DNA Barcode Variability in Canadian Cnidaria by Kathryn Hotke a Thesis

DNA Barcode Variability in Canadian Cnidaria By Kathryn Hotke

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Masters of Science in Integrative Biology

Guelph, Ontario, Canada © Kathryn Hotke, September 2015

ABSTRACT

DNA Barcode Variability in Canadian Cnidaria

Kathryn Hotke Advisor: University of Guelph, 2015 Professor P.D.N. Hebert

This thesis investigates patterns of sequence variation in Canadian Cnidaria for the DNA barcode region of the cytochrome c oxidase subunit 1 (COI) gene. As such, it begins development of a DNA barcode reference library for this phylum. This work confirms the COI gene region as an effective tool for delineating currently recognized species of cnidarians and revealing cryptic species. As well, this study shows the value of COI barcodes in the identification of newly collected specimens and morphologically unusable specimen fragments. A detailed analysis of the genus Cyanea explores the incidence of cryptic taxa, revealing high genetic diversity. The results from this study have implications for the utility of DNA barcoding both for documenting biodiversity and broadening our understanding of biogeographic patterns of Cnidaria.

Acknowledgements

Firstly, I would like to thank my advisor Dr. Paul Hebert for providing me with guidance and support during my program. You always encouraged me to travel to different collection sites across

Canada and take advantage of all opportunities presented to me. I am also very grateful of your support of my choice to enter the Doctor of Veterinary Medicine program. I am also incredibly grateful for the input

I received from my committee members, Dr. Elizabeth Boulding and Dr. Teresa Crease. Your enthusiasm for this project kept me motivated and your promptness with feedback and advice was always appreciated.

I would like to thank the Natural Sciences and Engineering Research Council of Canada and the

Ontario Ministry of Training, Colleges and Universities for funding this research. I am grateful to members of the Pacific Biological station including Dave Workman and Malcolm Wyeth for allowing me on their scientific cruise of Hecate Strait. I am thankful to Bill Austen for taking me on sample collection trips around the Gulf Islands. I would like to thank Jack Fife and the members of the St. Andrews

Biological Station and Huntsman Marine Center for being so accommodating and allowing me to use their facilities. I am also very grateful to the Stephanie Gagnon and members of the Marine Environment

Discovery Center for performing scientific dives, collecting specimens and providing me with accommodations during my field season.

As well, I am thankful to Danny Kent and members of the BC Waters section for their behind- the-scene access of the Vancouver Aquarium. I would also like to thank Paula Romagosa from the Shaw

Ocean Discovery Center, Jill Marvin from l’Aquarium du Quebec, Laurent Robichaud and Conrad Allen from l’Aquarium et Centre Marin du Nouveau-Brunswick and Jim Cornall from the Fundy Discovery

Aquarium. I would also like to extend my gratitude to Dr. Elizabeth Boulding, Kara Layton, Luc Savoie from Department of Fisheries and Oceans (DFO) Moncton, Dave Hardie from the Bedford Institute of

Oceanography, Jamie Emberly of the St. Andrews Biological Station, Philippe Sargent of DFO St. John,

Diane Archambault of the Maurice Lamontagne Institute and Patrick Allaire for their help in specimen collections.

iii

Lastly, I would like to thank the Canadian Centre for DNA Barcoding (CCDB) and Sean Prosser for helping me without delay with PCR, sequence acquisition and interpreting my results. A sincere thank you to all graduate students in the Hebert, Adamowicz and Hajibabaei labs for providing input into my project and contributing greatly to my happiness during this program. I especially want to thank Monica

Young for her advice, patience and willingness to help me out with whatever problems I encountered.

Finally, I would like to thank my close friends and family, who provided me with love and support throughout this project.

Table of Contents Abstract…………………………………………………………….………………………………………ii Acknowledgements………………….……………………………………………………………………iii Lists of Figures…………………….……………….……………………..…….…………………..……vii List of Tables……………………………………….……………….….………………………..………..ix General Introduction……………...………………………………………………………………………1 Chapter 1: Patterns of DNA Barcode Variation in Canadian Cnidarians…….…...….………………4 Abstract……………………………………………………………………………….…………………4 Introduction.…………………………………………………………………………..…………………5 Methods………………………………………………………………………………………………….7 Specimen Collection and Taxonomy ………………………………………………………………7 DNA Isolation, Extraction and Amplification…...…………………………………………………7 Species Delineation………………………..……………………………………………….…………9 Sequence Analysis……………………...... …………………………………………………………9 Results…………………………………………………………….……………………………………..9 Taxon Diversity………….………………………………………..……………………………....…9 Sequence Recovery…………………………………………………..…………………………....…10 Scyphozoa …………………………………….…………………………...…………………………11 Aurelia aurita…………………………………….…………………...…………………………12 Phacellophora camtschatica…………….……………………………………………………13 Hydrozoa ……………………………………….……………………………..………………………13 Sarsia…………………………………………..…………………………………………………14 Hydra…………………………………..………………………………………………...………14 Obelia………………………………….………………………………………………………...15 Staurozoa ………………………………..…………….….……………………………………………15 Anthozoa ……………………………………….……………………..………………………………16 Pachycerianthus……………………………….…………………...……………………………17 Gersemia………………………………………….………………………………………………17 Pennatula…………..…………………………………….…………..…………………………17 Anthopleura……………………………………………………………………….……………18 Urticina………………..…………………………………….…………………………………18 Stomphia……………..…………………………………….……………………..……………19 Discussion………………………………………………………………………………………...……19 Collection……………………………….…………………………………………………...…20 Sequencing Success in Cnidaria……….………………………………………..……………21 Patterns of Sequence Variation…….…………………………………………..……….……21 Low Interspecific Divergence in Anthozoa…………………………………….……………22 Urticina………………..…………….…………….………….……………………..……………24 Stomphia……………..…………………………………………………………...……..……25 Cases of Cryptic Species…….…………………………………………….………....………26 Conclusions……………………………………………………..………………...…………27 Chapter 2: Revealing Cryptic Diversity in the Scyphozoan Cyanea capillata………………….……58 Abstract……………………………………………………………………………………………...…58 Introduction.…………………………………………………………………………...……….....……59 Methods……………………………………..………………………………………………………….61 Specimen Collection and Taxonomy ……………………..………………………………………61 DNA Isolation, Extraction and Amplification…………….……………..…………..……………61 Species Delineation…………………………………………..………………..……………………63 Sequence Analysis……………………...... …………………..……………………………………64 Morphological Analysis……………………………………...……..………………………………65 Salinity Data……..……………………...... …………..……..…………………………….………65

Results…………………………………………………………………………………………….…..66 Collections and Sequence Recovery……………..…..……………………………………………66 COI Phylogenetic Analysis…………………………………………………………………………66 Geographic Distribution and Collection..………………………………………..………………67 Distribution of Lineages Relative to Salinity…..…………………………………….……………67 16S, ITS1 & ITS2 Analysis………..…….………………………..……………………………...…68 Relationships between Canadian Cyanea and those from other Regions………………...………68 Discussion…………………………………………………………………………………………...…70 General Conclusions..………………………………………………………………..………..…………95 Literature Cited…….………………………………………………………………………………….…97 Appendix A: Chapter 2 Supplementary Material……..………………………...... …………………110 Appendix B: Collection Data……………………………...………………………...…………………115 Appendix C: R Code….……………………………..………………………………….………………157

List of Figures Chapter 1..…………………………………………………………………………………………………4 Figure 1.1 Sampling locations and the number of specimens (indicated by the white numbers) examined in this study………………………………………………...…………………….…..……..28 Figure 1.2 Neighbor-joining tree of scyphozoan COI sequences…………………….…..…………...29 Figure 1.3 Fragmented and 95% EtOH dehydrated specimens identified by COI sequences…....…...30 Figure 1.4 Neighbor-joining tree of Canadian Aurelia aurita COI sequences……….....…………….31 Figure 1.5 Nearest neighbor barcode gap of Scyphozoa, Hydrozoa and Staurozoa COI sequences….32 Figure 1.6 Neighbor-joining tree of Canadian and GenBank Aurelia spp. COI sequences…………..33 Figure 1.7 Neighbor-joining tree of Canadian Phacellophora camtschatica COI sequences…...... 34 Figure 1.8 Neighbor-joining tree analysis of hydrozoan COI sequences………………….……..…...35 Figure 1.9 Melicertum octocostatum specimens from BOLD: ACO2504……………………...……..36 Figure 1.10 Neighbor-joining tree of Canadian Sarsia COI sequences……………..…..…….....…....36 Figure 1.11 Neighbor-joining tree of Canadian Hydra COI sequences ………………....…...... ….….37 Figure 1.12 Neighbor-joining tree of Canadian Obelia COI sequences …………...…….....………...38 Figure 1.13 Neighbor-joining tree of Canadian staurozoan COI sequences………….....…...... ……...38 Figure 1.14 Neighbor-joining tree of anthozoan COI sequences…………………………...…………39 Figure 1.15 Neighbor-joining tree of Canadian Pachycerianthus COI sequences.……...…..…….….40 Figure 1.16 Nearest neighbor barcode gap of Anthozoa COI sequences…………………….…..…...41 Figure 1.17 Neighbor-joining tree of Canadian Gersemia COI sequences………………….…....…..42 Figure 1.18 Neighbor-joining tree of Canadian Pennatula COI sequences……………….…...……..43 Figure 1.19 Anthopleura species from BOLD: AAK0746…………………………………….……...44 Figure 1.20 Neighbor-joining tree of Canadian Anthopleura COI sequences………………...……....45 Figure 1.21 Urticina species from BOLD: AAJ8124..…………………………………….……....….46 Figure 1.22 Neighbor-joining tree of Canadian Urticina COI sequences……………….…...……….47 Figure 1.23 Neighbor-joining tree of Canadian Stomphia COI sequences………………….….……..48 Figure 1.24 Representation of possible evolutionary scenarios for slow mtDNA evolution in Anthozoa (modified from Stampar 2014)……………………………………………………………...….……...49 Chapter 2.…………………………………………………………………………………………...……58 Figure 2.1 Collection locations and number of Cyanea specimens…………………………………...74 Figure 2.2 Morphology of Cyanea capillata from Gulf of St. Lawrence (BOLD: AAP1190)…...…..76 Figure 2.3 Morphology of North Canada Cyanea lineage (BOLD: AAD3480).…………………...... 77 Figure 2.4 Neighbor-joining tree of a selection of COI sequences with Cyanea sequences from GenBank.…………………………………………………………………………………………...….79 Figure 2.5 Barcode gap of Canadian Cyanea lineage COI sequences………………………………...80 Figure 2.6 Molecular phylogenetic analysis of Canadian Cyanea species COI sequences with Cyanea sequences from GenBank……………………………….……………………………...….…………..81 Figure 2.7 Maximum likelihood bootstrap comparisons between COI, 16S, ITS1 and ITS2 for five lineages of Cyanea capillata s. l., five other species in the genus and lineages investigated by Sparmann (2012)……………………………………………………………………………………….82 Figure 2.8 Surface salinity values at collection locations for five lineages of Cyanea specimens……83 Figure 2.9 Neighbor-joining tree of a selection of ITS1 sequences with Cyanea sequences from GenBank.…………………………………………………………………………………………...….84 Figure 2.10 Neighbor-joining tree of a selection of ITS2 sequences…………...…..……………...….85 Figure 2.11 Neighbor-joining tree of a selection of 16S sequences with Cyanea sequences from GenBank…………………………………………………………….……..…………………….....….86 Figure 2.12 Molecular phylogenetic analysis of Canadian Cyanea ITS1 sequences with Cyanea sequences from GenBank………………………………………………...………………….……..….87 Figure 2.13 Molecular phylogenetic analysis of Canadian ITS2 sequences………..…...……….....…88 Figure 2.14 Molecular phylogenetic analysis of Canadian Cyanea 16S sequences with Cyanea sequences from GenBank…..……………………………………………………………………...…..89

