UC San Diego Electronic Theses and Dissertations

Total Page:16

File Type:pdf, Size:1020Kb

Load more

UC San Diego UC San Diego Electronic Theses and Dissertations Title Dissecting Enhancer Functions in Signal Induced Transcription Programs Permalink https://escholarship.org/uc/item/0n31q74b Author Hu, Yiren Publication Date 2018 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Dissecting Enhancer Functions in Signal Induced Transcription Programs A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biology by Yiren Hu Committee in charge: Professor Michael Geoff Rosenfeld, Chair Professor Christopher K. Glass Professor Cornelis Murre Professor Amy Pasquinelli Professor Samuel Pfaff 2018 The Dissertation of Yiren Hu is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair University of California, San Diego 2018 iii Table of Contents Signature Page .................................................................................................................. iii Table of Contents ............................................................................................................... iv Acknowledgements .......................................................................................................... viii Vita .......................................................................................................................................x Publications ..........................................................................................................................x Abstract of the Dissertation ............................................................................................... xi Introduction ..........................................................................................................................1 Chapter 1: Condensin I and II Complexes License Full Estrogen Receptor α-Dependent Enhancer Activation .............................................................................................................4 Chapter 2: JMJD6 Licenses Estrogen Receptor α-Dependent Enhancer and Coding Gene Activation by Modulating the Recruitment of the CARM1/ MED12 Co-activator Complex .............................................................................................................................26 Chapter 3: KDM2B and ERα Function as Dual Transcription Brakes to Curb Inflammation ......................................................................................................................59 Chapter 4: Discussion .......................................................................................................73 Appendix:Figures ..............................................................................................................78 References ........................................................................................................................134 iv List of Figures Figure 1: Estrogen-Induced Loading of Condensins to ER-α-Bound Active Enhancers, Continued ...........................................................................................................................78 Figure 2: ER-α Interacts with Condensins .........................................................................80 Figure 3: Condensin I and Condensin II Control ER-α-Regulated Gene Activation in a Partially Overlapping Manner ............................................................................................81 Figure 4: Condensins Are Needed for Full eRNA Activation and Enhancer:Promoter Looping, Continued ...........................................................................................................82 Figure 5: Condensins License Appropriate Coactivator and Corepressor Recruitment during Enhancer Activation ...............................................................................................84 Figure 6: Condensin-Dependent Recruitment of HECTD1 Is Required for E2-Induced eRNA Activation, Continued .............................................................................................85 Figure 7: Evidence Suggesting RIP140 as a Polyubiquitination Substrate of HECTD1, Continued ...........................................................................................................................87 Figure 8: JMJD6 Binding was Induced by Estrogen on ERα-Bound Active Enhancers, Continued. ........................................................................................................................101 Figure 9: JMJD6 is Required for Transcriptional Activation of ERα-Bound Active Enhancers, Continued. .....................................................................................................103 Figure 10: JMJD6 Regulates Estrogen-induced Coding Gene Transcription, Continued.105 Figure 11: JMJD6 Regulates MED12 Function in Estrogen-Induced Transcriptional Activation, Continued. .....................................................................................................107 Figure 12: JMJD6 Regulates MED12 Interaction with CARM1 and hence MED12 Methylation and Chromatin Binding, Continued. ............................................................109 Figure 13:JMJD6 is Required for Estrogen-Induced Breast Cancer Cell Growth and Tumorigenesis, Continued. ..............................................................................................111 Figure 14: A Proposed Model of JMJD6 Function in Estrogen/ERα-Regulated Enhancer and Coding Gene Activation. ...........................................................................................113 Figure 15: E2 Downregulates TNFα Transcription Program ..........................................122 Figure 16: ERα is Tethered to NFκB Enhancers to Repress Transcription .....................123 v Figure 17: KDM2B represses inflammation at basal condition .......................................124 Figure 18: KDM2B Nucleates PRC1 to Repress Inflammation ......................................125 Figure 19: KDM2B Represses Inflammation in Macrophage .........................................126 Figure 20: GRIP1 mediates ERα repressive effects on NFκB genes ...............................127 Figure S1: Additional descriptive data of condensins localization in the genome ............89 Figure S2: Additional descriptions of condensins ChIP-Seqs and their localization to active enhancers. ................................................................................................................90 Figure S3: Localization of condensins in mitotic MCF-7 cells, condensin/ER-α interaction and condensin I / II relationship, Continued. ...................................................91 Figure S4: Efficient knockdown of condensins and its effects on estrogen regulated transcription, Continued .....................................................................................................93 Figure S5: Depletion of condensins inhibits ER-α enhancer transcription, Continued. ....95 Figure S6: Depletion of condensins abolished the equilibrium of CoA/CoR recruitment to active enhancers, Continued. .............................................................................................97 Figure S7: Additional results for HECTD1 function, Continued. .....................................99 Figure S 8:JMJD6 is Recruited onto ERα-Bound Active Enhancers upon Estrogen Stimulation, Continued. ...................................................................................................114 Figure S 9:JMJD6 Determines the Transcriptional Activation of ERα-Bound Enhancers, Continued. ........................................................................................................................116 Figure S 10:JMJD6 Regulates MED12 Function in Estrogen-Induced Transcriptional Activation, Continued. .....................................................................................................118 Figure S 11:Arginine Methylation Sites Identified at the C-terminus of MED12. ..........120 Figure S 12:JMJD6 is Required for Estrogen-Induced Breast Cancer Cell Growth and Tumorigenesis. .................................................................................................................121 Figure S 13:Additional Results for E2 Down-regulates TNFα Transcription Program ..128 Figure S 14: Additional Results for ERα is tethered to NFκB enhancers to repress transcription .....................................................................................................................129 Figure S 15: Additional Results for KDM2B represses inflammation at basal condition130 vi Figure S 16: Additional Results for KDM2B Nucleates PRC1 to Repress Inflammation131 Figure S 17: Additional Results for KDM2B Represses Inflammation in Macrophage. 132 vii Acknowledgements Having Dr. Michael G. Rosenfeld as my mentor is the most valuable part of my experience at University of California, San Diego. His creative ideas, critical thinking and hardworking all set an extraordinary role model for me. I’m thankful for his encouragements that we should study the most interesting and challenging topics. I’m thankful for his high standards that we need to push research works to the most exciting level. I’m also thankful for his generous support each time when I experienced down times in graduate school. With his guidance, I’m honored to write this thesis. I want to thank my committee members Professor Cornelis Murre, Professor Christopher K. Glass, Professor
Recommended publications
  • Methylation Status of Vitamin D Receptor Gene Promoter in Adrenocortical Carcinoma

