DOCSLIB.ORG

Microphthalmia-Associated Transcription Factor Is a Critical Transcriptional Regulator of Melanoma Inhibitor of Apoptosis in Melanomas

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microphthalmia-Associated Transcription Factor Is a Critical Transcriptional Regulator of Melanoma Inhibitor of Apoptosis in Melanomas Research Article Microphthalmia-Associated Transcription Factor Is a Critical Transcriptional Regulator of Melanoma Inhibitor of Apoptosis in Melanomas Jasmin N. Dynek,1 Sara M. Chan,2 Jinfeng Liu,3 Jiping Zha,2 Wayne J. Fairbrother,1 and Domagoj Vucic1 Departments of 1Protein Engineering, 2Pathology, and 3Bioinformatics, Genentech, Inc., South San Francisco, California Abstract execution of programmed cell death (6, 7). X chromosome–linked Melanoma inhibitor of apoptosis (ML-IAP) is a potent IAP (XIAP) protein is an IAP family member that can bind to and potently inhibit caspase-3, caspase-7, and caspase-9 (8). After cells inhibitor of apoptosis, which is highly expressed in melano- mas and likely contributes to their resistance to chemother- receive death stimuli, second mitochondria-derived activator of apeutic treatments. Herein, we show that the lineage survival caspases (SMAC) is released from mitochondria into the cytosol oncogene microphthalmia-associated transcription factor where it binds to XIAP and abrogates its caspase-inhibitory (MITF) is a critical regulator of ML-IAP transcription in activity (9, 10). ML-IAP, on the other hand, seems to primarily melanoma cells. The ML-IAP promoter contains two MITF exert its prosurvival properties by binding to SMAC via its consensus sites, and analysis of MITF and ML-IAP mRNA levels conserved baculovirus IAP repeat (BIR) domain, overcoming revealed a high correlation in melanoma tumor samples and SMAC antagonism of XIAP-mediated caspase inhibition, and thus effectively halting apoptosis (2, 4, 11). cell lines. In reporter assays, MITF promoted a strong ML-IAP stimulation of transcriptional activity from the ML-IAP At present, little is known about how tissue- and tumor- specific expression is achieved. In this study, we focused specifically promoter, and MITF bound the endogenous ML-IAP promoter on elucidation of a molecular mechanism for transcriptional in melanoma cells by chromatin immunoprecipitation and regulation of ML-IAP in melanoma. Melanoma is a neoplasm that electrophoretic mobility shift assay. Strikingly, small interfer- originates from melanocytes and is highly resistant to chemother- ing RNA (siRNA)–mediated knockdown of MITF in melanoma apeutic and radiological treatments (12). ML-IAP has been shown cells led to a dramatic decrease in ML-IAP mRNA and protein to be highly expressed in the majority of melanoma patient levels, establishing that ML-IAP expression in melanoma cells samples surveyed, as well as in a number of melanoma cell lines is MITF dependent. Additionally, cyclic AMP–mediated induc- (2, 13). However, in the same studies, ML-IAP expression was not tion of MITF expression in melanocytes resulted in increased detected in benign melanocytic proliferation or normal melano- ML-IAP expression, suggesting that melanocytes can express cytes (2, 13). Mechanisms describing how ML-IAP expression may ML-IAP when MITF levels are heightened. Disruption of MITF be up-regulated during melanocytic transformation have not yet by siRNA led to a decrease in melanoma cell viability, which been reported, although it is noteworthy that ML-IAP maps to could be rescued by ectopic expression of ML-IAP. Collectively, 20q13.3, a region frequently amplified in melanomas (14). these findings implicate MITF as a major transcriptional Understanding the regulation of ML-IAP expression in melanomas regulator of ML-IAP expression in melanomas, and suggest may contribute to the ongoing efforts to overcome resistance to that ML-IAP contributes to the prosurvival activity of MITF in apoptosis in melanoma through apoptosis-based therapeutics (15). melanoma progression. [Cancer Res 2008;68(9):3124–32] Microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix-leucine zipper protein (16). Nine different Introduction isoforms of MITF with various tissue specific expression patterns