- -  ,%"+  )+, '()* & ! "# $%                 Penicillium expansum 0  1, -   +,  * 0 . /  %  

=/ ; '0< - 7 6:  8. ' 9- 
72 345 46 ('' $5  ()$' *+,'$ - ./ 0 12  3+) 4+,'$ $%&'  $%&' ! "" #  ('' ('"  : :;"  <= >'  29&' $'3 *+,'$    &1  %)$  #%82 7,'$ 6 (H @+.$' : DEF A" G C $ : @$ A" )  ># PQK8 #Q  @Q'$ 3' -    #L ' $ < & MK2  # !&12 N5* O ('1= #    K= 3' $J%&' $ Q #Q15 WQ> N = $  2)    =$  @ U- $  $  V5, @ U-   3',' . @&' $ RL2  OS)  QK= [%\2   " @;" #) ! &  2 $ U'%2 3 @+ $ 3' Y)'F V5, @ U- '% ' Z :;" N' $ .  2  XL&  3' NQ' 3' #Q) "Q=9/' ]&'  `S& .  & $ #% '_ Penicillium expansum  ^_  ( Lavandula officinalis ) ]$8L&' Q 2 $ 3' QY)'F V5Q, @ U- 3, W2  =1K2 .K= #c.  L8  a%2 1b ( &  W2 3' $J%&'  2 @&$ # (23  +2 K=    " $U  ! & $ e._  3 1, V5, @ U- ('5 2 N%+ Vf1F 3 $ $'$ (+, d%, .  1 7 F ! & . Q  Q+2 3 NQ' $ VU&   3'  g #   " # $ V5, @ U- N%+  $ '$ 1-2 *$   " # !Y, 75' N'   Q: :;" $ 'EQU . $'$  W2 & # @.Y, 3' Y)'F V5, @ U- 1 7 F @ ' "h ') 3, W2 #) $'$ (+, d%, N 1i 7 ) ' 723 (23  #15  D N 1b $ ) N 1i $ $J%&'  V5, % 1 7 F @ $.2, W2 3' $ 2 $1+ F 1 . .  $ 2 . . Penicillium expansum 3,  .K= #c. ( &  a%2 1b 3' Y)'F V5, :  @  ?-

The evaluation of peroxidase using multivariate regression models, neural networks and neuro-fuzzy in apple fruit treated with plant extract and Penicillium expansum

J. GHOLAMNEZHAD 1
, R. TAGHIZADEH-MEHRJARDI 1 and F. NASERINASAB 2 1- Assistant Professor & Assistant Professor, Respectively; Faculty of Agriculture and Natural Resources, Ardakan University, Yazd, Iran; 2- PhD. Graduate, Science and Research Branch, Islamic Azad University, Tehran, Iran Abstract The use of plant extracts can consider as an alternative for pesticides, to control post-harvest diseases like apple blue mold. It was efficient method the measuring the enzymes activity involved in plant defense systems to evaluate the disease, but it was expensive method. At present research, the peroxidase activity in treated apple fruits with lavender extracts and pathogen during eight days was investigated. Then, we applied three common models (i.e. multiple linear regression models, neural networks and neuro-fuzzy) to predict the peroxidase activity based on the information of the previous test. The results showed the highest enzyme activity was observed in the infected apples treated with the extract in fifth days, as the days before and it was significant compared to other treatments. The most activity of peroxidase was observed in all treatments except control, was observed on the fifth day. Our constructed models revealed that neuro-fuzzy model had higher performance in the peroxidase activity prediction compared with the other models. Key words: Neural network, Neuro-fuzzy, Multivariate regression, Penicillium expansum , Peroxidase, Systemic Aquried Resistance.

Corresponding author: [email protected] ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345

 Q& .w' # J%\2 N ::;2 m&"  8 $F ~ J& '8 .( .( Herger et al ., 1988 ) @&' $  3Q+)  g hK;2 N " V2 3' !4 & N N QU'  Q  =Q$ Q @Q U- $  $  V5, $QQ '3 QQ2 ]QQ&' QQ . $QQ QQ2 jQQY;2 (' 'QQ 3'Q,'  1%QY '3 Q e2=  ' $ (   =$ #. QU'  ) W& d1F / +) $ ! &  U" ('5 2 3+) Q XLQ& Q 3' $ Q2)  , @ U-    lqr 3'  #%Q'$  p$ n/ m&%2 / # #,h& kl( ,Q23 $ $ Q V 5, @ U-    3',' h -2 2' . @&' Hkl WQ& $ NQ" '5Q Hsqs #Q H WQ& $ NQ" '5 Q  Q 8'  Q WQ& $ 'EQU .  2  #1 5    @_  1 hQK ;2 N Q $ ! &  U"  W& N' / . @&'  &    Q) $'$  Q WQ2 3' $J%Q&' Q " ,'$ D9" N ::;2 NQ' $Q3  U" # t, . @&' #%'$ ' W' #." '  g . Q11) Q %2'F N Q ' Q1 7 QF #Q <'Q_'  Q11) Q1 7 F Q2' '$Q.,' #Q WK;2 N' 3 ,  eK O $ WK;2 #Q) @Q&' 0 Q&    ' #% ( 2 3> O  ) $'$ Q Q .,' $Q., @Q= # *$ M/ 3' . @&' EF, j1%' N N Q2  $  Q 2 $'$ * F (i J%\2   3> 3' $3 'Y8 v-2 $ WK;2 N'  3 # uU14" =9/' " @&' $) Z J" V  ' m."2   23 #1  &  Janisiewicz and Korestent, ) @Q&' b_   #  €'\%Q&' '  $'$ 3' 5 Vf> $ #%J, 1 3' 7,'$  NQ' #Q Q.,' $ #Q) Q Q NQ" V2 3' 4 .( 2002 [Q+) Q1  3' Q+\ ) $'$ .( Han et al ., 2011 )  , e2=  ! &  OS)  1) 2 $' Y8 WK;2 Q1b ( & e ._ 3' ) $'$  D ',' . @&' 7,'$ @QQ&' Penicillium Link (1809) `1QQ [QQ%\2 QQ #QQ, @Q Q%8$ ( Q&  =1QK2 .QK= #c.  a%2    7) ^_ 3' $J%&' .( Gholamnejad et al ., 2009 ) N 3 $' W‚2 ('1= # . @&'  $J%&'  V5, 1 7 F 2' @&'      3.2  '  N" 0& 3' 4 $ (' QY)' Q%, V  5Q, @ U- 1 7 F @ $'3 +%2   MQ/ OQ 3' (QY,' @29Q&  @QY3 m Q;2 #Q ! &   Q a%2 Q1b ( Q&  Q WQ2 3' (Q, <Q1 Y8  Q*$ M/ 3'   . )" # '3  e2'= @2:2 #QQ) 1%QQ'$ ( QQ  QQ,$) $J%QQ&' =1QQK2 .QQK= #c.QQ 3'   @  W.,$ # #) @'$ (  ' (::;2 @Q  "hQ  'Q)  ''$ =1QK2 .QK= #c.Q W2 .( Gholamnejad et al ., 2009 ) 1 . )" N' j\2 w Javad Zarin and ) @Q&' $Q Qt, $Q2 V  5Q, Q1 7 QF 3' Qc  Q- ./ xQ+12  ". )"  K= 3'  $J%&' @ Q U- 'Q% ' $ |> Z :;" $ . ( Moteshare Zadeh, 2016 0Q& $', (Y,' @29&  y& w #) @&'  D @Q;" #) ! &  2 $ U'%2 3 @+ $ 3' Y)'F V 5, Q  @2:2  1.2 '5 (1z "  $ 2 #5f" Penicillium expansum  Q QK= [Q%\2    " @Q&' Q+, D'5Q    K=   `,&' # @.Y, (23 'N 3' #) "=9/' ]&'  `S&  & $ #% '_ #Q41' Q 9Q= Q  Q K= .( Bakkali et al ., 2008 )  Q a%2 Q1b ( Q&  Q WQ2 3' $J%&'  2 @&$ # Q VQY ,42 3' Q{- Q,$_ ,'$ 4 2| @ p8  V  5Q, @ Q U-  3, W2  =1K2 .K= #c.  L8 WQ-  ^_ #  3' 4 2 e2'=  ' $ '   =$ . . 1 7 F ! &  2 $   " N @;" 3' Y)'F @QQ U- 7'5QQ' =QQ$ QQ VQQY ,42 NQQ' 3' QQ4 . QQ11) Q1,2 ,' QY)' Q%, Q V5Q, #Q  3' =$  V5,

 C- QK= Qw' .( Daayf et al ., 1997 ) @Q&' 3hQ")  3' Y)'F Penicillium sp.  ^_ & N' $ : 0  1, WQ%1)  @Q2:2 :U' $ Reynoutria sachalinensis   }  GHIJ %:* & G 0* & EF @6 :   0  - D  eQ2= ^Q_ SQ&' 3' ‡QU †Q 'Q% ' .  # " PDA @+z Q #Q $U ! &  3' $5  $  V -, #,8$& 3' % U  2 s $ -   #%'$ @+) m ;2  3'  e2= ^_ .  $J%&' #-UL2 N' $  3&'   OS) ls ls N yQ" ( VQf> #Q VQf> ) % sq/s > (%& L:2 j Q2$ $ ( Potato Dextrose Agar ) PDA m Q;2  Q Q @Qtg #Q " @ ep> ( Y,S&& 3' .   #/g 3' Q- ^Q_ NQ' . Q 'Q*, $'Q %,Q& #Q$ b Q Q $ <  1z s ˆ #) 3 , $2 @tg .  $J%&' 3 , $2   ) m&" Penicillium expansum #, > $ 3&'   %2% Q& ('Q1= #Q j 3' $J%Q&' Q Q   K= QL_   &   ( O 3 d1F  )  b  &F $   O+8 $2 3' < d1F D N' $ .  €'\%&' . .    3',' ` U) 3' $J%&'   #4U @=Q& 6 3' `F  ,Y 8 (%& L:2 j % U  2 „„ #Q% t, $ '4" b  "  ' 723 N' $ t12 # #>2 N' $ .  uJ%,&  .= e 2 #bF 3' VQ83 #Q& ''$ Q 2 Q   2 #& e2 '4"  #)  $ OQQuU 4 2 QQp 3' QQ  QQK= ($QQ , (%QQ& SQ&' (Q s N Q" Q Q  F W;2  ! & . $ .( Azimi et al ., 2006 )  $J%&' ,4 2 Etebarian et al ., )  #% t, $ VU&   ('1= # ^_ K  $ K  K L-%M%NK +, O  .( .( 2005 'K6 K:# K)   / K %K  -     K /    P         VQ_ V83 (  VU&   2 3' (23 N' $ :       )   +, - 0  1, QR  * 0 . $  # " $5 (%&  2 N$ 2 3' #) Golden delicious  V  5Q, 'Q a" Q& Qt12 #Q : L% K@ '6 :# eQ = #Q # Q+2 V_ 3' $J%&' $ @_$ @,   $J%&' X Q|" Q ( $2 $ e._ 1 $ #)   ! & 3' 3' Y)'F 3'Q,' Q Q Q 2 3' $J%Q&'  -&  723 N' $ . 2 . .  '$ #, ,  $'$ $ QQ QQ 2  ;LQQ& ,J=QQ| 'QQ . @QQ&' $QQ (QQY4   Q ! Q& ) VUQ&   e2   " + 23 N ' $ j Q Q $ `SQ&   #/g p$ /s V& @)S Q Q1" #Q)  Q ! Q&  ( (%Q& L:2 j   ,3 # 2 W,Q"' $ #Q ,w ls 2 # @, $  $'$ +%Y (%& <Q)1  ' mQ: #Q) $U   ! & $  ,3 # 2 K= QJ> #Q& (%& (3& † m&" `S&   #/g % ns Q #Q)  Q ! Q&  $Q $) @ $ '   e2= ^_ . Q $Qf' ! Q& Q $ H mm Z =  q/ mm  L_ # Q  'Q . Q,$  ,3 # 2 K=    e2= ^_ m Q;2  3 Qb @ Q+z 3' Q ^Q_  SQ&' ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345 

('QQ1= #QQ 3 (  '$QQ $ V 5QQ, ('5 2QQ  WQQ2  $ .  #% t, $ '4"  " WQ‚2 ('Q1= #Q ! "" N .   #% t, $ W2 8 %)Q #Q) ׌ e %) 7 23 p # + 23 $ V 5, ('5 2  '  $ V+ 3 $ V 5, @ U- ('5 2 #Q, , (Q23 )Œ e2Q B %)   )  " e2 A . .  $'$ '_ V%J 3 eQ2= ^Q_ Q Q,3 # Q 2 3' Q- 3 @Q+ Q1-   '$ ( & #U$-2 ) e4 : NM  ! "# $%   .  <f,' $K" 92) # F R/ !U_ $ $ (  : :  2 ( ) #L ' p # O &9) W S.- TU" - 1V 1R W S.- 1 $    () µ Ɣ ͕* ƍ ͕ͥͬͥ ƍ ˆ ƍ ͕)ͬ) QK= $ $2 N Ž"F ('5 2   3' t12 # :   Q a%2 Q xi  V( 5, @ U- ) 8  a%2 Y ( $ #) 3' 3' QY)'F V5Q, @Q U- ('5 2 N -" @ 7 23 $2 #QU$-2 !'| a  ( - 3 $ V 5, @ U- ('5 )2 $ .  $J%&' ( Bradford, 1967 ) $$' D 'Q Q- 2 NQ% ) D Q hQ -2 . 1 2 jY> # @Q U- Q& 'Q :   0  +, ' :.

. $ 2 $J%&' #,1b L8 ( & !'| $ Q a" )Q,' Q Gong et al . (2001) D 3' 3' Y)'F V5, (%SQ&F #c. 7 F N' $ : ,%"+  )+, '()* . Q $'$ 'Q_ AQ MQ‰ $ Q1 b (Q '% ' .  $J%&' #Qh $  y * & 3& W- 0 " ''$ #z J\2 #h †     $'$ '_ ( e8'$ $  2 @ 3' < O  `S& $'Q-"  $ 8 #h $ L8 3& W- 0 "  J\2 Q ' pH Q hQ2 „C/„ V  Q& JY  3' % U  2 #& $'Q-" NQ%  $Q Q a%2 (, s " O 3' (  (, Q\2 O Q (Q2 @&$ # 3' `F .  \2 92) @J 'Q_ Q& $Q2 Q N -" L8  -& p # (, $  Q W Q  eQ8'$ #Q #Qp9 eQp> Q\2 (u N' $ h @=&  $&  'z @= # N 1i . @ #  „„„ g $ u J %,&4 2 *%&$ $  e:%12  U % 2  Q $J%Q&' 'zQ2 }.,QU Q32 V%Q*U' Z :;"  Q u J %,& ] Y& #$  2$ $ #: _$  2 .( .( Amini et al ., 2005) $ V  5Q, @ Q U-  Q   3 'Q,'  'Q eQp>  h W;2 N QQQQ&, '5QQQQ' <QQQQ, 3' QQQQ|> 7 QQQQF $ .  '*, $' %,& #$ 6„ $ 5  .QQK= #c.QQ QQ>'/ 'QQ d1QQF #\QQY, ( Neurosolutions ) 3'  : ( POX )        $    $J%Q&' V  5Q, @ Q U- ('5 Q 2 1 7 F @, $  =1K2 %2%%4SQQ&' *%QQ&$ 3' $J%QQ&' QQ 3' QQY)F @ QQ U- #Q Q $'$ $ 3' eQ._ =1K2 .K= #c. D $ .  . QQ <QQf,' Milton Roy Company-Unterfoehring-germany $ Q $'$  Q D3'$QF 7 QF Yc  #c. O Q Q2 # # ,w „ ep'  ŒC nm $ ) jE ' a" #c. $' <8 p #  $'$ #) "p $ . $  p @ Q U- Q>' ('1= # N Ž"F <  2 $ #: _$ $ ( _$ #:  Q "QJ%2  wQ" Q $'$ $Q3 ' a" @= # , . #% t, $ 3' Y)'F > # $3  8  (, 3' 8 #) L #%'E #c. $ : ( POX )  K   K   K  $   " T   #Q Q%> Q (Q, 3' Q*$ Q8 #) U> $  & 7" ( Q& e ._ 3'  ) $'$   D ',' 3' |> Z :;" Q $'$ #) @&' <3h '% ' $ 'EU . ,'  &, 5 , @ U- #,%& @Q  3Q,  =1QK2 .K= #c.  L8  a%2 1b )s   )s h -2 #) $= #12'$ O N 1- , 3&  -2  Q WQ2 <Q " $ . Q $ $J%&' t, $2 V 5, 1 7 F VQ * Qt, $ '  y * & 0 " ' . ,  '_  2 (  ('Q1= #Q 3 O Q  x8 "  V 5, @ U- ('5 2 & $2

 Firing Rate  GHIJ %:* & G 0* & EF @6 :   0  - D 

W2 f1&.%='  ' #1 5 N % L ' N 1b $ . 1) 2  $ $3 " s $;2 $ 0 " N' !  $ 2  +2  $'$ MEQQ> D #QQ f1QQ&.%='  2QQ_  '$QQ #QQ+:, 7 Q) ( ! Q $Q 2 O$5, O  Jp # #) d" #   'QQ @ QQ -_2 n-1 #QQ ( n) $'$ QQ* .F @QQ&' ( QQ1 7 QQF '  s #,%& $:2 #41' /\ ."' N' $ . 1) 2 ' F $ . $Q 2 V Y:" f1&.%='  ' @ -_2 O  f1&' 3' $J%Q&'   $'$ V  #%', #c. # $  $'$ $  $$Q Q2 'Q' Q MEQ> @ -_2  ' W2 '4"  Q,  '_ k/s /s N  $'$ $ 2 ‘= (#) )l #L ' Q-_' 'Q:2 Q `SQ& . $$ 2 1 7 F  ME>  a%2 .  3&  -2

N Q .' $Q Q2 #.Q&;2 Q1 7 QF  L8  $$ 2 #Y :2 X − X y = 8. * i min + 1. X − X )6( `F . $ 2 <f,'  '$ #, ,   @ -_2 #  ' 1  max min

   $Q:2 N Q N Q ." ! | 3' $J%&'  !&1 2 W2 N -" 3' NQ" }5 X max  $'$ N" †bz X min #L ' N' $ 3' $J%Q&' Q N Q1i  V  5Q, @ U-  $  -_' Q $'$ #QL ' N' 3' $J%&'  .  2  $'$ & $'$ N *, Q 2  QL8 Q- 2 #+  N *, 2   “8 #.&;2 . ,  2 '_ k/s /s N $

! Q "" # ͒  ͒ͤ G ( $ #) . f1&.%=' W2  L8  D 3' D32 1 ' D N' $ :  -

# ͒Ŭ  ͒Ŭͤ  $3 N \"      3',' V 5, @ U- Q    L8 - 2 #1 )  L8 +%,' `F D32 $3 N Q \"  Q    3',' 5,V @ U- N *, 2 ! "" 3& #1   .K= #c. 32  V%*U' 3' $J%&'   . . @&'  $'$ $'-" n   0Q '" 3' <'z  . $  2 p @{= 0 '"  %2'F

ͦ ͥ/ͦ ∑ʚ͒ͤ Ǝ ͒ ʛ )H( NQ% z Q WQ2 ]Q&'   (0 " [%\2 $'-"  ) @{= ͇͍͌̿ Ɣ ʨ ʩ ͢ ͦ 0 Q" @, $ . $ D32 L8  -& D # L8 ('5 2 ͦ ∑ʚʚ͒ Ǝ ͒Ŭ ʛʚ͒ͤ Ǝ ͒Ŭͤʛʛ )r( ͌ Ɣ ʨ ͦ ͦ ʩ ǭ∑ʚʚ͒ Ǝ ͒Ŭ ʛ ʚ͒ͤ Ǝ ͒Ŭͤʛ ʛ 3' $J%Q&' Q 7 QF N' $ .   '8 5 @{= ) 1 )q( H l ͇̿ Ɣ ȕʚ͒ͤ Ǝ ͒ ʛ .QK= Q: .L" D  !%2 '5' <, $ @$' ` J,' m ;2 ͢ $Ͱͥ  ( ' #U*,3  &  ‚‚2 ) @{= 0 " , @+  3 Z[ - 'U  # . 3& #1  D  $= #, " O N 0 "  $'-" !     ! & W' 3 $ :  P   D !.  QL8 e_'Q> 3' $J%Q&' Q  #% '_ (23 $2 ! "" ('5 Q 2 Qt, 3' ]$8LQ&'  Q  K=    " $U . @&' 2 @&$ # ( $'-"  0 " , N% N Q1i   Q VUQ&   ! &  #Y :2 $ V 5, @ U- ('5 2 t12 # W2  ') &  ' :     Q1-2 7 '5' 1"   K=    " VU&   ! &  $'$ O QQ MEQQ> D #QQ f1QQ&.%=' V 5QQ, @ QQ U- Q Q $U   ! &  #Y :2 $ 2' ,$'$ (+,  '$ Q) #$  (23 #) L ' $ . @ <f,' ( 1 7 F K=    " $U   ! .& ,$', (+, 9%8' 1" #Q1 5 N  Q% $'Q, $Q UQ %>' #Q, , @'$  ' Q1-2 M9%Q8'  ''$ 3 N ' $   " # :  <$ 3 $ .( Brus et al ., 2011 ) @Q&' $'$ MEQ> D #Q f1&.%=' V%QQ+ 3 ( QQ F QQ" '$ QQ1-2 M9%QQ8' N QQ '  $QQ '$ #Q ($Q) V QY:" D N ' $  $'$ V Y:" D M98 ('5 Q 2 N  %Q+ Vf1QF 3 $ . @Q'$ $Q  '$Q #, , "w’Q2 ' D N Q ' #Qz $Q Q2 <Qf,'   EQF'4" / Q " $QU  Q ! & $ e._   3 1, V 5, @ U- l Anfisedit   Q  " #Q @ .QY, 7  5Q' N Q '    $ K=   H MATLAB ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345 

' Q F #2'$' V+ 3 1,2 + ) , N ' 5 , V%+  V%J # Q Q " # $ V 5, @ U- N %+  $ '$ 1-2 * $ .( .( e4 ) $) VQ+ 3 $ . Q  Q+2 3 N Q ' $ VUQ&   3'  g 3 $ . Q Q% ) $Q8 3' eQ._ 3 # @.Y, V 5, @ U-

2.00 Healthy apples a 1.80 P. expansum b 1.60 Plant extract c c 1.40 Pe+Plant extract d e e 1.20 f f g h 1.00 i ij ij j k k 0.80 l m n 0.60 op o o q pq q q pq pq pq pq pq 0.40

0.20 Changes in light absorption475nm/min/mg protein absorption475nm/min/mg lightin Changes 0.00 1 2 3 4 5 6 7 8 Days after penicillium inoculation

]$8L&'   K=  Penicillium expansum ^_  ,3 #2 w' $ ! &  2 $ ( POX ) 3' Y)'F V5, @ U- ('5 2 ' a" \ G 1>* Fig. 1. Changes in the activity of peroxidase (POX) in inoculated apple fruit with Penicillium expansum and lavender extract

<”Q" Q " $ ' V5Q, @ U- ('5 2 #)  2 , & :      $   " T  dQ%, . 1) 2 1 7 F P. expansum     K = ( Q& N Q -"  'Q :  KNM  K ! "# $%   h$Q-2 sq/s XLQ& $ ($Q '$1-2 3' 5 , `,' #5f" [Q%\2  Q 3 $ V  5Q, @ Q U- ('5 Q 2 L8  a%21b .( .( p<0.05 ) $'$ @4>  $'$ D3' <”Q" Q "  Q   QK=  P. expansum    )

P. expans um )ˆ( , QQ& #QQL ' ( QQ  QQ  QQK= POX / Ɣ 0.12 ƍ 0.71 Ɛ POX ΢ͯͥ )n( . 2 @&  " r ' ( ")k ( )ˆ m ' p # #/ 2 POX ΢ Ɣ 0.43 ƍ 0.61 Ɛ POX ΢ͯͥ )(  QL8 Q- 2 #Q+ dQ%, $ 2 #t>92 #) L, POX ΢ Ɣ 0.35 ƍ 0.56 Ɛ POX ΢ͯͥ )k( POX ΢ Ɣ 0.56 ƍ 0.56 Ɛ POX ΢ͯͥ @Q U- 1 7 F ' ns/s  /s ssr ! "" # N ." !| #Q  $  Q $'$ 'Q% ' $ :  ,%"K+  )K+, '()*  P. expansum Q m'Q $   Q m'Q $ V5, #Q Q $'$ #Q) "Qp $ . $$Q  3&$',%&'    #c. QQ  QQ  QQK= <”QQ" QQ "  QQ  QQK= Q $'$ $ Q 3 ' Q a" @= # $ #c. $' <8 p  HH/s  rˆ/s  H/s  qH/s  ll/s ! "" # P. expansum 3' Q8 #Q)  Q/ # #%'E #c.    "J%2  wx" #Q+ N *,Q 2 ('5Q 2 NQ% ) .(  W ) 2 @& rq/s * $ 8 #) U> $  & 7" > # $3  8  (, WQ2 #Q Q 2 N Q ." !| ('5 2 N"h  L8 - 2 Amini et al ., ) ,'  &, 5 , @ U- #,%& # %>  (, 3'  Q Q " $ ' V5, @ U- ('5 2 #)  2 , & #Q ~F'  '4" $'-" N 1i  #c. #1  %8 .(& 2005 #Q+ N *, 2 ('5 2 N%+ # +2 / # . 1) 2 1 7 F QL8 - 2 #+   -2 3' $J%&'  L8  -& D WQ2 #Q Q 2 Q1 7 QF @Q_$ NQ% )  QL8 - 2  GHIJ %:* & G 0* & EF @6 :   0  - D 

ls/s  ls/s  Q   QK= Q " $ V5, @ U- ('5 2 ' L8 - 2 #+ ':2 e_'> . $ N -" N ." !|  + + Q  K=  "  " $ V5, @ U- ('5 2 ' ns/s  QJ\2 #Qh $ (, d1F  #c. #  2    " $ #+ N *, 2 ('5 2 N% ) . 2 @& P. expansum  *$   " $ V5, @ U- ('5 2 '  ss '4" $'-" WQ2 #Q Q 2 N Q ." !| ('5 2 N"h  L8 - 2 QK= <”Q" Q "  Q  K=  P. expansum  ) $ ' V5Q, @Q U- ('5 2 #)  2 =1K2 .K= #c. Q #c.Q #  2 ! "" # ( P. expansum     ('5Q 2 N%Q+ # Q+2 / # . 1) 2 1 7 F    " ns  rqs  qss '4" $'-"  J\2 #h $ (, n r  Q 2 Q1 7 F @_$ N% )  L8 - 2 #+ N *, 2 - 2 #+ ':2 ]&'  D N' L8 d%, .  2 V5, @ U- ('5 2 #)  2 =1K2 .K= #c. W2 # ('5QQ 2 'QQ q/s /s ss !QQ "" #QQ N QQ ." !QQ|  QQL8 P. expansum QQ  QQ  QQK= <”QQ" QQ " $ ' ('5QQ 2 'QQ n/s  r/s  QQ QQ " $ V5QQ, @QQ U- 1). 1). 2 1 7 F nq/s  sk/s  P. expansum Q Q " $ V5Q, @ U-

( ( N Ž"F <  2 $ #: _$ $ jE ' a" ) V5, @ U- ('5 2 1 7 F @ L8 #,1b ( & W2 3' 2 @& d%, #Y:2 7\ -6 Table 1. Compare the results of multiple linear regression model to predict the enzyme activity R2 RMSE ME Treatment 0 .

0.70 0.004 0.009 * Control

0.53 0.22 0.21 P. expansum

0.46 0.13 0.17  +, Plant extract

0.45 0.33 0.28  0  QR -  +, Plant extract + Pathogen

RMSE: Root Mean Square Error ME: Mean Error R2: Coefficent of Determination

V5, @ U- ('5 2 1 7 F @ =1K2 .K= #c. W2 3' 2 @& d%, #Y:2 =\ -6 Table 2. Compare the results of artificial neural network to predict the enzyme activity R2 RMSE ME Treatment 0 . 0.85 0.001 0.002 * Control 0.71 0.14 0.13 P. expansum

0.75 0.09 0.11  +, Plant extract 0.70 0.20 0.17  0  QR -  +, Plant extract + Pathogen

RMSE: Root Mean Square Error ME: Mean Error R2: Coefficent of Determination ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345 

! Q "" #Q N Q ." !  Q|  L8 - 2 #+  ':2 ]&' %2'QF Q1b Q #c.Q N' $f' ' :  -  /s /s    " $ V 5, @ U- ('5 2  ' k/s  /s ss D  0 Q" $'Q-" @Q{= 0 " , e2 #) , #1  QQQ QQ " $ V  5QQ, @ QQ U- ('5 QQ 2  'QQ nk/s  <Q " Q) N' ' .  2 ( Epoch ) ~F' $'-"   $  " $ V 5, @ U- ( 2 '5  ' n/s  sq/s  P. expansum  pK8 d%, #) 2 @& L8  -& # & h> $ V  5Q, @ Q U- ('5 Q 2  ' nq/s  r/s    K= V5Q, @Q U- ('5 2 1 7 F ' #% ) # 3, W2 P. expansum <”Q" Qp #     K=  " . @Q&' Q $'$ (Q+, ( )H WQ $ [%\2   " $ Q- 2 #Q+  N *, 2 ('5 2 N % ) .( r W ) 2 @& N Q -" QL8 Q- 2 #Q+ Q -2 # #"  %8& N% #c.Q WQ2 #Q Q 2 N Q ." !  Q| ('5 2 N "h  L8 jQ\%,' Q& 0 Q" 0 Q" , N% W‚2 ('1= # . $ Q " $ ' V  5Q, @ Q U- ('5 2 #)  2 =1K2 .K=  Q Q " $ QL8 Q- 2 #Q+ 'Q:2 e_'> .  $ N *, Q 2 ('5 2 N %+ # +2 / # . 1) 2 1 7 F   'Q 'Q4" s  @{= 0 " H  3, W2 #  2 WQ2 #Q Q 2 1 7 F @_$ N % )  L8 - 2 #+   P. expansum  ) *$   " $ V5, @ U- ('5 2 $ ' V  5Q, @ Q U- ('5 2 #)  2 =1K2 .K= #c. QQ  QQ  QQK= <”QQ" QQ "  QQ  QQK= P. expansum QQp #QQ QQ   QQ QQK= QQ " 0 Q" r H r Q #c.Q #Q Q 2 ! "" # ( P. expansum 1). 1). 2 1 7 F Q D N Q ' QL8 dQ%, .  2 '4" qs  @{=

V5, @ U- ('5 2 1 7 F ' \%,' 3, W2   ]\ -6 Table 3. The features of neuro-fuzzy model to predict the amount of enzyme activity 0 " , 0 '" $'-" ($) 3$ D  $ D '4" Treatment 0 . @{= @{=

,3 N *, 2 . gaussmf 80 3 * Weighted Average Hybrid Control

,3 N *, 2 . gaussmf 150 4 P. expansum Weighted Average Hybrid

,3 N *, 2 . gaussmf 150 3  +, Weighted Average Hybrid Plant extract

,3 N *, 2 . gaussmf 150 4  0  QR -  +, Weighted Average Hybrid Plant extract + Pathogen

5,V @ U- ('5 2 1 7 F @  3, W2 L8    -2 3'  ^\ -6 Table 4. Evaluation of error criteria for ANFIS model on prediction of enzyme activity R2 RMSE nRMSE Treatment 0 .

0.89 0.001 0.002 * Control 0.79 0.11 0.10 P. expansum

0.78 0.05 0.06  +, Plant extract

0.75 0.14 0.11  0  QR -  +, Plant extract + Pathogen RMSE: Root Mean Square Error R2: Coefficent of Determination  GHIJ %:* & G 0* & EF @6 :   0  - D 

@.Y, .K= #c.   3,   W2 $ L8 7 ) ('5 2  .K= #c.  3, #  2 d %, :     #Q .  (2 7 F N ' $ W2 N " ) ( & D # V  5Q, @ Q U- ('5 Q 2 #Q Q 2 QL8 #Q,1b ( & @Q_$ =1QK2 .QK= #c.Q   3Q, WQ2 W‚2 ('1= # #"  . @&' 2 ( r l ) W' $     3','   'Q #Q,1b QL8 ( Q& D # @.Y, ' 1 7 F V  5, @ U- ('5 2 1 7 F  ' $4 = N % W' N '   'Q Qp$ nq  nq  Q Q " $ V  5Q, @ U- ('5 2 Q%  -2 #&  –;U 3'   2  3, W2 #  2   'Q Qp$ Hˆ  qs ('5 Q 2 # P. expansum   " QL8 #,1b ( &  =1K2 .K= #c. W2 $ 3' Q "  'Q  Qp$ Hs  ˆ ('5 2 #   K=  " # ' $4 = N % .K= #c.  3, W2 3' - . @&' Hk Hk  qn ('5 Q 2 # P. expansum     K= <”" .QY, $Q. “8Q 3' N 1i . @&' $'$ PK%8' $8 . . @&' $'$ 7 '5' p$ Q2 N Q .(' l e4 )  $J%&'  W2  ') 3'   '

80 Artificial Neural Network 70 Neuro-Fuzzy

60

50

 40

30

20

10

0 Control P. expansum Plant extract Plant extract+Pe  " b $ V5, @ U- ('5 2 1 7 F $ L8 ( & W2 # @.Y,  W2 .Y, $. “8 \ = 1>* Fig. 2. Index relative improvement of linear regression models to predict the enzyme activity in four treatments

 UQQQ&  'QQQ$ %8QQQ& QQQ. )" $ 3' QQQY)'F  QQ  QQK= #QQz $'$ (QQ+, 7 QQF N QQ ' d QQ%, UQ& 'Q$ (Q VQ4;2 ‘= #) N 1* U ( &'52 F  Q:U' $ !&12 —;2 † ('1= # ,'" 2 ]$8L&' 7'5Q' 4 ,Q42  Q& #f %, $ 1)   $ 2 ~Q;2 $Q2 O  ('1= #  1) e = 3' Yz'F V5, 5%1& #Q  Q  Q2 7 Q) '3 Q eQ2= J, @=&  #% .1%Q&' N Q1b (Q23 N Q ' d%, 3' .  =$   @ U- $Q8 = Q$ Q 71Q)' #Q)  $ 2 3'    W& Q " $QU  Q  2 $ 3' Yz'F V5, @ U- #z $ 2 Q1) V Qt1" $'$ 3Q , %Q+ (23 # ( W- ' #) ' Q,3 #Q2  Q # @.Y, ]$8L&'   K=   .( Durner et al ., 1997 )  3' QY)'F . @Q&' #%Q'$ 7'5Q' (%& L:2 j   

#Q %Q+ @2:2  =$  V5, 7'5' N ."' ' H2O2 @Qtg #Q) 1%QY ,' QY)' %,   V 5, 3h") . @Q&' Q D'5 5 , *$ N ::;2 m&" '3  e2'= De Gara ) ('4  ' $ .( Barcelo, 1997 ) 11) 2 V t1"

QQ V5QQ, @QQ U- @QQ U- QQ  QQ&' O  QQY U& QQw' Q $ 3' Q,'" Q2 H2O2 #) ,$'$ (+, ( et al ., 2003 # Q& #Q 3Q& $U 3' - # U' =& $ @,' Y)' %, Q 71Q)' ($Q) 5 UQ")  e Y" Z/ 3' @ e8'$ # ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345

 QY Q  #Q @.QY, 71Q" (Q23 $  V 5, @ U- ( d%,   & Mycosphaerella grraminicila  #QQ m."QQ2 QQ=9/' QQ: :;" N ' dQQ QQ%, . @QQ&'  QQ| 3hQQ") 3' QQY)'F QQ V5QQ, @QQ U- #QQ) $'$ (QQ+,  $'$ 7  '5Q' ' Q  #Q @Q2:2  eQ ;" VY ,42  ]QY> VQ_ $ $ 3Q U ,2 N Q,h e 1  3' Y)' e1 F '  QQ1 @ QQY 3  QQ D ' 3' eQQ ;%2 <QQ_'  QQ U" <Q=  Q{> $  Q&' O  QY U& # Q& #Q <Q1 <:2 ' Q V 5Q, @ U- ('% #) ,23 0_' $ . $3& 2 "' Gholamnezhad ) QQ1) QQ2 'QQ F 7'5QQ' QQ QQ{> (Q Q1  @=Q& lr  'Q 3 O    $'$ 3' $J%&'  @ Q2:2 Q:U' $ 5 Q , `Q) } K= w' .( et al ., 2016 3' $Q) 1 7 F - 3 $ V 5, @ U- ':2    3',' $ )  “\+2   &  8 $F ~ J& # = #Q  V Q  Q2 F <:2 g  <:2 <_' $ # ( Z /  Q 8  Q  $ Q   $ V%Y &  :U' ‘= `) K= . $QQ) V 'QQ8  QQ #QQp @QQ_  (QQ23 $ # QQ& N 'QQ Sirous and Jamali ) $Q 2  $F ~ J&   # @.Y, $ V 5QQ, @ QQ U- 7 QQ1 QQF @QQ QQJ%\2  QQ D .( Zavareh, 2014  ( #  3' #) $'$ $ ! & #  3'     W&  Q  Q WQ%1) $      D N F   ')  =1QK2 .QK= #c.Q  Q a%2 1b ( & # ('" 2 Q 74b_  ' $   e2=   # & @2:2   @Q_$  ''$ .QK= #c.Q WQ2 eQ) $ . $) '  3, 3' Q,  Q #Q1 5  QL ;2 @QY  3 94Q+2 'Q # NQ4 2 ' Q 3 @&' L8 #,1b ( & # @.Y,  "h N QQ::;2 #QQ" N %QQ+ #QQ) QQ !QQ2 < QQ& MQQK2 Z/Q12 $ 2 @& U:%,' 0 '"  ') M/ O  3' @&' D N Q '  $Q MQL-2 <Q:2 <_' 3' $J%&' @ & # Qt, ZQ./ Q*$ MQ/ 3'  #%Q'$ QJ" VQ Q [%\2 . $$QQ RQQL2  QQ WQQ%1) D N  QQ% ('QQ1= #QQ ('QQ1= QQ QQ+ F ]QQ&' QQ #QQ) Schaap et al . (1998 )  QQ ' N QQ% 3' QQ4 . ( Gholamnezhad et al ., 2016 ) %)QQ mQQ&" 3QQS U QQ U" 3QQ& #QQ1   3QQ 3QQYU2 #Q > Q . @Q&' Q, 0&  &1 <:2 <_' # &%&$ Q D 3' ( $   ep> Pseudomonas aeruginosa 3' Q-  Q W-   =$   #,2&   #   ( CCD ) 5QQ)2 @QQ3S2) RQQ/  ( RSM ) ;LQQ& AQQ&F $ #Q)  Q V 5Q,  Q N Ž"F  =$   (u ( 7 '5'  RSM ($Q ) # #-UL2 ( M N" V2   $J%&' ' Q F 7  '5Q' (Q':2 1%Y   =$ @ U-  ."' 3QS U V5,  U" 3YU2  3S U  U" 3& #1  ' GA Q1 Ž"F hK;2    =$   (u ( ('5 .2 1) 2 $'$ (+, $ 3,  D  .K= #c. 3' $J%&'  SAR =Q$  Q AQ&F $ VQ2 eQ2= O Q ('Q1= #  ( Q1 7 QF ('Q" 2 3,  .K= #c. 3' $J%&'  #) #QQ =  [QQ%\2 (QQ   $ ( Systemic Aquried Resistance ) .( .( Padmavathi, 2013 ) @'$ 3S U  U" 3' : _$ Gholamnezhad et al ., ) @Q&'  <f,'   3'  Y <3h h$-2 3' p8 , .K=  #c. >'/ $ Q V5Q, ('5Q 2 $ Q <:2  ]Y> (   $ .( 2016 8   $   $'$ N !&12 #L ' $f '   $., ('5 Q 2 QU Q1) 2 ' F 7 '5' =$   @ U-  m."2 mQ ' $Q @= #  @  @&$ !&12 d %, # ('" 2 ŠQJ"' ]QY> V_ 3' "$3  Y <:2 V_ $ 7 '5' N ' #c.Q ,Q Q1 7 QF  #%QY '  Q  a%2 N L8 g #Q >  Q  #Q Q #Q) ,Q23 Q* $ .= # %' 2 #%Q'$ ( Q&  Q WQ2 #Q @.Y,  % $4 = .K= VQ" 3' `QF # U' =& ( $ V 5, ':2 ' 1) 2 .QK= #c.Q "hQ  'Q) [Q%\2 N Q::;2 d  Q%, . @&' (Q+, @Q2:2  Q #Q Q,'" ,   14, ' F 7 '5' QQ,' $QQ)  QQ  " QQL8 0QQ '"  QQ& #QQ @.QQY, ' =1QQK2 Q1 7 F  & . $  '8 N 3' ' (     GHIJ %:* & G 0* & EF @6 :   0  - D 

  L8 - 2 #+  ':2 . $ V 5, @ U- ('5 2 $ $ .( Taghizadeh Mehrjardi et al. , 2013 ) 3' Q% ) Q  " <Q " $Q2 $  3Q, W2  #.&;2  Q  a%2 ($Q Z Q _$ v # F   D N ' 2 " @Q_$ Q1 $ (+, #) $ ( &  =1K2 .K= #c. m '  @&' '%&'  ( #  2 ' +2  #-UL2 $2 . . $  W2  &  #Y :2 $ W2 N ' "h $ #Q) UQ> $ . @Q&' Q vQ Z Q _$ 5 Q , Q  a%2 N 7 Q1 Q1 7 QF  'Q Z Q :;" N ' $ #) 7 1 F   W2  Q ' Q+2 h -2  V 5, @ U- e‚2 %Y 3   V%Y & ('5 Q 2 # 1%Y,'" #&  1% ) # 3' Y)'F V 5, @ U- L 'Q N 1b $ $'$ $   a%2 N ' #%81, m ' QQ1  @=QQ& 6 $ ' V 5QQ, @ QQ U- ('5 2QQ UQQ._ eQQ _  Q *U' #Qy'' #Q $Q_ #Q) @   ('" 2   W2 3' #, #, 2Q& 3' "Q=9/' N Q1b N Q ' # 3 , # t, . 11) 1 7 F N Q ' #Q) ' #Q, #Q 1   a%2 N m ' 3' " !&12 Q1 Q1 7 QF $ Q WQ2 N ' 7 F 3' 7 $J%&'   =$ . 1Q #%Q'$ Q-_' Q  ,$   %+ Š.L,' 1,'%  W2   Q @ U-  &  =$   (u N 1i   V 5, @ U- Q m."Q2  Q F '$ < ' @ 2 # #"  ! "" N   Q,'" Q2 @Q&' Q   Q$ Q ."' $ #) 4 uU  5   $Q:2 ($Q . :"  V 5, @ U- ('5 2  '3   e2'= $ &1   N 1i  "., R9p' N ::;2  + '  'Q) Q& 2 t, # V 5, @ U- ('5 2     3',' $1Q+ F 'EQU . Q #Q%\  '" (Q   R9Qp'   U" @ @Q U- Q1 7 QF $  3   #= f2  1%.2 W2 "h $ $'$  %Q+ $'Q-" Q @Q&$ N ' 3' ": :;" #) $ 2 N Q::;2 .( Mohammadi, 2007 ) Q @Q= N Q #Q V5, Qp V  5Q,  %Q+ $'Q-" Q N 1i  V 5,  $2 mQ ' #) L' $ 3 ( & D #) 1% #f %, #) $) $J%&' '   V 5, $ 2 $1+ F N 1i  $  Q L8  #) $'2 $ ) / #    a%2 N '$ < ' 3' $J%Q&'   ,'$ @) 4 uU 5  1%2    Y2 $ @Q&' RQL2 , Q& h$Q-2 %8& $ < ' 3' , V%Y & $ #)    Y2  7 1 F N ' 3' ep> =9/' ( Q& D 'Q .Q&12 N5*Q  eQ 42 ,'" 2 N Q1i . $'$ Q."' * 4   1%Y W- 4 uU   NQ' $ .( Mohammadi and Taheri, 2005 ) $Q Q:" Q2 @Q  "hQ  ')  ''$  3, W2 #) $'$ (+, d %, # c.Q #Q) Q/ #Q . Q2 @Q&  +2 d%, 5 , Z :;" . . @&'  W2  & # @.Y, 3' Y)'F V 5, @ U- 1 7 F  Q% )  'Q)  ''$  3,  #Y :2 $ =1 K2 .K=

References

ABDULAZIZ, A., Y. AL-ASKAR and M. RASHAD, 2010. bicolor against Fusarium solani, Fusarium poa in Efficacy of some plant extracts against Rhizoctonia Persian. Journal of Medicinal Plants, 6 (1): 26 - 32. solani on Pea. Journal of Plant Protection Research, BAKKALI, F., S. AVERBECK, D. AVERBECK and M. 50 (3): 239-243. IDAOMAR, 2008. Biological effects of essential oils- AMINI, M., K. C. ABBASPOUR, H. KHADEMI, N. A review . Food Chemistry Toxicology, 46: 446–475. FATHIANPOUR, M. AFYUNI and R. SCHULIN, BARCELO, A. R. 1997. Lignification in plant cell walls. 2005. Neural network models to prediction exchange International Review of Cytology, 176: 87–132. capacity in arid regions of Iran. Europian Journal of BATTA, Y. A. 2004. Effect of treatment with Trichoderma Soil Science. 53: 748–757. harzianum Rifia formulated in invert emulsion on AZIMI, A. A., H. B. DELNAVAZ and G. A. MANSOUR, postharvest decay of blue mold. Food Microbiology, 2006. Antifungal effect of aqueous alcoholic and 96: 281– 288. phenolic extracts of seed and leaves of Sorghum BRADFORD, M. M. 1967. A rapid sensitive method for the ...  - - ,%"+ )+, '()* & ! "# $%               : $(0 - 2 345

quantification of microgram quantities of protein extracts of Reynoutria sachalinensis (F. Schmidt) utilizing the principle of protein-dye binding. Nakai against fungal diseases, especially powdery Analytical Biochemistry, 72: 248-254. mildews. Nachrichtenblatt des Deutschen BRUS, D. J., KEMPEN, B. and G. B. M. HEUVLINK, 2011. Pflanzenschutzdienstes, 40(4): 56 – 60. Sampling for validation of digital soil maps. European JANISIEWICZ, W. J. and L. KORESTENT, 2002. Journal of Soil Science, 62: 394-407. Biological control of postharvest disease of fruits. DAAYF, F., A. SCHMITT and R. R. BELANGER 1997. Annual Review of Phytophatology, 40: 411-441. Evidence of phytoalexins in cucumber leaves infected JAVADZARIN, I. and B. MOTESHARE ZADEH, 2016. with powdery mildew following treatment with leaf Evaluation of multivariate regression models and extracts of Reynoutria sachalinensis . Plant Physiology, artificial neural network to predict the activity of 113: 719 – 727. antioxidant enzymes in wheat shoots ( Tritivum DE GARA, L., M. C. DE PINTO and F. TOMMASI, 2003. aestivum ) under cadmium toxicity. Iranian Journal of The antioxidant systems visavis reactive oxygen Soil and Water Research, 46: 727-737. (In Persian) species during plant–pathogen interaction. Plant MOHAMMADI, J. 2007. Testing an artificial neural network Physiology and Biochemistry, 41: 863–870. for predicting soil water retention characteristics from DURNER, J., J. SHAH and D. F. KLESSIG, 1997. Salicylic soil physical and chemical properties. 17th World acid and disease in plants. Trends in Plant Science, Congress of Soil Science, Thailand, Paper No 221. 2: 266–274. MOHAMMADI J. and M. TAHERI, 2005. Estimation of ETEBARIAN, H. R., P. L. SHOLBERG, K. C. EASTWELL, pedotransfer function using fuzzy regression. Journal and R. J. SAYLER, 2005. Biological control of apple of Agriculture Science and Technology, 2: 51-60. blue mold with Pseudomonas fluorescens . (In Persian) Microbiology, 51: 591-598. PADMAVATHI, M. 2013. Fuzzy modeling and optimization GHOLAMNEJAD, J., H. R. ETEBARIAN, A. ROUSTAEE, of lipase production using Pseudomonas aeruginosa . and N. A. SAHEBANI, 2009. Biological control of International Journal of Current Biotechnology, apples blue mold by isolates of Saccharomyces 2(1):1-6. cerevisiae . Journal of Plant Protection Research, 49: SCHAAP, M. G., F. J. LEIJ and M. T. VAN GENUCHTEN, 270-275. 1998. Neural network analysis for hierarchical GHOLAMNEZHAD, J., F. SANJARIAN, E. M. prediction of soil hydraulic properties. Journal of Soil GOLTAPEH, N. SAFAEI and K. RAZAVI, 2016. Science Society of America, 62: 847-855. Effect of salicylic acid on enzyme activity in wheat in SIROUS, A. and A. H. JAMALI ZAVAREH, 2014. immediate early time after infection with of salacilic Effectiveness of celery leaf extraction the induction of acid Mycosphaerella graminicola. Plant Sciences, resistance against cucumber powdery mildew, 50(2): 47: 1-8. 151-161. GONG, Y., P. M. A. TOIVONEN, O. L. LAU and P. A. TAGHIZADEH MEHRJARDI, R., F. SARMADIAN, G. R. WIERSMA., 2001. Antioxidant system level in SAVAGHEBI, M. OMID, N. TOMANIAN, M. G. `Braeburn' apple is related to its browning disorder. ROUSTA and M. H. RAHIMIAN, 2013. Comparison Academia Sinica Taipei Journal, 42: 259-264. of fuzzy techniques, genetic algorithms, neural HAN, J., M. KAMBER and J. PEI, 2011. Data mining: networks and multivariate regression prediction of soil concepts and techniques. Elsevier. salinity (Case study: Ardekan city). Journal of Range HERGER, G., F. D. KLINGAUF, E. H. MANGOLD, P. and Watershed Management, 66: 207-222. (In Persian). POMMER and M. SCHERER, 1988. Efficacy of

             

#  " !  ( Cytospora cincta )                  

* )  %&' (
  $ $  # #$ +/) .  ,- # #$ %& % '( )  *+(   # #$ %& % '( ) "  ! 8;;  89:; 01/ =  20) # #$ 8)0< 89:; 7 34 5 6)   01/ 20) (G ?;?- : 2 F( @  E D C  : A ? @  ) , , + "TQW !T/ ?;? 8T1S  ;UT<V < RST !T ?TQ +1 Q? 8  P " < O MN ; ! FL A 7I JK- ? )#)   <   T ^T "TQ_ ? ` V] K W % )0 V<; ;C .? S;? 8[V S ? %  Z Y/  Z <V( S7) :6X ? 3 / ?Q   O 8VT< ? !QT< Md +T1 Q? 8 Z_   ;R G ( bc< M ? Z Y/  bc< G ? a;/  Z <V(  8[V )S    ?K `)] iT_ 0; TS  ;UT<V < RST !7<  0 0;    % ( ? Z Y/  Z <V( 8[V S S7) :6X h?7V)  fg < e6) ! a <  Z T<V( 8[V S S7) :6X !6  :? 0; m;$S ; l- !/ S?;? 81S = .VS  aPS; GNG Njk   h< ? Cytospora cincta Fries ?T)  ;FTW T:6X 0; a;/  ? %   ?3 / . A<; " < 8V-?  ;U<V < RS !7<  0 6 % (  ; "<6) ; !6 + Z Y/   T AT1 ( T6$6)  T 0 bcT< T:? C  % . ?;? ;_  fg A$ ;       o ? AeW ? h?7 aX nX 0;  nTX Z T<V(  8[TV S 0; ap ?9V<; ? . !6  ;#) 0;  %    Z/  8 ? K) 8[V S ;#) !/   ?    ? ( AUDPC ) T Z/ Z <V(  8[V S ! A3YS   % / ? Z Y/  .fg  ? % / ;  ;U<V < RS ! 8[V S 66/ 7VY)  Zfg <V(  ? a < !#c6) ? " < 8V-? Z Y/ ( h$)  ,- ? Z <V(  8[V S  ;FW :6X h?7V) ?9V<; !/ ?;? 81S % '( C ; = .VS ? . .  ? ) % / % G dN/  ;  ;U<V < RS    ! : 8;+ ) q<;  . . ;FW :6X RS ;U<V < " < : ./  " ,-(

Nutritional effects of apple trees on Cytospora canker severity ( Cytospora cincta ) in Semirom orchards

A. HEIDARIAN
and M. TADAYON NEJAD MSc. Plant Protection Research Department & MSc. Soil and water Research Department; Respectively; Esfahan Agricultural and Natural Resources Research and Education Center, Agricultural Research, Education and Extension Organization (AREEO), Esfahan, Iran Abstract Preliminary studies on nutritional status of 29 commercial Golden Delicious orchards infected to Cytospora canker disease, showed defficiecy of potassium and calcium and excess of nitrogen in most of infected orchard. In this regard, an orchard’s trials was conducted to determine the effects of balanced potassium, nitrogen and calcium elements on prevention of incidence and development of Cytospora canker disease of 27 years apple Golden Delicious cultivar during 2014-15 in the commercial orchard at Semirom, Iran. Eighteen treatments (nitrogen and potassium at 3 levels and calcium at 2 levels) were designed in a factorial complete randomized block design with three replications. The results showed that deviation from optimum percentage index of nitrogen, potassium and calcium is proper option for predicting the occurrence and development of Cytospora canker disease of apple trees. Deficiency or excess of any nutrient caused imbalances in other elements and influenced the severity of the disease extensivily. The highest percentage area under disease progress curve occurred in most of the treatments, that nitrogen rate was less or more than the optimal amount. Combined application of nitrogen and potassium in most of the treatments significantly reduced the predisposing effects of high nitrogen application. The impact of calcium on reducing disease was lower than nitrogen and potassium. This results of this study showed that, balance utility of nutrients such as nitrogen, potassium in soils of Semirom area orchards and spraying of calcium based on recommended manual reduced Cytospora canker disease at 83.79 percent. Key words: Apple, Cytospora , canker, nutritional elements.

