DOCSLIB.ORG

Supplementary Table 2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 2 List of 608 Alternative Splice Variants identified including both known and novel proteins by MPPI analysis Variant ID Protein Description Mgi Sample Unique type Symbol type peptide found ENSMUSP00000046910 known selenoprotein tumor yes ENSMUSP00000032899 known RIKEN cDNA 1110004F10 1110004F10Rik tumor yes ENSMUSP00000101665 known RIKEN cDNA 1190003J15 1190003J15Rik tumor no ENSMUSP00000059932 known RIKEN cDNA 2610016E04 2610016E04Rik normal no ENSMUSP00000110537 known RIKEN cDNA 2610018G03 2610018G03Rik tumor no gb|EDK99196.1| known AP2 associated kinase 1 aak1 tumor no ENSMUSP00000086948 known AP2 associated kinase 1 Aak1 tumor yes ENSMUSP00000108104 known abhydrolase domain containing 14b Abhd14b both no ENSMUSP00000042351 known acetyl-Coenzyme A acyltransferase 1A Acaa1a both yes ENSMUSP00000020843 known acetyl-Coenzyme A carboxylase alpha Acaca normal no ENSMUSP00000018718 known acyl-Coenzyme A dehydrogenase, very Acadvl normal yes long chain ENSMUSP00000099634 known acyl-Coenzyme A dehydrogenase, very Acadvl normal yes long chain ENSMUSP00000007131 known ATP citrate lyase Acly both no ENSMUSP00000100038 known aconitase 1 Aco1 both no ENSMUSP00000072322 known acyl-CoA thioesterase 5 Acot5 tumor no ENSMUSP00000106509 known acid phosphatase 1, soluble Acp1 tumor no ENSMUSP00000015160 known acyl-CoA synthetase family member 3 Acsf3 normal yes ENSMUSP00000106000 known acyl-CoA synthetase long-chain family Acsl1 normal no member 1 ENSMUSP00000108524 known acyl-CoA synthetase long-chain family Acsl4 tumor no member 4 M5C12606_13_s605_e1808_1 novel actin, beta, cytoplasmic Actb tumor yes _rf1_c1_n0| ENSMUSP00000098066 known actin, beta Actb tumor no ENSMUSP00000031564 known actin, beta Actb both yes ENSMUSP00000087736 known actin, alpha, cardiac muscle 1 Actc1 both no ENSMUSP00000087043 known actin, gamma, cytoplasmic 1 Actg1 normal no M11C14232_5_s89_e1262_1_r novel actin, gamma 1 Actg1 tumor no f1_c1_n0| intron ENSMUSG00000074978|ENS novel actin, gamma, cytoplasmic 1 Actg1 both yes MUST00000099636|NULL_s2 _e1124_1_rf0_c1_n0| ENSMUSP00000071486 known actin, gamma, cytoplasmic 1 Actg1 both no ENSMUSP00000074658 known actin, gamma 2, smooth muscle, enteric Actg2 both no ENSMUSP00000067708 known actinin alpha 2 Actn2 normal yes ENSMUSP00000008966 known acylphosphatase 1, erythrocyte Acyp1 tumor no (common) type ENSMUSP00000047665 known adenosine kinase Adk tumor yes ENSMUSP00000050076 known adhesion regulating molecule 1 Adrm1 tumor yes ENSMUSP00000021726 known adenylosuccinate synthetase like 1 Adssl1 normal no ENSMUSP00000090633 known AHNAK nucleoprotein (desmoyokin) Ahnak both yes ENSMUSP00000020017 known absent in melanoma 1 Aim1 tumor no ref|NP_765981.2| known absent in melanoma 1 Aiml tumor no ENSMUSP00000108902 known adenylate kinase 1 Ak1 both no ENSMUSP00000099664 known adenylate kinase 2 Ak2 both no ENSMUSP00000035829 known A kinase (PRKA) anchor protein (gravin) Akap12 both yes 12 ENSMUSP00000100045 known aldo-keto reductase family 1, member B3 Akr1b3 both yes (aldose reductase) ENSMUSP00000103068 known aminolevulinate, delta-, dehydratase Alad both no M5C6439_110_s2_e902_1_rf2 novel albumin Alb both no _c1_n0| deletion M5C6439_135_s278_e851_1_r novel albumin Alb both yes f0_c1_n0| M5C6439_12_s86_e356_1_rf2 novel albumin Alb1 both yes _c1_n0| ENSMUSP00000065089 known aldehyde dehydrogenase family 7, Aldh7a1 tumor no member A1 ENSMUSP00000032934 known aldolase A, fructose-bisphosphate Aldoa both no M7C11435_34_s299_e1256_1 novel aldolase a Aldoa tumor yes _rf0_c1_n0| ENSMUSP00000017534 known aldolase C, fructose-bisphosphate Aldoc both no M11C7819_3_s149_e1250_1_r novel aldolase c Aldoc tumor yes f2_c1_n0| ENSMUSP00000099990 