DOCSLIB.ORG

Antioxidant Property of Weissella Cibaria DMA 18 Isolated from Tender

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Antioxidant Property of Weissella Cibaria DMA 18 Isolated from Tender The Pharma Innovation Journal 2019; 8(9): 01-06 ISSN (E): 2277- 7695 ISSN (P): 2349-8242 NAAS Rating: 5.03 Antioxidant property of Weissella cibaria DMA 18 TPI 2019; 8(9): 01-06 © 2019 TPI isolated from tender coconut water www.thepharmajournal.com Received: 01-07-2019 Accepted: 03-08-2019 Amrutha TA, AK Beena, Aparna Sudhakaran V, Rejeesh R, Archana C Amrutha TA and Vinod V M. Tech scholar, Dept. of Dairy Microbiology College Of Dairy Abstract Science and Technology Kerala The objective of this study was to evaluate the functional properties of a lactic acid bacteria isolated from Veterinary and Animal Sciences tender coconut water. On the basis of biochemical characteristics and 16S rRNA sequencing, the isolate University, Mannuthy, Kerala, India was identified as Weissella cibaria, the sequence of which is deposited in NCBI with accession number MH782084. Acid tolerance, bile tolerance and adhesion potential were assessed in vitro. Weissella AK Beena cibaria DMA 18 strain was found to withstand pH 3.0 and 0.6% (w/v) concentration of bile salt Professor and Head, Dept. of environment for a period of 3h. Auto-aggregation and cell surface hydrophobicity of 83.78% and 89.1% Dairy Microbiology College of is suggestive of the good adhesion potential of the isolate. The non-haemolytic nature of the strain Dairy Science and Technology indicates the possible absence of virulence factors. Both the culture and crude EPS displayed remarkable Kerala Veterinary and Animal antioxidant DPPH assay revealed antioxidant activity of 27% and 33.55% respectively with sample Sciences University, Mannuthy, volumes as low as 10 µl and 6µl respectively. The results confirm the potential of Weissella cibaria Kerala, India DMA 18 to be used as a functional culture for designing foods to ameliorate disorders induced by oxidative stress. Aparna Sudhakaran V Asst. Professor, Dept. of Dairy Keywords: W. cibaria, exopolysaccharides, antioxidant activity, coconut water Microbiology College of Dairy Science and Technology Kerala Veterinary and Animal Sciences Introduction University, Mannuthy, Kerala, Oxidation is an integral metabolic reaction in all living cells. Presence of free radicals leads to India oxidative stress that is evidently harmful to human beings. The reactive oxygen species (ROS) are highly destructive to cells and for the same reason they play a crucial role in the initiation Rejeesh R Asst. Professor, Dept. of Dairy and progression of different disease conditions such as cancer, heart diseases, and [27] Microbiology College of Dairy inflammatory bowel disease (Valko et al., 2001) . With free radical species being identified Science and Technology, as responsible for augmented number of diseases, antioxidants are gaining more attention these Thiruvananthapuram Kerala days. Antioxidants are those substances, which can reduce the oxidative stress either by Veterinary and Animal Sciences preventing the formation of radicals, or by scavenging these radicals or by destroying them. University, Kerala, India Living organisms are well protected against free radical damage by enzymes such as, Archana C superoxide dismutase and catalase, or compounds such as ascorbic acid, tocopherol and Asst. Professor, Dept. of Dairy glutathione (Niki et al., 1994) [20]. Synthetic antioxidants such as butylated hydroxyanisole Microbiology College of Dairy (BHA), n-propyl gallate (PG) and butylated hydroxytoluene (BHT) also exhibit strong Science and Technology, antioxidant activity but their toxic nature pose potential risks. Antioxidants from natural Pookkode Kerala Veterinary and Animal Sciences University, sources are likely to be of more demand as the use