydrogenase F: ATTTAGCTGCTGAGGCTGGC 423 58 1.5 This study NM_182977 R: TGTTGGAATACAGGGTGCTG NPR3 Natriuretic peptide receptor C/guanylate 21q17 F: AGATGATGCTCGCCCTGTTC 132 55 1.5 This study NM_000908 cyclase C (atrionatriuretic peptide receptor C) R: GCAAGCCTTCCTCCTGGAAG OSRF Osmosis-responsive factor F: TTTCAAGTAGCCCTTCACATC 198 58 1.5 This study NM_012382 R: ACAAACAGCAACAATCTCATCA PDE4D cAMP-specific 21q14 F: TGTTTGTCTGTTTACAACCA 209 58 1.5 This study NM_006203 phosphodiesterase 4D R: AAACAAGCTCTAAGGTGACA .Ghe l eois8 20)89 (2007) 89 Genomics / al. et Goh G. PELO Pelota homolog F: TGGTTATGCAGGAAGGCCTC 241 58 1.5 This study NM_015946 (Drosophila) R: TAGTCGCAGAACTGCTCCCT PIK3R2 Phosphoinositide-3-kinase, regulatory F: AGGGAGAGTACACGCTGAC 656 58 1.5 This study NM_005027 subunit 2 (p85 β) R: TTGGACACTGGGTAGAGGAG PLK2 Polo-like kinase 2 F: TGTGGTACCCCAAATTATCTTTCTC 762 58 1.5 This study R: TGTCATCCAAACTGGGACGA POLS Polymerase F: CGACATCAGCTTTAACATGGA 1216 58 1.5 This study NM_006999 (DNA-directed) σ R: GCAGGAGGAACTGTTTCAGT PRLR Prolactin receptor F: ATGTCCAGACTACAAAACCG 170 55 1.5 This study NM_000949 R: ACATAAAGTGGATCCGAGGA RFXANK Regulatory factor X-associated F: TGTCCATCCACCAGCTTGCA 300 58 1.5 This study NM_003721 ankyrin-containing protein R: GGCTTGTTGATGAGGTTGT

SDHA Succinate dehydrogenase complex, subunit A, 21q19 F: CACTACATGACAGAGCAGGCC 445 58 1.5 This study NM_004168 – flavoprotein (Fp) R: ACCAAAGGCACGCTGGTAG 112 SEMA5A Sema domain, seven thrombospondin repeats F: AACCTGACGGAGATCCATGAC 197 58 1.5 This study NM_003966 (type 1 and type 1-like), transmembrane domain R: TTGGAGTTGTACTGTGCGGTG and short cytoplasmic domain (semaphorin) 5A SGCV14 Microsatellite 21q13 F: CCCCAGTGGTTCCATTTAGATGT 188 58 3.0 [1] U90593 R: GGGGAGAGCATTTTGGTGA SGCV16 Microsatellite 21q13 F: AATTCTCAAATGGTTCAGTGA 190 58 2.0 [1] U90594 R: CTCCCTCCCTTCCTTCTA SKP2 S-phase kinase-associated protein 2 (F-box F: CCGACCAGAGTAGCAACGTT 198 58 1.5 This study NM_005983 protein Skp2) (cyclin R: CATTCCCTTTGCTCTTCAGC A/CDK2-associated protein p45) (p45skp2) (F-box/LRR-repeat protein 1) SLC27A1 Solute carrier family 27 (fatty acid 21q13-q14 F: TTCAACAGCCGCATCCTGC 305 60 1.5 This study NM_198580 transporter), member 1 R: CTGTGGGCGATCTTCTTGCT (continued on next page) 109 110

Table 2 (continued)

Marker Name Horse Primers (5′−3′) PCR Ta MgCl2 Accession Human locus product size (mM) No. Accession No. (B) TARS Threonyl-tRNA F: ACCACCAGTGTGCAACAATAC 284 58 1.5 This study NM_152295 synthetase R: ACCCCAAGATGGCTCTATGG TKY021 Microsatellite 21q13 F: AGGTGAACCCCAGAGAGTCC 117–132 58 2.0 [1] AB048331 R: AGTGAGGCCTCGGTTGGGAG TKY280 Microsatellite 21 F: GAGGAGACCAAAATAACAGG 309–321 58 3.0 [1] AB033931 R: ACTCCCTGCTTTGCACTCTG TKY677 Microsatellite F: ATGGAAATTGCCTGATTGGA 116 