DOCSLIB.ORG

Homologue-Specific Chromosome Sequencing Characterizes Translocation Junctions and Permits Allelic Assignment Fumio Kasai1,2,*, Jorge C

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Homologue-Specific Chromosome Sequencing Characterizes Translocation Junctions and Permits Allelic Assignment Fumio Kasai1,2,*, Jorge C DNA Research, 2018, 25(4), 353–360 doi: 10.1093/dnares/dsy007 Advance Access Publication Date: 6 March 2018 Full Paper Full Paper Homologue-specific chromosome sequencing characterizes translocation junctions and permits allelic assignment Fumio Kasai1,2,*, Jorge C. Pereira2, Arihiro Kohara1, and Malcolm A. Ferguson-Smith2 1Japanese Collection of Research Bioresources (JCRB) Cell Bank, Laboratory of Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, Ibaraki 567-0085, Osaka, Japan, and 2Cambridge Resource Centre for Comparative Genomics, Department of Veterinary Medicine, University of Cambridge, Cambridge CB3 0ES, UK *To whom correspondence should be addressed. Tel. þ81 72 641 9851. Fax. þ81 72 641 9859. Email: [email protected] Edited by Dr. Yuji Kohara Received 13 August 2017; Editorial decision 11 February 2018; Accepted 12 February 2018 Abstract Chromosome translocations can be detected by cytogenetic analysis, but it is hard to character- ize the breakpoints at the sequence level. Chromosome sorting by flow cytometry produces flow karyotypes that enable the isolation of abnormal chromosomes and the generation of chromosome-specific DNA. In this study, a derivative chromosome t(9; 14) and its homologous normal chromosomes 9 and 14 from the Ishikawa 3-H-12 cell line were sorted to collect homologue-specific samples. Chromosome sequencing identified the breakpoint junction in the der(9) at 9p24.3 and 14q13.1 and uncovered the formation of a fusion gene, WASH1–NPAS3. Amplicon sequencing targeted for neighbouring genes at the fusion breakpoint revealed that the variant frequencies correlate with the allelic copy number. Sequencing of sorted chromo- somes permits the assignment of allelic variants and can lead to the characterization of abnor- mal chromosomes. We show that allele-specific chromosome sequencing of homologues is a robust technique for distinguishing alleles and this provides an efficient approach for the com- prehensive analysis of genomic changes. Key words: chromosome sorting, allelic profile, fusion gene, breakpoint junctions, variant frequency 1. Introduction recent advances in single cell analysis can distinguish differences be- Next-generation sequencing provides whole genome analysis of struc- tween cells and help to uncover genetic heterogeneity in tumour cells,8 tural variants as well as sequence variants.1,2 The technique has made the investigation of allelic differences remains challenging. a significant contribution to cancer genomics and to the analysis of Chromosomes can be distinguished in fluid suspensions using a human cancer cell lines that have been accumulated in the Cancer bivariate fluorescence-activated cell sorter which separates them by Cell Line Encyclopedia3 and the Catalogue of Somatic Mutations in size and base pair ratio and displays the results in the form of a flow Cancer.4 It is noted that clinical tumour samples are often contami- karyotype,9 allowing accurate estimation of chromosome size and nated with normal cells and show heterogeneity due to clonal evolu- GC content.10,11 The procedure enables the isolation and collection tion5,6 which is also observed in tumour cell lines.7 These two not only of aberrant chromosomes but sometimes also of normal ho- features present problems in sequencing tumour samples. Although mologues that contain measurable differences in repetitive DNA.12 VC The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 353 354 Homologue-specific chromosome sequencing Analysis of sorted chromosomes can characterize cryptic allelic vari- sheath pressure to 60 psi and the drop drive frequency to 95 kHz ants occurring in a reciprocal chromosome translocation.13 Sorted using a 70 lm cytonozzle tip. The flow karyotype was displayed by chromosome samples have been extensively exploited in diagnostic Hoechst 33258 versus Chromomycin A3 fluorescence and acquired by cytogenetics and in the production of chromosome-specific DNA for a total of 50,000–100,000 events at a rate of 1,000 events per second. chromosome painting14,15 and chromosome sequencing.16,17 The lat- Data collected from the experiments were analysed using Summit ter serves to focus on regions of interest and has application in refin- Software Version 4.1 (Beckman Coulter). Approximately 2,000 chro- ing genome analysis and assisting genome assembly. mosomes were flow sorted into a 0.5-ml UV-treated PCR tube from In this study, chromosome-specific sequencing reveals the break- each chromosome peak. point junction and identifies a novel fusion gene in a translocation between chromosomes 