vii

Appendix A…..…………………………………………………………………………………….……110 Figure A.1 Histogram of salinity frequencies from all Canadian Cyanea collection locations….…..110 Figure A.2 Calculations of Variance for the Random Effects Model ANOVA of Salinities for each Lineage Distribution……………………………………….…………………………...………….....111 Figure A.3 Residuals Plots of Salinity Values for the Cyanea Lineages Geographic Ranges………………………………………………………………………………………...……....111

viii

List of Tables General Introduction.……………….…………..……………………………….……………………..…1 Table 1. Taxonomic classification of taxa reported in Canadian waters (modified from Archambault et al. 2010)…………………………………………………………………………………………...…….3 Chapter 1.……………………..……………………………………………….…………………………..4 Table 1.1 Preservation of cnidarian specimens and COI barcode sequencing success ………...... …..49 Table 1.2 Significant sources of specimens collected from Canada and their locations………….…..49 Table 1.3 The number of cnidarian specimens collected, collection locations and sequences retrieve in this study……………………………………………………………………………………………….50 Table 1.4 Specimen contaminants and BOLD (www.boldsystems.org) Process IDs of source specimens……………………………………………………………………………………...……….51 Table 1.5 Analysis of COI mtDNA Sequencing Failure Rate among Cnidarian Orders and Families…………………………………………………………………………………………..…….54 Table 1.6 Mean Pairwise Genetic Distances (K2P) among Cnidarian species based on mitochondrial COI………………………………………………………………………………………………..…....56 Chapter 2.……………………..……………………….………………..…………………………..……58 Table 2.1 Summary of changes in taxonomy of Cyanea species reported from Canadian waters……90 Table 2.2 BIN Nomenclature ……………………………………………………………………..…..93 Table 2.3 Mean Pairwise Genetic Distances (K2P) among five BINs of Cyanea capillata s.l. and seven species within the genus Cyanea based on mitochondrial COI (A) 16S (D) and nuclear ITS1 (B) ITS2 (C) ……………………………………………………….………………………………..……..94 Appendix A…..…………………………………………………………………………………….……110 Table A.1 GenBank sequence data…..……………………………………………………...... …….112 Appendix B…..…………………………………………………………………………………….……115 Table B.1 Collection data for Cnidaria specimens used in this study……..…….…………………...115 Table B.2 Collection data for Cyanea specimens used in this study……..……………………….....151

General Introduction

Marine biodiversity is important on both the economic and ecological levels, providing a source of food, as well as indicating environmental health and ecosystem functioning (Archambault et al. 2010,

Radulovici et al. 2010, Snelgrove 2010). Bordered by the Pacific, Arctic and Atlantic oceans, Canada has the longest coastline of any nation and its territorial waters are 14.3% of the global total (Archambault et al. 2010). Canadian marine biodiversity is being severely reduced by ocean acidification, overfishing, pollution, alteration of food webs, eutrophication, climate change and the destruction of ocean habitats

(Archambault et al. 2010; Radulovici et al. 2010). Given these major concerns, it has become more important than ever to protect and document Canadian marine biodiversity.

It has been estimated that at least 16,000 marine species are present in Canadian waters (Table 1;

Archambault et al. 2010). Moreover, this total is likely an underestimate of true species richness due to gaps in the literature, the limitation of previous studies, a lack of willingness to share data and the seasonality of Canadian waters affecting currents and marine population locations and numbers.

Taxonomic effort in Canada has declined in recent decades with decreasing numbers of taxonomists and systematists specializing in marine taxa (Hebert et al. 2003a, b; Archambault et al. 2010; Radulovici et al.

2010). Traditional discrimination of species has relied solely on morphological traits, often resulting in cryptic species going undetected. As well, morphology-based identification is often limited to certain life stages or to intact specimens which possess specific diagnostic traits (Hebert et al. 2003, Carr et al. 2010,

Radulovici et al. 2010). As a consequence, there is a need for a new method of taxon recognition (Hebert et al. 2003a).

DNA barcoding involves the use of a short, standardized gene region to identify and discover species (Hebert et al. 2003a, b). A 648 base pair (bp) region of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the DNA barcode for metazoans (Hebert et al. 2003a). The COI gene was chosen due its ability to be applied to a broad range of taxa, the prevalence of robust universal primers for this gene and its high rates of sequence change creating sequence diversity, permitting it to be

used for discrimination between closely allied species (Mardulyn & Whitfield 1999; Hebert et al. 2003a, b). Species are delineated based on the separation between intra- and interspecific genetic distances or

‘barcode gap’, while they are identified through sequence similarity within a library containing sequences of identified representative species (Hebert et al. 2003, Witt et al. 2006, Kerr et al. 2009; Radulovici et al.

2010). DNA barcoding has been particularly useful in marine organisms where variable reproductive forms and life stages, morphological stasis, and damage to specimens during collection hinder identification of even well-known taxa (Knowlton 1993). Moreover, such analysis often highlights cases of cryptic diversity, particularly in marine species with broad ranges (Knowlton 2000, Carr et al. 2010,

Bucklin et al. 2011).

This thesis extends the knowledge of Canadian species diversity in the phylum Cnidaria. Cnidaria is a diverse phylum consisting of taxa with multiple life stages often exhibiting morphological plasticity and cosmopolitan distributions. Cnidaria play key roles in ecosystems as predators and prey as well as acting as habitats for many other animals. Scientific interest in Cnidaria has increased lately due to the effects of jellyfish blooms and coral bleaching (Rasmussen 1973, Brown 1997, Hoegh-Guldberg 1999,

Houghton et al. 2006, Purcell et al. 2007, Richardson et al. 2009, Purcell 2012, Gibbons & Ricardson

2013). This study explores genetic variation in Cnidaria and provides insight into diversity patterns in

Canadian oceans. Chapter 1 begins the assembly of a DNA barcode reference library for Canadian cnidarians and examines patterns of COI sequence clustering. Chapter 2 provides an in-depth analysis of the deep COI sequence divergences found in the genus Cyanea. This thesis demonstrates the efficacy of using DNA barcodes for the delineation of cnidarian species and for highlighting cases of deep intraspecific divergence that may signal cryptic species. This work highlights the need for greater effort in species documentation to further understanding of marine biodiversity and to aid in conservation.

Table 1. Taxonomic classification of taxa reported in Canadian waters (modified from Archambault et al. 2010). The subtotal indicates the number of taxa excluding the domains Bacteria and Archaea as well as five additional eukaryan phyla. The minimum number of taxa in the three Canadian oceans is estimated to be between 15,988 and 61,148, a broad range given the lack of sampling in many areas of Canada and the known underestimation of taxa in Canadian oceans.

Taxonomic Group No. Taxa Western Canadian Eastern Domain Kingdom Phylum Canada Arctic Canada Archeae 50-5000 50-5000 50-5000 Bacteria 5000- 5004-50,004 5000- 50,000 50,000 Eukarya Other Eukarya (5 phyla) 50-500 50-500 50-500 Chromista Phaeophyta 134 134 120 Chromobiota 355 774 333 Plantae Chlorophyta 122 132 121 Rhodophyta 380 66 130 Protoctista Dinomastigota 112 301 219 Unclassified 41 14 Prototista Unclassified 3 30 29 choanoflagellates Animalia Porifera ND 4 6 Cnidaria 5 47 97 Platyhelminthes 2 1 3 Mollusca 188 156 228 Annelida 364 324 439 Crustacea 481 722 719 Bryozoa/Ectoprocta ND 3 8 Echinodermata 24 35 52 Urochordata 12 3 ND (Tunicata) Other invertebrates 46 52 72 Vertebrata (Pisces) 371 189 538 Marine mammals 37 24 32 SUBTOTAL 2636 3038 3160 TOTAL REGIONAL DIVERSITY 7736- 8142-58,547 8260- 58,136 58,660 TOTAL 15,988-61,148

Chapter 1 Patterns of DNA Barcode Variation in Canadian Cnidarians

Abstract This study begins the assembly of a DNA barcode reference library for Canadian Cnidaria and explores patterns of cytochrome c oxidase subunit 1 (COI) sequence variation, both within and between morphologically identified species. It establishes that COI sequence divergence between congeneric species of scyphozoans, hydrozoans, and staurozoans averages 15.0%, 16.0% and 22.6%, respectively, ensuring the effectiveness of DNA barcoding for species delineation in these groups. By contrast, congeneric species of anthozoans generally exhibit low divergence (1.9%); so species-level resolution is usually not obtained. However, high divergences were observed among species of the tube-dwelling anemones, Pachycerianthus; sea pens, Pennatula and soft coral, Gersemia. Finally, cases of deep (>2%) intra-specific divergence were detected in two scyphozoan genera. Four lineages of Aurelia aurita were detected that diverged by up to 17.1%, and two lineages of Phacellophora camtschatica diverged by

11.7%, suggesting the occurrence of overlooked species.

Introduction The phylum Cnidaria includes approximately 11,000 species, mostly marine lineages, assigned to five classes: Anthozoa, Cubozoa, Hydrozoa, Scyphozoa and Staurozoa (Daly et al. 2007; Kayal et al.

2013). Members of the Anthozoa, the most speciose class, lack a free-living medusa stage and are assigned to two subclasses: Hexacorallia, the hard corals and sea anemones, and Octocorallia, soft corals, sea pens and gorgonians (Daly et al. 2007, Collins 2009). The remaining four classes belong to the subphylum Medusozoa whose species generally possess both a polyp and medusa stage in their lifecycle

(Kayal et al. 2013). The Hydrozoa, which display more life cycle flexibility than the other classes (polyp only, medusa only or both life stages in their life cycle), includes hydras, hydroids, hydromedusae and siphonophores. The Cubozoa include the box jellies and sea wasps, while the Staurozoa contain stalked jellyfish and the Scyphozoa contain the true jellyfish.

Approximately 481 cnidarian species are known from Canada (CaRMS, www.marinespecies.org/carms/) including 330 hydrozoans, 130 anthozoans, 11 scyphozoans and 10 staurozoans. True diversity is likely greater (Archambault et al. 2010) as new species are regularly reported and as genetic studies reveal that many long-recognized species are actually species complexes

(Lom & Dykova 2006; Collins 2009). Species-level identification of cnidarians is often difficult because many closely allied species are discriminated by subtle morphological characteristics (Calder 1971; Weill

1934; Watson 1988), while others display either geographic variation in phenotypes or marked phenotypic plasticity in response to environmental conditions (Schuchert 2001; Schroth et al. 2002;

Thuesen 2003; Bolton & Graham 2004; Willcox et al. 2008). Taxonomic decisions are further complicated by the prevalence of hybridization in certain groups, such as corals (Willis et al. 2006), and by damage to specimens during collection due to their fragility (Totten 1965). Furthermore, the immature stages of many cnidarians are either unknown, or diagnostic features are absent or unrecorded preventing their identification (Ortman 2010).

DNA barcoding overcomes many of the difficulties associated with the use of morphological traits for both species delineation and identification (Hebert & Gregory 2005; Hebert et al. 2003a). In

most animal groups, sequence variation in the 5’ region of the cytochrome c oxidase subunit 1 (COI) gene is extremely effective in species delineation. However, the situation in Cnidaria is more complex. Most members of the Anthozoa show rates of mitochondrial evolution that are only 5-10% of those in other animal lineages (Best & Thomas 1993; van Oppen et al. 1999; Shearer et al. 2002). As a consequence, congeneric species often fail to show divergence in the barcode region. For example, members of the

Montastraea annularis species complex possess identical COI sequences despite morphological, physiological, reproductive and allozyme divergence (Medina et al. 1999; Snell 2000). Similarly, species of Acropora showed only 0.3-0.8% sequence difference in the mitochondrial cytochrome b gene (van

Oppen et al. 1999). Because of this slow rate of molecular evolution, sequence variation in COI often only provides genus-level resolution in anthozoans (Shearer 2002). The situation is different in the four classes of Medusozoa, as their rates of mitochondrial evolution appear similar to those in other metazoans

(Govindarajan et al. 2005a; Lewis & Bentlage 2009; Ortman 2010 et al.; Bucklin et al. 2011; Collins et al. 2011). As a result, DNA barcoding is a powerful tool for the delineation of species in these taxa. For example, analysis of COI sequence variation in the scyphozoan Aurelia aurita revealed that what is referred to in the literature as a cosmopolitan species is a complex of at least nine species (Dawson &

Jacobs 2001). Similarly, a study of COI variation in the hydrozoan Obelia geniculata found three allopatric COI lineages in the North Atlantic and in waters near Japan and New Zealand, representing cryptic species (Govindarajan 2005a).

