DOCSLIB.ORG

Avadomide Induces Degradation of ZMYM2 Fusion Oncoproteins in Hematologic Malignancies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Avadomide Induces Degradation of ZMYM2 Fusion Oncoproteins in Hematologic Malignancies RESEARCH ARTICLE Avadomide Induces Degradation of ZMYM2 Fusion Oncoproteins in Hematologic Malignancies Aline Renneville1,2,3, Jessica A. Gasser1,2, Daniel E. Grinshpun1,2, Pierre M. Jean Beltran1, Namrata D. Udeshi1, Mary E. Matyskiela4, Thomas Clayton4, Marie McConkey2, Kaushik Viswanathan2, Alexander Tepper1,2, Andrew A. Guirguis1,2,5, Rob S. Sellar2,6, Sophie Cotteret7, Christophe Marzac7, Véronique Saada7, Stéphane De Botton8, Jean-Jacques Kiladjian9, Jean-Michel Cayuela10, Mark Rolfe4, Philip P. Chamberlain4, Steven A. Carr1, and Benjamin L. Ebert1,2,11 Downloaded from https://bloodcancerdiscov.aacrjournals.org by guest on September 26, 2021. Copyright 2021 American Copyright 2021 by AssociationAmerican for Association Cancer Research. for Cancer Research. ABSTRACT Thalidomide analogues exert their therapeutic effects by binding to the CRL4CRBN E3 ubiquitin ligase, promoting ubiquitination and subsequent proteasomal degrada- tion of specific protein substrates. Drug-induced degradation of IKZF1 and IKZF3 in B-cell malignancies demonstrates the clinical utility of targeting disease-relevant transcription factors for degradation. Here, we found that avadomide (CC-122) induces CRBN-dependent ubiquitination and proteasomal degradation of ZMYM2 (ZNF198), a transcription factor involved in balanced chromosomal rear- rangements with FGFR1 and FLT3 in aggressive forms of hematologic malignancies. The minimal drug- responsive element of ZMYM2 is a zinc-chelating MYM domain and is contained in the N-terminal portion of ZMYM2 that is universally included in the derived fusion proteins. We demonstrate that avadomide has the ability to induce proteasomal degradation of ZMYM2–FGFR1 and ZMYM2–FLT3 chimeric oncoproteins, both in vitro and in vivo. Our findings suggest that patients with hematologic malignancies harboring these ZMYM2 fusion proteins may benefit from avadomide treatment. SIGNIFICANCE: We extend the potential clinical scope of thalidomide analogues by the identification of a novel avadomide-dependent CRL4CRBN substrate, ZMYM2. Avadomide induces ubiquitination and degradation of ZMYM2–FGFR1 and ZMYM2–FLT3, two chimeric oncoproteins involved in hematologic malignancies, providing a proof of concept for drug-induced degradation of transcription factor fusion proteins by thalidomide analogues. INTRODUCTION IKZF3, accounting for their therapeutic efficacy in multiple myeloma due to addiction of certain B-cell malignancies to Thalidomide and its analogues, including lenalidomide these transcription factors (2, 4, 9). Lenalidomide-induced and pomalidomide, have demonstrated extraordinary clinical degradation of casein kinase 1 alpha (Ck1α) explains the utility mediated by drug-induced targeted protein degrada- clinical efficacy of lenalidomide in myelodysplastic syn- tion. Thalidomide analogues bind the Cullin-RING E3 ubiq- drome with deletion of chromosome 5q [del(5q); ref. 3]. uitin ligase CUL4–RBX1–DDB1–CRBN (CRL4CRBN) complex, Avadomide (CC-122) is a novel thalidomide analogue with promoting ubiquitination and subsequent proteasomal deg- potent antitumor and immunomodulatory activities, par- radation of nonnative target proteins, called neosubstrates ticularly in diffuse large B-cell lymphoma, through degrada- (1–5). Thalidomide analogues bind a shallow hydrophobic tion of IKZF1/3 (10). Phase I trials revealed that avadomide pocket on the surface of CRBN to create a compound– monotherapy has acceptable safety and favorable pharma- protein interface for substrate recruitment to the CRL4CRBN cokinetics (10–12). complex, thereby acting as a “molecular glue” (6–8). Using quantitative mass spectrometry–based proteomic Thalidomide, lenalidomide, pomalidomide, and other profiling, we found decreased ZMYM2 abundance following thalidomide analogues induce degradation of IKZF1 and avadomide treatment. ZMYM2, formerly known as ZNF198, is a zinc finger protein that may function as part of a transcriptional corepressor complex (13). ZMYM2 has long 1Broad Institute of MIT and Harvard, Cambridge, Massachusetts. 