of synthetic antioxidants food is restricted [26] Kerala, India or prohibited in many (Tayo et al., 2018) . Lactic acid bacteria and their metabolites are reported to impart numerous health benefits Vinod V when consumed. Major share of probiotic LAB mainly include members of the genera College of Dairy Science and Lactobacillus and Bifidobacterium. Members of Pediococcus, Weissella, Lactococcus and Technology, Mannuthy Kerala Veterinary and Animal Science Enterococcus are also being recognized for their health-promoting effects (Zommiti et al., [32] University, Kerala, India 2018) Lactic acid bacteria like W. confusa, L. plantarum, L. rhamnosus and L. mesenteroides have been proved to be capable of reducing free radicals in our body (Sharma et al., 2018, Le and Yang, 2018, Xing et al., 2015, Abubakr et al., 2012) [23, 16, 30, 1]. Exopolysaccharides, referred to as natural antioxidants can substitute synthetic antioxidants in Correspondence the proactive management of lifestyle diseases like heart disease, obesity, stroke and diabetes [19] Amrutha TA (Nampoothiri et al., 2016) . EPS produced by LAB are reported to have emulsifying, gelling M. Tech scholar, Dept. of Dairy and stabilizing properties. Health conscious population prefer low fat products but consumer Microbiology College Of Dairy appeal of these products are very much affected because of poor ‘mouth feel’. EPS being a Science and Technology Kerala natural bio thickener, exopolysaccharides producing lactic acid bacteria has ample scope to be Veterinary and Animal Sciences University, Mannuthy, Kerala, used in food industry for improving the rheological property of fermented milk products. India ~ 1 ~ The Pharma Innovation Journal This work attempted to evaluate the probiotic temperament of Bacterial cell surface hydrophobicity a LAB isolated from tender coconut water, a nutritious thirst The adhesion potential was measured in terms of Cell surface quenching fruit drink popular in the state of Kerala. hydrophobicity by BATH (Bacterial Adhesion to Hydrocarbons) assay (Collado et al., 2008) [6]. The isolates Materials and methods were grown in MRS broth for 16-18 h at 37 °C. Bacterial cells Isolation and identification of lactic acid bacteria in the stationary phase were harvested as pellets by Coconut water was collected aseptically from freshly refrigerated centrifugation at 4 0C for 12000rpm for 10 harvested tender coconut. A pre-enrichment was done initially minutes. After washing the cell pellet with phosphate buffered by transferring one millilitre of sample to five millilitre of saline (Himedia) thrice, pellet was suspended in the same MRS broth and incubating at 37 °C for 24h. Appropriate buffer to have an optical density of 0.25±.05 at 600 nm. To dilutions of these samples were pour plated in De 5ml of this suspension, equal volume of xylene was added Man, Rugose and Sharpe (MRS) agar and incubated at 37 °C and the two phase system was mixed thoroughly by vortexing for 48h so as to get well isolated discreet colonies. for five minutes. Immediately after vortexing, OD at 600nm Morphological and biochemical identification at preliminary was recorded. The vortexed samples were then kept at 37 ⁰C level was performed according to the methods described in for 1h to allow phase separation. The aqueous phase on the Berge’s Manual of systematic Bacteriology for identification top was pipetted out and OD at 600nm was determined. The of LAB (Holt et al., 1994) [15]. All the tests for identification percentage decrease in absorbance of the original suspension was carried out using freshly activated cultures in MRS broth. due to partitioning of cells was taken as the CSH value. The Molecular level confirmation of the isolate was done by 16S average of triplicate observations were recorded as result. The rRNA sequencing. The primers used were 16S-RS-F Forward CSH value was calculated using the formula. 