Although the utility of DNA barcoding has been demonstrated, no study has aimed to assemble a barcode reference library for the cnidarian fauna of a large geographic region. The present study begins this task for the fauna of Canada’s oceans, examining COI sequence variation in one quarter (119) of the known cnidarian species. It establishes the effectiveness of COI barcodes for species delineation in the

Hydrozoa, Staurozoa, and Scyphozoa as well as in certain Anthozoa. As well this study reveals possible cases of cryptic speciation in jellyfish of the species Aurelia aurita and Phacellophora camtschatica.

Finally this study demonstrates the advantage of COI barcodes for providing rapid identifications of cnidarians in different life stages and of morphologically unidentifiable fragments.

Methods

Specimen Collection and Taxonomy

The 781 specimens that were collected in good condition were preserved intact, while tissue samples were taken from 1225 specimens that were either too large to transport or in poor condition

(Table B.1). As well, tissue samples were taken from 428 museum specimens that were collected from one to more than ten years previously. The preservation history was known for 382 of these museum specimens: 171 had been stored in 60% in isopropanol, 19 in formalin, 103 in 95% ethanol, while the remaining 89 were initially fixed in formalin before being stored in 95% Ethanol (Table 1.1). These 2434 specimens were collected from 2102 locations across Canada by various methods including: dip nets, trawling and diving (Figure 1.1, Table B.1). Significant sources of specimens are shown in Table 1.2.

Whenever possible, specimens were identified using field guides to genus level using morphological characters at the time of collection. Whole specimens or parts of them were usually preserved immediately in 95% ethanol, but some specimens were frozen in seawater before transfer to 95% ethanol

(Table 1.1).

DNA Isolation, Extraction and Amplification

A small (~2mm2) tissue sample was excised from each specimen and placed in a well of a 96 well microtitre plate. Each tissue sample was placed in 45 µL of cetyltrimethylammonium bromide (CTAB) lysis buffer solution (Ivanova et al. 2008) along with 5 µL of proteinase K and incubated at 56oC for 12-

18 hours. DNA was extracted following the manual protocol of Ivanova et al. (2008) using a 3 µm glass fibre plate, and was resuspended in 40-50 µl of ddH2O. Cytochrome c oxidase subunit I (COI) was amplified from all specimens using newly designed primers AnthoF1 (5’-

ATTTTCTACTAATCATAARGATATHGG) and AnthoR1 (5’-

TGCCCAAAGAACCAAAAYARRTGY) developed by myself on the basis of all available anthozoan

COI sequences in GenBank. Each polymerase chain reaction (PCR) was carried out in a 12.5µL reaction volume containing 6.25 µL 10% trehalose, 2µL ddH2O, 1.25µL 10X PCR buffer (Invitrogen), 0.625 µL

MgCl2 (50mM, Invitrogen), 0.125 µL of each primer (10µM), 0.0625 µl dNTPs (10mM, Invitrogen), 0.06

µl Platinum Taq polymerase (Invitrogen) and 2 µl of DNA template (10-50ng). The thermocycling regime consisted of one cycle of 1 min at 94oC, five cycles of 40 s at 94oC, 40 s at 45oC, and 1 min at

72oC, followed by 45 cycles of 40s at 94oC, 40s at 48oC and 1 min at 72oC with a final extension for 5 min at 72oC. PCR products were run on the E-Gel(R) 96-well system (Invitrogen). Amplicons in PCR plates with more than 80% amplification success were bi-directionally sequenced using Big Dye v3.1

(Applied Biosystems). The reactions were resolved on an ABI 3730XL DNA Analyzer (Applied

Biosystems). In plates with lower success, wells with amplicons were removed from their plate and aggregated in a plate with other amplicons for sequencing. Sequencing primers were the same as those used for PCR. The 9.5 µL of PCR product remaining after E-gel screening was diluted with 15µL ddH2O as high amplicon concentration led to depletion of dNTPs, causing the loss of signal strength before sequencing was complete. Each sequencing reaction was carried out in a 9 µL reaction volume containing

5 µL of 10% trehalose, 0.875 µL ddH2O, 0.25 µL Big Dye, 1.875 µL 5x seq buffer, 1 µL of primer

(10µM) and 2 µl of diluted PCR product. The thermocycling protocol consisted of one cycle of 2 min at

96oC, thirty cycles of 30s at 96oC, 15s at 55oC and 4 min at 60oC. Sequences were manually edited using

CodonCode Aligner 4.1.1 (CodonCode Corp., Dedham, MA) and aligned using Clustal W in MEGA 6.0

(Tamura et al. 2013). Sequences containing more than 1% ambiguous base calls or that were shorter than

220 bp were excluded from subsequent analyses. All sequences were checked for stop codons, double peaks or insertions and deletions (indels) as a signal of putative pseudogenes. Sequences that passed this screening were examined in GenBank by BLAST (Altschul et al. 1997) as well as identified on the BOLD

(http://www.boldsystems.org) database to ensure that the sequence matched the source organism. This analysis revealed 129 sequences that were derived from another cnidarian taxon or from zooplankton other than the source specimen. All valid sequences were deposited on BOLD in project DS-CC1KH

(doi:dx.doi.org/10.5883/DS-CC1KH).

Species Delineation

All COI sequences longer than 500bp were assigned a Barcode Index Number (BIN) by BOLD

(Ratnasingham & Hebert 2013). BINs are generated by the Refined Single Linkage (RESL) algorithm

(Ratnasingham & Hebert 2013), which employs a three-phased analysis to reach decisions on the number of BINs in the overall sequence data set on BOLD. Sequences assigned to different BINs are likely to represent separate species (Ratnasingham & Hebert 2013).

Sequence Analysis

Phylogenetic tree construction and calculation of pairwise genetic distances were performed in

MEGA 6.0 (Tamura et al. 2013). Neighbor-joining (NJ) trees were generated using the NJ method from distances calculated using the K80 model (Kimura 2-parameter: equal base frequencies, one transition rate and one transversion rate; Kimura 1980) with 1000 bootstrap replicates chosen due to its use in other barcoding papers (Hebert et al. 2003; Ortman et al. 2010; Holst & Laakman 2013) therefore making this study comparable.

Results

Taxon Diversity

The 2434 cnidarian specimens include 1258 from British Columbia, 372 from the Gulf of St.

Lawrence, 176 from Nova Scotia, 116 from Newfoundland and 209 from the Bay of Fundy. Another 213 specimens were collected from Hudson Bay, 78 from Labrador, Baffin Island and the Beaufort Sea and 4 from Ontario and 8 from Alberta (Table 1.3, Figure 1.1). Using morphology, 73 of these specimens were only identified to phylum, 412 to class, 36 to order, and 64 to family given that higher classification required specimen dissection and microscopic examination. The remainder were assigned to a genus

(447) or a species (1402). Most specimens with a class or lower-level identification were Anthozoa (1272 specimens), followed by Hydrozoa (691 specimens), Scyphozoa (385 specimens) and Staurozoa (13

specimens). Specimens were analyzed from 102 genera; 71 were represented by one morphospecies, while 31 genera contained two or more.

Sequence Recovery

The largest challenge in this study was to develop new protocols for sequence recovery of cnidarians. This study employed multiple rounds of PCRs, tested different primer cocktails and modified

PCR regimes to minimize contamination and pseudogene recovery. These optimization studies revealed that adding an extra wash step during DNA extractions, a 1:10 dilution of DNA, and using a PCR thermocycling protocol with an annealing temperature of 48oC and amplification for 45 cycles generated the highest success.

A COI sequence was recovered from 1604 of the 2434 specimens. Nearly all DNA sequences

(99.5%) contained less than 1% ambiguous bases and none showed evidence (e.g. double peaks, stop codons or indels) of being derived from pseudogenes. The COI sequences were used to make a usable dataset of 1324 COI barcodes that were greater than 500bp in length and uncontaminated with foreign

DNA. They were assigned to 125 BINs and represented 129 morphospecies from a total of 72 genera, 53 families and 236 morphologically unidentified specimens.

A relatively high incidence of contamination was encountered as 129 of the 1604 sequences did not derive from their source specimen. Sample contamination often involved other cnidarian species collected at the same time or located on the same plate. Most sources of contamination were from anthozoans (79 cases) especially caused by anemones in the genera Metridium and Urticina. Scyphozoans caused 21 cases of contamination, primarily by jellyfish of the genus Aurelia. While 18 cases of contamination were caused by hydrozoans. Eleven additional cases of contamination were caused by other taxa such as pathogenic bacteria, Vibrio splendidus (1) and marine invertebrates including rotifers

(1), brine shrimp (3) and copepods (2) (Table 1.4).

Although amplification of DNA extracts had high success, ranging from 75-80%, 282 samples had mixed traces during the sequencing reaction in which multiple sequences were being sequenced at the

same time preventing the calling of a single base. Amplicons and sequences could not be generated from

548 specimens with an overall failure rate of 34.1%. One hundred and three of these failures involved specimens initially frozen in seawater, suggesting that DNA degradation occurred during the delayed transfer to 95% ethanol. As well, sequences could not be generated from 375 museum specimens.

Sequencing failure for 341 specimens, with a known preservation history, reflected initial fixation or preservation in formalin or isopropanol as well as appreciable specimen age (Table 1.2). Success was higher for freshly collected specimens with sequences generated from 66% of specimens (Table 1.3). Of the specimens from which a sequence record was not generated, 551 were Anthozoa, 322 Hydrozoa, 92

Scyphozoa and 4 Staurozoa. Among the sequencing failures there were no clear patterns of failure associated with specific families or orders, which would have indicated a primer problem (Table 1.5).

Most taxa with high failure rates were also represented by low numbers of specimens or high numbers of preserved museum specimens.

Scyphozoa

A COI sequence was recovered from 293 of the 385 scyphozoans for a success rate of 76.1%

(Table 1.3, Table B.1, http://www.boldsystems.org/). The order Coronatae showed the highest sequencing failure rate (59.4%, Table 1.5); however this was due to the majority of the specimens being museum- preserved (Table 1.1). These sequences included 232 that were >500bp and 94.8% of these were >600bp in length (Table 1.3). The sequences were derived from nine species, five genera and four families.

Neighbor-joining analysis revealed 16 lineages that were each assigned to a different BIN (Figure 1.2) with a mean interspecific divergence between congeneric taxa of 22.0%. Mean intra-specific divergence was 10.6% and divergence between species in different genera averaged 33.6% (Table 1.6). A barcode gap was present for most morphologically identified species with a few species exhibiting deep intra- specific divergences indicating possible cryptic species.

A few specimens were fragmented so they were morphologically unidentifiable. A jellyfish fragment (KHA160-14) was identified as a scyphozoan because its large size indicated it could not be a

hydrozoan or staurozoan (Figure 1.3A). Its COI sequence grouped it with Cyanea sp. BOLD: AAP1190.

Two other specimen fragments (KHA233-14, KHA186-14) were identified in a similar fashion; both were placed in BOLD: ACO7920 which was Periphylla periphylla (Figure 1.3B, C).

Aurelia aurita (Order: Semaeostomeae, Family: Ulmaridae)

A total of 82 specimens of Aurelia aurita including both medusae and polyps were collected from

British Columbia, Hudson Bay, Newfoundland, New Brunswick and Nova Scotia (Table 1.3). Sequences were recovered from 36 of these specimens and all were >600bp in length (Table. 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed four lineages, each assigned to a different BIN (BOLD: AAN6775, AAC2226, AAC5462, AAA4674, Figure 1.4A). Bootstrap values on the neighbor-joining tree were high (100%) providing strong support for the lineages. Mean pairwise distances between lineages ranged from 13.5-20.5% while mean pairwise distances within lineages were

0.0-0.9%, creating a pronounced barcode gap (Table 1.6, Figure 1.5A).