58.0 2.0 Tozaki AB103895 R: AAAGGAAGATTGGCAACAGA et al., unpublished TKY678 Microsatellite F: TAAAAGAAGGGGGTAATGGG 207 58.0 2.0 Tozaki AB103896 R: TGTGGTGCTTGTTCCAGCA et al., .Ghe l eois8 20)89 (2007) 89 Genomics / al. et Goh G. unpublished TKY806 Microsatellite 21 F: TGGAACTGTGATGATGTTGC 180 58.0 2.0 [22] AB104024 R: TCTTTCTTCCCTTCCGAGAG TKY824 Microsatellite F: AATGGTATTTGCAATAGATTTGGG 161 58.0 2.0 Tozaki AB104042 R: GCAGAAAACAGTTTGATAAAATGC et al., unpublished TKY1018 Microsatellite F: TCAAAAAGGCAGAAAGGGTC 175 58.0 2.0 Tozaki AB104236 R: TCTTGTTCATGCAGCTCTAC et al., unpublished TRIO Triple functional domain (PTPRF interacting) F: GTCCAACTCAACACGACCTACC 181 58 1.5 This study NM_007118 R: AGGTCTCTTCCACGCTGTCG UBA52 Ubiquitin and ribosomal protein L40 precursor F: GCAGACATGCAGATCTTTGTG 108 60 1.5 This study CD536556 NM_003333

R: CTCCTTGTCTTGGATTTTAGC – UMNe139 Microsatellite 21 F: AGACACAGGTTTAGGTGGATGC 100 58 1.5 [21] AY391300 112 R: GATCAAGCACATAAGGGACAC UMNe147 Microsatellite 21 F: CAGACCTACTCCAGTCATCAGC 180 58 1.5 [21] AY391302 R: AAACAAAGAGACTTGAAGTGGC UMNe206 Microsatellite 21 F: GATCAAGCACATAAGGGACAC 154 58 2.0 [23] AF536289 R: CATATCCATAGCTTTTTGACCC UMNe229 Microsatellite 21 F: CTTCTCTGGACAAAGGGGTG 123 58 2.0 [23] AF536303 R: CATGAATTTGCCAGTTTGATG UMNe327 Microsatellite 21 F: TTTTCCTTCCTCATTGGTGC 157 58 2.0 [21] AY391339 R: GAAATGCAGGGCTAAGGATG UMNe464 Microsatellite 21 F: GTTCCATTTGCGAAAATTTAGC 272 58 2.0 [20] AY464492 R: CGTTTGCTTCTAAGCCGTTC UMNe509 Microsatellite 21 F: GGGCATTCTCAATCTTTAGGC 181 58 2.0 [20] AY464511 R: GAGGATGCAAAGGAATAAGGC UMNe564 Microsatellite 21 F: GAATACAGGGGCTTTTTCTGC 223 58 2.0 [20] AY464530 R: TTCTGCATCTTGATTGCAGTG UMNe603 Microsatellite F: TTGTCCTGAGTGTTCATTCCC 186 58 2.0 This study R: AAGCTGCAAAAAGATAGATGCC XTP1 HBxAg-transactivated protein 1 F: TGGATATCACTTTATCTGCTCCA 136 50 1.5 This study NM_018369 R: TTGGAGAGTTTGGCATCTGT G. Goh et al. / Genomics 89 (2007) 89–112 111

Acknowledgments Mickelson, A 1.3-Mb interval map of equine homologs of HSA2, Cytogenet. Genome Res. 112 (2006) 227–234. [10] J. Schmutz, J. Martin, A. Terry, O. Couronne, J. Grimwood, S. Lowry, L.A. This project was funded by grants from the Texas Higher Gordon, D. Scott, G. Xie, W. Huang, U. Hellsten, M. Tran-Gyamfi, X. She, Education Board (ATP 000517-0306-2003 to B.P.C.), S. Prabhakar, A. Aerts, M. Altherr, E. Bajorek, S. Black, E. Branscomb, C. NRICGP/USDA Grant 2003-03687 (B.P.C.), the Texas Equine Caoile, J.F. Challacombe, Y.M. Chan, M. Denys, J.C. Detter, J. Escobar, D. Research Foundation (B.P.C.), the Link Endowment (B.P.C.), Flowers, D. Fotopulos, T. Glavina, M. Gomez, E. Gonzales, D. Goodstein, and the Dorothy Russell Havemeyer Foundation. Additional