Inhibitor of apoptosis (IAP) proteins are a family of have been reported, including the melanocyte-specific isoform antiapoptotic regulators that block cell death in response to MITF-M (17). The MITF-M isoform is expressed specifically in diverse stimuli through interactions with inducers and effectors of melanocytes and melanomas where it transcriptionally regulates apoptosis (1). Melanoma IAP (ML-IAP; also known as Livin, KIAP, genes for melanogenesis, cell survival, and differentiation (16). A and BIRC7) is a potent antiapoptotic protein that is highly nonfunctional mutation of the Mitf gene in mice leads to a expressed in melanomas and other cancers, but not in most adult complete absence of melanocytes and consequent lack of coat tissues (2–5). IAP proteins inhibit apoptotic stimuli that signal color (16). In humans, MITF mutation causes Waardenburg either intrinsically, such as intracellular damage, or extrinsically, syndrome type IIA, resulting in melanocyte deficiencies in the in the case of signaling via death receptor complexes, pathways skin and inner ear, hypopigmentation, and deafness (18). The (1). These stimuli lead to activation of caspases, cysteine- MITF gene is amplified in 15% to 20% of metastatic melanomas dependent aspartyl-specific proteases that are critical for the (19), and it is considered a lineage survival oncogene due to its requirement for melanocyte proliferation and differentiation and high expression level in the majority of melanomas (16, 20). As a Note: Supplementary data for this article are available at Cancer Research Online member of the MYC family of transcription factors, MITF binds (http://cancerres.aacrjournals.org/). Requests for reprints: Domagoj Vucic, Department of Protein Engineering, to the consensus E box sequence CA(C/T)GTG (21–23) within Genentech, Inc., 1 DNA Way, M/S 40, South San Francisco, CA 94080. Phone: 650-225- target genes such as cyclin-dependent kinase 2 (CDK2) and the 8839; Fax: 650-225-6127; E-mail: [email protected]. BCL-2 I2008 American Association for Cancer Research. antiapoptotic factor (24, 25). To date, both CDK2 and Bcl-2 doi:10.1158/0008-5472.CAN-07-6622 have been implicated as important mediators of the effects of Cancer Res 2008; 68: (9). May 1, 2008 3124 www.aacrjournals.org MITF Regulates ML-IAP Transcription in Melanomas MITF on melanoma proliferation and survival (24, 25). However, the RNeasy MiniKit (all Qiagen). For real-time PCR analysis, 100 ng of total there are likely additional MITF targets that also contribute to the RNA were used per standard 50-AL reaction volume. Fold change in gene role of MITF in melanomas. expression was calculated using the comparative CT method of relative Here we report that the ML-IAP promoter contains two quantitation. Standard curves were generated for all primer probe sets to confirm linearity of signals and relative efficiency over the experimentally functional MITF binding sites and that ML-IAP and MITF-M measured ranges. The following sequences were used: for detection of ML- mRNA levels are well correlated in melanoma patient samples IAP, 5¶-TTCCCCGACCACCGC (F), 5¶-AAACAGGTACAGTTAAGCCATCCC (R), ML-IAP and cell lines. We show that MITF binds to the promoter and 5¶-FAM-AGGAGGCCCTTGCTTGGCGTG-TAMRA (probe); for ML-IAP and transcriptionally regulates expression using luciferase MITF-M, 5¶-TCTCTTTGCCAGTCCATCTTCA (F), 5¶-CTGCACCTGATAGT- reporter assays, chromatin immunoprecipitation, electrophoretic GATTATATTCTAGCA (R), and 5¶-FAM-ACCGTCTCTCACTGGATTGG- mobility shift assay, and small interfering RNA (siRNA) knock- TGCCA-TAMRA (probe); for Axin2, 5¶-CTCCGTGTGTCGCCCTAT (F), 5¶- down of MITF in melanoma cells. Additionally, up-regulation of CATGACAAAAGTCATTGAGTACAAGA (R), and 5¶-FAM-TTGAGGGCT- MITF expression in melanocytes and melanoma cells was CAAGCTTTCCCTTGT-TAMRA (probe); for p21, 5¶-AACACCTTC- ¶ ¶ sufficient to elevate ML-IAP mRNA levels. Lastly, MITF modula- CAGCTCCTGTAACATA (F), 5 -GGGAACCAGGACACATGGG (R), and 5 - ¶ tion of ML-IAP expression was shown to play a vital role in FAM-TGGCCTGGACTGTTTTCTCTCGGC-TAMRA (probe); for MCP-1, 5 - GGGAAATTGCTTTTCCTCTTGA (F), 5¶-CTTTGTATTAATGATTCTTGCAAA- melanoma cell survival. GACC (R), and 5¶-FAM-CCACAGTTCTACCCCTGGGATGTTTTGA-TAMRA (probe); and for hRPL19, 5¶-AGCGGATTCTCATGGAACA (F), 5¶- Materials and Methods CTGGTCAGCCAGGAGCTT (R), and 5¶-FAM-TCCACAAGCTGAAGGCAGA- Cell culture and media. A375, A2058, SK-MEL-28, and UACC62 human CAAGG-TAMRA (probe). melanoma and Hek293T human embryonic kidney cells were obtained from Construction and mutagenesis of ML-IAP reporter constructs. A ¶ American Type Culture Collection and maintained in 50:50 RPMI 1640/ 2.8-kb fragment containing the 5 -untranslated region and upstream DMEM with 10% fetal bovine serum (FBS). 