5’CAGGCCTAACACATGCAAGTC3’ and 16S-RS-R Reverse 5’GGGCGGWGTGTACAAGGC3’. Hemolytic property The LAB strains were streaked on blood agar and incubated at Auto-aggregation 37 °C for 24h.. The LAB strains that produced green-hued MRS broth was inoculated with freshly activated culture at a zones around the colonies (alpha-haemolysis) or those that did level of one percent. After incubation at 37 °C for 18h, the not produce any effect on the blood agar (Gamma- hemolysis) cells were harvested by refrigerated centrifugation at 5000 g were considered non hemolytic. Those producing clear zones for 15 min, The cell pellet was washed twice with phosphate of RBC lysis around the colonies (Beta- hemolysis) were buffered saline (PBS) and then resuspended in same buffer so considered as haemolytic in nature (Adetoye et al., 2018) [2]. as to get an optical density of 0.60±0.02 at 600 nm. Four milliliters of this cell suspension was vortexed and 0.1 ml of Probiotic characterization of isolates this suspension was transferred to another tube with 3.9 ml of Probiotics bring about its beneficial effects by altering the PBS and the absorbance was measured at 600 nm (A1). The intestinal microflora in a way advantageous to the consumer. sample was kept undisturbed at 37 °C and OD of the sample So for an organism to be a potential probiotic candidate, it (A2) was determined again at 6h. should have the ability to withstand and surpass the harsh acid The auto-aggregation percentage was expressed as: and bile environment. Apart from these, ability to get attached to the intestinal mucosa is also equally important. These (Auto-aggregation) = [(A1 - A2)/ (A1) x 100] properties of the indigenous isolates obtained in this work were evaluated in terms of acid tolerance, bile tolerance and Where A1: initial optical density, A2: optical density after adhesion potential. incubation. Auto aggregation was calculated from three replicates as the Acid tolerance percentage decrease in absorbance
Load more

Recommended publications
  • Characterization of Weissella Koreensis SK Isolated From
    microorganisms Article Characterization of Weissella koreensis SK Isolated from Kimchi Fermented at Low Temperature ◦ (around 0 C) Based on Complete Genome Sequence and Corresponding Phenotype So Yeong Mun and Hae Choon Chang * Department of Food and Nutrition, Kimchi Research Center, Chosun University, 309 Pilmun-daero, Dong-gu, Gwangju 61452, Korea; [email protected] * Correspondence: [email protected] Received: 17 June 2020; Accepted: 28 July 2020; Published: 29 July 2020 Abstract: This study identified lactic acid bacteria (LAB) that play a major role in kimchi fermented at low temperature, and investigated the safety and functionality of the LAB via biologic and genomic analyses for its potential use as a starter culture or probiotic. Fifty LAB were isolated from 45 kimchi samples fermented at 1.5~0 C for 2~3 months. Weissella koreensis strains were determined as the − ◦ dominant LAB in all kimchi samples. One strain, W. koreensis SK, was selected and its phenotypic and genomic features characterized. The complete genome of W. koreensis SK contains one circular chromosome and plasmid. W. koreensis SK grew well under mesophilic and psychrophilic conditions. W. koreensis SK was found to ferment several carbohydrates and utilize an alternative carbon source, the amino acid arginine, to obtain energy. Supplementation with arginine improved cell growth and resulted in high production of ornithine. The arginine deiminase pathway of W. koreensis SK was encoded in a cluster of four genes (arcA-arcB-arcD-arcC). No virulence traits were identified in the genomic and phenotypic analyses. The results indicate that W. koreensis SK may be a promising starter culture for fermented vegetables or fruits at low temperature as well as a probiotic candidate.