I. Grigoriev, M. Groza, N. Hammon, T. Hawkins, L. Haydu, S. Israni, J. Jett, K. Kadner, H. Kimball, A. Kobayashi, F. Lopez, Y. Lou, D. Martinez, support was available from the USDA-NRSP-8 Coordinators C. Medina, J. Morgan, R. Nandkeshwar, J.P. Noonan, S. Pitluck, M. Fund and the Intramural Research Program of the NIH, NLM Pollard, P. Predki, J. Priest, L. Ramirez, J. Retterer, A. Rodriguez, S. (A.A.S., R.A.). Rogers, A. Salamov, A. Salazar, N. Thayer, H. Tice, M. Tsai, A. Ustaszewska, N. Vo, J. Wheeler, K. Wu, J. Yang, M. Dickson, J.-F. Cheng, Appendix A. Supplementary data E.E. Eichler, A. Olsen, L.A. Pennacchio, D.S. Rokhsar, P. Richardson, S.M. Lucas, R.M. Myers, E.M. Rubin, The DNA sequence and comparative analysis of human chromosome 5, Nature 431 (2004) Supplementary data associated with this article can be found, 268–274. in the online version, at doi:10.1016/j.ygeno.2006.06.012. [11] T. Raudsepp, L. Frönicke, H. Scherthan, I. Gustavsson, B.P. Chowdhary, Zoo-FISH delineates conserved chromosomal segments in horse and man, Chromosome Res. 4 (1996) 218–225. References [12] R. Chaudhary, T. Raudsepp, X.Y. Guan, H. Zhang, B.P. Chowdhary, Zoo- FISH with microdissected arm specific paints for HSA2, 5, 6, 16, and 19 [1] B.P. Chowdhary, T. Raudsepp, S.R. Kata, G. Goh, L.V. Millon, V. Allan, F. refines known homology with pig and horse chromosomes, Mamm. Piumi, G. Guérin, J. Swinburne, M. Binns, T.L. Lear, J. Mickelson, J. Genome 9 (1998) 44–49. Murray, D.F. Antczak, J.E. Womack, L.C. Skow, The first-generation [13] B.P. Chowdhary, T. Raudsepp, L. Frönicke, H. Scherthan, Emerging whole-genome radiation hybrid map in the horse identifies conserved patterns of comparative genome organization in some mammalian species segments in human and mouse genomes, Genome Res. 13 (2003) as revealed by Zoo-FISH, Genome Res. 8 (1998) 577–589. 742–751. [14] F. Yang, B. Fu, P.C.M. O’Brien, W. Nie, O.A. Ryder, M.A. Ferguson- [2] G. Guérin, E. Bailey, D. Bernoco, I. Anderson, D.F. Antczak, K. Bell, I. Smith, Refined genome-wide comparative map of the domestic horse, Biros, G. Bjornstad, A.T. Bowling, R. Brandon, A.R. Caetano, G. donkey and human based on cross-species chromosome painting: insight Cholewinski, D. Colling, M. Eggleston, N. Ellis, J. Flynn, B. Gralak, T. into the occasional fertility of mules, Chromosome Res. 12 (2004) Hasegawa, M. Ketchum, G. Lindgren, L.A. Lyons, L.V. Millon, D. Mariat, 65–76. J. Murray, A. Neau, K. Roed, K. Sandberg, L.C. Skow, I. Tammen, T. [15] Z. Jiang, C. Priat, F. Galibert, Traced orthologous amplified sequence tags Tozaki, E. Van Dyk, B. Weiss, A. Young, J. Ziegle, The second generation (TOASTs) and mammalian comparative maps, Mamm. Genome 9 (1998) of the International Equine Gene Mapping Workshop half-sibling linkage 577–587. map, Anim. Genet. 