known acidic (leucine-rich) nuclear Anp32b tumor no phosphoprotein 32 family, member B ENSMUSP00000103015 known alanyl (membrane) aminopeptidase Anpep tumor no ENSMUSP00000025561 known annexin A1 Anxa1 both yes ENSMUSP00000108609 known annexin A3 Anxa3 normal no ENSMUSP00000031447 known annexin A3 Anxa3 tumor yes ENSMUSP00000001187 known annexin A4 Anxa4 both no ENSMUSP00000018484 known annexin A6 Anxa6 both no ENSMUSP00000099788 known annexin A6 Anxa6 both yes ENSMUSP00000098405 known annexin A7 Anxa7 both no ENSMUSP00000099394 known amine oxidase, copper containing 3 Aoc3 both yes ENSMUSP00000105523 known adaptor protein complex AP-1, beta 1 Ap1b1 tumor no subunit ENSMUSP00000103489 known adaptor protein complex AP-2, alpha 1 Ap2a1 tumor yes subunit ENSMUSP00000082519 known adaptor protein complex AP-2, alpha 1 Ap2a1 tumor yes subunit dbj|BAA00767.1| known apolipoprotein a1 Apoa1 both yes ENSMUSP00000106951 known apolipoprotein A-II Apoa2 both no M9C3535_1_s2_e716_1_rf2_c novel apolipoprotein A-IV apoa4 normal yes 1_n0| ENSMUSP00000113058 known apolipoprotein C-III Apoc3 normal no ENSMUSP00000102621 known ADP-ribosylation factor 2 Arf2 tumor no ENSMUSP00000022429 known ADP-ribosylation factor 4 Arf4 tumor no ENSMUSP00000063714 known Rho GDP dissociation inhibitor (GDI) Arhgdia both no alpha M11C14328_14_s248_e947_1 novel Rho GDP dissociation inhibitor (GDI) Arhgdia tumor yes _rf0_c1_n0| alpha ENSMUSP00000107522 known Rho, GDP dissociation inhibitor (GDI) Arhgdib both no beta ENSMUSP00000079246 known ADP-ribosylation factor-like 1 Arl1 tumor no ENSMUSP00000082822 known actin related protein 2/3 complex, Arpc1b tumor no subunit 1B ENSMUSP00000109450 known actin related protein 2/3 complex, Arpc2 tumor no subunit 2 ENSMUSP00000106047 known N-acylsphingosine amidohydrolase 1 Asah1 tumor no ENSMUSP00000104485 known ATX1 (antioxidant protein 1) homolog 1 Atox1 both no (yeast) ENSMUSP00000095072 known ATPase, Na+/K+ transporting, alpha 2 Atp1a2 tumor no polypeptide ENSMUSP00000104124 known ATPase, Ca++ transporting, ubiquitous Atp2a3 normal no ENSMUSP00000026495 known ATP synthase, H+ transporting, Atp5a1 normal yes mitochondrial F1 complex, alpha subunit, isoform 1 ENSMUSP00000110396 known ATP synthase, H+ transporting, Atp5a1 tumor no mitochondrial F1 complex, alpha subunit, isoform 1 ENSMUSP00000003156 known ATP synthase, H+ transporting, Atp5d both no mitochondrial F1 complex, delta subunit ENSMUSP00000110314 known ATPase, H+ transporting, lysosomal V1 Atp6v1a tumor no subunit A ENSMUSP00000103724 known BCL2-associated athano 1 Bag1 tumor no ENSMUSP00000112524 known brain-specific angiosis inhibitor 2 Bai2 both no ENSMUSP00000070682 known HLA-B-associated transcript 1A Bat1a tumor no ENSMUSP00000084529 known HLA-B-associated transcript 3 Bat3 tumor no ENSMUSP00000097622 known BCL2-associated transcription factor 1 Bclaf1 tumor no ENSMUSP00000111462 known bridging integrator 1 Bin1 both no ENSMUSP00000043092 known biliverdin reductase B (flavin reductase Blvrb both yes (NADPH)) ENSMUSP00000099801 known basic transcription factor 3-like 4 Btf3l4 both no ENSMUSP00000110293 known carbamoyl-phosphate synthetase 2, Cad tumor no aspartate transcarbamylase, and dihydroorotase ENSMUSP00000110673 known caldesmon 1 Cald1 both no ENSMUSP00000001204 known calmodulin 1 Calm1 both yes ENSMUSP00000087967 known calumenin Calu both yes ENSMUSP00000031779 known calumenin Calu tumor yes ENSMUSP00000101862 known CAP, adenylate cyclase-associated Cap1 both no protein 1 (yeast) ENSMUSP00000109705 known capping protein (actin filament), Capg both no gelsolin-like ENSMUSP00000106631 known calpain 2 Capn2 normal no ENSMUSP00000106777 known cell cycle associated protein 1 Caprin1 tumor no ENSMUSP00000030519 known capping protein (actin filament) muscle Capzb both no Z-line, beta ENSMUSP00000065275 known calpastatin Cast both no ENSMUSP00000028610 known catalase Cat both yes ENSMUSP00000111116 known caveolin 1, caveolae protein Cav1 normal no ENSMUSP00000026148 known carbonyl reductase 2 Cbr2 both yes ENSMUSP00000018810 known chromobox homolog 1 (Drosophila HP1 Cbx1 both no beta) ENSMUSP00000031862 known chromobox homolog 3 (Drosophila HP1 Cbx3 both no gamma) ENSMUSP00000109289 known cysteine conjugate-beta lyase 1 Ccbl1 tumor no ENSMUSP00000054634 known cell division cycle 42 homolog (S. Cdc42 tumor yes cerevisiae) ENSMUSP00000112216 known carnitine deficiency-associated Cdv3 both no expressed in ventricle 3 ENSMUSP00000096269 known carcinoembryonic antigen-related cell Ceacam1 tumor no adhesion molecule 1 M8C7190_6_s53_e1784_1_rf2 novel carboxylesterase 1 Ces1 tumor yes _c1_n0| ENSMUSP00000066677 known complement component factor h Cfh tumor no ENSMUSP00000064557 known cofilin 1, non-muscle Cfl1 normal yes ENSMUSP00000112259 known cofilin 1, non-muscle Cfl1 tumor no M12C3203_3_s2_e476_1_rf2_ novel cofilin 2 cfl2 normal no c1_n0| intron insertion M7C1514_4_s2_e1334_1_rf1_ novel UTR creatine kinase, muscle Ckm tumor no c1_n0| ENSMUSP00000000317 known creatine kinase, mitochondrial 1, Ckmt1 tumor no ubiquitous ENSMUSP00000103477 known clathrin, light polypeptide (Lca) Clta both no M11C9065_6_s2_e749_1_rf1_ novel clathrin, heavy polypeptide Cltc tumor yes c1_n0| ENSMUSP00000099475 known clathrin, heavy polypeptide (Hc) Cltc tumor no ENSMUSP00000085703 known citrate lyase beta like Clybl normal no ENSMUSP00000109249 known cellular nucleic acid binding protein Cnbp both no ENSMUSP00000025546 known CNDP dipeptidase 2 (metallopeptidase Cndp2 both yes M20 family) ENSMUSP00000101013 known calponin 2 Cnn2 tumor no M4C2149_6_s2_e230_1_rf0_c novel ciliary neurotrophic factor receptor Cntfr tumor yes 1_n0| ENSMUSP00000112604 known collagen, type XII, alpha 1 Col12a1 tumor no ENSMUSP00000109237 known coatomer protein complex, subunit Copg tumor yes gamma ENSMUSP00000072095 known coatomer protein complex, subunit zeta 1 Copz1 tumor
Load more

Recommended publications
  • Supplementary Materials
    DEPs in osteosarcoma cells comparing to osteoblastic cells Biological Process Protein Percentage of Hits metabolic process (GO:0008152) 29.3 29.3% cellular process (GO:0009987) 20.2 20.2% localization (GO:0051179) 9.4 9.4% biological regulation (GO:0065007) 8 8.0% developmental process (GO:0032502) 7.8 7.8% response to stimulus (GO:0050896) 5.6 5.6% cellular component organization (GO:0071840) 5.6 5.6% multicellular organismal process (GO:0032501) 4.4 4.4% immune system process (GO:0002376) 4.2 4.2% biological adhesion (GO:0022610) 2.7 2.7% apoptotic process (GO:0006915) 1.6 1.6% reproduction (GO:0000003) 0.8 0.8% locomotion (GO:0040011) 0.4 0.4% cell killing (GO:0001906) 0.1 0.1% 100.1% Genes 2179Hits 3870 biological adhesion apoptotic process … reproduction (GO:0000003) , 0.8% (GO:0022610) , 2.7% locomotion (GO:0040011) ,… immune system process cell killing (GO:0001906) , 0.1% (GO:0002376) , 4.2% multicellular organismal process (GO:0032501) , metabolic process 4.4% (GO:0008152) , 29.3% cellular component organization (GO:0071840) , 5.6% response to stimulus (GO:0050896), 5.6% developmental process (GO:0032502) , 7.8% biological regulation (GO:0065007) , 8.0% cellular process (GO:0009987) , 20.2% localization (GO:0051179) , 9.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Universidade Estadual De Campinas Instituto De Biologia
    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Targeting Tyro3 Ameliorates a Model of PGRN-Mutant FTLD-TDP Via Tau