    Methylation Status of Vitamin D Receptor Gene Promoter in Adrenocortical Carcinoma

    UNIVERSITÀ DEGLI STUDI DI PADOVA DEPARTMENT OF CARDIAC, THORACIC AND VASCULAR SCIENCES Ph.D Course Medical Clinical and Experimental Sciences Curriculum Clinical Methodology, Endocrinological, Diabetological and Nephrological Sciences XXIX° SERIES METHYLATION STATUS OF VITAMIN D RECEPTOR GENE PROMOTER IN ADRENOCORTICAL CARCINOMA Coordinator: Ch.mo Prof. Annalisa Angelini Supervisor: Ch.mo Prof. Francesco Fallo Ph.D Student: Andrea Rebellato TABLE OF CONTENTS SUMMARY 3 INTRODUCTION 4 PART 1: ADRENOCORTICAL CARCINOMA 4 1.1 EPIDEMIOLOGY 4 1.2 GENETIC PREDISPOSITION 4 1.3 CLINICAL PRESENTATION 6 1.4 DIAGNOSTIC WORK-UP 7 1.4.1 Biochemistry 7 1.4.2 Imaging 9 1.5 STAGING 10 1.6 PATHOLOGY 11 1.7 MOLECULAR PATHOLOGY 14 1.7.1 DNA content 15 1.7.2 Chromosomal aberrations 15 1.7.3 Differential gene expression 16 1.7.4 DNA methylation 17 1.7.5 microRNAs 18 1.7.6 Gene mutations 19 1.8 PATHOPHYSIOLOGY OF MOLECULAR SIGNALLING 21 PATHWAYS 1.8.1 IGF-mTOR pathway 21 1.8.2 WNTsignalling pathway 22 1.8.3 Vascular endothelial growth factor 23 1.9 THERAPY 24 1.9.1 Surgery 24 1.9.2 Adjuvant Therapy 27 1.9.2.1 Mitotane 27 1.9.2.2 Cytotoxic chemotherapy 30 1.9.2.3 Targeted therapy 31 1.9.2.4 Therapy for hormone excess 31 1.9.2.5 Radiation therapy 32 1.9.2.6 Other local therapies 32 1.10 PROGNOSTIC FACTORS AND PREDICTIVE MARKERS 32 PART 2: VITAMIN D 35 2.1 VITAMIN D AND ITS BIOACTIVATION 35 2.2 THE VITAMIN D RECEPTOR 37 2.3 GENOMIC MECHANISM OF 1,25(OH)2D3-VDR COMPLEX 38 2.4 CLASSICAL ROLES OF VITAMIN D 40 2.4.1 Intestine 40 2.4.2 Kidney 41 2.4.3 Bone 41 2.5 PLEIOTROPIC
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With

    Evidence for Differential Alternative Splicing in Blood of Young Boys With

    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
  • AVILA-DISSERTATION.Pdf

    AVILA-DISSERTATION.Pdf

    LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have.
  • The Role of Gli3 in Inflammation

    The Role of Gli3 in Inflammation

    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Winter 2020 THE ROLE OF GLI3 IN INFLAMMATION Stephan Josef Matissek University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Matissek, Stephan Josef, "THE ROLE OF GLI3 IN INFLAMMATION" (2020). Doctoral Dissertations. 2552. https://scholars.unh.edu/dissertation/2552 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. THE ROLE OF GLI3 IN INFLAMMATION BY STEPHAN JOSEF MATISSEK B.S. in Pharmaceutical Biotechnology, Biberach University of Applied Sciences, Germany, 2014 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Biochemistry December 2020 This dissertation was examined and approved in partial fulfillment of the requirement for the degree of Doctor of Philosophy in Biochemistry by: Dissertation Director, Sherine F. Elsawa, Associate Professor Linda S. Yasui, Associate Professor, Northern Illinois University Paul Tsang, Professor Xuanmao Chen, Assistant Professor Don Wojchowski, Professor On October 14th, 2020 ii ACKNOWLEDGEMENTS First, I want to express my absolute gratitude to my advisor Dr. Sherine Elsawa. Without her help, incredible scientific knowledge and amazing guidance I would not have been able to achieve what I did. It was her encouragement and believe in me that made me overcome any scientific struggles and strengthened my self-esteem as a human being and as a scientist.
  • MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene

    MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC317351 MED6 (NM_005466) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MED6 (NM_005466) Human Untagged Clone Tag: Tag Free Symbol: MED6 Synonyms: ARC33; NY-REN-28 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_005466, the custom clone sequence may differ by one or more nucleotides ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAAGCCAAAA GGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTCAGACAAAA ATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACAAAGAAAGAG GCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAACAGACAGTGA GTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_005466 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete
  • COFACTORS of the P65- MEDIATOR COMPLEX