2Depart- been known for its implication in a chimeric fusion gene ment of Medical Oncology, Dana-Farber Cancer Institute, Boston, with fibroblast growth factor receptor-1 FGFR1( ), generated Massachusetts. 3INSERM U1287, Gustave Roussy Cancer Campus, Villejuif, by a t(8;13)(p11;q12) chromosomal translocation (14–19). France. 4Celgene/Bristol-Myers Squibb Corporation, San Diego, California. ZMYM2 is the most frequent FGFR1 partner gene, account- 5 6 Peter MacCallum Cancer Centre, Melbourne, Victoria, Australia. Depart- ing for 40% to 50% of cases of FGFR1-rearranged myeloid/ ment of Haematology, UCL Cancer Institute, London, United Kingdom. 7Département de Biologie et Pathologie, Gustave Roussy Cancer Campus, lymphoid neoplasms (18, 20), a distinct entity in the 2016 Villejuif, France. 8Département d’Hématologie, Gustave Roussy Cancer revision of the WHO classification of myeloid neoplasms Campus, Villejuif, France. 9Université de Paris, AP-HP, Hôpital Saint-Louis, and acute leukemia (21). More recently, another fusion tran- Centre d’Investigations Cliniques CIC 1427, INSERM, Paris, France. script involving ZMYM2, ZMYM2–FLT3, resulting from a 10Hematology Laboratory and EA3518, University Hospital Saint-Louis, Université de Paris, Paris, France. 11Howard Hughes Medical Institute, cytogenetically cryptic inversion on chromosome 13, has Dana-Farber Cancer Institute, Boston, Massachusetts. been identified by RNA sequencing in patients with myelo- Note: Supplementary data for this article are available at Blood Cancer proliferative neoplasms with eosinophilia (22) and Philadel- Discovery Online (https://bloodcancerdiscov.aacrjournals.org/). phia chromosome–like acute lymphoblastic leukemia (23). In Corresponding Author: Benjamin L. Ebert, Dana-Farber Cancer Institute, this study, we report for the first time that ZMYM2–FGFR1 450 Brookline Avenue, D1610A, Boston, MA 02215. Phone: 617–632– and ZMYM2–FLT3 oncoproteins are avadomide-dependent 1902; E-mail: [email protected] CRBN neosubstrates, suggesting patients with hematologic Blood Cancer Discov 2021;2:1–16 malignancies harboring these ZMYM2 rearrangements may doi: 10.1158/2643-3230.BCD-20-0105 benefit from treatment with avadomide or novel thalidomide ©2021 American Association for Cancer Research. analogues that selectively degrade ZMYM2. MAY 2021 BLOOD CANCER DISCOVERY | OF2 Downloaded from https://bloodcancerdiscov.aacrjournals.org by guest on September 26, 2021. Copyright 2021 American Association for Cancer Research. RESEARCH ARTICLE Renneville et al. RESULTS Fig. S2I), consistent with a nontranscriptional mechanism of regulation. Avadomide Decreases ZMYM2 Protein Level To identify novel targets of avadomide, we profiled Avadomide-Induced Ubiquitination of ZMYM2 changes in protein abundance in Hep3B cells, a hepato- Depends on CRBN cellular carcinoma cell line, treated with varying concen- trations of avadomide, pomalidomide, or vehicle control To investigate the mechanism of avadomide-mediated (Supplementary Fig. S1). Samples were analyzed by liquid decrease in ZMYM2 protein level, we treated Hep3B cells chromatography/tandem mass spectrometry (LC/MS-MS) with avadomide or the vehicle control for 12 hours in the employing isobaric chemical labeling and multiplexing presence or absence of small-molecule inhibitors of the using tandem mass tag (TMT) reagents for precise rela- ubiquitin-proteasome system. Cotreatment with avadomide tive quantification and offline fractionation for deep-scale and the E1 (UBA1) inhibitor MLN7243, which blocks all cellular ubiquitination by inhibiting the initial step of the protein analysis. Of the ∼10,000 proteins quantified in Hep3B cells, 8 had decreased abundance following avado- ubiquitination cascade, abrogated ZMYM2 depletion. Like- mide treatment relative to vehicle control, with a log fold wise, addition of MLN4924, a NEDD8-activating enzyme 2 inhibitor that interferes with the activity of Cullin-RING change < –0.8 and a Padj value < 0.01 (Fig. 1A; Supplemen- tary Fig. S2A–S2C; Supplementary Table S1). Among those E3 ubiquitin ligases, or the proteasome inhibitor MG-132, significant hits were ZFP91, RAB28, and WIZ, previously prevented ZMYM2 from being degraded in the presence of identified as targets of thalidomide analogues (2, 24, 25), avadomide (Fig. 1G). and two