34 (2003) 161–168. [16] Z. Jiang, C. Renier, C. André, F. Galibert, RH mapping of canine TOAST [3] M.C.T. Penedo, L.V. Millon, D. Bernoco, E. Bailey, M. Binns, G. markers: a new strategy for species-specific primer design to prevent Cholewinski, N. Ellis, J. Flynn, B. Gralak, A. Guthrie, T. Hasegawa, G. amplification of host orthologous gene products especially with similar Lindgren, L.A. Lyons, K.H. Roed, J.E. Swinburne, T. Tozaki, International sizes, Mamm. Genome 12 (2001) 799–801. Equine Gene Mapping Workshop Report: a comprehensive linkage map [17] E.-J. Lee, T. Raudsepp, S.R. Kata, D. Adelson, J.E. Womack, L.C. Skow, constructed with data from new markers and by merging four mapping B.P. Chowdhary, A 1.4-Mb interval RH map of horse chromosome 17 resources, Cytogenet. Genome Res. 111 (2005) 5–15. provides detailed comparison with human and mouse homologues, [4] M. Perrocheau, V. Boutreux, S. Chadi, X. Mata, P. Decaunes, T. Raudsepp, Genomics 83 (2004) 203–215. K. Durkin, D. Incarnato, L. Iannuzzi, T.L. Lear, K. Hirota, T. Hasegawa, B. [18] S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, Zhu, P. de Jong, E.P. Cribiu, B.P. Chowdhary, G. Guérin, Construction of a D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of medium-density horse gene map, Anim. Genet. 37 (2006) 145–155. protein database search programs, Nucleic Acids Res. 25 (1997) [5] J.E. Swinburne, M. Boursnell, G. Hill, L. Pettitt, T. Allen, B. 3389–3402. Chowdhary, T. Hasegawa, M. Kurosawa, T. Leeb, S. Mashima, J.R. [19] M.L. Wagner, G. Goh, J.T. Wu, L.Y. Morrison, L.J. Alexander, T. Mickelson, T. Raudsepp, T. Tozaki, M. Binns, Single linkage group per Raudsepp, L.C. Skow, B.P. Chowdhary, J.R. Mickelson, Sixty-seven new chromosome genetic linkage map for the horse, based on two three- equine microsatellite loci assigned to the equine radiation hybrid map, generation, full-sibling, crossbred horse reference families, Genomics 87 Anim. Genet. 35 (2004) 484–486. (2006) 1–29. [20] M.L. Wagner, G. Goh, J.T. Wu, T. Raudsepp, L.Y. Morrison, L.J. [6] T. Raudsepp, E.-J. Lee, S.R. Kata, C. Brinkmeyer, J.R. Mickelson, L.C. Alexander, L.C. Skow, B.P. Chowdhary, J.R. Mickelson, Radiation hybrid Skow, J.E. Womack, B.P. Chowdhary, Exceptional conservation of horse– mapping of 63 previously unreported equine microsatellite loci, Anim. human gene order on X chromosome revealed by high-resolution Genet. 35 (2004) 159–162. radiation hybrid mapping, Proc. Natl. Acad. Sci. USA 101 (2004) [21] M.L. Wagner, G. Goh, J.T. Wu, T. Raudsepp, L.Y. Morrison, L.J. 2386–2391. Alexander, L.S. Skow, B.P. Chowdhary, J.R. Mickelson, Radiation hybrid [7] C. Brinkmeyer-Langford, T. Raudsepp, E.-J. Lee, G. Goh, A.A. Schäffer, mapping of 75 previously unreported equine microsatellite loci, Anim. R. Agarwala, M.L. Wagner, T. Tozaki, L.C. Skow, J.E. Womack, J.R. Genet. 