    COFACTORS of the P65- MEDIATOR COMPLEX

    COFACTORS OF THE April 5 p65- MEDIATOR 2011 COMPLEX Honors Thesis Department of Chemistry and Biochemistry NICHOLAS University of Colorado at Boulder VICTOR Faculty Advisor: Dylan Taatjes, PhD PARSONNET Committee Members: Rob Knight, PhD; Robert Poyton, PhD Table of Contents Abstract ......................................................................................................................................................... 3 Introduction .................................................................................................................................................. 4 The Mediator Complex ............................................................................................................................. 6 The NF-κB Transcription Factor ................................................................................................................ 8 Hypothesis............................................................................................................................................... 10 Results ......................................................................................................................................................... 11 Discussion.................................................................................................................................................... 15 p65-only factors ...................................................................................................................................... 16 p65-enriched factors ..............................................................................................................................
  • MED12 Related Disorders FTNW

    MED12 Related Disorders FTNW

    MED12 related disorders rarechromo.org What are the MED12 related disorders? MED12 related disorders are a group of disorders that primarily affect boys. Most boys with MED12 related disorders have intellectual disability/ developmental delay, behavioural problems and low muscle tone. MED12 related disorders occur when the MED12 gene has lost its normal function. Genes are instructions which have important roles in our growth and development. They are made of DNA and are incorporated into organised structures called chromosomes. Chromosomes therefore contain our genetic information. Chromosomes are located in our cells, the building blocks of our bodies. The MED12 gene is located on the X chromosome. The X chromosome is one of the sex chromosomes that determine a person’s gender. Men have one X chromosome and one Y chromosome, while women have two X chromosomes. Because the MED12 gene is located on the X chromosome, men have only one copy of the gene, while women have two copies. A change in the MED12 gene can cause symptoms in men. Women with a change in the MED12 gene usually have no symptoms. They carry a second copy of the gene that does function normally. Women may show mild features such as learning difficulties. The MED12 related disorders are FG syndrome , Lujan syndrome and the X- linked recessive form of Ohdo syndrome . Although these syndromes differ, they also have the overlapping features listed on page 2. The way that these conditions are inherited is called ‘X-linked’ or ‘X-linked’ recessive. In 2007 it was discovered that changes in the MED12 gene were responsible for the symptoms and features in several boys with FG syndrome.
  • Integrated Analysis of the Critical Region 5P15.3–P15.2 Associated with Cri-Du-Chat Syndrome

    Integrated Analysis of the Critical Region 5P15.3–P15.2 Associated with Cri-Du-Chat Syndrome

    Genetics and Molecular Biology, 42, 1(suppl), 186-196 (2019) Copyright © 2019, Sociedade Brasileira de Genética. Printed in Brazil DOI: http://dx.doi.org/10.1590/1678-4685-GMB-2018-0173 Research Article Integrated analysis of the critical region 5p15.3–p15.2 associated with cri-du-chat syndrome Thiago Corrêa1, Bruno César Feltes2 and Mariluce Riegel1,3* 1Post-Graduate Program in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil. 2Institute of Informatics, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil. 3Medical Genetics Service, Hospital de Clínicas de Porto Alegre, Porto Alegre, RS, Brazil. Abstract Cri-du-chat syndrome (CdCs) is one of the most common contiguous gene syndromes, with an incidence of 1:15,000 to 1:50,000 live births. To better understand the etiology of CdCs at the molecular level, we investigated theprotein–protein interaction (PPI) network within the critical chromosomal region 5p15.3–p15.2 associated with CdCs using systemsbiology. Data were extracted from cytogenomic findings from patients with CdCs. Based on clin- ical findings, molecular characterization of chromosomal rearrangements, and systems biology data, we explored possible genotype–phenotype correlations involving biological processes connected with CdCs candidate genes. We identified biological processes involving genes previously found to be associated with CdCs, such as TERT, SLC6A3, and CTDNND2, as well as novel candidate proteins with potential contributions to CdCs phenotypes, in- cluding CCT5, TPPP, MED10, ADCY2, MTRR, CEP72, NDUFS6, and MRPL36. Although further functional analy- ses of these proteins are required, we identified candidate proteins for the development of new multi-target genetic editing tools to study CdCs.
  • MED12 Mutations Link Intellectual Disability Syndromes with Dysregulated GLI3-Dependent Sonic Hedgehog Signaling

