The Pharma Innovation Journal 2019; 8(9): 01-06 ISSN (E): 2277- 7695 ISSN (P): 2349-8242 NAAS Rating: 5.03 Antioxidant property of Weissella cibaria DMA 18 TPI 2019; 8(9): 01-06 © 2019 TPI isolated from tender coconut water www.thepharmajournal.com Received: 01-07-2019 Accepted: 03-08-2019 Amrutha TA, AK Beena, Aparna Sudhakaran V, Rejeesh R, Archana C Amrutha TA and Vinod V M. Tech scholar, Dept. of Dairy Microbiology College Of Dairy Abstract Science and Technology Kerala The objective of this study was to evaluate the functional properties of a lactic acid bacteria isolated from Veterinary and Animal Sciences tender coconut water. On the basis of biochemical characteristics and 16S rRNA sequencing, the isolate University, Mannuthy, Kerala, India was identified as Weissella cibaria, the sequence of which is deposited in NCBI with accession number MH782084. Acid tolerance, bile tolerance and adhesion potential were assessed in vitro. Weissella AK Beena cibaria DMA 18 strain was found to withstand pH 3.0 and 0.6% (w/v) concentration of bile salt Professor and Head, Dept. of environment for a period of 3h. Auto-aggregation and cell surface hydrophobicity of 83.78% and 89.1% Dairy Microbiology College of is suggestive of the good adhesion potential of the isolate. The non-haemolytic nature of the strain Dairy Science and Technology indicates the possible absence of virulence factors. Both the culture and crude EPS displayed remarkable Kerala Veterinary and Animal antioxidant DPPH assay revealed antioxidant activity of 27% and 33.55% respectively with sample Sciences University, Mannuthy, volumes as low as 10 µl and 6µl respectively. The results confirm the potential of Weissella cibaria Kerala, India DMA 18 to be used as a functional culture for designing foods to ameliorate disorders induced by oxidative stress. Aparna Sudhakaran V Asst. Professor, Dept. of Dairy Keywords: W. cibaria, exopolysaccharides, antioxidant activity, coconut water Microbiology College of Dairy Science and Technology Kerala Veterinary and Animal Sciences Introduction University, Mannuthy, Kerala, Oxidation is an integral metabolic reaction in all living cells. Presence of free radicals leads to India oxidative stress that is evidently harmful to human beings. The reactive oxygen species (ROS) are highly destructive to cells and for the same reason they play a crucial role in the initiation Rejeesh R Asst. Professor, Dept. of Dairy and progression of different disease conditions such as cancer, heart diseases, and [27] Microbiology College of Dairy inflammatory bowel disease (Valko et al., 2001) . With free radical species being identified Science and Technology, as responsible for augmented number of diseases, antioxidants are gaining more attention these Thiruvananthapuram Kerala days. Antioxidants are those substances, which can reduce the oxidative stress either by Veterinary and Animal Sciences preventing the formation of radicals, or by scavenging these radicals or by destroying them. University, Kerala, India Living organisms are well protected against free radical damage by enzymes such as, Archana C superoxide dismutase and catalase, or compounds such as ascorbic acid, tocopherol and Asst. Professor, Dept. of Dairy glutathione (Niki et al., 1994) [20]. Synthetic antioxidants such as butylated hydroxyanisole Microbiology College of Dairy (BHA), n-propyl gallate (PG) and butylated hydroxytoluene (BHT) also exhibit strong Science and Technology, antioxidant activity but their toxic nature pose potential risks. Antioxidants from natural Pookkode Kerala Veterinary and Animal Sciences University, sources are likely to be of more demand as the use of synthetic antioxidants food is restricted [26] Kerala, India or prohibited in many (Tayo et al., 2018) . Lactic acid bacteria and their metabolites are reported to impart numerous health benefits Vinod V when consumed. Major share of probiotic LAB mainly include members of the genera College of Dairy Science and Lactobacillus and Bifidobacterium. Members of Pediococcus, Weissella, Lactococcus and Technology, Mannuthy Kerala Veterinary and Animal Science Enterococcus are also being recognized for their health-promoting effects (Zommiti et al., [32] University, Kerala, India 2018) Lactic acid bacteria like W. confusa, L. plantarum, L. rhamnosus and L. mesenteroides have been proved to be capable of reducing free radicals in our body (Sharma et al., 2018, Le and Yang, 2018, Xing et al., 2015, Abubakr et al., 2012) [23, 16, 30, 1]. Exopolysaccharides, referred to as natural antioxidants can substitute synthetic antioxidants in Correspondence the proactive management of lifestyle diseases like heart disease, obesity, stroke and diabetes [19] Amrutha TA (Nampoothiri et al., 2016) . EPS produced by