DNA Research, 2018, 25(4), 353–360 doi: 10.1093/dnares/dsy007 Advance Access Publication Date: 6 March 2018 Full Paper Full Paper Homologue-specific chromosome sequencing characterizes translocation junctions and permits allelic assignment Fumio Kasai1,2,*, Jorge C. Pereira2, Arihiro Kohara1, and Malcolm A. Ferguson-Smith2 1Japanese Collection of Research Bioresources (JCRB) Cell Bank, Laboratory of Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, Ibaraki 567-0085, Osaka, Japan, and 2Cambridge Resource Centre for Comparative Genomics, Department of Veterinary Medicine, University of Cambridge, Cambridge CB3 0ES, UK *To whom correspondence should be addressed. Tel. þ81 72 641 9851. Fax. þ81 72 641 9859. Email: [email protected] Edited by Dr. Yuji Kohara Received 13 August 2017; Editorial decision 11 February 2018; Accepted 12 February 2018 Abstract Chromosome translocations can be detected by cytogenetic analysis, but it is hard to character- ize the breakpoints at the sequence level. Chromosome sorting by flow cytometry produces flow karyotypes that enable the isolation of abnormal chromosomes and the generation of chromosome-specific DNA. In this study, a derivative chromosome t(9; 14) and its homologous normal chromosomes 9 and 14 from the Ishikawa 3-H-12 cell line were sorted to collect homologue-specific samples. Chromosome sequencing identified the breakpoint junction in the der(9) at 9p24.3 and 14q13.1 and uncovered the formation of a fusion gene, WASH1–NPAS3. Amplicon sequencing targeted for neighbouring genes at the fusion breakpoint revealed that the variant frequencies correlate with the allelic copy number. Sequencing of sorted chromo- somes permits the assignment of allelic variants and can lead to the characterization of abnor- mal chromosomes. We show that allele-specific chromosome sequencing of homologues is a robust technique for distinguishing alleles and this provides an efficient approach for the com- prehensive analysis of genomic changes. Key words: chromosome sorting, allelic profile, fusion gene, breakpoint junctions, variant frequency 1. Introduction recent advances in single cell analysis can distinguish differences be- Next-generation sequencing provides whole genome analysis of struc- tween cells and help to uncover genetic heterogeneity in tumour cells,8 tural variants as well as sequence variants.1,2 The technique has made the investigation of allelic differences remains challenging. a significant contribution to cancer genomics and to the analysis of Chromosomes can be distinguished in fluid suspensions using a human cancer cell lines that have been accumulated in the Cancer bivariate fluorescence-activated cell sorter which separates them by Cell Line Encyclopedia3 and the Catalogue of Somatic Mutations in size and base pair ratio and displays the results in the form of a flow Cancer.4 It is noted that clinical tumour samples are often contami- karyotype,9 allowing accurate estimation of chromosome size and nated with normal cells and show heterogeneity due to clonal evolu- GC content.10,11 The procedure enables the isolation and collection tion5,6 which is also observed in tumour cell lines.7 These two not only of aberrant chromosomes but sometimes also of normal ho- features present problems in sequencing tumour samples. Although mologues that contain measurable differences in repetitive DNA.12 VC The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 353 354 Homologue-specific chromosome sequencing Analysis of sorted chromosomes can characterize cryptic allelic vari- sheath pressure to 60 psi and the drop drive frequency to 95 kHz ants occurring in a reciprocal chromosome translocation.13 Sorted using a 70 lm cytonozzle tip. The flow karyotype was displayed by chromosome samples have been extensively exploited in diagnostic Hoechst 33258 versus Chromomycin A3 fluorescence and acquired by cytogenetics and in the production of chromosome-specific DNA for a total of 50,000–100,000 events at a rate of 1,000 events per second. chromosome painting14,15 and chromosome sequencing.16,17 The lat- Data collected from the experiments were analysed using Summit ter serves to focus on regions of interest and has application in refin- Software Version 4.1 (Beckman Coulter). Approximately 2,000 chro- ing genome analysis and assisting genome assembly. mosomes were flow sorted into a 0.5-ml UV-treated PCR tube from In this study, chromosome-specific sequencing reveals the break- each chromosome peak. point junction and identifies a novel fusion gene in a translocation between chromosomes 9 and 14 observed in a human cancer cell 2.4. Chromosome sequencing line. The sequence analysis of homologous regions on chromosomes For chromosome-specific