Corresponding author: [email protected] #  " !                  : * )  (   $


`T _  T W T66/ T) ; T ( 5T P    S   i_   V/ '1' `);X f; ? !1   A ?$) . 6VY    ; qV

TR TR +  5S;) !R ? ) #; A)#) ?  8[ 8 nX T wT3 ; ? 8T + ) `T $ To ? 3X ! .( Webb, 1991 T  T) ?T3 + T S T !T ?TQ  ; ?     T ?T T .Tc)  Q   ƒ9€ ? 8  S; .( .( Taiz and Zeiger, 2013; Marschner, 2012; Huber, 1980) T „ T S[  w3 ; ? A)#) .   ;- l&1) T  T  OT ; ! FL A 7I   0; % '( C ; 0; m  T AT)#) !T/ TC ; ?T  A<; c $) z ;  8 + ) T:6X  fgT T<   ;U<V < RS ! ?Q  ZQ< Agrios, ) ?T T) hTV6/ R VS[ : !   ! ` $ 8T + ) T T 8 %6/ Z   Z Y/  Z <V( 8[V S  ;FW ?T % T  ?T3 ] JK- !  z $)  fg A$ ); ( 2005 " T< 8TV-?  ;UT<V < RS    % / ?  ;FW :6X .( Krauss, 1999 ) S  ) ;_ + S  ;FW :6X . . ? +1 Q? 8  T T     [Q   + L  ;   }  2VY T:6X .( Marschner, 1995 ) T6 ? T) ;_  fg A$ ?   >(  QT<  T ; ? A)|<      [Q  +  ;FW ( ,F3 " ! D ( E    @ ABC  ? ;T_  fgT AT$ ; 8 + )    3 /   1W A1S   !7T<  0T ?  ;FTW :6X %#S 0;   ; : GF qTY€ `T€;) ? ; T 8;+ T ) 8 T |X  6 ? ) OT MN a T< !T#c6) ? " T< 8TV-? ; ;U<V <  fgT A$   0; CVY  ?   ;    ! 8 + ) T C C T % T ) +1 Q? 8 Z_  ;;? " < ZQ< O MG  ?Q z T$) ?  T L T  ;FTW T:6X C T6u . T6 ? ) ;_ T4 !T (? )  1) Z_ ;C  !#c6) ? ?Q 8;+ ) T6 ? ;T_  fgT AT$ ;  2VY  6VY ?_ ,- !T#c6)  T OT T6   S !T/  .&VS; ; !S !  ?K .( Dordas, 2008 )   ,T- AT   T6  VY(  _; z ; ! FL ) 6 ; (  01/ ? <<; 6 ; }   h?7V) ! FL OT T .( TS?  ;?T !S S `$)    l-          hV6/ ? ?;) "W; ? !/ ;C  ; A<; hT< M‡kd C  8 8V-?  A7< 5 )V) ‡ˆˆˆ `_;€ ?9VT<; . AT<; ATY 0 z T$)  0<   !: ! 8#) .T&VS; ?TK T: ! A-? ‡ O  ? . 6V;? C< `T _ bcT< C  T ZT/ ! ;     ;FW :6X 0; .c) T ‡ˆ `_;€ ?;7 0; ` a ; 0; 7 0 Nˆ v3  # .   T 2 T 8 hTV6/ ATQ€ ;?C .  ? ) % / Q3_  ;?TTT !TTTS S hTTT< TTT TTTY- !TTTV !7TTT<  ?TKV_; TeS 0;  T yT) T %T/ A  o ? )V  T !TS S  T !  0; ‰T(  `#V6) o1 )0 !  !S S . C +o    2 0; R .c) ! FL . A<;   F( !  T ZTŠ 2 !T T 8  ;FTW T:6X `T/ T "/)  ?TR X %  ;+T; ? !T/ AT<; T    T   hV6/   ;FTW :6X AeW ?;X; .     0;S; ( Wet Digestion ) .( Batish et al. , 2007 ) ?;?  ;+T< T !  +fg S hK$) A / 9 !TT6  TT:? 0; m;TT$S; 2 !TT TT) ATT

T ? ( Cref ) 5T) AeW ! A3YS ?Q   O 8V-? .( Agrios, 2005 )  !3T<$) ( OT MG )  T 0;  TX ZQ<   O 8V-? " < 8V-?  ;U<V < RS A  ) 2 C V 0; m;T$S; T:? T: !T DOP l-T .  ?  Y9   A†9€ C ;C .? A<; ; +!6 6 QV6/ A ) ? ( }T1- ?T) T:? q<;  )  ;FW K6X }  AeW eS ! . A<;  !6 + C  <<; 0; R 8 .c) ! FL  5T) ;T#) 8;T6X A$ ) A

TV) VST< Œˆ T ˆ yT X ? 1 )0 8R) ,- A .  !3<$)  0 h) 0; ?9V<;  ( Montanes et al. , 1993 )

 8;+ T .) ? ; c_    ZVY <  ( M h ) < V < DOP= [(C×100) / C ref ] – 100  T !T/  ? Z e6 ; !S ! `K ! !     ? E TK6X T ATeW = C E !T6  :? 0; m;$S; = DOP

. . ?1S h X; 8V-? !  %6 .ZQ<   O ? z<V) AeW = Cref   ;FTW    V ) ;f; 0;   ; : '3 MK AT ZQ< O MG  ?Q O MN ^- 0;  ;? !S S 8V-?    0      ;U<V < *S !7<   ? . T aTPS;  `K z<;; ? ^-   % )0 aPS; 0; `T3_ GNj  GNG   h< 69<; ? &VS; +1 Q? 8 T 0;TS; T<! ?  .T&VS; m?TK !T AT-? ‡ O  T  ;* !<  ;;?   .  aPS; 8V-? 8 ; T ,T-  TV) VST< Œˆ ˆk yT X 0; ,T- !S S G A-? T€; T 8TV-? m;T4; ) ? A-? }  1 )0 €; oT1 )0 ? vTV S  T !VT;? ( Auger ) 80 h oV

T ; ?  ( Nr a) T<  T O  ; 0; ?/ ! :  (N0) Fotouhifar et al. 2 !T .T   ` *1   ( 6*

! :  (K0) 9: ) bc< !< ? Z <V(  (( N2r ) /F) ! : T . T  0T< lQT-  ;   `)X i_ ( 2007 )

! T: T ; ?  ( Kr a) T<  T OT  ; <V( ?/ ZT_     !-  ) A

(  ( Ca 0) 9TTTT: ) bc TTTT< ? ? Z TTTTY /  ( K2r ) /F TTTT) . T T< Heidarian et al. (2001) 2 !T +T1 Q? 8T

 ;T* !T<  ;;? T  .  ? ;; ( Ca r) ( h$)  ;T  .T&VS;  tT T ;0    S;;  ;! T 8V-? m;4; ) ? A-? }  `) 1 )0 €;   T:K- qT<; T . T ?9VT<; T % )0 ? S0 )! .( .(  !V eS ? ! € ‘ ?   1 )0 €; l &T1 Cytospora cincta Fries iT_ ! T ; [Q) ! ! T: qT<; " <   O  ;FW :6X !6  8;+ ) T 2;+ a < !#c6) ? "QW !S 8;6X ! !/  ?;? aTPS; % 'T(  ( Malakouti, 2014 ) ;? !TS;? 8TV-?  ?/ . (Mehrabi et al ., 2011) A<; " <   O ? ( !V S 1VS; ) 8;R   z<   TP OT } T ? % )0 : L '?3 ' CJK Z ST) 9QT< aT dˆˆ : `) A-?   ;0; ! a < T ( ?T) a) < 8V< ? ?Q !Q< Md +1 Q? 8 ‡ˆˆ Z <V( 9Q< a ‡ˆˆ `U  9Y (< a ‡ˆˆ ;T; ‡ ° G ′ j ″ _ h4  G ° Gj ′ M ″ Q  X aTT M‡ˆ   9QTT< aTT G‡ˆ CTT  9QTT< aTT 8VTY  T y4T6) +T  ;  . eS0; !#c6) C .; ?  TT<; aT ˆ  ‰TT) 9QT< aTT ‡ˆ +T6o6) 9QT< C oS T ) z<V) . A<; ?< hV7)   8VY)0  }1-  a :6X 8;+ ) ! oVY  ?#) C ; 0; ?9V<; .  ) }  q Y< !? d Œj/  M/d 0;  -; h< G !S )  )? ?T) ? 8;T T S  TC 0 ;; ?;? %  T)0 `T$) ,- ? TV) T ) ‡Mˆ d/ T -; h< G ? !S Q< S C oS )  TS;$ ?T€ 8 Q ?;? Z 7 a <   ,-  ! .(  h ) A<; ?
 9;<=  : 8 9 , 8 67 .5 : " 4 "   ( 23

!TV  !7T<  ‡ˆ `_;€ 0; ;? !S S ` a 0; 7 AT<; T1S T< a T<  T ,T- ?  ;FTW :6X 0;  T h<   !_<   ( !-  VS; 0; Z1  ) ,T- 8T)0 qT<;  T 8;T S S6/ z ; ? C ; 6 eS 0; o1 )0 ?    !S S .  aPS;  ;R  hT 7) .  ,T- !Y<) ! : 0; ?9V<;  ? S ! : . . S ? ! +P Z Y/  Z <V( 8[V S  ;FW :6X ! T: yT34 JT-    ? Z Y/ ( h$) . A<; 8T)0 0; ) 0  !T: !T AT S ‡ ? .  ,T- !Y<) RS ( O  ? =6T( ATeW T Z Y/ / 0; ?9V<;  (  ) `  R1 ( ,F3 " ! E ( D    @ ABC  ? .  aPS; ;+ yT X ? ZQT<   O ,-   !/   0; q<;  : GF ?T/ aT / Gˆ T S7) :6X  ŽS q<;  ,T- AT T OT % Œj M/ T aPS;  V) VS< Œˆ  ˆ AT-? 0;TS; <!  VS; ?   ? w&)  <( S; € C T/ . 6VT;? < V < ,- A % G‡ dM/  < < V  T AT ? ?T/ hT M ? S;? ;_ h7   !1  !/ ? aT )  ‡kN C  :? GG/ˆ dd/k C  8 Q   0 ? 6 Q    A ? a? h< ?  W _ TV)  ‰6 0

C oS TT ) qTT<; ( Cref ) 5TT) ATTeW  TT  TT  0;TTS; ? . 1 )0 h<  ))  ?;?- - A S !T{;; j h ? = VS C ; !/  ? C 7  8 ?  AeW EP  G P&./ ( G PQ 8-(P  PABC  NO . A<;  ? 0 Nˆ vT3 #  T1 )0 a? h< ? :  L '?3  " #  " !                  : * )  (   $


G kGNj   h<  !Y #) ? GNG kGNj   h< ? a < !S Q< S z<V)  !S )  )? z<V) !Y #) UV T(5 Table 1. Mean montly temperature and mean anual precipitation in 2014 and 2015 in Semirom compared to the same figures for 2002-2015 Year Annual precipitation (mm) Mean high Temperature (monthly) (°C) Mean low Temperature (monthly) (°C) 2014 386.1 17.25 6.58 2015 370.1 17.97 7.43 Average (2002-15) 520.7 17.64 7.12

%)0  ;; `$) ,-   R  +   '  WV T(5 Table 2. Characteristics of the soil in the experimental site Soil depth Clay Silt Sand TNV OC EC P K Zn Cu Mn Fe Gypsum pH (cm) (%) (dS/m) (mg/L) mg/100 29 2.2 0.6 12.6 6.5 0-60 55 37 8 55 1.03 1.04 7.5 43 15 5 6 8 6 2

V) VS< Œˆ  ˆ y X ? %)0 ?)   O ,-   R  +   '  ; L !6);? XV T(5 Table 3. Ranges of ohysical and chemical properties of the soils (0-60 cm) in the experimental trial site Depth Clay Silt Sand K (ava.) P (ava.) TNV OC EC CaSO4 Orchards pH cm % mg/kg % dS/m mg/100 0-60 Healthy 35-57 32-50 19-86 170-956 1.8-33.3 18-38 0.33-1.77 7.4-7.8 0.4-1.2 9-15 0-60 Infected 27-37 32-38 11-29 300-750 2.2-33.2 25.5-50.5 0.56-2.11 7.3-7.8 0.51-1.1 9-20

` a 0; 7 0 Nˆ ZQ< +1 Q? 8   O ? 0 S Z/  0 S(  ;FW :6X 5) AeW YV T(5 Table 4. Concentration reference determined from leaf macro and micro nutrients contents at 90 DAFB in Golden Delicious cultivar in healthy orchards N P K Ca Mg Fe Mn Zn Cu % mg/kg 1.89 0.17 1.37 2.06 0.96 88.12 27.04 16.87 11.13

Pozza and Pozza, 2012; Thompson and ) TS;? ;0 T A 7TI l &T1  ;T K- 8;6X ! DOP 2 ( ( Huber, 2006; Biggs and Peterson, 1990; Zahoor et al. , 2017  ;FTW T:6X ?T % T  ?T3 ] C 7  8V-? ; ! FL   T T T  8  fg 7 34 z ; ?   .&VS; DOP   ?#) q<;  :6X V_ .  ? ) ;_ ?9V<; ?)  . .  < " < 8V-?  ;U<V < RS T }T / DOP l-   ;FW K6X S  6 A Q; EP  G P&./ ( G PQ 8-(P  PABC  NO  ;FW :6X  < ! A3YS  % 0 S  6 ? 81S 9: 0;   ;FTW T:6X ATeW C oS T ) !Y #) :  L '?3  " ; T! FL h?7 l- 8  |X .( ‡ h ) ?  ;- ? ;? T67) m|V-; `_;€ 8)0 0; ?9V<;    0; ?) + S   ) A

  O ? 0 S Z/  0 S(  ;FW :6X ; ! FL h?7 l-  !6  :? 0; m;$S; ZV T(5 *` a ; 0; 7 0 Nˆ Cytospora cincta Fries ! ?Q +1 Q? 8 Table 5. DOP and ΣDOP index determined from leaf macro and micro nutrients contents at 90 days after full boom in Golden Delicious cultivar in infected orchards by Cytospora cincta Fries * DOP Lab. no. ΣDOP N P K Ca Mg Fe Mn Zn Cu 166 1376 -33 24 -31 -33 -53 -17 -66 180 939 167 618 -29 141 17 -58 -74 -2 -54 95 148 168 803 -29 253 -28 -30 -59 -9 -35 45 315 413 381 15 -24 -18 -56 -6 24 -23 167 -48 414 264 32 18 -5 -67 -28 30 -20 49 -55 415 423 30 12 -9 -55 -4 30 -2 231 -50 423 205 13 71 6 -32 46 22 2 9 4 424 232 47 41 -15 -50 7 44 -3 0 -25 428 224 -10 35 22 -41 27 -19 -9 -49 -12 429 277 -9 35 -24 -15 83 36 45 -16 -14 430 202 -19 29 17 -33 45 5 2 -44 8 431 143 0 29 -5 -35 39 12 0 -13 -10 432 217 4 76 7 -27 56 15 -4 -3 -25 433 212 5 24 11 -49 9 4 -49 -31 -30 437 285 -6 -24 -31 -17 79 11 37 -41 -39 438 311 -30 -29 -26 -33 44 -38 18 -36 -57 439 245 -10 29 7 -26 59 -17 8 -45 -44 211 354 55 6 -9 17 -15 -24 70 116 -42 212 414 13 -6 -33 68 15 -60 152 -37 -30 213 264 21 -6 -27 -11 -38 -54 48 -38 -21 214 292 11 -29 9 -18 -56 0 41 -68 -60 215 329 34 6 11 -33 -29 -3 100 -79 -34 216 471 25 -12 -15 -8 -42 -31 196 -100 -42 221 401 24 0 24 k -17 -42 -41 100 -100 -53 222 221 -2 -29 -16 -28 17 -31 86 -3 -9 223 331 17 6 17 -37 6 -24 177 -36 -11 226 246 4 -18 7 -24 40 -24 75 39 -15 227 300 51 -6 20 -35 17 -18 112 35 -6 228 285 30 -41 -18 -49 14 -17 59 -38 -19 Average - 8.76 21.07 -6.31 -28.69 5.41 -6.76 36.656 6.52 8.76 `T aT 0; T7 0 Nˆ   T hT<  T TY- T C T1 0;  ;?T !TS S q<; +1 Q? 8 Z_  ;FW :6X !Y #)   ?;SV<; : * . . A<; ( )ˆ !6  ! A3YS ;#) C  Z/  C  %  " C  ! (+)  ( )k   A)|X .( Bergmann 1992 ) *: Mineral leaf composition standards for Golden Delicious cultivar, based on sixth-shoot leaves sampled at 90 days after full bloom (Bergmann 1992). Sign (-) and (+) indicates lower and higher content than optimum (0) respectively.

 8[TV S ;T#) ? h?T7 aTX !T/ ?TV; x9 ;     ( G P&./ ( G Q 8-(   %' ABC  ?   TS T  T oS C ) C . A;? ? K) Z <V( T ?   0 Z{|X C Q; :      m|VT-; % ‡ hT V€; bcT< ? 1 )0    ?   ?  TS0 T! ) 0; T7 !TV9 !T< `_;T€ T1 )0 h< ? #  " !                  : * )  (   $ 

T ; T L TS . AT<; T !T{;; d h ? " < T  0; ?) S7) :6X V )  .fg A ;? ? ;? 67) . . A<;  LV)  ŽS ! !    8TV-?  ;UT<V < RST  T T C oS )  

* 1 )0 a? h< ? ` a 0; 7 0 Nˆ +1 Q? 8 Z_  ? Z Y/  Z <V( 8[V S  ;FW :6X ;#) C oS ) [V T(5 Table 6. Mean contents of nitrogen, potassium and calcium in Golden Delcious cultivar leaves, at 90 DAFB in treatments at second year trial * N K Ca Treatment % N0K0Ca 0 1.07e 0.88c 0.69g N0K0Ca r 1.08e 0.82cd 2.88a N0KrCa r 1.01e 1.25b 2.14c N0KrCa 0 0.99e 1.22b 0.98ef N0K2r Ca r 1.03e 1.77a 2.09c N0K2r Ca 0 0.97e 1.73a 1.03e NrK0Ca r 1.51d 0.84c 2.10c NrK0 Ca 0 1.53d 0.77cd 1.30d NrKrCa r 1.48d 1.23b 2.20bc NrKr Ca 0 1.45d 1.23b 1.04e NrK2r Ca r 1.52d 1.69a 2.17bc NrK2r Ca 0 1.50d 1.65a 0.87f N2r K0Ca r 1.56cd 0.76cd 2.30b N2r K0 Ca 0 1.98a 0.68d 1.25d N2r Kr Ca r 1.67bcd 1.25b 2.10c N2r Kr Ca 0 1.93ab 1.25b 1.07e N2r K2r Ca r 1.70abcd 1.72a 2.15bc N2r K2r Ca 0 1.83abc 1.77a 1.10e LSD 0.2922 0.1484 0.1574 CV(%) 12.33 6.99 5.74 . . S;S ;? 67) m|V-; % ‡ h V€; bc< ? m|V-; `_;€ 8)0 q<; ! 1) m€   oS C ) 8V<  ? : * *: Means followed by the same letter in the column do not differ statistically through the test of LSD value, at 0.05 probability level.

  % / :?  ( AUDPC )   A1 ( 6$6)  0 bc<   S    oS C ) \V T(5 * GNj  GNG   h< ? Z Y/  Z <V( 8[V S :6X  fg A$ Table 7. Means of final disease severity, area under disease progress curve (AUDPC) and disease reduced percent as affected by nitrogen, potassium and calcium fertilizer applications at 2014 and 2015 years * Final mean canker lesion size The Area Under the Disease 2 Disease reduced (%) Treatments (mm ) Progress Curve (AUDPC) 2013 2014 2013 2014 2013 2014

N0K0Ca 0 1551.00a 985.00a 1425 2301 0.00 0.00 N0K0Ca r 1491.00ab 879.00ab 1373 2130 4.62 10.76 N0KrCa r 1139.00fg 537.67hij 1035 1589 26.58 45.41 N0KrCa 0 1180.00f 580.33ghi 1065 1558 23.90 41.08 N0K2r Ca r 949.70h 360.33k 810 1120 38.77 63.42 N0K2r Ca 0 1092.00g 492.33ij 1036 1381 29.59 50.02 NrK0Ca r 1358.00cd 778.67bcde 1323 1955 11.28 20.95 NrK0Ca 0 1376.00c 759.00cdef 1253 1911 12.42 22.94 NrKrCa r (recommended) 342.00k 159.67l 247 458 77.95 83.79 NrKrCa 0 355.30k 177.67l 261 480 77.09 81.96 NrK2r Ca r 837.30ij 454.67jk 737 1118 46.27 53.84 NrK2r Ca 0 882.00i 496.33ij 781 1192 43.13 49.61 N2r K0Ca r 1440.00b 826.67bcd 1370 2107 5.01 16.07 N2r K0Ca 0 1473.00b 840.33bc 1345 2091 7.14 14.69 N2r KrCa r 1320.00d 722.00def 1225 1850 14.87 26.70 N2r KrCa 0 1350cd 750.33cdef 1250 1898 12.94 23.82 N2r K2r Ca r 1250.00e 650.33fgh 1150 961 19.39 33.98 N2r K2r Ca 0 1270.00e 670.33efg 1214 1880 14.87 31.95 LSD 46.85 115.8 - - - - CV(%) 12.46 11.29 - - - - . . S;S ;? 67) m|V-; % ‡ h V€; bc< ? m|V-; `_;€ 8)0 q<; ! 1) m€   oS C ) 8V<  ? : * *: Means followed by the same letter in the column don't differ statistically through the test of LSD value, at 0 .05 probability level. 
9;<=  : 8 9 , 8 67 .5 : " 4 "   ( 23

T6 !T/  T |T(  ( T1)  T T !T/ ?/ l&1)  8T + ) %6T/ Z  !/ ?;? 81S  ?;? ` $  ! +P AT<;  T ? hT X; T 8 ? ( ?T %   ?3 ] ) 8[V S hT< ? ? T  ;T/ T % ‡ bcT< ?  ;FW :6X To ?  T |T( T !TY #) ? ;  T 8;+ T ) C  % 0; `T:€ = VS !/ C ; ! !  . S;? ;? 67) f; 1 )0   ;TT/  TT6 !TT Z TTY/ 0; ?9VTT<; .( d hTT ) 6VTT;? T9 GNG hT< ?  T  TS  C oS ) !Y #)

( T1)  T  !6    !Y #) ?      ;? 67) hT<  T oS C T ) ;FTQ A;S GNj h<  ; !e€|) ` _   ;? T67) T4 !T Z <V(  8[V S 0; ap ?9V<; . A;S AT1 ( T6$6)  T 0 bcT< .( d hT )  0;  GNj T 8[V S % ;+; 66/7VY)  fg   ! A3YS ( 0.05 )  ;   % / :?   S   (AUDPC )  T96) oVY3 AUDPC    C . ?;? % / ;    T !T)S !T/ ?;? 8T1S AUDPC = .VS  ?9V<; 0;  2 .( .( `R ) A;? ? ( R /Mk= ˆj ) AT$ ;   A1 (( P ≤0.05 )  ;? 67) 4 !  ;FW  oS C ) !Y #)  / 4 ! .( d h ) 6 ? ) ;_  fg

AUDPC AUDPC Total N, K and Ca (%dry weight leaf at 90 DAFB leaf at weight (%dry and Ca K Total N,

Treatments

Z Y/  Z <V( 8[V S :6X 8;+ )  ; U<V < RS  A1 ( 6$6) 0 bc< V U ] ;FW ‘V&)    fg A$ +1 Q? 8 8V-?  ? Fig. 1. AUDPC of Cytospora canker and content elements of nitrogen, potassium and calcium in leaf of Golden Delic ious plants as affected by different nutritional treatments

A<; Z/    < ! A3YS !6   ? AUDPC :? T ? ?T)  ;FW :6X 8;+ ) C  ) m|V-; Marschner, 2012; ) T aTPS;  T % '(  !P VS C ; !/ ( Œ hTT ) ‘TTV&)  TT  ? `TT aTT 0; TT7 0 Nˆ !T6 )0 C T ; (? Taiz and Zeiger, 2013; Freitas et al. , 2015 ? ?T)  ;FW :6X   ‘V&)     fg  8  S. ) A# c) !T A3TYS Z TY/  Z T<V( 8[V S :6X 8;+ .) ? 

‘TV&)    C   A1 ( 6$6)  0 bc< T !T A3YS   %  ` _ 4 (! T1)   

  T  "TW; ? AUDPC :? C  %  ? ) 81S T:6X 8;+ .()  `R  Œ h ) ?  LV) ( NrKrCa ) !6  T  T T Z/  8 ? K) 8[V S ;#) !/ A<; ?V; x9 ; h ) 5)   AeW 8;+ ) ! !6   ?   ? ?) G G hT ? ` Q? C !  A<; ? !6  ;#) 0;  % 8 T h•TY)  ;FTW T:6X !T/ TC ; AX .! ? } ?+S ( j !T6);? ?Q   O ,- ? ( Q C / ) ,- 8[V S 8;+ ) ;FQ 6VY   ?      +R  : ! #; A)#) #  " !                  : * )  (   $ 

( NrKr) T   ;FTW ?;) eS (0; NrKrCa ) !6    T A T<Y€   8[TV S Tf; . T ? T) 8T1S ; < 7 } T ?  ) eS 0; (  `R ) 6V;? ; AUDPC C  Z/  T V/ ! oVY  A<;  LV)   ! 8   A)#) ? AUDPC ;T#) C   tT .( d hT ) T6V ;T_  ?T)  ;FTW 5 T6)  AeW „ S[  6S)  o ? ATX TC ; !T Z Y/  8[V S Z <V( mK) aX    . ?;? To ?  ;FTW T:6X T 8[TV S %6T/ Z   ?9V<; 8;+ T ) !T  ;FTW T:6X  < ! A3YS :6X C ; !/ A<;  C TYRQ;V  C Q 6o 8 !V-< ! 8[V S "<6) AeW  ( Malakouti, 2014 ) a0t " T< 8TV-? ! FL ?   % C T ;  T Q % T/ nTX 8 ? %  6/ ) } /  CS Heidarian and Tadayonnejad, ) T    T   hV6/ ? y T 4 0; +V6T<V ? C T/  ;T TI# !cT<; ! 3 /   T  / %T#S ( 2014; Belan et al. , 2014; Furtado et al. , 2009   A Q V)  Q ? h|V-; nX !/ ? ) ‰ / !- T    T  T ? ST7) TK6X !T< C ; %#S . S;? ( shikimic acid cycle ) T<; } R T !- y 4 0;  Sf     8 %6/ Z   8 + ) !S ! oVY  J- 8  |X . 6VY  I A)#) ?P ;  ; !/ S )  ?9VT<; ? T) ST7) TK6X ! !VY . ?;? c $) z ; + T S  bc< ?   /< (  0

; .  ?? )  + <; 1 ƒ9€ nX Q<   F(~9S ;T#) 8?T S !TI; T .( d hT ) AT  % / % j ŒN/ o ? R Q V) 6 ; C 6   I  +S A Q7  ; % T/   0 ? 8[V S ? %   ?3 ]  Zfg <V( TTK6X C .(;TT Marschner, 2012 ) ?0TT< TT) q ATT

; T ~T9S  ?TQ  T `$) ? Q< C  `-;? N2r Kr  T  ?  %  NŒ/    NrKr  ? Z <V(

? Z T<V( ?T3 ] .( Pozza and Pozza, 2012 ) 6/ )  A&< !T . AT % T/ :? G N‡/  MG M/ "  ! N2r K2r  iT_ 0; TS 0T)  )S(        Ž_  66/7VTY)  fgT Z T<V( ;T#) % ;+;  o ? 3X Furtado et al. , 2009; ) Fusarium oxysporum f.sp. cubense  TS T  T ZT/   !7<  0 ? 8[V S iTT_ 0; TTS  TT< –TTS0  ( Silva and Rodrigues, 2013 !/ ( d h   `R ) A<; !V  % / AUDPC    ?;? %  ;+T; ; ( Doreto et al. , 2012 ) Phakopsora pachyrhizi Z T<V(  8[TV S T:6X h?7V) AeW   / %#S  8 ( TV Q ? h) )  d 0;  % Z) <V( ;#) % ;+;  . A<; ? T aTPS; % 'T( T !/ A<;   C ; A  ) ? T !TRQ  T    ,- 8 A1/ ZVY < ? Heidarian and ) T  S T) AT# c) ,- 8 A1/ z ; Lima et al. , ) Phoma tarda i_ 0; S _ 8V-?  )  T  !T Z TY/ 8?T S !I;  .( Tadayonnejad, 2014 iTT_ 0; TTS TT_ 8TTV-? ; TT_ ZTT1 !TTRQ  ( 2010 !T/ QT€? ? % G dN/   % / !6   ? x

% T/ ( Garcia Junior et al. , 2003 ) Cercospora coffeicola "  !   N2r K2r Ca  N2r KrCa  NrK2r Ca    ? T:6X T h?T7 aX AX !    aPS;<  !V T 8 T !/ A<; !V  % / :? GG N/  MŒ dˆ/  ‡G j/ Œˆ Œˆ mTK) T aT6 ? . AT<; !TV %  ;+T; To ?  ;FW   % '( . A<; o ? K6X ? ! A3YS Z Y/  Z/  fg oV-T<  T  VR ? Z <V( 9Q< a / Amarante et al. , 2009; Miqueloto et al. , 2014; ) TT -; % / % ‡  Pyrenophora tritici-repentis i_ 0; S  %  ;+T; !T/  ? ) 81S ( Heidarian and Nematollahi, 2016 .( .( Sharma et al. , 2005 ) A<; !V  AX !   !6  0 S 0; % Z <V(  8[V S mK) ;#) Z TTY/ ?TT3 ] TT 8TTV-? Z TT<V(  8[TTV S 0; TT7 nTX Z TY/  Z <V( VY SVS f;  8[V S A_  fg 6VT;? !T6  ! T FL T !T A3TYS ; AUDPC C  % TŠ7 ?  ??T T) " <  ) ? Y/ t|V-; 0 T:6X ?T3 ] !T A3TYS Z TY/ AUDPC ! ; .(  `R ) 0; !T/   S ) 0 O z ; ?  ! x !IX ?;) ?  ;FTW TK6X C T ; A T ; ); A<;  C ( o ?  ;FW ? T:6X C T ; K) ;#) ! :- ! VY  eS ;C Pozza and ) A<;  !VYS;? Z)       A ) " T< 8TV-?  ;UT<V < RST  T  O A ) ? T ?TQ l &T1 !T TK6X C .(; Pozza, 2012 . ? } / Q< ; ? V-<   1W 3f    <|(  1W C  T6 T wT3 ; ? Z T<V( ?3 ]  8   A <Y€ 0; 0; ?T0 T 2;+ C ; 6 .( Huber et al. , 2012 ) 6/ ) AT<; 8   ? K6X C ;  z3 )  0<  A-< A Q7 ?;? ?T ,T- ? Z TY/ mK) f; ?    % / TT Z TT<V( .( Amtmann et al. , 2008; Marschner, 2012 ) #  " !                  : * )  (   $  mTK) Z T<V(  8[V S !/    ? .( Peterson, 1990 0TT) ?0   o TT<  TT .( Pozza and Pozza, 2012 ) ?  T L T T); . AT<; + TS + S Z Y/ %#S A<;  ?oS   Cercospora coffeicola T  ( Freitas et al. , 2015 ) T  T T ; T L TS Z T<V(  8[TV S 8;+ ) Mycosphaerella citri iT_  (Garcia Junior et al. , 2003 )  _   TT) TeS 0; T   !TV  TT  ZL TY/ T( hT$) Phytophthora  ( Mondal and Timmer, 2003 ) T3/)   4T- !T vtT V€; !T/ TS;? ; TK&1) v|)T/ ST( Z !T/ €;TS ? ( Serrano et al. , 2013 ) wT   cinnamomi    T:? !T !  . A<; o ? K6X ?  8 %6/ Z  %T#S 4T- T ! !VT;? ? ,- ? / 0;S; Z! Y/ ŽT P) ?  d( hT ) ‘V&)    ?   % / T 0; TS  T !TRQ !7T<  0 ? Z Y/  € ; T ? ? T<<; %#S Z Y/ !/ ;C ?  < ) eS ! ATeW !T/ T ? T) 8T1S I€   !V . A<; ?  Z/  8[TV S K6X ? ! A3YS vt V€; ?;? 8   ? Q< . T6/ Z e6 ; A)#) bc< A<; CR )   A ? Z Y/   ;UT<V < RST  T % T/ ?  0 %#S Z <V( h?T7V) ATeW T wT3 ; ?   !7<  0 C ; 6 y34 !/ ;C ! eS ); .( Huber et al. , 2012 ) ?;S " < 8V-? 8[TV S ? h?7 . ? ?9V<;?) Z Y/  Z <V( 8[V S  ;#V<; 0; 7 Z Y/ ( h$) .  ,- !Y<) ! : ? !T/ ?;? oVTY x7 8;+ ) !   ? Z Y/  Z <V( T % T/ T T /  fgT ?T T) aPS;  0 !T/ TC ; !T !T T ;FQ . A<; 3YS A 4  )?  w3 ; . . ?;?  AT<; a0t T6/ ) A/€    S ZVY < ? Z Y/ ?T T) .FT T 5 T< :6X  < ! A3YS Z <V( h?TT7V) TT ? ; Z TTY/ ATTeW TT( hTT$) y TT 4 0; " _ } Z <V( !/ ;C ! eS .( Demira and Koseoglu, 2005 ) ; T ( Z + 6)  Z <V( K6X ?  VY SVS f;  A;? !oS   ;FTW ?;) ? 8 AeW  3YS 4 ! ; A<;  _ -  ,T- 8?T TR  ?T T .( Palenciaa et al ., 2010 ) 6RS ; Z + 6)  Z Y/ Z < 6S)  8 /  < .F  t ?T3 ]   ?T7V) ` T t? !T G( h ) !7Qc) ?)   O   ;FTW  T hT$) ? Z <V( ;   ? ) ;_  fg A$ j(. hT ) ?T T)  T1) WT tTK$) ? Z Y/ .FT   t A3YS ! o ?   8 /  !V;S ? aT   8VY   / A 4 ? aX   ,- R1- % ;+;  + S I€ % '( ? .(Mengel, 2007 )  6 ;- "3T< !T/ ( hT ) C T( AT 4  t ;€ !?  `RT ) ?;TS 81S  L  ? Z Y/ ;#) Z <V( mK)  ?;T) 8 T   !P VS ?    % / `_;€ ! x7 ? ) Z TY/ T( hT$) TI  A ; ŽI) C ; !/ (  T< T) `_;T€ !T T   TS ? Z Y/ JK- ! ? ( Palenciaa et al ., 2010; Shahabi and Malakouti, 2000 )  T ) ? 8 ?3 ]  !  ( Shahabi and Malakouti, 2000 ) ;#) C  % ` Q? C !    S )  { ; " < 8V-? 0; ?9VT<; C  ; T6  ‡( hT ) ??T )  1)    !TV : ( h$) !/   ?    ? Z Y/  a0t " T< 8TV-?   T( hT$) T: ! Z Y/ !T hTK ; ? T +Z 6)  Z T<V(  T 8 / .( Œ h ) ? .( Shahabi and Malakouti, 2000 ) A<;  I ET66/ T) AT _ Z TY/ T   T<|(  T1W ? T A < " T< A-? 06/;VS   S;?0 nX Z Y/ ? T 8 +o6  T nTX T +Z 6)  Z <V(  ? 0 C ; 6 T C. acutatum   Colletotrichum gloeosporioides 0; S  V-T< ? T1#S !T/ T  ;-   <|(  1W bc< ? TT ) %TT#S ATT<; CTTR ) Z TTY/ .( Biggs, 1999 ) ATT<;    T<|(  T1W !TP VS ? S;S   <|(  1W ?R X  T Z +TS Tf; ? QT<  T ; T ? ! T +P 0;    t|VT-; !T  ) A A <Y€ nX  ?/  ;- A1S Biggs and ) T !VT;? ;0 T `T);X zT<  Q  9;<=  : 8 9 , 8 67 .5 : " 4 "   ( 23

?€ a < !#c6) ? !/   8 0; C ; 6 .  ? % / ; Yermiyahu et al. , 1994; ) ?T T) Z TY/ ?T3 ] 0; TS

 AT<; T1S C T 7 " < 8V-? ?  ;FW :6X S;$ .Elumalai et al. , 2002; Freitas et al. , 2010; Freitas and 0;  ? S  ?/ ! :  O ,- 8)0 q<;  8; S . ( Mitcham, 2012 .  ,T-  # #$ !Y<) !6  ! :  o ? m4 h?TT7V) ATTeW A TT ; % 'T( C TT ; 0; `TT:€ =  TVS ?;? 8T1S ;    8;+ ) C  Z/ + S % '( C ; ? RSTT  TT % TT/ ? ; Z TTY/  Z TT<V( 8[TTV S  T % T/ Te6) !T !#c6) C ; ? !/ ? ) ?61 ( !T/ ;C 4- . !  ? ) 81S ; " < 8V-?  ;U<V < mTK) " T< 8TV-?  ;UT<V < RS   hV6/ ?  ATT<; C TT ZTT/ !TT6  TT TT 8TTV-? ? AUDPC (  ( .  ,T- !Y<) ! : q<; )  ;FW :6X h?7V) AT<; C  % 8[V S ? %  Z <V( ?3 ]     ; ; T 0; `3_ ? / ,- : ! Z <V(  8[V S '  !  ;FTW T:6X T- h?T7 aTX !/ !S 8 .(  `R ) AT S =6T( ? ( h$) : ! Z Y/  8V-? 8 ; TY/ t|VT-; !T " T< 8TV-? ?  ) A <Y€ ? Z‡ TY/ T/ T 0  !T: !  ` 2+  0; 7  ( Heidarian and Nematollahi, 2016 ) T ? ) ;_  fg A$ A T 9 /  A T / T6 !S : ;C .? ?? =  ;+ aTX 0; f gTV) T3QW + T S " T< 8V-?  ;U<V < RS 8TV-?  ;U<V < RS   !/    ) ?3  )  . A<;  ? Z Y/  Z <V( 8[V S  ;FW :6X h?7 . . ?? ) hV6/ - ! " <  T O ? Z <V(  8[V S '  !  ;FW :6X h?7  ;UT<V < RST  T % T/ A ? a < " < References

?  ;FTW TK6X }  ? %   ?3 ]  ?;?  0 A? ; AGRIOS, N. G. 2005. Plant Pathology. 5th ed., Elsevier- Academic Press, p. 635. !T/ !TS 8 AY S   0 66/ C 7  6 ! ,- ALTAMIRANDA, E. A. G., A. B. ANDEREU, G. R.  ;FW :6X ; L !6);? ?  ZQ<  ?Q   O ,- DALEO and F. P. OLIVIERI, 2008. Effect of ? ;TV ;  T ZT{|X To ? 8 T !T . S?;? 81S ;  0? B-aminobutyric acid (BABA) on protection against  8[TV S  T ?/ mTK) eS 0; !/   1) SV-? Phytophthora infestans throughout the potato crop cycle. Australas Plant Pathology, 37:421–427. ?  T 8;+ T ) C  T % T C 6u . S?3S h?7V) Z <V( AMARANTE, C. V. T., P. R. ERNANI and C. A. 8[TV S 6 !/     ( ?/ mK) 8 )    STEFFENS, 2009. Predição de "bitter pit" em maçãs  T1) ?T T ? T T/ !  8 ? ( ? %  ?  Z/ ) 'Gala' por meio da infiltração dos frutos com magnésio. Revista Brasileira de Fruticultura, 31: 962 -968. (in ?T/ ;T !T T<V( ?T/ ? / o ? m4 0; . ? Portuguese). T . ?;? % T/ ; 8[TV S  T? 0 66/7VY) f; 8[V S AMTMANN, A., S. TROUFFLARD and P. ARMENGAUD, T ? AUDPC ;T#) C  Z/ % '( C ; = VS ! ! 2008. The effect of potassium nutrition on pest and  C ; ?  ;FW :6X AeW    1) !6  m K) disease resistance in plants. Physiologia plantarum, 133: 682–691. } T ?+S  TY ZQ< 8V-?  ? ( Cref ) 5) AeW ! BATISH, D. R., H. P. SINGH, N. SETIA, R. K. KOHLI, S. aX  mK)    Z <V(  8[V S mK) aX C 6u . ? KAUR and S. S. YADAV, 2007. Alternative control of T ‚/;T€ nTX Z T<V( ? T/ 8 8[V S mK) little seed canary grass using eucalypt oil. Agronomy AUDPC for Sustainable Development, 27: 171–177. h?T7V) mK) : ?   ?     S BELAN, L. L, E. A. POZZA, M. L. FREITAS, A. A. A.  T  S; ) Z Y/ ( h$) Z <V(  8[V S

#  " !                  : * )  (   $ 

POZZA, M. S. ABREU and E. ALVES, 2014. COELHO, H. S. ROCHA and A. A. A. POZZA, 2015. Nutrients distribution in diseased coffee leaf tissue. Spatial distribution of Yellow Sigatoka Leaf Spot Australas Plant Pathology, 44: 105–111. correlated with soil fertility and plant nutrition, BIGGS, A. R. 1999. Effects of calcium salts on apple bitter Precision Agriculture, pp. 1-15. rot caused by two Colletotrichum spp. Plant Disease, FREITAS, S. T. D. and E. J. MITCHAM, 2012. Factors 83: 1001–1005. Involved in Fruit Calcium Deficiency Disorders. BIGGS, A. R. and C. A. PETERSON, 1990. Effect of Horticultural Reviews, Volume 40, First Edition. chemical applications to peach bark wounds on Edited by Jules Janick. Wiley-Blackwell. Published by accumulation of lignin and suberin and susceptibility to John Wiley & Sons, Inc. Leucostoma persoonii . Phytopathology, 80: 861–865. FREITAS, S. T. D., C. V. T. AMARANTE, J. M. BURKS, S., W. R. JACOBI and I. A. MCINTYRE, 1998. LABAVITCH and E. MITCHAM, 2010. Cellular Cytospora canker development on Aspen in response to approach to understand bitter pit development in apple nitrogen fertilization. Journal of Arboriculture, 24: 28- fruit. Postharvest Biology and Technology, 57:6–13. 34. FURTADO, E. L., C. J. BUENO, A. L. D. OLIVERIA, J. O. CAO, T., B. C. KIRKPATRICK, K. A. SHACKEL and T. M. M. MENTEN and E. MALAVOLTA, 2009. DEJONG, 2011. Influence of mineral nutrients and Relationship between occurrence of Panama disease in freezing-thawing on peach susceptibility to bacterial banana trees of cv. Nanicão and nutrients in soil and canker caused by Pseudomonas syringae pv. syringae . leaves. Tropical Plant Pathology, 34: 201–215. Fruits, 66:441–452. GARCIA JUNIOR, D., E. A. POZZA, A. A. POZZA, P. E. DEMIRA, M. A. and T. KOSEOGLU, 2005. Effect of SOUZA, J. G. CARVALHO and A. C. BALIEEIRA, potassium on yield, fruit quality and chemical 2003. Incidence and severity of the brown eye spot of composition of green-house-grown of galia melon. coffee according to supply of potassium and calcium in Journal of Plant Nutrition, 28: 93-100. nutrient solution. Fitopatologia Brasileira, 28: 286 – 2 DORDAS, C. 2008. Role of nutrients in controlling plant 91. diseases in sustainable agriculture. A review. GEARY, B., J. CLARK, B. G. HOPKINS and V. D. Agronomy for Sustainable Development, 28: 33-76. JOLLEY, 2014. Deficient, adequate and excess DORETO, R. B. S., W. L. GAVASSONI, E. F. SILVA, M. nitrogen levels established in hydroponics for biotic E. MARCHETTI, L. A. BACCHI and F. F. and abiotic stress – interaction studies. Potato Journal STEFANELLO, 2012. Asian rust and soybean yield of Plant Nutrition, 38:41–50. under potassium fertilization and fungicide, in the GRAHAM, D. R. and M. J. WEBB, 1991. Micronutrients 2007/08 crop season. Semin: Ciências Agrárias, 33: and disease resistance and tolerance in lants, in: 941–952. MORTVEDT, J. J., F. R. COX, L.M. SHUMAN and ELUMALAI, R. P., P. NAGPAL and J. W. REED, 2002. A R. M. WELCH (Eds.), Micronutrients in Agriculture, mutation in the Arabidopsis KT2/KUP2 potassium 2nd ed., Soil Science Society of America, Inc. transporter gene affects shoot cell expansion. Plant Madison, Wisconsin, USA, pp. 329–370. Cell, 14: 119–131. HEIDARIAN, A. and M. R. NEMATOLLAHI, 2016. FOTOUHIFAR, K. H. B., G. H. A. HEDJARODE, D. J. Interrelation between mineral nutrients and calcium ERSHAD, S. M. MOUSAVI, S. M. OKHOVAT and disorders in apple Red Delicious and Golden Delicious M. JAVANNIKKHAH, 2007. New information on the cultivars. Plant Pathology, 52(2): 267-278. (in Persian). form-genus Cytospora in Iran. Rostaniha, 8 (2): 129- HEIDARIAN, A. and M. TADAYONNEJAD, 2014. Effect 149 (in Persian). of Different levels of Nitrogen and Potassium on FREITAS, A. S., E. A. POZZA, M. C. ALVES, G. Infection Severity of Canker of Apple Caused by  9;<=  : 8 9 , 8 67 .5 : " 4 "   ( 23

Cytospora cincta Feries in Hydroponic Condition. and Increasing Farmers' Income. Mobaleghan Press, Seed and Plant Production Journal, 30-2(4): 473-485. Second Edition 318p. HEIDARIAN, A., A. ALIZADEH and V. MINASIAN, 2001. MALAKOUTI, M. J. and M. N. GHEIBI, 1997. The The susceptibility of certain citrus cultivars to branch determination of the critical nutrient elements of wilt and decline disease caused by Nattrassia strategic products and advice on the proper fertilizer mangiferae . Iranian Journal of Plant Pathology, 37: recommendations in Iran. Publication Agricultural 135-143. (in Persian). Education, p. 54. HUBER, D. M. 1980. The use of fertilizer and organic MARSCHNER, H. 1995. Mineral Nutrition of Higher Plants. amendments in the control of plant disease, in: 2nd ed., Academic Press, London, p. 889. Pimental D. [Ed.] Handbook Series in Agriculture. MARSCHNER, H. 2012. Mineral nutrition of higher plants, Sect. D. CRC Press, Inc., West Palm Beach, FL, USA. 3rd edn. Academic, San Diego, 643 p HUBER, D. M. and D. C. ARNY, 1985. Interactions of MEHRABI, M., F. MOHAMMADI GOLTAPEH and B. potassium with plant disease. In: Munson RD (ed) FOTOUHIFAR, 2008. Report on fungi associated with Potassium in Agriculture. ASA, CSSA, SSA, Madison, Cytospora canker of apple trees in Semirom region of pp. 467–488. Esfahan province. Proceeding if the 18th Iranian Plant HUBER, D. M. and S. HANEKLAUS, 2007. Managing Protection Congress, Bu Ali Sina University, Nutrition to Control Plant Disease. Landbauforschung Hamedan, Iran. P. 27 (in Persian). Völkenrode, 4(57): 313-322. MEHRABI, M., F. MOHAMMADI GOLTAPEH and B. HUBER, D., V. ROMHELD and M. WEINMANN, 2012. FOTOUHIFAR, 2011. Studies on Cytospora canker Relationship between nutrition, plant diseases and disease of apple trees in Semirom region of Iran. pests. In: MARSCHNER H. (ed) Mineral nutrition of Journal of Agricultural Technology, 7(4): 967-982. higher plants, 3rd edn. Academic Pres, San Diego, pp. MENGEL, K. 2007. Iron avaihability in plant tissue-iron 283–298. chlorosis in calcareous soils. Iron Nutrition in Soils and KRAUSS, A. 1999. Balanced Nutrition and Biotic Stress, Plants. Dodrecht, Netherlands, pp. 389-397. IFA Agricultural Conference on Managing Plant MIQUELOTO, A., C. V. T. AMARANTE, C. A. Nutrition. 29 June-2 July 1999, Barcelona, Spain. STEFFENS, A. D. SANTOS and E. MITCHAM, 2014. KRUPINSKY, J. M. and D. L. TANAKA, 2001. Leaf spot Relationship between xylem functionality, calcium diseases on winter wheat influenced by nitrogen, content and the incidence of bitter pit in apple fruit. tillage, and haying after a grass-alfalfa mixture in the Scientia Horticulturae, 165: 319-323. Conservation Reserve Program. Plant Disease, 85: MONDAL, S. N. and L. W. TIMMER, 2003. Effect of urea, 785–789. CaCO3, and dolomite on pseudothecial development LIMA, L. M. D., E. A. POZZA, H. N.TORRES, A. A. and ascospore production of Mycosphaerella citri . POZZA, M. SALGADO and L. H. PFENNING, 2010. Plant Disease, 87: 478–483. Relationship between nitrogen/potassium with Phoma MONTANES, L., L. HERAS, J. ABADIA and M. SANZ, spot and nutrition of coffee seedlings cultivated in 1993. Plant analysis interpretation based on a new nutrient solution. Tropical Plant Pathology, 35: 223– Index: Deviation from optimum percentage (DOP). 228. Journal of Plant Nutrition, 16: 1289-1308. MALAKOUTI, M. J. 2014. Recommendations for Optimal PALENCIAA, P., F. MARTINEZA, E. RIBEIROC, M. Fertilizer Use in Agricultural Crops of Iran: PESTANAC, F. GAMAC, T. SAAVEDRAC, A. D. Determination of Amount, Type and Time of Fertilizer VARENNESB and P. J. CORREIAC, 2010. Aplication for the Purpose of Achieving Self- Relationship between tipburn and leaf mineral Sufficiency, Food Security, Sustainable Agriculture composition in strawberry. Scientia Horticulturae, 126: #  " !                  : * )  (   $ 

242–246. on the 4th cycle. Revista Brasileira de Fruticultura, POZZA, A. A. A., H. E. P. MARTINEZ, S. L. CAIXETA, A. 35:1170–1177. doi:10.1590/S0100294520130004000 A. CARDOSO, L. ZAMBOLIM and E. A. POZZA, 28. 2001. Influence of the mineral nutrition on intensity of TAIZ, L. and E. ZEIGER, 2013. Fisiologia vegetal, 5th edn. brown-eye spot in young coffee plants. Pesquisa Artmed, Porto Alegre, 918p. Agropecuária Brasileira, 36: 53–60. THOMPSON, I. A. and D. M. HUBER, 2006. The role of POZZA, E. A. and A. A. A. POZZA, 2012. Relação entre manganese. In L.E. Datnoff, W.E. Elmer, and D.M. nutrição e as doenças de plantas: implicações práticas. Huber (eds.). Mineral Nutrition and Plant Disease. APS Simposio Avancos Na Otimizacao Do Uso De Press, St. Paul, MN. Defensivos Agricolas No Manejo Fitossanitario, 12., VEROMANN, E., M. TOOME, A. KANNASTE and R. Lavras. Anais Lavras: UFLA, 2012. 1 CD-ROM. (in KAASIK, 2013. Effects of nitrogen fertilization on Portuguese). insect pests, their parasitoids, plant diseases and SERRANO, M. S., P. FERNÁNDEZ-REBOLLO, P. VITA volatile organic compounds in Brassica napus . Crop and M. E. SANCHEZ, 2013. Calcium mineral nutrition Protection, 43:79-88. increases the tolerance of Quercus ilex to Phytophthora YERMIYAHU, U., S. NIR, G. BEN-HAYYIM and U. root disease affecting oak rangeland ecosystems in KAFKAFI, 1994. Quantitative competition of calcium Spain. Agroforestry Systems 87: 173–179. with sodium or magnesium for sorption sites on plasma SHAHABI, A. and M. J. MALAKOUTI, 2000. Calcium membrane vesicles of melon ( Cucumis melo L.) root sprays undeniable necessity to improve the qualitative cells. The Journal of Membrane Biology, 138: 55–63. properties of stored fruit in calcareous soils country. ZAFAR, Z. and H. U. R. ATHAR, 2013. Reducing disease Technical Bulletin No. 136. Ministry of Agriculture. incidence of cotton leaf curl virus (CLCUV) in cotton Karaj. Iran (In Persian). (Gossypium hisotum L.) by potassium SHARMA, S., E. DUVEILLER, R. BASNET, C. B. KARKI supplementation. Pakistan Journal of Botany. 45(3): and R. C. SHARMA, 2005. Effect of potash 1029-1038. fertilization on Helminthosporium leaf blight severity ZAHOOR, R., W. ZHAOL, M. ABID, H. DONG and Z. in wheat, and associated increases in grain yield and ZHOU, 2017. Potassium application regulates nitrogen kernel weight. Field Crop Research 93:142–150. metabolism and osmotic adjustment in cotton SILVA, J. T. A. and M. G. V. RODRIGUES, 2013. (Gossypium hirsutum L.) functional leaf under drought Nutricional evaluation, production and incidence stress. Journal of Plant Physiology, 215: 30–38. Panamá disease in banana ‘Prata anã’ fertilized with K,

             

*  !"              

8+  :;4 , 9 867 ,7 ( 50,123  4 ( ' /* .,  ( ' )&)& * +,- (#
'$% & # = = :; < ).   487 94.  0 01" 67.  2  3'4 53 0 01" +/ + ,- .  ' ()*  $%&' ! "" #  67.  2  3'4 53 0 01" +/ $%&' AB >' ' 4' '  487 @ "  94. 0 01" >.4& >%&4? >%&' >'A '   8 D 487 @ "  94. 0 01" >.4&  C >&'? >%&' = :; < ).   487 94.  0 01" >' ' L7  487 @ "  94. 0 01" >.4& J  KD # "  GHI' 0 01" #F&. ()*  $%&' ! "" # E (E  " : 9J- O" A   " : N$ O" ) <= #Z <[' $ R 1%. >  .   $S  # #7 X ' $ %W N&'   T&" U? KV1.  S"  D'"   # R 1" 4'  $'Z=" RZ 1" >'6 . \ ="  4'   ' + ,- \ ' $ . )) . 7D' ! & . 3  #%D \ 4' > T&" S )%F (FW  ' ' [ ]D4 d' . D & Eab ac  EaE ab 3'4 K& $ ; $ ` "D_ B^ 5 ) ' [ ]D4   # N:FD 5) !/%). 5[' >Z8D @ Z%D .  & ( +)" 53 )   4'  NfgW T ' $  ( +)" )    T ' $ $ 5) KV1. $e 3  4' ' $ ZF? #Z).'$ + ,Z- \ Z ' $ . $Z % Bc B/ ' Z[ ]ZD4 #Z N:ZFD Z& $Z.   ` "D_ # 7 $e 3 + 7 I$ \ hD . #7 $'$ ! Z "" #   '\ # N:FD KV1. $e 3 ' l" \ % 7 . $  l%. I$ bk S' k 4' ' [ ]D4 # N:FD & $.   ` "D_ ' ' Z[ ]ZD4 #Z N:FD 7J. 5[' ! "" # #7 $ I$ k S' \k + 7  o'   ) ' 4'  >' & nH '  $  5[' # m . oZ=%. ! "" # KV1. + 7 % c^ S' E^ $W   $e 3 ' l" \ %8 :&1. \ (&'  . )%'$ ' $e 3  ' - \ %8 \ Z ' #Z N:ZFD ' $Ze 3  ' Z - \  Z% 7  F? \ %8 #7 $ n)      %&' \ DS' ("  8 D  Dp 5[' #  )%Z'$ ' + Z7 \  Z% 7 $e 3 + 7 B% / k% cB/  ! "" #   o' 5[' ' [ ]D4 # (FW 5[' \ $ . )%'$   . . D$  \ ' 5[' \ " R 1%. . . 5)  $e 3 + 7 ' [ ]D4   # R 1" : >?  9

Evaluation of tolerance to leaf rust disease in some selected bread wheat genotypes

S. T. DADREZAEI
1, N. TABATABAI 1, I. LAKZADEH 1, A. JAFARNEZHAD 2, F. AFSHARI 3 and Z. HASSAN BAYAT 3 1. Assistant Professor; Researcher & Research Assistant; Respectively; Agronomic and Horticulture Crops Research Department, Khuzestan Agricultural and Natural Resources Research and Education Center, AREEO, Ahvaz, Iran; 2. Assistant Professor; Agronomic and Horticulture Crops Research Department, Khorasan Razavi Agricultural and Natural Resources Research and Education Center, AREEO, Neyshabur, Iran; 3. Professor & Technician; Respectively; Seed and Plant Improvement Institute, Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran Abstract Tolerance to diseases is, the plant's ability to produce good yield even when the plant is infected by pathogen. In fact tolerant plants are susceptible to the pathogen but not destroyed by pathogens and generally little damage is caused on the plant. In this study, the tolerance of 20 wheat genotypes was evaluated against leaf rust. The effect of leaf rust on yield was evaluated in severe disease (stress) conditions and in protected from disease conditions (the controls) in Ahvaz area. The mean percentage of yield reduction caused by leaf rust was 25.2% over all genotypes. The range of yield loss was varied from 7 to 46 percent. The lowest yield loss due to the leaf rust, ranged from 6 to 16% in Shirodei, Aflak, Sirvan, Shiraz, Inia and Ofogh cultivars indicating their highest yield stability to leaf rust. Based on these data, the highest yield loss ranged from 30 to 50% in Bolany, Neyshabur, Toos, Alvand, Roshan, Star, Shahriar and Veerynak cultivars with the lowest yield stability. The cultivars Kavir, Shahriar, Roshan, Toos, Veerynak, Bahar, Bolany, Alvand and Ofogh were susceptible to leaf rust. Ofogh and Bahar with 16.52% and 21.8% yield loss respectively, were the most tolerant cultivars of this group. Key words: Leaf rust, Loss of yield, Tolerance to disease, Wheat.