9 and 14 observed in a human cancer cell 2.4. Chromosome sequencing line. The sequence analysis of homologous regions on chromosomes For chromosome-specific sequencing, chromosomes were amplified separated by flow sorting has enabled alleles at several loci to be dis- by the REPLI-g single cell kit (Qiagen) and a genomic DNA fragment tinguished by their nucleotide differences. library was prepared using the Ion Xpress Plus Fragment Library kit (Life Technologies). Emulsion PCR of the library was performed by the Ion One Touch 2 system using the Ion PGM Template OT2 400 2. Materials and methods kit (Life Technologies). Sequencing was carried out by the Ion PGM 2.1. Cell lines and DNA preparation sequencer using the Ion PGM Sequencing 400 kit and the Ion 318 The Ishikawa 3-H-12 cell line registered as JCRB1505 was estab- Chip (Life Technologies). All protocols followed the manufacturer’s lished from an endometrial cancer.18 Cells were cultured using MEM instructions. Alignment of sequencing reads with the human genome with 15% non-heat-inactivated foetal bovine serum. Genomic DNA reference (GRCh37/hg19) was performed using the Torrent Suite was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen). The v4.1.2 software. The bam file was mapped to the hg19 reference us- karyotypes and SNP array profiles are available from our previous ing the TMAP software v5.0.13 with standard options study (Supplementary Fig. S1A).7 Because t(9; 14) was detected in all (Supplementary Table S1). This was visualized in the Integrative the metaphases examined and therefore expected to be a reference Genomics Viewer (IGV) using the mapping quality value as 1. BLAT marker for this cell line, this study was focused on der(9). search in the UCSC Genome tools was used to find similarity of sequence reads in the genome database. 2.2. Chromosome preparation and staining Mitotic cells were collected by shake-off from three 175-cm2 flasks at 2.5. Fusion point analysis passage 25* after colcemid treatment (KaryoMAX Colcemid, Gibco) The breakpoint junction was amplified by PCR at an annealing tem- at a final concentration of 0.1 lg/ml for 5 h. Cells were centrifuged at perature of 65C using the following primer pairs designed using the 250 g for 8 min in 50 ml tubes. The supernatant was discarded and Primer3 software; der9-BPf: GGAAGGCTCAGACAGAGAGG and replaced by 10 ml of hypotonic solution (75 mM KCl, 0.2 mM sper- der9-BPr: CTCTCCCTTGCACTCAGCTC. Total RNA was pre- mine, 0.5 mM spermidine, 10 mM MgSO4Á7H2O, pH 8.0) and incu- pared using the AllPrep DNA/RNA Mini Kit (Qiagen) and treated bated at RT for 15 min. After centrifugation, the cell pellet was with DNaseI. Reverse transcription of RNA into cDNA was per- resuspended in 1 ml of ice-cold polyamine buffer (2 mM EDTA, formed using the PrimeScript RT-PCR Kit (Takara) with random 0.5 mM EGTA, 80 mM KCl, 0.25% Triton X-100, 0.2 mM hexamers. Amplification of the WASH1–NPAS3 fusion transcript spermine, 0.5 mM spermidine, 20 mM NaCl, pH 7.2) and incu- was performed with annealing temperature at 63C using the PCR bated on ice for 10 min. The suspension was then vortexed vigor- primer pair of WASH1f: GGAAGGCTCAGACAGAGAGG and ously for 12 s and the chromosomes were stained by 5 lg/ml of NPAS3r: AGCATCTCGGGATTTCTCCT. Hoechst 33258 (Sigma-Aldrich, B2883), 40 lg/ml of Chromomycin A3 (Sigma-Aldrich, C2659), and 10mM MgSO4.10mMsodium 2.6. Variant analysis citrateand25mMsodiumsulphitewereadded1hbeforeflow Multiplex primer pools for eight genes at 9p24.3, 10 genes at 14q13 sorting. and the breakpoint boundary region at 14q13.1 were obtained using the Ion AmpliSeq Designer and are listed in Supplementary Table S2. 2.3. Chromosome sorting The Ampliseq custom panels for 9p24.3 and 14q13 consist of 118 Flow cytometric analysis was carried out at the Cambridge Resource and 120 amplicons, covering 33,607 and 33,275 bp in total size, re- Centre for Comparative Genomics. Stained chromosome suspensions spectively. Sequence library and template preparations were per- were analysed on a flow cytometer (MoFlo, Beckman Coulter, formed using the Ion AmpliSeq Kit for Chef DL8 and Ion PGM Hi- Fullerton, CA, USA) equipped with two water-cooled lasers (Spectra- Q Chef Kit (Life Technologies), respectively. Sequencing was run on Physics Model 2020) spatially separated at the flow chamber. The first the Ion PGM using the Ion 316 chip. The analysis was carried out us- laser was tuned to emit multiline UV (330–360 nm) which excites ing the Variant Caller plug-in in the Torrent Suit and the parameters Hoechst 33258. The second laser was tuned to emit light at 457 nm to are given in Supplementary Table S3. excite Chromomycin A3. The power of both lasers was set to 300 mW and kept constant using light control feedback. Fluorescence emitted 3. Results from Hoechst 33258 was collected using a 400 nm long pass filter combined with a 480 nm short pass filter.