    MED12 Mutations Link Intellectual Disability Syndromes with Dysregulated GLI3-Dependent Sonic Hedgehog Signaling

    MED12 mutations link intellectual disability syndromes with dysregulated GLI3-dependent Sonic Hedgehog signaling Haiying Zhoua, Jason M. Spaethb, Nam Hee Kimb, Xuan Xub, Michael J. Friezc, Charles E. Schwartzc, and Thomas G. Boyerb,1 aDepartment of Molecular and Cell Biology, Howard Hughes Medical Institute, University of California, Berkeley, CA 94270; bDepartment of Molecular Medicine, Institute of Biotechnology, University of Texas Health Science Center at San Antonio, San Antonio, TX 78229; and cGreenwood Genetic Center, Greenwood, SC 29646 Edited by Robert G. Roeder, The Rockefeller University, New York, NY, and approved September 13, 2012 (received for review December 20, 2011) Recurrent missense mutations in the RNA polymerase II Mediator divergent “tail” and “kinase” modules through which most activa- subunit MED12 are associated with X-linked intellectual disability tors and repressors target Mediator. The kinase module, compris- (XLID) and multiple congenital anomalies, including craniofacial, ing MED12, MED13, CDK8, and cyclin C, has been ascribed both musculoskeletal, and behavioral defects in humans with FG (or activating and repressing functions and exists in variable association Opitz-Kaveggia) and Lujan syndromes. However, the molecular with Mediator, implying that its regulatory role is restricted to a mechanism(s) underlying these phenotypes is poorly understood. subset of RNA polymerase II transcribed genes. Here we report that MED12 mutations R961W and N1007S causing Within the Mediator kinase module, MED12 is a critical trans- FG and Lujan syndromes, respectively, disrupt a Mediator-imposed ducer of regulatory information conveyed by signal-activated transcription factors linked to diverse developmental pathways, constraint on GLI3-dependent Sonic Hedgehog (SHH) signaling. We including the EGF, Notch, Wnt, and Hedgehog pathways (10–12).
  • MED21 Polyclonal Antibody

    MED21 Polyclonal Antibody

    PRODUCT DATA SHEET Bioworld Technology,Inc. MED21 polyclonal antibody Catalog: BS61042 Host: Rabbit Reactivity: Human,Mouse,Rat BackGround: Q13503 In mammalian cells, transcription is regulated in part by Purification&Purity: high molecular weight co-activating complexes that me- The antibody was affinity-purified from rabbit antiserum diate signals between transcriptional activators and RNA by affinity-chromatography using epitope-specific im- polymerase. These complexes include the SMCC (SRB munogen and the purity is > 95% (by SDS-PAGE). and MED protein cofactor complex), which consists of Applications: various subunits that share homology with several com- WB: 1:500~1:1000 ponents of the yeast transcriptional mediator complexes Storage&Stability: and including the human proteins Srb7, Med6 (also des- Store at 4°C short term. Aliquot and store at -20°C long ignated DRIP33) and Med7 (also designated DRIP34). term. Avoid freeze-thaw cycles. SMCC associates with the RNAPII (RNA polymerase II) Specificity: holoenzyme through Srb7 and, in turn, enhances MED21 polyclonal antibodydetects endogenous levels of gene-specific activation or repression induced by MED21 protein. DNA-binding transcription factors. Med6 and Med7, as DATA: well as other components of SMCC, associate with co-activator proteins from the TRAP (thyroid hormone receptor-activating protein) complex and DRIP (for vita- min D receptor interacting protein) complex to facilitate steroid receptor dependent transcriptional activation. Ad- ditionally, SMCC associates with PC4 (positive cofactor 4) to repress basal transcription independent of RNAPII activity. Western blot (WB) analysis of MED21 polyclonal antibody at 1:500 di- Product: lution Rabbit IgG, 1mg/ml in PBS with 0.02% sodium azide, Lane1:CT26 whole cell lysate(40ug) 50% glycerol, pH7.2 Lane2:HEK293T whole cell lysate(40ug) Molecular Weight: Lane3:HCT116 whole cell lysate(40ug) ~ 15 kDa Note: Swiss-Prot: For research use only, not for use in diagnostic procedure.
  • MED12 Gene Mediator Complex Subunit 12