Corresponding author: [email protected] . r. J  KD # "  GHI' #F&. ^ bE ^E aBBks   # r"0 01" G; q'' 4' . N& @%D 4' r8/ (&'  #S0. \' *   !"            : A  9  $% &


 >  'Zd' Z ‚.  n1. 1" >$ D K=  2 "B" R 1%. >   . )7 .  S" ? KV1.  $ D )? ' ''$ 5Z) tZ.  Z  >'Z)3 # Z 'Z  ]D4 #%D \ 4' > T&" S )%F (FW  # <[' $ ]ZD4 . D' $ > uX& $ " R [ $V%[' F? NZ.0. ƒZ #Z7 SZW $ . )) . 7D' ! & ~. 3  wZ[ T&" #7 (Brown rust) 5) ' [  (Leaf rust) v  !Z['3 RZ 1" .  .   R?'$ $   + 7   \" t. 4' $ . $x' Puccinia triticina Eriks RZ 1" . Z)7 . $1. '  .I 4' D   . - 4' yZ- NZ ' ZzD 4' Z \Z' >'' $ .  . 5) + Z7 ' Z  KZV1.  S" $  ! &  F? > N ' >%&4? >%&' $ S $'$ '[ $4 ]D4  $Ze 3 + Z7 #F0. 4' K =. ; # ! & \' .  $ . Z  #Z I # #7  K& $ N&' $4 ]D4 4' %8 . . . N& $S  [      $S >   UZ) o;). $ KV1.  h 8{ + 7 |3   f KZV1. #DpZ&  S"  + 7 |3 ' [ ]D4 Z #Z H%:. 5)  #D'$ . $$ . 87 K   U2 Ze. Z1%. p' 5)  S" o;). 5 " $ ~:0" 5) Z #Z W Zd' $  $Z U2.D  }{7  7{ ' Z[ ]ZD4 F?  B^^b K&  " B^^^ K& 4' . $$ . ~ZIV? ' Z[ ]ZD4 .   . + 7 % a^ " KV1. >4 p$ >Z  . Ec^ 94' #Z \Z" >  . #&  „S e. $ $ ZD'  #= )D. (FW  . 5[' #7  K& $ ]ZD4 B^^s KZ& $ . (Appel et al ., 2009) Z $4 \ Z /" Z? $  N  . 9%F 8  . N87 >%&4? #D%ZF.4  Z 5Z) $ KZV1. % b + Z7 |3 ' [ Torabi et al ., 2001; ) Z$ Z D NZ'$ SZV1. '6.

 dZ" NZ1" ' Ze  .' 5Z) KZV1.  S" #7   yD'6D7 .Torabi et al ., 2003; Dadrezaei and Aslahi, 2004; Dadrezaei % c^ 4' + Z ZF? >'6 Z . (FW 5[' $ . $'$ '[ $?  ZF  } >')3 # ' [ ]D4 >)7' . ( et al ., 2012 T'Z  o;). $ .( Ordonez et al ., 2010 ) N&'  $ NZ&'  #%?) 5) D KV1.  S" + 7 $ t. UZ) Z)D ' Z[ ]ZD4 #=Z&" !Z&). '  U Z 'l o;Z). $ KZV1.  h Z8{ + Z7 |Z3 #7 (  ( RZ4  #Z - # '    \ %D'_ ) \ "p e. # $S d' $ 5) KV1. + 7 $. .  D$ 4' = & ZD'" Z. 0SZ $Ze 3 + 7 $8D $g%&' +e{[ ' >4  #:)Z& $ #D'$ $'=" + 7 d' $ p =. ' [ ]D4 . . $$ „S c^† 4' + Kolmer, 2005; Marasas et al ., 2004; ) Z Z. #ZD'$ '6Z 5_  5ZZ) 5ZZ0. 5ZZ[' #=ZZ&"  ZZ ZZ + ZZ* \ZZ' ZZF? .( Roelfs et al ., 1992; Huerta-Espino, 2011 Z $g%Z&' ZIV%?' N.0. 4'  > $ #7  t&H- #SZ& #Z . NZ&'  9'6  D$ €%/. o;) . 4'    Z $',ZD $x'  5xD'& 5[' R :[ \' . $  . I Z  f '6. $ 5) + RV ?'' $  \' NZZfgW NZZD $  ZZ #%ZZFe ~pZZ =. ZZD NZZ.0. 4' RZ:[  #7 %[ . $ . KV1. :FD + 7 |3 5Z[' Z. DpZ; 'Z- 5Z3 . ))7 . $x' '-D #Z  h Z8{ ZF?  D # W 5) #  #W. \Z' NZ.0. 'Z-D  ZIV%?' $',D # N.0. ''$ .  D . $' KV1. $Ze 3 'Z-D |Z3 ]D4   $',D  ' $ 5[' TZ& " UZ? KZV1.  S" D'"  # R 1" . . D$ . 87 $ 5) . Z Z $ZS Z # #7 X' $ %W N&'   ]ZD4 pZ $ZS Z #Z R 1" $ 5[' D'" #7 N&' > 6 .   %d'  ,  N S= #x %D R 1" 'Z- NZfgW ZD }Z !:& KV1.  + 7 > Z >Z 6 . $  e"   '  # >$'$ 4' \ C
 GHIJ ,F ( G  F ( DE >3 :     9 +7C

#Z 4' yZ- #Z7 Z%[ ~ZIV? Butler t[ . $'$ >8D :&). #Z 8 #7 '{ $  .   ' $ KV1. + 7 #:)Z& 4' R:[ #7 D.4 .'  $ R 1%. $ $S \% #:)& Z)7 Z D $Zx ' Z NZ =  $ Z= :; +)6 >')3 Seneca tZ[ ye3Z .  D   # R 1%.  \% $  $Z=.  Z 9'6Z Z){  ( Caldwell et al ., 1958 ) 4' y- >.4 $  $ R 1%. \% #:)& 4' R:[ >.4 $ T0 #Z RZ 1" $'$ $Z HZ2 $ ]ZD4 #Z RZ 1"  m:"' \ Z ' Z=SX. \ Z ' $ . $Z:D  Z #Z R 1%. \% #:)& ' rust-enduring _' Cobb (1894)  $'$ $4 N.[  >Z.4   $S $ 5[' :FD R 1" #7  N 0" # C Z ]ZD4 # $S ){ #7 ) 5) 4' ` " } € I" ' Zg%. ZD4 #Zx)- >Z.4  Z $ZS #Z N:FD R.7   $:.ZD . $Z Ze ( )%Z'$ Z? $Ze 3 Z.' D$  . . (Roberts et al ., 1984)  . . )Z . $D  F  5) #D \' #7 $'$ u C" \ )‡ #ZZ7  $ZZ=%. o;ZZ). $ >  ' ZZ -  #ZZD'$ $ZZe 3 ZD$'$ $)Z8 - (Bolley and Pritchard, 1906) $‡-  S  +) 6 $ t.  =. >')3 # $'$ $ 1. X   +)" ]D4   T ' $ p #D'$ '6 >4  5[' +) 6  #7     9 >)7 " . N&' #% '[ $g%&' $. 5[' =. Z& $ . $Z D UZ/%D' ' ]ZD4 #Z R 1%. 5[' >'" . #Z).'$ $ Z   5[' $e 3  ' - 4'   '  $=%. 4' RZ:[ $S $ Amilcar t[ R 1" Martinez et al . (2012) $Ze 3 #ZF 0. . D'  # ''  '  U T ' 4' & = 4' ZI$ Ek Z)" ' Z[ ]ZD4 # N:FD t{- v f +)  6Z  ( +)Z" >Z  +)Z" ) $Z‚%. ZX 1. T ' $ k^ $ZW (FW   #7 SW $ $'$ N&$ 4' ' $e 3 ZI' ƒZ ) 4& T 1. $  # #7   ` "D_ tZZ[ RZZ 1" RZZ 0. $ . $'$ NZZ&$ 4' ' $ZZe 3 4' ZZI$ Clarke et al ., 1992; Ehdaie ) NZ&' $Z  + ,- #D \ ' ' $Ze 3 4' I$ BE )" t{- v f 4' = Avispa ' .( et al ., 1988 c^ $ZZW $ (ZZFW  ZZ #ZZ7 SZZW $ $'$ NZZ&$ 4' ‰?ZZ ( Fisher and Maurer, 1978 ) ZZ.  ZZ8  RZ 1" 4' "g %. e %D_ K%)7 #7 $'$ >8D @%D \' I$ #Z7 ZD$7 =.  \ S'  ' ' (SSI) +)" # N &FW RZS ! Z 7"  ) t[ $ \ [H" . $'$ $ t[ $  $ ' Z  +)Z" T Z1. $ pZ $e 3  >   D'" . T0 uXZ& +  '6Z' #Z x). N&' \e . ( t[ $  $ UX. T Z1. $ Z?  Zz" Z/%D'  ` "D_  )* U/%D' . (Martinez et al ., 2012) $ R 1" $' > Z #Z7 $Z $'' \'  N'$  ) '/D +)" >  K%)7 T ' N1" ' [ ]D4 # R 1" =SX. Z&) \ hD .  ‰? (Fernandez, 1992) 4DD . sk   $',D # N:FD >D 5) t[ $ 4' $g%&'  #D/ $ ZZD'" ZZ. #ZZ7 ' ESTI +)ZZ" #ZZ RZZ 1" ‰?ZZ  BGMP    Z Z  # 4' y- Roberts et al . (1984) T&" B  T Z1. T'Z $ NZ1" $Ze 3-  RZ 1%. Z ` "D_   ' Z[ ]ZD4 Zd' #ZF 0. .  5xD'  N?')e  (FW   #SF. # #"  . $7 =. ' ))7 6 %. + Z7 \  %Z8 #7 $'$ >8D #D'$ >4  $'=" #D'$ $e 3 5Z[' N?) z). # 54p  + ,- $. 5[' > #Z 4' RZ:[  Z $ZS #Z m .  I$ ck R7 \ hD . Z87 $  Z #Z RZ 1" Z 7  4& n$  R 1%. c $ZW 6 Z D $Ze 3 + Z7 T&%. .  . \% #:)& $ ]ZD4 #Z 5Z[' RZ 1" >'6 .  o 01" . N&'  C . Z . \% #:)& # 4' =   $S # m .  I$ $ NZfgW 4' pZ uXZ&  t[ \" R 1%. Fulhard t[ SSI = Stress Susceptibility Index = +)" # N &FW ‰?  RZ 1" . NZ'$ ' ]D4  ' $ $e 3 ! &  + 7  ' STI = Stress Tolerance Index = +)" # R 1" ‰? B Fulhard Kanqueen GMP = Geometric Mean Productivity =q  r&) \ hD . E RZ 1" Z.' $Z t[ 4' % 7 #{ '  t[   !"            : A  9  $% &


K; # T ? k $ ` "D_  .  &  ` "D_ \'  4' ZZe  ZZD'" ZZ.  ZZ #ZZ RZZ 1" . $'ZZD $ZZ >' 'ZZ Z%. $ JZ b^^ JZ t7'Z"  %. %D& B^ #I  %. k :ZFD RZ 1" \ ="   ` "D_  '  t.   ,  $ $ 'Ze" #Z& Z $V" R.7 n G; !S[ $ < . #D \ ' >'% ' . N&'  C  .'  ]D4 # ` "D_  KZ& #Z& Z. #Z 4'Z ' $  >   T ' (ZFW 5Z[' \ 6h  ' R FD%--  (FW R 1%. 5[' Z ` "D_ ".0. &  J  e" K' K & .  4' WHZI'   [H" $ N.0.   >_ D  S' >')3 # #Z% ZzD $ 7JZS' ‹ + .4  '' 5&  5$ K&  $       # K %W' #7 0;).  ' >'" . $ D . . \%ZFe >Ze.'   Z   Z Z $    + d'  #ZZ36. $ 4'ZZ ' >%ZZF h%ZZF' $ + ,ZZ- \ 'ZZ $Z. 5Z[' NZ87 # %8 >) ;'  $'$ $ N.0. 4' RZ:[ Z ZD4 #Z. + ,- \' $ .  '' 8.4 5Z) 87 4' ' $%F W'D $ \ )‡ . $ D 5'[' zD +e{[  D4 #. >  "   5xD' t{- v f 5[' o;). \ '  '   . D4  2   +)" Š=. $   'Z . Z #Z% ZzD $   >')3 #   $ Nz1. >$Z (ZFW R S$ # .' $'$ $ X 1. +)" # R 1%. 5ZD Z K4ZDe -- +e{Z[ 4'      " NfgW $ DZ ƒJZW  S" #?{ 4' N&' \e . ]D4   # $ Z% S t ZD >'6 Z . #Z EC 25% > Z&p.  N "  x" . ) R 1%.   # N&' \e . 5[' \ ' #7 "I #Z  Z $g%Z&' ' Z[ ]ZD4 9 f 4' R:[ %e #36. $ 5)   ` "D_ R 1" >'6 . + ,- \ ' $ $Zx ' T  'Z $ . Z 'Ze" Œ & :e  #%g #& #I #Z #Z7 ( 4'Z ' ) >%&4?  487 0 01" 67. 8 .4 tZ[ Z%. k KZ;  $  Z)- # + .4 $ " $    ZZ&) ZZ. ZZ&  DZZ ZZ. $ZZS ' ZZ[ ]ZZD4 #Z  Z 4' NZfgW T ' $ .  N87 Dp (FW ZZ=.   ZZ #ZZ RZZ 1%. R ZZFD%--  ZZ ` ZZ "D_ tZ[   Z 4' NZfgW +  Z.4 $ " $ ! "" \  5Z) GHZI' $ Z > $ Z7 ƒZ  t[ \ " R 1%. 4' $g%Z&' Z  3)ZV. ZD4 .# . $ N87 #?7 50.  Z # R 1"  hS 2  ' .7   ‰? &  ]ZD4 ŒZ&' 4' ;Z/. V ) #0X). ]D4   '# . $ + ,- \ '  '' ƒ' ' #  4' $ %Z&$ 9Z- $ } 7 # ( $ # }  N:FD # }S" $- Z- ŒZ&' 5Zh) $ .  $ 5xD' U2 $  5'  ' #, K9 %. t D  }  g"' # } %&H- }  T&" 7 $ " $ 5Z[' R 1" >'6 . \ ="  4'   ' + ,- \ ' $ \ .Z" \ Z.4 # Z " 4' tZ3' 3'4   3 # .7  V1. >' Z& ` Z "D_ B^ 5Z) ' Z[ ]ZD4 $S # N:FD ƒ3 (&' 4   €3  4:.     $7   4 D n)   (" \    7 B >' {  nH' %&' Z 4'  '$ N'$$  .  5xD' )   # I"  #0X).  Z8 D  Z ) ' tZ  >'Z { >%F &  o'  DS' 4'   Z Zf $ %?'Z)e 4' y-  t{- v 4'  Z- 5Z['  Z ` Z "D_ \ Z )' D & Dp   $  ZI$ \ Z =" oZ; 4' Z:e 4 $ Z (FW t[  #Z RZ 1" Z)D. UZX.  ZF  Z Z,   Z  R FD%- GHZI' 9 (Z&' Z ( ^ ^^ ) vZ uX& $S +- ]D4 # :S2 #7 $    . )D D4  2   +)" et al $ZS ` Z " I #  (Peterson ., 1948) U7  Z ' Z[ ]ZD4 Zd' .( )Z Z. (ZFW $4   ' [ et al : :  5xD' R  G # Roelfs . (1992) 9 (&'  $  Z  Z T  'Z $ $ 5Z) KZV1. $e 3 . . t H3 #Dh‡ > : >V. = O Z (4' +e{Z[ t& 4' $g%&'  )  NfgW T'

GHIJ ,F ( G  F ( DE >3 :     9 +7C

(F ? I$ ) } Z "7  } Z "eD  'D   #eS f : 50. = R SI =Stress Intensity= (Fisher and Maurer, 1978) . )7'-  6    9   Œ&' f >

ZZ #ZZD'$ $ZZe 3 ! ZZ "" #ZZ  TZZ ' \ ZZ ' $ #Z7 ]ZD4 }Z{7  Z 9Z f : 50. # =D MR >Z )  Z >Z  ( +)Z" )  Z T ' $ ` "D_ D'.  #;W' } "eD   #eS # & Z ` Z "D_ R7 #D'$ $e 3 \ hD . ! "" #   ( +)" TZ&%. 4'ZD' #Z   9 f : (FW # =D MS Z # Z 6x" .  .   T ' $    > T ' $ . } "7   #eS  '  } "eD #eS > yD ' # 6x" 5$ K& > - $  K&  $ $& yD ' 'Z0. #Z ]ZD4 v6Z  Z 9Z $ : (FW = S .  5xD' 7 gI   !7.  . #eS \ '  '  } "7   #eS >  >'' Z \% zD $  #36. $    \ hD . L  9 M! Z (&'   ` "D_ .   4' 7 # $   #Z N:FD & $.   ` "D_ +)7'  V/8.  k^ S Z ) pZ Z Z $ZS Z #& # $S   # 4' ' $ . N&'  # ''  K $ ' [ ]D4  k^( S 4' Z% 7  b^ S) TZ&%. Z Z $ZS  ("p HZ2 Z8  .4 #Z36. $ ' Z[ ]D4 N?')e     >Z.4  .$ DZ t F0" ( b^ S 4' % 7 ) \ -   $S $ ' Z[ ]ZD4 N Z S= >.4  '0%&' . .  $ $x '  Z   4'ZD' #D'$ '6 >4  7  #D'$ $e 3 N'$ \  Z . $Z 'Z #:)Z& Zf  >.6  4 k^ $W +)Z" #Z RZ 1"  '  ` "D_   4' N'$ 4' y- . #Z N:ZFD RZ 1" _- $ & $.   ` "D_ ! "" $Ze 3 \ hD Z . 4' $g%&'  z). . \  5xD'   N Z S= . 1S # t   1S # t ' [ ]D4  Z >Z  ( +)Z" )  Z T  'Z $ ` "D_  #D'$ UX.  F T ' $   %?')e  t    R.3 ( STI )  Z +)Z" #Z RZ 1"  Z ‰? ( +)" > )    \ ' # 5[' R 1"  N.0.  ) % '[   # \ hD Z .  (TOL ) RZ 1" ‰?Z ( SSI ) +)Z" # N &FW $. $. 4'    N S=  7'W T ' $ ‰?Z ( GMP )   Z &) \ hD . ( MP )    B B KZ $ #ZD'$ $Ze 3 !7. yD ' # 6x" @ %D ZZI$  (YSI ) $ZZe 3  ' ZZ - ‰?ZZ  ( YI ) $ZZe 3 $ #ZD'$ $Ze 3 \ Z @  Z%D (Z&'  . N&'  $'$ >8D 5Z[' $ ( SI ) +)"   ( PYV ) t[  $e 3 ' l" >'6 Z . ZzD 4' $ZS Z[  $S  " €%/.   'e" :  #:&1. R  G # ( ZI$ } Z uX& $ )  '$ )=.  F g" #D'$ $e 3 SSI = Stress Susceptibility Index = (Fisher and Maurer,  $ZS 5Z3 R 0%.  d" N1" #D'$ $e 3 . N'$ $ 1978) . . $'$ >8D  '$ )=.  F g" 6 D t[  $S STI = Stress Tolerance Index = (Fernandez, 1992) $ #D'$ '6 >4  #D'$ $e 3 g" >$ '$ )=. 4' TOL= Tolerance Index = – (Rosiellev and Hamblin, 1981) #Z7 NZ #Zx %D >'Z" Z. + .4  '' €%/.   K& MP = Mean Productivity= (Rosiellev and Hamblin, 1981) $  #%Z'$ d' K& yD ' $ T0 K& d' 4' D g" GMP = Geometric Mean Productivity = (Fernandez,1992) . . N&' $ D $   l"  " yD ' YSI = Yield Stability Index = (Bouslama and Schapaugh, 1984) /^ /^ BcBb ' Z[ ]D4 #S& $ ( SI ) +)"  \ hD . YI = Yield Index = (Gavuzzi et al ., 1997)   Z ‰?Z #SZ& $ @  Z%D (&'  \ )‡ .  #:&1. PYV = Percentage yield variations of each cultivar =   !"            : A  9  $% &


:( k^S  ,O! ? 9 b^ S)  *C R#!" +F    Z #Z N:ZFD KZV1. $e 3 ' l" \ % 7 +)"  Z8 D  ) ' t  >' { >%F & t[ Ng $S T&%. nHZ'  $ Z 5Z[' #Z mZ . ! Z "" # ' [ ]D4 k^ k^ S 4' Z% 7  b^ S 4' "pZ 'e" #& $ 4'    $  \k ZZ + ZZ7 ZZI$ ZZ oZZ'   )ZZ ' 4' ZZ >' ZZ& Z  Z ' ) /%  4'   a/c%   $  . $ N'$$  #Z N:ZFD 7JZ. 5Z[' ! Z "" #Z #7 $ I$ k c/ S' + ZZ7 BE% b/ ZZ >'ZZ {  B^% c/ ZZ >%ZZF &  B% ca/ )%Z'$ ' $Ze 3  ' Z - \  %Z8 4' ' $ ' [ ]D4 „SZ #7  8 D # N:FD  " R 1%. 5[' ! "" # $e 3 c(. K ) yZ-  8 .D D$ N'$ $e 3 + 7  F? b^%  Z  $e 3 ' l" \ %8 :&1. \ (&'  Z1S 4'  8 D . N'$ ' F? I$ \ "p Dp 4' 5Z[' ! Z "" #Z KZV1. + Z7 ZI$ c^ S' E^ $W $ 5 Z 7 kB #D S& + 7   K&  $ + 7 >'6 .    ZZ %ZZ&' \ZZ ZZDS' (ZZ"  ZZ8 D  DpZZ + Z7 Z  $  . $ ''$ ' F? >'6 . \ %8 %e ' $Ze 3  ' Z - \  Z% 7  ZF? \  %Z8 n)  + Z7 >'6 Z . \  Z% 7 %e $ 5 7  ^ $W #D S& ZI$ \ hD Z . Z x. $ . )%Z'$ ' Z[ ]D4 # N:FD . . NZ'$ ' Z[ ]ZD4 #Z $S T ' $ ' #D'$ $e 3 # N:FD K& $ $ & $.   ` "D_ $e 3 + 7 >'Z {  ZI$ ^ b/  $ Z   Z ) ' 5[' #D'$ '6 >4 c(. K ) $ $ I$ Bc Bb/ 4' ' $ ' [ ]D4 . . D$'$ >8D + 7 $S 53 T ' # N:FD I$ B E/  ' ZZ[ ]ZZD4  ZZ #ZZ $ZZS ZZ (ZZ&' ZZ E^aE Z 4' Z 5Z['  Z T 1. $ #D'$ $e 3 zD 4' : )% '[ R   #& $  ` "D_ $ $ 5 Z 7 Basb   ' ) 5 7  E^b  >%F &  5 7  :( , NO 9 k^S +OF )  O*C  N +F   $Ze 3 \ %8 %e $ 5 7  BaEc  >' {  %e  DpZ Z nZ)   (Z" \Z    7 5[' b.( b.( K ) )%'$ ' \ Z ' $ k^S  p $S T&%.  'e" #& $ o'  DS'  k% cB/ Z ! Z "" #Z Z  o' 5[' . )%'$ '[  ' ' Z[ ]D4   # N:FD 5)   ` "D_ +)7' 'T S93  )%ZZZ'$ ' + ZZZ7 \  ZZZ% 7 $ZZZe 3 + ZZZ7 B% / Eab Eac  EaE Eab 3'4   K& $ 4' ' h%F' $ Table 1. Wheat genotyp reactions to leaf rust in 2015 to 2016 in . D$  \ ' 5[' \ " R 1%. Ahvaz station   Z T Z1. $ $ 5Z[' $Ze 3 \ hD Z . zD 4' Wheat genotypes 2015 Wheat genotypes 2016 1 Neyshabur 50S Neyshabur 50S \ hD Z . Z oZ' tZ[ Z3'4 K& $ . $   > 2 Kavir 80S Kavir 90S 3 Shirodei 10MS Shirodei 50S $e 3    K' #:" $ %e $  7  Eab.b $ e 3 4 Shiraz 40MS Shiraz 50S 5 Shahriar 80S Shahriar 70S \ hD Z . 5Z& #Z:" $ nHZ' 4' yZ- %e $  7 Esaa 6 Sistan 40MS Sistan 50S 7 Sirvan 0 Sirvan 30S 8 Star TMS Star 5MS $ nHZ' tZ[ . E( K ) )% '[ T 1. $ $ $e 3 9 Aflak 5MS Aflak 20R 10 Roshan 60S Roshan 90S #ZD'$ '6Z >4 . N'$ '[ 50. 5['  $ + .4 \ ' 11 Chamran 30MS Chamran 50S 12 Toos 70S Toos 60S Z% 7  t[  % B 4' % 7 ' [ ]D4 # N:FD o' t[ 13 Veerynak 60S Veerynak 70S 14 Bahar 30MS Bahar 60S . D$'$ >8D + 7 % s 4' 15 Bolany 80S Bolany 80S 16 Bam 50S Bam 50S ZI$ b Z (Z"   Z8 D  ZI$ bk Z Dp 17 Inia 30S Inia 50MS 18 Alvand 60MS Alvand 60S 19 Ofogh 30S Ofogh 70S ' $Ze 3 + Z7 \  %Z8  Z # N:FD $e 3 + 7 20 Chamran 2 10MS Chamran 2 20MS . )%'$   \ ' # N:FD
 GHIJ ,F ( G  F ( DE >3 :     9 +7C

( ( EaE ac– ) ' [ ]D4   +)" 53  +)" T ' $ 5[' #D'$ $e 3 !7. yD ' # 6x" 5T S93 Table 2. Combined analysis of variance for grain yield in non-stress and stress of leaf rust condition (2015 to 2016)

+,U V" C 3 +2," W M" +2," :X" S.O.V Degrees of Freedom Sum of Squares Mean Square Year K& 1 22503862.84 22503862.84 ** Stress (>e. T) 1. 1 62384226.34 62384226.34 ** YS K& *>e. 1 8144218.84 8144218.84 ** Rep(YS) >e.  K& >$ 'e" 8 1916803.03 239600.38 ** Genotype ` "D_ 19 27525069.55 1448687.87 ** YG K& *` "D_ 19 19722392.41 1038020.65 ** SG >e. *` "D_ 19 13250524.25 697396.01 ** YSG K& *>e. *` "D_ 19 5660097.75 297899.88 ** Error X? 152 18340270.30 120659.67 Total 239 179447465.3

CV=11.08% A ** Significant at 1% %  uX& $ '$ )=. **

( ( EaE Eac 3'4  K& ) ' [ ]D4     2 T' $  $ 5)  ` "D_ #D'$ $e 3 #S& $ \ hD . #F0. 8T S93 Table 3. Mean comparison grain yield of wheat genotypes in both condition under non-stress and stress of leaf rust (2015 to 2016 cropping seasons) Y       ,<> Z : X "  [ 9 NO Wheat genotypes Mean grain yield (tha -1) 1000 grain weight(g) 1 Ofogh 3894.4a 33hi 2 Aflak 3845.1ab 38c 3 Bahar 3798.9abc 35fg 4 Alvand 3738.1abcd 34gh 5 Star 3708.3abcd 42b 6 Neyshabur 3619.6abcd 37cde 7 Sirvan 3593.9abcd 43a 8 Veerynak 3535.6abcd 34ghi 9 Sistan 3482.1abcde 38cd 10 Chamran 3377.1abcde 38cd 11 Chamran 2 3334.6abcde 37cde 12 Bam 3283.3bcde 35fg 13 Toos 3276.1bcde 29j 14 Shiraz 3230.9cdef9 33hi 15 Inia 3187.8defg 34ghi 16 Kavir 3187.6defg 32i 17 Shahriar 3150.6defg 29j 18 Shirodei 2947.0efg 37de 19 Bolany 2713.9fg 29j 20 Roshan 2665.2G 36EF   !"            : A  9  $% &


( ( EaE Eac 3'4   K& ) ' [ ]D4     2 T' $ 5)   ` "D_ #D'$ $e 3 #S& $ \ hD . \T S93 Table 4. Mean comparison grain yield of wheat genotypes in both condition under non-stress and stress of leaf rust (2015 to 2016 cropping seasons)   ,]   without leaf rust under leaf rust

       ,<> Z : X "  [ 9        ,<> Z : X "  [ 9 Mean grain yield 1000 grain Mean grain yield 1000grain Wheat genotypes -1 Wheat genotypes -1 (tha ) weight(g) (tha ) weight(g) Alvand 4631.0 38.4 Aflak 3706.9 38.4 Neyshabur 4550.8 41.7 Ofogh 3543.7 31.1 Star 4397.9 43.9 Sirvan 3448.8 40.5 Bahar 4263.5 38.1 Bahar 3334.3 31.7 Ofogh 4245.1 35.3 Shiraz 3093.1 28.9 Veerynak 4153.4 37.4 Sistan 3084.4 33.5 Toos 4110.7 32.6 Star 3018.7 39.4 Aflak 3983.4 38.0 Inia 2973.6 32 Sistan 3879.8 42.4 Chamran 2935.3 35.3 Chamran 2 3828.2 39.7 Veerynak 2917.9 30.4 Chamran 3819.0 40.3 Shirodei 2857.2 34.6 Bam 3752.1 39.8 Alvand 2845.2 29.6 Sirvan 3738.9 46.0 Chamran 2 2841.0 34.7 Shahriar 3724.6 32.1 Bam 2814.5 30.1 Kavir 3697.8 36.0 Neyshabur 2688.4 33 Bolany 3525.0 35.1 Kavir 2677.4 28.9 Inia 3402.0 35.7 Shahriar 2576.5 25.5 Shiraz 3368.7 36.3 Toos 2441.6 25.5 Roshan 3221.7 40.2 Roshan 2108.8 32.1 Shirodei 3036.8 38.6 Bolany 1902.9 23.1

  >  ' [ ]D4  T' $  $ 5)  ` "D_ #D'$ $e 3 \ hD . ^T S93 ( ( EaE Eac 3'4  K&  ) > # R 1"  N &FW  ‰? Table 5. Mean grain yield of wheat genotypes in both condition under non-stress and stress of leaf rust and their susceptibility and tolerance indices (2015 to 2016 cropping seasons) Wheat genotypes Stress indexes under disease condition

SSI TOL STI MP GMP YSI YI PYV 1 Shirodei 0.23 179.61 0.58 2946.97 2945.60 0.94 0.99 5.9145 2 Aflak 0.27 276.50 0.99 3845.14 3842.65 0.93 1.28 6.9413 3 Sirvan 0.31 290.11 0.86 3593.89 3590.96 0.92 1.19 7.7592 4 Shiraz 0.32 275.67 0.70 3230.89 3227.95 0.92 1.07 8.1831 5 Inia 0.50 428.44 0.68 3187.78 3180.57 0.87 1.03 12.594 6 Ofogh 0.65 701.39 1.01 3894.36 3878.54 0.83 1.23 16.522 7 Sistan 0.81 795.39 0.80 3482.14 3459.35 0.79 1.07 20.501 8 Bahar 0.86 929.25 0.95 3798.88 3770.35 0.78 1.15 21.795 9 Chamran 0.92 883.72 0.75 3377.14 3348.11 0.77 1.02 23.14 10 Bam 0.99 937.61 0.71 3283.31 3249.66 0.75 0.97 24.989 11 Chamran 2 1.02 987.22 0.73 3334.61 3297.87 0.74 0.98 25.788 12 Kavir 1.09 1020.39 0.66 3187.64 3146.54 0.72 0.93 27.594 13 Veerynak 1.18 1235.50 0.81 3535.64 3481.25 0.70 1.01 29.747 14 Shahriar 1.22 1148.11 0.64 3150.56 3097.82 0.69 0.89 30.825 15 Star 1.24 1379.28 0.89 3708.31 3643.61 0.69 1.04 31.362 16 Roshan 1.37 1112.89 0.45 2665.22 2606.49 0.65 0.73 34.544 17 Alvand 1.53 1785.78 0.88 3738.11 3629.91 0.61 0.98 38.561 18 Toos 1.61 1669.17 0.67 3276.14 3168.05 0.59 0.84 40.605 19 Neyshabur 1.62 1862.39 0.82 3619.64 3497.81 0.59 0.93 40.924 20 Bolany 1.82 1622.11 0.45 2713.94 2589.92 0.54 0.66 46.017 SSI = Stress Susceptibility Index = +)" # N &FW ‰? ; TOL = Tolerance Index = R 1" ‰? ; STI = Stress Tolerance Index= ‰? +)" # R 1" ; MP = Mean Productivity=   \ hD . ‰? ; GMP = Geometric Mean Productivity =  Z Z&) \ hD Z . ; YSI = Yield Stability Index = $e 3  ' - ‰? ; YI = Yield Index = $e 3 ‰? ; PYV = Percentage yield variations of each cultivar = ' Z l" ZI$ t[  $e 3
 GHIJ ,F ( G  F ( DE >3 :     9 +7C

. NZ&' #%Z'$ KZV1. $e 3 gI   '  d" \ %8 5Z[' :( b^ S  ,O! ? )  O*C :  O_ +F   #Z 'Z  $'$ DpZ; #‡/ "  ]D4 \ h)& F? b^ S 4' Z% 7 $ZS Z B >'Z {  nHZ' %Z&' >' & RZ [  $ZV%[' ZF?  ''$ 5Z) tZ.    >')3 >Z8D ' NZ.0. +)Z7' \  "pZ  $S  \ % 7 Z  #Z $ KZ. >')3 # . D' $ > uX& $ " B >'Z { sk/s% >' Z&  ab/k% $ZW nHZ' t[ . D$'$ c/ c/ $ZW >' Z ' $ $4 ]ZD4 ZF? >'6 . s sB K& $ 5Z[' \ Z .' )%Z'$ $e 3 + 7 E% b/ %&'  Bc% / 5Z[' 4' $g%Z&' . $Z Z $ Z  Z S" + 7 \" > .  E^a  Bb  Ebba  Es^s ! ZZ "" #ZZ  ZZ T 'ZZ .' . N&'  ]D4 K%)7 9 \ "  $V%['  \ "d“. 50. #ZD'$ '6 >4 . b( K ) )%'$ $e 3 %e $ 5 7  $Zx '  D'"   ]D4 '4   R.'3   J-  l" R S  Z # $S T ' $ B >' {  >' & %&' 5[' Z KZ& 4' yZ- #Z7  FD%- -   ` "D_     $',D 5Z3 T  'Z #Z N:ZFD ZI$ B b/ B  ^ !E/ "" # Z. 3 DZ . =. 50. 5[' >')3 # o 01"  9H" $ nHZ' tZ[ #ZD'$ '6Z >4 S $'$ >8D + 7 $S #%Fe  ]D4 #  > N.0. ". 4' y- N87 #I3 $ #Z +)Z7' ` " zD 4' %&' . $'D >8D 8 7 T ' \ Z[ R Z S$ # T 1. T ' >$ 3F. I $   ZI$ zD 4' .' $'$ >8D ' +)7' \ " 50. ' [ ]D4 $%ZF Z  #Z |Z3 Z ]D4 < & R.  S"   e" Z $ ' $Ze 3 + Z7 I$ \ %8 $e 3 + 7   ' Z -D  F? {$ KV1.  S"  D .   tZ[ 4' yZ- #Z=SX. $Z. 5[' \ $  N'$ 50. 5[' Z  Z tZ&H-_  $e 3 4' NfgW  ' 'JS .   '? tZ8 #Z:" $ $e 3 + 7 E% b/  %&' \ (FW #Z  Zx" 5Z['  '$ #hD  ƒJW $: '   87 9 4' c(. K ) N'$ '[ $'$ NZ87 #Z.'$' 4' .[' # )" #7 $$ K 3' ' #D :ZFD Z:d +  Z.4  'Z' @  Z%D $ #" R [ #%eD #Z7 NZ&' 4 D R S$ \ # ) R 1%.   # #7 $ $  +  Z.4  '' K& $  $ >' & t[ #D'$ $e 3 5Z['  DZ #%'$ #hD   &)   # R 1%. 5[' .( b KZ ) Z Z. $ZS  $S 53 T ' $  #ZD$ 4' $ . $'  > #    F? #7 (FW ' >' Z& tZ[ >'" . + .4 \ ' @ %D # #"  \ ' ) T  'Z $ $Ze 3  ' Z - Z" D$ L?  S"  N87 T  'Z #Z N:ZFD p  4&  R FD%- - [ >')3 # >Z.4 $ Z ]ZD4 Z 4:. 53 . $ ”gW ]D4   # >' Z& tZ[ . NFD'$ ' [ ]D4   +)" 53  +)" $ . $Z Z. KZV1. # " R [ F? |3 !&).  $ZS 5Z3 T  'Z $ Z $ ' #D'$'6 >4 \ %8 $  Z N  Z. $ :Z&). #Z) 6 R 1" X ' \ ){ $ $ t[ \ ' #D'$ '6 >4 g" S N&' #%'$ $S \ h)Z& F? 4' #7  . N.0. > #%Fe I 5Z[' \ Z $ . $Z '$ Z)=. $ZS  $S 53 T ' $Ze 3  pZ  ' -D   S"   + 7  KV1. # $ $ nHZ' tZ[ #ZD'$ '6Z >4 g" T0 & $. . . )7 .    >'Z" . \ ' ) $:D '$ )=. $S  $S 53 T '  D Z 6 Z D  Z #Z RZ 1%. >   U/%D' $ I' ƒ '  Z d " \ % 7   N =C t[ \ ' $ #7 N #x %D . Z Z.  Z T  'Z $ $Ze 3  ' Z -  p  S" '$$. #D'$ '6 >4 o ; 4' #D'$ $e 3    Z # +)" T ' $ p $e 3 \ hD .  5[' $ DZ ( 0. $ 5) D4 +)" R.3 \ " t.  ]D4  Z=.  5Z[' \ Z '  &) #7 $'$ >8D + ,- \ ' $ $ ,  Z 5Z) $Ze 3 + 7 |3 D4 +)" \ .' )%F   Z ZX? - o;). $ $e 3  ' - |3 > #=&" } Z _S R.'3 4' D +)" \ .' $ .   # T '   !"            : A  9  $% &

$Z? Z. 3  ) 7 . #0X). $ F?   9%F .   '?  5Z0. 5 Z[' N&' \e . .' D . 6 {D F? {$ !Z&).  ZF ' } Z #Ze) '  H3   # R 1" Z  Z  R.7 N.0. $  (FW # D %W  50. #  D Z > NZ.0. #7  FD%- - 5[' ƒJW 4'     ' >'Z)3 #Z ) DZ " R [ F? {$ :FD N.0. . Z .  #%Fe N.0.   >_ }" 4' $g%&' R S$ # >Z{ Z.' ( ' Z[ ]D4 R 0. $ B >' {  %&' t[ K. $ #Z7 ' Z ] ZD4     $',D < &  S"  $ x ' Re8.  $Z Z% 7 (ZFW 5Z[' 4'  > F? #% t   NZ= :; $ ' = :;  D4   T 1. $ N [ T ' $Zx  ' 4'  Z) $ Z. + Z7 ' >    ]D4 9%F $Z boom and bust cycle #?{ $ ]D4 R.3  5) \ #Z0X). $ Z > $Z Z))7 .        # #Z #  $3  = :;  4'  R 1%. 5[' 6 D ' $'$   Z N  .  $e 3  ' - ”gW  .'  .  g. ' RZ.'3 \ Z ' N Z =  Z Z + 8    $',D $e 3 #7 &FW 5[' . $ 67 %. (FW 5['      #x %D $   = :; K$=" ”gW |3 'JS  $ . + 7 ' )%Z'$   Z + 7  #% '[  d" N1" '   >  D. .    6 D   '4   $',D f 4'   Z  dZ" NZ1" Z% 7  >  $e 3 #7 .['  ƒJW 4' u 1ZI n$   +)" #  ` "D_ R 1" & $ $ NZ87 ' %&'  ' ' )%'$ S:[ R [ $e 3  D$ ]D4    ' >'" . T 1.  > 6 .  \ R.=" %:Z&). 5Z[' Z" $ Z D  '$Z   $7  '$ #hD #0X).  $ D U/%D' +)"   ‰? > . 4' :&). ‰? 6 D #Z7 )%ZF   ` "D_ R 1%.   ` "D_ . D \ 6h  ‰?Z . $'$ 5ZxD' ' 5Z['  Z #Z RZ 1"  Z) #:" $Ze 3 N' \ hD . # N:FD +)" T ' $  > $e 3  'Z Z ‰?Z   Z& Z #F 0. $ SSI +)" # N &FW \ ZZ ' ZZ . ZZ ZZ% 7 +)ZZ" T 'ZZ $ ZZ ` ZZ "D_ # 7ZZ Z" !Z&).  Z # (FW   ` "D_  &)  K 2 $ Z > $Ze 3 N' + .4 \ ' $ #7   ` "D_ (&' $Ze 3  ' -  % 7 ‰? \ ' '0. #{  . N&' ]ZD4 #Z RZ 1%. $ % 7 % Bc 4' ' [ ]D4 +)" T ' ‰?Z \ Z ' Z.' $Z  '? %8 +)" T ' $ ` "D_ . . )%F ' [ N Z f ) +)Z" > T ' $ p $e 3 hD8D D'" D (&'  '  ` "D_ R 1" >'" . SSI  =. (&'  ‰?Z \ Z)‡  ‰? \ ' ' 4  ( $e 3  p $Z: '  4' Zz). \ Z ' #Z . $Z7  ) #:" $e 3  ' - >'6 ZZ . 4' ZZ 7   JZZ-  dZZ" #ZZ7 )%ZZF ZZV? $ TOL T Z1. $ Z $  ` "D_ $e 3  $0. (&'  +) 6 T  'Z $  Z  $e 3 >'6 . 4' %8  D'$ #)  $e 3 Z)7   &) z). # . $ . $g%&' +)" >  +)"  ( SSI ) +)Z" #Z N Z&FW ‰?Z . ZD' #% J-  d" +)"   Z ` Z "D_ > Z . 4' +)Z" #Z (FW   ` "D_ \%'J   ‰? )D'" (. PYV ) t[  $e 3 ' l" I$ \ .  )7 t . \ =" ' SSI ‰? 7 #D%& >'6 . R 1%. ZX? - o;). $ ]D4 # R 1%. 5[' U/%D'  ' :&). Z ) #ZX ' 4' '  Z =. SSI >'6 . #7 $ . R 3 ! "" ‰?Z Z.' ) >l. N$  K  o;). )D. $4 ]D4   ''$  ZZ ` ZZ "D_  ( c KZZ ) $ NZZ& (  – +)ZZ" ‰?Z Z ‰?Z   Z&  #F 0. $ STI +)" # R 1" ' +  Z.4 T ' $  =. SSI 4' %8    F. SSI '0. $ $ UZX. $ Ze 3 Z Z ` "D_  &)  ' !&). $.   ` "D_ > . 4'  #% zD $   # (FW o;Z).  'Z ‰? \ .'  . +)" >  +)" T ' . . $$ . ƒJW }Z8? # D o;).   67. o;). )D. 6 D ]D4 "X? t7 @  Z%D $ (  +)Z" Z = sc/^ ) =. SSI (&'   ]ZD4  Z e" 4' 5Z) 5Z0. 5Z[' . NZ&'" !Z&). 87
GHIJ ,F ( G  F ( DE >3 :     9 +7C

\ Z ' RZ 1" R Z S$ # N.0. > #%Fe I $ [H" 5ZZ[' ( c KZZ ) ' ZZ[ ]ZZD4 #ZZ N:ZZFD 4'ZZ ' #SZZ& $ $ $ZZe 3  ' Z -  #ZZ%  + Z7 ZZF? >'6 Z . 5Z['  Z =. SSI #Z7 oZ'   Z ) ' 4' Z >' & nH'  $  . . $$ . \ ."   >   # T ' \ Z ' $ . DZ ƒJZW # 0  U/%D' $ sc/^ 4' % 7  > Z >'Z" Z. + ,Z- \ ' 4' . N& @ %D (&'  ]ZD4 #Z R 1%. 5[' >')3 #  ) '  o' (FW 5[' > . ]ZD4 #Z RZ 1"  'Z ' >%ZF &   t[ Š 2' 7 \ 6h  Z Z" . DZ Z. =. 5[' [H" #D'6? $ ' [ . . $7 #C' [H" #D'6? # ' [ $ NZ.0.  Z >_ ZD  ZS' >'Z)3 #Z (ZFW 5[' #ZD'6? $ 5Z[' \ Z ' 4' $g%Z&'   D WHI'   [H"

References

APPEL, J. A., E. DEWOLF, W. W. BOCKUS and T. TODD, DADREZAIE, S. T. and R. ASLAHI, 2004. Evaluation of 2009. Preliminary 2009 Kansas wheat disease loss resistance in some wheat cultivars and advanced lines estimates. Kansas : Kansas cooperative plant disease to Leaf Rust, Yellow Rust and Septoria Leaf Blotch in survey report. Khuzestan province. Proceedings of the 16 the Iranian BOLLEY, H. L. and F. J. PRITCHARD, 1906. Rust plant protection congress Volume 2: Plant Diseases problems: Facts, observations and thecries; possible and Weeds 28 August -1 September 2004. University means of control. North Dakota Agricultural of Tabriz. Experment Station. Bulletin 69. EHDAIE, B., J. G. WAINS and A. E. HALL, 1988. BOUSLAMA, M. and W. T. SCHAPAUGH, 1984. Stress Differential response of landrace and improved spring tolerance in soybean. Part I: Evaluation of three wheat genotypes to stress environments. Crop Science, screening techniques for heat and drought tolerance. 28: 838-842. Crop Science 24: 933-937. FERNANDEZ, G. C. 1992. Effective selection criteria for CALDWELL, R. M., J. F. SCHAFER, L. E. COMPTON, assessing plant stress tolerance. Proceedings of the and F. L. PATTERSON, 1958. Tolerance to cereal leaf International Symposium on Adaptation of Vegetables rusts. Science, 128(3326): 714-715. and other Food Crops to Temperature and Water CLARKE, J. M., R. M. DEPAUW and T. F. Stress. Taiwan, 1992. pp: 257-270. In: Kuo, C.G. (ed.). TOWNLEYSMITH, 1992. Evaluation of methods for FISHER, R. A. and R. MAURER, 1978. Drought resistance quantification of drought tolerance in wheat. Crop in spring wheat cultivars. I. Grain yield responses. Science, 32: 723-728. Australian Journal of Agricultural Research, 29: 897- COBB, N. A. 1894. Contributions to an economic knowledge 912. of the Australian rusts (Uredinae). The Agricultural GAVUZZI, P., F. RIZZA, M. PALUMBO, R. G. Gazette of New South Wales, 3:181-212 and 5:239- CAMPALINE, G. L. RICCIARDI and B. BRGHI, 252. 1997. Evaluation of field and laboratory of drought and DADREZAEI, S. T., E. MOHAMMADI GOLTAPPEH, F. heat stress in winter cereals. Canadian Journal of Plant AFSHARI and K. NAZARI, 2012. Pathotypes and Science 77 (4): 523-531. physiologic races of Puccinia triticina Erik's. The HUERTA-ESPINO, J., R. P. SINGH, S. GERMA´N, B. D. causal agent of wheat leaf rust and their distribution in MCCALLUM, R. F. PARK, W. Q. CHEN, S. C. Iran in 2009 and 2010. Seed and Plant Improvement BHARDWAJ and H. GOYEAU, 2011. Global status of Journal, 28-1:685-715 (in Persian with English wheat leaf rust caused by Puccinia triticina . Euphytica, summary). 179:143–160.   !"            : A  9  $% & 

KOLMER, J. A. 2005. Tracking wheat rust on a continental PATTERSON, 1984. Tolerance to leaf rust in scale. Current Opinion in Plant Biology, 8: 441–449. susceptible wheat cultivars. Phytopathology, 74:349- MARASAS, C. N., M. SMALE and R. P. SINGH, 2004. The 351. Economic Impact in Developing Countries of Leaf ROELFS, A. P., R. P. SINGH and E. E. SAARI, 1992. Rust Rust Resistance Breeding in CIMMYT related Spring Disease of wheat: Concepts and Methods of Disease Bread Wheat. CIMMYT, Mexico D.F. Management. CIMMYT. Mexico. MARTINEZ, F., A. CASTILLA and L. BARRIO, 2012. ROSIELLE, A. and J. HAMBLIN, 1981. Theoretical aspects Tolerance to leaf rust ( Puccinia triticina ) in durum of selection for yield in stress and non-stress Wheat. 13-16 Jun. 11th International Congress of environment. Crop Science 21: 943-946. Spanish Association animal reproduction. Cordoba. TORABI, M., V. MARDOUKHI, A. FROUTAN, M. A. ORDONEZ, M. E., S. E. GERMÁN and J. A. KOLMER, RAMAEI, S. T. DADREZAEI, H AKBARI 2010. Genetic differentiation with in the Puccinia MOGHADDAM, S. RAJAEI and H. AZIMI, 2003. triticina population in South America and comparison Virulence genes of Puccinia recondita f. sp. tritici , the with the North American population suggests common causal gent of wheat leaf rust in some regions of Iran ancestry and inter continental migration. during 1995-1999. Seed and Plant, 18: 432-449 (in Phytopathology, 100: 376-383. Persian with English summary). PETERSON, R. F., A. B. CAMPBELL and A. E. HANNAH, TORABI, M., K. NAZARI and F. AFSHARI, 2001. Genetic 1948. A diagrammatic scale for estimating rust of pathogenicity of Puccinia recondita f. sp . tritici, the intensity of leaves and stems of cereals. Canadian causal gent of leaf rust of wheat. Iranian Journal of Journal of Research, 26: 496-500. Agricultural Science, 32: 625-635 (in Persian with ROBERTS, J. J., L. T. HENDRICKS and F. L. English summary).

             

( #  '%  # &  # $       ! "        

/"'. , . 
-) *! + , *!# %&  '() * *+& ,)(# -. /01   * *+& 23#) (-. #45 * *+& 67  !"#$  ,$$ ,@A$ ,@A$ ,"#$ B3( ? +) BC@D E. $!$  < => ? +) $ :4; 9 8 ,$$ ,$& (-. (L 4@#$ : 'JK G& 8  !$!I : B! G& ) )'01 25"7=OI )$ ! PQ) ,$$ R .  N ($ / ,$4S 2 2"J ! Asio otus (Linnaeus, 1758) (Aves: Strigidae) ($! ' N XOY EO Z [ O*  ON 2O  ($ /O ,O5K . B#$ ! 6$0$ TD ! -. U"7) V*5 ! 2"J  T# ! , B <  ($ 6 ^K _$ ! . ! ) 2"@ (pellet) 2  , 2 2. 44. ) ]I !I , ! ($ E/ $ 25$"#$  2\ A 2 $   <  2 <>    ($5$ $J   0 & $" $ c-)( 2 T*"5$ ($ dK  2  .   b  2  aa ,$   ,@A$ ]. ) `>4) 2O  ff ! ,O5  O. O> 2 . 5 #4  e /@& , #4 E Z  2 <> E/\$ ?#&  2  ,53 I  d1# .  _(& lL EO. ($ . 4"O$! !O (% f/ ) 2O   ! $-D  (% /j ) 2  jg !  $I -D  (% jk / ) 2  j ! ,5K  (% a g/ ) d4 ($ 2 <> LL  (% 9m op/ ) Microtus  T d4 ($ 2 <> l9  (% Ln m9/ ) Mus  ') d4 ($ 2 <> 9L ,5  #4 2 <> O .  O3 XO# Rhombomys  Nesokia  Rattus  d4  (% om/ ) Meriones ,) d4 ($ 2 <> qp  (% 99 / ) Cricetulus  "3) Mus O 'O) d4O ,$O !  (% Ll l/ ) Cricetulus  "O3) d4O ,@OA$ ! r\[ 25 .(% Lq/o  % mn/o  qo/9% r && 2 ) 4"$! O _ )( 4. ! , YD  ,35$ ($ ($! ' N !( ,$4s 25 :$ tS BS 2 . ! (% lq Lp/ ) Microtus  T ]. !  (% qL o/ ) . . ! 5 (-. v$0) ! ,5 * @& T"4. ! !@"#$ $  , r 2 t$Z$ ,$& ) u!05 4 ! (-. .ew\ T"4.  e 5$ (-. 2   ,5 ($! ' N ": 3%' "  2)

Diet of the Long-eared Owl in Alborz, Esfahan and Hamedan provinces through pellet analysis with emphasis on rodents

A. KHALEGHIZADEH 1
and M. OMIDI 2 1- Assistant Professor, Agricultural Zoology Research Department, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran; 2- Senior Expert on Natural Environment, Esfahan Provincial Office of the Department of the Environment, Esfahan, Iran Abstract The Long-eared Owl Asio otus (Linnaeus, 1758) (Aves: Strigidae) was previously considered as a rare bird species in Iran but its population has increased in recent years. Raptors, in particular owls regurgitate undigested remains in the form of cylinder called pellet. In this study, 744 pellets were collected from Karaj, Esfahan and Hamedan areas. After collection of pellets and transferring them to the laboratory, they were cleaned, numbered, measured and weighed. Then, these pellets were wetted by alcohol. Pellets were dissected and skulls and other animal remains were extracted, labeled and identified. In total, rodents were present in 551 pellets (74.06%), birds in 211 pellets (28.36%), Insectivora in 20 pellets (2.69%) and insects in 13 pellets (1.75%). Among 583 rodent prey items identified, 231 items were from the genus Mus (39.62%), 152 items from Microtus (26.07%), 133 items from Cricetulus (22.81%), 47 items from Meriones (8.06%) but less item numbers were from the genera Rattus , Nesokia and Rhombomys (2.40%, 0.69% and 0.34%, respectively). The dominant prey in Karaj was Microtus (54.37%), in Hamedan was Mus (43.80%) and in Esfahan was Cricetulus (35.15%). Because the Long-eared Owl can inhabit in agricultural ecosystems and near human settlements, it can be recruited to control rodents in agricultural fields. Key words: Biological control, Long-eared Owl, Organic agriculture, Pellet, Rodents .

Corresponding author: [email protected] ( # '%  # &  # $       ! "         : "'.  ) *! +


 64.$OK B $  I$  T# ! &.*. BO#$ 6$0O$ TOD ! ,$O$ !  ON 2OJN&  B <  e w\.$ <\Q) X) v$5$ ($ $I 2 <> 2 <> ? $ Osaei et al ., 2007; Obuch, 2011; Obuch and Khaleghizadeh, ) O#  O $ ($ O/ . 4"O3 UO"7)   X"3 #.$ !