The Canadian Aurelia aurita lineages were compared with Aurelia spp. COI sequences from

BOLD and mined from GenBank to establish identities through sequence similarity (Figure 1.6).

Specimens of BOLD: AAN6775 were collected solely from Hudson Bay and did not cluster with any other Aurelia spp. COI sequences. Members of a second lineage (BOLD: AAC2226) collected from

Newfoundland, the Gulf of St. Lawrence and the Bay of Fundy grouped with a lineage of A. aurita previously known from the Baltic, White, North, Black, and Irish Seas as well as from Boston Harbor

(Dawson et al. 2005; Shao et al. 2006; Armani et al. 2012; Holst & Laakman 2013; Keskin & Atar 2013;

Dawson et al. 2014). Specimens of the other two BINs (BOLD: AAC5462, AAA4674) derived from aquaria. Specimens from the Shaw Ocean Discovery Center (BOLD: AAC5462) were originally collected from Saanich Inlet and Haro Strait, British Columbia and clustered with sequences of Aurelia labiata, which is broadly distributed in the Pacific waters of North America, occurring from California to Alaska

(Holland et al. 2004; Dawson et al. 2005). By contrast, specimens from the Vancouver Aquarium, which

were derived from Japan, clustered with sequences of Aurelia sp. 1 from Korea (Ki et al. 2008; Park et al.

2010) and China (Minxiao et al. 2012; Armani et al. 2014).

Phacellophora camtschatica (Order: Semaeostomeae, Family: Ulmaridae)

A COI sequence >600bp in length was retrieved from nine of twelve specimens of Phacellophora camtschatica collected from British Columbia (Table 1.3, Table B.1, http://www.boldsystems.org/).

Neighbor-joining analysis revealed two lineages, each assigned to a different BIN (BOLD: ACM3971,

ACN0101; Figure 1.7). Bootstrap values on the neighbor-joining tree were 100% providing strong support for the lineages. Sequences from two jellyfish fragments, KBCSM258-14 and KBCSM237-14, also clustered with these specimens (Figure 1.3D, E). Pairwise between lineage and within lineage sequence distances were 11.7% and 0.1-0.5% respectively, creating a pronounced barcode gap (Table 1.6,

Figure 1.5B).

Hydrozoa

A COI sequence was recovered from 369 of 691 hydrozoan specimens of which 95.7% were

>600bp in length, for a sequencing success rate of 53.4% (Table 1.3, Table B.1, http://www.boldsystems.org/). The sequencing failure rate for many hydrozoan families was 100%, based on 1-2 specimens. The orders Siphonophorae and Trachymedusae displayed the highest sequencing failure rates of 59.4% and 65.4%, respectively (Table 1.5). In total the hydrozoan sequences represented

33 species, 23 genera and 19 families. Neighbor-joining analysis revealed 57 lineages which were each assigned to a different BIN (Figure 1.8) with mean interspecific sequence divergence between morphologically identified congeneric taxa of 15.0%, mean intra-specific divergences of 0.5% and mean divergences between genera of 27.9% (Table 1.6).

Although the 267 hydrozoan specimens could only initially be identified to phylum or class using morphological characters, their COI sequence enabled a more precise assignment. Five specimens

(KHA737-14, KHA738-14, KHA739-14, KHA740-14, KHA741-14) were initially only identified to

phylum, but their barcodes matched those of Melicertum octocostatum, an identity confirmed by morphological examination of the specimens (Figure 1.9). KHMS043-14 was morphologically unrecognizable due to dehydration in 95% ethanol, but its COI sequence was assigned to BOLD:

ACL8523, which represents Aeginopsis laurentii collected from the same locality (Figure 1.3F).

Additionally, 27 medusae only identified as Hydrozoa belong to BOLD: AAF4843, which includes a species of Bougainvillia.

Sarsia (Order: Anthoathecata, Family: Corynidae)

Fifteen specimens representing species of Sarsia were collected from Quebec and Hudson Bay, producing 13 sequences >500bp (Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed three lineages, each assigned to a different BIN (BOLD: AAD5402, AAN4843,

AAF1632, Figure 1.10). Pairwise interspecific sequence distances ranged from 4.5-6.4% while intra- specific distances ranged from 0.0-2.2% (Table 1.6, Figure 1.5C). Bootstrap values on the neighbor- joining tree were high, ranging from 99-100% providing strong support for the lineages. Two specimens identified to the class Hydrozoa (KHMS004-14, ARCMI584-14) and one specimen mis-identified as

Hybocodon prolifer (CAISN1248-13) clustered with Sarsia sequences and BLAST of their sequences identified them as Sarsia with 99% probability. Members from BOLD: AAN4843 were identified as S. princeps, while those of BOLD: AAD5402 were S. tubulosa. A BLAST of the sequences from BOLD:

AAF1632 also came up as S. tubulosa with 99% probability.

Hydra (Order: Anthoathecata, Family: Hydridae)

Nineteen sequences >600bp in length were generated from 20 specimens of Hydra collected from

Alberta and Manitoba (Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed five lineages which were each assigned to a different BIN (BOLD: AAN4537, AAI8740,

AAX2382, ACJ0105, ACM7076, Figure 1.11). Bootstrap values on the neighbor-joining tree were high, ranging from 98-100%, providing strong support for the lineages. Six specimens were initially

morphologically identified to the family Hydridae (CCSMA262-14, CCSMA263-14, CCSMA264-14,

CCSMA265-14, CCSMA266-14, CCSMA268-14) which all cluster in BOLD: ACM7076. A BLAST of their sequences identified them as Hydra canadensis with 99% probability. Pairwise interspecific distances ranged from 7.3-18.1%, and mean pairwise intra-specific distances ranged from 0.0-1.0%, resulting in a pronounced barcode gap (Table 1.6, Figure 1.5D).

Obelia (Order: Leptothecata, Family: Campanulariidae)

Fifteen specimens, both polyps and medusae, of Obelia were collected from British Columbia,

Hudson Bay, Newfoundland and the Gulf of St. Lawrence, and each produced a COI sequence >500bp

(Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed three lineages, each assigned to a different BIN (BOLD: AAA7089, ACN0372 AAE6029, Figure 1.12). Pairwise interspecific sequence distances ranged from 7.8-12.9%, and pairwise intra-specific distances ranged from

0.3-0.6% creating a pronounced barcode gap (Table 1.6, Figure 1.5E). Bootstrap values on the neighbor- joining tree were high (100%) providing strong support of the lineages. Four specimens initially identified to just class level (KBCSM022-14, KBCSM649-651-14) clustered with O. dichotoma sequences in

BOLD: ACN0372. Seven specimens, initially identified to genus, clustered in BIN: AAA7089

(KHA001-14, KHA747-14, KHA749-751-14, CCSMA168-08, CAISN176-12) and were identified as O. geniculata with 100% probability on BLAST.

Staurozoa

Thirteen stalked jellyfish from the family Lucernariidae were collected from the Arctic,

Newfoundland and Hudson Bay (Table 1.3, Table B.1, http://www.boldsystems.org/). Five of these specimens were morphologically identified as Lucernaria quadricornis and one as Haliclystus auricula.

Nine sequences >500bp were produced, and neighbor-joining analysis revealed three lineages, each assigned to a separate BIN (BOLD: AAG1976, AAN4493, AAN4494, Figure 1.13). Bootstrap values on the neighbor-joining tree were high (100%) providing strong support for the lineages. Mean pairwise

between lineage sequences distances ranged from 21.2-23.5%, while mean pairwise within lineage distances were 0.3-0.4%, producing a pronounced barcode gap (Table 1.6, Figure 1.5F).

Anthozoa

A COI sequence was generated from 721 out of 1272 anthozoan specimens collected from 1050 locations across Canada (Table 1.3, Table B.1, http://www.boldsystems.org/). Of these 721 sequences,

645 were >500bp and of these 591 were >600bp in length. Failure rates were high for the orders

Ceriantharia, Corallimorpharia, Pennatulacea and Scleractinia (Table. 1.5); however, both Pennatulacea and Scleractinia contained a high number of museum-preserved specimens. In total, the Anthozoa sequences in the dataset were estimated to belong to 74 species, 39 genera and 25 families. Neighbor- joining analysis revealed 41 lineages assigned to a different BIN (Figure 1.14) with interspecific divergences ranging between 0.0-19.5% between congeneric taxa, while intra-specific divergences averaged 0.2% and divergences between genera were 17.7% (Table 1.6). As detailed below, many morphologically distinct species grouped together in a single BIN because of their low sequence divergence. A few of these cases included members of different morphologically and ecologically distinctive genera, such as Epiactis lisbethae and Aulactinia stella, Hormathia nodosa and Actinauge cristata, Urticina spp. and Cribrinopsis fernaldi.

Because most congeneric anthozoans show little sequence divergence (Table 1.6), unidentified specimens could only be assigned to a genus. Three COI sequences (KHA137-14, KHA482-14,

KHA018-14) grouped with Gersemia (BOLD: AAP1189, ACI2162). Similarly, the COI sequences of several specimens identified to either the class Anthozoa or genus Bolocera (KHA182-14, KAH173-14,

KHA175-14, KHA141-14, KHA120-14, KHA203-14, KHA180-14, KBCSM240-14 and KHBC206-13) were placed in BIN: AAP1192 with Actinostola anemones.

Pachycerianthus (Order: Ceriantharia, Family: Cerianthidae)

Six COI sequences were generated from 28 specimens of tube-dwelling anemones,

Pachycerianthus, collected from British Columbia, Newfoundland, New Brunswick and Nova Scotia

(Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed two lineages each assigned to a different BIN (Figure 1.15). Bootstrap values on the neighbor-joining tree were high

(100%) providing strong support for the lineages. Sequences of the morphologically identified P. borealis were assigned to BOLD: AAI3719 while those of P. fimbratus were placed in BOLD: ACQ4502. The mean pairwise interspecific sequence distance was 19.5%, and mean pairwise intra-specific distance was

0.25%, resulting in a pronounced barcode gap of 19.25% (Figure 1.16A; Table 1.6).

Gersemia (Order: Alcyonacea, Family: Nephtheidae)

A total of 79 specimens of Gersemia were collected from British Columbia, Labrador, Hudson

Bay, the Gulf of St. Lawrence and Nova Scotia (Table 1.3, Table B.1, http://www.boldsystems.org/).

Another two specimens, one morphologically identified as Drifa glomerata and another as Anthozoa

(KHA482-14, KHA137-14) were added to the analysis creating a total of 58 COI sequences, all >600bp in length. Neighbor-joining analysis revealed three lineages each assigned to a separate BIN (Figure

1.17). Bootstrap values on the neighbor joining tree ranging from 79-97%, showing moderate support for the lineages. Gersemia specimens assigned to BOLD: AAP1189 were collected in Hudson Bay and the

Atlantic, whereas specimens from BOLD: ACI2162 were mostly collected from British Columbia with one specimen from Newfoundland. Mean pairwise between lineage sequence distance was 1.9% and mean pairwise within lineage distance was 0.4%, having a small barcode gap of 1.0% (Figure 1.16B;

Table 1.6).

Pennatula (Order: Pennatulacea, Family: Pennatulidae)

Twenty-two sea pens belonging to Pennatula were collected from British Columbia and the Gulf of St. Lawrence from which 16 sequences >500bp were generated, of which 87.5% were >600bp (Table

1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed two lineages each assigned to a separate BIN (Figure 1.18). Bootstrap values on the neighbor-joining tree were high (98-

100%) providing strong support for the lineages. Pennatula aculeata sequences were assigned to BOLD:

ACM3244 while sequences of P. grandis were assigned to BOLD: ACM3142. Sequences from two specimens identified to genus (KHBC088-13, KHA201-14) grouped with P. aculeata. Mean pairwise interspecific sequence distance was 3.9%, and mean pairwise intra-specific distance was 0.0%, resulting in a barcode gap of 3.4% (Figure 1.16C; Table 1.6).