    MED12 Gene Mediator Complex Subunit 12

    MED12 gene mediator complex subunit 12 Normal Function The MED12 gene provides instructions for making a protein called mediator complex subunit 12. As its name suggests, this protein forms one part (subunit) of the mediator complex, which is a group of about 25 proteins that work together to regulate gene activity. The mediator complex physically links transcription factors, which are proteins that influence whether genes are turned on or off, with an enzyme called RNA polymerase II. Once transcription factors are attached, this enzyme initiates gene transcription, the process by which information stored in a gene's DNA is used to build proteins. Researchers believe that the MED12 protein is involved in many aspects of early development, including the development of nerve cells (neurons) in the brain. The MED12 protein is part of several chemical signaling pathways within cells. These pathways help direct a broad range of cellular activities, such as cell growth, cell movement (migration), and the process by which cells mature to carry out specific functions (differentiation). Health Conditions Related to Genetic Changes FG syndrome At least two mutations in the MED12 gene have been found to cause FG syndrome, which is characterized by intellectual disability, behavioral problems, and physical abnormalities including weak muscle tone (hypotonia) and obstruction of the anal opening (imperforate anus). The mutations that cause FG syndrome each change a single protein building block ( amino acid) in the MED12 protein. One mutation replaces the amino acid arginine with the amino acid tryptophan at protein position 961 (written as Arg961Trp or R961W). The other replaces the amino acid glycine with the amino acid glutamic acid at protein position 958 (written as Gly958Glu or G958E).
  • Estrogen Receptor Coregulators and Pioneer Factors: the Orchestrators of Mammary Gland Cell Fate and Development

    Estrogen Receptor Coregulators and Pioneer Factors: the Orchestrators of Mammary Gland Cell Fate and Development

    REVIEW ARTICLE published: 12 August 2014 CELL AND DEVELOPMENTAL BIOLOGY doi: 10.3389/fcell.2014.00034 Estrogen receptor coregulators and pioneer factors: the orchestrators of mammary gland cell fate and development Bramanandam Manavathi*, Venkata S. K. Samanthapudi and Vijay Narasimha Reddy Gajulapalli Department of Biochemistry, School of Life Sciences, University of Hyderabad, Hyderabad, India Edited by: The steroid hormone, 17β-estradiol (E2), plays critical role in various cellular processes Claude Beaudoin, Blaise Pascal such as cell proliferation, differentiation, migration and apoptosis, and is essential for University Clermont-Ferrand 2, reproduction and mammary gland development. E2 actions are mediated by two classical France nuclear hormone receptors, estrogen receptor α and β (ERs). The activity of ERs depends Reviewed by: Anne Hélène Duittoz, Université de on the coordinated activity of ligand binding, post-translational modifications (PTMs), and Tours, France importantly the interaction with their partner proteins called “coregulators.” Because Songhai Chen, University of Iowa, coregulators are proved to be crucial for ER transcriptional activity, and majority of breast USA cancers are ERα positive, an increased interest in the field has led to the identification of *Correspondence: a large number of coregulators. In the last decade, gene knockout studies using mouse Bramanandam Manavathi, Department of Biochemistry, School models provided impetus to our further understanding of the role of these coregulators of Life Sciences, University of in mammary gland development. Several coregulators appear to be critical for terminal Hyderabad, Gachibowli, end bud (TEB) formation, ductal branching and alveologenesis during mammary gland Hyderabad-500046, India development. The emerging studies support that, coregulators along with the other ER e-mail: [email protected] partner proteins called “pioneer factors” together contribute significantly to E2 signaling and mammary cell fate.