    ARTICLE DOI: 10.1038/s41467-018-02821-z OPEN Targeting Tyro3 ameliorates a model of PGRN- mutant FTLD-TDP via tau-mediated synaptic pathology Kyota Fujita1, Xigui Chen1, Hidenori Homma1, Kazuhiko Tagawa1, Mutsuki Amano 2, Ayumu Saito3, Seiya Imoto 4, Hiroyasu Akatsu5, Yoshio Hashizume6, Kozo Kaibuchi2, Satoru Miyano3 & Hitoshi Okazawa1 PGRN 1234567890():,; Mutations in the progranulin ( ) gene cause a tau pathology-negative and TDP43 pathology-positive form of frontotemporal lobar degeneration (FTLD-TDP). We generated a knock-in mouse harboring the R504X mutation (PGRN-KI). Phosphoproteomic analysis of this model revealed activation of signaling pathways connecting PKC and MAPK to tau prior to TDP43 aggregation and cognitive impairments, and identified PKCα as the kinase responsible for the early-stage tau phosphorylation at Ser203. Disinhibition of Gas6 binding to Tyro3 due to PGRN reduction results in activation of PKCα via PLCγ, inducing tau phosphorylation at Ser203, mislocalization of tau to dendritic spines, and spine loss. Administration of a PKC inhibitor, B-Raf inhibitor, or knockdown of molecules in the Gas6-Tyro3-tau axis rescues spine loss and cognitive impairment of PGRN-KI mice. Collectively, these results suggest that targeting of early-stage and aggregation-independent tau signaling represents a promising therapeutic strategy for this disease. 1 Department of Neuropathology, Medical Research Institute and Center for Brain Integration Research, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510, Japan. 2 Department of Cell Pharmacology, Graduate School of Medicine, Nagoya University, 65, Tsurumai, Showa, Nagoya, Aichi 466-8550, Japan. 3 Human Genome Center, Institute of Medical Science, The University of Tokyo, 4-6-1, Shirokanedai, Minato-ku, Tokyo 108- 8639, Japan.
    [Show full text]
  • Analysis of Mouse Keratin 6A Regulatory Sequences in Transgenic Mice Reveals Constitutive, Tissue-Speci®C Expression by a Keratin 6A Minigene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Analysis of Mouse Keratin 6a Regulatory Sequences in Transgenic Mice Reveals Constitutive, Tissue-Speci®c Expression by a Keratin 6a Minigene Donna Mahony, Seetha Karunaratne, Graham Cam,* and Joseph A. Rothnagel Department of Biochemistry and the Institute for Molecular Bioscience, University of Queensland, Brisbane, Queensland, and *Division of Animal Production, CSIRO, Blacktown, New South Wales, Australia The analysis of keratin 6 expression is complicated atin 6 expressing tissues, including the hair follicle, by the presence of multiple isoforms that are tongue, footpad, and nail bed, showing that both expressed constitutively in a number of internal stra- transgenes retained keratinocyte-speci®c expression. ti®ed epithelia, in palmoplantar epidermis, and in Quantitative analysis of b-galactosidase activity veri- the companion cell layer of the hair follicle. In addi- ®ed that both the 1.3 and 0.12 kb keratin 6a promo- tion, keratin 6 expression is inducible in interfollicu- ter constructs produced similar levels of the reporter. lar epidermis and the outer root sheath of the Notably, bothconstructs were constitutively follicle, in response to wounding stimuli, phorbol expressed in the outer root sheath and interfollicular esters, or retinoic acid. In order to establishthecriti- epidermis in the absence of any activating stimulus, cal regions involved in the regulation of keratin 6a suggesting that they lack the regulatory elements (the dominant isoform in mice), we generated trans- that normally silence transcription in these cells. This genic mice withtwo different-sized mouse keratin 6a study has revealed that a keratin 6a minigene con- constructs containing either 1.3 kb or 0.12 kb of 5¢ tains critical cis elements that mediate tissue-speci®c ¯anking sequence linked to the lacZ reporter gene.