sequencing, chromosomes were amplified separated by flow sorting has enabled alleles at several loci to be dis- by the REPLI-g single cell kit (Qiagen) and a genomic DNA fragment tinguished by their nucleotide differences. library was prepared using the Ion Xpress Plus Fragment Library kit (Life Technologies). Emulsion PCR of the library was performed by the Ion One Touch 2 system using the Ion PGM Template OT2 400 2. Materials and methods kit (Life Technologies). Sequencing was carried out by the Ion PGM 2.1. Cell lines and DNA preparation sequencer using the Ion PGM Sequencing 400 kit and the Ion 318 The Ishikawa 3-H-12 cell line registered as JCRB1505 was estab- Chip (Life Technologies). All protocols followed the manufacturer’s lished from an endometrial cancer.18 Cells were cultured using MEM instructions. Alignment of sequencing reads with the human genome with 15% non-heat-inactivated foetal bovine serum. Genomic DNA reference (GRCh37/hg19) was performed using the Torrent Suite was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen). The v4.1.2 software. The bam file was mapped to the hg19 reference us- karyotypes and SNP array profiles are available from our previous ing the TMAP software v5.0.13 with standard options study (Supplementary Fig. S1A).7 Because t(9; 14) was detected in all (Supplementary Table S1). This was visualized in the Integrative the metaphases examined and therefore expected to be a reference Genomics Viewer (IGV) using the mapping quality value as 1. BLAT marker for this cell line, this study was focused on der(9). search in the UCSC Genome tools was used to find similarity of sequence reads in the genome database. 2.2. Chromosome preparation and staining Mitotic cells were collected by shake-off from three 175-cm2 flasks at 2.5. Fusion point analysis passage 25* after colcemid treatment (KaryoMAX Colcemid, Gibco) The breakpoint junction was amplified by PCR at an annealing tem- at a final concentration of 0.1 lg/ml for 5 h. Cells were centrifuged at perature of 65C using the following primer pairs designed using the 250 g for 8 min in 50 ml tubes. The supernatant was discarded and Primer3 software; der9-BPf: GGAAGGCTCAGACAGAGAGG and replaced by 10 ml of hypotonic solution (75 mM KCl, 0.2 mM sper- der9-BPr: CTCTCCCTTGCACTCAGCTC. Total RNA was pre- mine, 0.5 mM spermidine, 10 mM MgSO4Á7H2O, pH 8.0) and incu- pared using the AllPrep DNA/RNA Mini Kit (Qiagen) and treated bated at RT for 15 min. After centrifugation, the cell pellet was with DNaseI. Reverse transcription of RNA into cDNA was per- resuspended in 1 ml of ice-cold polyamine buffer (2 mM EDTA, formed using the PrimeScript RT-PCR Kit (Takara) with random 0.5 mM EGTA, 80 mM KCl, 0.25% Triton X-100, 0.2 mM hexamers. Amplification of the WASH1–NPAS3 fusion transcript spermine, 0.5 mM spermidine, 20 mM NaCl, pH 7.2) and incu- was performed with annealing temperature at 63C using the PCR bated on ice for 10 min. The suspension was then vortexed vigor- primer pair of WASH1f: GGAAGGCTCAGACAGAGAGG and ously for 12 s and the chromosomes were stained by 5 lg/ml of NPAS3r: AGCATCTCGGGATTTCTCCT. Hoechst 33258 (Sigma-Aldrich, B2883), 40 lg/ml of Chromomycin A3 (Sigma-Aldrich, C2659), and 10mM MgSO4.10mMsodium 2.6. Variant analysis citrateand25mMsodiumsulphitewereadded1hbeforeflow Multiplex primer pools for eight genes at 9p24.3, 10 genes at 14q13 sorting. and the breakpoint boundary region at 14q13.1 were obtained using the Ion AmpliSeq Designer and are listed in Supplementary Table S2. 2.3. Chromosome sorting The Ampliseq custom panels for 9p24.3 and 14q13 consist of 118 Flow cytometric analysis was carried out at the Cambridge Resource and 120 amplicons, covering 33,607 and 33,275 bp in total size, re- Centre for Comparative Genomics. Stained chromosome suspensions spectively. Sequence library and template preparations were per- were analysed on a flow cytometer (MoFlo, Beckman Coulter, formed using the Ion AmpliSeq Kit for Chef DL8 and Ion PGM Hi- Fullerton, CA, USA) equipped with two water-cooled lasers (Spectra- Q Chef Kit (Life Technologies), respectively. Sequencing was run on Physics Model 2020) spatially separated at the flow chamber. The first the Ion PGM using the Ion 316 chip. The analysis was carried out us- laser was tuned to emit multiline UV (330–360 nm) which excites ing the Variant Caller plug-in in the Torrent Suit and the parameters Hoechst 33258. The second laser was tuned to emit light at 457 nm to are given in Supplementary Table S3. excite Chromomycin A3. The power of both lasers was set to 300 mW and kept constant using light control feedback. Fluorescence emitted 3. Results from Hoechst 33258 was collected using a 400 nm long pass filter combined with a 480 nm short pass filter.