other proteins not previously published as drug- We next sought to determine whether ubiquitination and induced CRL4CRBN substrates, PDE6D and ZMYM2. Given degradation of ZMYM2 was dependent on CRBN, the molec- the implication of ZMYM2 in two fusion oncoproteins ular target of thalidomide analogues. We utilized CRISPR/ involved in hematologic malignancies, we decided to prior- Cas9 gene editing in Hep3B cells to generate biallelic inacti- itize this target for validation and follow-up studies. Poma- vation of CRBN. In CRBN-knockout Hep3B cells, avadomide lidomide, whose chemical structure is closely related to that did not induce degradation of ZMYM2 (Fig. 1H). We next examined whether ZMYM2 binds CRBN and is ubiquit- of avadomide, had a less pronounced effect on ZMYM2 CRBN protein abundance (Fig. 1B). inated by CRL4 E3 ubiquitin ligase. We observed coim- To validate the proteomic findings, we performed immu- munoprecipitation of endogenous CRBN with V5-tagged noblot analysis in Hep3B cells and tested a series of tha- ZMYM2 only in the presence of avadomide (Fig. 1I). Analysis lidomide analogues. Avadomide was the only drug tested of V5-tagged ZMYM2 in Hep3B cells
Load more

Recommended publications
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Screen for Multi-SUMO–Binding Proteins Reveals a Multi-SIM–Binding Mechanism for Recruitment of the Transcriptional Regulator ZMYM2 to Chromatin
    Screen for multi-SUMO–binding proteins reveals a multi-SIM–binding mechanism for recruitment of the transcriptional regulator ZMYM2 to chromatin Elisa Aguilar-Martineza, Xi Chena, Aaron Webbera, A. Paul Moulda, Anne Seifertb, Ronald T. Hayb, and Andrew D. Sharrocksa,1 aFaculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom; and bCentre for Gene Regulation and Expression, University of Dundee, Dundee DD1 5EH, United Kingdom Edited by James L. Manley, Columbia University, New York, NY, and approved July 17, 2015 (received for review May 20, 2015) Protein SUMOylation has emerged as an important regulatory human proteins containing two or more motifs corresponding event, particularly in nuclear processes such as transcriptional to the extended negatively charged amino acid-dependent control and DNA repair. In this context, small ubiquitin-like modifier SUMOylation motif (NDSM) (13) Thus, there is a huge poten- (SUMO) often provides a binding platform for the recruitment of tial for widespread multi-SUMOylation of proteins to occur. proteins via their SUMO-interacting motifs (SIMs). Recent discoveries Indeed, several of these proteins have been shown to be point to an important role for multivalent SUMO binding through SUMOylated on multiple sites, including megakaryoblastic leu- multiple SIMs in the binding partner as exemplified by poly- kemia (translocation) 1 (MKL1) (14), CREB-binding protein SUMOylation acting as a binding platform for ubiquitin E3 ligases (CBP) (15), and PEA3/ETV4 (16). Furthermore, two recent such as ring finger protein 4. Here, we have investigated whether proteomic studies emphasize the potential for more widespread other types of protein are recruited through multivalent SUMO multi-SUMOylation as they found that a large proportion of all interactions.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • T-Cell Lymphoblastic Lymphoma Arising in the Setting of Myeloid/Lymphoid Neoplasms with Eosinophilia
    cancers Article T-Cell Lymphoblastic Lymphoma Arising in the Setting of Myeloid/Lymphoid Neoplasms with Eosinophilia: LMO2 Immunohistochemistry as a Potentially Useful Diagnostic Marker Magda Zanelli 1 , Giuseppe G. Loscocco 2,3 , Elena Sabattini 4, Maurizio Zizzo 5,6,* , Francesca Sanguedolce 7, Luigi Panico 8, Daniela Fanni 9, Raffaella Santi 10, Cecilia Caprera 11, Cristiana Rossi 12, Alessandra Soriano 13,14, Alberto Cavazza 1, Alessandro Giunta 5, Cristina Mecucci 15, Alessandro M. Vannucchi 2,3, Stefano A. Pileri 16 and Stefano Ascani 11,15 1 Pathology Unit, Azienda Unità Sanitaria Locale—IRCCS di Reggio Emilia, 42123 Reggio Emilia, Italy; [email protected] (M.Z.); [email protected] (A.C.) 2 Department of Experimental and Clinical Medicine, University of Florence, 50134 Florence, Italy; gloscocco@unifi.it (G.G.L.); a.vannucchi@unifi.it (A.M.V.) 3 Center of Research and Innovation of Myeloproliferative Neoplasms (CRIMM), Azienda Ospedaliero-Universitaria Careggi, 50139 Florence, Italy 4 Citation: Zanelli, M.; Loscocco, G.G.; Haematopathology Unit, IRCCS Azienda Ospedaliero-Universitaria di Bologna, 40138 Bologna, Italy; Sabattini, E.; Zizzo, M.; [email protected] 5 Sanguedolce, F.; Panico, L.; Fanni, D.; Surgical Oncology Unit, Azienda Unità Sanitaria Locale—IRCCS di Reggio Emilia, 42123 Reggio Emilia, Italy; [email protected] Santi, R.; Caprera, C.; Rossi, C.; et al. 6 Clinical and Experimental Medicine PhD Program, University of Modena and Reggio Emilia, T-Cell Lymphoblastic Lymphoma 41121 Modena, Italy Arising in the Setting of 7 Pathology Unit, Azienda Ospedaliero-Universitaria—Ospedali Riuniti di Foggia, 71122 Foggia, Italy; Myeloid/Lymphoid Neoplasms with [email protected] Eosinophilia: LMO2 8 Pathology Unit Azienda Ospedaliera dei Colli Monaldi-Cotugno-CTO, P.O.
    [Show full text]
  • Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham a Thesis Submitted in Conformity
    Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Edward James Higginbotham 2020 i Abstract Characterizing Genomic Duplication in Autism Spectrum Disorder Edward James Higginbotham Master of Science Graduate Department of Molecular Genetics University of Toronto 2020 Duplication, the gain of additional copies of genomic material relative to its ancestral diploid state is yet to achieve full appreciation for its role in human traits and disease. Challenges include accurately genotyping, annotating, and characterizing the properties of duplications, and resolving duplication mechanisms. Whole genome sequencing, in principle, should enable accurate detection of duplications in a single experiment. This thesis makes use of the technology to catalogue disease relevant duplications in the genomes of 2,739 individuals with Autism Spectrum Disorder (ASD) who enrolled in the Autism Speaks MSSNG Project. Fine-mapping the breakpoint junctions of 259 ASD-relevant duplications identified 34 (13.1%) variants with complex genomic structures as well as tandem (193/259, 74.5%) and NAHR- mediated (6/259, 2.3%) duplications. As whole genome sequencing-based studies expand in scale and reach, a continued focus on generating high-quality, standardized duplication data will be prerequisite to addressing their associated biological mechanisms. ii Acknowledgements I thank Dr. Stephen Scherer for his leadership par excellence, his generosity, and for giving me a chance. I am grateful for his investment and the opportunities afforded me, from which I have learned and benefited. I would next thank Drs.
    [Show full text]
  • Identification of Disease Gene Variants That Can Lead to Familial Myelodysplasia and Acute Myeloid Leukaemia
    Identification of disease gene variants that can lead to familial myelodysplasia and acute myeloid leukaemia A thesis submitted for the degree of PhD Shirleny Romualdo Cardoso Supervisors: Professor Inderjeet Dokal, and Professor Tom Vulliamy Centre for Genomics and Child Health, Blizard Institute Barts and The London School of Medicine & Dentistry, Queen Mary University of London In loving memory of my beloved sister Karla Romualdo Cardoso 2 I, Shirleny Romualdo Cardoso, confirm that the research included within this thesis is my own work or that where it has been carried out in collaboration with, or supported by others, that this is duly acknowledged below and my contribution indicated. Previously published material is also acknowledged below. I attest that I have exercised reasonable care to ensure that the work is original, and does not to the best of my knowledge break any UK law, infringe any third party’s copyright or other Intellectual Property Right, or contain any confidential material. I accept that the College has the right to use plagiarism detection software to check the electronic version of the thesis. I confirm that this thesis has not been previously submitted for the award of a degree by this or any other university. The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without the prior written consent of the author. Shirleny Romualdo Cardoso 3 Abstract Myelodysplasia (MDS) is characterised by inefficient haematopoiesis with dysplastic features of blood and bone marrow, reduction of mature blood cells and continuous bone marrow failure (BMF).