888 and 624 melanoma cells sequence of ML-IAP was amplified from human BAC clone 3243M2 ¶ were maintained in DMEM with 10% FBS in the absence of antibiotics (as (Invitrogen) using primers 5 -CACCCCACGGTATCATCCTGCAAAGCTGC ¶ described in ref. 2). Normal human epidermal melanocytes were purchased (F) and 5 -CTTGGCACTGTCTTTAGGTCCCATGGAG (R). The smaller from Cambrex and maintained in MBM-4 medium supplemented with the 1.6-kb fragment ML-IAP Pro 4 was subsequently amplified from the ¶ MGM-4 bullet kit (all Cambrex). 2.8-kb fragment using the primers 5 -GACTCTCGAGGAGC- ¶ In situ hybridization. PCR primers were designed to amplify a 447- CTTCTCTGCTTCCG (F) and 5 -GCTAAAGCTTGGAGGGAACACTGG- bp fragment of human ML-IAP spanning nucleotides (nt) 21 to 447 of CTCTG (R). The other ML-IAP promoter constructs were amplified from NM_139317.1 (upper, 5¶-CAAGTGCCTGCACCGTGGACC-3¶;lower,5¶- either
Load more

Recommended publications
  • BIRC7 Sirna (Human)
    For research purposes only, not for human use Product Data Sheet BIRC7 siRNA (Human) Catalog # Source Reactivity Applications CRJ2387 Synthetic H RNAi Description siRNA to inhibit BIRC7 expression using RNA interference Specificity BIRC7 siRNA (Human) is a target-specific 19-23 nt siRNA oligo duplexes designed to knock down gene expression. Form Lyophilized powder Gene Symbol BIRC7 Alternative Names KIAP; LIVIN; MLIAP; RNF50; Baculoviral IAP repeat-containing protein 7; Kidney inhibitor of apoptosis protein; KIAP; Livin; Melanoma inhibitor of apoptosis protein; ML-IAP; RING finger protein 50 Entrez Gene 79444 (Human) SwissProt Q96CA5 (Human) Purity > 97% Quality Control Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency. Components We offers pre-designed sets of 3 different target-specific siRNA oligo duplexes of human BIRC7 gene. Each vial contains 5 nmol of lyophilized siRNA. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. Our siRNA oligos are also chemically modified (2’-OMe) at no extra charge for increased stability and Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry,
    [Show full text]
  • Genome Wide Association Study of Response to Interval and Continuous Exercise Training: the Predict‑HIIT Study Camilla J
    Williams et al. J Biomed Sci (2021) 28:37 https://doi.org/10.1186/s12929-021-00733-7 RESEARCH Open Access Genome wide association study of response to interval and continuous exercise training: the Predict-HIIT study Camilla J. Williams1†, Zhixiu Li2†, Nicholas Harvey3,4†, Rodney A. Lea4, Brendon J. Gurd5, Jacob T. Bonafglia5, Ioannis Papadimitriou6, Macsue Jacques6, Ilaria Croci1,7,20, Dorthe Stensvold7, Ulrik Wislof1,7, Jenna L. Taylor1, Trishan Gajanand1, Emily R. Cox1, Joyce S. Ramos1,8, Robert G. Fassett1, Jonathan P. Little9, Monique E. Francois9, Christopher M. Hearon Jr10, Satyam Sarma10, Sylvan L. J. E. Janssen10,11, Emeline M. Van Craenenbroeck12, Paul Beckers12, Véronique A. Cornelissen13, Erin J. Howden14, Shelley E. Keating1, Xu Yan6,15, David J. Bishop6,16, Anja Bye7,17, Larisa M. Haupt4, Lyn R. Grifths4, Kevin J. Ashton3, Matthew A. Brown18, Luciana Torquati19, Nir Eynon6 and Jef S. Coombes1* Abstract Background: Low cardiorespiratory ftness (V̇O2peak) is highly associated with chronic disease and mortality from all causes. Whilst exercise training is recommended in health guidelines to improve V̇O2peak, there is considerable inter-individual variability in the V̇O2peak response to the same dose of exercise. Understanding how genetic factors contribute to V̇O2peak training response may improve personalisation of exercise programs. The aim of this study was to identify genetic variants that are associated with the magnitude of V̇O2peak response following exercise training. Methods: Participant change in objectively measured V̇O2peak from 18 diferent interventions was obtained from a multi-centre study (Predict-HIIT). A genome-wide association study was completed (n 507), and a polygenic predictor score (PPS) was developed using alleles from single nucleotide polymorphisms= (SNPs) signifcantly associ- –5 ated (P < 1 ­10 ) with the magnitude of V̇O2peak response.