35 (2004) 68–71. Mickelson, B.P. Chowdhary, A high-resolution physical map of equine [22] T. Tozaki, M.C. Penedo, R.P. Oliveira, J.P. Katz, L.V. Millon, T. Ward, homologs of HSA19 shows divergent evolution compared with other D.C. Pettigrew, L.S. Brault, M. Tomita, M. Kurosawa, T. Hasegawa, K. mammals, Mamm. Genome 16 (2005) 631–649. Hirota, Isolation, characterization and chromosome assignment of 341 [8] A. Gustafson-Seabury, T. Raudsepp, G. Goh, S.R. Kata, M.L. Wagner, T. newly isolated equine microsatellite markers, Anim. Genet. 35 (2004) Tozaki, J.R. Mickelson, J.E. Womack, L.C. Skow, B.P. Chowdhary, High- 487–496. resolution RH map of horse chromosome 22 reveals a putative ancestral [23] J.R. Mickelson, J.T. Wu, L.Y. Morrison, J.E. Swinburne, M.M. Binns, vertebrate chromosome, Genomics 85 (2005) 188–200. K.M. Reed, L.J. Alexander, Eighty-three previously unreported equine [9] M.L. Wagner, T. Raudsepp, G. Goh, R. Agarwala, A.A. Schäffer, P.K. microsatellite loci, Anim. Genet. 34 (2003) 71–74. Dranchak, C. Brinkmeyer-Langford, L.C. Skow, B.P. Chowdhary, J.R. [24] B.P. Chowdhary, T. Raudsepp, D. Honeycutt, E.K. Owens, F. Piumi, G. 112 G. Goh et al. / Genomics 89 (2007) 89–112

Guérin, T.C. Matise, S.R. Kata, J.E. Womack, L.C. Skow, Construction of FISH and alignments of human and mouse draft genome sequences, a 5000rad whole-genome radiation hybrid panel in the horse and Cytogenet. Genome Res. 108 (2005) 122–138. generation of a comprehensive and comparative map for ECA11, [40] W.J. Murphy, R. Stanyon, S.J. O’Brien, Evolution of mammalian genome Mamm. Genome 13 (2002) 89–94. organization inferred from comparative gene mapping, Genome Biol. 2 [25] R. Agarwala, D.L. Applegate, D. Maglott, G.D. Schuler, A.A. Schäffer, A (2001) Reviews0005.1–0005.8. fast and scalable radiation hybrid map construction and integration [41] L. Frönicke, J. Wienberg, G. Stone, L. Adams, R. Stanyon, Towards the strategy, Genome Res. 10 (2000) 350–364. delineation of the ancestral eutherian genome organization: comparative [26] D.L. Applegate, R. Bixby, V. Chvátal, W. Cook, On the solution of genome maps of human and the African elephant (Loxodonta africana) traveling salesman problems, Doc. Math. J. in Int. Congr. Math III Suppl. generated by chromosome painting, Proc. Biol. Sci. 270 (2003) (1998) 645–656. 