Anthopleura (Order: Actiniaria, Family: Actiniidae)

Fifty Anthopleura anemones were collected from British Columbia from which 48 sequences

>500bp in length were generated (Table 1.3, Table B.1, http://www.boldsystems.org/). Initial morphological inspection revealed that they include three species: A. elegantissima, A. xanthogrammica and A. artemisia (Figure 1.19). However, neighbor-joining analysis of COI barcodes placed all

Anthopleura species in one BIN (BOLD: AAK0746, Figure 1.20). Pairwise distance between the

Anthopleura species was low, ranging from 0.1-1.1%, with intra-specific distances of 0.0% so there was no barcode gap (Table 1.6, Figure 1.16D).

Urticina (Order: Actiniaria, Family: Actiniidae)

A total of 189 Urticina of five different species (Figure 1.21) were collected from British

Columbia, Hudson Bay, Newfoundland, New Brunswick and Nova Scotia from which 75 sequences

>600bp were generated (Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed one lineage, assigned to one BIN (BOLD: AAJ8124, Figure 1.22). Pairwise interspecific distances between Urticina species averaged 0.0-0.2%, and mean pairwise intra-specific distance was

0.1%, resulting in no barcode gap between species (Figure 1.16E; Table 1.6). U. lofotensis was the only species showing some intraspecific variation with a pairwise intra-specific distance of 0.2%. It clustered separately from other Urticina species on the maximum likelihood tree. Thirty two specimens identified

to class or family level were identified by sequence similarity to the genus Urticina, clustering within

BOLD: AAJ8124. As well, ten individuals identified as Cribrinopsis fernaldi collected from British

Columbia grouped in the same BIN with no divergence from individuals of the different genus.

Stomphia (Order: Actiniaria, Family: Actinostolidae)

A total of 27 COI sequences >500bp in length were generated from 62 Stomphia specimens from

British Columbia, New Brunswick, Nova Scotia, Newfoundland and the Arctic (Table 1.3, Table B.1, http://www.boldsystems.org/). Neighbor-joining analysis revealed one lineage assigned to one BIN

(BOLD: ACO8748, Figure 1.23). Sequences from sixteen anemones identified to the class level, and ten anemones which had been misidentified to the genus Urticina, also grouped in BOLD: ACO8748.

Although specimens from S. coccinea and S. didemon were morphologically distinct, mean pairwise interspecific distance between Stomphia species was only 0.2%, and consequently the mean pairwise intra-specific distance was 0.1%, resulting in no barcode gap (Figure 1.16F; Table 1.6).

Discussion

The phylum Cnidaria is comprised of remarkably diverse and ecologically important taxa (Park et al. 2012). Assessment of biodiversity and traditional morphological identification of Cnidaria is difficult owing to variability of reproductive forms, life stages, hybridization events, phenotypic plasticity, and damage to specimens during collection (Knowlton 1993, Totton 1965). Morphological descriptions of these taxa are often based upon subtle characteristics, such as cnidae (Calder 1971; Weill 1934; Watson

1988) or other easily damaged features (Hernroth & Grondahl 1983) and are often a matter of subjectivity

(Coyne & Orr 2004; Radulovici et al. 2012). Considering the amount of characters and detail required to examine these taxa, traditional morphological methods are not conducive to quick identification or recognition by non-specialists. This study shows the utility of DNA barcodes in the delineation and identification of species and revelation of cryptic species as well as provides the foundation of a reference library of COI sequences for Canadian Cnidaria.

Collection

A total of 2434 specimens were collected from Canadian waters which represented 25% of

Canadian cnidarian fauna (according to the Canadian Register of Marine Species, CaRMS). Although a large diversity of cnidarian specimens was initially collected, barcodes could not be generated for many of them. Many were collected from the Royal British Columbia Museum where the specimen had been initially fixed in formalin which has DNA-degrading properties and rendered these specimens unusable for molecular analysis. Although cnidarian specimens should be stored in formalin to preserve morphological characters, these results show the importance of keeping a tissue subsample in ethanol for future molecular analysis.

Of the specimens morphologically identified to class, 4.5% were scyphozoan that had either been fragmented or lacked diagnostic morphological characters. The second highest number (31.5%) of specimens that were only identified to the class level was Anthozoa. Anthozoan identification is difficult as it requires the examination of numerous characters (Won et al. 2001) and relies on microscopic variation in attributes such as nematocysts and nerve nets (Schuchert 1993, Bridge et al. 1995). The majority of specimens identified only to the class level (64.0%) were Hydrozoa. Hydrozoa are particularly challenging to identify morphologically. Hydrozoans exhibit the highest plasticity in life cycles among cnidarians including morphological transformations, specialised dormant stages, progenesis and transverse fission (Govindarajan et al. 2005a, Schuchert 2005, Werner 2006, Moura et al. 2008).

There are about 3700 described species (Bouillon et al. 2006), but most defining characteristics are microscopic and slight variations are used to differentiate species (Calder 1971, Moura et al. 2008).

Often, identification of a species can only be accomplished at a particular life stage or when reproductive structures are present. Furthermore, taxonomic expertise in the group is diminishing, and existing taxonomists tend to focus their studies only on a particular life stages and/or taxonomic groups. Many of the identified museum specimens are preserved in formalin and therefore are useless for molecular analysis.

Sequencing Success in Cnidaria

Most of the sequences generated in this study were greater than 600bp in length.

Mucopolysaccharides are present in all cnidarian taxa and are not always removed during the DNA extraction protocol used in this study. These can interfere with DNA polymerase, thus reducing PCR amplification success and thus may have influenced the complete sequencing failures (Kress & Erikson

2012). The failure to produce a sequence occurred in 322 Hydrozoa, 92 Scyphozoa, 549 Anthozoa, 4

Staurozoa and 66 specimens identified to the phylum level indicating that challenges to removing mucopolysaccharides still remain. An additional challenge is the carbonate skeleton present in many

Hydrozoa. Most Hydrozoa polyps occur as colonies joined by tubes of tissue protected by a rigid exoskeleton, known as the perisarc, which prevents access to tissue for DNA extraction (Cornelius 1995a, b; Moura et al. 2008).

Beyond this there was also the problem of contamination; even with primers specifically designed for cnidarians many specimens were contaminated by other cnidarians and a few specimens by other taxa.

Cnidarians are hosts of many organisms including bacteria such as Vibrio splendidus and predators of organisms such as brine shrimp, Artemia franciscana and rotifers, which were sources of a few of the cases of the contamination. In cases of contamination by other Cnidaria, the contamination was usually caused by a cnidarian in a different class than the source specimen or by a morphologically distinct species, ruling out mis-identification error.

Patterns of Sequence Variation

Canadian cnidarians showed a mean intra-specific divergence of 2.86%, a value much higher than that reported for polychaetes (0.38%, Carr et al. 2010), marine fish (0.39%, Ward et al. 2005), decapods

(0.46%, Costa et al. 2007), marine molluscs (0.51%, Layton 2013) and echinoderms (0.62%, Ward et al.

2008). However this divergence value decreases to 0.27% after exclusion of the cases of deep divergence found in Aurelia aurita, Phacellophora camtschatica and Cyanea capillata. There was little overlap between within and between lineage genetic divergences in the classes Hydrozoa, Scyphozoa and

Staurozoa as demonstrated by Obelia, Sarsia and Lucernaria species as well as the freshwater Hydra, thus suggesting that DNA barcoding is very effective in delineating these cnidarian species. This study also demonstrates the ability of COI barcodes to identify morphologically mis-identified and unidentified specimens as well as specimen fragments. Furthermore, these results are significant to the study of marine organisms as they indicate the ability of COI barcodes to identify species of cnidarians at all stages during their life cycles.

Low Interspecific Divergence in Anthozoa

Historically, species-level resolution of Anthozoa has been difficult owing to a slow rate of mitochondrial DNA evolution, resulting in low interspecific sequence divergence. Nevertheless, tube- dwelling anemones, members of the genus Pachycerianthus exhibit higher divergences, different from the majority of anthozoans. Pachycerianthus borealis and P. fimbratus form separate lineages with deep divergence and assigned to separate BINs (BOLD: AAI3719, ACQ4502). In fact, Stampar et al. (2014) suggested that species in the order Ceriantharia have fast-evolving mtDNA as do other Medusozoa, with

COI interspecific genetic distances ranging from 3-17%. The results of their study of the phylogeny of anthozoan orders (Stampar et al. 2014) also suggested that Ceriantharia should be ranked as a separate subclass within Anthozoa, outside of Hexacorallia. Therefore, two scenarios for the evolution of fast- evolving mtDNA are possible (Figure 1.24). Mitochondrial DNA evolution could have gathered speed in

Bilateria but was slowed in Anthozoa, not including Ceriantharia. Alternately, higher rates of evolution could have evolved independently in the Medusozoans, Ceriantharia and Bilateria (Huang 2008, Stampar et al. 2014).

High divergence was also found among species of sea pens and soft corals from the orders

Pennatulacea and Alcyonacea (subclass Octocorallia), respectively. France & Hoover (2001) historically describe deep sea octocorals with low interspecific COI divergences; however, their study was limited, involving only two species in different genera of the order Alcyonacea and no species of the order

Pennatulacea. COI has since been used to discriminate Mediterranean gorgonian corals, from the order

Alcyonacea (Calderon et al. 2006). In this study COI barcodes could be used to discriminate between soft corals of the genus Gersemia, which were assigned to 3 BINs and showed a mean pairwise interspecific distance of 1.9%. Although no COI studies have been performed on the order Pennatulacea, studies involving other mitochondrial markers have displayed high divergence (Dolan et al. 2013). This study demonstrated 3.9% sequence divergence between congeneric sea pens, P. aculeata and P. grandis, with a barcoding gap of 3.4%. COI has also been used to discriminate hexacorallian species of the order

Zoantharia (Sinniger et al. 2008, 2010), but few zoanthids were collected in this study to display this high interspecific COI divergence.

Although congeners of Pachycerianthus show high divergence, the other Anthozoa collected for this study display classic low divergences (<2%). For instance, species of Anthopleura, Urticina and

Stomphia are clearly morphologically distinguishable, yet show interspecific COI distances of less than

2%. This study confirms the ability of COI to distinguish higher-level taxa (Shearer 2002) with unidentified and misidentified anemone sequences clustering with genera such as Actinostola, Urticina and Stomphia. However the ability of COI to distinguish anthozoan species depends upon the species being investigated.

Many reasons have been suggested for the slow rate of mitochondrial DNA evolution in

Anthozoa including selection, a recent bottleneck, enhanced mitochondrial DNA repair, genome linearization and fragmentation, gene arrangement, hybridization and the effect of symbionts through horizontal gene transfer (Shearer 2002; Hurst & Jiggins 2005, Bilewitch & Degnan 2011, Kayal et al.

2011, Brockman & McFadden 2012, Stampar et al. 2014). Anthozoa possess typically circular mitochondrial DNA (Bridge et al. 1992; Pont-Kingdon et al. 2000) whereas medusozoans have linear

DNA; therefore it has been suggested that genome linearization in Medusozoa caused the acceleration of the mtDNA evolutionary rate in this subphylum. The loss of DNA repair genes in Medusozoa and

Bilateria has also been indicated as suspects causing increased evolutionary rates.

The homologue to the bacterial MutS-like protein is encoded by the mitochondrial genome of

Octocorallia, producing a mismatch repair system which in principle could contribute to the low rates of

molecular evolution in this group (Pont-Kingdon et al. 1995, 1998; Culligan et al. 2000, France & Hoover

2001, Stampar et al. 2010). However, this hypothesis is uncertain as there is no evidence of a MutS repair gene in Hexacorallia (Knowlton 2000, Ogata et al. 2010). The slow rate of mitochondrial evolution could also reflect the effect of regular hybridization which is strongly argued by Veron (1995) in corals, many of which reproduce from mass spawning events at approximately the same time (Knowlton 2000).