    [Show full text]
  • Plant-Based Alternatives to Yogurt: State-Of-The-Art and Perspectives of New Biotechnological Challenges
    foods Review Plant-Based Alternatives to Yogurt: State-of-the-Art and Perspectives of New Biotechnological Challenges Marco Montemurro 1 , Erica Pontonio 1 , Rossana Coda 2,3 and Carlo Giuseppe Rizzello 4,* 1 Department of Soil, Plant, and Food Science, University of Bari Aldo Moro, 70126 Bari, Italy; [email protected] (M.M.); [email protected] (E.P.) 2 Department of Food and Nutrition, University of Helsinki, 00014 Helsinki, Finland; rossana.coda@helsinki.fi 3 Helsinki Institute of Sustainability Science, 00014 Helsinki, Finland 4 Department of Environmental Biology, “Sapienza” University of Rome, 00185 Rome, Italy * Correspondence: [email protected] Abstract: Due to the increasing demand for milk alternatives, related to both health and ethical needs, plant-based yogurt-like products have been widely explored in recent years. With the main goal to obtain snacks similar to the conventional yogurt in terms of textural and sensory properties and ability to host viable lactic acid bacteria for a long-time storage, several plant-derived ingredients (e.g., cereals, pseudocereals, legumes, and fruits) as well as technological solutions (e.g., enzymatic and thermal treatments) have been investigated. The central role of fermentation in yogurt-like production led to specific selections of lactic acid bacteria strains to be used as starters to guarantee optimal textural (e.g., through the synthesis of exo-polysaccharydes), nutritional (high protein digestibility and low content of anti-nutritional compounds), and functional (synthesis of bioactive compounds) features of the products. This review provides an overview of the novel insights on fermented yogurt-like products. The state-of-the-art on the use of unconventional ingredients, traditional and innovative biotechnological processes, and the effects of fermentation on the textural, Citation: Montemurro, M.; nutritional, functional, and sensory features, and the shelf life are described.
    [Show full text]
  • Dense Tracking of the Dynamics of the Microbial Community and Chemicals Constituents in Spontaneous Wheat Sourdough During Two Months of Backslopping
    Journal of Bioscience and Bioengineering VOL. 128 No. 2, 170e176, 2019 www.elsevier.com/locate/jbiosc Dense tracking of the dynamics of the microbial community and chemicals constituents in spontaneous wheat sourdough during two months of backslopping Mugihito Oshiro,1,2 Rie Momoda,1 Masaru Tanaka,1 Takeshi Zendo,1 and Jiro Nakayama1,* Laboratory of Microbial Technology, Division of Systems Bioengineering, Department of Bioscience and Biotechnology, Faculty of Agriculture, Graduate School, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395, Japan1 and Central Laboratory of Yamazaki Baking Company Limited, 3-23-27 Ichikawa, Ichikawa-shi, Chiba 272-8581, Japan2 Received 7 December 2018; accepted 12 February 2019 Available online 14 March 2019 Wheat sourdough is a common traditional fermented food that is produced worldwide. However, product quality of spontaneous sourdough is not easy to control because it depends on natural fermentation and backslopping, about which little is known, notably after ten backslopping steps. To this end, we tracked the spontaneous fermentation of three sourdoughs made from wheat flours during 32 backslopping steps for 60 days. At 24 time points, the microbial community was analyzed by both culture-dependent and culture-independent methods and its chemical constituents were assessed. Dynamic changes were observed in the microbial community, which showed a common succession pattern among the three sourdoughs at the bacterial family level and differences at the species level. The bacterial communities evolved through three phases that were driven by different groups of lactic acid bacteria (LAB) species. The dynamism among the metabolites also differed, depending on the species composition of the LAB and yeast commu- nities.