.( .( Khaleghizadeh et al ., 2015 .2011; Tohidifar et al ., 2011; _O/ ) !OI 2O. BO#$ <)  "+) 2<\Q)  $I 2 <> (OO-. XOO) OO ($ ,$OO$  ,OO ! ,OO5 O# ` O > ($   ,$c4#  "+) e /@& ` > ($ B#$  "O$ {/-) ( ‚S {S 2 . 5 ) R3+) $ 25$"#$ y& S   2\  2  . ! tx5$ 2   "+) TO"4. EO \! _ O 2O . 5 ) ƒ5QI   v  ,O5K  !I 5$ D -5 XY 67 E) E/ 25 O#\ . BO#$ O~ )$ `>4) ($  3 ! ,5 ,)( .  4 )  2 <>   ,$5!  2 x  D   / TO"4. O ' v$O5$ ($ !@"O#$ $O "@c4  240  BS# _4s  2  ,!$! ,  -5 XY !$) b x& v$0O) ! O , XO„S$ 6O7 2. ! ) BI$!K ,5 . B#$ @") $J[ "+) ,$0 )  v5  25 r3D  6O. O5 t O#   O !$O) OA 2O (-. $JO[ XOw O ! O )  !$! 5$& )  2  2<\Q)  2O \$ $O $ v$O5$ !Ox$ ‚OS 0 5 t # _ .  ) vO4& 2O ,$& )  2  #  . 4. 2z$$  / ,5K  ,$5O ,O   (O-. O}+) ,35$ ! 25 X  w !  25 ($ e  A!  !$<&  !I $ 25 ($ 2. B#$ ~ _$  4 . !5 ) < =>  X"3 #.$ `>O4) ! O 2O <> OA!  $ 25 r .& @&   $J[ eO 5$ B-. 2<#& B ! ew\ 44. T"4. A4S TO> ! O !OI  O 2 <> B <  5#5 U"7) ($  ON ,O5 eOw\ TO"4. !) ! . !! t$Z$ . !O OK U"7)   T# _  $J[ X w  N& "D  T# . . 4"3  , s/  ,$5 _& X) 64.$OK  vO4& 45) &S{>$ "D 5$&  ) 2  2<\Q) OO4 ! E /OO-& OO 2OO <> _ OO <& ` OO *+& _OO$ †OO  |7O-) 2O*Q4) O !O+) eO ! eOs. ,$$5"3K ! ! ,O5 OA ! _ <& ($! ' N 2  "+) .  ! ,-5 0 $5  , } K $ 2O5 vO4& O#  ($! 'O ON $JO[ "+) O& \ O O/)$ ($ (Asio otus L.) ($! 'O ON O5 _ <&  5 2  :#$  2<\Q) !) `>4) ,5 /O O5K _O$ . !$! 64.$OK *  T    # K$ $JO[ O"+)  O @& _ <&  (-. B  ! ($ ($! 'O ON . O4. O) BO3( ( ~$$ ! T< r ! . ! . U"7) `>4) ! ,5 ‡}7  N Del Hoyo et al ., ) O4. O) 2JN& es. ,$$5"3K ($ yA$   ,@OA$ (O=\$ O ,"O#$ ! : &56! 7. . $ . ,O5 O BO \< 5O)0 O BS 2  N .( 1999 OO EOO+) _"OO OO„4) 2OO 5$OO ) OO# $OO" $ ,$OO _ &OK ,$0O ) 2 ( 5  b#  A ,/)$ es. y"=35 2€ ! . O tOx5$ ($! 'O ON $ !  z$! BD$"#$ 6O*5 _O$  O4 . O4 5 O) 2JN& ,5 ($ y& S (! †$O>$ ) ,@OA$  ( O) q ( 4. ! ) (=\$  ,"#$ Nistreanu, 2007; Seckin and ) 5 $! ,5 T"4. ! ) O _ O <& O EO+) :O#$   E+) _$  ( ,@A$  2O 2"OJ ! ( Asio otus ) ($! 'O N .( Coskun, 2006 ,$O ,"#$ ! .  tx5$ 5$$ ,#4 5K ?#& =Z Mansoori, ) !O POQ) ,$$ R .  N ($ / ,$4S bO x& ($  E+) )$ -5 B =Z  '$0 E+) VO*5 ! O 5 !$O<& O I$  T# ! 25"7=I )$ ( 2008 . .  $ K   †$>$ !  , BD$"#$  Khaleghizadeh et al ., ) BO#$ 6$0O$ TD ! -. U"7)  BD$"O#$ EO+) ` Z! B ?@A  = > ) = ;< 3 :  ' "  " '#  8 9:

:OO#$ OO ,OO5  OO* . 5OO uOO @& ( OO 2OO <> )  2OY O4< OYD X{S    ($ !@"#$  N b x&  u  ,$7"#$ E/   ,$5! bQ*)  5$5!  T)  N b x& +) 2#  .  _ <& (  E/ )  N 2  Etemad, 1978; ) b OO4) OO 2OO3*) ' ! OO 2OO x  ]O. O) ! . 4"O$! $OZ (-.  _ )( 4. ! (OO) ! !OO) OO 2OO5 5  ( Morowati et al ., 2010 E O $$ ($  ( Z lo lq° lm' " \  Ll q° op' " }"7) ) =Z <\Q) 2 x& _ 4  ,$$ (-. #45 O4. ! 2O. 5/O3) $ 2 D5 ! ($! '   N 0 K  2O . O4" $OZ #4  # !) ,$  x) 2O3#) &O* *+& v$0O)   (O-. b O#  O _ )( ,  eOO /@& $OO OO †OOA ,OO)( EOO. _ c5OO ) OO> EO+) _ O $ 2O !$! $OZ J  T5 P{A$  2 & * *+& TO> 2O 2O* Z! o 2O  O $O U"7)    ($5$ bZ$ ]. ,"I!   ,"3)( E} , K &  !. ) $JOO  OO eOO /@& ,!OO. 0OO & E)OO 2OO. OO )x5$  $O" $ ! !O 9 ($ , !$O<& . 44 0 ) B)Z$ E+) _ $ !  2 x  "+) ,!. $ ,53 I _(&   ($5$  !  O O) ! B <  ]$ ! !  & ! _ $  "5$ . !O 2   ! #4 E Z "+) #4   ,$5!  \ O L9 L9° l' " O}"7) ) ,@A$ ! . !  N") _  ,5K  ,5 ($ ,5K _$ 2JN& ,$0 ) # $ Lo ! bOZ$  &  "# †$>$ !  ( Z l9 o° q' " O ,O5K O 2O  # T <) ' :#$  ! ($! 'O   N ,@A$  ‹ R4  ") . $O O 2O  E; , ) ! $J[ !)  ! A! 4< B O <  . O5$ ! B)Z$ v$0) 4. ,"I!    T# T> O 2O5 ,O ) ! O 2O <> B=O3 .5 O 2=#+) ,/)  2O  !O 25 O !  $$! 2O. !O O) Œ\ ! o 2 , !$O<& :O#$ 0O 5 O# EO; T> ! ,5 U"7) Lq lq° l' " }"7) ) ,$  ! . 5($!K )   2 . tx5$  B 2 x    ($! 'OO   OON  ( ZOO q 9p° l' " \ OO  O !( ! 2O. 5$! B)Z$ < => b 4) 2>+) # ,"I! CD#  & B' ( VO*5 ($ eO  O ! . 5O  ! ! 2# EZ$D  $+A ($ !OO=5 ,OO3/  OO  bOO  OO 2OO  E/OO bO x& 2O5 _$  $  N ($ c! 25 $ !) 2O*Q4) 2O# E. ! .( 9 E/ ) 5! $ $! & 4 $ 25$"#$ .  ) 25 _$ b x& E+) A  2"$5 ,O5 .   b  2  pqq ,$  ,@A$ ]. (%  (% 9 Lm/ ) 2OO  9 ! ,OO5K  (% pq om/ ) 2OO  ll ! #  2O  L ! $O-D  (% mn/9 ) 2O  9o !  $I -D 2O    bO  O 2O   $O" $ O# !) `>4) ! 2 <> 9L 5 2 <> lL E. ($ . 4"$! YD (% pl/ ) O Y ($! ' N  2  . 5 E*"4) c- )( Microtus d4OOO ($ 2OOO <> l9  (% Ln m9/ ) Mus d4OOO ($ ($ dOK . 4"O3 !O-  "3. I Ž5 2 E/ 4 # qp qp  (% 99 / ) Cricetulus d4OOO ($ 2OOO <> LL  (% 9m op/ ) cO- )( ? +) !  2  $" $ c-)( 2  2  T*"5$ OO d4OO OO)$ OO5! (% om/ ) Meriones d4OO ($ 2OO <> 5O5   23 . !  2  ($ e  . 5 e-I  0 & 4"OO$! OO .  OO3 XOO# Rhombomys  Nesokia  Rattus d \O;   , QZ  T> d1# .  $J   25$ .( .( T ) (% Lq/o  % mn/o  qo/9% r && 2 ) \O" x! ($O& O  O  ($5$ ( ")  ) o9/o BZ!  ) O O 2O  O< 2D) ! . 5 _(& ( t o / BZ! ) O t$O5$ O* O ( X ($ "<4A E\$ ! , 53 I !O) 5O * c!  ,5K  ,5 U"7) ( # '%  # &  # $       ! "         : "'.  ) *! +

E I! ,$ ! # ,"I!  (( R ]. ! ]. ,"I!  (( U\$  2Y   2    G - F0= Fig. 1. Signs of pellets and faeces, right) bellow pine trees in Mehr -Shahr, Karaj, left) bellow cypress trees around Bahar, Hamedan

,@A$ ($   b  ($! ' N 2  U"7)  E/ G / F0= Fig. 2. Different shapes of Long -eared Owl pellets collected around Esfahan city

(!$( *\I . $ ($ d/S ) ,$ ,"#$  ! # ,"I!  ($! ' N e G H F0= Fig. 3. A Long-eared Owl on a Cypress tree in Bahar, Hamedan province (photo by A. Khaleghizadeh)
 >?@A  = > ) = ;< 3 :  ' "  " '#  8 9:

,$ ,"#$   , †$>$ v$0)  ($! ' N b x& E+) B

n n p/ ‘0O OQZ  (N=71 ) L n/ O 2O  T> ?#") > !$O<& .   b  2  Loo ]. ) ! : K% ?O#") ,(  ( N=82 ) ")  ) m L/ es. QZ  ( N=82 )  0 K T} ! . !  N") T# U"7)  ,)( !  N 9.( 9.( T ) ! ( N=55 ) t lo/9  , ,"3 &   T} ! )$   -) N  & L ,"3)( 2O  mo ! ,O5 2O  nq _ ! ,@A$ ! !  N E+) _$ ! . -5  -) ($! ' N  ! O $I -D  (% 9p L9/ ) 2  lL ! ,5K  (% 9 qp/ ) O") 9 yO=*& vO@&$ 2O O4 ]O. ,"I!  ( T> OOYD (% /m ) 2OO  9 ! $OO-D  (% l/9 ) 2OO  l O 2O  TO> ?O#") > 2 ]. ! . 5!. ) BD$"#$  "3) d4 ($ 2 <> l 5 2 <> ml E. ($ . 4"$! eOOs. OQZ  ( N=54 )  /o ‘0O OQZ  (N=55 ) LL on/ Mus OO 'OO) d4OO ($ 2OO <> l9  (% Ll l/ ) Cricetulus tOO mn/ OO , ?OO#") ,(  ( N=46 ) OO") OO ) q n9/ 2OOO <> qm ! Meriones OOO ,OOO) d4OOO  (% L l/ ) 9.( T ) ! ( N=75 )  Rattus d4OO ($ ‘0OO OO 'OO) OO)$ OO5! (% 9p / ) 2OO  pl ! ,OO5 2OO  Loo _ OO ! ]OO. ! %  % l/q rOO && 2OO ) 4"OO$! 0 sOO5  OO3 XOO# Nesokia O $I O-D  (% qo oo/ ) 2O  9o ! ,5K  (% l LL/ ) .(  T ) (% m/o eO  ! $-D )$ 4"$! YD (% mm/q ) 2  q ! 9lo !$O<& ,$O ,"O#$ O  †$>$ ! :  ($ 2O <> p 2O <> mo EO. ($ . BO$5 !O O 2  ($ O# ,"I!   N E+) _$ ! .   b  2  O ') d4 ($ 2 <> mm  (% lq Lp/ ) Microtus  T d4 O5!. O) BD$"O#$ O")  y=*& v@&$ 2 Z $  I  Rattus d4O ($ ‘0  ')  )$ 5! (% q 9l/ ) Mus LL LL n/ O 2O  TO> ?O#") O> 2 ,$ ! .( L E/ )  % lo/9 rOO && 2OO ) 4"OO$! 0 sOO5  OO3 XOO# Nesokia 9 9 p/ eOOs. OOQZ  ( N=121 ) m n/ ‘0OO OOQZ  (N=32 ) .( T ) (% p/ !O ( N=40 ) tO  n/ , ?#") ,(  ( N=128 ) ")  )  bO  2O  nq ,@A$  †$>$ ! :  9.( 9.( T ) 25 O L  4"O$! 0 5  2 E+) _$ !  N .  2O  9m ! ,O5 2O  9lo _ O ! ,$ ! _O$ ($ O/ Lnq O ! 2O. O  O-) EO+) _$ !  OO $I OO-D  (% q )q/ 2OO  Lm ! ,OO5K  (% m )q/ ,O5 ,O"I!   N E+) _$ ! . ! T<  25  ($ . 4"O$! YD (% )q/o 2  e ! 4& t$.  $-D 2O ,@OA$ ! . 5!. ) BD$"#$ ") l m =*& v@&$ 2 ( # '%  # &  # $       ! "         : "'.  ) *! +


$5"O3K  O5K 2O5 9m ($  v4")  I , $J[ U >  (% qL o/ ) Mus O ') d4 ($ 2 <> L 2 <> 9l E. O 2O  ! OA! l L/ O \ <) T . !  E /-& ml  (% 9n op/ ) Cricetulus  "OO3) d4OO ($ 2OO <> pl  Cojocna 2OOO*Q4) ! OOOA! p p/ Cluj-Napoca 2OOO*Q4) ($ ‘0  ')  (% 9l n/ ) Microtus  T d4 ($ 2 <> . O5! ON _O$ $JO[ XOw ! $JO[ 6O7 _& X) 0 sO5  O3 XO# Meriones  Rhombomys  Rattus d4 2O*Q4) O 2O  t! 2O=& ! A!  9/  c4 ') .( T ) (% Ln/o  pp/o  pp/o% r && 2 ) 4"$! t! 2OO=& ! OOA! 9 L/ OO $+OOA T  Cluj-Napoca O I t!  55 2.  T  tx5$ # `=> T 2O*Q4) ! O ! . 4 "O$!  Cojocna 2*Q4)  2  E. ($ lL% )p/ 4 ) N _$ 2 <> _& X) 4"3 &. O 2O  ! 2O5 _& ,$$ ( Microtus arvalis ) \ <) Marti, () O5! Microtus d4 ($ /)  K$ !  2 <> ‹OO ROO4 ! . (Nistreanu, 2007) !OO ($! 'OO OON ! ! nnm O& nnq O T# ! N _$  2  .( 1976 . . 4"$! !  2  ($ % nn ! es. ,5 ,"3\ 2O. (Nistreanu, 2007)  #   b  5) 2*Q4)

($! ' N  2  !  #4 "+) v5  !$<& -G L Table 1. Number and type of identified prey in pellets of the Long-eared Owl

Mus Mus P. 6 Place Birds Birds Rattus Rattus Insects Insects

(O 8MN

Nesokia Nesokia Number Microtus Microtus Meriones Meriones Cricetulus Cricetulus Insectivora Insectivora Rhombomys Rhombomys + )MN

( &6 F% 6 No. of prey items of rodents of rodents items of No.prey )( )( &6 " &  6 No. of pleets containing rodents rodents containing of No.pleets

2  !$<& Karaj 0 120 0 0 76 3 4 0 54 NA 175 14 No. of pellets 1 Quail, Karaj 2 <> !$<& 0 0 0 87 3 4 0 66 160 175 17 81 Sparrow No. of prey item 2  !$<& Esfahan 12 53 0 42 0 1 8 51 44 NA 160 5 No. of pellets 1 cf. White-eared Bulbul, 1 Myna Esfahan 2 <> !$<& 12 0 46 0 1 8 58 52 165 160 5 or Starling, No. of prey item 6 sparrow 2  !$<& Hamedan 1 36 2 1 58 0 2 71 93 NA 216 1 No. of pellets 1 Budgriegar, Hamedan 2 <> !$<& 1 2 1 65 0 2 75 113 258 216 1 Crocidura 15 sparrow No. of prey item 2  !$<& Total 13 211 2 43 134 4 14 122 191 NA 551 20 No. of pellets 1 Quail, 1 Budgriegar, 2 <> !$<& Total 12 Coleoptera 1 White-eared 2 47 152 4 14 1333 231 583 551 22 No. of prey item Bulbul, 1 Myna or Starling, 102 sparrow

NA= Not available because some pellets were damaged.
 >?@A  = > ) = ;< 3 :  ' "  " '#  8 9:

,$  ,@A$ ]. ($   b  ($! ' N  2    ($5$ /G L Table 2. Measeurements of pellets collected from Karaj, Esfahan and Hamedan

U  T1% 7S QR# 7S L Title Weight Lesser diameter Greater diameter Length Karaj &  6 N=75 N=46 N=54 N=55 No. of pellets V%N 0.2 g 10.0 mm 10.3 mm 14.0 mm Maximum FSN 4.9 g 21.4 mm 25.5 mm 64.0 mm Minimum W . 1.69 g 14.92 mm 18.08 mm 33.09 mm Average Esfahan &  6 N=55 N=82 N=82 N=71 No. of pellets V%N 5.0 g 22.8 mm 28.0 mm 73.0 mm Maximum FSN 0.9 g 10.8 mm 14.3 mm 21.7 mm Minimum W . 2.50 g 16.3 mm 19.7 mm 38.9 mm Average Hamedan &  6 N=40 N=128 N=121 N=32 No. of pellets V%N 4.3 g 19.6 mm 51.9 mm 61.0 mm Maximum FSN 0.6 g 5.2 mm 10.7 mm 18.3 mm Minimum W . 1.9 g 12.7 mm 16.9 mm 33.9 mm Average

T OA! ,"O3)( 0 K ! .  B= 2<\Q) _$ ! ,"3 & !O 25 _$ $J[   ! 25 _& X) \ <) T l l ,"O3 &  E}  23*) ! $J[ Xw ! \ <) $ :O)  =)O#!  ) !  2 <> E. ($ % o !D 2. Xw 2. 5 ) =x)  N ,"3)( ! . ! " .  A! 0OO.) 6OO7 ! . (Dziemian et al ., 2012) !!$ OO) E /OO-& OO4 ! OO N& _0cOO OO 2OO <> 2OO $ !OOI $JOO[ ON $JO[ XOw !O) ! O=Z <\Q) 45 ,"3\ OOO5{4 ROOO[ ! . (Romanowski and Żmihorski, 2008) O{>  "3) !$5I  3) K$ ! ($! ' (O-. ~$$ A! pm E)  R7"5$  c"3( ! 2O <> _& B $  ,$4S 2 \ <) T ^ 2  T  O~$$ A!   R$!) A! l Ec4 A!    O ') . 5 #4 ,"3 &   , "3)( 0 K E} ($! ' N $J[ Xw ! . ! ( 5/3)  [ )   XOw _ $! 4<) @& . 5!  2 <> ($ X)  _ )! ,O-5 O5{4 R[ ! ` *+& %"5 . B#$ 2 <> _& X) T O  ,"O3)( 0 OK TO} ! ($! 'O N $J[ ( # '%  # &  # $       ! "         : "'.  ) *! +


O5! ,5   25 _ & X) (%  ;9/ Mus cf. abbotti ) 6 O ( A! p ) 5{4 !  / T B=35 2.  ! ) . . (Obuch, 2011) m  q rOO && 2OO ) \ OO OO/)$  OOK$ OO<\Q) ($ 2O <> 6 ^OK _O$ ! O) BO#! 2 %"5 :#$  2O VO ) O  /O 2 <> 5$$ _"-  ! ( A! Cricetulus  "3) d4 ,@A$ ! ($! ' N r\[  2  2<\Q) . (Korpimaki, 1992) ! Microtus epiroticus !  (% qL o/ ) Mus OO 'OO) d4OO ,$OO !  (% Ll l/ ) ! 2O .& / O! ,"O#$ ZO T O ! O  b  2OO %OO"5 .(  TOO ) !OO (% lq Lp/ ) Microtus OO T ]OO. ]. ,"I! &<\Q) 2*Q4) ! .  tx5$ 9oo 9ooo T#  OK$  \N$ _ Q3 2 .& %"5 2 = ]. ($ ) B#! ,O"I! ?O#& 2.  E+) ($  25 .5 5 ! r\[ 6K Marti, 1976; Seckin and Coskun, 2006; ) !OO OO/) 5O35$ O BO \< ?O# & rO7& _O" .  2>D$ ]. %O"5 . ( Nistreanu, 2007; Yosef, 2009; Dziemian et al ., 2012 O ! rO[$ O 2O  2O.   b   ! 2" A !O K$ 0.) 2*Q4) %"5 2 -) ,@A$ ($ ) B#! 2 OA! nl q/ O ,5 . 5! es. ,$$5"3K 5  yO##$ EO $( ! . (Romanowski and Żmihorski, 2008) BO#$ $JO[ 67 _& X) Microtinae  T . 5! r\[ 2 <> O4 E  E) ( t lo ($ 6 ) 2€ ‘0 ,5 O B * ($ A! p 9n/ "5 T . 5! N _$ XOw ! !O& BO3( EO. ($ OA! p9 /n _ )$ ')  _ O)!  c5OI 'O) . O5 !$! ) E /-& $  2  ,! ! r .& TD  . 2 5!$ ! ) E /-& $ ($! ' N $J[ E /-& $ * ($ A! n Ll/ 2. ! / ,$$ 25 ! ,$J ,"3)( ($! ' N ?#&   A  2 <>  \NOO$ _ QOO3 ! . (Seckin and Coskun, 2006) !$! OO) ($! 'O ON ?O#& 2O. BO#$ O 2O <> 45) E $( 9ooq O& nnl O T# 2A !   b   2  . BO#$ O /O Oc! `>4) ($  3 ! ,$J ,"3)( Yosef, ) O5! $+OA T O  2O <> ($ % nm 2. !$! ,-5 ^O 2O 2O€ ‘0O ,O5  E $( ! 2 <>  S 67  b  E $( ($ ($! ' N  2  ,$$ ! .( 2009 %"5 †{I . (Khaleghizadeh et al ., 2009) ! 4 E  OA! nn ! ,O5 2. (Khaleghizadeh et al ., 2009)  ($ y&O S O~D 6 ^OK ! O) B#! 2  2 <> E $( O#4 2O <> 9l :O#$ O . 4 "$! ! 2  9lo ($ "O3  c5OI ') 45 & es. 2€ $$! ,5 ! ) OA! qp /p ,O5 : BO$! !O ( r .&   2OO. (  TOO ) OO5! Microtus  Cricetulus  Mus OO T   OA! 9m /p EO   25  ( -5 #4 25 ’Q# RO3+) (O-. ~$$ ! X) ,5 0 5 2 ,$$5"O3K 2O *  OA! p / Tatera indica O4 E  .( .( Ziaie, 2008; Morowati et al ., 2010 ) 5 ) O 25  Nesokia indica _ )$ ') E)  #4 $ O .  O3 O5$$  5O)  O 2  ! ,5K E. ($ A!  ($ " . t$.   I -D  E  ! #4  2  ,! 5K 25 o E. ! . 5!$ ! ) E /-& E   25 . 5!  2  !  B  2 <> !$<& ,O ) ($ . O5! ,5O# eO-x4 2"O#$ ($ O , 2O   sO EO  yO "D$ 5O-5 #4 2. $ 2€ es. eO-x4  ( Passer montanus ) O"I! eO-x4 ,O5K . (Khaleghizadeh et al ., 2009) . 4O O) (Gerbillus nanus ) po po  O5! 2O5 _O& ,$$O ( Passer domesticus ) c5I BO7& ) ,$O$ 2OQ*5 2# ($   b   2  _ 4 O . (Nistreanu, 2007) 5O O) E)O $ ,5K ($ A! ) B#! 2 2 <> op ($ 2. !$! ,-5  (!0  5$  -  O 2O  ($ % qo o/ ! ,5K ~D 6 ^K %"5 :#$  O5!$ ! O) E /O-& $ O 2O <> E. ($ % lo =*& ,5 O 2O  ($ % q q/  ,@OA$  2  ($ % 9p L/ ! ]. 'O)  (% 9L ;q/ Microtus socialis ) SO "$ T O 25
 >?@A  = > ) = ;< 3 :  ' "  " '#  8 9: r .& . (Wood and Fee, 2003) ! 5 v$0) !  N B  D OO 2OO <> ($ OO . !$O<& EOO $( ! . 4"OO$! OOYD ,$O ON  2O ,$0O ) ! 2O <> RO7"5$  $JO[ Xw  -  B7& ! . (Khaleghizadeh et al ., 2009) 5! , 5K tOS BOS 2O . (Korpimaki, 1992) B#$  ) 0 5 ($! ' p q/ c5OI eO-x4  ,5K $  2 <> ($ A! qL l/ 25 O rO}5 , 35$ ($ ($! ' N !( ,$4s 25 :$ . (Obuch, 2011) !$! ) E /-& $ ,5K   2 <> ($ A! O O (Charter et al ., 2009) v $ 0O) ! $ 25 O =O# O s `>4) 2 * ($ ,@A$ ! 2   ($5$ 6 ^K _$ ! tOx5$  ON !$O<& 6$0O$   2O 6$0$ †  2  2 -) ,@A$  2  ,( .( 9 T ) ! "0 ") l q v@&$ ! EZ$D S4})  25  _$ . ! ) TOO> . (Khaleghizadeh et al ., 2009) !OO tOO lo/9 EOO $( . . 4"3 ! 2 0 5 ,35$ :"#! ( $ 2. 5 ) r}5 EO $( O 2O  ($ O"D ( O")  ) L )n/ ,@A$  2  BO ,5  B <  ($ r#4) 2JN& A ! (Khaleghizadeh et al ., 2009) !O "O- X ( ")  ) Lp )l/ 2O5 _O$ ($ ,$& )  S4})  25  2 r#4) G#K  O5! O") O ) LL !O+) ! ,$  ].  2  )$  ! ($  !. !@"#$ ,5 ew\ T"4. B ! 9 )o/ EOO $( OO 2OO  OOQZ OOA OO ! .( 9 TOO ) 2O O5$& ) !I 2. B#. -. ! 6. 5 t #  \& O~D 6 ^OK ! 2O*Q4) 2#   2  QZ ($ ( ")  ) _$  4 . ! PQ) ")*) !}"Z$  240 ($ / ,$4S . (Khaleghizadeh et al ., 2009) ! "- O S O  $ uO!05 O4  ! O& ! $ )$ ,$& ) O€.$ ! ,5 r#4)  B <  YD 2 2&   eOw\ TO"4. ! !@"#$ $  , r $ r#4) ! $ rO\[ 6O*5 ,O5 2O/4$  (O-.  _ )( . B#! 2 (-. v$0) ! ,5 * @& O„5 !) `>4) 4 ! ) E /-& ($! '  N 2JN& POQ) O( $ !4O- K O) BO#! 2 %"5 :#$  RO7"5$ N 25 _$ ?# (& ].  ,$ ,@A$ 4< ) !: !: ) T OOA}7) ,OO5 OO B=OO35 .( q E/OO ) 5OO ,5 U"7)  2 <> 5$$ 25 ) 5#5  $ O5K _$ B $ ($! ' N $J[ Xw ! \ <) ! $JO[ O  _ O4  O#  2O<\Q) !) `>4) ! !(O# O) /O (O O c"O3( ! ,O5 T"4. ! ($O5$ E/ v5  $ 9 . !! # 0 5  2 ,)( `>OO4) ! ($! 'OO OON _OO$  OO4 . (Nistreanu, 2007) ! S4O})  25  r}5 $ r#4) v@&$ _ 4  ($ !@"#$ 45)  '  # 4. ! 5$& ) ,$$ (-. ON BO <  6$0O$ O ,  &  ($! ' N r  $J 2 <>    = .& ($ !@"#$  / 5/)   '   2OO3*) !OO}"Z$ OO# .L !!OO OO# ($! 'OO !O) 2O€ eOs. ,O5 TO"4. ! OQI XO. t #  ($ !@"O#$  ,O5 TO"4.    ' ($ !@"#$ 2OO. D$OO5 !  OON ($ !@"OO#$ . !OO  $OOZ !@"OO#$ 2 OA& 0O 5 ,O5 BO <  6 O. ! ($! ' N B <  ”@D r) 5$& ) "- B#$ -5  $J 2 <> . . !! )   ON ($ !@"O#$ ` O @& OA  ! )$ !  N !  ON ! O. 2O E S ! 5$& ) !+)  $J 2 <> "RX Y O45) _ 0c  O t O# _ O4 . O)x4 ,O5 T"4. B     B  D  $ -. /01   * *+& 23#) ($  O  O ,O)  O O44. X *S e w\   6. 5 m 9 9 m m nLp RO}) wK  $$ ! &.$&  \) * @& T"4. ! :#$ _$  . 5  $Z # !) "- . . !! ) 5$!Z  rO 2O t$OZ$ ,$O& O) (O-. v$0O) ! ,5 ( # '%  # &  # $       ! "         : "'.  ) *! + 

References Institute of Plant Protection, 136 pp. NISTREANU, V. 2007. The importance of the Long -eared CHARTER, M., Y. LESHEM and S. HALEVI, 2009. Use of Owl (Asio otus otus L.) in rodent control, Bulletin nest baskets by Long-eared OwlsAsio otus in Israel, USAMV -CN 63. Sandgrouse, 31: 36-37. OBUCH J. and A. KHALEGHIZADEH, 2011. Spatial DEL HOYO, J. , A. ELLIOT and J. SARGATAL, (Eds.), variation in the diet of the Barn Owl Tyto alba in Iran, 1999. Handbook of the Birds of the World , vol. 5, Podoces 6(2): 103–116. Barn -owls to Hummingbirds , Lynx Edicions , OBUCH, J. 2011. Diet of Long -eared Owl in the Middle Barcelona , Spain. East, Abstract - International Conference on the Survey , DZIEMIAN, S., B. PI łACI ńSKA and G. PITUCHA, 2012. Monitoring and Conservation of the Long -eared Owl Winter diet composition of urban long -eared owls Asio otus, 1-5 November 2011, Kikinda , Serbia. (Asio otus ) in Rzesz ów (SE Poland), Biological OSAEI, A., A. KHALEGHIZADEH and M. E. Letters, 49 (2): 107-114. SEHHATISABET, 2007. Range extension of the Barn ETEMAD, E. 1978. Mammals of Iran, Vol. 1, Natioanl Owl Tyto alba in Iran, Podoces 2 (2): 106–112 Society for protection of natural and human ROMANOWSKI, J. and M. ŻMIHORSKI, 2008. Effect of environment, Tehran, 288 pp. season , weather and habitat on diet variation of a KHALEGHIZADEH, A., M. TOHIDIFAR, S. B. MUSAVI, feeding specialist: a case study of the long -eared owl , A. HASHEMI, A. KHANI and M. OMIDI, 2015. Asio otus in Central Poland, Folia Zoologica, 57(4): Population increase of the Long-eared Owl Asio otus 411-419. (Linnaeus, 1758) in Iran (Aves: Strigidae), Zoology in SEÇKIN, S. and Y. CO ŞKUN, 2006. Small mammals in the the Middle East, 61(3): 215-219. diet of the Long -eared Owl , Asio otus , from KHALEGHIZADEH, A., T. ARBABI , G. NOORI, M. Diyarbakir , Turkey, Zoology in the Middle East, 35: JAVIDKAR and A. SHAHRIARI, 2009. Diet of 102-103. wintering Long -eared Owl Asio otus in Zabol , TOHIDIFAR, M., A. KHALEGHIZADEH and S. B. southeastern Iran, In: Johnson D. H. , Van MUSAVI, 2011. Recent status of the Long-eared Owl Nieuwenhuyse D. and Duncan J. R. (Eds.), Proc. with first breeding records in Iran, International Fourth World Owl Conf. Oct –Nov 2007, Groningen , Conference on the Survey, Monitoring and The Netherlands. Ardea, 97(4): 631-633. Conservation of the Long-eared Owl Asio otus , 1-5 KORPIMAKI, E. 1992. Diet composition , prey choice , and November 2011, Kikinda, Serbia. breeding success of Long -eared Owls: effects of WOOD, B. J. and C. G. FEE, 2003. A critical review of the multiannual fluctuations in food abundance, Canadian development of rat control in Malaysian agriculture Journal of Zoology 70: 238-273. since the 1960s, Crop Protection, 22: 445-461. MANSOORI, J. 2008. A Guide to the Birds of Iran, Farzaneh YOSEF, R. 2009. Further on the diet of wintering Long -eared Publishing Co., 513 pp. (In Persian). Owl Asio otus in northern Israel, Sandgrouse, 31: 106- MARTI, C. D. 1976. A review of prey selection by the Long - 108. eared Owl, Condor 78: 331-336. ZIAIE, H. 2008. The Mammals of Iran, 2nd edition, Wildlife MOROWATI, M., F. NAZARI and V. MALIKOV, 2010. Club, Tehran, 420 pp. (In Persian). Important rodents in Agriculture, Iranian research

             

Streptomyces carpaticus UTS49         $ % #  Meloidogyne javanica  #   ! "

, - "
)* +! ( !% & %' +  ,# + ) -%& ' .%# /%& '  /01    2 %& '   %& '    !"   !"# $%& ' ( )) * (; :' : 789 5) 2   : 4' 5) ) ./0 IBJK  *& GHH . > * E" : FA . "BC + ' = ! >"# 9   ' +   ? @-& + "A *  *%  ) & ?S * 'K :"R '  + %#) & 4 PQ *# "BC B?OK N  B# *  . Streptomyces M *& . ""# K * L & +   . + 0Z K  Streptomyces carpaticus UTS49 '1Z! + Z) Z ( NZ" YZ& '  +. *& ' ) K  8X  BC SW)  T UV) : ' .4!  ! *Z  ' ' +Z%& ^ZB& . Z Z! Meloidogyne javanica Z  *Z% Z) & ]ZB"# & )  -& * *[   \!0 + ! 0 &# .  N$& 4 ` + . ' K  + .! ?& +/K   !  ' -%K. _  '  *% ) & ]B"# * '` S. carpaticus UTS49 %  ) Z) & * A 4C &B& aB"# ` > 0  bA BC : *#  : c) N" *& '  Streptomyces  8X BC :B ! : ' . Z 0Z & B# _!) -& * *% + ! 0 &# `     > 0 jA  (iJ) 5\) > # % hh /  N' :! f  K  eK . 4 ' 4?OK S -& *   ' *%      ECKB9B! kN" *& ' : "[ .+ ! 0 &# N" *& ' 4C &B& .! ?&  ' 1! :'!  .1"

Effect of some solid nutrient state substrates on sporulation of Streptomyces carpaticus UTS49 and control of Meloidogyne javanica in tomatoes

N. MOHAMMADI FESHARAKI, K. BEHBOUDI
and R. HEYDARI M.Sc. Student of Plant Pathology, Associate professor & Associate professor, Respectively; Department of Plant Pathology, College of Agriculture, University of Tehran, Karaj, Iran Abstract Root-knot nematodes ( Meloidogyne spp.) are obligate plant parasites distributed worldwide. The genus almost parasitize about 3500 species of different vascular plants. The gram-positive bacteria of the genus Streptomyces have nematicide trait. The effects of millet and grain substrates on the sporulation of Streptomyces carpaticus UTS49, antagonistic ability on Meloidogyne javanica , the growth of tomato seeding and colonization of the rhizosphere were studied. As a result, the antagonists were able to control of root- knot nematode in vitro. Mass production of antagonists conducted with the cheap materials. The result indicated that the best substrate for S. carpaticus was wheat grain. This substrate showed high biocontrol ability against nematode with 71% mortality of the second stage juveniles (J2), reduction of 22/33% of eggs hatching, strong ability of colonization and growth-promotion on tomato. Wheat grain-Streptomyces had a positive effect on shoots and root growth of tomato. Key words: Antagonists, colonization, mass production, sporulation, wheat grain.

Corresponding author: [email protected] ...  ! " Streptomyces carpaticus UTS49         : +3 " 4% &


S. *# ' ' +%& + ^B&  4!  ! S. hydrogenans 6 *Z + Z) ZK  +  4 a BK  hydrogenans strain DH16 :Z) iZK . Meloidogyne spp. Z  *Z% Z Z) &  Z :Z Z bZA 'Z & '\BZ! :  %#) & + "A  .  @KA : .  K -& * * . CQ @K A Kaur and ) ' '  Z` '\BZ! 'ZK 0Z & Z  Z > 0Z *Z f' 'Z  K HH . > Z CQ (K ") * *&f! :BZ! ( Kim et al ., 2011 ) + Z/  i Z# .( Manhas, 2014 Z) & ]ZB"l . (Huang et al. , 2004) 'Z ZK .%# >J @ZK A . Z/ + "A *  Streptomyces sampsonii KK1024 *ZQR Z)l '  &Z 0 K = Z! *Z"K ' @ a' *  *% +. Z Z *Z   SWZ) .&'# cK BC. ]B"# ' TK  Z' + +'Z ZQ ' @Z-& 0Z &  'Z. @ZOK  a)  &. Z (?Z! *Z% Z a) . 4Z! 'Z *Z) @Z ` 0Z & *% Z 7 m") iX A .(Lopez-IlorcaL et al ., 2008)  K * L   '   4KUK > 0 *$ B& '     N & . nZ Z *Z# Z 4'ZVK @Z a' *Z  ) & : ]B"# . . 4!   ) & *  . .  @K A  Z SqZK  =pZ` 7 n o & ' #8K  7 m Z& Z a)  Z IZBJK Z iZC & / K & ) Z ]Z! ' *#  7 . / .& & rCVK .?K > 0Z *     ""# i {")  BC &B& ? #)  Z` *) 'K ]B"#   .  @K A ! "&  Q *Z Z 4C &B& 4 ac . 4! *BC   + aB"#  # . ZZ ZZK BZZC. ZZK @ZZK A . '\BZZ! 4ZZ! *ZZB    /0   B#  SW) 4V) ]B"# @KA + "A * L  *% ) & * sQ ' A"BK  iC & / K _ ZVK 4Z! ' ' +Z%& U UV) . '  K  ` 4C. _ VK Z tZ` *Z# &Z ZK & 4 c  > # (K  ""# K Z? #) Z a) Z + 0 K  SqK  B# . / 4%# . & K rCVK & :) iK  ) &   B#  Z#  Z  Z  Z" ' > 0Z ? #)  BC &B& Z B#Z uZ * sQ  \K  iC & / K ' # fZ  *"0 . 4! n|a ]B"# @KA aB"# ` . "BC @K A : x VP 4K ' vwK  *"0 . /  Z *Z# 4Z!  a) !!  4'VK . / '}B` 4 PQ *# "BC B?OK N  B# *  .  B# " B# aB"# Z 4 Z #  \ 4 Z # > 0  4'VK :  *?X 4Z!  Z! Z?S *Z 'ZK :Z"R ' Z + Z%#) & + .  (Z!"K 4Z%# Z _ VK . + ) K n|a @KA . ZZP' yH 'ZZL ZZ :ZZ . (Dimkpa et al ., 2008) '\BZ! Z?&  a) ' SqK  B# . / + "A * 4 ` Z" ' ZK @ /Z%) #ZQ Z _ VK '  B# 4 c   ZK + Z!B"K  Z# Zp *Z .(Verma et al ., 2007) '# . ZZZ  Streptomyces spp. .(Takatsu et al ., 2003) Z 4ZC &B& * Z K Z a)  A 7 ' =K + !B"K zQ ' f 4 c  */"  bA *# "BC  B# " B# Z *Z& ' m &  4C &B& K + !B"K .' "BC . " K 0 &  ! _  @ V) * '` " ' K @ /%)  . Z"# ZK Z .Z%# ZK cZ~   ?L bX  a) Streptomyces spp.  B#  S)  iC &/K . / zZQ ' i UBZCK P * B% iBC ! : & ]}VK *Z + Z) ZK ' ZK :Z *Z  . . Z ZK Z nZ ) B& Z* K  .    > #   P  *A0K  *& 0Q  K 0- / Z! :  /! B) : CKB9B !  n ) B& Ramanujam et al ., ') ' K *~ + * ' 0#Q   . (Malkawi et al ., 1999) 'Z#  *&S  4 a BK !  .( .( 2010 "Z%# Z 4 a BK  a) @ a' *  ECKB9B! . Q *Z  Z""# ]ZB"# ZS Z! T UV) : .  Schaad ) &Z K '\B!   @-&  ) & ]B"# 4 ZZ  *ZZ% ZZ) &  Streptomyces carpaticus UTS49 ZZ%#) & UaZZ 4ZZac *ZZ&J _ ZZ ' .( et al ., 2001
 <=>?  *; ( < .; ( 9: ' :  #   " 7%8

Barker 7 *Z N' :Z! f .Z!  . ( Barker, 1973 Z *ZP *Z +ZUK Z a) +Z/K  Meloidogyne javanica * Z! * iJ) 5\) . E9 *& .  f .  N$& (1985) /|Za ]ZB"#  # O# L   .1! + 0 K O# L . .  .!  >K GHH na .4!  *% ) &  4Z 4Z%# Z‰  n R * >K. N$&   f 'ZA HH ZL + C&1!! B a  K ^"9  *&Q hy  @" 1Z! + ZC&1!! ZB a K  ^"9 E1!   *~ ) & +Z# m 0ZK . Z  *Z% ) & :  A/ " * *Z!  )    .  *~ ×G/y H  4{X * 4C &B& +Z ZB& Z-a Z}J%K . '\BZ! Z . Z *Z ) r ZB a Z K ^"9   *& &   .  *B {& '  /) >ZK. 'ZK *Z& . Z Z!" (Pereneal pattern) 'ZK ‚ C! *' hG K' ' >K. .  *~ +B! wUK E9 .(Sasser and Carter, 1985)  ' ' € J%) M. javanica 4AZZ! h . EZ9 N' :Z! f Z K  eZK . Z NZ$& 'Z) 7 . '\BZ! Z  ) & * 'a   *& & * ) . . 7  ‚ZCL iZ` Z *[    + a BK  O)  '\"K iJ) *!  ) & iJ) 5\) + 0 K  B# *   S ! „ ZK *Z Z *Z[   .  N$& ƒ-& * &  a Meyer et al. 7 * 4A! h . E9  )     /) 4ZZ p  ‚ ZZC! *ZZ' ˆ ˆ†k ZZK' ' . †‡ ZZa . .   '}) ‹bK# vp (a` '  (2004) Z >K. N$&   . &  -& *&J P' † †‡k K 4%# _ VK :  !   "  J& * '\BZ! l  ! 7 . N' :! f  iJ) , JB!  ZwUK r ZB a Z K GH  NZ"  *Z& ' NZ HH L .( Hussey and Barker, 1973 )  ZB a Z K GH  +. 8 N HH L K 4%# _ VK Streptomyces B#Z *Z  :  !B BA/ " B* . .  * ) wUK r nZ|a ]ZB"# -Z%K. + C/# . carpaticus UTS49 4Z%# _ ZVK L  :a 4%# _ VK * ) . E9 _Z!) *Z  :  * ) + ) -%& '     ' *U `' H K *  4A! hy *P * a BK . ' '  'Z Z .Z!  ,Z# m 0ZK Z  Q   *%  . " A . . & +B! b#) 'Z/ A Sclerotinia sclerotiorum *Z A  Q   ' 4C& ) * ×G/y H  + C&9! B# 4%# . _ VK * )   4Z%# Z{"K *Z .(Eini, 2013 ) Z ' +Z%& SqK aB"# Z _ ZVK ZL Z :a . n  * B a  K ' + 0 K ZZ‰  ZZ' '\BZZ! SCA 4ZZ%# _ ZZVK . B#ZZ *' hŒ K' ' . ' K * :a E1!  *~ 4%# *Z ‚ ZC! *Z' H ZK'  ) /& @Q ' >' B9 Zhang ) 4ZZ  ZZ` "ZZ 4AZZ! h  ‚ ZZC! .( Kaura et al ., 2016 )  ' '  ` 4A! hH K .( et al ., 2014 " E" -B "D B " C B "  !B   _ VK . N n :    LK -K .Z! Z  Z : Meloidogyne javanica  FG H I wUK r B a  K ' E1!  *BJ +B! +/a @Q '  MZBK B&Z! *Z! a ' cw` * ) & * 'a *% iJ)  *ZU `' *Z! ZK *  '# *~ +/ a  * +B! iZ! 4Z#1 ]VK B a  K hH ' E1!   'Q _ ZVK ZL  1Z! E1! ' '  ` f '  E/) *Z *ZU `' ' Za nZ ZK *   ' '  ` P' n * ! * _ VK  1! .  ' ' ?A @ K *R9 . 4%# *ZBJ >ZK GHH nZa  + . E9 .  ' ' +/)  Sargin et al ., ) Z 7 Z  /)  *!  BKB ! Nf Hussey and ) Z ' ' Z%BC +BZ! ZwUK r Z   ...  ! " Streptomyces carpaticus UTS49         : +3 " 4% &


. .  '\B! (2001) .(2013 4ZC &B& 1!     8X  BC N ' B _ ZVK *Z ) . E9 :   *$  . -K   *Z  ZJK +B! " k Ka zQ  ×G/y H 4{X * +B! P 8X# @Q ' ' :a BVK :a '  4%# Z-& * %& 'A Ž E1!  *~  # n +  K " Ka @ @Q ' @B! P 8X#  E1!  *BJ 48 . E9 .  @UB"K +   *  R *LK ' *Z' GH ZK' ' 4AZ! ' ZK *Z  ' '  ` +B! *Z)  *`p  p '  *) &. *K 5) . *B\ n *Z Z _ VK + n%Q . E9 ' '  ` + ' ‚ C! hHHH + Z Z *  '$ BK B&! ^"9 T A *  ! *! Z E1Z! Z '9 1! L  _ VK r ! * ! *Z' hŒ hk K' '   ) .  *~ N' :! f 'A . EZ9 . Z ' '  Z` ‚ C! *' R K' ' _ VK . . & *B ' *-& P' G Hk 4 p   ‚ C! .  !  _ VK &K &. K >  *! n Zw *Z% . +   N ) ) & &. *K . c . yG Z *Z Z @UB"K +B!  +/a * '9 N n Z *BZC 4Z`' Z r + _!)  *%  ,Q @K# *! K *   *~ +B! wUK r B a  K *& +/a Z& ]Zp  *`Z!  *% ) +.    *% .  *Q 4Z` ]Z! N Z# Z .  Z EZ/& f '  *U `' Z ]Z ' Zc)  *% +'# n%Q . @?` .    . & *Z _ ZVK  &K &.   4%# SCA _ VK '  *B . 7   *% iBC ! N )     a) .( Witkowska et al ., 2016 )  *?!VK   "# * ! Z zZQ N ˆ‡‡ zQ ' f ' c) : c) {"K * -B "D B " C B " M' G L! J&  Barker (1985) 7 *Z N' :!  f    +  hGH Z :Za ' : B # B B FG H I " E" 7 ‚Z!  *% iJ) ' c) . & 7   .!  _ ZVK NZ ^"Z9 + 0Z K *Z @Z?` Z 7 Z"&K ZB a  K a)  a)  B# *?!VK .  7  Hussey and Barker (1973) ' Z 4ZC &B& Z . E9 .  * ) IBJK  4%# : : Z c) Z * a 4 Z c  *Z  & 4 c  i CU) ‚!  @OK ZwUK r _ ZVK Z *Z  ( ZB a  K GH  ) _ VK +.   Hussey and Janssen (2002) 7 * ] €Q : "[ . *Z *ZU `' ' ' ŒH '   :a E1!  *~ +B! vp (a` ' >K.   /) ^"9   '  )  . : c)  ZZL ]ZZVK + . EZZ9  ' ' +ZZ/) *ZZU `' ^"ZZ9 ZZK . .  '}) bK# Z?A @Z K *R9 . 4%# _ VK L 1! + C&1!! $ % # I"N +N'! +N  . & ` 1! + C&1!! ") )  ' ' ƒ&. * K . . „ 48 . E9 :  !   J + 0Z K Z IZBJK  4%# _ VK S ! {"K * 0 &# + 0 K ! {"K *  4C &B& _!)   7 . ZZ) & iZZJ) 5ZZ\)  N' :ZZ! f ZZ K eZZK  p * L& > zQ  4C &B& _!) *% + :Z! f  K  eK P'   '\B! Meyer et al. (2004) i i  *B ' -& * ( *% BK B&! ' ) *% *?Z!VK 4AZ! h . EZ9 ) & iJ) 5\) P '  N' @Q '  JK zQ . N n E1!  '# JK ' >ZK. . Z *B {& '  /) *!  )    .   * *  JK +B! wUK r B a  K *&   *BJ +/a .   '}) ‹bK# vp (a` E1! .  ' '  ` E/)  f ' *U `' *! K  4   !    +N  k k ;    * ) ‡ ‘‡ 4` ]! *PL + C&1!! .  *Z   SWZ) + 0Z K Z!  Z : G'#   #  *' ˆ K' '   ' ' 4%#  kr _ VK  Siddiqui et al . 7 . Z) & : ]B"l ' {& 'K B#

<=>?  *; ( < .; ( 9: ' :  #   " 7%8

12 a b  . E9  ' '  ` 4A! ’ˆ ˆ„k K * ‚ C! 10 B&# &# -B!'  4C &B&  CFU + 0 K  "# 8 c . ! 6 4 zQ '  4C &B& 4 c  + 0 K ! {"K * CFU (Log) CFU 2 +   . -& *  *% @K# ,Q . E9 0 n +   .   JK i  Q *  +  zQ wheat seed milet seed SCA CFU treatment  “ 7 "&K  *B ' zQ (  /) *! ) N . Papavizas and Lumsden, 1982 ( )  ! 4C &B& 1Z! a)  + 0 K  +.  N" *& ' K  BC S

% xw! ' +K. . '\B!   ' ' : -& K . N$& Spss (16.0)  0 Fig. 1. The effect of millet and grain solid state substrates on . the production of spores at 1%  *CUK :/& '

^& ) > ' 1!  a)   + /  .! Q& " P S. purpurascens  Streptomyces griseus *Z  Z  +BZ!  " C   Streptomyces carpaticus UTS49   ' ' +Z%& ^ ZB& . &'# ƒ&. * K S. thermotolerans  N0035 : Meloidogyne javanica B FG H I " E" - "D Z Z ' H  × .y kH  × .y 'ZL  B# 1! 4 c  Streptomyces *  ' ' +%& 4A! h . E9 B&^ ! (Z!"K  8X BC n +B! ^& :  " . 4! ^& N ) & N' :! f 4 c  > # * '` carpaticus UTS49 Soares ) 'Z :  Z9 *Z" 0  EC KB9B! ?&  a)   5 ZZ\) > ZZ#  ZZP' % H / + 0 KZZ *ZZ ZZ  *ZZ%  ( . . ( et al ., 2007 .( ] )  P' % h + 0 K * ) & iJ)   8”K ' K ( #) ' N" ‚?!  *& '  9 [ 4 K  Z# Z N$& Zahed (2016) _!) *# % u9 ' Z"c  fZ *BZ!%&  L N" *& ' . 4! + ' * }V"K  ZZ @ZKA tZ` Z * A Streptomyces carpaticus UTS49 . Bc"ZP  ƒ  Z  M Z U Z-  ' *C UK ' P' G / +Z%& ^ ZB& . 4Z  ` ! 'K Fusarium oxysporum '\B! 0&i a)    + ) K  GG %Œ/ ^& ‚?! ?` @ tZ` 1Z! Z&. *&  . P'  + 0 K *  B# : ' ' Z  Z  a) Z{"K * & 0 T UV) : ' .( Ellaiah et al ., 2002) '# .'l   EZC KB9B! ƒ&. *•K : 9  *" 0  EC KB9B! ?& *ZPL ^ ZB& :      LK K- ' ' ' ' +Z%& ^ ZB&  Z NZ$& IZBJK K   BC    1Z! Z  a) Z  8ZX   BC ' ' +%& . ' . E9   NZ" *Z& ' EZC KB9B! 1! a)    BC : B +. *& '  N" *& ' . 4! *B ' S  B# 4 c  > 0 H H ( 4%# VK _ N n ' × /h H  ×/Œ H ) +. *& ' (Z!"K  BZC  8ZX ' K +'# *~ *  & . o + .( .( @/ ) 4! ' +. *Z& '  N" *& ' ' ' +%& .B&^ 4!  B#    1Z! &ZK Z&. :    *$ "   . -K  ×/Œ H H (ZZ )) *ZZ )  B#ZZ 1ZZ! > 0ZZ *ZZ ZZ$"K @Z ` Z ”) ZK n . E9 Streptomyces carpaticus UTS49  Z Z ) 4?ZC& ( 4Z%# _ ZVK NZ n ' × /h H H *ZB > Z# 1! 4 c  +K. K * K 4 & ) .( @/ ) & ×G/G H  ( SCA ) ...  ! " Streptomyces carpaticus UTS49         : +3 " 4% &


Streptomyces avermitilis * . & (f  K  eK  iJ) Streptomyces carpaticus &K &.   *# % K. ' . 4!  ZP' G / + 0 Z K *Z iZJ) 5 Z\) > Z# (?! Manp  Z& ) EZC KB9B! k NZ" *Z& ' BC  N$& UTS49 4Z! Z ZP' Œ GŒ/ + 0 Z K * f K   eK > 0 *Z 4?C& K > . E9  B# 1!   -& '  )f .( .( Jayakumar, 2009 ) h.( @/ ) '  ' +. *& '

 4   !   +N  12 a b a b c d d ' ' ' ' +%&  *&J >K. ^B& : G'#   #  10 e ) & CQ > # jA IBJK  8X  BC ' # 8 ' ' +%&  ! . 4!  -& *   *% 6 4   )  *CUK ' B# 1!    N" *& '  ) CFU (Log) CFU 2 > #  B S SCA  B# 1!    +. *& ' 0   *%  ] ' c)  ] €Q  ) & iJ) ' c) after drying after 1 after 3 after 6 month months months     €Q . 4! *B '    ) * 4?C& storage storage storage W.s S.s time B# 1!    N" *& '  ) ' (   +.  ]p ) ;( . . ;( ] ) ' ' +%& > 0 &ZK Z&. Z +.  N" *& ' K  BC S ! TS R/; Streptomyces carpaticus UTS49 Kaura et al . (2016) G% xw! ' 1!   -& Z%#) & Ua 4ac % u9 ' Fig. 2. The effect of millet and grain solid substrates on ^ ^ ZB& . Z&'# Z!  *Z&J _ Z ' S. hydrogenans viability and spores maintenance of Streptomyces carpaticus UTS 49 at 5%.   Z 4 a BK  S. hydrogenans strainDH16 ' ' +%& !

  bA  ' '\B! :  %#) & + "A *  & ) K + -B "D  " C   " M' G      . . 4!  & 0    > 0 jA * : :  ' ' +Z%& Z! :Z :  #    FG IH " E" KK1024 : BZ! Kim et al . (2011) Z! ' : "[   Streptomyces carpaticus UTS49 *ZZ  ƒZZ&. * ZZ K ' ' TZK @ZK A . Z/  + Z"A *Z Streptomyces sampsonii *BZ ' 4Z?OK ZS + Z%# ) & 4 PQ  K   BC @Z ` Z 0 & *%  +.   * SW)  .  cK BC . ]B"# > 0Z  Z (Z!"K BZC +. *Z& '  N" *& ' . 4! ' '   Z Z N &  (?! *%  a)  4! ' *) ˆ.( ] ) &'  B# : %# ) & 4 PQ . . 0Z @ZK A *Z L Z  '   4KUK > 0 *$ B& B#ZZZ ZZZ}A ZZZ% #) & @ ZZZC&B9 ZZZ% u9 ' '. '. K  ) & *  Meloidogyne ZZZ) & ZZZ  ' Streptomyces hydrogenans : : !   J I"N  6U  + N '! iZJ) 5 Z\) > Z# jZA Z) @Z ` p * incognita  ECKB9B! *# &K. *# ' ' +%& T UV) : ^B& – G . > Z N' :Z! f Z K  eK  ( P' HH ? U) ) SCA  *# BaL * 4?C&  ' ' 4%# K  BC .( Kaura et al ., 2016 )  4A!  . c . 4! *B ' )f ""# 0 &# `  ' ' 4%# *Z  *Z# &' ' +%& Ruanpanun et al . (2011) : "R i N" *& '  ) _!) *% *Uw"K ""# 0 &# :B *Z iZJ) 5Z\) > # (?! Streptomyces sp. CMU-MH021 ] y.( y.( ]  ) ' B# 1!    ' ZP' ˆ + 0Z K *  K  eK > 0  P' ;; / + 0 K 5Z\) ZP' †/;  ’— †/ + 0 K  ( )) )*    *CUK
 <=>?  *; ( < .; ( 9: ' :  #   " 7%8

-%K. _  ' Meloidogyne javanica ) & ]B"#  S. carpaticus UTS49 1! + C&1!! S VS " Table 1. The effect of spore suspension of S.carpaticus UTS49 on Meloidogyne javanica in vitro Treatment Egg hatch (%) J2 mortality (%) Streptomyces carpaticus UTS49 23 b 70.33 a control 83 a 11.6 b

-% K. _  ' Meloidogyne javanica ) &  Streptomyces carpaticus UTS49 *  L +.  N" *& ' 4%#   BC S WS " Table 2. The effect of millet and grain solid substrate containing Streptomyces carpaticus UTS49 on Meloidogyne javanica in vitro Treatment Egg hatch (%) J2 mortality (%) Wheat seed 11.3 d 78 b Milet seed 16.6 b 84 a SCA 23 b 71.3 b Control 83 a 11.6 c

*&J _ ' Meloidogyne javanica ) &  Streptomyces carpaticus UTS49 *  L +.  N" *& ' 4%#   BC S XS " Table 3. The effect of millet and grain solid substrate containing Streptomyces carpaticus UTS49 on Meloidogyne javanica in vivo

egg gall (cm) factor factor weight (g) Root fresh Root fresh Gall Index Treatment shoot length length shoot second stage stage second Reproduction Reproduction aerial parts (g) aerial parts The number of The number of The number Fresh weight of Fresh weight root length (cm) root length juvenile/1kg soil) juvenile/1kg Wheat seed + S. carpaticus UTS49 5114 e 2.9 e 650 e 5.8 e 0.8 e 1.5 a 6.7 a 15 a 28.8 a Milet seed + S. carpaticus UTS49 5900 d 3.3 d 730 d 6.6 d 1 d 1.5 b 6.5 b 14.8 a 28.1 a SCA + S. carpaticus UTS49 7360 c 4.3 c 1240 c 10.4 c 1.4 c 1.2 c 6.2 c 14.2 b 27.5 b Spore of S. carpaticus UTS49 8000 b 4.7 b 1500 b 11.5 b 1.8 b 1.1 d 5.8 d 13.9 b 26.5 b

control 13912 a 8.5 a 3114 a 29.4 a 2.6 a 0.7 e 4.6 e 8.2 c 19.1 c

-& * *%  *Uw"K + ! 0 &# + 0  K Streptomyces carpaticus UTS49 *  L +.  N" *& ' 4%#   BC S YS " Table 4. The effect of millet and wheat grain solid substrate containing Streptomyces carpaticus UTS49 on colonization of tomato rhizosphare Trearment Root colonization CFU Wheat seed + S. carpaticus UTS49 105 a × 2.5 108 a × 8.9 Milet seed + S. carpaticus UTS49 105 b × 1.2 108 ab × 6.5 SCA + S. carpaticus UTS49 104 c × 5.5 107c × 1.2 spore of S. carpaticus UTS49 105 c × 4.8 107 c × 0.9 Control d 0 d 0

...  ! " Streptomyces carpaticus UTS49         : +3 " 4% &


  &ZcK ' ZK 4 abL +|B & 4 ?O)  Streptomyces spp. Z 4ZC &B& _Z!) Z   *Z% xw! + 0 &l  Z  Z    > 0 (?!    +K   ! a)  > Zl *Z Z$"K Ž BZC ! Ua 4KUK '$  & ) K .( .( Dimkpa et al ., 2008 ) & K (. Kloepper et al ., 1992 ) ' .  @K A i UBCK  * L

References

BARKER, K . R. 1985. Nematode extraction and bioassays, Karnataka Journal of Agricultural Science, 22:564-566. In: Barker KR, Carter CC and JN Sasser (eds), An KAUR, T. and R. K. MANHAS, 2014. Antifungal, advance treatise on Meloidogyne, Vol. ii, insecticidal, and plant growth promoting potential of Methodology. North Carolina State University Streptomyces hydrogenans DH16. Journal of Basic Graphics, pp. 19–35. Microbiology, 54 (11): 1175–1185. DIMKPA, C., A. SVATOŠ, D. MERTEN, G. BÜCHEL and KAURA, T., S. JASROTIAB, P. OHRIB, M. KUMARI, E. KOTHE, 2008. Hydroxamate siderophores produced 2016. Revaluation of in vitro and in vivo nematicidal by Streptomyces acidiscabies E13 bind nickel and potential of amultifunctional streptomycete, promote growth in cowpea ( Vigna munguiculata L.) Streptomyces hydrogenans strain DH16against under nickel stress. Canadian Journal of Microbiology, Meloidogyne incognita . Microbiological Research, 54 (4): 163-172. 192: 247–252. EINI, S. 2013. Assesment of rhizosphere Streptomyces of KIM, S., S. KANG, J. KIM, Y. LEE and S. HONG, 2011. cucomber for biocontrol of Sclerotinia sclerotiorum Biological control of root-kont nematode by [Dissertation].Karaj: Tehran Univ, Streptomyces sampsonii KK1024. Korean Journal of ELLAIAH, P., K. ADINARAYANA, Y. BHAVANI, Soil Science Fertility, 44 (6): 1150-1157. P. PADMAJA and B. SRINIVASULU, 2002. KLOEPPER, J., S. TUZUN and J. KUC, 1992. Proposed Optimization of process parameters for glucoamylase definitions related to induced disease resistance. production under solid state fermentation by a newly Journal of Biocontrol Science and Technology, 2 (4): isolated Aspergillus species. Process Biochemistry, 349-351. 38 (4): 615–620. LOPEZ-ILORCAL, V., J. G. MACIA-VICENTE and H. B. HUANG, X., N. ZHAO and K. ZHANG, 2004. Extracellular JANSSON, 2008. Mode of action and interaction of enzymes serving as virulence factors in nematophagous nematophagous fungi. In: Ciancio A. and Mukerji K. fungi involved in infection of the host. Research in G. (eds) Integrated Management and Biocontrol of Microbiology, 155 (10): 811-816. Vegetable and Grain Crops Nematodes, pp. 51-76. HUSSEY, R. S. and K. R. BARKER, 1973. A comparison of MALKAWI, H. I., I. SAADOUN, F. A. MOUMANI and M. method of collecting inoculation for Meloidogyne spp. M. MEQDAM, 1999. Use of rapid PCR fingerprinting including a new technique. Plant Disease, 57: 1025- to detect genetic diversity of soil Streptomyces isolates. 1028. New Microbiology, 22 (1): 53-58. HUSSEY, R. S. and G. J. W. JANSSEN, 2002. Root-Knot MEYER, S. L. F., R. N. HUETTEL, X. Z. LIU, R. A. Nematodes: Meloidogyne species, In: Starr, J. L, HUMBER, J. JUBA and J. K. NITAO, 2004. Activity Cook,R and Bridge,J (eds), Plant resistance to parasitic of fungal culture filtrates against soybean cyst nematodes. CAB International, Wallingford, Oxon, nematode and root-knot nematode egg hatch and UK, pp. 43-70 . juvenile motility. Nematology, 6: 23–32. JAYAKUMAR, J. 2009. Streptomyces avermitilis as a PAPAVIZAS, G. C. and R. D. LUMSDEN, 1982. Improved biopesticide for the management of root knot medium for isolation of Trichoderma spp. from soil. nematode, Meloidogyne incognita in tomato . Plant Disease, 66: 1019–1020.
 <=>?  *; ( < .; ( 9: ' :  #   " 7%8

RAMANUJAM, B., R. D. PRASAD, S. SRIRAM and R. SOARES, A. C. F., C. S. SOUSA, M. S. GARRIDO and RANGESWARAN, 2010. Mass production, J. O. PEREZ, 2007. Production of Streptomyces formulation, quality control and delivery of inoculum in strelized rice. Scientica Agricola, 64: 641- Trichoderma for plant disease management . Journal of 644. Plant Protection Sciences, 2 (2): 1-8. TAKATSU, T., N. HORIUCHI, M. ISHIKAWA, RUANPANUN, P., N. TANGCHITSOMKID, K. D. HYDE K. WANIBUCHI, T. MORIGUCHI and S. and S. LUMYONG, 2011. Actinomycetes and fungi TAKAHASHI, 2003. A novel nematocide from isolated from plant-parasitic nematode infested soils: Streptomyces lavendulae SANK 64297 . Journal of screening of the effective biocontrol potential, indole- Antibiotics, 56: 306-309. 3- acetic acid and siderophore production. World VERMA, M., K. B. SATINDER, R. D. TYAGI, R. Y. Journal of Microbiology Biotechnology, 27: 1373- SURAMPALLI and J. R. VALERÓ, 2007. Starch 1380. industry wastewater as substrate for antagonist, SASSER, J. N. and C. C. CARTER, 1985. An advance Trichoderma viride production. Bioresource treatise on Meloidogyne . North Carolina State Technology, 98: 2154-2162. University Graphics, pp. 422 WITKOWSKA, D., A. KANCELISTA, A. WILCZAK, R. SARGIN, S., Y. GEZGIN, R. ELTEM and F. VARDAR, STEMPNIEWICZ, M. PASŁAWSKA, M. PIEGZA 2013. Micropropagule production from Trichoderma W. ŁABA and M. SZCZECH, 2016. Survivability and harzianum EGE-K38 using solid-state fermentation storage stability of Trichoderma atroviride TRS40 and a comparative study for drying methods. Turkish preserved by fluidised bed drying on various Journal of Biology, 37: 139-146. agriculture by-products. Biocontrol Science and SCHAAD, N. W., J. B. JONES and W. CHUN, 2001. Technology, 12(26): 1591–1604. Laboratory guide for identification of plant pathogenic ZAHED, M. J. 2016. Assesment of rhizosphere Streptomyces bacteria. 3nd Ed. APS Press . of tomato for biocontrol of Fusarium oxysporum f.sp. SIDDIQUI, I. A., M. AMER ZAREEN, M. JAVAD ZAKI, radicis-lycopersici [Dissertation]. Karaj: Tehran Univ. and S. S. SHAUKAT, 2001. Use of Trichoderma ZHANG, S. W., Y. T. GAN and B. L. XU, 2014. Efficacy of species in the control of Meloidogyne javanica , Roor- Trichoderma longibrachiatum in the control of rot nematode in the Okra and Mungbean. Pakistan Heterodera avenae . Biocontrol, 59: 319–331. journal of Biological sciences, 4(7): 846-848.