1331–1340. [27] A. Everts-van der Wind, D.M. Larkin, C.A. Green, J.S. Elliott, C.A. [42] F. Richard, M. Lombard, B. Dutrillaux, Reconstruction of the ancestral Olmstead, R. Chiu, J.E. Schein, M.A. Marra, J.E. Womack, H.A. Lewin, A karyotype of eutherian mammals, Chromosome Res. 11 (2003) 605–618. high-resolution whole-genome cattle–human comparative map reveals [43] F. Yang, E.Z. Alkalaeva, P.L. Perelman, A.T. Pardini, W.R. Harrison, details of mammalian chromosome evolution, Proc. Natl. Acad. Sci. USA P.C.M. O’Brien, B. Fu, A.S. Graphodatsky, M.A. Ferguson-Smith, T.J. 102 (2005) 18526–18531. Robinson, Reciprocal chromosome painting among human, aardvark, and [28] S.N. Meyers, M.B. Rogatcheva, D.M. Larkin, M. Yerle, D. Milan, R.J. elephant (superorder Afrotheria) reveals the likely eutherian ancestral Hawken, L.B. Schook, J.E. Beever, Piggy-BACing the human genome: II. karyotype, Proc. Natl. Acad. Sci. USA 100 (2003) 1062–1066. A high-resolution, physically anchored, comparative map of the porcine [44] M. Svartman, G. Stone, J.E. Page, R. Stanyon, A chromosome painting test autosomes, Genomics 86 (2005) 739–752. of the basal eutherian karyotype, Chromosome Res. 12 (2004) 45–53. [29] A. Everts-van der Wind, S.R. Kata, M.R. Band, M. Rebeiz, D.M. Larkin, [45] J. Ye, L. Biltueva, L. Huang, W. Nie, J. Wang, M. Jing, W. Su, N.V. R.E. Everts, C.A. Green, L. Liu, S. Natarajan, T. Goldammer, J.H. Lee, S. Vorobieva, X. Jiang, A.S. Graphodatsky, F. Yang, Cross-species chromo- McKay, J.E. Womack, H.A. Lewin, A 1463 gene cattle–human some painting unveils cytogenetic signatures for the Eulipotyphla and comparative map with anchor points defined by human genome sequence evidence for the polyphyly of Insectivora, Chromosome Res. 14 (2006) coordinates, Genome Res. 14 (2004) 1424–1437. 151–159. [30] M. Menotti-Raymond, V.A. David, M.E. Roelke, Z.Q. Chen, K.A. [46] F. Yang, A.S. Graphodatsky, T. Li, B. Fu, G. Dobigny, J. Wang, P.L. Menotti, S. Sun, A.A. Schäffer, J.F. Tomlin, R. Agarwala, S.J. Perelman, N.A. Serdukova, W. Su, P.C.M. O’Brien, Y. Wang, M.A. O’Brien, W.J. Murphy, Second-generation integrated genetic linkage/ Ferguson-Smith, V. Volobouev, W. Nie, Comparative genome maps of the radiation hybrid maps of the domestic cat (Felis catus), J. Hered. 94 (2003) pangolin, hedgehog, sloth, anteater and human revealed by cross-species 95–106. chromosome painting: further insight into the ancestral karyotype and [31] S. Sun, W.J. Murphy, M. Menotti-Raymond, S.J. O’Brien, Integration of genome evolution of eutherian mammals, Chromosome Res. 14 (2006) the feline radiation hybrid and linkage maps, Mamm. Genome 12 (2001) 283–296. 436–441. [47] S. Nilsson, K. Helou, A. Walentinsson, C. Szpirer, O. Nerman, F. Stahl, [32] D. Milenkovic, A. Oustry-Vaiman, T.L. Lear, A. Billault, D. Mariat, F. Rat–mouse and rat–human comparative maps based on gene homology Piumi, L. Schibler, E. Cribiu, G. Guérin, Cytogenetic localization of 136 and high-resolution Zoo-FISH, Genomics 74 (2001) 287–298. genes in the horse: comparative mapping with the human genome, Mamm. [48] W.G. Nash, J.C. Menninger, J. Wienberg, H.M. Padilla-Nash, S.J. O’Brien, Genome 13 (2002) 524–534. The pattern of phylogenomic evolution of the Canidae, Cytogenet. Cell [33] S. Godard, A. Vaiman, L. Schibler, D. Mariat, D. Vaiman, E.P. Cribiu, G. Genet. 