    [Show full text]
  • Evaluation of Weissella Cibaria JW15 Probiotic Derived from Fermented
    animals Article Evaluation of Weissella Cibaria JW15 Probiotic Derived from Fermented Korean Vegetable Product Supplementation in Diet on Performance Characteristics in Adult Beagle Dog Hao Yang Sun 1, Kun Phil Kim 1, Chun Ho Bae 2, Ae Jin Choi 3, Hyun Dong Paik 4 and In Ho Kim 1,* 1 Department of Animal Resource and Science, Dankook University, Cheonan 31116, Korea 2 Aram Co., Ltd. 54 Gyeongchung-daero 1234 beon-gil, Chowol-eup, Gwangju-si, Gyeonggi-do 12735, Korea 3 National Institute of Agricultural Science, Department of Agro-food Resources, 166 Nongsaengmyeong-ro, Iseo-myeon, Wanju-gun, Jeollabuk-do 55365, Korea 4 Department of Food Science and Biotechnology of Animal Resources, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Korea * Correspondence: [email protected]; Tel.: +82-41-550-3652; Fax: +82-41-559-7881 Received: 19 May 2019; Accepted: 14 August 2019; Published: 20 August 2019 Simple Summary: Dogs are the most popular companion animals worldwide, and their popularity is still increasing. Maintaining health and seeking optimal nutritional feed for dogs is an important component of responsible pet ownership. Probiotics have been widely used in animals; however, little research exists on some probiotic species which have been reported to have good probiotic properties. The present study investigated the effects of Weissella cibaria JW 15 isolated from the traditional Korean fermented vegetable product (kimchi) as a probiotic feed additive on the nutrition and health characteristics in the adult Beagle dogs. The results of this study indicated that Weissella cibaria probiotics have beneficial effects in dogs, which provide evidence and insight for the application of probiotics in dogs.
    [Show full text]
  • Effect of Weissella Cibaria on Fusobacterium Nucleatum-Induced Interleukin-6 and Interleukin-8 Production in KB Cells
    Journal of Bacteriology and Virology 2011. Vol. 41, No. 1 p.9 – 18 DOI 10.4167/jbv.2011.41.1.9 Original Article Effect of Weissella cibaria on Fusobacterium nucleatum-induced Interleukin-6 and Interleukin-8 Production in KB Cells * Mi-Sun Kang1, Hoi-Soon Lim2, Seon-Mi Kim2, Hyun-Chul Lee1 and Jong-Suk Oh1 1Department of Microbiology, School of Medicine, Chonnam National University, Gwangju, 2Dental Science Research Institute, Chonnam National University, Gwangju, Korea Oral microorganisms, including pathogens together with commensals, interact with oral epithelial cells, which can lead to the activation and expression of a variety of inflammatory mediators in epithelial cells. Fusobacterium nucleatum is a filamentous human pathogen that is strongly associated with periodontal diseases. Our previous data suggest that Weissella cibaria, an oral commensal, inhibits the proliferation of periodontopathic bacteria including F. nucleatum. The aim of this study was to examine the effects of W. cibaria on the inflammatory mediators, interleukin (IL)-6 and IL-8, in KB cells stimulated by F. nucleatum. In a reverse transcription-polymerase chain reaction and an enzyme-linked immunosorbent assay, live F. nucleatum alone induced high levels of gene expression and protein release of IL-6 and IL-8, whereas W. cibaria alone did not induce IL-6 and IL-8 responses in KB cells. W. cibaria dose-dependently inhibited the increases of the IL-6 and IL-8 gene expression as well as IL-6 protein level in KB cells which was induced by F. nucleatum. Bacterial viability and its coaggregation with F. nucleatum are not essential in the inhibitory effect of W.
    [Show full text]
  • Effects of Probiotic Bacterium Weissella Cibaria
    Kang et al. BMC Oral Health (2020) 20:243 https://doi.org/10.1186/s12903-020-01231-2 RESEARCH ARTICLE Open Access Effects of probiotic bacterium Weissella cibaria CMU on periodontal health and microbiota: a randomised, double-blind, placebo-controlled trial Mi-Sun Kang1, Dong-Suk Lee2, Seung-Ah Lee2, Myoung-Suk Kim2 and Seoul-Hee Nam3* Abstract Background: Weissella cibaria CMU (oraCMU) has been commercially available in the market for several years as oral care probiotics. The present study aimed to evaluate the effects of oraCMU-containing tablets on periodontal health and oral microbiota. Methods: A randomised, double-blind, placebo-controlled trial was conducted in 92 adults without periodontitis (20–39 years of age). All subjects received dental scaling and root planing, and were randomly assigned to either probiotic or placebo groups. The tablets were administered once daily for 8 weeks. Periodontal clinical parameters included bleeding on probing (BOP), probing depth (PD), gingival index (GI), and plaque index (PI). In addition, microbiota in the gingival sulcus were analysed. Results: BOP improved more in the probiotic group over 8 weeks. There were statistically significant differences in BOP of the maxilla buccal and lingual sites between the groups during the intervention (P < 0.05). No significant inter-group differences in PD, GI, and PI were observed during the intervention. Oral bacteria were observed to be fewer in the probiotic group. There was a significant change in levels of Fusobacterium nucleatum at four and 8 weeks between the two groups. Besides, there were significant differences at 8 weeks in levels of Staphylococcus aureus.