    [Show full text]
  • XIAP's Profile in Human Cancer
    biomolecules Review XIAP’s Profile in Human Cancer Huailu Tu and Max Costa * Department of Environmental Medicine, Grossman School of Medicine, New York University, New York, NY 10010, USA; [email protected] * Correspondence: [email protected] Received: 16 September 2020; Accepted: 25 October 2020; Published: 29 October 2020 Abstract: XIAP, the X-linked inhibitor of apoptosis protein, regulates cell death signaling pathways through binding and inhibiting caspases. Mounting experimental research associated with XIAP has shown it to be a master regulator of cell death not only in apoptosis, but also in autophagy and necroptosis. As a vital decider on cell survival, XIAP is involved in the regulation of cancer initiation, promotion and progression. XIAP up-regulation occurs in many human diseases, resulting in a series of undesired effects such as raising the cellular tolerance to genetic lesions, inflammation and cytotoxicity. Hence, anti-tumor drugs targeting XIAP have become an important focus for cancer therapy research. RNA–XIAP interaction is a focus, which has enriched the general profile of XIAP regulation in human cancer. In this review, the basic functions of XIAP, its regulatory role in cancer, anti-XIAP drugs and recent findings about RNA–XIAP interactions are discussed. Keywords: XIAP; apoptosis; cancer; therapeutics; non-coding RNA 1. Introduction X-linked inhibitor of apoptosis protein (XIAP), also known as inhibitor of apoptosis protein 3 (IAP3), baculoviral IAP repeat-containing protein 4 (BIRC4), and human IAPs like protein (hILP), belongs to IAP family which was discovered in insect baculovirus [1]. Eight different IAPs have been isolated from human tissues: NAIP (BIRC1), BIRC2 (cIAP1), BIRC3 (cIAP2), XIAP (BIRC4), BIRC5 (survivin), BIRC6 (apollon), BIRC7 (livin) and BIRC8 [2].
    [Show full text]
  • An Integrative Systems Biology Approach Identifies Molecular
    Journal of Clinical Medicine Article An Integrative Systems Biology Approach Identifies Molecular Signatures Associated with Gallbladder Cancer Pathogenesis Nabanita Roy 1 , Mrinmoy Kshattry 1, Susmita Mandal 2, Mohit Kumar Jolly 2 , Dhruba Kumar Bhattacharyya 3 and Pankaj Barah 1,* 1 Department of Molecular Biology and Biotechnology, Tezpur University, Sonitpur 784028, India; [email protected] (N.R.); [email protected] (M.K.) 2 Centre for BioSystems Science and Engineering, Indian Institute of Science, Bangalore 560012, India; [email protected] (S.M.); [email protected] (M.K.J.) 3 Department of Computer Science and Engineering, Tezpur University, Sonitpur 784028, India; [email protected] * Correspondence: [email protected]; Tel.: +91-3712-27-5415 Abstract: Gallbladder cancer (GBC) has a lower incidence rate among the population relative to other cancer types but is a major contributor to the total number of biliary tract system cancer cases. GBC is distinguished from other malignancies by its high mortality, marked geographical variation and poor prognosis. To date no systemic targeted therapy is available for GBC. The main objective of this study is to determine the molecular signatures correlated with GBC development using integrative systems level approaches. We performed analysis of publicly available transcriptomic data to identify differentially regulated genes and pathways. Differential co-expression network analysis and transcriptional regulatory network analysis was performed to identify hub genes and Citation: Roy, N.; Kshattry, M.; hub transcription factors (TFs) associated with GBC pathogenesis and progression. Subsequently, we Mandal, S.; Jolly, M.K.; Bhattacharyya, assessed the epithelial-mesenchymal transition (EMT) status of the hub genes using a combination D.K.; Barah, P.