...  ! " Streptomyces carpaticus UTS49         : +3 " 4% & 

             

'  &    !  "##  $%                       

8  7  - *"   2 36 .
5 / 01 234 . *  "#+, ) - . *  ")  (   6$*  45#$ !$3 2'($! 0 01*  ./ -$    #,    !"#$  !"#$ "%! &'($! ) ** +   A34 0 01* 643# '@ =>?   0 01* +<#4      ;  0 01* 9:   '($! 8 6$7 $  $E"  $E"    +($" 4 3- /$3 +"' ? FEG4  E$ D >@4 2' C?  6$7 $ 6$*  3'@ B * (O ,N#$ : AM? J* 7  L : I! J* ) "9: + V 01* D .$  4  &($ R Q$34   ,,@ !& $ T4$/ D * S4 3$ = Fig mosaic emaravirus (FMV)  &($ R Q$34 ;  (NP)  ]<`@^@( D ^*]? ],,@ ]@ 6_  ],[4   $3[* \ $ +FEG4 D ,X  '@ Y":4 VZ,4 ! FMV   !   #, W,4  >]@4 e ] !  ] &($ I]'@ Y":4 VZ,4 3$ 3@  = Q$34 S 5/  $$!  &($ d +( ( bc !$F* W,4 D $  .$ I M? a RT-PCR 6]43 . I .&($ FMV ;  ah"i$  ! "( 3$ !N"#$  $> E$ 643 V Z 3$ + E$ .!  !   g  6$ $ f, S]#   ]  *^ @( E$* D F*  3# +(< . I M? a (NP) 6_ ah"i$   3j 3$ !N"#$  + E$   ! B "(  Q* W,4 + m bb b/ 6$> ] 4 3$ @]- E=E4 643  = _E#   ! B ."( I .&($ Y":4   $k VZ,4 3$ ):",4 + $ c  $3[* Ii! $] +] '@ >@4  e  VZ,4 + n 4   + $ 4 * +@ !$! 6'(  $3 [* FEG4 B ."( ! # !4   +( ( ! !E   $3[*  R ! ( .  6["#$ ) ; 6"#$   + $ +@ E- ! (  4 $o I  !  '@  # 3$  A$>   + $ . + $ .  4  $3[*  ,   S  5/  D  $! ,F4 n[*$ ! 3$ @- +a- B ."( (  , +"#!  II  $ = _]E  $3     ahi  $$! +@ # 4 W,  (!  '@   + $  #  N* 6$> 4 D "' D"$!  II  3$  JA2 . .  4  p  =* FEG4 !  ahi D $ D F* +@   !N h1,4 .RT-PCR  DAS-ELISA  &($ R Q$34 ; D ^*?  <`@ ^@(   $3[* :!  "%

Detection and phylogenetic analysis of Iranian Fig mosaic emaravirus isolates on the basis of the gene encoding Nucleocapsid protein (NP)

1 1 2 1 3 M. SHAHMIRZAIE , F. RAKHSHANDEHROO , M. R. SAFARNEJAD
, H. R. ZAMANIZADEH and T. ELBEAINO 1-PhD. Student, Assistant Professor & Professor, Respectively; Department of Plant Pathology, Science and Research Branch, Islamic Azad University, Tehran, Iran; 2- Associate Professor, Department of Plant viruses, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran; 3- Research Scientist Istituto Agronomico Mediterranero di Bari,Via Ceglie 9, 70010 Valenzano (BA), Italy Abstract Fig mosaic emaravirus (FMV) is considered as one of the main causal agents of Fig Mosaic Disease complex (FMD). In order to detection and identification of FMV in different regions of Iran and better understanding of the phylogenetic relationships between isolates, a number of 54 symptomatic fig leaves with chlorosis and mosaic symptoms were collected from different fig-growing areas in the center, north and south of Iran. Primary detection for all collected samples performed by DAS-ELISA using polyclonal AP-conjugated antibody which was raised against nucleocapsid protein of FMV positive samples in DAS-ELISA were checked by RT-PCR using NP gene specific primers. The amplified fragments of 14 isolates were cloned and sequenced. DAS-ELISA results indicated to a 55.5%FMV infection of collected isolates. Phylogenetic analysis on the basis of nucleotide sequences categorized the isolates in two main groups in which isolates from the center and northern regions of Iran placed in a separate subgroup beside other isolates from other countries which their complete coding sequences were available in GenBank of NCBI whereas the isolates from south of Fars province (Estahban and Jahrum districts) clustered in a separate phylogenetic group distinct from other Iranian and the world isolates which may show that genetic makeup of FMV may be affected by geographical isolation. A significant correlation between symptoms severity and phylogenetic groups observed that may put forward the probability of having a new viral strains in Fars province Key words: DAS-ELISA, Fig mosaic emaravirus (FMV), Nucleocapsid protein, Phylogenetic analysis, RT-PCR.

Corresponding author: [email protected] '  &    !  "##  $%          =  >  =     =  = : $ <3   ")


]]# S]]Q5/ D]$ !]]&$ ! Badnavirus  Closterovirus ? ! = Q$3]4 S]5/  $$!  &($ 6"i! !  ($ ! T i! 6]   D]* o 3$ = (Ficus carica L.)  &($   Gattoni et al ., ) ]($  F4  #, Y":4  '@ +]( 4i +  3$ 6 VZ,4 i ! +@ ! 6$$ 4 .2009; Elbeaino et al ., 2011a, b; Elbeaino et al ., 2007; !3  < $!  $Mj A3$ I +   D$ .  4

\]#*  "i#$ FEG4 +"M ! .( Laney et al ., 2012; +]* !]4  ]'@   q,  3$  < ! 3 ! 3$ 6 <= z- $   D $ ! ("=E$ y =#= 4 $  f Y":4 \$ ! ($* 4  &($   . I#$ ! Double membrane bodies +]{ ! |]'j ] ] R4$]($ ]  A?   R'i + (  R'i VZ,4 ! +  3$ ]'($?  e# ! $ T= j4 S:* * ! (DMBs) 643]# ] ]'",4 +4(4 ;#$  . (Stover et al ., 2007) ]# I 4  F +@ !$! 4 6'( S5/ $$!  d  E*  6$$ 8r e# ! FAO 1"4 T4 (  $i ] }:]'4 ] D$ #, )[# ! ( 90(  6! ] E*  ]'@ D ] ! $ .]t .]04 D* r s +( E# D]$ .( Caglayan et al ., 2010; Nolasco and de Sequeira, 1991 ) ] ;] 6"]#$  I]#$ !$! uh"i$ !i +  &($ ,,@ R]"4 >$ ]# ] = ? +{ ! |'j   R4$($ S]!  ]  ]a ! +] e]# ! ] &($ D* r  E* Fig mosaic emaravirus (FMV) ]] &($ R]] Q$34 ;]] I]#$ !$! u]h"i$ !]i +] $ ] &($  E* S# D"' x,]] ! ;]] D]]$ $3]][* ]]FEG4 ! . ,]] ]]4  D]* S]4 3$ = .(Anonymous, 2015; Anonymous, 2016) ] ], +0[Z ( Fimoviridae !$(i ) Emaravirus # R] Q$34 ]  &($ ! #   D* f:4 ]]t  Fig mosaic emaravirus ;]] ]] 5]]/ . I]]#$ "' ! 34$ +@  4 Fig mosaic Disease (FMD)  &($  Pigeonpea sterility mosaic virus Rose rossette virus ; +]" A"]< !] ]4 I]'@ ( !  &($ +@  '@ European mountain ash  Raspberry leaf blotch virus 3$ ] D ]E$ ] D$ . (Blodgett and Gomec, 1967) I#$ ]($   , +0[Z x, D $ ! > ( ringspot associated virus Condit and Horne \]#* ]=4 ! ] (N E@ ] j T-# Elbeaino and Digiaro, 2009; Mielke-Ehret and Mühlbach, ) v],"4  !"<  D$ ! S5/ . ! A$ > (1933)  ]'   ] .$]($ V ] Z 3$ I]F [Z !   D .$ ( 2012  .$($ ? q( 3$ ai 2E$ !E 6"i!  ! +] e0"($ T o Aceria ficus (Family: Eriophydae) +,@  ( ? =] D ],X  $ +< ?  = Q$34 S5/ T4 $ .]](_ . (Flock and Wallace, 1955) ]] ]]4 SE]]# 6]]   +] ] ] 4  ] d]  3]=(  +=E !   d ]h I]#$   E$* T4@ G +@ FMV ; ! ], ! ]4 6]'( $ ] ] 4 ]/4 3$ 9 ]? A> $ 3$ .$]@ ] +]@  4 N,4 $ +" R* RNA +FGo 9 E- ! ! 4 ! S Q5 /  d 3$ !$F* ! S !$4  ](_ R]* 3] (]($i fo R   $$! 4 (_ FGo D $ . ,"]< S]Q5 / 6] +i] 6  "-  d + 0 +@ "i]]# D ]] $ ! RNA3 +]]@ ]] ]]4 ( Monocisteronic ) 3$ * Rt@ I#$ D= 4 !E  &($ 6"i! i !   4 63 ]] $ ]], ^*? 3]] I]]N cr e]]Z ]] 4 ]](_  ] @ w]1E 3$ ]4$ D]$ +@ ( T=  e F4 3$($ D ^*]]?  ]]<`@^@( 6$]],/ +]] 6]]"E$! @ b E]]=E4 Blodgett and ) I$!  $i e[(! + $ != / 9 @ N @ Elbeaino ) ],@ 4  E* ;  Nucleocapsid protein (NP) 3$ .](_ ] ]# ] D],t 6,@ * .( Gomec, 1967 D ^*]? R  NP go$ ! .( et al. , 2009; Elbeaino et al. , 2012 +]  3$ Y]":4 ] x,] +] n] 4 DNA  RNA v(

Trichovirus Alphcryptovirus Maculavirus Ampelovirus  Open reading frame (ORF)
 *8FG  E) . * "3) . CD ! : B  3 @-A

D ],X  ;  D Q? IWj T E! +  &($ ahi  4 +:]<( D ,t \#* RNA +FGo  +@ I#$  "i# a$ ! ]  @]# ]?   D (* ,(4 + (‚   I E "4 ! T =]'*  !] ]4 !$! 9]? ] D ^*]?  <`@^@( 3$ ] +]@ ]h :'*   A 3$ !N"#$ .>E     I  +/ &4 D $ +@  ! 4 $ ~ D ^*?^@([    +/ &4 ,] +"]$! $ ; ]  ]  !  ]($* I #<-  Io! ]= ? 9  $!]   3]#,(  $! +:<(   ,  ! Shahmirzaie et al ., 2012; Danesh-) ]# ]4 W( +  p 6_ D E$ NP 6_ go$ ! ,,@ 4 N $ $ 4 90( # 

.Amuz et al ., 2014; Ale-Agha and Rakhshandehroo, 2014; 3$  $! +:<(  3# ,( ,  ! +@  4 #   D ] $ 3$ .( Khoshkhatti et al ., 2016; Ghorbani et al ., 2016 ! ](_ +:]<( D ]* 6$$] 6$],/ +  +" M? a 6 ] 5/   E$*  E=E4  #,   A   = ! v],* v]o 6]=4$ T E! +  !$! ! !E   e# ]# ! ($* 4 #  T4/ V o! } :'*   #, 6$,/ + '?   D ^*? ,(  $! +:<( , $ Z ]= ]= "(_ +FEG4   + $ D  $3[* \ $  = "(_ v,* ] ; ]  ! ]= "(_ v],* ]# I] [#,4  (@  ]< Y]":4 VZ],4 ! ; ]  ]= "(_ v,*  " F  Shi et al ., 2007; Överby et al ., 2007; ) ,] ]4 ]G4  ]] X ? €! ! 6 3$ T]]a- B  ]]"(  !]] ,4!]]# ; ]  D ] $ 8rr e# ! .( Callaghan and Dietzgen, 2005 6_  ]],[4 ]] .]]04 .]]o$  ]] E*  ]]  _E 4 ?$]] 6"]# ) 6$*   6"#$ 3$ 6$=  Q$3 4  \#* ]] ,4!]]# e]]",%  C*$"]]#$ +]]Q$$ I]] I]]404  ]#,  ],[4 ] ( !]  .i 6"# ) 6"#E  ( D 4$ T ] E! + RNA .(_  $$!   ; . (Desbiez et al. 1996) 3$]]4 ]]? RNA S  >]]( ]],,@>4 6_ 3$ ]]': E]]=E4 I]]  o I ]] F   {]] 3$]]($  g ]]#  ]] ƒ=* {]] 9]] .( Shahmirzaie et al ., 2010 ) ] ! A$>] (RdRp) #  $ ]] k* D ]] $  ]]($! $ g ]]# „G]]# ! 4 ]](_ $ ]] k*  6"#$ 3$ FMV ;  +$  $3[* FEG4 +]@ !] ;      I( $  + &,4 ($* 4 ],[4 ] 6"#E  >@4 p 6#$i 6$* 6$(34 6!]@ !]E I]404  ] 6_ ] +][j )[]# I#$ D= 4 3$ @]- +]a- B]"( . I]#$  .&($ D ^*?=  6_ D ] $ ! . !]  ]    To(  9,@$?      6 > 4 ]'@ ! ]# !4  +$ D }:'4 N* ./ FMV ]  &($ R ] Q$34 ;    !   #, $" $ V 01* ] +]# $] +] +FEG4 !4  +# 4 * .  4 VZ],4 !  ] &($ R ] Q$34   SQ5/  $$!   +( ( ! ]($ +]" $]o  3 R ! + @* '@ 3$  A$>    *^@(  $3[* \ $ D ,X   .&($ 6$ $ Y":4 $3]][* ]]FEG4 D ]],X .( Danesh-Amuz et al ., 2014 ) A$>]  ] ]+ $  #  $($   $+   #$, 4  3$]4 ]? 6_ ;]#$   &($ R Q$34 ; ($$ +# D ^*]?  ]<`@^@( ,,@  E* 6_  ,[4  6 !  +] ]( 4] *  !]  +# D$ ! N* ./ 3$ @- . # ]($ + ]" $o   3 R ! $ +($" 4   + # $ ], ! 6]'( ]($* ]4 B "( D .$ (Shahmirzaie et al ., 2012)   H  +] + ] @* ]'@ 3$ ; ]  D ] $  ] D "#$ ! e "-$ !$F* b 6"< *   eh Z ! :    3 .  €"'4 4=* | ',4 D"$!  6$ $ E  VZ,4  = Q$3]4 }i] S ] 5/  $$! +]@  ] &($  +( ( bc R Q$34 ;  W",4 j   $ A"< + +*  =] ] D ],X  3]@ 3]=( ]2(3 + - T4 6"i! ! ;    ! 5='4 D ,X  (FMV) &($ 

 *]0 01*  &* !i  &($ j 3$   4   d ~ Ribonucleoprotein complexes (RNPs) '  &    !  "##  $%          =  >  =     =  = : $ <3   ")


b EDTA pH b/ PBS X)  ]]   ]]h/ ]] S]]&- 65 ]]  (D ]]=,* ) 6$]](34  (D ]]4$ ) 6$]]*  ]] 6"]]#$   !]# ], t 6] ! ( PVP-40 ]a! 8 {]4 4  6]]4@  (‰$3 ) !>]]  (]]# ) >]]@4  ($"]]#  6]]& { ) $> ]] {$ T]]-$4 .]]&($ 3$ x]]?   ]]  ]] ]]h/ J ]]   g]  ( I@  B$ 6["#$ . ) ;  ( ‰ # ) BioTeck e]]4 6$]]i $> ]] {$ 2"]]#! 3$ !N"]]#$ ]] B ]]"(  e] )  $2( J  2'43 + e0"($ 643 * ]  ]  3$ !]4 "4(]( crb †4 eZ ! instrument EL800 .( T= 

. ," $o R ] Q$34 ; ]  ]  ! I] : I RNA O PQ ELISA 6]43 ! +@   +( ( 3$ T@ RNA †$:"#$  &($ I @ + # (!  !$! } :'* I[ƒ4 !E + I[<( HiYield™ Total RNA Mini Kit (Plant), RNA †$:"]]#$ T FE$"#! ;#$    I 3$ (Real-Biotech, Taiwan) RNA I ] @  I ] @ N ]# . ] .]&($ +]Z 4 I@ D ],X  % 3 e_ ! 3"=E$ + #  †$:"#$ NanoDrop™1000 y$!(( 2"#!   "4""=`#$ \#*  ]] .]]&($ Spectrophotometer (Thermo Scientific,USA) T]0",4 ; <# +! 8r >  +  $2( I  +( (

. . ( +] !]E  ] d ! FMD &($  R Q$34   SQ5/ *L I9)   " N  M#N L 9K     J)  $ A = Q$34 SQ5/ $$! !E Ii! 3$   ( : (A) .  &($ R Q$34 ;  (RT-PCR) I]]  ]] 3j ]]# D ]] $ ! : NN  NN!& T]a$  ! 3]@  R] Q$34 : (C)  (B)   4 /4 3$ 9 ? A>  e] ) FMV-NP (Reverse) I'  FMV -NP (Forward) . 3@   d = : (D) 3=( 2(3 $ +  d[ D Fig. 1. Symptoms of Fig Mosaic Disease (FMD) in FMV -  ]]<`@^@( ]](_ +]]FGo T]]4@ e]]Z ]] ƒ=* I]]  8( infected leaves. (A): Infected fig tree showing mosaic, chlorosis and $>]]]$ .]]( \]]#*  ]]] &($ R ]] Q$34 ; ]]  D ^*]]? premature fruit drop. (B) and (C): interveinal mosaic and chlorosis associated with rust-color necrosis bands. (D): Deformity and Ver.9, Scientific and ) Clone Manager Professional chlorosis in fig leaves. \]#* ]( >",#    -$Z ( Educational Software, USA . .  .&($ 6 E MWG I@ N N3  B7A '  K JE  %7   $ A \]#* = _E]#  ] 6]43 B  ]"(  ] Q* W,4 + ! FMV ]]  !  + ]] E$  ]]#, ]]W,4 +]] : FMV NN 3$ !N"]#$ ] OT =4 .6$.$ ! Ii# $" $  RT-PCR 643 (DAS-ELISA) S 0"<4 $> {$ 643 S 5/  $$!   +( ( r r $]] +]] ]] †$:"]]#$ RNA 3$ .]]= 4 rr b ]],t  !]] ]]"( 3$ !N"]]#$ ]] (Clark and Adams, 1977)  FMV-NP (Reverse) "' ah"i$ 3j 3$ e4= ? + ] / +]@ 3*N]< D E]=E S >(   $! 6'( $ +(< S]&- ! ˆ ;]=F4 $! +:<( S >( 3$ -$ 8rr D ,X ]  &($ R ] Q$34 ; ]  ]($ $ + $  <`@^@( D ^*? D  ] . (Unpublished Data) ] .]&($ !]  + * (FMV)  cDNA ˆ Moloney murine leukaemia virus (MMLV) ] $ +]# ! S ] 5/  $$!  ] &($   d 3$ !$F* W,4
 *8FG  E) . * "3) . CD ! : B  3 @-A

E. coli K12 DH5 α  F"]<4  ] e# 3$ !N"#$   *$- cDNA >",]]# I ]] @ T FE$"]]#! ;]]#$ ]] ]]" E= 4 8r  ]<`@^@( 6_ T]4- ) ] @*( 3]# +(< To( $ + . I M? a ( Thermo Fisher Scientific, USA ) LB \ ]]]14  "@]]] I]]]'@ 3$ x]]]? . ]]] .]]]&($  FMV ; ]  ]  ! ]W,4 +] NP 6_  ] ƒ=* I  (50 µg/ml) D  ]# ]`4 R] * "( - (Luria-Bertani) R]* S  >]( 3$ !N"]#$ ] PCR 3$]4 ]? $  ] &(3 9,@$  ]]#5? †$:"]]#$  X-Gal (40µg/ml)  IPTG (0.2 mM) /r 6$> ] 4 +] (5Unit/ml) (Fermentas Inc, Germany) Š3$ ? PCR ],@ 6]43 +]@ ]2(  N]# ] +,? 3$ ) @*( 3$ .$@  3$ " E= 4 8/  cDNA 3$ " E= 4  " E= 4 ] !] !]@ ] ‹* ]( ! $ 3]# +(< , I1a b/8 {]4= ? r I]Wj ] "]'  I]   3j High Pure Plasmid Isolation Kit I]]] @ 3$ !N"]]]#$ {]4 ] 4 br 3$ ]" E= 4  r X PCR  3$ " E= 4   ]]#5? E$]]* D ]] F* .]] .]]&($ (Roche,Germany) S]]&- ! {]]4= 4 r dNTPs 3$ ]]" E= 4 b/r  MgCl2 3$ !N"]# $ ] ], ]@ 6_@]4 I@ \#* ) @*( R ] T4] PCR  4! +4( .  .&($ " E= 4 8b  (   ] ] E$]* x`]#   .&($ M13 4 /  3j ; ]<# +]! c  4! !  $" $ 6 I#$ +-4 ! !4 FMV ; D ^*?  <`@^@( 6_ T4@ E$* I]#$ T4]  ]4! +it r $ + +0 o! c 4 + e] ) ] +<04 BLAST $>$ .( \#* NCBI 6_ R( + ] (‚ cb ]4 +] ; <# +! c  4! ! + E$  3# \]#* ] *^@( ] E$]* 3]# Y! 3$ x? .(  +] ; ]<# +! b  4! ! 2E$ +" + 3j eh*$ S]]#  $3]][* \]] $ ]]#  Clustal X $>]]$ .]]( +]! 8  ]4! ! ]W( !]4 +]FGo  ] ƒ=* + (‚ cb 4 ]]2E$ ]],[4 ]] Bootstrap ]]h = "(_]]  I]]i!  (  ƒ=* +-4 R 6 ? !  + (‚ cb 4 + ; <# $>]]]$ .]]]( \]]]#* $]]]=* rrr ]]] Neighbor joining  $] . !] +]0 o! b ]4 +] ; ]<# +! 8  4! ! . .  .&($ Mega 6 (MEGA Software,USA) e]h14 3]"=E$ $]" $ ]  ] ƒ=* +]FGo  3# ,( TAE1X ]]] $]] +]] ]]a! b/ 3]] e_ ! PCR R4 Q  Acetic acid {]4 ] 4 8r  pH 7.6 Tris {]4 ] cr4 ) EDTA !  ] &($ R ] Q$34 ;    ! W,4 + V 01* D $ + ] E$ ]  ! B "(  Q* 3$ x? .  .&($ ( {4 4  RT-PCR FMV D ],X  ]'@ Y]":4 VZ],4 ! S ] 5/  $$! 6"i! + ] $ c !$F*  643 ! + !E   +( ( 6_ ;]#$ ] ]   g]   ] ]#+  $3[* # .  ! f:"($   $k N*  ,[4  6]"i! 3$ ]W,4 D]$ $] . IM? a  <`@^@( : 7  '  K '   &    !  $%   3 '@ Y":4 VZ,4 j ! !3  R Q$34 S5/ $$! T]4@ eZ  - ):",4   + $ 3$ +"  ƒ=* (_ +FGo 3$ !N"]#$ ] $> E$ 643  !E !   $! +( ( E$* D F*   3# +(< I D ^*?  <`% ^@( E$* ] 6]43 B]"( . ] .]&($ ; ah"i$ ! "( ;]#$ ] Ultra-Clean purification kit I @ 3$ !N"#$  $" $ bc bc v] &4 3$ +]( ( r 6!] !]E 3$ @]- =_E # Gene JET TM Gel Extraction Kit (3]# I@] T]@*? +]*  . !  &($ R Q$34 ; +  (a! bb )b/ +( (  ] !  3# }Ei 3 e_ 3$ (Fermentas Inc, Germany) $$! ] +]( ( ! ;] D]$ +] E$ } :'* B"( + Thermo Fisher ) pTZ57R/T 3]# +(]< T]o( ! x`]#  !>]  ( ‰ ]# ) 6]4@ ] 6"#$ 3$   g  S5/ €] A +] e]0"($ T / .  !$! $o ( Scientific, USA

3$ ]#  !4  +( ( V 01* D$ ! . '( ! (‰$3 ) Š Taq DNA Polymerase '  &    !  "##  $%          =  >  =     =  = : $ <3   ")

](!$! 6]'( ] &($ R] Q$34 ;] + $ !E D" @ 6$](34  ( B]$  I]@ . 6["#$ ) ;  6"#$ .( .( e )  !E D"' a! /  s8  / ) ** + ( D =,* ) ]a! r / ] ( 6]& {  $"]# ) 65  6"#$  +( (

 RT-PCR  DAS-ELISA _E# 643 !    g    +( ( ! FMV ;  + E$   ! B "( *L S    $k +0G,4  3$ ):",4    E$*   + $ !$F* $ + Table 1. Results of FMV primary detection in collected samples using serological assay DAS-ELISA and RT-PCR and number of sequenced isolates which were selected from each geographical region Collected and Tested Province Region Infected samples Sequenced isolates samples No No % No Tehran Varamin 3 2 66.6 1 Jahrom 7 4 57.1 3 Estahban 4 4 100 4 Fars Iej 3 3 100 - Karft 3 3 100 - Kerman Sirch 3 - - - Astara 7 2 28.5 1 Gilan Lahijan 6 2 33.3 2 Mazandaran Tonekabon 9 7 77.7 2 Markazi Saveh 5 3 60 1 Yazd Zarch(Sarcheshmeh) 4 - - - Total 54 30 55.5 14

  &($ R Q$34 ;  D ^*?  <`@^@( ,,@ >4 6_  ƒ=* ! !N"#$ !4   3j E$* 5L S  Table 2. Sequences of the primers used in amplification of FMV nucleocapsid protein Primer name Nucleotide sequence of primer Expected size Annealing region FMV-NP(Forward) 5’ CCATGGCACCTAAGAGTAAGACTAC 3’ 950 Nucleocapsid Protein FMV-NP(Reverse) 5’ CTCGAGAACATGAGCACTTGCAATC 3’

] ;] ]# !] 3$ ]( ($* 4  +( ( D$ ! 3@  = Q$34 S5/ !   +( ( 3$ !$F* ! : : T [o 3$   &($ $3  3$ x]? ]E ]!2 ( }:]'4 $>]{$ 643 ! ( !E ;]  ]ah"i$ ] 3j ] RT-PCR 6]43 .&($ Fig latent virus-1(FLV-1), Fig leaf mottle associated virus-1(FLMaV-1) (Shahmirzaie et al. , 2012), FLMaV-2 ! I]#$ D]= 4 vp4 D$ +@ ! ! ( ! FMV (Danesh-Amuz et al. 2014), FLMaV-3 (Norozian et al. , ]N"4  C     ! ; IWj 6! S@ ‚$ 2014), Fig fleck associated virus (FFKaV ), Fig cryptic 3$ ]2! ]i ! .  #  +$ ! =_E# virus (FCV) (Ale-Agha & Rakhshandehroo, 2014), Fig FMV badnavirus-1(FBV-1) (Alishiri et al ., 2016; Alimoradian 3$ R]] Œ ]] ] ;]] S]]5/ !] ]] ]] +]( ( et al. , 2014). S5/ ! . '( ! ( ! RT-PCR  $>{$  643
 *8FG  E) . * "3) . CD ! : B  3 @-A

V 01* D $ ! # !4  (FMV)  &($ R Q$34 ;    + $ 6 > 4  ‹',4    ; 8L S  Table 3. Accession numbers, hosts and origins of Fig mosaic emaravirus (FMV) isolates/strains analyzed in this study Origin (Number Nucleotide Accession Isolate Protein-ID Host of isolates) Numbers Name/strain Australia(1) KU674950 AQR59327 Aust Ficus carica Canada(1) HQ703345 AEI98678 CAN01 F.carica MG880766,MG880758, - VA22, JA1, F.carica MG880759,MG880760, JA2, JA3, MG880754,MG880753, ES1,ES2, Iran(14) MG880755,MG880756, ES3, ES4, MG880757,MG880761, AS1,LA2, MG880762,MG880764, LA4,TO4, MG880765,MG880763 TO7,SA5 Italy(2) FM991954, LC002800 CAX21211, BAU20387 GR10, IR-1 F.carica AB697843, AB697844, BAM13802, BAM13803, JS1, JF1, F.carica cv. Hourashi, F.carica cv. Hourashi, AB697846, AB697847, BAM13805, BAM13806, JTT-At, JTT-Ki, F.carica cv. Athenes , F.carica cv. King, Japan(7) AB697848, AB697849, BAM13807, BAM13808, JTT-Li, JTT-Pa, F.carica cv. Lisa , F.carica cv. Panachee, AB697850 BAM13809 JTT-Vi F.carica cv. Violette de Sollies AB697851, AB697852, BAM13810, BAM13811, SB1, SB2-2, F.carica Serbia(6) AB697853, AB697854, BAM13812, BAM13813, SB2-3, SB2-4, AB697855, AB697856 BAM13814, BAM13815 SB2-5, SB2-6

3$ !N"]#$  RT-PCR 643 B "( . +[#14 " E= 4 ! I45]# 3$ 6], Z$ W,4 + +@  ! 4 6'( B "( D $ 3$ @]-  ]<`@^@( ],,@ @ 6_ ah"i$   3j p E=E4  R_E#  A 3$ !N"#$ 6"i! !]E  ] +]( ( ! 3 IN br eZ + (_ +FGo  ƒ=* +]   R 64> !E ! 6=4$ + +*  .  4 I] $! V ]G* ]W( !]4 6_ 3$]($ ] +]FGo D ] $ +]@  ! multiplex- T] [o 3$ T =4  A 3$ !N"#$ ; ,t 8.( 8.( T= ) !,]' ?  ] E$*  T<(  ,"[4  A   PCR ]W( !4 (  <`@^@( 6_ 3# +(< W,4 + +]@ ] ! ]4 6]'( 6$$ ! +"M 0 01* B"( . !! 4 !  ] 3]#$ 3 e_  3$ ):",4  +$ ! S]5/ $$! ] &($ 6"i! ; D* S4 6$,/ + FMV 6]43  3# +(< I1a .! !$ pTZ57R /T To( .( Danesh-Amuz et al ., 2014 ) !$! ! R Q$34  3$  ]#5? †$:"]#$ 3$ x]?  ] ] ‹*  # ? , @ ;]] ]]= "(_ v]],*  ]],@$? V]] 01* D]]$ ! 3$ !N"]]#$ ]] ]](_ +]]FGo E$]]* D ]]F* )]]:",4 ]] ]],@  ]<`@^@( ,,@>4 6_ T4@ E$* +?   &($ R Q$3$4  ]]# 3$ x]? . IM]]? ]a e]]# ( ] ] $? VZ],4 3$ ]  g]   +$ D ! FMV D ^*? 6_ ( R( ! MG880753-66    ;   E$*  +( ( 3$ RNA $" $ W,4 D$ $ .  .&($ 6$$ Y":4 N! S D ,X  BLAST > E( B"( . ( I[‚ (NCBI) . †$:"#$ E$]* ] $ ]a!  8 I '4  # !4  E$ * 3$ @]- 3] e_ ! 4 3[  RNA   (  '4 6_  #$, 4 E$*  a! s  I '4   *^@( RNA I]Wj  ] 4 +a- R ^@(  #$  { ui  ] ; ) x($] E$* + n 4 (N-gene)  <`@^@( .(( /8 !- y$!(( 2"#! \#*  †$:"#$ T@ . . !$! 6'( ( FM991954.1  Next generation sequencing (NGS) '  &    !  "##  $%          =  >  =     =  = : $ <3   ")


] *^@( E$]* ],[4  $3[* \ $ # ! 1 2 3 4 5 6 7 8 H M ! !  ]'@ ]# ] +]$  # !4  +$ D]$ ;]#$ ] . (] ], +"]#! $>]&4 = "(_]   E   >@4 VZ,4 + n 4  +$ 4 * , 

6] VZ],4 # 3$  A$>  +$ $ + 6$$ 1000 bp +] n] 4 ] +$ +/ &4 . ( , +"#! I  ! ]] ! $>]]&4 ]]h ( .]]  6["]]#$ ) ;]] 6"]]#$ ES2 ES1 II  +$ !  D$ ! . ," $o = "(_  ]]],,@>4 6_  ]]] ƒ=* 3$ T]]]a- PCR e]]]h14 5L I9NNN)  ES3  +$  I 3 ! 6["#$ 6"# + n 4 ]] Fig mosaic emaravirus (FMV) ;]] Nucleocapsid Protein .] 6"#  + $ $ + ( 6["#$ 6"# ) ES4 FMV-  FMV-NP(Forward) ]]]]ah"i$ ]]]] 3j 3$ !N"]]]]#$ .( .( T= ) . (  , +"#! II  3 ! 1Kb DNA ladder (Excel :M . ]a! b/ 3] e_  NP(Reverse) FMV + !E  &($   : 1-8 &($ SE#   : H Band, SMOBIO)

Fig. 2. PCR Amplification of Nucleocapsid Protein Gene of Fig mosaic emaravirus (FMV) Using FMV-NP (Forward) and FMV-NP (Reverse) Primers. M, 1Kb DNA ladder (Excel Band, SMOBIO); H, healthy fig plants; 1-8: FMV infected fig plants.

Subgroup I

Group I

Subgroup II

Subgroup I

Group II Subgroup II

   ($ $ ):",4 + $ c 6 ! +@ FMV D ^*?  <`@^@( ,,@ >4 +0G,4   *^@(   E$* # 3$ Ta-  $3[* Ii! 8– I9) 3$ a! br 3$ " @   A3$ a! sr A \i  rb/r = "(_ +a . # !  I[‚ ( T4@ E$* NCBI 6_ R( ! +@ 6 3$ + $ . . ! f:"($ outgroup 6$,/ + European mountain ash ring spot associated virus (EMARaV)(KJ439589) ; . ( ŽM-     Fig. 3. Phylogenetic tree constructed using nucleotide sequences of FMV nucleocapsid protein coding region of 14 Iranian isolates in comparison with 17related FMV isolates in NCBI. Genetic distance and Cut off are 0.05 and 80% respectively. Bootstrap values less than 50% are omitted. European mountain ash ring spot associated virus (EMARaV) (Accession No. KJ439589) is selected as an out-group species.
 *8FG  E) . * "3) . CD ! : B  3 @-A

Group I

Group II

  ] ]($  $ )]:",4 + $ c 6 ! +@ FMV D ^*?  <`@^@( ,,@ >4 +0G,4   #$, 4   E$* # 3$ Ta-  $3[* Ii! U– I9)    3$ ]a! br 3$ ]" @   A3$ a! sr A \i   = "(_ +a . # !  I[‚ ( T4@ E$* NCBI 6_ R( ! +@ 6 3$ + $ . . ! f:"($ outgroup 6$,/ + European mountain ash ring spot associated virus (EMARaV)(KJ439589) ; . ( ŽM-   Fig. 4. Phylogenetic tree constructed using amino acid sequences of FMV nucleocapsid protein coding region of 14 Iranian isolates in comparison with 17 related FMV isolates in NCBI. Genetic distance and Cut off are 1 and 80% respectively. Bootstrap values less than 50% are omitted. European mountain ash ring spot associated virus (EMARaV) (Accession No. KJ439589) is selected as an out-group species

9  $!]   3]#,(   $!] +:]<(  ] ,  ! NP  ] E$]*  ],[4 ] ] $3 ][* \ $ # D ,X „G]# !][ )]4 ]($* ]4  N* D $ #  = ? !$! 6]]'( D ^*]]?  ]]<`@^@( ]],,% ]]% 6_   ]]#$, 4  +  ]# ! ] $3  ] ]0*$ ]W,4 +] D ^*]?  != / . (! 4  , +"#! $>&4  8 ! # !4   $+ B  ]"( +]< 04 . (Garcia-Arenal et al ., 2001) !!] ]#  ;] 6"]#$ +] n] 4 + ] $ R ] ,*  ,  D $ !    ]#$, 4    *^@( E$*  ,[4   $+  ,  $]o = "(_   R  ! $>&4 a +  JA2  ( . ) ! ]# !]4   + $ !4 !  ! +@  ! 4 6'( +] I[]<( 6 ]*! ]= "(_ +]a , ! 6'( +@ !  4 !  ] ! $ +@ G( . (  4 $o +($  ! c.( T= )  4  + $  # 4 4 ]] * NP 6_  ]] *^@( Ž!$]]*  ]],[4  ]], ]] positive selection ) I][ƒ4 f]:"($ ]' # 4 W( + ! ]," $]o $>]&4 ] R  ! ; 6"#$   $+ v],* )]4  ]  *^@( v],* *  ! )4 ( pressure +]Z 4 6_   #$, 4 Ž!$*  ,[4   ,  ! += E- 6_ 9]0( + +*  . !! (JA2) . + $ !   #$, 4 '  &    !  "##  $%          =  >  =     =  = : $ <3   ") 

]($ $  ] ]+ $ ] 6 +< 04 6=4$ V 01* D $ ! + @* ] ! ( JA2 .] + $ ) ; 6"#$ 3$ + $ R  ,* +]]@ !$! 6]]'( V ]] 01* D ]] $ B ]]"( . ! ]][ (   M]]? 6]]=4$  $] ]N"4  ] 6$]@ ! + +*  . I $o .! 6$ ] $ >]@4  E ] VZ],4 +] n] 4  ] ]+ $ 4  * 3$   ]< ! +] * ],  $ ! +], 4  #$ R     $o $] +] (  >]@4  6$]* 6$](34 65 ]  ] 6"#$ ) Ž!$]* !  ] k* +] &,4   *^@( Ž!$* !  k* !$4 $!](@ 6"]< a D?$_  $E"   '@ + n 4   $+ ! +@ !! 4 )[# I Fp D .$ !! ( +Z 4  #$, 4 ]4$ D ] $ +@ (  4 $o = "(_   R  !  E$"#$  ]   ]#$, 4 „G]# ! ] ]+ $ + ]'* !$4 3$  <  V ] 01* R ] B ."(  4  $+ D $  { + '* 3$ @- ] ]+ $  ], ] !  ] N*  ! "' 2 =  R ] Q$34 ; ]  + $ (NP-gene)  4 (_ +FGo  ,[4  ]  .&($ # ! . (Alishiri et al ., 2013) !!  '4 ]] + ]] $ D $]] ]]= !>( 3$ @]]- 6"]]#E 6"]]#$ 3$  ]] &($ ]* 8 6$> ] 4 + I    + $    *^@( Ž!$* ;#$ Ghorbani et al ., ) ] ]4 D]?$_  6"]< a 3$   $+ +]<  04 ] . ,"]$! I [] II    + $  a!  .( .( 2016 !]- !  ! D $ D I [ 6$> 4    #$, 4 Ž!$*   ] ]+ $  $3[* +FEG4  D E$  $ V 01* D $ ! ] II  3$ JA2 . + $ .  ! D F* a! s * r   { I'@  3 „G# !  . I M? a ; 6"#$ I [] 6$> 4 D " @  $$! I  z/$  + '* a ! r $ !  6"#$ D $ !  &($ D  "]' D"]$! ] + $ D .$  4   #$, 4 „G# ! ! 6,@]]*  ]]  D ]] $ !  ]] &($ R ]] Q$34  ]] 6$$]] +@ # 4 W,  (!  '@   + $  #  N* 6$> 4 ]a ]# 6"#$ D $   $+ = "(_ v,* uhi  !]N ]h1,4 = _E  $3     ahi  $$! „G]]# !  $3]][* \]] $ ]]# B ]]"( . I]]#$ +]]"2(  ]p  =* FEG4 !  ahi D $ D F* +@  6"]#$  ] ]+ $ 4 ] * +@ !$! 6'( (  T= )   *^@( .  4 3$ T0"]<4 = "(_]   R ! ( .  6["#$ ) ; 3$ FMV ;    $+  $3[* FEG4 +"M ! ! ]N* D ] .$ ] ]4 6]  6$ ] $  ] ]+ $  # ] 6$*  6$(34  p 6#$i   6"#$  &($ j $  ]  +  ]# R ] z- e "-$ ; 6"#$   $+ D ^*?]=  6_  #$  , 4    *^@(   E$*  ,[4   3]#,( , (4   ,  . !3# 4 G4 +0G,4 6  $ Danesh-Amuz ) !]] +]]" ]]a 3$]]4 ]]? D ],X   +"]< $ 3$]4 ? S.6$.$ >(  Gi ‚$ ! +@ Gi F"<4 et al ., 2014; Shahmirzaie et al. , 2012; Ale-Agha and .   [ @*](  ] W(   !$]i  !!] 4 !& $  .6$.$ + +@  ! 4 6'( 0 01* D $ B "( .( Rakhshandehroo, 2014 3$ 6_*]? 6] > 4 T 0"4 $‚$ D ,X  ‘ "(_ =  ( 3$ ] A$>]  ] + $ $ + $($   $+ 4  * = "(_ v,* !& $ ! ,($* 4 G 14 T4$/  D o( V Z D ] $ +]@ (  4 $o +($   3 R  ! + @* '@ Zarghani et al ., 2013; Schneider and Roossinck, ) , ‚4 ] ] + $ D $   $k  3# , ! 6'( ($* 4 4$ !]&  $ ! ],($* ]4 T4$/ D $ 3$ .$@  +@ &( 3$ .( 2001 .  6 3$  A$>   + $  # + I[<( 2 =  ] >]@4  e ] VZ],4  ] ]+ $ D ] ! ]= "(_ v,* D"]$! ] 4  # fj +0G,4  &($   | ',4 +@ &( 3$ ] + ] @* '@ 3$  A$>   + $ €"'4 4=* | ',4

 error-prone replication +* .  ( W"($ 3$ ! 6$ $ E  VZ,4   + $   RdRp  Recombination ]'@   $+ D ^*?  <`@^@( 6_ E$* I[‚ ./ + ‘ Genetic reassortment  *8FG  E) . * "3) . CD ! : B  3 @-A

! ]N* +] &,4 ($* 4   '4 "(_ =   N*  6["]#$ 6"]# ) ;] 6"]#$ +] n] 4  ] $+ ! ] $3     6$> 4 +  3$ #   ahi D ]] $ ! ]] =* ]]FEG4 D  $ ]], ,]] ‚]]4  (.]]  +  ]# 3]  = "(_ N* D $ +@ !! +Z 4   $+  ]( ,  vo +"M .!  4  p uhi  S ] 5/  {  T4/ 6$,/ + ($* 4 $3      $$! ]    ] ; ]  ! = "(_ v,* !& $ ! "(_ = . .  G4 +0G,4 !  / ]] Tomato spotted wilt virus (TSWV)  ] A$>] ;] 6"#$ !  &($ R Q$34   \#* ! T] "14 T4/ 6$,/ + ,  D .$ (Tentchev et al ., 2011) !  ] &($  ] E* I] 3$ 6"#$ D $ I $ + +*  . I#$ ; ]   ] ]+ $ !     + # !& $  v,* !& $ ]#    + # !   '4 N* D ,X  '@ . (Walia et al ., 2014) I]#$  ] A$>] > (  &($ R Q$34 v]( +]@ ]# ]4 ]W, ]'@ VZ],4   ]# ] +0G,4 D $ v( +@ I#$ !$! 6'( + @* ! +" a [o FEG4  ! 0"<4 90( +0G,4 ! !4 #    #+ ]N"4  ] &($ Y":4 .o$ 3$  $ #    #+ .]&($ +] † ] "-$ + W( D $  ‹  * +@  +"$! $3    ! +]0G,4 4  .o$ 90( 3$ @- ($* 4 4$ D .$  4 . . !$! uhi D $ !  =* FEG4  ] &($ R ] Q$34 ; ]      !$C( +F#*  v,* !& $ 6"#$ !  I'@ .o$ +@ &( 3$ . (Elçi et al ., 2013)  References 4 ]  >[]# S]o * / ( 6["#$ 6"# ahi ) ;

ALE ‐AGHA, G. N. and F. RAKHSHANDEHROO, 2014. ],(4 ]'@ e ] ! ] / .o$ 3$ N"4  ! +0G,4 Detection and Molecular Variability of Fig 4 4 ] .o$ 90( $ME , 4 ( ('@  N &,4 !3  )# Fleck ‐Associated Virus and Fig Cryptic Virus in Iran. Journal of Phytopathology, 162 (7–8), pp. 417–425. ! ; ]   ]    + #  "(_ =   N* !& $ ! ALIMORADIAN, P., F. RAKHSHANDEHROO and M. 90( !4 ! * o! V   =* FEG4 +"[E$ . I< ( W"($ 3$ SHAMS-BAKHSH, 2014. First record of Fig D ],X  S ] 5/  ] $3    ! 4    #+ Badnavirus-1 in fig trees in Iran. Journal of Plant ] . ! M]? ]a  ]  +0G,4 4  .o$   e0"($  ($* Pathology, 96 (4SUP), pp. 4–124. ALISHIRI, A. F. RAKHSHANDEHROO, G. H. SALEHI ! 6["]#$  .] +]0G,4 !  ]  $k ]= !>( + +* JOUZANI and M. SHAMS-BAKHSH, 2016.  ]  ƒ=* !$]4  e]( !"]< {![* !  ; 6"#$ Detection and Molecular Characterization of Fig +] n] 4  ] + $ ! + '* +0G,4 ! D $ D !   badnavirus-1 Iranian isolates on the Basis of the Protease Gene. Applied Entomology and n 4   + $ D" $o . # 4 W, 0G,4 VZ,4 D $ Phytopathology, 84(1), pp.119–130. 6]'( $>]&4 ] R ] ! ( ]'@ f], ) ; 6"#$ + ALISHIRI, A., F. RAKHSHANDEHROO, H. R. T]4=*  ]= "(_ v],* !& $ !  $  k  $ ‚$ , ! ZAMANIZADEH and P. PALUKAITIS, 2013. Prevalence of tobacco mosaic virus in Iran and $$ Y":4   ’ *(_ ! , ! 6'( ($* 4  I#$ evolutionary analyses of the coat protein gene. The ! $]$  ] ’ ] *(_ !] > ( +"M ! .  +0G,4 ! Plant Pathology Journal, 29(3), pp. 260-273 f], VZ],4 !  ]4 ](> ! d ;    I F  ANONYMOUS, 2014. Preliminary 2014 Production Data. . (Kargar et al ., 2016) I]#$  ] ! A$>] ]'@ ] j Statistical Data. FAOSTAT. Available at: http://www.fao.org/faostat.  Grapevine fanleaf virus (GFLV) '  &    !  "##  $%          =  >  =     =  = : $ <3   ") 

ANONYMOUS, 2015. Statistical annual report of Iranian multipartite single-stranded negative-sense RNA virus agricultural crops. is the putative agent of fig mosaic disease. Journal of BLODGETT, E. C. and B. GOMEC, 1967. Fig mosaic. Plant General Virology, 90, pp.1281-1288. Disease Reports, 51, pp.893–896. ELBEAINO, T., M. DIGIARO and G. P. MARTELLI, 2009. CAGLAYAN, K., C. U. SERCE, E. BARUTCU, K. KAYA, Complete nucleotide sequence of four RNA segments V. MEDINA, M. GAZEL, S. SOYLU and O. of fig mosaic virus. Archives of virology, 154(11), CALISKAN, 2010. Comparison by Sequence-Based p.1719. and Electron Microscopic Analyses of Fig mosaic virus ELBEAINO, T., M. DIGIARO and G. P. MARTELLI, 2012. Isolates Obtained from Field and Experimentally RNA-5 and -6, two additional negative-sense RNA Inoculated Fig Plants. Plant Disease, 94(12), pp.1448– segments associated with fig mosaic virus. Journal of 1452. Plant Pathology, 94(2), pp. 421–425. CALLAGHAN, B. and R. G., DIETZGEN, 2005. ELBEAINO, T., R. A. KUBAA, M. DIGIARO, A. Nucleocapsid gene variability reveals two subgroups of MINAFRA and G. P. MARTELLI, 2011a. The Lettuce necrotic yellows virus. Archives of Virology, complete nucleotide sequence and genome 150(8), pp. 1661–1667. Available at: https://doi.org/ organization of Fig cryptic virus, a novel bipartite 10.1007/s00705-005-0528-7. dsRNA virus infecting fig, widely distributed in the CLARK, M. F. and A. N. ADAMS, 1977. Characteristics of Mediterranean basin. Virus Genes, 42(3), pp. 415–421. the microplate method of enzyme-linked ELÇI, E., Ç. U. SERÇE and K. ÇA ĞLAYAN, 2013. immunosorbent assay for the detection of plant viruses. Phylogenetic analysis of partial sequences from Fig Journal of general virology, 34(3), pp. 475–483. mosaic virus isolates in Turkey. Phytoparasitica, 41(3), CONDIT, I. J. and W. T. HORNE, 1933. A mosaic of the fig pp. 263–270. in California. Phytopathology, 23(11), pp. 887–896. FLOCK, R. A. and J. M. WALLACE, 1955. Transmission of DANESH-AMUZ, S., RAKHSHANDEHROO, F. and S. fig mosaic by the eriophyid mite Aceria ficus. REZAEE, 2014. Prevalence and genetic diversity of fig Phytopathology , 45(1), pp.52–54. mosaic virus isolates infecting fig tree in Iran. Acta GARCÍA-ARENAL, F., A. FRAILE and J. M. MALPICA, Virologica, 58(3), pp. 245–252. 2001. Variability and genetic structure of plant virus DESBIEZ, C., C. WIPF-SCHEIBEL, F. GRANIER, C. populations. Annual review of phytopathology, 39(1), ROBAGLIA, T. DELAUNAY and H. LECOQ, 1996. pp. 157–186. Biological and molecular variability of zucchini yellow GATTONI, G., A. MINAFRA, M. A. CASTELLANO, A. mosaic virus on the Island of Martinique. Plant disease, DE STRADIS, D. BOSCIA, T. ELBEAINO, M. 80(2), pp. 203–207. DIGIARO and G. P. MARTELLI, 2009. Some ELBEAINO, T., M. DIGIARO, A. DE STRADIS and G. P. properties of Fig latent virus 1, a new member of the MARTELLI, 2007. Identification of a second member family Flexiviridae. Journal of Plant Pathology, pp. of the family Closteroviridae in mosaic-diseased figs. 555–564. Journal of Plant Pathology, pp.119–124. GHORBANI, A., K. IZADPANAH, R. A. AFSHARIFA and ELBEAINO, T., M. DIGIARO and G. P. MARTELLI, F. MEHDINIA, 2016. Phylogenetic study of Fig 2011b. Complete sequence of Fig fleck-associated mosaic virus Lorestan isolate and detection of virus, a novel member of the family Tymoviridae. Closteroviruses associated. In Proceedings of 22nd Virus Research, 161(2), pp. 198–202. Iranian Plant Protection Congress. p. 26. ELBEAINO, T., M. DIGIARO, A. ALABDULLAH, A. DE KARGAR, M. M. ZAKIAGHL, M. MASOUMI, M. STRADIS, A. MINAFRA, N. MIELKE, M. MEHRVAR and K. IZADPANAH, 2016. Analysis of CASTELLANO and G. P. MARTELLI, 2009. A genetic diversity of Grapevine fanleaf virus isolate  *8FG  E) . * "3) . CD ! : B  3 @-A

from Fars and Kohgiluyeh-Boyer Ahmad provinces. ZAMANIZADEH and T. ELBEAINO, 2012. Current Iranian Journal of Plant Pathology, 52(3). status of fig mosaic disease in Iran. Journal of KHOSHKHATTI, N., M. ABADKHAH and D. E. O. Phytopathology, 160(7 ‐8), pp.324–330. KOOLIVAND, 2016. Occurrence of Fig mosaic virus SHAHMIRZAIE, M., F. RAKHSHANDEHROO, H. R. in fig orchards from Tarom region in Zanjan province. ZAMANIZADEH, T. ELBEAINO and G. P. In Proceedings of 22nd Iranian Plant Protection MARTELLI, 2010. First report of Fig mosaic virus Congress. p. 28. from fig trees in Iran. Journal of Plant Pathology, LANEY, A. G., M. HASSAN and I. E. TZANETAKIS, 92(4), pp.S120–S120. 2012. An integrated badnavirus is prevalent in fig SHI, X., A. KOHL, P. LI and R. M. ELLIOTT, 2007. Role of germplasm. Phytopathology, 102(12), pp.1182–1189. the cytoplasmic tail domains of Bunyamwera MIELKE-EHRET, N. and H. P. MÜHLBACH, 2012. orthobunyavirus glycoproteins Gn and Gc in virus Emaravirus: a novel genus of multipartite, negative assembly and morphogenesis. Journal of virology, strand RNA plant viruses. Viruses , 4(9), pp.1515– 81(18), pp.10151–10160. 1536. STOVER, E., M. ARADHYA, L. FERGUSON and C. H. NOLASCO, G. and O. A. DE SEQUEIRA, 1991. Double- CRISOSTO, 2007. The fig: overview of an ancient stranded RNA (dsRNA) associated with fig mosaic fruit. HortScience, 42(5), pp.1083–1087. disease. In Proceedings of the 4th Portuguese-Spanish TENTCHEV, D., E. VERDIN, C. MARCHAL, M. Biochemistry Congress, Lisbon, 1991. JACQUET, J. M. AGUILAR and B. MOURY, 2011. NOROZIAN, E., F. RAKHSHANDEHROO and M. Evolution and structure of Tomato spotted wilt virus SHAMS-BAKHSH, 2014. Presence of fig leaf mottle- populations: evidence of extensive reassortment and associated virus 3 in an Iranian fig Orchard. Journal of insights into emergence processes. Journal of general Plant Pathology, 96(4SUP), pp.4–131. Virology, 92(4), pp.961–973. ÖVERBY, A. K., R. F. PETTERSSON, and E. P. A. NEVE, WALIA, J. J., A. WILLEMSEN, E. ELCI, K. CAGLAYAN, 2007. The glycoprotein cytoplasmic tail of Uukuniemi B. W. FALK and L. RUBIO, 2014. Genetic Variation virus (Bunyaviridae) interacts with ribonucleoproteins and Possible mechanisms driving the evolution of and is critical for genome packaging. Journal of worldwide Fig mosaic virus Isolates. Phytopathology, virology, 81(7), pp.3198–3205. 104(1), pp. 108–114. SCHNEIDER, W. L. and M. J. ROOSSINCK, 2001. Genetic ZARGHANI, S. N., M. SHAMS BAKHSH, N. S. BASHIR, diversity in RNA virus quasispecies is controlled by and T. WETZEL, 2013. Molecular characterization of host-virus interactions. Journal of virology, 75(14), pp. whole genomic RNA2 from Iranian isolates of 6566–6571. Grapevine fanleaf virus. Journal of Phytopathology, SHAHMIRZAIE, M. M., F. RAKHSHANDEHROO, H. R. 161(6), pp.419–425.