95 (2001) 210–224. Guérin, Cytogenetic localization of 44 new coding sequences in the horse, [49] A.S. Graphodatsky, F. Yang, P.C.M. O’Brien, P. Perelman, B.S. Milne, N. Mamm. Genome 11 (2000) 1093–1097. Serdukova, S.I. Kawada, M.A. Ferguson-Smith, Phylogenetic implications [34] A. Goureau, M. Yerle, A. Schmitz, J. Riquet, D. Milan, P. Pinton, G. of the 38 putative ancestral chromosome segments for four canid species, Frelat, J. Gellin, Human and porcine correspondence of chromosome Cytogenet. Cell Genet. 92 (2001) 243–247. segments using bidirectional chromosome painting, Genomics 36 (1996) [50] L.S. Biltueva, F. Yang, N.V. Vorobieva, A.S. Graphodatsky, Comparative 252–262. map between the domestic pig and dog, Mamm. Genome 15 (2004) [35] N.J. Larsen, S. Marklund, K.A. Kelly, M. Malek, C.K. Tuggle, M. Yerle, 809–818. M.F. Rothschild, New insights into porcine–human synteny conservation, [51] A.S. Graphodatsky, F. Yang, P.L. Perelman, P.C.M. O’Brien, N.A. Mamm. Genome 10 (1999) 488–491. Serdukova, B.S. Milne, L.S. Biltueva, B. Fu, N.V. Vorobieva, S.I. [36] D. Haig, A brief history of human autosomes, Philos. Trans. R. Soc. Kawada, T.J. Robinson, M.A. Ferguson-Smith, Comparative molecular London B Biol. Sci. 354 (1999) 1447–1470. cytogenetic studies in the order Carnivora: mapping chromosomal [37] W.J. Murphy, D.M. Larkin, A. Everts-van der Wind, G. Bourque, G. rearrangements onto the phylogenetic tree, Cytogenet. Genome Res. 96 Tesler, L. Auvil, J.E. Beever, B.P. Chowdhary, F. Galibert, L. Gatzke, C. (2002) 137–145. Hitte, S.N. Meyers, D. Milan, E.A. Ostrander, G. Pape, H.G. Parker, T. [52] A.R. Caetano, L.A. Lyons, T.F. Laughlin, S.J. O’Brien, J.D. Murray, A.T. Raudsepp, M.B. Rogatcheva, L.B. Schook, L.C. Skow, M. Welge, J.E. Bowling, Equine synteny mapping of comparative anchor tagged Womack,S.J.O’Brien, P.A. Pevzner, H.A. Lewin, Dynamics of sequences (CATS) from human chromosome 5, Mamm. Genome 10 mammalian chromosome evolution inferred from multispecies compara- (1999) 1082–1084. tive maps, Science 309 (2005) 613–617. [53] J.R. Mickelson, M.L. Wagner, G. Goh, J.T. Wu, L.Y. Morrison, [38] W.J. Murphy, E. Eizirik, W.E. Johnson, Y.P. Zhang, O.A. Ryder, S.J. L.J. Alexander, T. Raudsepp, L.C. Skow, B.P. Chowdhary, J.E. O’Brien, Molecular phylogenetics and the origins of placental mammals, Swinburne, M.M. Binns, Thirty-five new equine microsatellite loci Nature 409 (2001) 614–618. assigned to genetic linkage and radiation hybrid maps, Anim. Genet. 35 [39] L. Froenicke, Origins of primate chromosomes—As delineated by Zoo- (2004) 481–484.