Urticina

Many valid species in the genus Urticina are reported from Canadian waters including: U. columbiana (Verrill 1922), U. coriacea (Cuvier 1798), U. crassicornis (Muller 1776), U. felina (Linnaeus

1761), U. eques (Gosse 1860) U. lofotensis (Danielssen 1890) and U. piscovora (Sebens & Laakso,

1977). The majority of the species are reported from British Columbia (Verrill 1922, Sebens & Laakso

1977, Cline & Wolwyk 1997, Lamb & Hanby 2005), whereas U. felina is solely located in the Atlantic

(Carlgren 1921) and U. esques in the Arctic (Lumsden et al. 2007). Urticina crassicornis is reported to have the most widespread distribution, found globally in temperate waters (Lamb & Hanby 2005,

Carlgren 1921, 1934; Verrill 1864; McMurrich 1901). Many of these species were originally classified as

Tealia (Sebens & Laakso 1978). Species of Urticina are easily distinguished by colour patterns alone, particularly the markings on the oral disk and tentacles (Sanamyan et al. 2013). Morphological characteristics such as tubercle arrangement and tentacle characters further separate these species (Fautin et al. 1987). However, in COI barcode analysis, the species of Urticina group together in the same lineage and BIN group with low interspecific divergence. Even anemones from different coasts did not separate from each other.

Cribrinopsis fernaldi anemones clustered in the same lineage and BIN group as all the Urticina anemones. Cribrinopsis fernaldi was first described in 1976 by Siebert and Spaulding off the coast of

British Columbia. The genera Urticina and Cribrinopsis have never been distinguished by molecular means, only morphology. Cribrinopsis and Urticina are thought to be closely related and have several common features including morphological characters and details of cnidae (Sanamyan et al. 2013). Yet,

Cribrinopsis and Urticina vary in the distribution of gonads and differences in the size ranges of nematocysts in tentacles and actinopharyx (Sanamyan & Sanamyan 2006; Sanamyan et al. 2013). The close relationship of these genera and the few distinguishing morphological characters as well as the lack of molecular studies reveals the need for a re-examination of these taxa’s classification.

Several anemones identified only to either the class or family level, Anthozoa or Actinariidae, grouped in the same BIN as Urticina indicating that they are most likely from the same genus. These included anemones collected from the Arctic section of the Vancouver Aquarium. Other anemones identified as Actinostola sp. and Stomphia coccinea, collected in Nova Scotia and New Brunswick, also grouped with Urticina indicating that these were perhaps misidentified when collected. These examples show the ability of COI to identify Anthozoans to the genus level as well as to identify specimens that had lost diagnostic characters.

Stomphia

Two species of swimming anemones from the genus Stomphia are reported from Canadian waters

(Lamb & Hanby 2005). These two species are morphologically distinguished by tentacle number and their arrangement and retractor muscles in the mesenteries (Siebert, 1973). These two species were initially considered to be a single species, but physiological and behavioral differences, such as swimming behavior and habitat selection, led to their separation (Robson 1966, Ross & Sutton 1967). Stomphia coccinea and S. didemon, have both been reported from the Pacific coast of Canada; whereas S. coccinea is the only species from the Atlantic coast and Arctic (Lamb & Hanby 2005; Feder & Jewett 1977).

Initially, S. didemon was assigned to the genus, Actinostola, but Carlgren (1949) distinguished S. didemon based on retractive capabilities, mesentery arrangement and tentacles. COI barcodes confirm this discovery as S. didemon is not in the same BIN as Actinostola. However, the different species of

Stomphia (S. didemon, S. coccinea) group together in the same lineage and BIN group with low interspecific divergence. Even anemones from different coasts did not separate from each other.

Several anemones identified just to the class Anthozoa, grouped in the same BIN as Stomphia indicating that they are from the same genus. Other anemones identified as Urticina also grouped with the

Stomphia specimens, indicating that these were perhaps misidentified at collection. These show the ability of COI to identify anthozoans to the genus level as well as to identify specimens which had lost diagnostic characters.

Cases of Cryptic Species

Previous studies have shown the ability of COI to reveal cryptic species in Medusozoans (Moura et al. 2008). In this study, examination of three species revealed the deep intraspecific divergence indicating cryptic species, one of which is studies further in Chapter 2. This study revealed four lineages of Aurelia aurita distributed across Canada and two lineages of Phacellophora camtschatica distributed to British Columbia. Analysis of Aurelia aurita and Phacellophora camtschatica confirm the ability of

COI barcodes to reveal instances of morphospecies possibly containing cryptic species.

Previous study of the cosmopolitan moon jellyfish Aurelia (Kramp 1968; Russell 1970) revealed nine separate lineages collected worldwide (Dawson & Jacobs, 2001). Of the four lineages revealed in this study with high COI interspecific divergence of mean 17.1%, three were genetically similar to previously identified species. Aurelia labiata, distinct from A. aurita, is the only species recognized as native to Pacific North America (Wrobel & Mills, 1998). The lineage from Shaw Ocean Discovery Center

(BOLD: AAC5462) was the only lineage found off the coast of British Columbia and was genetically similar to A. labiata, confirming its identity. Similarly, sequences from the Vancouver Aquarium lineage

(BOLD: AAA4674), consisting of specimens originally collected from Japan, grouped with sequences from Asia known as Aurelia sp. 1 from the Dawson & Jacobs study (2001). The Atlantic lineage (BOLD:

AAC2226) was genetically similar to A. aurita specimens from the White and Black Seas in Europe which is consistent with the findings of Dawson & Jacobs (2001). They suggested that this occurrence is likely due to A. aurita from the Atlantic Ocean recolonizing the Mediterranean Sea following the

Messianian Salinity Crisis (Dawson & Jacobs, 2001). The Hudson Bay lineage (BOLD: AAN6225) was

not genetically similar to any GenBank sequences. Furthermore, no previous studies have investigated moon jellyfish from this region, thus indicating that this lineage may represents a new species of Aurelia.

Little to no taxonomic work has been performed on the genus Phacellophora. The World Register of Marine Species (WoRMS) recognizes only Phacellophora camtschatica in the genus (Widmer 2006,

Costello et al. 2011) and indicates that its distribution includes all temperate oceans. However, the situation is more complex as its listing of species on WoRMS is incomplete, as it does not include P. ornata (Ortman 2010). In this study, two lineages of Phacellophora sp. are described with overlapping geographic ranges. The phylogenetic analysis of these BINs and high divergence of 11.7% between them indicates that this species possibly consists of two or more cryptic species.

Conclusion

After the current study, barcode records (www.boldsystems.org) are now available for 1522 species of the estimated 10,000 species of cnidarians (Daly et al. 2007), therefore there is a need to extend coverage both for the continued documentation of marine biodiversity and for conservation efforts. This study begins to address this gap by developing a barcode reference library for the Canadian fauna and providing new cnidarian PCR primers and protocols. This study establishes the effectiveness of DNA barcodes in delineating species of cnidarians and reveals that DNA barcoding is not only useful for documenting biodiversity, but also for unveiling patterns of genetic variation across a broad taxonomic group on a large geographic scale.

21 17 7

6 27 62 183 1 30 108

505 75 8 223 71

1 248 4 84

75 428 63 186

Figure 1.1 Sampling locations and the number of specimens (indicated by the white numbers) examined in this study.

99 Cyanea sp. (BOLD: AAP1194) N=59

99 Cyanea sp. (BOLD: AAP1190) N=42 99

89 Cyanea sp. (BOLD: AAD3480) N=3 99 99 Cyanea sp. (BOLD: AAF9673) N=20

37 99 Cyanea sp. (BOLD(BOLD ACM9673): ACM6954) N=42 99

42 99 Phacellophora camtschatica (BOLD: ACN0101) N=2

99 Phacellophora camtschatica (ACM3971) N=7 99 Chrysaora sp. (BOLD: ACF6328) N=1 99 99 Chrysaora sp. (ACO9127) N=3 99 99 Chrysaora sp. (ACD2727) N=7

99 Aurelia sp. (AAC5462) N=4 68

43 76 Aurelia sp. (AAN6775) N=4 99 Aurelia sp. (AAA4674) N=1 97 Aurelia sp. (AAC2226) N=20 99 Scyphozoa sp. (AAG4832) N=1

Periphylla periphylla (BOLD: ACO7920) N=13 99

0.022%

Figure 1.2 Neighbor-Joining Tree of Canadian Scyphozoa COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. Sample size, the species represented and BIN is indicated next to branch tips. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

A B C

D E F

Figure 1.3 Fragmented and 95% EtOH dehydrated specimens identified by COI sequences. (A) KHA160-14 identified as Cyanea capillata, BOLD: AAP1190 (B, C) KHA233-14 identified and KHA 186-14 identified as Periphylla periphylla, BOLD: ACO7920 (D, E) KBCSM258-14 and KBCSM237-14 identified as Phacellophora camtschatica, BOLD: ACM3971, ACN0101 (F) KHA043-14 identified as Aeginopsis laurentii BOLD: ACL8523.

Aurelia aurita (KHA342-14) Aurelia aurita (KHA714-14) Aurelia aurita (KHA713-14) Aurelia sp. (KHA796-14) Aurelia aurita (KHMS074-14) Aurelia aurita (KHA343-14)

Aurelia sp. (KHA795-14) Aurelia aurita (ARCMI615-14)

8061 Aurelia aurita (CAISN135-12) Aurelia aurita (KHA716-14) Aurelia aurita (KHMS075-14) Aurelia aurita (KHA712-14) BOLD: 70 64 Aurelia aurita (KHMS076-14) AAC2226 Aurelia aurita (ARCMI617-14)

Aurelia sp. (KHA323-14) Aurelia aurita (KHA305-14) 74 Aurelia aurita (KHA344-14)

100 Aurelia aurita (KHA371-14)

95 Aurelia sp. (KHA794-14)

Aurelia aurita (KHA802-14) Aurelia aurita (KHA715-14) Aurelia aurita (KHA803-14) Aurelia aurita (ARCMI614-14)

95 Aurelia aurita (ARCMI616-14) 57 Aurelia aurita (ARCMI618-14) Aurelia aurita (KHBC268-13) 96 Aurelia sp. (KHBC308-13) BOLD: 100 Aurelia aurita (KBCSM637-14) AAC5462

Aurelia sp. (KHBC307-13) Aurelia aurita (KHBC175-13) BOLD: AAC6775 Aurelia sp. (CCSMA233-10) 89 Aurelia sp. (RDMPC130-10) 100 BOLD: Aurelia sp. (RDMPC122-10) AAA4674 Aurelia sp. (RDMPC162-10)

0.02 2%

Figure 1.4 Neighbor-Joining Tree of Canadian Aurelia COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 657 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

A. Aurelia aurita B. Phacellophora camtschatica

Barcode Gap = 11.2% Barcode Gap =12.6%

(%) Frequency Frequency (%) Frequency

25 Distance (%) Distance (%)

C. Sarsia sp. D. Obelia sp.

Barcode Gap =4.5%

Barcode Gap =7.2%

Frequency (%) Frequency

(%) Frequency

Distance (%) Distance (%)

E. Hydra sp.

F. Lucernaridae sp.

Barcode Gap =6.4% Barcode Gap =20.8%

Frequency (%) Frequency (%) Frequency

Distance (%) Distance (%) Figure 1.5 Nearest Neighbour Barcode Gap of Scyphozoa, Hydrozoa and Staurozoa COI Sequences. These histograms confirm the existence and magnitude of a barcode gap between mean nearest neighbour pairwise within lineage (blue) and between lineage (red) distances of morphologically identified species. (A) Aurelia aurita, (B) Phacellophora camtschatica, (C) Sarsia sp., (D), Obelia sp., (E) Hydra sp., (F) Lucernaridae sp.