    [Show full text]
  • BMC Infectious Diseases Biomed Central
    BMC Infectious Diseases BioMed Central Research article Open Access Accuracies of Leuconostoc phenotypic identification: a comparison of API systems and conventional phenotypic assays Wanla Kulwichit*1, Sumanee Nilgate2, Tanittha Chatsuwan2, Sunisa Krajiw1, Chudaachhara Unhasuta2 and Anan Chongthaleong2 Address: 1Department of Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand and 2Department of Microbiology, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand Email: Wanla Kulwichit* - [email protected]; Sumanee Nilgate - [email protected]; Tanittha Chatsuwan - [email protected]; Sunisa Krajiw - [email protected]; Chudaachhara Unhasuta - [email protected]; Anan Chongthaleong - [email protected] * Corresponding author Published: 2 July 2007 Received: 10 September 2006 Accepted: 2 July 2007 BMC Infectious Diseases 2007, 7:69 doi:10.1186/1471-2334-7-69 This article is available from: http://www.biomedcentral.com/1471-2334/7/69 © 2007 Kulwichit et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Commercial diagnostics are commonly used to identify gram-positive bacteria. Errors have been reported mostly at the species level. We have found certain phenotypic criteria used in API systems which significantly misidentify Leuconostoc, an emerging human pathogen, at the genus level. We also attempt to find practical, conventional phenotypic assays for accurate identification of this group of bacteria. Methods: Clinical isolates of catalase-negative, gram-positive coccoid or coccobacillary bacteria with non-β hemolysis in our institute during 1997–2004 were subject to an identification aid by API 20 STREP, following the instruction manual, as an aid to conventional phenotypic tests.
    [Show full text]
  • The Role of Dextran Production in the Metabolic Context of Leuconostoc and Weissella Tunisian Strains
    The role of dextran production in the metabolic context of Leuconostoc and Weissella Tunisian strains 1 Norhane Besrour-Aouam1,2+, Imene Fhoula2+, Annel M. Hernández-Alcántara1 , Mª Luz Mohedano1, 2 Afef Najjari2, Alicia Prieto1, Patricia Ruas Madiedo3, Paloma López1* and Hadda-Imene Ouzari2 3 +Both of these authors contributed equally to the work 4 5 1 Margarita Salas Biological Research Centre, CIB-CSIC, Madrid, Spain 6 2 Laboratoire Microorganismes et Biomolécules Actives (LR03ES03), Faculté des Sciences de Tunis, 7 Université Tunis El Manar, Tunis, Tunisia66de Productos Lácteos de Asturias (IPLA), CSIC, 8 Villaviciosa, Asturias, Spain 9 *Corresponding author: Paloma López: Address: Margarita Salas Biological Research Centre. 10 Ramiro de Maeztu 9, 28040 Madrid, Spain. e-mail: [email protected]. Telephone: +34 91 837 31 12. 11 Fax: +34 91 538 04 32 12 e-mails: 13 Norhane Besrour-Aouam <[email protected]> 14 Imene Fhoula <[email protected]> 15 Annel M. Hernández-Alcántara <[email protected]> 16 Mª Luz Mohedano <[email protected]> 17 Afef Najjari<[email protected]> 18 Alicia Prieto <[email protected]> 19 Patricia Ruas Madiedo <[email protected]> 20 Hadda-Imene Ouzari <[email protected]> Abbreviations: cfu, colony forming unit; Dsr, dextransucrases; EPS, exppolysaccarides; HoPS, homopolysaccharudes; GC-MS, gas chromatography-mass spectrometry; LAB, lactic acid bacteria; LDH, lactate dehydrogenase; MDH, maplate dehydrogenase; NCBI, National Center or Biotechnology Information; PEP, phosphoenolpyruvate; PYR, pyruvate; TEM, transmission electronic microscopy 21 Abstract 22 High molecular weight dextrans improve the rheological properties of fermented products, and have 23 immunomodulatory and antiviral activity. We report on 5.84x107-2.61x108 Da dextrans produced by 24 Leuconostoc lactis AV1n, Weissella cibaria AV2ou, and Weissella confusa V30 and FS54 strains.