    [Show full text]
  • Microphthalmia-Associated Transcription Factor Controls the DNA Damage Response and a Lineage-Specific Senescence Program in Melanomas
    Published OnlineFirst April 13, 2010; DOI: 10.1158/0008-5472.CAN-09-2913 Tumor and Stem Cell Biology Cancer Research Microphthalmia-Associated Transcription Factor Controls the DNA Damage Response and a Lineage-Specific Senescence Program in Melanomas Sandy Giuliano1,2, Yann Cheli1,2, Mickaël Ohanna1,2, Caroline Bonet1,2, Laurent Beuret1,2, Karine Bille1,2, Agnès Loubat2,4, Véronique Hofman2,5, Paul Hofman2,5, Gilles Ponzio2,4, Philippe Bahadoran3, Robert Ballotti1,2, and Corine Bertolotto1,2 Abstract Apoptosis and senescence are cellular failsafe programs that counteract excessive mitogenic signaling ob- served in cancer cells. Melanoma is known for its notorious resistance to apoptotic processes; therefore, se- nescence, which remains poorly understood in melanomas, can be viewed as a therapeutic alternative. Microphthalmia-associated transcription factor (MITF), in which its M transcript is specifically expressed in melanocyte cells, plays a critical role in melanoma proliferation, and its specific inhibition is associated with G0-G1 growth arrest. Interestingly, decreased MITF expression has been described in senescent melano- cytes, and we have observed an inhibition of MITF expression in melanoma cells exposed to chemotherapeutic drugs that induce their senescence. All these observations thereby question the role of MITF in controlling senescence in melanoma cells. Here, we report that long-term depletion of MITF in melanoma cells triggers a senescence program characterized by typical morphologic and biochemical changes associated with a sus- tained growth arrest. Further, we show that MITF-silenced cells engage a DNA damage response (DDR) sig- naling pathway, leading to p53 upregulation, which is critically required for senescence entry. This study uncovers the existence of a lineage-restricted DDR/p53 signaling pathway that is inhibited by MITF to prevent senescence and favor melanoma cell proliferation.
    [Show full text]
  • Gene Expression in the Mouse Eye: an Online Resource for Genetics Using 103 Strains of Mice
    Molecular Vision 2009; 15:1730-1763 <http://www.molvis.org/molvis/v15/a185> © 2009 Molecular Vision Received 3 September 2008 | Accepted 25 August 2009 | Published 31 August 2009 Gene expression in the mouse eye: an online resource for genetics using 103 strains of mice Eldon E. Geisert,1 Lu Lu,2 Natalie E. Freeman-Anderson,1 Justin P. Templeton,1 Mohamed Nassr,1 Xusheng Wang,2 Weikuan Gu,3 Yan Jiao,3 Robert W. Williams2 (First two authors contributed equally to this work) 1Department of Ophthalmology and Center for Vision Research, Memphis, TN; 2Department of Anatomy and Neurobiology and Center for Integrative and Translational Genomics, Memphis, TN; 3Department of Orthopedics, University of Tennessee Health Science Center, Memphis, TN Purpose: Individual differences in patterns of gene expression account for much of the diversity of ocular phenotypes and variation in disease risk. We examined the causes of expression differences, and in their linkage to sequence variants, functional differences, and ocular pathophysiology. Methods: mRNAs from young adult eyes were hybridized to oligomer microarrays (Affymetrix M430v2). Data were embedded in GeneNetwork with millions of single nucleotide polymorphisms, custom array annotation, and information on complementary cellular, functional, and behavioral traits. The data include male and female samples from 28 common strains, 68 BXD recombinant inbred lines, as well as several mutants and knockouts. Results: We provide a fully integrated resource to map, graph, analyze, and test causes and correlations of differences in gene expression in the eye. Covariance in mRNA expression can be used to infer gene function, extract signatures for different cells or tissues, to define molecular networks, and to map quantitative trait loci that produce expression differences.