Aurelia sp. (RDMPC122-10) 100 Aurelia sp. (RDMPC162-10) BOLD: Aurelia sp. (RDMPC130-10) AAA4674 91 Aurelia sp. (CCSMA233-10) Aurelia sp. (KHBC175-13) Aurelia sp. 1 (GBCI4442-14) BOLD: 100 Aurelia sp. 1 (GBCI0666-06) AAC6775 78 75 Aurelia sp. 1 (GBCI0669-06) Aurelia labiata (GBCI0567-06) Aurelia labiata (GBCI0218-06) Aurelia sp. (KHBC308-13) 100 69 BOLD: Aurelia sp. (KHBC268-13) AAC5462 Aurelia labiata (GBCI0566-06) 69 Aurelia sp. (KHBC307-13) Aurelia aurita (ARCMI614-14) Aurelia aurita (ARCMI615-14) 100 58 Aurelia aurita (KHA305-14) BOLD: 66 Aurelia aurita (DNATR1940-13) AAC2226 40 Aurelia aurita (GBCI0591-06)

0.02 2%

Figure 1.5 Neighbor-Joining Tree of Canadian and Genbank Aurelia spp. COI sequences. A selection of both Canadian sequences from each BIN and Genbank Aurelia sequences (in bold) were chosen to construct this tree. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 657 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Phacellophora camtschatica (KHBC182-13) Phacellophora camtschatica (KBCSM473-14) 64 Phacellophora camtschatica (KBCSM472-14) 58 Phacellophora camtschatica (KBCSM258-14) ACM3971 100 Phacellophora camtschatica (KBCSM013-14) Phacellophora camtschatica Phacellophora (KHBC182-13) camtschatica (KBCSM011-14) 100 64 Phacellophora camtschatica46 Phacellophora (KBCSM473-14) camtschatica (KBCSM701-14)

Phacellophora camtschatica Phacellophora (KBCSM472-14) camtschaticaBOLD: (KBCSM229-14) 58 ACN0101 ACM3971 Phacellophora camtschatica100 Phacellophora (KBCSM258-14) camtschaticaACM3971 (KBCSM237-14) 100 Phacellophora camtschatica Cyanea sp. (ARCMI607-14)(KBCSM013-14) Phacellophora camtschatica Cyanea (KBCSM011-14)sp. (KBCSM340-14) 100 Outliers 46 Phacellophora camtschatica (KBCSM701-14) 99 Cyanea sp. (KHA610-14) Phacellophora camtschatica100 Cyanea (KBCSM229-14) sp. (KHA111-14) BOLD: ACN0101 100 Phacellophora camtschatica (KBCSM237-14) ACN0101

Cyanea sp. (ARCMI607-14) 2%0.02 Cyanea sp. (KBCSM340-14) Outliers 99 Cyanea sp. (KHA610-14) Figure 1.7 Neighbor-Joining Tree100 of Canadian Cyanea sp. Phacellophor (KHA111-14) a camtschatica COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is

0.02 drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

100 Aequorea sp. (BOLD: ACM3194) N=55 20

12 Eutonina indicans (BOLD: AAP1358) N=28 Figure 1.8 Neighbor-Joining Tree of 100 100 Canadian Hydrozoa COI sequences. Earleria cellularia (BOLD: ACN0557) N=3

Hydrozoa sp. (BOLD: AAG1978) N=1 Neighbor-joining tree (Saitou & Nei 36 Hydrozoa sp. (BOLD: ACM4381) N=1 1987) with bootstrap values shown 49 100 Laodicea undulata (BOLD: ACM9406) N=2 next to the branches. Sample size, 2 100 100 Obelia geniculata (BOLD: AAA7089) N=8 species represented and BIN indicated 98 52 Obelia dichotoma (BOLD: ACN0372) N=4 next to branches. The tree is drawn to 100 25 Hydrozoa sp. (BOLD: ACO4122) N=1 scale, with branch lengths given as a 57 Obelia longissima (BOLD: AAE6029) N=4 100 percentage of the number of base Clytia sp. (BOLD AAR9450) N=1 7 100 substitutions per 100 nucleotide sites 5 Melicertum octocostatum (BOLD: ACO2504) N=4 100 computed using the Kimura 2- Hydrozoa sp. (BOLD: ACN0558) N=2 21 parameter method (Kimura 1980). All 28 Staurostoma sp. (BOLD: ACM3778) N=27 ambiguous positions were removed for 100 each sequence pair. There is a total of Hydrozoa sp. (BOLD: ACO3399) N=1 Hydrozoa sp. (BOLD: AAO4013) N=1 661 positions in the final dataset. 28 4 Hydrozoa sp. (BOLD: ACO7472) N=1 Evolutionary analyses were conducted 25 100 53 Hydrozoa sp. (BOLD: ACM6659) N=7 in MEGA 6.0 (Tamura et al. 2013). 97 Hydrozoa sp. (BOLD: ACM8177) N=1 100 44 Hydrozoa sp. (BOLD: ACN0374) N=3 98 Halecium halecinum (BOLD: ACM7666) N=3 0 98 46 Hydrozoa sp. (BOLD: ACN0373) N=3 100 Rathkea octopunctata (BOLD: ACL8220) N=1 12 Pandeidae sp. (ACM6649) N=2 100 100 Hydrozoa sp. (BOLD: ACM3552) N=3 Hydrozoa sp. (BOLD: ACI2118) N=1 2 2 Hydrozoa sp. (BOLD: ACO8204) N=1 6 Agalmatidae sp. (BOLD: AAJ7391) N=1 6 60 Agalmatidae sp. (BOLD: ACL8638) N=2 100 100 Neoturris breviconis (BOLD: ACM6633) N=5 52 89 Leuckartiara nobilis (BOLD: AAP8540) N=2 100 Leuckartiara octona (BOLD: AAP1206) N=4 100 6 6 Hydrozoa sp. (BOLD: ACO8375) N=1 100 Gonionemus vertens (BOLD: AAN2778) N=8 38 49 Bougainvillia sp. (BOLD: AAG4843) N=43 100 17

100 Sarsia tubulosa (BOLD: AAD5402) N=3 67 Sarsia sp. (BOLD: AAF1632) N=2 20 99 100 Sarsia princeps (BOLD: AAN4843) N=2 100 Polyorchis penicillatus (BOLD: ACM3961) N=5 33 100 Hydrozoa sp. (BOLD: ACL8346) N=1 Hybocodon prolifer (BOLD: ACH4931) N=1 Euphysa sp. (BOLD ACL8339) N=1 18 Ectopleura larynx (BOLD: ACF7228) N=1 90 42 Hydrozoa sp. (BOLD:(BOLD: ACF7228) AAP1198) N=1 96 82 Ectopleura crocea (BOLD: ACH9116) N=4 100 99 Hydra circumcincta (BOLD: AAX2382) N=1

Hydra sp. (BOLD: ACJ0105) N=1 100 98 Hydra oligactis (BOLD: AAI8740) N=5 100 Hydra sp. (BOLD: AAN4537) 100 N=6

91 Hydridae sp. (BOLD: ACM7076) N=6 100 Aeginopsis laurentii (BOLD: ACL8523) N=6 100 100 Aglantha digitale (BOLD: ABA2523) N=4 100 Aglantha digitale (BOLD: AAC2227) N=6 100

0.05 5% 35

Sarsia princeps (KHMS042-14) 52 42 Sarsia princeps (KHMS038-14) Sarsia princeps (RDMPC183-10)

10066 Sarsia princeps (NRMMC155-10) Figure 1.9 Melicertum octocostatum specimens from BOLD: ACO2504. AAN4843 Sarsia princeps (CCSMA169-08)

Sarsia princeps (KHMS004-14)

58 63 Sarsia princeps (KHMS016-14) 52 Sarsia princeps (KHMS042-14) Sarsia princeps (KHMS019-14) 42 Sarsia princeps (KHMS038-14) Sarsia tubulosa (RDMPC039-10) 100 Sarsia princeps (RDMPC183-10) Sarsia tubulosa (RDMPC038-10) AAD5402 10066 Sarsia100 princeps (NRMMC155-10) Sarsia tubulosa (RDMPC026-10)AAN4843BOLD: Sarsia princeps (CCSMA169-08) Sarsia sp. (ARCMI584-14) AAN4843 Sarsia princeps (KHMS004-14) AAF1632 99 Sarsia sp. (CAISN1248-13) 58 63 Sarsia princeps (KHMS016-14) Obelia longissima (CAISN176-12) Sarsia princeps (KHMS019-14) Outliers 100 Obelia longissima (CAISN181-12) Sarsia tubulosa (RDMPC039-10) 100 Hydra sp. (KBCSM704-14)BOLD: Sarsia tubulosa (RDMPC038-10) AAD5402 Outliers 100 100 Hydra sp. (KHMS011-14)AAD5402 Sarsia tubulosa (RDMPC026-10) Sarsia sp. (ARCMI584-14) 0.02 BOLD: 2% AAF1632 99 Sarsia sp. (CAISN1248-13) AAF1632

Obelia longissima (CAISN176-12) Outliers 100 Obelia longissima (CAISN181-12) Figure 1.10 Neighbor-Joining Tree of Canadian Sarsia Hydra sp.COI (KBCSM704-14) sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale,Outliers with branch 100 Hydra sp. (KHMS011-14) lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence0.02 pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Hydridae sp. (CCSMA266-14)

58 Hydridae sp. (CCSMA265-14) Hydridae sp. (CCSMA264-14) Hydridae63 sp. (CCSMA266-14) ACM7076 Hydridae sp. (CCSMA262-14) 58 Hydridae98 sp. (CCSMA265-14) Hydridae sp. (CCSMA268-14) Hydridae sp. (CCSMA264-14) BOLD: 63 Hydridae sp. (CCSMA263-14) ACM7076 84 Hydridae sp. (CCSMA262-14) ACM7076 98 Hydra sp. (SAHYD005-10) Hydridae sp. (CCSMA268-14) Hydra sp. (SAHYD002-10) Hydridae sp. (CCSMA263-14) 84 100 Hydra sp. (SAHYD003-10) Hydra sp. (SAHYD005-10) AAN4537 Hydra sp. (SAHYD004-10) 98 Hydra70 sp. (SAHYD002-10) Hydra sp. (SAHYD001-10) 100 Hydra sp. (SAHYD003-10) BOLD: 22 Hydra sp. (SAHYD006-10) AAN4537 Hydra sp. (SAHYD004-10) 98 70 AAN4537 Hydra oligactis (GBCI3776-14) 99 Hydra sp. (SAHYD001-10) Hydra oligactis (RBNII103-13) 22 Hydra sp. (SAHYD006-10) 99 Hydra oligactis (RBNII097-13) AAI8740 99 Hydra oligactis (GBCI3776-14) Hydra sp. (KBCSM704-14) Hydra99 oligactis (RBNII103-13) BOLD: 67 Hydra sp. (KHMS011-14) 99 Hydra oligactis (RBNII097-13) AAI8740AAI8740 Hydra circumcincta (RBNII098-13) AAX2382 99 Hydra sp. (KBCSM704-14) 99 Hydra sp. (RBNII102-13) ACJ0105 67 Hydra sp. (KHMS011-14) Obelia sp. (KHA747-14) Hydra circumcincta (RBNII098-13) AAX2382BOLD:AAA7089 AAX2382 100 Obelia sp. (KHA751-14) 99 Hydra sp. (RBNII102-13) ACJ0105 BOLD: ACJ0105 Obelia sp. (KHA747-14) 0.02 AAA7089 2% 100 Obelia sp. (KHA751-14)

Figure 1.11 Neighbor-Joining Tree of Canadian Hydra COI sequences. Neighbor-joining tree (Saitou & Nei0.02 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Obelia geniculata (KHA747-14) 67 Obelia geniculata (KHA751-14)

Obelia geniculata (KHA750-14) 98 Obelia geniculata (KHA749-14) 69 Obelia geniculata (KHA001-14) Obelia100 geniculata (KHA747-14) 67 Obelia geniculata (CCSMA168-08) Obelia geniculata (KHA751-14) 100 Obelia geniculata (CAISN1255-13) 98 Obelia geniculata (KHA750-14) Obelia bidentata (KBCSM649-14)BOLD: Obelia geniculata (KHA749-14) 69 Obelia bidentata (KBCSM651-14)AAA7089 Obelia geniculata100 (KHA001-14) 100 Obelia bidentata (KBCSM022-14) Obelia geniculata48 (CCSMA168-08) 96 Obelia bidentata (KBCSM650-14|) 100 Obelia geniculata (CAISN1255-13) Obelia longissima (ABMMC6253-10) Obelia bidentata (KBCSM649-14) Obelia longissima (CAISN171-12) Obelia100 bidentata (KBCSM651-14) 100 BOLD: 56 Obelia longissima (CAISN176-12) 48 Obelia bidentata (KBCSM022-14) ACN0372 86 Obelia longissima (CAISN181-12) 96 Obelia bidentata (KBCSM650-14|) Hydra sp. (KBCSM704-14) Obelia longissima (ABMMC6253-10) 100 Hydra sp. (KHMS011-14) Obelia longissima (CAISN171-12) 100 BOLD: Obelia longissima (CAISN176-12) 56 AAE6029 0.02 2% 86 Obelia longissima (CAISN181-12)