    [Show full text]
  • The Genus Weissella: Taxonomy, Ecology and Biotechnological Potential
    REVIEW published: 17 March 2015 doi: 10.3389/fmicb.2015.00155 The genus Weissella: taxonomy, ecology and biotechnological potential Vincenzina Fusco 1*, Grazia M. Quero 1, Gyu-Sung Cho 2, Jan Kabisch 2, Diana Meske 2, Horst Neve 2, Wilhelm Bockelmann 2 and Charles M. A. P. Franz 2 1 National Research Council of Italy, Institute of Sciences of Food Production, Bari, Italy, 2 Department of Microbiology and Biotechnology, Max Rubner-Institut, Kiel, Germany Bacteria assigned to the genus Weissella are Gram-positive, catalase-negative, non-endospore forming cells with coccoid or rod-shaped morphology (Collins et al., 1993; Björkroth et al., 2009, 2014) and belong to the group of bacteria generally known Edited by: as lactic acid bacteria. Phylogenetically, the Weissella belong to the Firmicutes, class Michael Gänzle, Bacilli, order Lactobacillales and family Leuconostocaceae (Collins et al., 1993). They are Alberta Veterinary Research Institute, Canada obligately heterofermentative, producing CO2 from carbohydrate metabolism with either − − + Reviewed by: D( )-, or a mixture of D( )- and L( )- lactic acid and acetic acid as major end products Clarissa Schwab, from sugar metabolism. To date, there are 19 validly described Weissella species known. Swiss Federal Institute of Technology Weissella spp. have been isolated from and occur in a wide range of habitats, e.g., on in Zurich, Switzerland Katri Johanna Björkroth, the skin and in the milk and feces of animals, from saliva, breast milk, feces and vagina of University of Helsinki, Finland humans, from plants and vegetables, as well as from a variety of fermented foods such *Correspondence: as European sourdoughs and Asian and African traditional fermented foods.
    [Show full text]
  • Diversity of Microorganisms in Global Fermented Foods and Beverages
    REVIEW published: 24 March 2016 doi: 10.3389/fmicb.2016.00377 Review: Diversity of Microorganisms in Global Fermented Foods and Beverages Jyoti P. Tamang 1*, Koichi Watanabe 2 and Wilhelm H. Holzapfel 3 1 Department of Microbiology, School of Life Sciences, Sikkim University, Tadong, India, 2 Department of Animal Science and Technology, National Taiwan University, Taipei, Taiwan, 3 Advance Green Energy and Environment Institute, Handong Global University, Pohang-si, South Korea Culturalable and non-culturable microorganisms naturally ferment majority of global fermented foods and beverages. Traditional food fermentation represents an extremely valuable cultural heritage in most regions, and harbors a huge genetic potential of valuable but hitherto undiscovered strains. Holistic approaches for identification and complete profiling of both culturalable and non-culturable microorganisms in global fermented foods are of interest to food microbiologists. The application of culture-independent technique has thrown new light on the diversity of a number of hitherto unknown and non-cultural microorganisms in naturally fermented foods. Edited by: Functional bacterial groups (“phylotypes”) may be reflected by their mRNA expression Abd El-Latif Hesham, Assiut University, Egypt in a particular substrate and not by mere DNA-level detection. An attempt has been Reviewed by: made to review the microbiology of some fermented foods and alcoholic beverages of Catarina Prista, the world. Instituto Superior de Agronomia, Portugal Keywords: global fermented
    [Show full text]
  • Why Are Weissella Spp. Not Used As Commercial Starter Cultures for Food Fermentation?