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name E2F-associated phosphoprotein Gene Symbol EAPP Organism Human Gene Summary This gene encodes a phosphoprotein that interacts with several members of the E2F family of proteins. The protein localizes to the nucleus and is present throughout the cell cycle except during mitosis. It functions to modulate E2F-regulated transcription and stimulate proliferation. Gene Aliases BM036, C14orf11, FLJ20578, MGC4957 RefSeq Accession No. NC_000014.8, NT_026437.12 UniGene ID Hs.433269 Ensembl Gene ID ENSG00000129518 Entrez Gene ID 55837 Assay Information Unique Assay ID qHsaCID0008053 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000250454, ENST00000554792 Amplicon Context Sequence CAACCCAGGCCTGATCTCTGTTATCTTTTTCAGGATCATACAGTAATTCGTCATTT GTTGGAATCTTGTGTTGTTTCTTCTTTTTTTTCTTGGTCACCTGTACTGCTCTGTCT TCATCCTCGGAATCAGAATCAAAATATATATCATCGTAG Amplicon Length (bp) 122 Chromosome Location 14:34998580-35002699 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 104 R2 0.9989 cDNA Cq 19.93 cDNA Tm (Celsius) 79.5 gDNA Cq 34.63 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report EAPP, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Cell-Type–Specific Eqtl of Primary Melanocytes Facilitates Identification of Melanoma Susceptibility Genes
    Downloaded from genome.cshlp.org on November 19, 2018 - Published by Cold Spring Harbor Laboratory Press Research Cell-type–specific eQTL of primary melanocytes facilitates identification of melanoma susceptibility genes Tongwu Zhang,1,7 Jiyeon Choi,1,7 Michael A. Kovacs,1 Jianxin Shi,2 Mai Xu,1 NISC Comparative Sequencing Program,9 Melanoma Meta-Analysis Consortium,10 Alisa M. Goldstein,3 Adam J. Trower,4 D. Timothy Bishop,4 Mark M. Iles,4 David L. Duffy,5 Stuart MacGregor,5 Laufey T. Amundadottir,1 Matthew H. Law,5 Stacie K. Loftus,6 William J. Pavan,6,8 and Kevin M. Brown1,8 1Laboratory of Translational Genomics, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 2Biostatistics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 3Clinical Genetics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 4Section of Epidemiology and Biostatistics, Leeds Institute of Cancer and Pathology, University of Leeds, Leeds, LS9 7TF, United Kingdom; 5Statistical Genetics, QIMR Berghofer Medical Research Institute, Brisbane, Queensland, 4006, Australia; 6Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA Most expression quantitative trait locus (eQTL) studies to date have been performed in heterogeneous tissues as opposed to specific cell types. To better understand the cell-type–specific regulatory landscape of human melanocytes, which give rise to melanoma but account for <5% of typical human skin biopsies, we performed an eQTL analysis in primary melanocyte cul- tures from 106 newborn males.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Prospective Diagnostic Analysis of Copy Number Variants Using SNP Microarrays in Individuals with Autism Spectrum Disorders
    European Journal of Human Genetics (2013), 1–8 & 2013 Macmillan Publishers Limited All rights reserved 1018-4813/13 www.nature.com/ejhg ARTICLE Prospective diagnostic analysis of copy number variants using SNP microarrays in individuals with autism spectrum disorders Caroline Nava1,2,3,4,19, Boris Keren5,19, Cyril Mignot4,6,7,8, Agne`s Rastetter1,2,3, Sandra Chantot-Bastaraud9, Anne Faudet4, Eric Fonteneau5, Claire Amiet10, Claudine Laurent1,2,10, Aure´lia Jacquette4,7,8, Sandra Whalen4, Alexandra Afenjar4,6,7,8,11, Didier Pe´risse10,12, Diane Doummar6, Nathalie Dorison6,11, Marion Leboyer13,14,15,16, Jean-Pierre Siffroi9, David Cohen10,17, Alexis Brice*,1,2,3,4,18, Delphine He´ron4,6,7,8 and Christel Depienne*,1,2,3,4,18 Copy number variants (CNVs) have repeatedly been found to cause or predispose to autism spectrum disorders (ASDs). For diagnostic purposes, we screened 194 individuals with ASDs for CNVs using Illumina SNP arrays. In several probands, we also analyzed candidate genes located in inherited deletions to unmask autosomal recessive variants. Three CNVs, a de novo triplication of chromosome 15q11–q12 of paternal origin, a deletion on chromosome 9p24 and a de novo 3q29 deletion, were identified as the cause of the disorder in one individual each. An autosomal recessive cause was considered possible in two patients: a homozygous 1p31.1 deletion encompassing PTGER3 and a deletion of the entire DOCK10 gene associated with a rare hemizygous missense variant. We also identified multiple private or recurrent CNVs, the majority of which were inherited from asymptomatic parents. Although highly penetrant CNVs or variants inherited in an autosomal recessive manner were detected in rare cases, our results mainly support the hypothesis that most CNVs contribute to ASDs in association with other CNVs or point variants located elsewhere in the genome.