'  &    !  "##  $%          =  >  =     =  = : $ <3   ") 

             

%   "#  $   !            

21' % $ (0  ) '-.  / +
,&# '  * + )&' " (  6(7 ( 6(*  23+( $(4 5&'($  - -.*  /0 1(    +,     $"+(  "#$ %&'($ ) ** !  B *  A42 - -.* 624+ &@ =>?   - -.* !<+2    +, ;   - -.* 9: $"+( 8 6( ( 6GF( $H $H "E,F D0 A42 !<+2 $"+( 7C 6( (  6(*  4&@ (C ,G+( : AN? K* 7  M  : J$ K* ) 3 ( Faba bean necrotic yellows virus, FBNYV ) 3U $2 J $4 ; .  2 6((   '$ $ $:' S(>2 $ P QR30 4( $4 Q]R30 ] $:'  !' ' CZ\ CZ[  Y + $ .  2 $4 !X0  ( + W2(0 4( Nanoviridae  *  Nanovirus V, 4( ' $ F_"`( 4a JG 4( $G"+(  ;  '' ! $D ( 6( $ ^(:"+( 4( V?    P  &'2@  6"+D  6"+( 4( $4 ] Q>' h+* (RCA) Y_.2 >' Qe /%'(   f g* ( RCA ) 6da ($ A bc 4( $]] D ]] !' ' ( 6( $ . $ $  DNA-R, DNA-S, DNA-C, 2]+( ] 2]'j !]EdU . $ 4+( 4 JG  @ i $1 4('(  ; 2'j k":2 EdU  Aat II !]<-2 . ]$ m$(]* M ] E*  ] l=*  FBNYV F_"`(  4a JG 4( $G"+(  DNA-U4  DNA-U2 DNA-N, DNA-M, DNA-U1 $ ] ]'(( ] !(] $]4 J o 5'&' GenBank 6j i' $ $2  m$(*  FBNYV '(( !( !+ $ !' n EdU m$(* J o] 5'&' DNA-S, C, U1 EdU (  Q+  (4o* J`$ . $ 6% p 4( FBNYV-[AZ; 13.5]  FBNYV-[AZ; 12] !( ]EdU m$(]* . ]," (]U ] '$ ] !]( + 4( ( II ) W-"<2  $  FBNYV-[AZ;12] 6% p !( $ ! &2 EdU  ' $4 . ," (U (I) W-"<2  $  !"($ J o  < FBNYV-[AZ;13.5] 6% p 4( 5$ !(  '((  !( DNA-R,M,N,U2,U4  6(](  !( M ' SU ! X 2 J+ B"' .   &2 > ' '((  !( M $ 6% p !( $ M = "'j G* ,@. ,@. 2 J 1 ( 6% p .3U  $2 J]]  $4 ;   $:'  $4 : (* 4

Molecular characterization of three Faba bean necrotic yellows virus (FBNYV) isolates, originated from chickpea in Iran

Y. SOKHANSANJ 1, K. BANANEJ 2
, F. RAKHSHANDEHROO 1 and A. AHOONMANESH 3 1-PhD Student & Assistant Professor, Respectively; Department of Plant Pathology, Science and Research Branch, Islamic Azad University, Tehran, Iran; 2- Professor, Department of Plant Virus Research, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran; 3- Professor, Foulad Institute Technology (FIT), Foulad-shahr, Isfahan-Iran

Abstract Yellowing is one of the most prevalent symptoms in chickpea fields, worldwide and Iran. Faba bean necrotic yellows virus (FBNYV, genus Nanovirus , family Nanoviridae ) is associated with the yellowing symptoms in the chickpea fields. During the survey of the Lorestan and Kermanshah provinces in May 2015-2016, chickpea plants showing yellowing symptoms were collected and total DNAs were extracted. The samples were checked for nanovirus infection by PCR, using nanovirus-specific degenerate primers. Total DNA preparations from the nanovirus-positive samples were used for RCA, using φ29 polymerase and restriction endonuclease Aat II digests yielding products of ~1kb corresponding to linearized nanovirus DNA components. FBNYV genomic components were amplified using RCA products and specific primers of eight different U1, M, N, C, S, R, U2, and U4 components. The amplified fragments were purified and sequenced. Nucleotide sequences of the eight different components of three Iranian isolates of FBNYV (Lor-28, Lor-1, and Ker-21) were compared with FBNYV sequences in GenBank. Sequence comparison indicated that Iranian isolates of FBNYV are most similar to Azerbaijan isolates of FBNYV: FBNYV-[AZ; 12], and FBNYV-[AZ; 13.5]. Phylogenetic analyses of nucleotide and deduced amino acid sequences of DNA-S, C, and U1 revealed that Iranian FBNYV isolates clustered with Azerbaijan isolate FBNYV-[AZ;12 ](group II), while DNA-R, DNA-M, DNA-N, DNA-U2, and DNA-U4 clustered with FBNYV-[AZ; 13.5], (group I). Considering the genomic differences between two Azerbaijan isolates, which can be expected among Iranian isolates. These results may provide evidence of the reassortment occurrence among Iranian and Azerbaijan FBNYV isolates. Key words: Chickpea, Faba bean necrotic yellows virus, yellowing

Corresponding author: [email protected] %  "#  $   !           : % 67  &' "


.1993; Makkouk et al ., 1994; Makkouk et al ., 1998a; 1998b; 8 .( Najar et al ., 2000 $ M s*]? M 2 ]]]r * F( P  ]] ,2 4( q  ]] ]]] o1 4( nn Y+ $  M D( 3U $2 J  $4 ;  $(']` 4( Cicer arietinum $:' .  2   ! 6((   '$ A(>] ! ]+ $ Lattakia !]-d,2 $ (V. faba ) 3U 6 > 2 (N]a P ,2 M* Q2 4( q   2 ( Fabaceae ) H- z]a ] 0   ]&@ 4(  ]$ 4 $(E* $ 6 4( V?   Parsa and ) ] ]2 ( ]F$ 8C ]*  ) M s*? 4( +  ]] >%D( ]]_2  ? ]] *( 6$(  ]] t' ]]-  Y ]]   ]]+ ]  (` 624+ !2'2 M ` ;+(  . ( Bagheri, 2008 Katul et al ., 1993; Franz et al. , ) ]] J]]o| 9@(]]2  6( ( &@  (FAOSTAT, 2014) ."2 W2 624+  4&@ $ $ ,* ;  (M  2 _* 9 ?  ,} * .( 1995; 1996  D("]+( ],   ]&@ 4( ]E $]:'  ] D* 6(> 2 t' 4( ( ]M ]M ( wvvv Y]+ $ 2( $($ e1 - Y   +  za . (FAO, 2014) $($ (U 6 Q%,? /-2 $  ' 2  6"<@? ( Babin et al. , 2000 )  '~+( 4( ?( $  D( M  ( ;  ]$ W1(]+ ,l"]+( !] 6(( bc,2 l#( $ $:' J&# (4( (4( Kumari et al. , 2009 ) wvv Y]]]+ $ 6 4( V]]]?  6 J]&# bc],2 M]* Q]2  J]+( Y E2 9  Q# >` 3U]] $]]2 J]] $4 ;]] . ]] A(>]] 6]]%  p 6]+(` ; M>U  a  U 6% p : 4( ,*o0 $ (Nanovirus ) ;']' V,] ]e0( 4( q FBNYV M  ]`  ],o2 ] . >]#2 6"+(  6"+$# 6"+D 62# (($ ] ;']' .  2 (Nanoviridae ) ''  * ]]0(4  ]] Y]]+ $  4]]&@ $]] (4 !]]2'2  (+SSDNA) ( 6( $ V,]] 4(  ] ]]-1 H ]]* /]]'j  ]]  ]]"= w ) ]]"= uvvv ]] $]]:' CZC Z\ (multiple circular ssDNAs ) , ]] 2 ( !EdU ,} _ 6 ] 2 $ ( J]&@  ] 4 yd]+ M  *H] ( Q $ "= uxx  Small ) ] ],}   = ? $ !'( d /(#  !# M]* vvv 6(> ] 2 6 4( !]@ J]+( $] (($  o1  + n n 4( ; ]  M ( /'j . ' 2 , !"< ( isometric virions  ]  ]F !  J&@   M 24 4( M* vvu ) $:'   dU EdU M ( 2 * !@ J+(  W =&*  -1 !EdU J($ ( Q $ F !  J&@   M 24 4( M* nwv ; ]  M ( , s*? 9? . '($ "2''  wv $1 $ .( Anonymous, 2015 ) J+(  ]EdU . J]+( 6]"D($ ] @ wv !  H i* M s*? i  W2 ],,# $].2  ]F( W]2(0 4( ]  ] ; W2  '($ 4 JG vu * xn $1 $ ( 4('( /'j J] $4 ;] . , 2   !  '$ $  o1 J&# ]],,@@ a ! ]] 1' i ]] ]]F( 4]] ']]'(` z]]U i ]] S(>2  (>*<`  P  ; 4( ( FBNYV) 3U $2 ]] *]]2? D(]]* i ]]  (($ ]],,@ ]]@ ! ]] 1' . ,]] ]]2 ] Y+ $   2 - Y    + za $  o1 ]"'( $ M '$ ? Y,5 + i M ,€   2 TATA box ] ]<` )o]+ 3U] $2 J $4 ;  2 ?( ,,@ 4a M s*? .,,@ 2  (N>2 ( M s*? i   '($ ] Y]+ $ ]_2 ]&# $ Yl2 6(,0 ! . $ 2 M 5,+ M s*?  &? M s*?  4+,' F( M s*?  l=*  6(>] 2 ! Y_.2 6(> 2 9 # {0 $3 2 n   w M s*]?  ( !"< Y-"'( M s*?  D+ W= + ,,@ W E* .( Makkouk and Kumari, 2009 ) J]+(  F$ v 4( 9  DNA-C  DNA-S  DNA-R EdU h+* ( ) ** ! ) "@1 ; M* Q2  (FBNYV) 3U] $2 J $4 ;  DNA-U1 ]EdU M ,€ ' 2 6 DNA-M  DNA-N $ ]]:  (' Lens culinaris Medik .) ;]]0 S(>]]2 $ (>*]]<` !"`,]]' $]]= 0 ]] M s*]]? !]]+ DNA-U4  DNA-U2 4( ]] < $ ( Phaseolus vilgaris ) D   (C. arietinum L.) Aronson et al. , 2000; Timchenko ) ],,@ ]2  (N]>2 ( Katul et al ., ) ] ]2 -  Y]    + z a   #&

<>?@ =/ + <  7/ + :; ( :   7  9 $

6"]+D 6"]+$@ ]&'2@ ] 6"]+( $ ;]0  3U  a ! 1' .( et al. , 2000; Katul et al. , 1993; Gronenborn, 2004  ?]_,2 h+*  ":  Y.2}  6GF( >@2 . ] $ ]2 W =&* ( ( SL ) !-1  !U+ "`+ /'j ,,@ @ 4(]'( ] ( !EdU  Nested-PCR A 4( $G"+(  6(= ( AGTATTACC )  ]]  *s@'  D(]]*  (($ "`]]+ M (]] m$( ]* M ] E*  ] l=* DNA-1 !] ƒ 2 4]]] JG n 6]da  ] ($ A !]  ] l=* r ]&,2 !]@ J]+(  JG1 $ $ 6(]=  $(„' 0 .( Mansourpour et al ., 2010 ) $  .( Koonin and Ilyina, 1992 )  2 !%'  D 3U S(>2 $ ( ; M( $ wv Y+ ] !"] h]+* 3U] $]2 J] $4 ; Y-"'( M ] E* ]  $ ' $ &@ 6"+( ,} $ $:'  ;0 ]]? b]]d  ( Aphis cracivora  Acyrthosiphon pisum ) 6&' ; M( ( DNA-S) &? M s*? 4( &: m$(* Franz et al ., 1999; Franz ) ] ]2 ( ] lq*  a ) &`} /]'j 4( 9]: M]( $ ]* W U D=D2 S,* !@ '$($ J $4 ; h+*  $%(  !'&' .( et al ., 1998 $] ] '  &2 FBNYV '((  !( M $ ;  5D]*# $4 W2] ‚oDa  +$+ 1(' $ 3U $2 !]EdU b] -.* M]( /%'( 4( WoU * .( Alavinejad et al ., 2011 ) $]2 J] $4 ; .  2 m3a W q&* $ Y3"`( 3U] !(]]  ( Acc. No. AM493899 ) $:' !( DNA-S  6 l@( !@  2 $.2 ‚"o<' ' > 2 !,2($ (($ 3U $$ ) ]&'2@  ( "]&D( ) 6"+D 4( ( Acc. No. AM493900 ) xv 4( 9 ] ;] M]( . , 2  /5D k ":2  !' Acc. No. ) $]:' !]( DNA-N !EdU  ( ) ** ! () 62( /]5D ] a 6]   4( $.2  < $(E* ,*  /5D !' $$ ) ]&'2@ 3U !(  ( "&D( ) 6"+D 4( ( AM493898  Amaranthus spp.  Stellaria media  Arabidopsis thaliana ) 6j i]' $  m$(]* M E* ( Acc. No. AM493901 ) ( 62( . ,@ 2 $D E oc  5&24 h( $ ( ( Malva spp. .( .( &' &",2  $($ 6(q  B', ) '(  Jo| ] D  5'$]:' ]2( J]+( ; M( F( 6 > 2 3U ]'( ( ! (  /'j !' n EdU D(* b -.* M ( $ ]E oc ]F ! ;0  $:'  o Q&}  D <'( J]] (U  ƒ]o*(  M ] E* 3U] $]2 J]  $4 ; ]  Makkouk et al ., 1992; Katul ) '] 2 $D FBNYV h+*

. . + '$  $ FBNYV   (! +  ('(   (! Y]1 !] * .( et al ., 1993; Franz et al ., 1995; Horn et al ., 1995 6]]% p  ]]&@ 4( 3U]] $]]2 J]] $4 ;]]  A  A(> 6((  V'*  ? *( !+ _2 9@(2  '~+( S(>]2 ]` 4( u x ]0(4 Y+ $ :  #7# $4 ;] 6(]( $ . ( Y ) J+(  m$(* M E* $] 4  $]  /]` $ ' "&D( ) 6"+D 6"+( $ $:' B,]? $ ;]0  $]:' S(>]2 ]` 4( 3U $]2 J]] M ]]+ ]]5,@ ]]<'( ) ]]&'2@  ( $]]  !]]a(4  U] 6% p 6"+$# 6"+D &'2# ) &# 6"+( ]]  ] !]' '  ]]] $4]] ( $]]  /3]+(  ]'@ $(]+ 6"]]+( 4( !]]-d,2 ]] $ 3U]] S(>]]2 4( $(]]E*  ( ]] a  !]' ' v 6"+D ) ( W= ) ]]5D*@   $4   !'&' J+(  A(> ( 62(  &'2# M ( !-d,2 ) &'2# ] ]_:&2 Jo| 4( V?    P  ( !' ' nv &'2@ 4( n Y]]+ $ ;]] M]]( . (Makkouk et al ., 2002) K  ]]*  W]].2 ]]  ]]&2  ]] !']]&' W ]] oU 4( !]]' ' ]]&'2@ M>]]U ]] 6"]]+( $ ;]]0  $]]:' S(>]]2 5]& 24 ! K       P    !' '   P  A 4( $G"]]+( ]] ]] a  U]] 6]]% p 6"]]+$@ /5, * ; <+ !$ u  2$ h ( $   $($ Y-"'( Vafaei et al ., )  A(> Tissue blot immunoassay (TBIA) . .  (5' !c 2   9 24 /%'( ] D $]:' S(>2 4( !' ' v $(E* n Y+ $ . ( 2008 %  "#  $   !           : % 67  &' "


. ]] > ]]  6 ]] 2  !]]- U$ w J]]N 4( V]]?  !]]X( 6"]]+ A !]$ wv ]G,2  2$ $  ^(:"+( $.6(.(   !' ' . . '  (5' $G"+( /5, * ; <+   ] !' ' 4( $G"+(  ( PCR ) 4( ? (  %'4 9,@( B C V,] ]F_"`( 4]a J]G  ] ^(:"+( ( 6( $ ( . ( Y]] ) ]] /]]%'( ( Kumari et al ., 2009 ) ; ']]' ]" D= 2 x/w W2]  ]" D= 2 wx Q%1 $ PCR 9,@( $4 Q]R30 ( C B) $4 Q30 U $:' !0>2 A i ]] H]]2 2 ]] xv MgCl2 ]]" D= 2 i ]] ( 10X ) ]] ( ) 2 $   &2 5D*@  dNTPs 4( /(]@  4( " D= 2 i  H2  2 $ " D= 2 Fig. 1. Noninfected chickpea field (A). Yellowing and dwarfing  Q  >]' 4( " D= 2 i   ; '' F_"`(   4a symptoms in the chickpea fields in Noorabad region, Lorestan province (B and C). Taq DNA polymerase,5u/µl !]@ $ ( 6(  $ " D= 2 w ( ) !]2' . ] '+ Q%1 !  d-*  $ d-2 z 6$>(  $ HI7 #7# $   DNA F"G ] ! ] D(  4]+ !"+( W2  ; '' $   ( PCR ^(:"+( :( PCR )7 (L   J# 1'*   KG / W2] ( !`} v !2'   x °C  2$ $ !- U$  2 ! ^(:"]+( J @ 4( $G"+(  (Total DNA )   W@ ( 6( $ v v ]2 ! uu °C Y_*(  2$ ! '| ux 2 ! x °C  2$ ;]]+( ]] GF-1 Plant DNA Extraction Kit (Vivantis)   ]2$ $ !]`} i ] V~+  ! '| v 2 ! w °C  ! '| : J /%'(  4  ! '4+ J@ W ED("+$ $ ]"=D( ] PCR Y_.2 . $ !- U$ v 2 ! w °C ] $]:'  ] !]' ' ] J 4( / 2  + * $ i ] Jo]<' !] ) ] 2 / *(   1 F$ i  4 Yj 2 J+ $?   !D 6 i  $ P 2 4( 4( $G"+( wv ]]2 !]] J]] | J]]D nv $ ( ]]" D ]] 2 $ /]]= 2  !]X( PL ] 4( " D= 2 wnv  Y-"'( = "+3? !DD !  l=* EdU 4(  ($ V=0   &2  + !- U$ v * K 4], s*? 4( ]" D= 2 wv . $ V=* ! '| v 2 ! 5"]]+$ 4( $G"]]+( ]] PCR 9,]]@( ]]c ( 6(  $ ]]  2 ! ƒ:2  (5' 4( V?  !X( = "+3? !DD ! . . /%'( ( , ) @ ( Y2 UV illuminator ] !]- U$ x 2 ! !F3  !$ x  2$ $ J0+ *w M ] ( $ : ( RCA )% P(Q   A  .%.  N (M  4( Q%1  w   4 .  $ >  6 2 vvv g J0+ j]  "@ 4(] ? DNA 4( $G"+(  .6(.( $ f g* b -.* ; ]]<+ !]]$ x $ !]]- U$ v ]]2 !]]  ƒ]]:2 PB Rolling Circle ) 6]]]da  ]]] ($ A ]]] ]]],"o2 φ29  !]X( b]d2 Y'*( 4( " D= 2 wvv V~+ .  (5' ],,@  ] D* J@ ! F* ;+(   ( Amplification, RCA !] !]' ' 4( " D= 2 xv V=* J ' ,} /%'( 4( E Amersham biosciences TempliphiTM 100 J) ]]]] @ ] !]- U$  ]2 !]  W]-",2 J @ $  ! oE*   6"+ : :  /%'(  4  ! ( Amplification Kit ‚($%2  4 P 2 mN1 4( V?  >  6 2 vvvv g J0+ ]5D( 6(,0 !  ^(:"+( $.6(.( 4( " D= 2 i  ]] 4( ]]" D= 2 xv ]] 6"]]+ V~]]+ . ]] ]]>  6 2]] !] !]  ƒ:2 (Sample buffer) !' ' ]]]]] 4( " D= 2  u V]?  >  6 2 vvvv g J0+  !- U$   (   J< V~ +   (5' ; <+ !$ x  2$ $ !- U$  2 i  ! 6"+ V~+ .  >  6 2 ‚($%2  4 P 2 mN1 4( 4( ]E   (]5' K   !- U$ $ * i  2 ! ƒ:2 !] 6"+ z 4( " D= 2 v  W-",2   = "+3? !DD
 <>?@ =/ + <  7/ + :; ( :   7  9 $

DNA Recovery Kit-Vivantis J ] @ 4( $G"+(  WoU !12 4( (Reaction buffer) ] 4( ]" D= 2 B,? ƒ:2 6 i,` m$(]* M ] E* J]   ]  4+ ˆD`  ^(:"+( Yj 4(  ]]]1 !]]]@ (Enzyme mix) Y]]].2 4( ]]]" D= 2 w/v h]+* ) ], ]@ &@ Macrogen J@ !   *s@' !]12  !]X( $]+ ƒ]:2 !] $ φ29DNAPolymerase . .  Y+( ( /5& ? J@ /]%'( J0]+ n ]2 !] v °C  2$ $  (5'  h< ] ] D(]* M E* EdU J o :  G#4(  R  #$ ƒ:2 DNA Polymerase Q  >' 6$@ YE  a t,2 ! .  4( $G"]+( ] GenBank 6j i]' $ $2   D(* + .  (5' !- U$ v 2 ! x °C  2$ $ !]( 2]' j ]EdU . ] /]%'( nBlast %"< *2  ]]&2 4( V]]? : RCA 9UIIVW II7R#$ SIIT 4( $G"]+( ] 6j i' $  Jo|   !( +  '(( /]%'( 4( 6, c( Y_1  %  4 Yj $ RCA H_.2 mN]]1 4( V]]?   4]]+ k]]$ ClustalW (>]]( /]]' ( +. . Y_.2   ^(]]:]]"+( ( .6(. $ !' ' f g* ]] = "'j]]  J]]`$  D(]]* 6$ 4( ‰]]?   ]] *s@' !]@ ( Fermentas Co., Germany ) Aat II ] Q   '> (RCA) !]]  ( Tamura et al ., 2013 ) Mega6 (>]]( /]]' 4( $G"]]+( ] ]2 ;']' V,] (]  5 i (($ ] xvv  ( Saitou and Nei, 1987 ) neighbor-joining F $2 '4+ J@  W ED("+$ boc  (Grigoras et al ., 2009) !] Banana bunchy top virus ;] . ]$ Q ]+* (=* /]%'( 4( V]? !]F1 ]EdU  !]"  (]U >' Qe   ] (! .  M E* (outgroup)  4( ^` e0 6(,0 .  + 4"=D( M ] ( $   +(, 2    *s@'   !< -2 $ $G"+( $2 9 P!       X 7 (L   J# 1'* .J+(  !R((  Y $ b -.* 4( $G"]+(  : Aat II / S R#$ 7 R#$ ST  (Y Z /'j !' n EdU ! ƒ 2 F_"`( 4a JG J& \W  J G# 9,]@( 624 w( Y ) ( R,S,C,M,N,U1,U2,U4 ) FBNYV 9,]@( 4( ]2 J]+ B  ]"' : I  # #   >' Qe 4( !F1 EdU  ( (PCR) 4( ? ( %'4  ]F_"`( 4a JG 4( $G"+(  PCR 4( ? ( %'4  !12 i  W2 PCR !2' . /%'( Aat II  Q >'    $]D 5']&'  (Kumari et al ., 2009) ; '' V,  4+ J+( J x °C  2$ $ !- U$ x 2 !  (" ( !] ( 6"+D  &'2@ ) ** ! )    P  !' ' u  !] x °C  2$ W2 ( !`} x !2' i  ( 6(  $ ! D( J]G xv $]1 4('(  ( !EdU  $ ; '' V, !] w °C  2$  ! '| v 2 ! xx °C  2$ ! '| v 2 $]D .( w W= )  $  &2 4"=D( Yj ($ bp ) 4 x ]2 !] w °C  2$ $ !`} i  V~+  !- U$ w 2 ( ]&'2@ ) '@ !-d,2 ,l"+( !  ($ !' ' bc,2 / * $ .$ !- U$ . . $  / ]  *(  ]1 ]F$ i  4 Yj $ PCR Y_.2 M]( $ : ( RCA )% P(Q  A   .%.  N(M J]D nv $ ( ]" D ] 2 $ /]= 2 i  Jo<' ! )  2 ( ( RCA ) 6da ($ A 4( $G"+(  ( 6( $ f g* b -.*   ]&2 . ] 4]"=D( !]- U$ v ]* wv 2 ! J | 4]"=D( Yj  ] d`   ?  &2   / %'( 9,]@( ]c !]"  ] l=* ( 6(  $ ]EdU 4(  ($ V=0  ] ;'' ! $D  !' ' $ ( 6( $ f g* 5'&' ( ], ) @ ( Y2 UV illuminator 5"+$ 4( $G"+(  PCR $] Grigoras et al . (2009) h]+* 2 J+ B"'  b d2 .  /%'( (. W= ) 2 J+ PCR Y_.2 :        [ . %  "#  $   !           : % 67  &' " 

I/ S RI#$ I I/ N  I(M  %  7 R#$ ST  F_"`( 5 i (($ Aat II  Q>' : Aat II -Lorestan-1 -Kermanshah-21 -Lorestan- 28

RCA Y]_.2 ] >' Q]e   ] ]2  ;'' $ -infected chickpea Non Marker Chickpea ] 4(]'( Q 4 JG  @ i 4('(  *EdU A {0 Chickpea Chickpea

Grigoras ) $]] ]]2 ]] ;']]' $ 2]]'j ]]EdU

et al ., 2009 Y]_.2 ] >' Q]e 4( ]2 J]+ B"' .( 1000 750 750BP RCA h]+* ]2 J]+ B]"' ] ! &2 > ' b -.* M( $ 500

250 Grigoras et al . (2009) i] $]1 ( 4(]'(  *EdU  $ Q]   &2 F$ i 4  Yj $ (1kb) 4 JG  @ $]D $:'   !' ' PCR Y_.2  4"=D( A-' ,C B/ $]D )] ** M  ( u W= )   R* PCR B"' M ,} V,] ]F_"`( 4]a J]G 4( $G"]+(    l=* ; '' ! 7 J]+( ] $($ 6&' i (   H $ ! (  6 > 2 /' . ; '' !] 5D*@  $4  !'&'    P   !' ' DNA ladder mix : 5']&' 7 ( ; ]  4(  ]0 ) QD]+ $]:' !]' ' : N

.  R*  ;'' .(SMOBio, 1 Kb) Fig. 2. Electrophoresis pattern of PCR product from Nanovirus- infected chickpea samples using Nanovirus specific primers. Name of the host and province and non-infected chickpea were typed at the top of each lane, Marker: DNA ladder mix (SMOBio, 1 Kb).

-Lorestan-1 -Kermanshah-21 -Lorestan- 28

Marker Chickpea Chickpea Chickpea

-Lorestan-1 -Lorestan- 28

kpea-Kermanshah-21

-infected chickpea

Marker Kit Kit Positive Control Chic Chickpea Chickpea

Non 1000 1000bp 750 ~

500

250

!]+ RCA Y]_.2 ] >' Q]e 4]"=D( A-' ]C B/ ] $ 1kb 4(]'( ! *EdU . Aat II  Q>'  FBNYV ( !'( (  !"' i (  H $ !(  6 > 2 /' . $ 2  &2 i ( .DNA ladder mix (SMOBio, 1 Kb) : 5'&' 7J+( Fig. 4. Electrophoresis pattern of RCA products digestion using 4( $G"]+( ] ] f ]g* 6(( $  4]"=D( A-' >C B/ Aat II restriction enzyme of 3 Iranian FBNYV isolates. Name of the  6] > 2 /]' . FBNYV ('( (!  ! ƒ 2 RCA 6da  ($ A host and isolate typed at the top of the each lane, Marker: DNA QD]+ $]:' !]' ' : N 7 J]+( ] $($ 6]&' i (   H $ ! ( ladder mix (SMOBio, 1 Kb). DNA Kit positive control : 5']&' 7 : J]ol2  ] 7 ( ; ]  4(  0 )

.ladder mix (SMOBio, 1 Kb)  Q$ K :   KG 7 (L   J# 1'* Fig. 3. Electrophoresis pattern of RCA product of 3 Iranian FBNYV isolates. Name of the host and isolate. None-infected I#   I  _I#4 I#  : 9 P!  ^  Y VG. chickpea typed at the top of each lane, Marker: DNA ladder mix JG J& 4( $G"+(  PCR 4( 2 J+ B "' : FBNYV (SMOBio, 1 Kb).  <>?@ =/ + <  7/ + :; ( :   7  9 $

! * 6( ( $ FBNYV .(  Y ) J+(  A(>  D(* ( R,S,C,M,N,U1,U2,U4 ) !' n  ]EdU F_"`(  ]] 4a l=* 5'&'  (Grigoras et al ., 2104 ) FBNYV /'j D 4( Y1 ]EdU  ]   !%'  $:' ،;0 J]+( ] A(> 3U Vafaei et al ., 2008; Mansourpour et al ., 2010; Alavinejad ) 3U] $2 J  $4 ;  ('(   (! /'j !' n M ] E* 4] J]G n 4(]'(  DNA-R !EdU .( et al ., 2011 ]] ]]   P]]   ]] !]]' ' $]]D  $]] FBNYV ] ( Mansourpour et al ., 2010 ) J]+( ] A(>]  D(* W= ) + o|( ! FBNYV ! 5D*@   $4   !'&' bn bn ] -.* M ( $ 2 J+ B "'  Š 03c( ! !* ]&'2@ ) $:' ! ( !+  $ 2'j !' n EdU .( x $ ] M ]D(  (] FBNYV ;  ( !'( ( /'j !EdU ( wn 6"]+D ) $]:' ! (  (  6"+D ) $:' ! (  w( $ $2 03c( ! !*  .  D(* M E*   l=* 6( ( !]] (]]  /'j !' n EdU m$(]]* M .E*  $  l=* 4( FBNYV /]]'j !]]EdU n D(]]* M ]] E*   ]] l=* GenBank ]* n M ] ]EdU Y]c !]@ $($ 6]&' FBNYV '(]]] ( M ] ( $  ] '$ $ ] M ]D(  (] (C. arietinum ) $:' 6 > 2 u.( Y )  2  *]s@' vvx .( .( Y ) J /%'( b -.*  I  I#  I I   #Ia*   !  ]+( ], 2   ]  *s@' m$(]* : ! I   

$ ] J]o|   m$(*  ( !'( ( /'j !' n EdU -R Chickpea-Ker-21 Chickpea-Ker-21-S -U1 Chickpea-Ker-21 -U2 Chickpea-Ker-21 -U4 -U4 Chickpea-Ker-21 -C Chickpea-Ker-21 -M Chickpea-Ker-21 -N Chickpea-Ker-21 DNA DNA DNA DNA Marker DNA ]]2 J]]+ B ]]"' . ]] $ !]]< -2 (  Y]] ) GenBank DNA DNA DNA

DNA-R '(]] (   (!  !EdU ! &* 6(> 2 M "& 5'&'

Ker-21 Lor-1 Lor-28 %  / %  / % )/ ** ! ) (   )

m$(]]* $ % n / % n  / n%   ]]  *s@' m$(]]* $

(Acc. No. HE663168) 1000 ~1000bp ( ! ( w *( ! ? (  (   +(, 2 750

500 6(> ]] 2 !]] ( Acc. No.KC979000  KC979009 ) 6]]%  p

250 $  % u/ ]* % x   ]  *s@' m$(]* $ %  */ % n u/ PCR $]:'  ] ]! ( DNA-S !]EdU . $] (   ]+(, 2 m$(* /]'j !]' n ]EdU Y]_.2  4"=D( A-' `C B/ Grigoras ) F_"`( 4a JG n 4( $G"+(  FBNYV ( !'( ( %  )/  ]  *s@' ! &* M "& ( Lor-28  Lor-1) 6"+D ]  H $ ! (  6 > 2 !' n EdU 4( /(@  /' .( et al. , 2104 ]] ! ]] ( ]] ( (% n )/   ]]+( ]], 2  ( )]] ** !] %  w/ .DNA ladder mix (SMOBio, 1 Kb) : 5'&' 7 J+(  $($ 6&' i ( ! ]] ( . ,"]]($ ( Acc. No. AM493899 ) ( 6"]]+D ) ]]'( ( Fig. 5. Electrophoresis pattern of PCR products of 8 components of Iranian FBNYV isolate (ker-21) using specific Ker-21    ]] *s@' ! ]]&* 6(> ]] 2 M "]]& ( ) ]]&'2@ primers (Grigoras et al ., 2014), name of the amplified fragments, ]'( ( ! ] ( ] ( (%  %/  )/ ] ** ! )   +(, 2 host, and isolate typed at the top of the each lane.. Marker: DNA ladder mix (SMOBio, 1 Kb). !]+ M ] ( M ],€ J]($ ( Acc. No. AM493900 ) ]&'2@

]]* x x/ 6(> ]] 2 !]] ( Ker-21  Lor-1Lor-28 ) ]]'( ( ! ]] ( !]' n ]EdU GenBank $ $2 03c( ;+(  D(]]* $ % v w/ ]]* n /  ]] *s@' D(]]* $ % x / 9@(]2  '~]+( 6]%  p   &@ 4( ,* FBNYV /'j (Acc. No. KC979001) 6]]%  p ! ]] ( ]]   ]]+(, 2 >] ! ) (Vicia Faba ) 3U 6 > 2 4(  V'*  ! + _2 ]]+ $]]2 ! ]] (  $ DNA-N !]]EdU . ,"]]($ J o]] M ] (E* (Acc. No. GQ351600) 6%  p 4( ;0 ! ( i  %  "#  $   !           : % 67  &' " 

]] ( (% x )/   ]]+(, 2  ( )]] ** !]] % n w/ % n w/  % )x/  ]]  *s@' ! ]]&*  (($ ( Ker-21  Lor-28  Lor-1) M "]]& . ,"]]($ (Acc. No. KC979005) 6]]%  p ! ]] ( !] % u  % n ) /   ]+(, 2  ( ) ** ! %  / %  u/   Lor-1) 6"]+D  ] ]! ( $ DNA-U2 !EdU ! &* 6(> 2 ( Acc. No. AM493898 ) ( 6"]+D ) ]'( ( ! ] ( ] ( ) ] ** %  *w/ % x / 6(> 2 ! (Ker-21) &'2@ ! (  ( Lor-28  ]  *s@' m$(]* ‹].D 4( ! ( !+ M ( M ,} Q 7'$   +(  2 , D(* $ %  */ % nn /   *s@' D(* $   )/   ]]+(, 2  ( )]] ** !]] %   %  / % )n/ 6]%   p ]&@ 4( 3U $2 J  $4 ;  ! (  Acc. No. ) ]]&'2@ ]]'( ( ! ]] ( ]] ( )]] ** !]] %  / Acc.No. ) ? ]] *( ]]&@ ! ]] (  ( Acc. No. KC979006 ) 6"+D   ! ( $ DNA-C !EdU . '$ ! &2 ( AM493901 !]]EdU ! ]]&* 6(> ]] 2 M "]]& .(  Y]] ) $]] ( HE663171 4( ! ]&* 6(> ] 2 M "& ( Ker-21  Lor-28 Lor-1) &'2@  (Ker-21  Lor-28  Lor-1) + $2 ! (  $ DNA-U4 ( ) ** ! %  / % x  / x% )n/   *s@' m$(* ‹.D ‹]].D 4(  (%  w/ ]]* %  )/ ]]  *s@' m$(]]* ‹]].D 4( % v w/ % nn x/ nn% )/   ]]]+(, 2 m$(]]]* ‹]]].D 4(  ]&@ 4( ! ] ( w ] (% n *u/ % w )x/   +(, 2 m$(* 6]]%  p ]]&@ 4( FBNYV ! ]] ( ]] ( ( )]] ** !]] .( .( Y ) $ (Acc. No. KC979007, KC979017) 6%  p  ] ]! (  $ DNA-M !EdU . ,"($ ( Acc. No. KC979002 ) !@ $($ 6&' (4o* EDd2 4( WF1 (4o* J`$ ‹]].D 4( ( ! ]]&* 6(> ]] 2 M  "]& ( Lor-28  Lor-1Ker-21 ) ( ! b -.* M( $ + $2 '((  !( R !EdU ]* nv )u/   ]+(, 2  (%  ]* v )n/  ]  *s@' m$(*  I ] $  '~]+(  V']*  ?] *( 6]% p  !( Acc. No. KC979018, ) 6%  p&@ 4( ! (   (% n / $ ]_2  !]+  ( !]( i] ) V'* 9@(2  !( (!  $ DNA-U1 !EdU . ,"($ ( KC 979003, KC 979012 .( .( W= ) ," (U II  (Ker-21  Lor-28  Lor-1 b) ]] -.* M ]] ( $ ]]+ $]]2 n%  n% )/  ]  *s@' m$(]* ‹].D 4( ! &* 6(> 2 M "&

  ;'' $ ( b -.* M( $  $G"+(  4a

3U $2 J $4 ; 2'j EdU  l=* ( b -.* M( $  $G"+(  4a ,C b Table 2. List of primer used in this study for detection of FBNYV Primer Sequence Size(bp) Refrence R-F 5’-CGAAGCTTCGAGGAGTATGTTAATTACGG-3’ ~1000 Grigoras et al ., 2014 R-R 5’- TCGAAGCTTCGTGGAAAGTCGAAGAGCACT-3’ S-F 5’- CTGTTCTAGAACACAGAGTTTATGT -3’ ~1000 Grigoras et al ., 2014 S-R 5’-GTGTTCTAGAACAGCTTTAAGAGCA-3’ C-F 5’- ATTGTCAACTGCAGTGAATTGGATAAATTA-3’ ~1000 Grigoras et al ., 2014 C-R 5’- GCAGTTGACAATCATACCGTCTTCGTATGT-3’ M-F 5’-TTGCGTCAACACTGACCAGAACTCC-3’ ~1000 Grigoras et al ., 2014 M-R 5’-CAGTGTTGACGCAACTCTTCTCTTC-3’ N-F 5’-TGGATCTCGAGTCTCAGTACTTGAAGAAGG-3’ ~1000 Grigoras et al ., 2014 N-R 5’-TGAGACTCGAGATCCAGGTTGAATGTCCTT-3’ U1-F 5’-GTCTGAATTCGTTGAAGAGTCTTCTCC-3’ ~1000 Grigoras et al ., 2014 U1-R 5’- TCAACGAATTCAGACTTGTGTTCTTCA-3’ U2-F 5’- TATGAAGCTTTCGATGAGAGAATTG-3’ ~1000 Grigoras et al ., 2014 U2-R 5’- TCGAAAGCTTCATACGCCTAATCGA-3’ U4-F 5’- GACTTGATTCAAAGGTCGATGAAG-3’ ~1000 Grigoras et al ., 2014 U4-R 5’- CAAGCGTCTTYAAATGCTGCATAAC-3’  <>?@ =/ + <  7/ + :; ( :   7  9 $

GenBank $  Jo|   (! +  3U $2 J $4 ;  ('(   (! !' J& EdU   +(, 2    *s@' J o F$ >C b ( ( &'2@ w $:'  6"+D wn $:' 6"+D  $:' ) ** ! C-Ker-21  C-Lor-28  C-Lor-1   !' ' ) Table 3. Percentage of amino acid and nucleotide sequence identity of 8 genomic DNA of Iranian FBNYV isolates in compare of other FBNYV isolates available in GenBank (C-Lor-1: Chickpea of Lorestan No.1, C-Lor-28: Chickpea of Lorestan No.28, C-Ker-21: Chickpea of Kermanshah No.21) FBNYV Isolates Iranian FBNYV Isolates C-Lor-1 C-Lor-28 C-Ker-21

Genome component Acc. Host Country Nt aa nt aa nt aa number (%) (%) (%) (%) (%) (%)

V. faba Azerbaijan KC979011 94.3 85.6 94.4 85.9 94.7 87.0 V. faba Azerbaijan KC979002 95.8 88.9 95.7 88.5 96.1 90.2 V. faba Spain KC979021 93.5 84.6 93.4 84.3 93.2 83.4 V. faba Spain KC979029 93.3 84.3 93.2 84.0 93.0 83.1 V. faba Spain KC979037 93.6 85.0 93.5 84.6 93.0 82.4 V. faba Morocco GQ274023 92.6 82.4 92.5 82.0 92.4 82.1 V. faba Egypt NC003559 89.9 79.4 89.8 79.1 89.7 78.5 DNA-C V. faba Egypt AJ132179 89.8 79.4 89.7 79.1 89.5 77.9 V. faba Tunisia KX431393 92.5 82.0 92.4 81.7 92.4 81.4 V. faba Tunisia KX431392 92.6 82.0 92.5 81.7 92.7 82.1 V. faba Tunisia KX431391 92.5 82.0 92.4 81.7 92.6 82.1 V. faba Tunisia KX431390 92.5 82.0 92.4 81.7 92.4 81.4 V. faba Tunisia KX431389 93.1 83.3 93.0 83.0 92.6 81.4 V. faba Syria KX431388 91.6 78.4 91.5 78.1 91.4 77.9 V. faba Syria KX431387 91.6 78.4 91.5 78.1 91.2 76.5 V. faba Spain KC979022 89.4 74.4 89.2 74.4 90.4 78.8 V. faba Spain KC979038 89.2 76.0 89.2 76.0 90.6 77.2 V. faba Spain KC979030 89.5 75.4 89.5 75.4 90.9 78.8 V. faba Azerbaijan KC979003 91.0 80.8 91.2 80.8 90.8 80.4 V. faba Azerbaijan KC979018 93.5 86.9 93.8 86.9 93.0 85.2 V. faba Azerbaijan KC979012 90.9 80.5 91.1 80.5 91.0 80.4 V. faba Morocco GQ274027 89.4 73.4 89.6 73.4 91.0 76.8 V. faba Ethiopia AF159705 81.0 69.9 81.2 73.4 80.8 72.3 V. faba Egypt NC_003562 80.4 62.3 80.6 62.3 82.4 65.9 DNA-M V.faba Egypt AJ132182 80.2 60.1 80.4 60.1 82.2 63.0 V. faba Syria Y11407 83.2 65.5 83.4 65.5 84.9 69.5 V. faba Syria KX431394 82.1 58.1 82.3 58.1 83.2 61.1 V. faba Syria KX431395 82.2 58.8 82.4 58.8 83.3 61.7 V. faba Tunisia KX431400 89.0 76.4 89.0 76.4 90.3 77.2 V.faba Tunisia KX431399 89.1 74.8 88.9 74.8 89.8 75.6 V. faba Tunisia KX431398 89.1 77.3 89.1 77.3 90.5 78.5 V. faba Tunisia KX431397 88.9 75.7 88.9 75.7 90.3 76.8 V. faba Tunisia KX431396 88.4 75.6 88.4 75.6 89.4 75.9 Cicer arientinum Iran AM493898 99.5 98.7 99.4 98.7 97.9 94.0 V. faba Iran AM493901 96.8 91.3 96.9 91.3 99.0 97.3 V. faba Azerbaijan KC979004 92.2 81.5 92.3 81.5 93.3 87.5 V. faba Azerbaijan KC979013 91.4 84.9 91.5 84.9 92.9 86.0 V. faba Spain KC979023 91.8 82.9 91.9 82.9 92.9 85.2 V. faba Spain KC979031 91.8 82.6 91.9 82.6 92.9 84.9 V. faba Spain KC979039 91.8 82.2 91.9 82.2 93.0 85.2 DNA-N V. faba Morocco GQ274030 92.4 84.0 92.5 84.0 93.4 86.3 V. faba Egypt NC_003566 92.2 79.8 92.3 79.8 93.5 82.5 V. faba Tunisia KX431403 92.2 83.9 92.3 83.9 93.3 86.2 V. faba Tunisia KX431404 92.2 84.3 92.3 84.3 92.9 85.0 V.faba Tunisia KX431405 92.2 83.9 92.3 83.9 93.3 86.2 V. faba Tunisia KX431406 92.3 83.9 92.4 83.9 93.4 86.2 V. faba Tunisia KX431407 92.2 83.6 92.3 83.6 93.3 85.9 %  "#  $   !           : % 67  &' " 

V. faba Syria KX431402 90.9 78.3 91.0 78.3 93.2 82.3 V. faba Syria KX431401 90.9 78.0 91.0 78.0 93.2 82.0 V. faba Azerbaijan KC979000 98.8 96.7 99.0 97.4 98.4 95.0 V. faba Azerbaijan KC979009 98.9 96.7 99.1 97.4 98.5 95.0 V. faba Spain KC979019 97.5 92.4 97.3 91.7 97.1 90.7 V. faba Spain KC979027 97.7 93.0 97.5 92.4 97.3 91.4 V. faba Spain KC979035 97.7 93.0 97.5 92.4 97.3 91.4 V. faba Ethiopia HE663168 99.3 98.7 99.1 98.0 99.3 98.3 V. faba Morocco GQ274025 97.5 93.7 97.5 93.7 97.4 92.0 V. faba Egypt NC_003560 96.0 89.4 96.0 89.4 96.2 89.4 DNA-R V. faba Egypt AJ132180 95.9 88.1 95.9 88.1 96.1 88.4 V. faba Syria Y11407 96.2 90.1 96.2 90.1 96.4 90.1 V. faba Syria KX431380 96.2 90.6 96.2 90.6 96.5 90.3 V. faba Syria KX431381 96.1 90.3 96.1 90.3 96.4 89.9 V. faba Tunisia KX431382 97.4 92.4 97.2 91.7 97.0 90.7 V. faba Tunisia KX431383 97.2 90.7 97.0 90.1 96.6 89.1 V. faba Tunisia KX431384 95.8 87.7 95.8 87.7 95.9 86.8 V. faba Tunisia KX431385 97.3 91.7 97.1 91.0 96.7 90.0 V. faba Tunisia KX431386 97.2 91.4 97.0 90.7 96.8 89.7 Cicer arietinum Iran AM493899 99.1 98.1 99.2 98.1 96.6 92.7 V. faba Iran AM493900 94.7 87.3 94.8 87.3 97.6 93.9 V. faba Azerbaijan KC979001 95.5 89.9 95.6 89.9 95.6 90.2 V. faba Azerbaijan KC979010 87.9 72.8 87.8 72.8 90.3 77.0 V. faba Azerbaijan GQ371215 89.3 81.0 89.1 81.5 92.2 88.3 Lens culinaris Azerbaijan GQ351600 89.0 81.3 88.9 81.2 92.3 88.5 V. faba Spain KC979020 87.8 72.5 87.9 72.5 90.4 77.3 V. faba Spain KC979028 87.8 72.5 87.9 72.5 90.4 77.3 V. faba Spain KC979036 87.4 72.1 87.5 72.1 89.9 76.9 V. faba Spain DQ830990 91.6 85.4 91.7 85.6 93.2 87.0 V. faba Ethiopia HE663169 87.2 70.4 87.3 70.4 89.7 75.5 DNA-S V. faba Morocco GQ274028 87.7 71.9 87.6 71.9 90.2 76.7 V. faba Egypt NC_003563 88.2 73.9 88.3 73.9 90.4 78.0 V. faba Egypt AJ132183 88.3 73.9 88.4 73.9 90.5 77.7 V. faba Syria Y11408 88.0 74.0 88.1 74.0 90.3 78.8 V. faba Syria KX431408 85.5 70.4 85.6 70.4 87.4 73,9 V. faba Syria KX431409 86.2 72.0 86.3 72.0 88.1 75.5 V. faba Tunisia KX431410 87.9 72.8 88.0 72.8 90.5 77.9 V. faba Tunisia KX431411 87.6 71.8 87.7 71.8 90.2 76.9 V. faba Tunisia KX431412 87.7 72.8 87.8 72.8 90.3 77.9 V. faba Tunisia KX431413 87.5 71.8 87.5 71.8 90.0 76.9 V. faba Tunisia KX431414 87.8 73.1 87.9 73.1 90.4 78.2 V. faba Azerbaijan KC979005 98.3 95.1 98.2 95.1 98.2 95.1 V. faba Azerbaijan KC979014 89.8 76.8 89.9 76.5 89.8 75.8 V. faba Spain KC979024 89.2 75.5 89.1 76.1 89.6 76.8 V. faba Spain KC979032 89.1 75.2 89.0 75.8 89.5 76.5 V. faba Spain KC979040 89.4 74.8 89.3 75.5 89.8 76.1 V. faba Ethiopia HE663170 88.8 72.9 88.9 72.5 88.8 72.5 V. faba Morocco GQ274026 87.9 69.6 87.8 70.3 88.1 70.3 V. faba Egypt NC_003561 87.1 69.3 87.4 68.6 87.1 68.3 DNA-U1 V. faba Egypt AJ132181 87.1 69.3 87.4 68.6 87.1 68.3 V. faba Syria Y11406 87.8 73.9 87.9 73.9 87.8 73.2 V. faba Syria KX431415 87.4 73.9 87.5 73.9 87.2 72.5 V. faba Syria KX431416 87.2 72.5 87.3 72.5 87.0 71.6 V. faba Tunisia KX431417 89.4 75.2 89.3 75.8 89.8 76.8 V. faba Tunisia KX431418 88.9 73.2 88.8 73.9 89.3 74.5 V. faba Tunisia KX431419 88.8 73.5 89.1 72.9 88.8 72.5 V. faba Tunisia KX431420 89.0 73.9 88.9 74.5 89.4 75.2 V. faba Tunisia KX431421 89.0 73.5 88.9 74.2 89.4 74.8 DNA-U2 V. faba Azerbaijan KC979006 97.1 91.6 97.1 91.6 97.2 91.9  <>?@ =/ + <  7/ + :; ( :   7  9 $

V. faba Azerbaijan KC979015 92.3 80.6 92.3 80.6 92.6 81.9 V. faba Spain KC979025 91.4 77.9 91.4 78.3 91.7 78.9 V. faba Spain KC979033 91.3 77.5 91.3 77.9 91.5 78.2 V. faba Spain KC979041 91.7 79.2 91.7 79.5 92.0 79.9 V. faba Ethiopia HE663171 96.1 89.0 95.9 88.3 96.4 89.6 V. faba Morocco GQ274029 90.6 77.6 90.4 77.3 90.6 77.5 V. faba Egypt NC_003564 79.0 59.2 79.0 58.9 79.3 59.7 V. faba Egypt AJ132184 79.1 59.2 79.1 58.9 79.4 60.1 V. faba Syria Y11409 85.4 69.1 85.6 69.5 85.7 69.1 V. faba Syria KX431422 87.5 73.2 87.6 73.2 87.8 73.2 V. faba Syria KX431423 90.4 77.5 90.6 78.5 90.9 78.9 V. faba Tunisia KX431424 90.9 77.2 91.1 77.9 91.4 78.5 V. faba Tunisia KX431425 90.7 78.5 90.9 79.5 91.2 79.8 V. faba Tunisia KX431426 87.6 73.2 87.7 73.2 87.9 73.2 V. faba Tunisia KX431427 90.1 76.1 90.3 76.8 90.6 78.1 V. faba Tunisia KX431428 90.9 79.2 91.1 80.2 91.4 80.5 V. faba Azerbaijan KC979007 99.1 98.4 99.2 98.4 98.4 96.1 V. faba Azerbaijan KC979016 93.4 88.4 93.5 88.4 93.7 87.5 V. faba Azerbaijan KC979017 96.6 93.5 96.5 93.5 96.3 92.5 V. faba Spain KC979034 89.4 78.2 89.3 78.2 89.4 79.4 V. faba Spain KC979042 89.3 78.2 89.2 78.2 89.3 79.4 V. faba Spain KC979026 89.3 78.2 89.2 78.2 89.3 79.4 V. faba Morocco GQ274024 88.0 78.2 87.9 78.2 88.3 77.8 V. faba Egypt NC_024457 83.2 67.8 83.1 67.8 83.3 68.6 DNA-U4 V. faba Egypt AJ749902 83.2 67.8 83.1 67.8 83.3 69.0 V. faba Syria AJ749903 84.2 70.7 84.1 70.7 84.3 72.5 V. faba Syria KX431429 86.0 71.3 85.9 71.3 86.1 72.9 V. faba Syria KX431430 86.2 72.6 86.1 72.6 86.3 74.2 V. faba Tunisia KX431431 89.0 77.9 89.1 77.9 89.3 79.4 V. faba Tunisia KX431432 88.9 77.9 89.0 77.9 89.2 79.4 V. faba Tunisia KX431433 88.9 77.9 89.0 77.9 89.2 79.4 V. faba Tunisia KX431434 88.6 77.9 88.7 77.9 88.9 79.4 V. faba Tunisia KX431435 89.1 77.9 89.2 77.9 89.4 79.4