LAB are reported to have emulsifying, gelling M. Tech scholar, Dept. of Dairy and stabilizing properties. Health conscious population prefer low fat products but consumer Microbiology College Of Dairy appeal of these products are very much affected because of poor ‘mouth feel’. EPS being a Science and Technology Kerala natural bio thickener, exopolysaccharides producing lactic acid bacteria has ample scope to be Veterinary and Animal Sciences University, Mannuthy, Kerala, used in food industry for improving the rheological property of fermented milk products. India ~ 1 ~ The Pharma Innovation Journal This work attempted to evaluate the probiotic temperament of Bacterial cell surface hydrophobicity a LAB isolated from tender coconut water, a nutritious thirst The adhesion potential was measured in terms of Cell surface quenching fruit drink popular in the state of Kerala. hydrophobicity by BATH (Bacterial Adhesion to Hydrocarbons) assay (Collado et al., 2008) [6]. The isolates Materials and methods were grown in MRS broth for 16-18 h at 37 °C. Bacterial cells Isolation and identification of lactic acid bacteria in the stationary phase were harvested as pellets by Coconut water was collected aseptically from freshly refrigerated centrifugation at 4 0C for 12000rpm for 10 harvested tender coconut. A pre-enrichment was done initially minutes. After washing the cell pellet with phosphate buffered by transferring one millilitre of sample to five millilitre of saline (Himedia) thrice, pellet was suspended in the same MRS broth and incubating at 37 °C for 24h. Appropriate buffer to have an optical density of 0.25±.05 at 600 nm. To dilutions of these samples were pour plated in De 5ml of this suspension, equal volume of xylene was added Man, Rugose and Sharpe (MRS) agar and incubated at 37 °C and the two phase system was mixed thoroughly by vortexing for 48h so as to get well isolated discreet colonies. for five minutes. Immediately after vortexing, OD at 600nm Morphological and biochemical identification at preliminary was recorded. The vortexed samples were then kept at 37 ⁰C level was performed according to the methods described in for 1h to allow phase separation. The aqueous phase on the Berge’s Manual of systematic Bacteriology for identification top was pipetted out and OD at 600nm was determined. The of LAB (Holt et al., 1994) [15]. All the tests for identification percentage decrease in absorbance of the original suspension was carried out using freshly activated cultures in MRS broth. due to partitioning of cells was taken as the CSH value. The Molecular level confirmation of the isolate was done by 16S average of triplicate observations were recorded as result. The rRNA sequencing. The primers used were 16S-RS-F Forward CSH value was calculated using the formula. 5’CAGGCCTAACACATGCAAGTC3’ and 16S-RS-R Reverse 5’GGGCGGWGTGTACAAGGC3’. Hemolytic property The LAB strains were streaked on blood agar and incubated at Auto-aggregation 37 °C for 24h.. The LAB strains that produced green-hued MRS broth was inoculated with freshly activated culture at a zones around the colonies (alpha-haemolysis) or those that did level of one percent. After incubation at 37 °C for 18h, the not produce any effect on the blood agar (Gamma- hemolysis) cells were harvested by refrigerated centrifugation at 5000 g were considered non hemolytic. Those producing clear zones for 15 min, The cell pellet was washed twice with phosphate of RBC lysis around the colonies (Beta- hemolysis) were buffered saline (PBS) and then resuspended in same buffer so considered as haemolytic in nature (Adetoye et al., 2018) [2]. as to get an optical density of 0.60±0.02 at 600 nm. Four milliliters of this cell suspension was vortexed and 0.1 ml of Probiotic characterization of isolates this suspension was transferred to another tube with 3.9 ml of Probiotics bring about its beneficial effects by altering the PBS and the absorbance was measured at 600 nm (A1). The intestinal microflora in a way advantageous to the consumer. sample was kept undisturbed at 37 °C and OD of the sample So for an organism to be a potential probiotic candidate, it (A2) was determined again at 6h. should have the ability to withstand and surpass the harsh acid The auto-aggregation percentage was expressed as: and bile environment. Apart from these, ability to get attached to the intestinal mucosa is also equally important. These (Auto-aggregation) = [(A1 - A2)/ (A1) x 100] properties of the indigenous isolates obtained in this work were evaluated in terms of acid tolerance, bile tolerance and Where A1: initial optical density, A2: optical density after adhesion potential. incubation. Auto aggregation was calculated from three replicates as the Acid tolerance percentage decrease in absorbance