    [Show full text]
  • CBWD1 Mouse Monoclonal Antibody [Clone ID: OTI3F9] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for CF501612 CBWD1 Mouse Monoclonal Antibody [Clone ID: OTI3F9] Product data: Product Type: Primary Antibodies Clone Name: OTI3F9 Applications: FC, IF, IHC, WB Recommended Dilution: WB 1:500~2000, IHC 1:150, IF 1:100, FLOW 1:100 Reactivity: Human Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombinant protein of human CBWD1 (NP_060961) produced in HEK293T cell. Formulation: Lyophilized powder (original buffer 1X PBS, pH 7.3, 8% trehalose) Reconstitution Method: For reconstitution, we recommend adding 100uL distilled water to a final antibody concentration of about 1 mg/mL. To use this carrier-free antibody for conjugation experiment, we strongly recommend performing another round of desalting process. (OriGene recommends Zeba Spin Desalting Columns, 7KMWCO from Thermo Scientific) Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 43.9 kDa Gene Name: Homo sapiens COBW domain containing 1 (CBWD1), transcript variant 1, mRNA. Database Link: NP_060961 Entrez Gene 55871 Human Q9BRT8 Synonyms: COBP This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 7 CBWD1 Mouse Monoclonal Antibody [Clone ID: OTI3F9] – CF501612 Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Cat# [PS100001], Left lane) or pCMV6-ENTRY CBWD1 (Cat# [RC222790], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • Mapping of a Chromosome 12 Region Associated with Airway Hyperresponsiveness in a Recombinant Congenic Mouse Strain and Selectio
    Mapping of a Chromosome 12 Region Associated with Airway Hyperresponsiveness in a Recombinant Congenic Mouse Strain and Selection of Potential Candidate Genes by Expression and Sequence Variation Analyses Cynthia Kanagaratham1*, Rafael Marino2, Pierre Camateros2, John Ren3, Daniel Houle4, Robert Sladek1,2,5, Silvia M. Vidal1,3, Danuta Radzioch1,2 1 Department of Human Genetics, McGill University, Montreal, Quebec, Canada, 2 Faculty of Medicine, Division of Experimental Medicine, McGill University, Montreal, Quebec, Canada, 3 Department of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada, 4 Research Institute of the McGill University Health Center, Montreal, Quebec, Canada, 5 McGill University and Genome Quebec Innovation Centre, Montreal, Quebec, Canada Abstract In a previous study we determined that BcA86 mice, a strain belonging to a panel of AcB/BcA recombinant congenic strains, have an airway responsiveness phenotype resembling mice from the airway hyperresponsive A/J strain. The majority of the BcA86 genome is however from the hyporesponsive C57BL/6J strain. The aim of this study was to identify candidate regions and genes associated with airway hyperresponsiveness (AHR) by quantitative trait locus (QTL) analysis using the BcA86 strain. Airway responsiveness of 205 F2 mice generated from backcrossing BcA86 strain to C57BL/6J strain was measured and used for QTL analysis to identify genomic regions in linkage with AHR. Consomic mice for the QTL containing chromosomes were phenotyped to study the contribution of each chromosome to lung responsiveness. Candidate genes within the QTL were selected based on expression differences in mRNA from whole lungs, and the presence of coding non- synonymous mutations that were predicted to have a functional effect by amino acid substitution prediction tools.