Acc.  Acc. No.KC979003 Acc. No.KC979018 ) 6]% p ]'(( !](  !]@ $($ 6]&' S !]EdU (4o* J`$ (]U I ] 4( ] ]4 i] $ Q] ] ( No. KC979012 6(]]( !]]( $ ]] b]] -.* M]]( $ ]]+ $]]2 FBNYV .( .( W= ) ," Acc. No. ) ]]&'2@  (Acc. No. AM493899) 6"]]+D ) $]2 ]'(( ] !]( U1 !]EdU (4o* J`$ $ $ (Acc. No. KC979001) 6]]% p !]](  ( AM493900 6% p &@ 4( !( i ( ! b -.* M( $ + .( W= ) ," (U ( II  )  i (]U II  4(  4 i $ Q  (Acc. No.KC979005) $]2 ]'(( ] !]( N !]EdU (4]o* J`$ $   !]@ $($ 6]&' U2 !]EdU (4o* J`$ .(  W= ) ," ]]'(( ]] !]]( (]] !]] b]] -.* M]]( $ ]]+ 6% p &@ !(  + $2 FBNYV '(( !( i $ Q  ( Acc. No. AM493901  Acc. No. AM493898 ) ( Acc.No. HE663171 ) ?] *( !(  (Acc. No. KC979006) .( W= ) ," (U I  4(  4 J]`$ .(  W=] ) ]," (U I  $  4 i $ ]'(( !](  !]@ $($ 6]&' C !EdU (4o* J`$ $]2 FBNYV '(( !(  !@ $($ 6&' U4 !EdU (4 o* ]]&@ !]]( ]] b]] -.* M]]( $ ]]+ $]]2 FBNYV Acc. No. KC979007, ) 6% p &@ 4( !( w  + (U ( II  )  i $ (Acc. No. KC979002) 6% p ," (U I  $  4 i $ ( Acc.No. KC979017 ] !]( M !]EdU (4]o* J`$ $ .(  W= ) ," .( W= ) ]&@ 4( !(  ( ! b -.* M( $ + $2 '(( %  "#  $   !           : % 67  &' " 

DNA_R DNA_S

I I

II II

DNA_N DNA_C

I I

II

II

DNA_M DNA_U1

I I

II II

DNA_U4 DNA_U2 I I

II II

] m$(]* ]+ ] ( FBNYV ) 3U] $]2 J $4 ;  !( /'j EdU  *s@' m$(* b d* 4( WF1  (4o* J`$ ;C B/ 4( . ], $ ]2 6]&' ( (]=* vv 6] 2 $ Bootstrap A4( ]F$ ] !` ,@ $(0( . MEGA6 (>( /' 4( $G"+(  ; M( 4(  Jo|  *s@' . $G"+( ( outgroup )  4( ^` ; 6(,0 ! Banana bunchy top virus ; Fig. 6. Phylogenetic tree obtained from the alignment of nucleotide sequences of Faba bean necrotic yellow virus (FBNYV) isolates compare with other isolate of this virus using MEGA6 program .Numbers on the branches indicate bootstrap percentage. In Phylogenetic analysis Banana bunchy top virus (BBTV) were used as outgroup. 
<>?@ =/ + <  7/ + :; ( :   7  9 $

!]( !]+ $ (DNA-N) !]EdU ]2( ]'( !" (U ( II  ) ;] ]'(( ] !]( /'j k":2 EdU 4('( ]C b FBNYV-[IR;1] ]' ( !( (  $  ( J o M"& '(( 3U $2 J $4 Table 4- Genomic Fragments size of Iranian isolates of Faba !"($ ( &' &",2  $($ 6(q  B', ) FBNYV-[IR;2]  bean necrotic yellows virus Isolate Component Size of DNA (nts) .( .( W= ) '( $($ ( I  $ W-"<2 4 i W =&*  R 1003 S 1005 C 993 $ ] ] ]'(( !(  $ ( U4  U2  M  R) EdU Chickpea-Lor-1, M 992 Chickpea-Lor-28, N 987 FBNYV-[AZ;13.5] FBNYV-[AZ;12] Chickpea-Ker-21  6]]]% p !]]]( U1 987 I U2 987 ]'( !]" (]U ] $ 4 i $  !"($ J &2 U4 989

!]]@ ]]' ($]]@ A(>]] 6(]]=  V(]]5 .(  W=]] ) 9@(]2 4( !( i   '~+( 4( !(  m$(* !<-2 D]]] E2 Œ ]]] * FBNYV-[AZ:13.5] !]]]]] (]] ‚H]]] "1( 4( 6 Y]-"'( Y] "1(  5]= ] ]' $4 J o 5'&' 6(] ]] (  >]]` ]]] $ !]]-d,2 $ FBNYV (type common) ] !]( M]( M(  30 .  2 ?( z, ! 9@(2 J]]`$ !]]@ D]]1$ (Grigoras et al ., 2014 ) ]] ]]2 FBNYV (type common) D] E2 Œ] * 5' ' J+( M= 2 ]] ]]2 Š]] )]]d2 m3]]` ]] Q ]]+*  ]] (4]]o* . (Grigoras et al ., 2014 ) ] ?( a z,  9@(2 $ ] ! ] ( ] ( J o M "& ( U1  C  S) EdU != c ! ]]&@ 4( FBNYV !]]( $ /]]'j !]]' n ]]EdU 6,@]]* ! ]] (  $ (U4  U2  M  R) ]]EdU  FBNYV-[AZ;12] FBNYV-[AZ;13.5]  FBNYV-[AZ;12] ] /' ! 6% p  FBNYV-[AZ;12] 6]]%  p ! ]] ( $ ]] ]] ]]'( ( ] i] $ 6]% p ] !]( . '(  m$(* M E* ] ! ] ( !]+ $ N !EdU  !"($ J &2 FBNYV-[AZ;13.5] i] 4 (( ]_2  !]+ ) !]' 2` ] !( M W-"<2 $ ] ( J o] M  "]& b -.* M ( $ + $2 ('( ]G* . '( !" (U 5$ mc 4( 9@(2   '~+(  mc $  !"]($ FBNYV-[IR;2]  FBNYV-[IR;1] ]'( ( ! ( ] !]( ]= "'j G* 4( 9 @N2 !( $ = "'j S],* $] J]0 . ]'( !]" (]U I ] 4(  4 i  W].2 !]F !]= D1 $  2 5=  9@(2   '~+(  ] ? S]U !] 6(]* ]2 ( ]'( (  ] ]! ( $ EdU . J]+( $] ]"2 xvv ,* 6% p !( $ ($ !' ' 2->! *ا $p !( ( DNA-N  DNA-S) EdU m Q]]] ]]]e1 . $($ Jo]]]<' (reassortment)  ]]]' 6]% 24[[[6 [J o]] 5']]&' FBNYV-[AZ;12 4[[$ [[ )[[! )[[ ا = k":2   (! 6 ? 4( S]U   ƒ 9 '[    ]]+   ]] ]]! ( 6 ]] 2 $ (recombination) o @*]]' Acc. No. AM493899 and "]&D( 6"]+D ) FBNYV-[IR;1]  ] *  Geminiviridae ]U$  ] ; ]   * $ ‚F_` !]]]]( !]]]]= D1 $ $]]]] ( Acc. No. AM493898) ˆ :]&* !] !]* ] . ] ]2 Nanoviridae   ']]' 6(]]( !]]( ]] ( J o]] M"]]& FBNYV-[AZ;13.5] ]] !]]< -2 $ (Makkouk et al ., 2002) 6( ]] ( $ $]]]]D Acc. No.  Acc. No. AM493900 ) ( &'2@ ) FBNYV-[IR;2] J]&@ !- ]+ M ],} Q  ( Grigoras et al ., 2009 ) 6%  p J]]]`$ .( Grigoras et al ., 2014 ) J]]]($ ( AM493901 ‚H] "1( !]@ $] '  ]   !% "' M ,} 6(* 2 6( ( $ $:' /'j EdU  *s@' m$(* b d* 4( WF1  (4o* 6( ( $ 3U $2 J  $4 ;  4( G":2   (! 3]0 !@ J+( 6 5'&' (  W= ) FBNYV '(( !(  W]2=* 5']5} J E]X !]  "]+$  (]  $($ $ $]2 '((  !( (U1  C) EdU  (DNA-S) !EdU    ]] ]]! ( ]] 6 ƒ]]o*(  ; ]] r ]]&,2 M ]] E*  oc ]]E !]]( ]] ( J o]] M"]]& >]] ' b]] -.* M]]( $ !]]EDd2 . .  2 "&    ($ !' ' /%'( ! 4 ' 6%  p W-"]<2 ] i $  !"($ 6% p 4( FBNYV-[AZ;12] %  "#  $   !           : % 67  &' " 

Refrences Microbiology, NO. 98: 103- 109. GRIGORAS, I., A. L. GINZO, D. P. MARTIN, A. ALAVINEJAD, E., S. A. A. BEHJATNIA, K. IZADPANAH VARSANI, J. ROMERO, V. A. CH. MAMMADO, and M. MASOUMI, 2011. Molecular detection of Faba I. M. HUSEYNOVA, J. A. ALIYEV, A. KHEYR- bean necrotic yellows virus in legume fields of some POUR, H. HUSS, H. ZIEBELL, T. TIMCHENKO, H. North, North West and South provinces of Iran. The 7 th J. VETTEN, and B. GRONENBORN, 2014. Genome National Biotechnology Congress of I. R. Iran. 6 pp. diversity and evidence of recombination and (in Persian with English summary). reassortment in nanoviruses from Europe. Journal of ANONYMOUS, 2015. Statistical annual report of Iranian General Virology, NO.95:1178–1191. agricultural crops (in Persian). GRIGORAS, I., T. TIMCHENKO, L. KATUL, A. GRANDE ARONSON, M. N., A. D. MEYER, J. GYRGYEY, L. -PEREZ, H. J. VETTEN and B. GRONENBORN, KATUL, H. J. VETTEN, B. GRONENBORN and T. 2009. Reconstitution of authentic nanovirus from TIMCHENKO, 2000. Clink, a nanovirus-encoded multiple cloned DNAs. Journal of Virology .NO.83: protein, binds both pRB and SKP1. Journal of 10778-10787. Virology, No. 74: 2967-2972. HORN, N. M., K. M. MAKKOUK, S. G. KUMARI, J. F. BABIN, M., V. ORTIZ, S. CASTRO and J. ROMERO, 2000. VAN DEN HEUVEL and D. V. R. REDDY, 1995. First detection of faba bean necrotic yellows virus in Survey of chickpea ( Cicer arietinum L.) for chickpea Spain. Plant Dis, No.84: 707. stunt disease and associated viruses in Syria, Turkey FAOSTAT, 2014. Prunus production: National Agricultural and Lebanon. Phytopathologia Mediterranea, NO. 34: statistics Service, USDA. 192–198. FRANZ, A., K. M. MAKKOUK and H. J. VETTEN, 1995. KATUL, L., H. J. VETTEN, E. MAISS, K. M. MAKKOUK, Faba bean necrotic yellows virus naturally infects D. E. LESEMANN and R. CASPER, 1993. Phaseolus bean and cowpea in the coastal area of Syria. Charecteristics and serology of virus-like particles Journal of Phytopathology, No. 143(5):319-320. associated with faba bean necrotic yellows. Annals of FRANZ, A., K. M. MAKKOUK, L. KATUL and H. J. Applied Biology, NO. 123: 629– 647. VETTEN, 1996. Monoclonal antibodies for the KOONIN, E. V. and T. V. ILYINA, 1992. Geminivirus detection and differentiation of faba bean necrotic replication proteins are related to prokaryotic plasmid yellows virus isolates. Ann Appl Biol., No.128: 255- rolling circle DNA replication initiator proteins. 268. Journal of General Virology, NO. 73(10):2763-2766. FRANZ, A., K. M. MAKKOUK and H. J. VETTEN, 1998. KUMARI, S. G., N. ATTAR, E. MUSTAFAYEV and Z. Acquisition, retention and transmission of faba bean AKPAROV, 2009. First report of faba bean necrotic necrotic yellows virus by two of its aphid vectors, yellows virus affecting legume crops in Azerbaijan. Aphis craccivora (Koch) and Acyrthosiphon pisum Plant Disease, NO. 93: 1220. (Harris). Journal of Phytopathology, NO. 146(7): 347- MAKKOUK, K. M., S. G. KUMARI and R. AL-DAOUD, 355. 1992. Survey of viruses affecting lentil ( Lens culinaris FRANZ, A., F. VAN DER WILK, M. VERBEEK, A. M. Med.) in Syria. Phytopathologia Mediterranea, DULLEMANS and J. F. J. M. VAN DEN HEUVEL, NO.31(3): 188-190. 1999. Faba bean necrotic yellows virus (genus MAKKOUK, K. M., Y. FAZLALI, S. G. KUMARI and S. Nanovirus) requires a helper factor for its aphid FARZADFAR, 2002. First record of Beet western transmission. Virology, NO. 262: 210–219. yellows virus , Chickpea chlorotic dwarf virus , Faba GRONENBORN, B. 2004. Nanoviruses : genome bean necrotic yellows virus and Soybean dwarf virus organization and protein function. Veterinary infecting chickpea and lentil crops in Iran. Plant  <>?@ =/ + <  7/ + :; ( :   7  9 $

Pathology, NO. 51: 387-387. 19th Iranian Plant Protection Congress, Karaj, Iran, p MAKKOUK, K. M., L. RIZKALLAH, M. MADKOUR, M. 769, (in Persian with English summary). EL-SHERBEENY, S. G. KUMARI, A. W. AMRITI NAJAR, A., K. M. MAKKOUK and S. G. KUMARI, 2000. and M. B. SOHL, 1994. Survey of faba bean ( V. faba First record of faba bean necrotic yellows virus and L.) for viruses in Egypt. Phytopathologia Mediterranea, beet western yellows virus infecting faba bean in NO. 33(3): 207-211. Tunisia. Plant Disease, NO. 84(9):1046. MAKKOUK, K. M., B. M. MUHAMMAD and R. JONENS, PARSA, M. and A. BAGHERI, 2008. Pulses. Jahad 1998a. First Record of Faba Bean Necrotic Yellows Daneshgahi Publication. 522p.(in Persian). Virus and Beet Western Yellows Luteovirus Affecting SAITOU, N. and M. NEI, 1987. The neighbour-joining Lentil and Chickpea in Pakistan. Plant disease of APS. method: A new method for reconstructing phylogenetic Journals. NO. 5:591. trees. Molecular Biology and Evolution. NO.4: 406- MAKKOUK, K. M., L. KATUL, S. G. KUMARI and H. J. 425. VETTEN, 1998b. Characterization and control of faba TAMURA, K., G. STECHER, D. PETERSON, A. FILIPSKI bean necrotic yellows nanovirus affecting legume and S. KUMAR, 2013. MEGA6: Molecular crops in west Asia and North Africa. In: Proceedings of evolutionary genetics analysis version 6.0. Molecular the Eighth Turkish Phytopathological Congress, 21-25 Biology and Evolution. NO .30(12): 2725 -2729 . September, 1998. Turkey: Ankara University. NO. TIMCHENKO, T., L. KATUL, Y. SANO, F. DE 210-217. KOUCHKOVSKY, H. J. VETTEN and B. MAKKOUK, K. and S. KUMARI, 2009. Epidemiology and GRONENBORN, 2000. The master Rep concept in integrated management of persistently transmitted nanovirus replication: identification of missing genome aphid-borne viruses of legume and cereal crops in West components and potential for natural genetic Asia and North Africa Virus Research Vol.141 (2), reassortment. Virology, NO. 274: 189-195. Pages, 29-218. VAFAEI, S. H., N. AZADBAKHT, N. SHAHRAEEN and MANSOURPOUR, M., A. MASSAH, A. AHOONMANESH N. HAJI, 2008. Survey virus disease of chickpea and and M. R. LAK, 2010. Detection and determination of lentil in province of Lorestan. 18 th Iranian Plant certain molecular properties of Faba bean necrotic Protection Congress, Hamedan, Iran.525. (In Persian yellows virus in central and western provinces of Iran. with English summary).

%  "#  $   !           : % 67  &' " 

             

!"                Habrobracon hebetor          

- - #   
'   () *+  , ' #$ %& ;9**  8% 9*" :()*&  2 34 5 67  0(1 .&/  +,-     ()*&  $%& '()*& ! "" #  9**  9*"  0(% A"  B07  = =>" 970@  (% +,-   = =>" #?@7   ()*& < (I &*& :7 B H/ D " ;  G  : E & D " )   ./ 9 , 7   #K '7 0*  KL$7  M"   * &*7 # 9 , 7 BH/  @6 6)7 2 34 96 & '$?  $  D@/ UV #2WX7 & . 6 ) 7 P* * 7 S=)   T$0*/ $  D@/  ?P"  Q& & "3 %" G 6R @6 . &*& N3"*   9 0*  8*\$@* * &*7  )*  7 )*  Y% Z7 9 , 7  [3"7   # Habrobracon hebetor  T$0* /  &7  # &W )* ^ ^_  Y% ` G@ ^ Z7   " . E *] @ &7 Z+ Y #4& A6@  & &* B  T$0*/ * 66% ! G$( 0* ^ ^_  ` G@ ^ #% &*& 9() A$) . )&  + )+7 #7a  )*   Y% *& 627 de$`*   " @  ( + )+7 )  %" )* G 3)0 [@"   " 0* + c\$)* "   -@ 970 7 b) 0* . )& *&` G@ ^  *   " 9*,: geV [@" h$\7   " 0*  8*\$@* 3 %" 0* )  #>* @ & G 6f . E*& & A$) i@*  . )&*& 9() ( Q/ * )    #?=7 & 3)0 ! & * *& 627 de$`* &W )*  ^ ^_ )*  Y% ` [* & 3)0 *1 S*,* 9j7*  T$0*/ 3)0 ! & l7 ( 3 1" ) ! 1" @6 #6 70 &  j" Ke4*  UV k =>" .&& 7 m * 2 34 . . Habrobracon hebetor   Y%     9@ Y / A6@    )* :1(2 1! 0 

Olfactory responses of parasitoid wasp Habrobracon hebetor to volatile compounds of host insect and pomegranate fruit under laboratory conditions

F. SHAFAGHI 1, S. H. GOLDANSAZ 1
and A. AVAND FAGHIH 2 1. PhD. Student & Associate Professor, Respectively; Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran; 2-Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran Abstract Foraging natural enemies rely on semiochemicals from a plant-host complex for recognition and acceptance of host, thus, key compounds that mediate behavioral response of parasitoids must be identified. We studied the choice time and olfactory responses of Habrobracon hebetor (Hymenoptera: Braconidae) females to the host odors, the Carob moth Ectomyelois ceratoniae , pomegranate fruit and extracted hexane associated with them performed by passing a stream of air in a Y-shaped olfactomete. The treatments were last instar larvae of carob moth, its faeces, infested pomegranate and pomegranate with mechanical damages. The results showed that H.hebetor preferred carob moth larvae and its faeces. There was significant difference of parasitoids choice time between pomegranate with mechanical damages and other treatment. The results of extracted hexane odor indicated that, the odors spread from the larvae, its faeces and infectrd pomegranate exhibited significant differences in wasp attraction, comparewith the clean air. Based on the results and complementary information on detection of the effective attractants of the parasitoid wasps, the efficacy of the wasp can be increased in the field. Key words: Carob moth, Habrobracon hebetor , olfactometer, pomegranate, semiochemical.

Corresponding author: [email protected] !"             Habrobracon hebetor       :  4%!  #$


Tumlinson et al ., 1992; ) n661 E*n 9n 9n , 7 E n@ #

Fadamiro, 2014; .Godfray, 1994; Ode, 2006; Morawo and Ectomyelois ceratoniae Zeller nnn)* nnn Ynnn1 0* &n0 &*n2" :& d4 0* .( Hilker and Fatouros, 2015 n 3+n(`  n 7 mn7 E o  (Lepidoptera: Pyralidae) knn4 0* * &nn` nn !nn@6$7 nn 9nn , 7  nn T$0*/ Al-Izzi et al ., ) n n7 n )& @*@ &  5 @ ) , 7 #67*& pn@@* #n%  n  g6: @ 0* P 4 E @ #  E  3%7  ')* Y*& )* #$?/ 7` # (V G* .( 1985 & . n66% n7 *n / ( n 97n% ) 6$? 9 , 7  N3"* & Warner et al ., 1990; ) n6% n7 &* n?` n )& & ! n@ n)0 #V7  m =$?7 4 #  9@ Y / G* &*7 ` ( Shakeri, 1993; Vetter et al ., 1997; Mehrnejad, 2002 &n7 0nV 9&n ) &n>7 #n n7* 6$n? ) [3"n7 9 , 7 En@* n #$`6n 9*n* & n)* E G" m7 9*6K #  0* . (Godfray, 1994) n66% n7 on % n  T$0*/ '$? n)* n qn & W2 p$3?) 2 34 96 & . (Shakeri, 1993) )*" & . & Y) * 9 , 7 ^_ 9*" 7 5 67 G* #  Kishani-Farahani et al ., 2010; Poorjavad ) n)*& & 9** 9*6K # 9 , 7 ^_ 0* &P$@* *  T$0*/ *(V 3)0 .( et al ., 2012; Saadat et al ., 2014; Nobakht et al ., 2015 &n n7 n&  P" 66% h]$7   66% ! o o Habrobracon hebetor (Say) (Hymenoptera: Braconidae) &n &n2$7 n B*,n gV G*  . (Mandour, 2014) 0* n+ 9*n6K # #% E@* 0 # ^  T$0*/$%* !n & ] Z7K o  ^_ #% G*  637 )*& _V 9** )*  q & E G* orW g$6% Z7*K Tang, 2016: Mandour, 2014; Tang ) 6n 7 2 34 96 & . (KiShani-Farahani et al ., 2010; Nobakht et al ., 2015) &*& nn6)7  nn nn 9nn@ Ynn / nn@6 .( et al ., 2009 & En W2 *n *n`    +    T$0*/ #nV7 G" a*  G $?\)  u   976 @  97%  rnW,  #' $) & )* #$ Z7+" b676R [ >7 o k =>" .  7 *(V   rW%* #6 70 & = =>" Z7n #n% &*& *] * #Hs" MX@ 6R  l" E>" 9$ n3)0 ! !3@ #% &0*&/ 7 * &*7 @ # UV #nnHs" &nn7 9nn    ( #nnHs" Y& MXnn@ ) 9**\ nn  n " & 7 )*  Y% E @ # H. hebetor  T$0* / 96 n&  Gn* 0* n 7 ( #Hs" g* MX@ ) 9**\   $n(  E =7 9*$ & 7 ZaV #% "Ke4* 637 0* #n% "Ke4* i@*  * 9 , 7 G$ * '$? 2 34 . . & E@& # (% )*  q & E G* g$6% & * Vet and ) n6 ) n7 *H #/ ) 7 E@& # 5 67 G* nn3)0 0* &P$nn@* 9&nn Snn\ nnl* G* nn6 . ( Dicke, 1992   6 [ * # &0 0*)* " orW g$6% #7) &  T$0*/ Yn% #n &nW n )* :9  6   1  7%8 [n * G* . &*& :$? E (V    [ >7 G Z =$7  5n  n@ )*  q 0* ( @ .7 m] ) )*  . (Colazza et al ., 1997) ) 7 &'*   &*7 #X@* # nn= =>" #nn?@7 nn@6 nn(V Snn\ :nn(70 #nn  &*n7 0* pn7 K  n T$0*/ 9 , 7 G$ * '$? 4 n )* :n(70 & . n Zn=$67 ( 9*" ) (% +,-   n  *n &*n7  9 , 7 9 , 7   [@" #>$7   + $n@e/ dnv Zn`*& #n  n *n  ^  @ Madden, 1968; Godfray, 1994; ) n)H/ n7  ltn" 9n , 7 *n #" E  9 c& #% x×y I× Cm &2 * # dP n3 1"   n &*n7 G* #  0* . ( Colazza et al ., 2004 &n n )n/ " #R/   {*@ *< Cm &2 * # 9**n`   [@" & ! @ 9   0* #1 6$? * W &  ]n6 mn] #$?/   ^ B/  #Hs" .  Z=$67 #n *  n T$0*/ 6)*" 7  (  976 @ )) 7 KL$7
 <>?@ = , <  % , :; (8 : !) 1! 1 %  9

#n  %" W ^ 9 )*  ^ # &W   )* ^ En 4 i n?@ #& < ± 7& ) E l [*  ]"* Rochat et al ., ) &*n B 0* &P$@*   + )+7 a  #n 6n EK@ y ) &  a& y} }± 3?) !n "" # 8*\$@* :$@& .  Y')* 0 #@ 7 # ( 2004 .  Y')* ( +" EK@ c nV * #(  dv g2 gu€ *  W"  / Z7 [* & H. hebetor  T$0*/ 3)0 B/ b67 # * * #n(  n # nWW n n " V * #(  dv , @* & * #n)*$7 n/ !n n` G@  ^ 0*   :(70 * ( A6@ &      661 cH  / V #nn Ephestia kuehniella (Zeller) (Lepidoptera: Pyralidae) . )&  ZL$7 :+ # 9P"  ‚6  [@" #% & n/ !n  #n W* n6% . n &P$@* G,: 9 , 7 9*6K  9 @*$  * g2 gu€  0* 3K 0* ./ * 9 +n,/ n   @6 (V :(70 0* & * #)*$7 knn4 0* 0nn@ cnn47 nnb67 #nn c  0* nn3K ,nn ) #n ( 8n% n2 34 5 n67  0(% .&/ ) 9*" :()*& nV * #n(  dnv &* )nP" j $@e/  ‚6  i n?@ #n& < ± 7& ) E l [* &  7 E@& n  n n7 !3n@ c47 * 9 . 7   " EKnn@ y nn) &  nna& y} }± 3nn?) Enn 4 &* nn)* nn nn 7  ^nn_  nn ^ 0* nn KnnL$7 &n7 *Hnu . n *n:) ( +n" EK@  # 6 En . )n  n661 cHn n / V * #(   #WW & Yn % on Z7n n/ !n G* B/ * &P$@* * # n(  dv 9& o +P" # %H7   " 8*\$@* ( 9*n* E`n@ #7 c) ) '   \7 Y #@  Y6 Z7%   *n o    $)* &  **&  #)*$@* Z+ # #% ƒL\7 n/ n )* n3)0  5n  *n . (Attaran, 1996) & . n6 $ *n] )& o   * #(    #WW  ‚6 gL"* 9Pna* &n  hn') & 5n]* &n  gen n q 0* 9$`& n" Q-/n@  &n7 )     661 cH  / .-@ g=$)* :(70 #   5  (32.611558 N, 51.313986E ) * #n(   #WW Z`*& ( j7 +/@ E1 E`@ < Y* mn\" V #% )*  Y%  A  ^ . ) &*& & & . n #n$\ ( #nWW  & Y  7 I}} *=7 ) „ dPn + $n@e/ dnv 9& )& b) &7  T$0*/ &*& *n] 9$@ #(  m(/ *=7 * #(   #WW $)*   6$ *] $7 $)@ < ~P"*   X] # * #)*$@*  #WW .  9 0* 3K # &] * 9 #% 4 #  " #R/   T$0*/ Z7% *(V v 970 " dv 0*  n  " V * #(  dv # d4 „ 0* * #(  n6 & Sn\ #n n@6 En n 3)0 . n )/ 9   0*)* :$@& `  ‚6  # :& d4 En . n &$n@ n(% +n,-   n= =>" #?@7 #n& <† ±  n7& & *(V B/  "* &  ZL$7 * * #n)*$7 n/ !n ` G@ ^ &K &  3)0 B/ nn) &  nna& †} y} 3nn?) Enn 4 i nn?@ Zn`*& #n 0 on &7  ) 3)0 EP o * # & n( . )  &*& *] +" EK@  # 6 EK@ y #n) &  Zn=$67 $7 $)@ < ~P"*   X] # dP dv 0* .n/ . n m nb6" #= ]& & $ W  7 †}  * 9 En 2  S*,n* E .  &?7 "  #R/  dv n661 cHn  / V * #(   #WW 0 #@ EH & 0 on & * #n)*$7  n/ !  ^  T$0*/ n 9*,n: geV $ W  7 o  9 0* Y*1  #  )  0 # n@ #n 3)0 Z7% *(V #Hs" . ) 7 2" 9 7 #nU* ( 9 W Q7 E% E`@ ) a& x ƒ` #& .  Y')* a& <} Z?K  c # #$(u #36/ 9n # $ n? !3n@ 661 cH  / 0* 3K  geV .  *n 3 1" 8*\$@*   K :  9 2A B C & n7 En@& # n n gn>7 . & 7  cH &*7 ^n_ n)*  Y% ` G@   ^ [@"   W" !"             Habrobracon hebetor       :  4%!  #$


&*& *] 9 $`* & , m\" E E ^ W )&  & Sn70 Yn')* 970 "   5  :&  #(  : : 0* )& 3K @ &7   " . & () ).  *:) i ?@ #& E *] 0 o  &  Y% ` G@ ^ IMN G* Y')* * : FG  9DC E   9 )*  ^ # &W )* ^ ^_  c6" #  9 .6 #%  &P$@* Zj Y A6@  o  0*  S70 & n " #n@ 9*n6K # + )+7 a #  %" W ^ na* 0 . & $7  7 < `*& X] # .% / #(  0* . .  #? =7 A6@    : &  0 gn4 n$7 $)n@ < K  0 0* o  $7 $)@ y 0n o n & n Yn% ` G@ ^ ^_ IO * 9 . ) ZL$7 #>* 5367 # K  0 . 6$*& ^ 9n n)*  ^ # &W )*  c6" #  E *] n &n'* &n n / [n@" #n= ]& & $ W  7 †} g&27   0n & n " & 9*6K # + )+7 a #  %" W gn2 gnu€ [n@" # PnL" 0* .n/  (Dweck et al ., 2010) . #? =7 A6@    : & 0nn & nn &  nn& cnn47  , nn@* c [nn@" #n n %" nW ^ 9n )*  ^ # &W )* IB n 0 En?" A6n/ n 0* .n/ . En 9 A6@  . .  #? =7 + )+7 a Wn $V* X` !3@ 9=" YK "  7  #  A6@    Y0^ 9n70 : J! JGG2 P(8 1    -I n #n>* *n:) n #nbP>7 S70 † 0* ./ . &() S  n70 6) A6@     0 0* o  c\$)* E † n" M3na x EKn@ G  S70 7 " . ) 7  #  9n70 . E *] #?=7 &7 :+  3)0 [@"  3] na #n *n+"  Y')* EK@ . ) Y')* v 0* 2 &* 3)0 #% * #b>W 0* 970 .  E3l $@& $7)% [@" & 0* ./ #%  3)0 . &% 7  s"   " G (`R  & 7  0 0* + &* #% )70 "  7 A6@     n))7 7 a* 0 & #= ]& A6/ Z]*V A6@    #   *n . n #3n@>7 En n7 n # $7 $)@  Z]*V Sn70 0* )&% ) c\$)* * K  0 0* Y*+f n$7 $)@  eK # hL)  &L" c\$)* YK 0* 96 4* #nn& <† ± '6nn@  nn  nn"* nn7& .)nn nn7 dHnnV n n . n & cn\$)*  n 27 9*n6K #n nK  0 g4 0* .  m b6" a& ‡} " †} G 3?) E4  i ?@ . . & *+" ˆ† Z7 S 70 1 1  JJ B CJJ JJ  JJ RJJA JJ  QI 0* Snn\ G n * : H. hebetor J  1 J 1J! EGJ2  ZnaV g>7 0* $ W+ 7 o  '6@   S70 Hnu%  *n+" n *0* #   " 0* o  8*\$@* 0* n3)0 I} n Q/ *  #?=7 & * Cm &2 * # a Y . .  Y')* A6@    & &%   EP &7  S70 & &P$@* &7 Z+ A6@   I ' H. Fig. 1. Y-tube olfactometer used in the experiments #n '6n@ n # N 7  &*& :1  1! SA n '$n? 9n70 #n N 7  &*&  χ2 970 o % 1 J! K J  J    J  1 J EG2  'I &7 #4 o  ANOVA # 0* &P$@*   $:W Z3" ˆ† n Sn70  :  !1   1  K 9KL ,  9n70 [n@"  G :) 7 #?=7 . E *] Z >"  #,'" EK@ ‡< ‰%*V #%  Y')* &%   EP  &7 3)0  #n,'" *n SAS Ver. 9.1 *,* Y) .  Y')* Tukey-HSD n #Hs" Z?K c   3)0 G* . & #$H 9v 0*
 <>?@ = , <  % , :; (8 : !) 1! 1 %  9

#n ) )n !n En*& *n] 9 & ^ #% 0 E @ .( SAS Institute, 2001 ) nn &P$nn@* nn &*&  nn7 Z nn >" n Z+n ) ( Z=2.46, P= 0.0136  Z=2.137, P= 0.032 ! "" . ) m@ Microsoft Excel 2007 *,* Y) o %   *& ) <.( <.( c  < b n)*  n Yn% ` G@ ^ ^_ 80 #?=7 TU  S &n  " & G *& 627 de$`* 6 & 9() ^ # &W J H. hebetor J  J   J  J 'I cn\$)* * ^n_ ( &nK

no response

pomegranate with f) ns mechanical damage 15 24 Infested 6 pomegranate e) pomegranate with * 8 mechanical damage 12 25 Faeces d) Infested Faeces 5 pomegranate * 14 26

pomegranate with c) Larvae 3 mechanical damage * 13 29

Infested b) Larvae 7 pomegranate * 13 25

ns Larvae 6 a) Faeces 18 21

100% 50% 0% 50% 100%

h$\7    "  V A6@   0 0* o # Habrobracon hebetor &7  T$0*/  3)0  D@/ a& I - H. ( (  & 7 9() *  " 9 #  ! &** &*2" 0    #$) &*K* ) Fig. 2. The percentage responses of female parasitoid wasps Habrobracon hebetor to either olfactometer arm contain different treatments (Numbers in bars are the total numbers of parasitoids responding to each odor source) !"             Habrobracon hebetor       :  4%!  #$


 n)& *& n627 de$n`* **& + )n+7 ! n@  )*  * *   3 %" =W S=) k =>" G*  #$ cn\$)* * ^ #n n$67 0 " "% 970 &  3)0 & n T$0*/  3)0 . )&*& 9() 2 34 96 & ! &

.( .( g ) (F 40 =5.29, P = 0.026) )& ) n 9n , 7 *n 3 %" # m E2 34 &  9 , 7  ?7 & V A6@  0 & G c\$)* 970 #?=7 !n E  (V * 3 %" # m  E (V   n )*  n)*  Y% ` G@  ^ ^_  " n 9 , 7 0*  KL$7   3 %" ^ 27 . ) 7 &n *& n627 de$`* & YK 6 & 9()  ^ # &W n3 %" # E3?)   T$0*/ * (  97% ) 9 =

^n_ n " & G n #% WV &  (F 38 =0.03, P = 0.873) n& ?` 9   0* #% " 3 %" 6)7   0* ) *  3)0 c\$)* 970  + )+7 #7a R&  )*   ^ n" n66% !n  n ( 976 n@ ) 6  KL$7 E 0* 970 0* *& 627 a # ^_ 0 # 9 @ * #% 6 & 7 9() UV k =>" A$) . (Godfray, 1994) 6$?

(F 35 =4.58, P = 0.039) &n n" n"% Zn =7 0n cn\$)* n` Gn@  ^ 0* )   S70 Y')* [* & n )*  ^ #n &W  )*  " & G & .(  g )    #?=7 &  9 ^_ G 6f  )*  Y% & *& n627 de$n`* n   T$0*/  + )+7 #7a **&  + )n+7 #7na nR& n)* n  E # &W )* 0* )

F38 =9.57, P ) )& ) c\$)* * &W  )* " "% 970 E @ # H. hebetor 3)0 ! & "l7 Z7*K 6)*" 7 .( .( g () = 0.038 #n &nW )*  " &   7 b) # .$V 6 9 , 7 (V 970 7 & & 7  (7  g & #% 4 9  ^   6)nn/ EnnWV  nnV" nn)* &nn` ^ n66% !n n nV #% A6@  0*  0 c\$)*  n T$  0*/ 9n !n n$ % ‹K  &% &' * ^_ n@  + )n+7 ! n@ nR&  )* G & 3)0 * n3)0 Manrique et al ., (2005) B*,n #n n6 . E@*  &   " @ G 7* E*& & *& 627 de$`*   " A6n@  & Anaphes iole (Hym.: Mymaridae)  T$0*/ Gn  3)0 $ G* . ()  (7 *& 627 de$`* &n7 n3)0 Gn* 9n , 7 n(V [@" #% )     # n Yn% n ^  K) #   " @ #%  Z W& n7* n !n n)& #n$ *n] ,n mn\" n  #Hs" #nR  ^ & 0* )  #>*  )* & N3"* & )* + ) n+7 na #n n& ! n@ n  0* n)   # #n &nW n )*  n` Gn@  ^ ) m =$?7 a # Goniozus legneri n T$0*/  G n6f . &*n) 9n() \@/ Gn@ n ^ ^n_ ) m =$n?7  u a # #R  ( ^ 9n , 7 &` _V 6)7  g6: @ 0* (Hym.: Bethylidae) nb) &7 0 c\$)*  9 ! & 5?" !3@ ( ` 6$? Œ \(" Z ] !@67 #a o 0* #% 9 ^_  . . E@*  3)0  n6% 7 &P$@* 9 , 7 G $ E c` * #)() 9*6K # n Yn')* = =>" # (7 V " 7 E@& # A$) E *Hn 0* n T$0*/ Gn* *n ^ ^n_  #  .  6nn nn7 Mbata et al . (2017)  Mandour (2014) [nn@" . (Aleosfoor et al ., 2014) 6$? *&` ^ Cotesia kariyai Watanabe n T$0*/ #n% &n1 E l )7 n #n$ J!: JGG2 P(8 1    -I & G n c\$)* &  )70 b) 0* (Hymenoptera: Braconidae)  n " & G c\$)* 970 &*& 9()  S70 G* 0* ZaV S)n , 7 ^n_ *n #n mWn@ n   mW@    " de$n`* &nW )*  ^  " G 6f  ^_  ^ Mythimna separata (Walker) (Lepidoptera: Noctuidae) &   F36 =0.58, P = 0.4511; F 38 ) !n "" #n 6$n*) *& n627 n #n?=7 & ^_ _V 9 ^ # &W    " ^  " & G c\$)* 970 #% WV & ( =0.93, P = 0.342

 <>?@ = , <  % , :; (8 : !) 1! 1 %  9

A6@   & @ &7    " E @ # Habrobracon hebetor &7   3)0 c\$)* ( ))l # 970 7 (  27 X` )± G :) 7 'I V8 Table 1 . Mean (±SE) of choice time(s) of Habrobracon hebetor females to tested treatments on olfactometer. Expriment no. Treatments Choice time (S) Larvae 110.04±19.04a 1 Faeces 124.32±16.9a Larvae 116.20±15.28a 2 Infested pomegranate 143.07±23.54a Larvae 60.20±5.45 a 3 pomegranate with mechanical damages 111.23±19.45 b Faeces 97.69±17.30a 4 Infested pomegranate 96. 9±11.7a Faeces 86.88±13.86 a 5 pomegranate with mechanical damages 137.75±19.04 b Infested pomegranate 66.35±17.9 a 6 pomegranate with mechanical damages 119.29±12.82 b ( ( P<0.05  %" 970 ) 6$? : +   *& 627 de$`* ] #)`  & # (7 dV  **&  G :) 7 * ∗ Means in a cell followed by the same letters are not significantly different (P< 0.05; Tukey-HSD)

*n &*7 0* ) #>* &K x 62 &7  3)0 a& *& n627 de$n`* 9n , 7 ^n_ *n #n &W   n)&*& M " Q/ *  * &W  )* 0*  8*\$@* n)  & n  " & 9n70 Gn* n7* n & ) 9() * 0* n 8*\$n@* n)*,: #n>* G n #n?=7 .( Ia Z+ ) Mandour, ) En@* " "%   " @ 0* V " ^_ & n)* n Yn% n` G@  ^ G 6f  ^_ (. 2014 na& ‡x  } !n "" #n #% &*& 9() Q/ *  #?=7  n T$0*/ *n D@/ 970  Œ\(7 G 6f * n@ &n7 n  " n 3)0 0* &K <  <} g&27 n)* #$n*) * 9n , 7 n 3] i "  # '" #%  H. hebetor 62 a& y E) & .( Ic  I b  Z+ ) )&*& M " n6 n/ !n &n7 *n(V #n% &n n7 n" "% $] n)* 0* n 8*\$n@* #n>* E n@ #n  3)0 0* &K ‡ #% WV & ) : *] A6@  & Plodia interpunctella & .( Id Z+n ) )n !n ( + )n+7 na # )  %" n i " 3] # '"   &7 * c\$)* 970 G" "% Gn@ n ^ 0* *\$@*  #>* Q/ *  #?=7 5n367 ?6 97   )0  ^ #% E@* $] 9 , 7 (Z= - 9 ^n_  (Z=-2.85, P=0.0043) n Yn% n` 9n+7 # N 7  #)() . (Mbata et al ., 2017) 6 Q>7 (Z= -2.29, P= 0.0218) &nW n )*  2.04, P= 0.00412) n(67 n T$0*/ 9n , 7 *n(V 9 0* p =$?7 #% 9 , 7 & n)&*& 9n() n3)0 9&n% ! & * *& 627 de$`* ~nU7 Gn*  6$? " c % E2 34 & p^ $V* )  7 #n n& ! @  )* 0* *\$@*  #>* G #% WV G 6R #%   9 , 7 " ] 2 34 c\$)* Z W& )*" 7 Qn/ *  #?=7 & (Z= -1.70, P= 0.881) + )+7 B . (Mandour, 2014) 66% 7  W" *  #)() #n #n% )&*& 9() 7  E@& # A$) . ()  (7 e$`* JJ  JJ JJ H. hebetor JJ   JJ  J QI n@  + )+7 a #  %"  )* LK  " 0*  u n : J  J   J J)() W2  K  B C . . )& 66% ! 3)0 *   " Sn70 &n7 n  " 0* n 8*\$@* * &*7 @ ‡I ‡I #% & Œ\(7  T0*/ 3)0   D@/  !"             Habrobracon hebetor       :  4%!  #$


no response

d) Hexane extraacted from pomegranate 5 air ns 8 17 with mechanical damage

c) air 3 ** 6 21 Hexane extraacted Larvae

b) air Hexane extraacted from faeces 5 ** 5 20

a) Hexane extraacted from infested 4 air 7 19 * pomegranate

100% 50% 0% 50% 100%

0*  8*\$@* * &*7 )  & A6@      0 0* o  # Habrobracon hebetor &7  T$ 0*/   3)0  D@/ a& I Q H. ( (  & 7 9() *  " 9 #  ! &** &*2" 0     #$) &*K* ) *  #? =7 & & )*  7  )*  Y% ^ Fig. 3 . The percentage responses of female parasitoid wasps Habrobracon hebetor to either olfactometer arm contain extracted volatile of Ectomyelois ceratoniae larve and pomegranate fruit vs. air (Numbers in bars are the total numbers of parasitoids responding to each odor source)

. . E n)&*& 9() &` = =>" & Fazeli-Dinan et al. (2015) na #n #R )*   70* #% )70 UV @ & 9n   #n Encarsia formosa (Hym.: Aphelinidae) n3)0 #% mn'V Ž>W # m  &% &P$@* &W )* #R  + )+7 ! @ 9n  . n& !n ,n ) 9n , 7 _V 9 mW@  ` !n  n T$ 0*/  *n n " & n "^ &$    &  &*& Œ \n(" * n  0* n) #>* 3)0 #% #%& ) n7 ) En@& #n n 9 G  *& 627 de$`*  )& 66% n_V gn $V*  #>* G* E&  7+" b) 0* #' $) &nW n)* E n@ #n n !   3)0 &*2" #% 6R #n An$)  #' $) G* . & 7 L$7    * oW  P@ G *  &P$@* *\$@*  #> * 0* #% )70 7* . & $( Gn+ 7 P" G* . &*& s7 UV k =>" & 7 E@&    n  n7 G /  $ & &*7 m'V   k ] * &*7  nP$7 #n) & n3)0 & ^* #%  Z W& G* # E@* + )n+7 ! n@ n )*  " & 3)0 !  * m'V G * &*& gn $V* G U &  6$? P$7 orW%* [*   n T$ 0*/  *n &nW n)* #n%  n 9 0* n7* &n3) % n kn =>" Gn* & n@ &n7 n " & 9*,: & #%    & 3)0 ! # &]  V " , )  G * & & " c*H &  . E@* & *H l"    # E3?) 3)0 S6%* ] ^_  ^  " # E3?) , )  " G * #%6R n)*,: &*n7 #n% &*& 9n( ) Silva et al. (2006) n@ Gn* n@ 7 b) # A $) G * # #"  &*& 9()  " / G ! Euschistus heros (Hemiptera: 9 , 7  ) 0*  8*\$@* E3n?)  97 %   T$ 0*/ ! &  & %  & 0* mnn\" nn T$0*/ nn3)0 nn &nn7 Enn?)*" Pentatomidae) . . 6 7 " 96 4* Z ]  976 @ # Zn`*& & * Telenomus podisi Ashmead (Hym.: Scelionidae) ‰%*nV #n !3n@ #n% n % 0n@ 0* n$ E`6 n n)*,: #n>* #% )70 G 6f . 6% ! A6@  ) 7   T$0*/   + :% ] 9)@ S*,n* cn\$)* #n  T$0*/ Z "  * 9 , 7 m\"

<>?@ = , <  % , :; (8 : !) 1! 1 %  9

#n n)*& *n% 0*n)* #nR )*n 7 [* & 66% ! onrW gn$6%  #n7) 9&n ) *n* " k7 & )*" 7 n Dn@/  n(7 0* ./ #%  7 0 )  +" = =>" l7 &P$@* . (Kishani-Farahani et al. , 2017)  l7   n66% ! a*  &7 ,$6@  9*" 7 #" Z ] E3‰7 n #n7) & *   T$0*/ % )*" 7 )7% 0* 0*  n3 %" Gn* nX >7 E?0 *4\7 YK 0* 96 4* Vet et al ., 1995; Phillips, ) n & S*,n* +rnW gn$6% . . & ) &P$@*  q & orW g$6% 0@ #6  *  9 H. hebetor  #n2WX7 Gn* ( 1997; Scholler and Prozell, 2002 )*  Y%  ^ # N 7   #)() 0* p" K 1 "X Ynn " .& &nn ) &P$nn@* &nn` 9nn , 7 9&nn% *nn / *nn n_K /n >7 mvn% $%& ] c6 0* # @ G  ^  [3"7    LK  9 & #%  S70 9n]  n(% +n,/ n  n= =>" #?@7 K    " @ 0*  T$0*/ D@/ 6$*& &  ^ &`  ,n%7 & )n7] ?` i67  / )] 9*7 i67 a* g6: @  97% #% )&*& 9() A$) G* . & $( n * n7 kn =>" Gn* & #n% @ 9$@ "3) PV '$n? n$ 0 * 3)0 G* [@" &P$@* &7 . . && 7 )*&] )& ) nn3 %" Gnn* &nn Œ\nn(7 #nn% Gnn* *nn . nn)* &nn 9

References

ALEOSFOOR, M., F. EHTESHAMI and L. FEKRAT, 2014. Journal of Chemical Ecology, No.30: 945–964. A six-arm olfactometer for analysing olfactory DWECK, H. K. M., G. P. SVENSSON, E. A. GUNDUZ and responses of Goniozus legneri Gordh (Hymenoptera: O. ANDERBRANT, 2010. Kairomonal Response of Bethylidae), the larval ectoparasitoid of carob moth, the Parasitoid, Bracon hebetor Say, to the Male- Journal of Entomological and Acarological Research, Produced Sex Pheromone of Its Host, the Greater No. 46: 119-122. Waxmoth, Galleria mellonella (L.), Journal of AL-IZZI, M. A. J., S. K. AL-MALIKY and N .F. JABBO, Chemical Ecology, No.36: 171–178. 1985. Bionomics of Ectomyelois ceratoniae FAZELI-DINAN, M. R., R. TALAEI-HASSANLOUI, H. (Lepidoptera: Pyralidae) on pomegranates in Iraq, ALLAHYARI, A. KHARAZIPAKDEL and H. Journal of Environmental Entomology , No. 14: 149– MOHAMMADI, 2015. Olfactometric responses of 153. Encarsia formosa (Hym.: Aphelinidae) to odors of ATTARAN, M. R. 1996. Effect of laboratory hosts on infested greenhouse whitefly Trialeurodes biological attributes of parasitoid wasp Bracon hebetor vaporariorum (Hem.: Aleyrodidae), by Lecanicillium Say, M. Sc. Thesis of Tarbiat Modares University, longisporum treated on cucumber leaves. Plant Pests Tehran, 77 pp . (in Persian with English Summary). Research, No. 5(1): 1-12. (in Persian with English COLAZZA, S., M. C. ROSI and A. CELEMENTE, 1997. Summary). Response of egg parasitoid Telenomus busseolae to sex GODFRAY, H. C. J. 1994. Parasitoids: Behavioral and pheromone of Sesamia nonagrioides , Journal of Evolutionary Ecology. Princeton, University Press, Chemical Ecology, No. 23(11): 2437-2444. Princeton, New Jersey, 473pp. COLAZZA, S., G. P. MCELFRESH and J. G. MILLAR, HILKER, M. and N. E. FATOUROS, 2015. Plant responses 2004. Identification of volatile synomones, induced by to insect egg deposition, Annual Review of Nezara viridula feeding and ovipositing on bean spp. Entomology, No. 60: 493–515. that attracts the egg parasitoid Trissolucus basalis , KISHANI-FARAHANI, H., S. H. GOLDANSAZ, O. !"             Habrobracon hebetor       :  4%!  #$

SABAHI and M. SHAKERI, 2010. Larval parasitoids of Entomology and Zoology Studies, No.3 (1): 287- of the carob moth Ectomyelois ceratoniae in three 289. regions of Iran Varamin Qom and Saveh.Iranian, ODE, P. J. 2006. Plant chemistry and natural enemy fitness: Journal of plant protection science, No. 41(2): 337-344. Effects on herbivore and natural enemy interactions, (in Persian with English Summary). Annual Review of Entomology, No. 51: 163–185. KISHANI-FARAHANI, H., Y. MOGHADASI, P. ABRUN, PHILLIPS, T. W. 1997. Semiochemicals of stored-product and A. ASHOURI, 2017. Olfactory learning and insects: research and application, Journal of Stored memory retention in Venturia canescens (Hym.: Products Research, No, 33:17–30. Ichneumonidae). Journal of Entomological Society of POORJAVAD, N., S. H. GOLDANSAZ, T. Iran,37(1)15-26. (in Persian with English Summary). MACHTELINCKX, L. TIRRY, R. STOUTHAMER, MADDEN, J. L. 1968. Behavioural responses of parasites to and T. V. LEEUWEN, 2012. Iranian Trichogramma : the symbiotic fungus associated with Sirex noctilio F, ITS2 DNA characterization and natural Wolbachia Nature,No. 218: 189–190. infection, BioControl, No. 57(3): 361-374. MANDOUR, N. S. 2014. Effect of Host Frass on Searching ROCHAT, D., K. MOHAMMADPOOR, C. MALOSSE, A. Behavior and Parasitization of Cotesia kariyai AVAND-FAGHIH, M. LETTERE, J. BEAUHAIRE, J. Watanab, Egyptian journal of pest control, No.24 (1): P. MORIN, A. PEZIER, M. RENOU and G. A. 183-189. BBDOLLAHI, 2004. Male aggregation pheromone of MANRIQUE, V., W. A. JONES, L. H. WILLIAMS and J. S. date palm fruit stalk borer Oryctes elegans , Journal of BERNAL, 2005. Olfactory Responses of Anaphes iole Chemical Ecology, No. 30(2): 387-407. (Hymenoptera: Mymaridae) to Volatile Signals SAADAT, D., A. A. SERAJ, S. H. GOLDANSAZ and J. Derived from Host Habitats. Journal of Insect KARIMZADEH, 2014. Environmental and maternal Behavior, No. 18 (1): 89-104 effects on host selectionand parasitism success of MBATA, G. N., T. SHU, W. PHILLIPS and S. B. Bracon hebetor , BioControl, No. 59: 297–306. RAMASWAMY, 2017. Semiochemical cues used by SAS INSTITUTE INC. 2001. SAS/ Stat users Guide, version Pteromalus cerealellae (Hymenoptera: Pteromalidae) 9.1 SAS Institute Inc, Cary, NC. to locate its host, Callosobruchus maculatus SCHOLLER, M. and S. PROZELL, 2002. Response of (Coleoptera: Bruchidae), Annals of the Entomological Trichogramma evanescens to main sex pheromone Society of America, No. 97: 353–360. component of Ephestia spp. and Plodia interpunctella , MEHRNEJAD, M. 2002. Biology of carob moth , (Z,E)-9, 12-tetra-decadenyl acetate (ZETA), The E. ceratoniae new pest on pistachio in Rafsanjan, Journal of Stored Products Research, No. 38: 177–184. Applied Entomology and Phytopathology, No. 60: SHAKERI, M. 1993. First report of attack of spectrobates 1–11. ceratoniae Zell. To figs in Iran, Applied Entomology MORAWO, T. and H. FADAMIRO, 2014. Duration of Plant and Phytopathology , No. 60: 29-32. Damage by Host Larvae Affects Attraction of Two SILVA, C. C., M. C. B. MORAES, R. A. LAUMANN and Parasitoid Species ( Microplitis croceipes and Cotesia M. BORGES, 2006. Sensory response of the egg marginiventris ) to Cotton: Implications for parasitoid Telenomus podisi to stimuli from the bug Interspecific, Journal of Chemical Ecology, No. 40 Euschistus heros , Pesquisa Agropecuária Brasileira, (11): 1176-1185. No. 41(7): 1093-1098. NOBAKHT, Z., J.KARIMZADEH and S. SHAHKARAM- TANG, Q. 2016. Olfactory responses of Theocolax elegans JAFARI, 2015. Identification of parasitoids of (Hymenoptera, Pteromalidae) females to volatile Apomyelois ceratoniae (Zeller) (Lepidoptera, signals derived from host habitats, Journal of Pyralidae) on pomegranate in Isfahan province, Journal Hymenoptera Research, No. 49: 95–109. <>?@ = , <  % , :; (8 : !) 1! 1 %  9

TANG, Q. F., Y. J. WU, B. M. LIU and Z. L. YU, 2009. Parasitoid foraging and learning. In: Carde RT, Bell Olfactory responses of Lariophagus distinguendus WJ (eds) Chemical ecology of insects II. Chapman & (Hymenoptera: Pteromalidae) to volatile signals Hall, New York, pp 65–101. derived from host habitats, Philippine Agricultural VETTER, R. V., S. TATEVOSSIAN and T. B. BAKER, Scientist, No. 92(2): 133–142. 1997. Reproductive behaviour of the female TUMLINSON, J. H., T. C. J. TURLINGS and W. J. LEWIS, carob moth (Lepidoptera: Pyralidae), Pan-pacific 1992. The semiochemical complexes that mediate entomologist, No 73(1):28-35. insect parasitoid foraging, Agricultural Zoology WARNER, R., L. M. BARNES, E. F. LAIRD and M. D. Reviews, No. 5: 221–252. LANHAM, 1990. Chemical control of carob moth, VET, L. E. M. and M. DICKE, 1992. Ecology of Ectomyelois ceratoniae (Lepidoptera: Pyralidae), and Infochemical Use by Natural Enemies in a Tritrophic various nitidulid beetles (Coleoptera) on ‘Deglet Noor’ Context, Annual Review of Entomology, No. 37: 141- dates in California, Journal of Economy and 172. Entomology, No.83: 2357-2361. VET, L. E. M., W. J. LEWIS and R. T. CARDE, 1995.