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Mouse Birc7 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Birc7 Knockout Project (CRISPR/Cas9) Objective: To create a Birc7 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Birc7 gene (NCBI Reference Sequence: NM_001163247 ; Ensembl: ENSMUSG00000038840 ) is located on Mouse chromosome 2. 7 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 6 (Transcript: ENSMUST00000108875). Exon 1~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit normal retinal morphology and function. Exon 1 starts from about 0.12% of the coding region. Exon 1~6 covers 100.0% of the coding region. The size of effective KO region: ~4181 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 Legends Exon of mouse Birc7 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • A Massively Parallel Barcoded Sequencing Pipeline Enables Generation of the First Orfeome and Interactome Map for Rice
    A massively parallel barcoded sequencing pipeline enables generation of the first ORFeome and interactome map for rice Shayne D. Wierbowskia,b,1, Tommy V. Vob,1,2, Pascal Falter-Braunc,d, Timothy O. Jobee, Lars H. Krusef, Xiaomu Weia, Jin Liangb, Michael J. Meyera,b, Nurten Akturkb, Christen A. Rivera-Erickb, Nicolas A. Corderob, Mauricio I. Paramob,g, Elnur E. Shayhidinb, Marta Bertolottib, Nathaniel D. Tippensa,b, Kazi Aktherh, Rita Sharmai, Yuichi Katayosej, Kourosh Salehi-Ashtianik,l,m,n, Tong Haol,m, Pamela C. Ronaldo,p,q, Joseph R. Eckerr,s, Peter A. Schweitzert, Shoshi Kikuchiu, Hiroshi Mizunov, David E. Hilll,m, Marc Vidall,m, Gaurav D. Moghef, Susan R. McCouchh,3, and Haiyuan Yua,b,3 aDepartment of Biological Statistics and Computational Biology, Cornell University, Ithaca, NY 14853; bWeill Institute for Cell and Molecular Biology, Cornell University, Ithaca, NY 14853; cInstitute of Network Biology, Helmholtz Zentrum München, German Research Center for Environmental Health, 85764 Munich, Germany; dMicrobe-Host Interactions, Faculty of Biology, Ludwig-Maximilians-Universität München, 80539 Munich, Germany; eBotanical Institute, Cluster of Excellence on Plant Sciences (CEPLAS), University of Cologne, 50674 Cologne, Germany; fPlant Biology Section, School of Integrative Plant Sciences, Cornell University, Ithaca, NY 14853; gDepartment of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853; hSection of Plant Breeding and Genetics, School of Integrated Plant Sciences, Cornell University, Ithaca, NY 14853-1901; iSchool
    [Show full text]
  • Genotype–Phenotype Correlations to Aid in the Prognosis Of
    European Journal of Human Genetics (2007) 15, 446–452 & 2007 Nature Publishing Group All rights reserved 1018-4813/07 $30.00 www.nature.com/ejhg ARTICLE Genotype–phenotype correlations to aid in the prognosis of individuals with uncommon 20q13.33 subtelomere deletions: a collaborative study on behalf of the ‘association des Cytoge´ne´ticiens de langue Franc¸aise’ Myle`ne Be´ri-Deixheimer1, Marie-Jose´ Gregoire1, Annick Toutain2, Kare`ne Brochet1, Sylvain Briault2, Jean-Luc Schaff3, Bruno Leheup4 and Philippe Jonveaux*,1 1Laboratoire de Ge´ne´tique, EA 4002, CHU, Nancy-University, France; 2Service de Ge´ne´tique, Hoˆpital Bretonneau, Tours, France; 3Service de neurologie, CHU, Nancy-Univeristy, France; 4Service de me´decine infantile et ge´ne´tique clinique, CHU, Nancy-Univeristy, France The identification of subtelomeric rearrangements as a cause of mental retardation has made a considerable contribution to diagnosing patients with mental retardation. It is remarkable that for certain subtelomeric regions, deletions have hardly ever been reported so far. All the laboratories from the ‘Association des Cytoge´ne´ticiens de Langue Franc¸aise’ were surveyed for cases where an abnormality of the subtelomere FISH analysis had been ascertained. Among 1511 cases referred owing to unexplained mental retardation, 115 (7.6%) patients showed a clinically significant subtelomeric abnormality. We report the clinical features and the molecular cytogenetic delineation of isolated de novo deletions on 20q13.33 in two cases. Detailed mapping was performed by micro-array CGH in one patient and confirmed by FISH in the two patients. We compare our data with the only three patients reported in the literature.