    [Show full text]
  • Cancer Drug Resistance
    Cowell et al. Cancer Drug Resist 2021;4:607-19 Cancer DOI: 10.20517/cdr.2021.30 Drug Resistance Review Open Access Mechanisms of resistance to FGFR1 inhibitors in FGFR1-driven leukemias and lymphomas: implications for optimized treatment John K. Cowell, Tianxiang Hu Georgia Cancer Center, 1410 Laney Walker Blvd, Augusta, GA 30912, USA. Correspondence to: Prof. John K. Cowell, CN2133, Georgia Cancer Center, 1410 Laney Walker Blvd, Augusta, GA 30912, USA. E- mail: [email protected] How to cite this article: Cowell JK, Hu T. Mechanisms of resistance to FGFR1 inhibitors in FGFR1-driven leukemias and lymphomas: implications for optimized treatment. Cancer Drug Resist 2021;4:607-19. https://dx.doi.org/10.20517/cdr.2021.30 Received: 6 Apr 2021 First Decision: 28 Apr 2021 Revised: 14 May 2021 Accepted: 24 May 2021 First online: 25 May 2021 Academic Editor: Godefridus J. Peters Copy Editor: Yue-Yue Zhang Production Editor: Yue-Yue Zhang Abstract Myeloid and lymphoid neoplasms with eosinophilia and FGFR1 rearrangements (MLN-eo FGFR1) disease is derived from a pluripotent hematopoietic stem cell and has a complex presentation with a myeloproliferative disorder with or without eosinophilia and frequently presents with mixed lineage T- or B-lymphomas. The myeloproliferative disease frequently progresses to AML and lymphoid neoplasms can develop into acute lymphomas. No matter the cell type involved, or clinical presentation, chromosome translocations involving the FGFR1 kinase and various partner genes, which leads to constitutive activation of downstream oncogenic signaling cascades. These patients are not responsive to treatment regimens developed for other acute leukemias and survival is poor.
    [Show full text]
  • ZBTB33 Is Mutated in Clonal Hematopoiesis and Myelodysplastic Syndromes and Impacts RNA Splicing
    RESEARCH ARTICLE ZBTB33 Is Mutated in Clonal Hematopoiesis and Myelodysplastic Syndromes and Impacts RNA Splicing Ellen M. Beauchamp1,2, Matthew Leventhal1,2, Elsa Bernard3, Emma R. Hoppe4,5,6, Gabriele Todisco7,8, Maria Creignou8, Anna Gallì7, Cecilia A. Castellano1,2, Marie McConkey1,2, Akansha Tarun1,2, Waihay Wong1,2, Monica Schenone2, Caroline Stanclift2, Benjamin Tanenbaum2, Edyta Malolepsza2, Björn Nilsson1,2,9, Alexander G. Bick2,10,11, Joshua S. Weinstock12, Mendy Miller2, Abhishek Niroula1,2, Andrew Dunford2, Amaro Taylor-Weiner2, Timothy Wood2, Alex Barbera2, Shankara Anand2; Bruce M. Psaty13,14, Pinkal Desai15, Michael H. Cho16,17, Andrew D. Johnson18, Ruth Loos19,20; for the NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium; Daniel G. MacArthur2,21,22,23, Monkol Lek2,21,24; for the Exome Aggregation Consortium, Donna S. Neuberg25, Kasper Lage2,26, Steven A. Carr2, Eva Hellstrom-Lindberg8, Luca Malcovati7, Elli Papaemmanuil3, Chip Stewart2, Gad Getz2,27,28, Robert K. Bradley4,5,6, Siddhartha Jaiswal29, and Benjamin L. Ebert1,2,30 Downloaded from https://bloodcancerdiscov.aacrjournals.org by guest on September 30, 2021. Copyright 2021 American Copyright 2021 by AssociationAmerican for Association Cancer Research. for Cancer Research. ABSTRACT Clonal hematopoiesis results from somatic mutations in cancer driver genes in hematopoietic stem cells. We sought to identify novel drivers of clonal expansion using an unbiased analysis of sequencing data from 84,683 persons and identified common mutations in the 5-methylcytosine reader ZBTB33 as well as in YLPM1, SRCAP, and ZNF318. We also identified these mutations at low frequency in patients with myelodysplastic syndrome. Zbtb33-edited mouse hematopoietic stem and progenitor cells exhibited a competitive advantage in vivo and increased genome-wide intron retention.