!"             Habrobracon hebetor       :  4%!  #$ 

             

    Mentha longifolia (Lamiaceae)       Ephestia kuehniella (Lep.: Pyralidae)     

& '!(
% !" # $    8 89" :; &$1* 7 6 0** &  45  0$12 3()*&  .(/ +()*&  +,-      ()*&  $%& '()*& ! "" #  0**  0*" .(% ?"  @.> 8 89" 0>.1 (/ +,-   8 89" #=1>  :% < (H &*&> : @ FG B " 6  DE1* : < & B " ) + + )*  #=8> & 0 =ED" < 1   2" P (  ,)O @ # Mentha longifolia #)G N)1* M 0 =2>*)) #J2K> L* & W =1 #& V ± >& R> 3(>. T* .  1 Ephestia kuehniella & G ! Q$;> RM*>  #)G 2 J> N)1* #M> `$D/ * ! "" # N)1* .* * $ 2  $ 2+ > V / V /  /  /  <]^ . & +"  \& [ Z± X=) < Y c c b/  <]^  (/P :>. & * $ 2  $ 2+ >  / VV V/  <]^ 0 =2>*)) &> & . < / # a;"  P & N)1*  0 =2>*)) * * $ 2  $ 2+ >  / <]^ & PT50 *8> .  1 (/ a;" & * $ 2  $ 2+ > b c/  * ! "" # < a;"  * $ 2  $ 2+ > V / <]^ & &8> L* .  L J" . /  Z c/  * ! "" # (/P :>. &   0 0 =2>*))  #)G N)1* PT50 &8> 0 > *& DJ> de$5* D & 0() ( RMP ) X=) < 1 0*, > . & . Zc/V  b bb/ :*,*  N)1* =ED" < 1 hEM ij '" :  < \5  #)G N)1* M 0 =2>*)) gM  #$ f K> . & < #M> ]) &  `$D/  #>) & <=. T 9> *& <1&  :+$ .*   k 0*Dj # )*" >    > )PY & 0 4*& .& #$ . . 0 =2>*)) & G !  4*& #)G N)1* :-+& -. ,

Comparison of durability of Mentha longifolia (Lamiaceae) essential oil and its nanoemulsion against Ephestia kuehniella (Lep.: Pyralidae)

M. LOUNI 1, M. NEGAHBAN 2
and J. SHAKARAMI 1 1- PhD. Student & Associate Professor, Respevtively; Department of Plant protection, Faculty of Agriculture Science, University of Lorestan, Khorramabad, Iran; 2. Assistant Professor, Pesticide Research Department, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (ARREO), Tehran, Iran Abstract In this study, the nanoemulsion containing Mentha longifolia essential oil was produced by using high-pressure homogenization method and its fumigant toxicity was compared with ordinary M. longifolia essential oil on different stages of Ephestia kuehniella . Experimental conditions were as follows; 27±1 °C, 70± 5% relative humidity in total darkness. Concentrations of 111.1-1111.1 and 62.9- 92.6 µl/l air of oil have been used to control larva and eggs, respectively. Nanoemulsion concentrations were studied at 122.2-1111.1 µl/l air for larvicide experiment and 81.4-114.8 µl/l air for ovicidal stage. PT 50 value at 1111.1 µl/l air as a larvicide for nanoemulsion and oil was estimated about 15.18 and 3.69 days, respectively. This value, at 92.6 µl/l air on egg was 14.44 and 2.58 days, respectively. The relative median potency parameter (RMP) showed that there was significant difference between PT 50 values of essential oil and its nanoemulsion on both of the two stages of pest. Results showed that nanoemulsion containing M. longifolia oil can release slow properties lead to durability of fumigant toxicity of oil in the long term. Therefore, this new formulation could be considered as a new and ecofriendly biopesticide in pest control. Key words: Ephestia kuehniella , Essential oil, Durability, Mentha longifolia , Nanoemulsion.

Corresponding author: [email protected]            :  01. 


t* &X  llG !ll #Jll1" *ll @ell" . (Donsi et al ., 2011)  .* + (Lepidoptera: Pyralidae) kl &l'* #l l'D> :l/ `l$J> *l  o T*l *)) Rllz> o & `ll9> 0 ll1P> L*  P  9 " 0 , > 0*Dj # WX1  &  ej *s R>ll ll 0 ll=2>*)) . (Nuchuchua et al ., 2009)  l / : l/ ij P Pp q '"  #Fr"  < & #ll/ Dll ll> $>)ll) [[[ Z[ llKn #ll ) ll=2>* &ll ll> kll(5 ll ll >  ?)ll s 4llD llE /  0  l l :l/  L* . (Gupta et al ., 2016) #  .* &J$> e+(> # 'D> X)*  `$D/ < &*l> l+,  lXt &X & t> @ k *s ku/ l1 *lt*  0l   &2 <=. T 9>  o &2 Rll>*j llD/*G :*,ll*  ll #2ll=-/)) $ll=. #l #l"  .( Boyer et al ., 2012 ) <1*  0**)$=G  . (Topuz et al ., 2016) & ll(/ ll(M #Jl1" # g . ) .>*     :/ < !J> ?lll* w*lll)* .* lll+ (GMS) *|$lll1*)> `lll=  #l 0l8> &lm$n* l]) .* #/  `$D/ L *  @   0 =2>*))  2" * {P J> #/  >  `= )> ll ll> Dll ll .ll1  #ll\ DD/ `&J$> 0*Dj # ! /" L* . &  > *n &E$1* &> l #) .*  = .( Moharramipour and Negahban, 2014 ) &l>  0 1P> &  `$D/ :  R>j  E =2>* .* & *,ll=  tll" ll 0 ll N)ll1*  ll   "ll> . (Kavadia et al ., 2017) &ll  ll> *lln &E$ll1* . (Isman, 2000) )*& X)*  R 8> & Pm9> kl D+" kl * 0&/ #2=-/+ > 0*} 0l jDJ) &*)5 # fJ$> Mentha longifolia L. #)G   Rosmarinus officinalis L. N)1* '" :   <]9> `ll$J> *ll  o T*ll &  ll #ll)5& # llM & . (Moretti et al ., 2002) l)&/ 0l l) dl a( * # j lD/ l> l  l1 olD   2*$l1* G* oD  ,/> Artemisia N)ll1* ll> ll - 2 *s)ll) llt* #llJ2K> & 0**l  #) .*   L* L Du a . (Seveg et al ., 2012) &*& 0() Bemesia tabaci G. k2  E1  arborescence L. Tl1" 0 (/ (M *t* #/  > 0** v8) .*  = ll >& & N)ll1* Pll ll+,  llXt illj @ Lll* Shakarami et al ., 2008; ) L 889> l . [ 0>. > & ( W =1 #& b[ )b Q $;> Pl  ;X" n  * X /" & .( Akrami et al ., 2011 . . (Lai et al ., 2006) <1* l <&l9> .*  l5 l) Rl 8> & FlG #,'"  #2l=-/)) N)l1* lDD/& lt* 0*+  0X3) :*,l*  * .* + .  >    N)1* .* &E$1* ll 0 llt* L llD~  Artemisia sieberi Besser ll  ll l 0 0&/ #2>   X /" L* &+ j &X  Xt Plutella ) ll1 2*  wl) ol;$)* . (Majeed et al ., 2015) R>*j & Pl  L* &*& 0() f 89" L * ?$) &*& 3$ll= `llm9> wll)  llt* ll9) N)ll1*  ll .l1  . &*& 2l J> N)l1* #

   N)1* < )  & . &G  ˆ(5     dFM lG ! P # j 0 n * #Fr"g *t*  C. B. Clarke l lK8> o l$ 2 l > V[[  *   &G 4 [[ & . <1*  0 Jamal et al . (2012) T1" , ) 1 2* <(G l>& & Clevenger * #l(   N)l1* 3$l1& .* &E$l1* N)ll1* .* ll #ll " `O)ll) lln llt* ll3&  #llJ2K> . l   N)1* o   K8" @ # W =1 #& [[ .  l1 " < l1 0*}  #J  4>* . (Ziaee et al ., 2014) 0&     o a1 E21 k /    q  Zataria multiflora .*  L( N)1* 0 =2>*)) 4*&  >l D >2 :l/ l $ 2  > V a'M # * #(  dy ll)&/ ll1 & llG !ll . b P  * Boiss W l=1 #l& b l>& T*l &  `l~; & a *G lD & 0l() l1 Ll* ?$) . Emamjomeh et al ., (2017 ) .( .( Negahban et al ., 2007 )  *3) hlEM  0 l1P> .* lJ N)l1* 1 < \5 :*,* l  . # " ]D> # : .    !D  * #lJ2K> 0lD/ " . & > )PY & 1 " < 1 4l  o l$ 2 l > [ #)G N)1* M 0 =2>*)) 4l')* & lG !l #l j #l)G N)1* 0 =2>*)) x*5 Tween ®80, Ph Eur, JP, NF, ) ( : [ *)) l=ED" < l1 : €lG Ll* & . $l1& 0. a # 1 # ( 1130 g/M, Merck, GER 4*&  & lG !l $=. Q$;> RM*>  #)G N)1* [[[ Z[[  L*& N)1* ly 0& ( #l8 n&   & #8 n& & & Z ) #8 n& & & v;> W =1 #& [ Z >& & $ 2  > [[ a'M   2 ;  99%, ) (GMS) *‰$l1*)> `ll=  4l V N-ll1 . l & qln* 4$+l=)* .* & lG !l : <'= ;  RH ) $l1* 3$1&  (358.56 g/M, Merck, GER `lY  + $1eG dy 0&   # " &  45 0$1 ‚ƒ ‚ƒ ) #l8 n& & & ƒƒ 7ƒƒ  l$> $)l1 V[ lKn  $> $)1 b l" W l=1 #l& c[ l>& & ( # )t  & #8 n& & & T*ll .  4llD WXll1 4l V lJ #lM> & . l &*& *M 0 os #M> 7 7± l>& R>l . #l& V[ #l l>&   #g*  os GMS # c[ L " T*l . 4')* l> <1& # ! /" .  #g* c[ L "  GMS ! /" # al l> &*&l> Rl** & : ?@   -  >1( 3$l1& kl / l  #lg* l  . # Kn Kn \ # 0$l1 d*lY* .* M. longifolia #l)G      0>. package, IKA, T 18 basic ULTRA-TURRAX `> ) ,)€ #8 n& „H   *r `Y #& „  #8 n& 7 & ) &  45 [ [ > * #8 n& & & V[[[[ [[[[ #8 n& #l1 T* & ‡.)  #n1  † R R>   * F0< 0 2   E@ -,4  2 F^/  ‡G R5*& N-1 . ) )+(5 !1D> #"  ŠKll1  ll(>  ll *ll& ll1D R+ll : << C0 .) *3) W =1 #& 7„ >& &  , & ‹+lll1+ > 3$lll1& .* &E$lll1* lll 0 lll=2>* )) lu l #5l N)l1* # " < :  A BC            :  01. 


N-l1 . l &*& *ln & lG !l . kl a;" &j [ TEM (Transmission electron microscope), . lXj )$+2*

l\& Z 0 l=2>*))  2 J> N)1* Q$;>  <]^ ql."  l(> #l)*  *+" & 0 Laser light scattering (SEMATech) 3$l1& .* *s .*l)* dly @lG&  l #l$; dly @G& 0& \ .  &E$1* :ll>. & &E$ll1* &ll> ll 'D1 <=. (>. # / : JK IH -. GH l$ 2+ > Z/V V/V  /V [  c /  / l l * (/ a;" 0$l12 3l()*& .(/ +()*& 1D a1 3(>. & l$ 2 l l$ 2+ > V / c  /  V/  V/ V / `&J> ) #l& V ±  l>& R>l 3l(>. T* .  4')* V/V /V /V c/V / / c/V /V /V V/V  2ll J> N)ll1* *ll ( *ll . &l +" T*  \& [ Z± X=) < Y W =1 b c/ [  /  V/ cZ / c b/ `&llllJ> ) llll$ 2+ > & 0 ll1P> #ll " #ll vll > RllM*> #ll / L llDuall !l=M l \& Z 0 =2>*)) * ( * $ 2  $ 2+ > l :l/  8 89" 3(>. . ?DG  &> 0*, > .  4')* (/ +,-   8 89" #=1> & qn* l\&  @ l &l> l a;"   P &*J" ! "" # -      LKD I1  2 #l / . l #X19> Abbott (1925) `> fY .*  >  †> #l)G N)1* =ED" < 1 0&  <1& # * :    l *l . l 4l')* *l+" Z &  "  *  :>. a;"  P  #)G N)1* M \& Z 0 =2>*))  0 =2>*))  K8> o .  ]D> # (> *+"    " l(>. 4l')* l l *l$ * & lG ! #l$ l]) & 0 l=2>*))  l 0*lDj #l N) 1* 0 N)l1* )  " &  * :>. @ .  L J" ">8> .) Ql$;> RlM*>  ( N)l1* lM 0 l=2>*))  #)G     LKD I1  2 @ W1*  <]^ L J" .* NG . & # (> < $=. l\& Z 0 =2>*)) =ED" < 1 4*& :    -  l$> $)1 & Kn # \  F^ / Negahban et al . (2007) 0*Dj #

#l)G N)l1* l=ED" < 1 .* > <1& # ( LC 80  LC 50 ) V al'M #l * #(  dy @G& 0& \  F^/ .* l L l J" l kl /  .  4')* a'DlG Ll1 P &j [ &*J" N-1 .  &*& *n $ 2  > Fl^/  N)l1* lM 0 l=2>*))  2l J> N)1* kl / l .  R8$D> dy 0& # ( . k ) & G ! l *n .* NlG  l #l$; l$> $)1 & Kn # \  / V/Z  R>l N)l1* Ql$;>  <]^ <- G+ > #$l= al+9> * #(  dy @G& dy @G& 0& b c/ bb b/ V /  / `&lJ> ) $ 2+ > [   / P &lj [ &*J" & N)1* B" .* . k .* NG .  .  #$; \ F^/  ( * $ 2  $ 2+ >  / Vb Vb .* NlG  l #$; dy 0& & G ! a'DG L1 ,l ) l(/P :l>. & \& Z 0 =2>*))  <]^    * ) L .  @  &>  P &*J" ) l$2+ > [   V/ /  /Z /   * .* NG #/ )>. z/*M " X+ . &  "      Z ll ( *ll ll$ 2 ll ll$ 2+ >  /    / V / #l . *&* 6&()  (>  >  †> Œ & N)1* &. L l ;" 0 l=2>*)) ( N)l1* ) t> &> 0*, > !=M 0 &l ) #$l(^ .* NlG , ) . #1 :>. * `z> 0*Dj l P `l8$)* .* NlG * #(  dy @G& N-1 .  N)ll1*  0 ll=2>*)) .* llD J> . & .  #$= a+9> <
 789: ! $ 7 1 $ 56 +( : . -. -12 34

MN2 JC nl #$l= . #l1 > #  #$= a+9> dy @G& F0< 0 <2 <  E@< -,<4 @G&  ) #g* <  P > L* .* NG  )> *s ŠKll1 Oll2>  ll *ll& $5ll1 : << C0 &*lJ" dy .*l)* L 3) > . <1*  &*& 0()  R+ & 0 =2>*)) . l #Xl19> l >  †l> l\&  @  &>  P „ „ &lM l)$+2* ‹+1+ > T1" 0 =2>*)) *s 4l')* 4*& :l>. )>.  #\ # *  ) L 3$l1& .* &E$1*  *8> L* #/ 2M & .  & $>)) :l>. @  T*l ,l ) & .  $>)ll) Vb &llM Laser light scattering (SEMATech) &l> <]^ & L J" .* NG #/ ! "" L* # . & P # (> Ll* Tl1" *s *l)* ql." L lDu al .  &. L ;" kl al;" &lj [ &*J" & N)1* .* NG . k  ]) V.( V.( R+ )  L J" 3$1& lJ . ?DlG   R8$D> dy R5*& # & G ! .  @ l l() BlE" l al;" &*J" (Brindley, 1930) - <= <  < < LKD I1 *l lX+ . &  ) .  #X19>  >  †> \& 0l() l :>. .* R\M ?$) :    -   #l 0 l=2>*))  N)l1* 4*& 1 < , ) < a;" lM 0 l=2>*))  #l)G N)l1* l=ED" < l1 D & RlM*> `8$)* .* RXn dy @G& .  4')* #)* Y l f lK> . l > & G ! Q$;> RM*>  N)1* Rl5*& #  #) ) #+D* .* NG  & #$= e>/ < Q$;> l >  †l> \& < G  <]^ a$32  b   R+ 4l " &   #$= {*&'> dy @G&  #$; dy #l/ l & l> 0l() & lG !l a;"  a'DG L1  P l " l *l  :>. . )> n &=> > L* `Y Ql$;> l RM*> E" #l . l *l    * # ( 0 =2>*))  N)1* ) #$*& $5*D+ (*,* ) 0 0 =2>*))  #)G N)1* . .  4')* *+" Z & #)* Y l\& Z 0 l=2>*))  2l J> N)1* LC 50 0*, > . <1* #l v > PT 50  LC 50 &8> #X19> : - 3 N l & lG !l al;"  a'DG L1 P  0 . *  # "  . RM*> .* k  l &. L l ;" #M>  # v >  &*& < G #,'" $>*lG #Xl19> .* &E$l1* l &l8> Ll* #l=8> L Du a .( .( V    ` ) SPSS 16 *,l* 4) .* (Relative median potency) X=) < 1 (. SPSS, 2007 )  &E$1*

#)G N)1* 0 =2>*)) $51 .*  Xj )$+2* ‹+1+ >  m" P 7 O) Fig. 1. Transmission microscope images of Mentha longifolia oil nanoemulsion            :  01. 


25 Mean= 234 nm 20

15

10 Number (%) Number 5

0 1 10 100 1000 10000 Particle size (nm) #)G N)1*  M 0 =2>*)) *s q ."  .*)* L 3) > P Q O) Fig. 2. Mean of particle size and distribution of Mentha longifolia oil nanoemulsion

& G ! a'DG L1 P   N)1*  M 0 =2>*))  #)G N)1* =ED" < 1 LC 50   &8> 7P R +( Table 1. LC50 values for fumigant toxicity of Mentha longifolia oil and its nanoemulsion against Ephestia kuehniella 5th instar larva

Compound LC 50 (µl/l) Chi-square n df Intercept Slope±SE P-value Confidence limit 95% Lower Upper Essential oil 413.69 0.63 250 3 -3.86±0.62 1.47±0.24 0.88 319.7 554.1 Nanoemulsion 427.05 1.06 250 3 -4.04±0.66 1.53±0.25 0.78 334.4 563.7

& G ! a;"  N)1* M 0 =2>*))  #)G N)1* =ED" < 1 LC 50 &8> QP R +(

Table 2. LC 50 values for fumigant toxicity of Mentha longifolia oil and its nanoemulsion against Ephestia Kuhniella egg

Compound LC 50 (µl/l) Chi-square n df Intercept Slope±SE P-value Confidence limit 95%

Lower Upper Essential oil 75.03 0.69 250 3 -22.08±3.05 11.77±1.62 0.87 72.2 77.6

Nanoemulsion 93.98 1.21 250 3 -24.02±3.38 12.17±1.71 0.74 90.6 97.1

& G ! a'DG L1 P   0 0 =2>*))  #)G N)1* t*  >  †> < G P 8 O) Fig. 3. Probit of mortality of Mentha longifolia oil and its nanoemulsion effects on Ephestia Kuhniella 5th instar larva
 789: ! $ 7 1 $ 56 +( : . -. -12 34

& G ! a;"   0 0 =2>*))  #)G N)1* t*  >  †> < G P S O) Fig. 4. Probit of mortality of Mentha longifolia oil and its nanoemulsion effects on Ephestia Kuhniella egg

Q$;>   <]^ & & G ! Q$;> RM*>  N)1* M 0 =2>*))  #)G N)1* =ED" < 1 1 &  #X19> LC 50 #= 8> 8P R +(

Table 3. Comparison of estimated LC 50 for fumigant toxicity of Mentha longifolia oil and its nanoemulsion on different stages of Ephestia kuehniella at different concentrations

2 3 1 Stages Exposure time (day) LC 50 (µl/l) (NEO ) LC 50 (µl/l) (EO ) RMP 95% Confidence limits

Larva 1 427.05 413.69 1.03 0.72-1.50

Egg 5 93.98 75.03 1.25 1.15-1.40 1- RMP= Relative Median Potency 2- Nanoemulsion 3- Essential oil

. &l "Pl N)l1* .* l" Rl n 0*, l > # 0 =2>*)) #l LC 50 L l (RMP) Xl=) < l1 #Xl19> W1*  & l & 0 l=2>*)) tl> &> 0*Dj # N)1* :   *))  2 J> N)1* .* > <1& L l * N)l1* l #lK * & l>* . & )PY  ' " <]^ . de$5*

4*&  (LC 80 ) Pl <]^ & .( Z R+ ) & "/  q 1 ) de$l5* lD & 0l() l(/ al;" :l>. & 0*,l > L* >*

lG !l a'DG L1   P # j 0 =2>*)) =E D" < 1 NlG ! /" & L* .* > <1& # LC 50 &8> L *& DJ> N)1*  * *8> L * #+ 2M &  >')* `Y # .  & l" : l Dl(/ N)l1*  & :>. 0>. .* . Z .* N)l1* *l l$ 2 l $ 2+ > b / <]^ & . & .  .( ` ) <*& 0 =2>*)) # *))  o 0 .> <*) >*& 0 =2>*)) de5 - =       LKD I 1  "lE" Πl 0 l=2>*))     0*Dj # N)1* 0  2ll J> N)ll1* 4*& :  << << -  << 2 J> N)1*  0 =2>*))  * PT 50 0*, .> ()  (> & & a'DlG Ll1  l P   N)1*  M 0 =2>*))

. . <1* > b ` & *l l$ 2 l $ 2+ > LC 80 = / LC 50 =b / <]^ 4*&

& G ! a'DG L1 P # j N)1* M 0 =2>*))  #)G N)1* =ED" < 1 PT 50 &8> SP R +( th Table 4. PT 50 values for fumigant toxicity of Mentha longifolia oil and its nanoemulsion against Ephestia Kuhniella 5 instar larva Concentration PT compounds 50 Chi-square n df Intercept slope±SE P-value Confidence limit 95% (µl/l) (day) Lower Upper 1111.1 15.18 3.00 450 7 2.79±0.37 -2.36±0.33 0.88 13.46 17.70 Nanoemulsion 413.7 11.45 2.86 350 5 2.31±0.41 -2.18±0.40 0.72 9.92 13.62 1111.1 Essential oil 3.69 0.7 200 2 1.65±0.25 -2.94±0.40 0.71 3.13 4.33

100 NEO LC LC 80 100 50 EO 80 80 NEO NEO without oil EO 60 EO control 60 Water water 40 40 EO control NEO without EO (%) mortality Mortality (%) Mortality 20 20 0 0 0 10 20 30 40 0 10 20 30 40 Time (days) Time (days) LC 80  LC 50 <]^ & & & G ! P # j     " * # N)1* M 0 =2>*))  #)G N)1* =ED" < 1 4*& P T O) Fig. 5. Durability for fumigant toxicity of Mentha longifolia essential oil and its nanoemulsion

of oil with controls on Ephestia kuehniella larva at LC 50 and LC 80

LC 50 100 LC 80 NEO 100 EO NEO 80 80 NEO without EO EO 60 EO control 60 NEO without EO EO control Water 40 40 Water Mortality (%) Mortality Mortality (%) Mortality 20 20

0 0 0 10 20 30 40 0 10 20 30 40 Time (days) Time (days) LC 50  LC 80 <]^ & & & G ! a;"      * # N)1*  M 0 =2>*))  #)G N)1* =ED" < 1 4*& P 6 O) Fig. 6. Durability for fumigant toxicity of Mentha longifolia essential oil and its nanoemulsion

with controls on Ephestia kuehniella egg at LC 50 and LC 80


789: ! $ 7 1 $ 56 +( : . -. -12 34

& G ! a;"   N)1*  M 0 =2>*))  #)G N)1* =ED" < 1 PT 50 *8> TP R +(

Table 5. PT 50 values for fumigant toxicity of Mentha longifolia oil and its nanoemulsion against Ephestia Kuhniella egg Concentration PT Confidence limit compounds 50 Chi-square n df Intercept slope±SE P-value (µl/l) (day) 95% Lower Upper 92.6 14.44 1.04 300 4 6.19±0.87 -5.34±0.76 0.90 13.49 15.57

Nanoemulsion

75.03 12.60 0.28 300 4 5.03±0.81 -4.55±0.73 0.99 11.49 13.63 92.6 Essential oil 2.58 0.01 150 1 1.14±0.22 -2.78±0.44 0.91 2.10 3.16

& G ! Q$;> RM*>   N)1*  M 0 =2>*))  #)G N)1* =ED" < 1 1 &  #X19> PT 50 #= 8> 6P R +(

Table 6. Comparison of PT 50 of fumigant toxicity of Mentha longifolia oil and nanoemulsion of oil on different stages of Ephestia kuehniella

2 3 1 95% Confidence Stages PT 50 (day) (EO ) PT 50 (day) (NEO ) RMP limits

Larva 3.69 15.18 4.04 2.56-7.74

egg 2.58 14.44 5.10 2.82-12.73 1- RMP= Relative Median Potency 2- Essential oil 3- Nanoemulsion

& l/  *l l(*,* #l  :  *l  5*  `1 & 0 l=2>*))  #l)G N)1* .* &E$1* &>  <]^

l l @ 0*lDj #l 0&l/ #2l=-/)) l k D+"  LC 50 Z= [/ `&lJ> < a;" #M> * 0 .*  # "

 l  l N)l1* &l+ j &X < & 0 1P> &   R+l l f lK> . & * $ 2  $ 2+ > LC 80 V= / Ll* & . (Majeed et al ., 2015) <1*  &'* X /" 3& . D)> , ) (/ a;" :>. .* &E$l1*  #)G N)1* M \& Z 0 =2>*)) #J2K> '" 0 =2>*)) .* &E$1* .* J  a;"  >  †> ) 4*&  < l1  0 *lt*  l  2"  @ k  l(/ `Y #/ )>. > . &  `$D/ N)1* :   tl> &l> 0*lDj #l #l)G N)1* .  1 #)G N)1* <]^ &  >  †> \& Z[ # 0 =2>*)) t*   a;" Ll* l 2" & #l$ l/ #l * &*>  GMS 0 1P> . l L l J" . b bb/ Dl1 *l $ 2  $ 2+ > V / 0**)$=G *  & .1 <=. T 9>  3 ! /" L* & . & . Zc/V   * $>*G L* 2 J> N)1* * #l #"  . (Anandharamakrishnan, 2014) D > K5  o .* Rll\M ll >  †ll> 0ll > "llE" ,ll ) #llM>

l  l 2" ! /" 0 =2>* )) t> &> ' " :   PT 50 0*,ll > . ll()  ll(> N)ll1* 0ll 0 ll=2>*)) & G !   a;"   P   2Xn R n =ED" < 1 V [/ *l l$ 2  $ 2+ > Z [/ <]^ & 0 =2>*))

(/P #M> &  & LC 50 0*, .> &*& 0() &5 .* L* & 2 J> N)1* 0 =2>*)) de5 .  & . N)l1*  lM 0 l=2>*))  2l J> N)1* .* &E$1*  lE" 0*,l > . ?DG <F .* NG  & 4*& n <]^  b / l l * ! l "" #l  k l &,) 3  l+  #l  = 0*, > #X19> .( Z ` )  1 E\ # & G !  a;"

#l$ / # <]^ L "P . & * $ 2  $ 2+ > bV [Z/  N) lll1* PT 50 &lll8> 0lll > &*& 0lll() Xlll=) < lll1  / `&lJ>  # l(> ! l /" & l  * #M> L * &  (/P RM*> &  & #)G N)1* M 0 =2>*)) L lDu l ?  l$) .* . l &. L l ;" * $ 2  $ 2+ > .( ` ) &*& & *& DJ> de$5* < (/ a;"            :  01. 

& R. officinalis l #2l=-/+ > N)l1* :  ( \& < l\5  .* lJ N)l1* #/   > P 4*& . (Passino et al ., 2004 ) <1* &*&  . 7‚ `Y Z[ 0*, l > l(/ a;" #M> & . D/ hEM * &5 (/ (M  Ocimum americanum (L.) ll  #ll1 N)ll1* 0 ll=2>*)) Z [/ )  ll" L llG `O)ll)  (Nuchuchua et al ., 2009) Aedes aegypti L. #ll(G & . l>  c/ ) 0 =2>*)) Sitophilus granarius L. 4lD #(-  C. copitum N)1* l & l> 0l() #l/ &*& &l  l(> J2K> #K * L * Tribolium confusum Jacquelin du Val & #llll(-  < l1 2l J> N)l1* #l  (Ziaee et al ., 2014) &ll5 .* : ll>. .* NllG # ll 2* 0ll>. &  ll" all/ ll=ED"  Plodia interpunctella (Hübner) lD lG !l # j 0 ). "Pll ll=ED" < ll1 0*ll}  0llX3) . ll & ll> 0ll()

0 l1P> . ( Allahvaisi et al ., 2017 ) . > & * #D>& N)1* (LC 50 = 3.78 ppm) L( N)1* 1 " < 1 4*& :*,* ij 0 =2>*)) l #2l=-/)) N)l1* #l . 4l')* .* NG

G ! . b  P # j Zataria multiflora .*  l)&/ @*,l l1 2* <(G G ! # j  (LC 50 = 11 ppm) 0l L l889> L* . (Emamjomeh et al ., 2017) <1*  & lt* l1 D)> , )  3 & J2K> & . (Negahban, 2012) &l> &l l> ilj l  N)1* 0&/ #2=-/)) )&/ #l(-  (Jamal et al ., 2012)  Sithophilus oryzae (L.) ?)lll . &*& lgM l1 ?$)  #/ & > hEM > & #ll(-   0 ll ). N)ll1* ll>  -ll  2 0 ll1P> l  N)1* 0 =2>*)) )&*& 0() , ) 0*+  0 )Gu  ll #ll$  (Khademi, 2012)  Tribolium castaneum (H.) lXt **& W l=1 #& VZ >& & (neem oil) :u & #lu* lgM  l #l$  Wl1* . > <1& #  (>  r" #) Œ 0 . [ > #  &  P +,  0 l=2>*)) #l N)l1* l"/ 0>. > l #2=-/)) N)1* . ( Choupanian et al ., 2017 ) )> n 0l>. <F  >* &  " : < 1  **& N)1*  M hlEM  'l" :l  ilj , ) Rosmarinus officinalis l #l2> N)1* # N)1* D(/ 0*, > & T. castaneum & #l(- #l j N)l1* l=ED" < l\5 elj 0 =2>*)) k D+" L * D . <     a(u : / **& #l)G l  . (Khoobdeli et al ., 2017)  > )PY ilj l"/ 0l>. l> & N)l1* 1 < > hEM  *llt* . ll ll> 0*ll* Qll$;> M*ll) & &ll. :D/*llG 0 l=2>*)) . l 0 4*&   l)> #l" R n : *,*  lDD/&  l(/ al;" lD)> l  L* N)1* (/ (M &lX ilj l)*" l> lgM #J2K> @ fXY   2" l  0D/l" l=ED" < l1  , a;" )*&. f K> . & > )PY & N)1* x*5 hEM  &+ j Shakarami et al ., 2010; Akrami ) ' l"  2,) ) Negahban (2012) gM   #$   Œ l 0D/ " .( et al ., 2011; Saeidi and Moharramipour, 2013  tl" il9" * l1 2*  †> ) : /    0 lt*  #l)G N)l1* 0 1P> # "   * #J2K>  ("  4* G G [ ) #D>&  #2=-/)) N)1*  P <]^ 0 l=2>*)) L * `Xn R n t* . <1* () 4')* & G ! N)l1*  #lD>& 2l J> N)1* 4*& <]^ L * & . )&/  l 2" 0l+>* )*" > & G ! Q$;> RM*> `$D/   . l L l J" . Z   l l * ! "" #  #2=-/)) #l #"  / Y # .   ) a * * 0 1P> L * X)* Z ) 0*,l > L" : )&*& 0() 0*+  0 1G L D~

789: ! $ 7 1 $ 56 +( : . -. -12 34 k l D+" .* &E$1*  D    ‘Y & 0*" > L * D .  & & #l)G 2l J> N)l1* #lu l*  ? $) Dl(/ *lt* l  l N)l1* .* &E$1* L D~  )) lG !   D(/ < \5 <=)*"  P {X 8" <]^ .*   l= l  & ) 4*n*   1 `$D/ < & "P 0 l=2>*)) l\ # 0 0&/ #2> >* 6 #$*& & . . &/ #X^  `$D/ & N)1* .* &E$1*   < &9> : *,* , ) * 0 4*& N)1* D(/ *t* hEM  <=)*"

References

ABBOTT, W. S. 1925. A method for computing the Procedia Food Science, 1: 1666-1671. effectiveness of an insecticide. Journal of Economic EMAMJOMEH, L., S. IMANI, KH. TALEBI, S. Entomology, 18: 265–267. MOHARRAMIPOUR and K. LARIJANI, 2017. AKRAMI, H., S. MOHARRAMIPOUR and S. IMANI, Preparation of nanoemulsion formulation of essential 2011. Comparative effect of Thymus kotschyanus and oil of Zataria multiflora and comparison of contact Mentha longifolia essential oils on oviposition toxicity with pure essential oil on Ephestia kuehniella . deterrence and repellency of Callosobruchus maculates Entomology and Phytopathology, 85: 181-190. F. Iranian Journal of Medicinal and Aromatic Plants, GUPTA, A., H. B. ERAL, T. A. HATTON and P. S. 27: 2-10. DOYLE, 2016. Nanoemulsions: formation, properties ALLAHVAISI, S., K. TALEBI JAHROMI, S. IMANI and and applications. Royal Society of Chemistry, 12: M. KHANJANI, 2017. Efficacy of electrospun 2826-2841. bionanofibers as fumigant pesticides in foodstuff HILL, D. S. 2002. Pests: class insecta. p. 135–316. In: “Pests storage. Journal of Plant Protection Research, 57: 72- of Stored Foodstuffs and Their Control”. Kluwer 80. Academic Publishers, Springer, Malaysia, 453 pp. ANANDHARAMAKRISHNAN, C. 2014. Techniques for ISMAN, M. B. 2000. Plant essential oils for pest and disease Nanoencapsulation of Food Ingredients. Springer management. Crop Protection, 19 (8-10): 603-608. Briefs in Food, Health, and Nutrition pp. 1-69. JAMAL, M., S. MOHARRAMIPOUR, M. ZANDI and M. BOYER, S., H. ZHANG and G. LEMPERIERE, 2012. A NEGAHBAN, 2012. Efficacy of nanoencapsulated review of control methods and resistance mechanisms formulation of essential oil from Carum copticum in stored-product insects. Bulletin of Entomological seeds on feeding behavior of Plutella xylostella (Lep: Research, 102: 212-229. Plutellidae). Journal of Entomological Society of Iran, BRINDLEY, T. A. 1930. The growth and development of 33: 23-31. Ephestia kuehniella Zeller (Lepidoptera) and Tribolium JEMAA, J. M., N. TERSIM and E. BOUSHIH, 2013. confusum Duval (Coleoptera) under controlled Fumigant control of the mediterranean flour moth conditions of temperature and relative humidity. Ephestia kuehniella with the noble laurel Laurus Annals of Entomological Society of America, 23: 741- nobilis essential oils. Tunisian Journal of Plant 757. Protection, 8: 33-44. CHOUPANIAN, M., D. OMAR, M. BASRI and N. ASIB, KAVADIA, M. R., M. G. YADAV, A. A. ODANETH and 2017. Preparation and characterization of neem oil A. M. LALI, 2017. Production of glycerol nanoemulsion formulations against Sitophilus oryzae monostearate by immobilized Candida antarctica and Tribolium castaneum adults. Journal of Pesticide B lipase in organic media. Journal of Applied Science, 42: 158-165. Biotechnology and Bioengineering, 2: 1-7. DONSI, F., M. SESSA, H. MEDIOUNI, A. MGAIDI and KHOOBDELI, M., M. AHSAEI and M. FARZANEH, 2017. G. FERRARI, 2011. Encapsulation of bioactive Insecticidal activity of polycaprolactone nanocapsules compounds in nanoemulsion based delivery systems. loaded with Rosmarinus officinalis essential oil in            :  01. 



Tribolium castaneum (Herbst): Insecticidal activity of of Medicinal and Aromatic Plants, 29: 909-924.

nanocapsules. Entomological Research, 47: 175-184. NUCHUCHUA, O., S. USAWADEE, N. UAWONGYART, S. LAI, F., S. A. WISSING, R. H. MULLER and A. M. PUTTIPIPATKHACHORN, A. SOOTTITANTAWAT FODDA, 2006. Artemisia arborescens L. essential oil- and U. RUKTANONCHAI, 2009. In vitro loaded solid lipid nanoparticles for potential characterization and mosquito ( Aedes aegypti ) agricultural application: preparation and repellent activity of essential-oils-loaded characterization. American Association of nanoemulsions. American Association of Pharmaceutical Scientists, 7: 1-9. Pharmaceutical Scientists, 10: 1234-1242. MAJEED, H., Y. Y. BIAN, B. ALI, A. JAMIL, U. MAJEED, PASSINO, G. S., E. BAZZONI and M. D. L. MORETTI, Q. FARID, K. J. IQBAL, C. F. SHOEMAKER and 2004. Microcapsulated essential oils active against ZH. FANG, 2015. Essential Oil Encapsulations: Uses, Indian meal moth. Boletin de Sanidad Vegetal Plagas, Procedures, and Trends. The Royal Society of 30: 125-132. Chemistry, 5: 58449-58463. SAEIDI, M. and S. MOHARRAMIPOUR, 2013. Insecticidal MOHARRAMIPOUR, S. and M. NEGAHBAN, 2014. Basic and repellent activities of Artemisia khorassanica , and applied aspects of biopesticides. Plant Essential Oil Rosmarinus officinalis and Mentha longifolia essential and Pest Management. In: Sahayaraj, K. (eds) Basic oils on Tribolium confusum . Journal of Crop and Applied Aspects of Biopesticides. Springer, New Protection, 2: 23-31. Delhi, India, 384 pp. SEVEG, D., N. NITZAN, D. CHAIMOVITSH, A. ESHEL, MORETTI, M. D. L., G. SANNA-PASSINO, S. and N. DUDAI, 2012. Chemical and morphological DEMONTIS and E. BAZZONI, 2002. Essential oil diversity in wild populations of Mentha longifolia in formulations useful as a new tool for the insect pest Israel. Chemistry and Biodiversity, 9: 577-587. control. American Association of Pharmaceutical SHAKARAMI, J., M. FALAHZADEH and S. ALMASI, Scientists, 3: 1-11. 2010. Fumigation toxicity and oviposition deterrency NEGAHBAN, M. 2012. Insecticidal properties of of four plant essential oils on cowpea beetle. Plant nanocapsulated essential oil of Artemisia sieberi Besser Protection Journal, 2: 265-276. on Plutella xylostella and Tribolium castaneum. Ph.D. SHAKARAMI, J., L. POURHOSSEINI, R. VAFAEI- thesis, Faculty of Agriculture, Tarbiat Modares SHOUSHTARI and S. GOLDASTEH, 2008. Ovicidal University. 173 pp. effect of three plant essential oils on Callosobruchus NEGAHBAN, M., S. MOHARRAMIPOUR and F. maculatus F. (Col., Bruchidae). Journal of SEFIDKON, 2007. Fumigant toxicity of essential oil Entomological Research, 3: 221-228. from Artemisia sieberi Besser against three stored- SPSS, 2007. SPSS 16 for Windows User’s Guide Release, product insects. Journal of Stored Products Research, Spss Inc, Chicago. 43: 123-128. TOPUZ, O. K., E. B. OZVURAL, Q. ZHAO, Q. HUANG, NEGAHBAN, M., S. MOHARRAMIPOUR, M. ZANDI and M. CHIKINDAS and M. GULUKCU, 2016. Physical S. A. HASHEMI 2013a. Efficiency of and antimicrobial properties of anise oil loaded nanoencapsulated essential oil of Artemisia sieberi nanoemulsions on the survival of foodborne pathogens. Besser on nutritional indices of Plutella xylostella. Food Chemistry, 203: 117-123. Iranian Journal of Medicinal and Aromatic Plants, 29: ZIAEE, M., S. MOHARRAMIPOUR and A. 692-708. MOHSENIFAR, 2014. Toxicity of Carum copitum NEGAHBAN, M., S. MOHARRAMIPOUR, M. ZANDI and essential oil-loaded nanogel against Sitophilus S. A. HASHEMI 2013b. Repellent activity of granarius and Tribolium confusum . Journal of Applied nanoencapsulated essential oil of Artemisia sieberi Entomology, 138, 763:771. Besser on Plutella xylostella L. larvae. Iranian Journal              

Eurygaster integriceps              

(")  * 
   !"# $%&' 6))  6)! 31% 4!  53- * *+! 6-3( 12 ./0   * *+! ",(-  #$%  &'() !! " (? &)&- : 5 => 8 ! <  91;&) : 9 & 8 ! ) - - +, &3 C( K& K " "2 9() F$ LM)& 9 2 J  6 GH- )I)  Eurygaster integriceps F$ A B- C( D E  6 3 3) . "2 M - ;( 6 6& " P)/  S/M T*'M)  "M)& & &U M & BOP 6&   C( Q-2 D1R   > . & - 6  "M)& M3  &E 5 & "  "M)& &3 C( K& .   - X 2 6  )MM W)U   U 9 J 2 6 T;M &.  "/V! F $ LM)& C! &3 C( F$  "M M 3) - & LM M YYZ &)B! .  FVM) 5 & C) 6 - LO )  ",*-  ) 1-3  ( C) & . & - ";(+- 9P&   3)! 3)  "M)& C3! & .  X-3 ( YZ × ) 6'(A  ( Y_ × ) C/P  _( × ) ]))  6'() & [P) U /2- "( " \B'- 3) F -  d 63 C cM -  SA(  "M)& 2b ."  9)&& S A(  &3 C(  "M)& 63  &)B! a .J! "  &J'() F -  /_   M3  &E 5 C  "M)& &3 C( K& )& $B- J! &  . M& ! c$( C F - _ 63 C cM -  &3 C(  "M)& K& x 6 & "2  y = 0.8374x + 0.02 LA&B- 3) &J'()  .( r = 0.98, P < 0.0001 ) 9)& & 5 & C) 6 - )& $B- 9;e- c',; & TR . &)& & c& 5 " &3 C(  "M)& 63  &)B!  5 3) a Q;! 6.-) 9() &3 C( M3 K& y   &E . . &)& ! 9E(  &( f+A " M3 D  & 5 & L,*- .Eurygaster integriceps F$ &3 C( LM)& : /0  -.

Evaluation of the relationship between numerical and weight percentage of kernel damaged by sunn pest, Eurygaster integriceps

J. MOHAGHEGH
and A. ABOLHASSANI Professor & Technician, Respectively; Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (ARREO), Tehran, Iran Abstract One of the major damage of sunn pest, Eurygaster integriceps , is its destructive effects on the quality of wheat grains, which is known as sunn pest kernel damaged. Nymphs and adult of the bugs inject salivary glands enzymes by piercing-sucking mouthparts into the grains, which degrade glutens, reduce dough and bread wheat quality. Grain damage percentage is calculated by the both numerical and weighing methods. In this research, an experiment was conducted to compare the relationship between these two methods. We measured 225 damaged wheat grain samples delivered from Arak ( n = 30 × 3), Ghazvin ( n = 20× 3) and Lorestan ( n = 25× 3). A digital scale with 0.1 mg precision was used to weigh kernels. For these samples, the number and weight of damaged and undamaged grains were recorded. In general, undamaged kernels with an average weight of 34 mg were heavier than damaged ones with average weight of 30 mg. Although, there was a significant difference between the numerical and the weight values, a significant positive correlation ( r = 0.98; P <0.0001) was detected between the two methods. By using the equation y = 0.8374x + 0.02, where x and y are the numerical and weight values, respectively, we are able to convert values from a given method to another one. However, the weighing method is advantageous in terms of simplicity and speed. Key words: Damaged kernel, Eurygaster integriceps, wheat.

Corresponding author: [email protected] Eurygaster integriceps               : (")     !"#



5=g> Qg P Sg % Z g! ) "M)& &3 C( 6)/ - 6$ s> # !#  Igg! "gg tgg - ggBAO- & . (Critchley, 1998) gg$M)& gg- Fggg$ Aggg B- Cggg( .ggg ggg 6ggg3 3) ggg. Ag B- Cg( &g- & "gq Fg$ LM)& 9 J 2 & &3 C( Fg$ LM)& 9 J 2 " 6 GH- )I) Eurygaster integriceps ";g(+- gK) 5 Fg$ g Cg( ( & "q  F$ Mg & BOP 6&   C( Q-2 ) 1R   > . 9() Every, 1992; Karababa and Ozan, 1998; ) 9() &E K& "g2 Mg g- ;g( gP)/ g S/M T*'M)  "M)& & &U

.Askarianzadeh, 1999; Bahrami et al. , 2003; Ghannadha and )MM W)U f+A " ) &U !)h 9 J 2 F$ LM)& C! 9g() uO- T)( C) 6$2) .( Ayeeneh, 2003; Dizlek, 2017 Kretovich, 1944; Paulian and Popov, 1980; ) g  9(& 3) &ggE  ggM3 ggK & ggM  6)/gg - & !ggJ! gg "gg2 "g gJ 2 g( g )g "g2 9g() ij) .( Dizlek, 2017 Cg) ) H(> T;M& " X s> C) v&)& & &3 C( "   "M)& 3) "=k! ) M3 f+A " F$  "M)& . . 9() X(> g )U ) ) "glRm- Qg P GgH- )gI) Sg 2 f+A . (Paulian and Popov, 1980) 9)=  $ 2 Q+! Fc$ 6)312 "nM C(  63 )I) lM 3) /g2- "g( "g \B'- &3 C( F$  "M M 3) a 3) gK& $'g, "g)- 6 g  g(  gU /g2)- " F$ _  _ g !! " 6'(A  C/P ]))  6'() & [P) U D g g- &)M'g() C3)g- \ gO- . 9( "M)& &3 C(  -K LM M  3) .  " ! - w. "M M YZ  Y_  &g Tg;P Q P % Y 6)/ - ! F$  "M)& &3 C(  _d "2 b "  "' - _ LM M "( &)B! &U " M " . (INSO-104, 2012) g$2 g M 6g$$2 A! "'- ) j tg - g "gM M C) . - 9(& " "M M YYZ &)B! xE V-  ggK& "gg,*- & 6)gg.  &)3 6.gg,E ggBAO- g "gM M 3) . gM&  T( & "M)  "A +- " Fg$ FgP) )g  gK& Y   Z d  Y _ : &3 C( Fggg$ ggg y ggg "gggM)&  ]gggU )ggg' )  ggg- &  "M)& &3 C( T;P Q P R 6-  C  -) )&(  5 g SAg(  &3 Cg( g "gM)& a .J! " z0( ) . (Askarianzadeh et al. , 2008) M) &2 5)/ K& & ) 3)g! ag 2 "g g &  "M)& C $n .  9)&& & "g! &g- Qpg,- 3) g. K& C B! cMcq agg 9ggP& gg Sartorius TE214S (Goettingen, Germany)  &)3 6.g,E "gnM . 9g() Fg$  "M)& &3 C( LA*- . .  9;I  C3! F F)/ & K& #()  M&2 rH1- &U  ( & 6). Qg+- & "g2 9g() ) "gM)& &3 Cg( LM)& {B! \ O- & g E g$;- "g2 "gnM g-) . &g &3 C(  "M)& &E "g.A |( & "2 & > }M - L.A ))& C( L=k! gU /g2)- ;g(+-  _d g- &)M'g()  rU 9g() C( L=k! Q+- 6 "2 }M  ( LO*M a ~))& / M 9;,M &3 C(  "M)& M3 K& &)& )P   (  F$ Kretovich, 1944; Paulian and Popov, 1980; ) gg gg- C g$n . (INSO-104, 2012) 9g() F$  "M)& Q2 63 " &ggE  ggM3 ggK& .( Javahery, 1995; Critchley, 1998 C'g C g 3) ;g( ) g&3 Cg( K& & 3) X aA/& €g V- "g g 6 63  &)B! 3) !! " &3 C(  "M)& . (Dizlek, 2010) 9gg() &gg M 6gg Fgg$ )MggM W)ggU . . - 9(& " &3 C(  SA(  "M)& 63  &)B!  g! Y C g C -g+A)  % /Y 6)/ - / M 6).  Tm 6 3) g&3 C( &E  M3  K& LO ) C B! ) gM) &g M gB- Tg;P Qg P R )  "M)& &3 C( K& SAS )/g) FgM   Pearson 5  c',; - L/V! 3) U  -) . (El-Haramein et al ., 1984; Canhilal et al. , 2005)

 :<=> $;8 9 : - 38 9 67 /' :     3   45*

  Tg & &3 Cg(  SA(  "M)& C - L,*- 3) &3 Cg(  SA(  "M)& C - L,*- .&  &J'() d d 63 g SAg( g "gM)& 2gb ." 9()  &)& 61M gK&  &gE gK& C g g- L,*- )  t 6-3 _ _ 63 C cMg - g &3 Cg( g "gM)& "g 9;g,M Fg  - 9() 2h " F3‚ .  &J'() paired t-test 3)  &3 C( M3 & & g&3 Cg( gK& &g . gM& ! C c$( F  - .& SP wH1- P F$ K)  "A +- "2 "g2 gb "g &g;M 6g,. cg.  M3  &E 5 5 & Cg) C g (paired sample t-test) g 9J t 6- 3 A"   ? @ &g .( T ) ( P<0.001 ) &)& 61M ) )& $B- J!  gP 9;e- &3 C( M3  &E K& C LO ) 3) 'g1 g 2 )g &gE 5 & g&3 Cg( gK& C) cM  Q. . - 9( (r = 0.98; P < 0.0001) )& $B- g g( & &g- Cg) . 9g() M3 5 & 6 & g&3 C( M)) ( &-  "M M & .  - "O )  (Mardoukhi and Heidari, 1993) ~ggg R  gggU&- . & K& 9J ! JK a&/M D&+- & '1  "M)& Dizlek and ) 9g()   1- P-m()  aA/ & C $n ggK& C gg ggOU 6 gg( LggA&B- . ( Islamo ğlu, 2010 25 gggK "ggg gggM3  &gggE 5 & & ggg&3 Cggg( 20

 &gE K& x 6 & "2 . - 9(& " y = 0.8374x + 0.02 15

. . 9() &3 C( M3 K& y 10 y = 0.8374x + 0.02 5 r = 0.98 C g B! g$;- 6)cg1 s> BAO- & "2 &E K& n = 225 0 . 9() 5=> &-   "'U$ 5 9() & &3 C( percentage damage Weight 0 10 20 30

/g2)- & ) 6 & g2  gM3 5 9Ag( &g C)  Numerical damage percentage &g g /g M "g 2! & . 9() & M Q ,!   (  U &E 5 c.   6 9 ;  5 & C) L,*- . F$ ~ "M)& &3 C( M3  ~&E K& 6 - c',; :C B+8 Fig. 1. Correlation between numerical and weight damage . . (Dizlek and Islamo ğlu, 2010) 9()  6 !& 'E) Q P percentage in wheat kernels.

. . &3 C( M3  ~&E K&  F$ D&3 C(  SA( LM)& 63 L,*- :C D ' Table 1. Comparison between the weight of undamaged and damaged wheat kernels, and numerical and weight damage percentages.  F &G  E # t-value df P Kernel type Mean ± SE &3 C( 30.1 ± 0.25 Damaged (n=210) ($ / # )  H 3.192 227.6 0.002 Kernel weight (mg) SA( 34.7 ± 0.25 Undamaged (n=225)

~&E K& 3.28 ± 0.25 (n=210)    Numerical % 8.258 209 <0.001 Damaged % M3 K& 2.77 ± 0.22 (n=210) Weight %

Eurygaster integriceps               : (")     !"#



9;g,M "g 3g M &g- 6g-3  9A( f+A " M3 5  ggM3 ggK& 6gg - "gg,*- & P-mgg()  aggA/&   g(  gU /g2)- & g)) Qg-)E 3) g' 2 9P Xg & ( K& !Z  3) &3 C(  "M)& ) &3 C( &E & g 5 Cg) 3) &J'g() & - &3 C( & „K 3) g' 2 )g gM3 gK& & "2 $'& F$ SP .9() XH 6$ b) & &)- C')& lM  6 D "p))  &)& 3) &J'()  . 9() &E K& 6)/ - gK& x) g- 9g(& " y = 0.878x - 0.0328 LA&B- ( n = )  LEM .( Y Q. ) ( &3 C( M3 K& y  &E

3) ) g$ M C gB- #g$- gP . 3) " ( C 5 &. &. - M)&P  .1! ( 12 !;M JR 6-3( 4 3

2 y = 0.878x - 0.0321 r = 0.99 References 1 n = 36 0 ASKARIANZADEH, A. R. 1999. An investigation on Weight damae percentage damae Weight 0 2 4 6 protein, reology and baking quality of improved wheat Numerical damage percentage varieties damaged by cereal sunn pest E. integriceps . MS thesis Tarbiat Modarres University. ~g "gM)& g&3 C( M3  ~&E K& 6 - c',; KC B+8 ASKARIANZADEH, A., N. RAJABZADEH and A. .( .( Dizlek and Islamo ğlu, 2010 3)  &)& ) F$ ABDOLLAHI, 2008. Injury effects of cereal sunn pest Fig. 2. Correlation between numerical and weight damage Eurygaster integriceps Put. in wheat varieties on the percentage in wheat kernels (data from Dizlek and Islamo ğlu, 2010). baking properyies and suggested methods to improve

their quality. Journal of Agronomic Science 1: 45-56 (In Persian with English summary). " g1-  g, "gA&B- Cg) & - "lRm- "2 "McM BAHRAMI, N., GH. RADJABI, M. REZABEIGI and K. 9g)& "!  "';A) . 9() jR X s> 3) QKR LA&B- KAMALI, 2003. Study on economic injury level of 9g BP- C g gJ! ;g( "g gM)! -  J! 3) U Sunn pest ( Eurygaster integriceps Put.) on wheat in rainfed field of Kermanshah province. Applied g ) & ( gjR LBAO- ) U /2)- 3) )& "M M B ;b Entomology and Phytopathology 70:29-44 (In Persian cg1-3 & Qg-2 g "M)& & &3 C(  K& S l$! with English summary). g &)& "g2 6 g! Sg- . g ( P-m()  aA/& LBAO- ) CANHILAL, R., H. KUTUK, A. D. KANAT, M. ISLAMULU, F. El-HARAMEIN and M. El- g&3 Cg(  gK& C cMg - $;- & 6)c1 s> BOUHSSINI, 2005. Economic threshold for the sunn &J'g() gK) g &)& 3) jR X s> & ".M TR & pest, Eurygaster integriceps Put. (Hemiptera: . 9()  Scutelleridae), on wheat in southeastern Turkey. 6g - g "gM)& g&3 C( K& )& $B- J! &  Journal of Agricultural and Urban Entomology 22: 191-201. C g )& $B-  P 9;e- c',;  M3  &E 5 CRITCHLEY, B. R. 1998. Literature review of sum pest gK & & 2 l$- 3) C) $ . 9)& & 5 & C) Eurygaster integriceps Put. (Hemiptera, Scutelleridae). 3) .  &3 C( &E K& cM U " M)! - M3 Crop Protection 17: 271-287. DIZLEK, H. 2010. A study on the determination of the some 3) agg gg Qgg;! 6gg.-) ‚gg LggA&B- 3) &J'gg() gg ggb characteristics of sunn pest damaged bread wheats and & "g2 VM 3) . &)& & c& 5 " &3 C(  5

 :<=> $;8 9 : - 38 9 67 /' :     3   45*

possibility of improving conditions. Ph. D. Dissertation, INSO-104, 2012. Cereal and cereal products, wheat, University of Çukurova, Turkey. specification and test methods. Retrieved May 7, 2018, DIZLEK, H. 2017. The effects of sunn pest ( Eurygaster spp.) from http://standard.isiri.gov.ir/StandardView.aspx?Id sucking degree in grain on wheat quality =36452. characteristics. Romanian Agricultural Research, No. JAVAHERY, M. 1995. A technical review of sunn pests 34: 1-11. (Heteroptera: Pentatomoidea) with special reference to DIZLEK, H. and M. ISLAMO ĞLU, 2010. Comparison of Eurygaster integriceps Puton. FAO/RNE. methods for determination of suni bug damage ratio in KARABABA, E. and A. N. OZAN, 1998. Effect of wheat wheat commodity used in our country. Ziraat Fakültesi bug ( Eurygaster integriceps ) damage on quality of a Dergisi, Uluda ğ Üniversitesi 24: 81-90. wheat variety grown in Turkey. Journal of the Science EL-HARAMEIN, F. J., P. WILLIAMS and A. RASHWANI, Food and Agriculture 77: 399-403. 1984. A simple test for the degree of damage caused in KRETOVICH, V. L. 1944. Biochemistry of the damage to wheat by suni bug (Eurygaster spp.) infestation. Rachis grain by the wheat-bug. Cereal Chemistry 21: 1-16. 3: 11-12. MARDOUKHI, V. and M. HEIDARI, 1993. Study on EVERY, D. 1992. Relationship of bread baking quality to variations of population density and damage of sunn levels of visible wheat-bug damage and insect pest (Eurygaster integriceps Put.) in dry rain-fed area proteinase activity in Wheat. Journal of Cereal of Kurdestan. Applied Entomology and Science16: 183-193. Phytopathology 60: 29-41 (In Persian with English GHANNADHA, M. R. and S. AYEENEH, 2003. Evaluation summary). of sunnpest resistance in wheat. Iranian Journal of PAULIAN, F. and C. POPOV, 1980. Sunn pest or cereal bug. Agricultural Sciences 34: 769-783. (In Persian with Pp. 69-74 in Ciba-Geigy. Wheat documenta. Basle, English Abstract). Switzerland.

Eurygaster integriceps               : (")     !"#