    Review Why Are Weissella spp. Not Used as Commercial Starter Cultures for Food Fermentation? Amandine Fessard and Fabienne Remize * UMR C-95 QualiSud, Université de La Réunion, CIRAD, Université Montpellier, Montpellier SupAgro, Université d’Avignon et des Pays de Vaucluse, F-97490 Sainte Clotilde, France; [email protected] * Correspondence: [email protected]; Tel.: +26-269-220-0785 Received: 25 June 2017; Accepted: 14 July 2017; Published: 3 August 2017 Abstract: Among other fermentation processes, lactic acid fermentation is a valuable process which enhances the safety, nutritional and sensory properties of food. The use of starters is recommended compared to spontaneous fermentation, from a safety point of view but also to ensure a better control of product functional and sensory properties. Starters are used for dairy products, sourdough, wine, meat, sauerkraut and homemade foods and beverages from dairy or vegetal origin. Among lactic acid bacteria, Lactobacillus, Lactococcus, Leuconostoc, Streptococcus and Pediococcus are the majors genera used as starters whereas Weissella is not. Weissella spp. are frequently isolated from spontaneous fermented foods and participate to the characteristics of the fermented product. They possess a large set of functional and technological properties, which can enhance safety, nutritional and sensory characteristics of food. Particularly, Weissella cibaria and Weissella confusa have been described as high producers of exo-polysaccharides, which exhibit texturizing properties. Numerous bacteriocins have been purified from Weissella hellenica strains and may be used as bio-preservative. Some Weissella strains are able to decarboxylate polymeric phenolic compounds resulting in a better bioavailability. Other Weissella strains showed resistance to low pH and bile salts and were isolated from healthy human feces, suggesting their potential as probiotics.
    [Show full text]
  • Metagenomics and Metatranscriptomics of Lake Erie Ice
    METAGENOMICS AND METATRANSCRIPTOMICS OF LAKE ERIE ICE Opeoluwa F. Iwaloye A Thesis Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 2021 Committee: Scott Rogers, Advisor Paul Morris Vipaporn Phuntumart © 2021 Opeoluwa Iwaloye All Rights Reserved iii ABSTRACT Scott Rogers, Lake Erie is one of the five Laurentian Great Lakes, that includes three basins. The central basin is the largest, with a mean volume of 305 km2, covering an area of 16,138 km2. The ice used for this research was collected from the central basin in the winter of 2010. DNA and RNA were extracted from this ice. cDNA was synthesized from the extracted RNA, followed by the ligation of EcoRI (NotI) adapters onto the ends of the nucleic acids. These were subjected to fractionation, and the resulting nucleic acids were amplified by PCR with EcoRI (NotI) primers. The resulting amplified nucleic acids were subject to PCR amplification using 454 primers, and then were sequenced. The sequences were analyzed using BLAST, and taxonomic affiliations were determined. Information about the taxonomic affiliations, important metabolic capabilities, habitat, and special functions were compiled. With a watershed of 78,000 km2, Lake Erie is used for agricultural, forest, recreational, transportation, and industrial purposes. Among the five great lakes, it has the largest input from human activities, has a long history of eutrophication, and serves as a water source for millions of people. These anthropogenic activities have significant influences on the biological community. Multiple studies have found diverse microbial communities in Lake Erie water and sediments, including large numbers of species from the Verrucomicrobia, Proteobacteria, Bacteroidetes, and Cyanobacteria, as well as a diverse set of eukaryotic taxa.
    [Show full text]