    [Show full text]
  • Candidate Genes Associated with Delayed Neuropsychomotor Development and Seizures in a Patient with Ring Chromosome 20
    Hindawi Case Reports in Genetics Volume 2020, Article ID 5957415, 6 pages https://doi.org/10.1155/2020/5957415 Case Report Candidate Genes Associated with Delayed Neuropsychomotor Development and Seizures in a Patient with Ring Chromosome 20 Thiago Correˆa ,1 Amanda Cristina Venaˆncio,2 Marcial Francis Galera,3 and Mariluce Riegel 1,4 1Genetics Department, Post-Graduate Program in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS, Brazil 2Post-Graduate Program in Health Sciences, Universidade Federal do Mato Grosso (UFMT), Cuiaba´, MT, Brazil 3Department of Pediatrics, Universidade Federal do Mato Grosso (UFMT), Cuiaba´, MT, Brazil 4Medical Genetics Service, Hospital de Cl´ınicas, Porto Alegre, RS, Brazil Correspondence should be addressed to Mariluce Riegel; [email protected] Received 4 November 2019; Accepted 17 December 2019; Published 21 January 2020 Academic Editor: Muhammad G. Kibriya Copyright © 2020 (iago Corrˆea et al. (is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ring chromosome 20 (r20) is characterized by intellectual impairment, behavioral disorders, and refractory epilepsy. We report a patient presenting nonmosaic ring chromosome 20 followed by duplication and deletion in 20q13.33 with seizures, delayed neuropsychomotor development and language, mild hypotonia, low weight gain, and cognitive deficit. Chromosomal microarray analysis (CMA) enabled us to restrict a chromosomal segment and thus integrate clinical and molecular data with systems biology. With this approach, we were able to identify candidate genes that may help to explain the consequences of deletions in 20q13.33.
    [Show full text]
  • Essential Role of Microphthalmia Transcription Factor for DNA Replication, Mitosis and Genomic Stability in Melanoma
    Oncogene (2011) 30, 2319–2332 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE Essential role of microphthalmia transcription factor for DNA replication, mitosis and genomic stability in melanoma T Strub1,4, S Giuliano2,4,TYe1, C Bonet2, C Keime1, D Kobi1, S Le Gras1, M Cormont3, R Ballotti2, C Bertolotto2 and I Davidson1 1Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, CNRS, INSERM, Universite´ de Strasbourg, Illkirch, France; 2INSERM U895 Team 1 and Department of Dermatology, CHU Nice, France and 3INSERM U895 Team 7, Nice, France Malignant melanoma is an aggressive cancer known use of internal promoters (Steingrimsson, 2008). The for its notorious resistance to most current therapies. MITF-M isoform (hereafter designated simply as The basic helix-loop-helix microphthalmia transcription MITF) is the major form produced specifically in the factor (MITF) is the master regulator determining the melanocyte lineage from an intronic promoter (Goding, identity and properties of the melanocyte lineage, and is 2000b). MITF is essential for the survival of melano- regarded as a lineage-specific ‘oncogene’ that has a blasts and postnatal melanocytes (McGill et al., 2002; critical role in the pathogenesis of melanoma. MITF Hou and Pavan, 2008), in which it also controls the promotes melanoma cell proliferation, whereas sustained expression of genes required for the melanin synthesis supression of MITF expression leads to senescence. (Bertolotto et al., 1998). By combining chromatin immunoprecipitation coupled to In addition to regulating multiple aspects of normal high throughput sequencing (ChIP-seq) and RNA sequen- melanocyte function, MITF also has a critical role in cing analyses, we show that MITF directly regulates a melanoma, in which it is required for survival, and set of genes required for DNA replication, repair and controls the proliferation, invasive and metastatic mitosis.
    [Show full text]