    [Show full text]
  • RESEARCH ARTICLE Body Weight-Dependent Troponin T Alternative Splicing Is Evolutionarily Conserved from Insects to Mammals and I
    1523 The Journal of Experimental Biology 214, 1523-1532 © 2011. Published by The Company of Biologists Ltd doi:10.1242/jeb.051763 RESEARCH ARTICLE Body weight-dependent troponin T alternative splicing is evolutionarily conserved from insects to mammals and is partially impaired in skeletal muscle of obese rats Rudolf J. Schilder1,*, Scot R. Kimball1, James H. Marden2 and Leonard S. Jefferson1 1Department of Cellular and Molecular Physiology, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033, USA and 2Department of Biology, The Pennsylvania State University, 208 Mueller Lab, University Park, PA 16802, USA *Author for correspondence ([email protected]) Accepted 19 January 2011 SUMMARY Do animals know at a physiological level how much they weigh, and, if so, do they make homeostatic adjustments in response to changes in body weight? Skeletal muscle is a likely tissue for such plasticity, as weight-bearing muscles receive mechanical feedback regarding body weight and consume ATP in order to generate forces sufficient to counteract gravity. Using rats, we examined how variation in body weight affected alternative splicing of fast skeletal muscle troponin T (Tnnt3), a component of the thin filament that regulates the actin–myosin interaction during contraction and modulates force output. In response to normal growth and experimental body weight increases, alternative splicing of Tnnt3 in rat gastrocnemius muscle was adjusted in a quantitative fashion. The response depended on weight per se, as externally attached loads had the same effect as an equal change in actual body weight. Examining the association between Tnnt3 alternative splicing and ATP consumption rate, we found that the Tnnt3 splice form profile had a significant association with nocturnal energy expenditure, independently of effects of weight.
    [Show full text]
  • TNNT3 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science TNNT3 Rabbit pAb Catalog No.: A15323 Basic Information Background Catalog No. The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle A15323 contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin Observed MW filaments. The altered conformation permits increased interaction between a myosin 37kDa head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I Calculated MW binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin 29kDa/30kDa/31kDa complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that Category encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as Primary antibody troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch Applications between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice WB variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B Cross-Reactivity (DA2B). Mouse, Rat Recommended Dilutions Immunogen Information WB 1:200 - 1:2000 Gene ID Swiss Prot 7140 P45378 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 147-256 of human TNNT3 (NP_001036246.1).
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Structural and Biochemical Changes Underlying a Keratoderma-Like Phenotype in Mice Lacking Suprabasal AP1 Transcription Factor Function
    Citation: Cell Death and Disease (2015) 6, e1647; doi:10.1038/cddis.2015.21 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis Structural and biochemical changes underlying a keratoderma-like phenotype in mice lacking suprabasal AP1 transcription factor function EA Rorke*,1, G Adhikary2, CA Young2, RH Rice3, PM Elias4, D Crumrine4, J Meyer4, M Blumenberg5 and RL Eckert2,6,7,8 Epidermal keratinocyte differentiation on the body surface is a carefully choreographed process that leads to assembly of a barrier that is essential for life. Perturbation of keratinocyte differentiation leads to disease. Activator protein 1 (AP1) transcription factors are key controllers of this process. We have shown that inhibiting AP1 transcription factor activity in the suprabasal murine epidermis, by expression of dominant-negative c-jun (TAM67), produces a phenotype type that resembles human keratoderma. However, little is understood regarding the structural and molecular changes that drive this phenotype. In the present study we show that TAM67-positive epidermis displays altered cornified envelope, filaggrin-type keratohyalin granule, keratin filament, desmosome formation and lamellar body secretion leading to reduced barrier integrity. To understand the molecular changes underlying this process, we performed proteomic and RNA array analysis. Proteomic study of the corneocyte cross-linked proteome reveals a reduction in incorporation of cutaneous keratins, filaggrin, filaggrin2, late cornified envelope precursor proteins, hair keratins and hair keratin-associated proteins. This is coupled with increased incorporation of desmosome linker, small proline-rich, S100, transglutaminase and inflammation-associated proteins. Incorporation of most cutaneous keratins (Krt1, Krt5 and Krt10) is reduced, but incorporation of hyperproliferation-associated epidermal keratins (Krt6a, Krt6b and Krt16) is increased.
    [Show full text]