    [Show full text]
  • A Global Transcriptional Network Connecting Noncoding Mutations to Changes in Tumor Gene Expression
    ARTICLES https://doi.org/10.1038/s41588-018-0091-2 A global transcriptional network connecting noncoding mutations to changes in tumor gene expression Wei Zhang 1,8*, Ana Bojorquez-Gomez1,8, Daniel Ortiz Velez2, Guorong Xu3, Kyle S. Sanchez1, John Paul Shen 1, Kevin Chen2, Katherine Licon1, Collin Melton4, Katrina M. Olson1,5, Michael Ku Yu1, Justin K. Huang1,6, Hannah Carter 1, Emma K. Farley1,5, Michael Snyder4, Stephanie I. Fraley2, Jason F. Kreisberg1* and Trey Ideker 1,2,6,7* Although cancer genomes are replete with noncoding mutations, the effects of these mutations remain poorly characterized. Here we perform an integrative analysis of 930 tumor whole genomes and matched transcriptomes, identifying a network of 193 noncoding loci in which mutations disrupt target gene expression. These ‘somatic eQTLs’ (expression quantitative trait loci) are frequently mutated in specific cancer tissues, and the majority can be validated in an independent cohort of 3,382 tumors. Among these, we find that the effects of noncoding mutations on DAAM1, MTG2 and HYI transcription are recapitu- lated in multiple cancer cell lines and that increasing DAAM1 expression leads to invasive cell migration. Collectively, the non- coding loci converge on a set of core pathways, permitting a classification of tumors into pathway-based subtypes. The somatic eQTL network is disrupted in 88% of tumors, suggesting widespread impact of noncoding mutations in cancer. uman cancers are fundamentally heterogeneous, with many Results distinct subtypes associated with differences
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • ZFP91 (NM 053023) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC208217 ZFP91 (NM_053023) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ZFP91 (NM_053023) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ZFP91 Synonyms: DMS-8; DSM-8; DSM8; FKSG11; PZF; ZFP-91; ZNF757 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 ZFP91 (NM_053023) Human Tagged ORF Clone – RC208217 ORF Nucleotide >RC208217 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGGGGGAGACGGAAGAGCCGAGACCCCCGGAGCAGCAGGACCAGGAAGGGGGAGAGGCGGCCAAGG CGGCTCCGGAGGAGCCCCAACAACGGCCCCCTGAGGCGATCGCGGCGGCGCCTGCAGGGACCACTAGCAG CCGCGTGCTGAGGGGAGGTCGGGACCGAGGCCGGGCCGCTGCGGCCGCCGCCGCCGCAGCTGTGTCCCGC CGGAGGAAGGCCGAGTATCCCCGCCGGCGGAGGAGCAGCCCCAGCGCCAGGCCTCCCGACGTCCCCGGGC AGCAGCCCCAGGCCGCGAAGTCCCCGTCTCCAGTTCAGGGCAAGAAGAGTCCGCGACTCCTATGCATAGA AAAAGTAACAACTGATAAAGATCCCAAGGAAGAAAAAGAGGAAGAAGACGATTCTGCCCTCCCTCAGGAA GTTTCCATTGCTGCATCTAGACCTAGCCGGGGCTGGCGTAGTAGTAGGACATCTGTTTCTCGCCATCGTG ATACAGAGAACACCCGAAGCTCTCGGTCCAAGACCGGTTCATTGCAGCTCATTTGCAAGTCAGAACCAAA TACAGACCAACTTGATTATGATGTTGGAGAAGAGCATCAGTCTCCAGGTGGCATTAGTGAAGAGGAAGAG
    [Show full text]