    [Show full text]
  • Triangulating Molecular Evidence to Prioritise Candidate Causal Genes at Established Atopic Dermatitis Loci
    medRxiv preprint doi: https://doi.org/10.1101/2020.11.30.20240838; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-ND 4.0 International license . Triangulating molecular evidence to prioritise candidate causal genes at established atopic dermatitis loci Maria K Sobczyk1, Tom G Richardson1, Verena Zuber2,3, Josine L Min1, eQTLGen Consortium4, BIOS Consortium5, GoDMC, Tom R Gaunt1, Lavinia Paternoster1* 1) MRC Integrative Epidemiology Unit, Bristol Medical School, University of Bristol, Bristol, UK 2) Department of Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, UK 3) MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK 4) Members of the eQTLGen Consortium are listed in: Supplementary_Consortium_members.docx 5) Members of the BIOS Consortium are listed in: Supplementary_Consortium_members.docx Abstract Background: Genome-wide association studies for atopic dermatitis (AD, eczema) have identified 25 reproducible loci associated in populations of European descent. We attempt to prioritise candidate causal genes at these loci using a multifaceted bioinformatic approach and extensive molecular resources compiled into a novel pipeline: ADGAPP (Atopic Dermatitis GWAS Annotation & Prioritisation Pipeline). Methods: We identified a comprehensive list of 103 accessible
    [Show full text]
  • NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
    Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
    [Show full text]
  • Bach1 Is Critical for the Transformation of Mouse Embryonic Fibroblasts by Rasv12 and Maintains ERK Signaling
    Oncogene (2013) 32, 3231–3245 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE Bach1 is critical for the transformation of mouse embryonic fibroblasts by RasV12 and maintains ERK signaling A Nakanome1,2, A Brydun1,3, M Matsumoto1,4,KOta1, R Funayama5,6, K Nakayama5, M Ono7, K Shiga2, T Kobayashi2 and K Igarashi1,3,6 Reactive oxygen species (ROS), by-products of aerobic respiration, promote genetic instability and contribute to the malignant transformation of cells. Among the genes related to ROS metabolism, Bach1 is a repressor of the oxidative stress response, and a negative regulator of ROS-induced cellular senescence directed by p53 in higher eukaryotes. While ROS are intimately involved in carcinogenesis, it is not clear whether Bach1 is involved in this process. We found that senescent Bach1-deficient mouse embryonic fibroblasts (MEFs) underwent spontaneous immortalization the same as did the wild-type cells. When transduced with constitutively active Ras (H-RasV12), the proliferation and colony formation of these cells in vitro were markedly reduced. When transplanted into athymic nude mice, the growth and vascularization of tumors derived from Bach1-deficient cells were also decreased. Gene expression profiling of the MEFs revealed a new H-RasV12 signature, which was distinct from the previously reported signatures in epithelial tumors, and was partly dependent on Bach1. The Bach1-deficient cells showed diminished phosphorylation of MEK and ERK1/2 in response to H-RasV12, which was consistent with the alterations in the gene expression profile, including phosphatase genes. Finally, Bach1-deficient mice were less susceptible to 4-nitroquinoline-1-oxidide (4-NQO)- induced tongue carcinoma than wild-type mice.
    [Show full text]
  • Identifying Potential Regions of Copy Number Variation for Bipolar Disorder
    Microarrays 2014, 3, 52-71; doi:10.3390/microarrays3010052 OPEN ACCESS microarrays ISSN 2076-3905 www.mdpi.com/journal/microarrays Article Identifying Potential Regions of Copy Number Variation for Bipolar Disorder Yi-Hsuan Chen 1, Ru-Band Lu 2, Hung Hung 1,3 and Po-Hsiu Kuo 1,3,* 1 Department of Public Health & Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei 100, Taiwan; E-Mails: [email protected] (Y.-H.C.); [email protected] (H.H.) 2 Department of Psychiatry, College of Medicine & Hospital, National Cheng Kung University, Tainan 704, Taiwan; E-Mail: [email protected] 3 Research Center for Genes, Environment and Human Health, National Taiwan University, Taipei 100, Taiwan * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +886-2-3366-8015; Fax: +886-2-2351-1955. Received: 1 December 2013; in revised form: 10 February 2014 / Accepted: 12 February 2014 / Published: 28 February 2014 Abstract: Bipolar disorder is a complex psychiatric disorder with high heritability, but its genetic determinants are still largely unknown. Copy number variation (CNV) is one of the sources to explain part of the heritability. However, it is a challenge to estimate discrete values of the copy numbers using continuous signals calling from a set of markers, and to simultaneously perform association testing between CNVs and phenotypic outcomes. The goal of the present study is to perform a series of data filtering and analysis procedures using a DNA pooling strategy to identify potential CNV regions that are related to bipolar disorder.
    [Show full text]