Hydra sp. (KBCSM704-14)

Figure 1.12 Neighbor-Joining Tree of Canadian100 Obelia Hydra COIsp. (KHMS011-14) sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths0.02 given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Lucernaria quadricornis (KHA765-14)

100 Lucernaria quadricornis (KHA762-14) 36 BOLD: Lucernaria quadricornis (KHA764-14) AAG1976AAG1976 34 Lucernariidae sp. (CCSMA199-10)

68 Lucernariidae sp. (CCSMA156-08) Lucernariidae sp. (CCSMA208-10) AAN4493BOLD: AAN4493 Lucernariidae sp. (ARCMI613-14) Lucernariidae sp. (CCSMA155-08) AAN4494BOLD: 100 AAN4494 86 Lucernariidae sp. (CCSMA209-10)

2%0.02

Figure 1.13 Neighbor-Joining Tree of Canadian Staurozoa COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 655 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

99 Metridium sp. (BOLD: ACO8622) N=101

99 99 Metridium sp. (BOLD: ACO8622) N=101

98 Diadumene lineata (BOLD: AAF8395) N=6 Figure 1.14 Neighbor-Joining Tree of 99 99 Actinauge sp. (BOLD: AAP1191) N=1 Canadian Anthozoa COI sequences. Actinauge sp. (BOLD: ABA28437) N=1 98 99 91 Diadumene lineata (BOLD: AAF8395) N=6 98 Stephanauge nexilis (BOLD: ABV1102) N=5 Neighbor-joining tree (Saitou & Nei 1987) with 99 75 Stephanauge Actinauge sp. sp. (BOLD: (BOLD: AAP1191) ACM6770) N=1 N=1 bootstrap values shown next to the branches. 99 ActinaugeActinauge sp.sp. (BOLD:(BOLD: AAE3706)ABA28437) N=7 N=1 48 91 99 The tree is drawn to scale, with branch lengths 50 98 Stephanauge nexilis (BOLD: ABV1102) N=5 75 71 Stephanauge sp. (BOLD: ACM6770) N=1 given as a percentage of the number of base 99 Hormathia nodosa (BOLD: AAF8957) N=49 94 Actinauge sp. (BOLD: AAE3706) N=7 48 substitutions per 100 nucleotide sites computed 50 71 99 using the Kimura 2-parameter method (Kimura Actinostola Hormathia nodosasp. (BOLD: (BOLD: AAP1192) AAF8957) N=20 N=49 38 94 1980). All ambiguous positions were removed Actinostola sp. (BOLD: ACM7064) N=1 for each sequence pair. There is a total of 654 99 89 99 Actinostola sp. (BOLD: AAP1192) N=20 38 positions in the final dataset. Evolutionary Stomphia sp. (BOLD: ACO8748) N=53 Actinostola sp. (BOLD: ACM7064) N=1 analyses were conducted in MEGA 6.0 99 89 99 99 Edwardsia elegans (BOLD: ACO2650) N=4 (Tamura et al. 2013). Stomphia sp. (BOLD: ACO8748) N=53 99 99 99 Anthopleura spp. (BOLD: AAK0746) N=50 Edwardsia elegans (BOLD: ACO2650) N=4 51 78

99 Bolocera sp. (BOLD: AAG1974) N=8 99 Anthopleura spp. (BOLD: AAK0746) N=50 90 Aulactinia stella (BOLD: AAI5336) N=15 51 88 99 78 99 Epiactis lisbethae (BOLD: AAI5336) N=2 98 96Bolocera sp. (BOLD: AAG1974) N=8 99 Epiactis sp. (BOLD ACE4272) N=11 90 98 Aulactinia stella (BOLD: AAI5336) N=15 88 99 99 Epiactis lisbethae (BOLD: AAI5336) N=2 98 96 81 Epiactis sp. (BOLD ACE4272) N=11 98

39 Urticina spp. (BOLD: AAJ8124) N=111 81 99

39 Urticina spp. (BOLD: AAJ8124) N=111 36 99

Edwardsiidae sp. (BOLD: ACR4682) N=1 Anthozoa sp. (BOLD: AAJ0939) N=3 8736 99 Epizoanthus scotinus (ABY9710) N=1 99 Zoanthidae Edwardsiidae sp. (BOLD: sp. (BOLD: ACU9353) ACR4682) N=1 N=1 99 Corynactis Anthozoa californica sp. (BOLD: (BOLD: AAI8947) AAJ0939) N=6 N=3 87 99 98 Balanophyllia Epizoanthus elegans scotinus (BOLD: (ABY9710) AAK0118) N=1 N=1 99 99 Zoanthidae sp. (BOLD: ACU9353) N=1 99 KHA380-14|HUNT-1053|Anthozoa|COI-5P 99 47 Corynactis californica (BOLD: AAI8947) KHA373-14|HUNT-1046|Urticina_sp.|COI-5P N=6 98 Balanophyllia KHMS049-14|L*12STAN006-05|Anthozoa|COI-5P elegans (BOLD: AAK0118) N=1 99 51 99 KHA380-14|HUNT-1053|Anthozoa|COI-5P Pachycerianthus fimbriatus (BOLD: ACQ4502) N=1 47 99 Pachycerianthus KHA373-14|HUNT-1046|Urticina_sp.|COI-5P borealis (BOLD: AAI3719) N=5 99 KHMS049-14|L*12STAN006-05|Anthozoa|COI-5P

51 Pachycerianthus fimbriatus (BOLD: ACQ4502) N=1 16 Gersemia rubiformis (BOLD: AAP1189) N=50 99 Pachycerianthus borealis (BOLD: AAI3719) N=5 24 99

94 16 Gersemia sp. (BOLD: ACI2162) N=5 92 Gersemia rubiformis (BOLD: AAP1189) N=50

24 73 78 Psammogorgia torreyi (BOLD: ACH7301) N=6 94 92 Gersemia Calcigorgia sp. (BOLD: spiculifera ACI2162) (BOLD: N=5 ACH6471) N=1 92 Clavularia sp. (BOLD: ACB4625) N=1 99 73 99 Psammogorgia Pennatula torreyi grandis (BOLD: (BOLD: ACH7301) 3142) N=6 N=7 78 31 92 28 Calcigorgia Umbellula spiculifera sp. (BOLD: (BOLD: ACL7076) ACH6471) N=5 N=1 93 Clavularia56 sp. (BOLD: ACB4625) N=1 99 Funiculina armata (BOLD: ACH6793) N=2 41 99 57 Pennatula grandis (BOLD: 3142) N=7 63 31 Halipteris sp. (BOLD: ABX8941) N=11 98 28 80 BalticinaUmbellula sp. sp. (BOLD: (BOLD: ACL7361) ACL7076) N=2 N=5 9399 5659 Pennatula Funiculina aculeata armata (BOLD: ACH6793)ACM3244) N=2N=9 41 57 63 Halipteris sp. (BOLD: ABX8941) N=11 97 Ptilosarcus gurneyi (BOLD: AAP1185) N=13 98 98 80 Balticina sp. (BOLD: ACL7361) N=2 95 58 99 59 Paragorgia spp. (BOLD: ACI0005) N=19 72 Pennatula aculeata (BOLD: ACM3244) N=9 Anthomastus sp. (BOLD: AAW0534) N=4 97 Ptilosarcus gurneyi (BOLD: AAP1185) N=13 99 91 98 Isidella sp. (BOLD: AAI8032) N=5 42 95 58 Paragorgia spp. (BOLD: ACI0005) N=19 72 97 Primnoa Anthomastus sp. (BOLD: sp. ACI1060) (BOLD: AAW0534) N=27 N=4 9099 91 42 Isidella sp. (BOLD: AAI8032) N=5

97 0.05 Primnoa sp. (BOLD: ACI1060) N=27 5% 90 39

0.05

Pachycerianthus borealis (KHA718-14) 63 89 Pachycerianthus borealis (KHA717-14) 86 63 Pachycerianthus Pachycerianthus borealis (KHA718-14) borealis (KHA719-14) AAI3719 89 Pachycerianthus100 Pachycerianthus borealis (KHA717-14) borealis (KHA720-14)

86 Pachycerianthus Pachycerianthus borealis (KHA719-14) borealis (LABBI097-09)AAI3719BOLD: 100 AAI3719 Pachycerianthus borealis Pachycerianthus (KHA720-14) fimbriatus (KHMS055-14) ACQ4502 Pachycerianthus borealis Anthopleura (LABBI097-09) elegantissima (KBCSM601-14) AAK0746 Pachycerianthus100 Anthopleura fimbriatus (KHMS055-14)elegantissima (KBCSM642-14)ACQ4502BOLD: ACQ4502 Anthopleura elegantissima (KBCSM601-14) AAK0746 0.05 100 Anthopleura elegantissima (KBCSM642-14) 5%

0.05 Figure 1.15 Neighbor-Joining Tree of Canadian Pachycerianthus COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

A. Pachycerianthus sp. B. Gersemia sp.

Barcode Gap =19.0% Barcode Gap =1.0%

(%) Frequency

Distance (%) Distance (%) C. Pennatula sp. D. Anthopleura sp.

Barcode Gap =3.4% Barcode Gap =0.1%

Frequency (%) Frequency (%) Frequency

Distance (%) Distance (%)

E. Urticina sp. F. Stomphia sp.

Barcode Gap =0% Barcode Gap =0%

Frequency (%) Frequency (%) Frequency

0.20

Distance (%) Distance (%)

Figure 1.16 Nearest Neighbour Barcode Gap of Anthozoa COI Sequences. These histograms display the magnitude of a barcode gap between nearest neighbour mean pairwise intra-specific (blue) and interspecific (red) distances. (A) Pachycerianthus sp., (B) Gersemia sp., (C) Pennatula sp. (D) Anthopleura sp., (E) Urticina sp., (F), Stomphia sp.

51 Gersemia rubiformis (KHA207-14) 54 Gersemia rubiformis (ARCMI588-14) 51 Gersemia rubiformis (KHA207-14) Gersemia rubiformis (KHA675-14) 54 Gersemia rubiformis (ARCMI588-14) Gersemia rubiformis (ARCMI586-14) Gersemia rubiformis (KHA675-14) Gersemia rubiformis (KHA118-14) Gersemia rubiformis (ARCMI586-14) Gersemia rubiformis (KHBC304-13) Gersemia rubiformis (KHA118-14) Gersemia rubiformis (KHBC303-13) Gersemia rubiformis (KHBC304-13) Gersemia rubiformis (CCSMA135-08) Gersemia rubiformis (KHBC303-13) 50 Gersemia rubiformis (CCSMA119-08) Gersemia rubiformis (CCSMA135-08) Gersemia rubiformis (CCSMA108-08) 50 Gersemia rubiformis (CCSMA119-08)56 Gersemia rubiformis (CCSMA107-08) Gersemia rubiformis (CCSMA108-08) Gersemia rubiformis (CCSMA103-08) 79 56 Gersemia rubiformis (CCSMA107-08) Gersemia rubiformis (KHA187-14) Gersemia rubiformis (CCSMA103-08) Gersemia rubiformis (KHBC293-13) 79 83 Gersemia rubiformis (KHA187-14) Gersemia rubiformis (KHA159-14) Gersemia rubiformis (KHBC293-13) 83 Gersemia rubiformis (KHA123-14) Gersemia rubiformis (KHA159-14) Gersemia rubiformis (KHA188-14) Gersemia rubiformis (KHA123-14) Gersemia rubiformis (KHA624-14) Gersemia rubiformis (KHA188-14)50 Gersemia rubiformis (KHA625-14) Gersemia rubiformis (KHA624-14) Gersemia rubiformis (KHA626-14) 50 Gersemia rubiformis (KHA625-14) Gersemia rubiformis (KHA676-14) Gersemia rubiformis (KHA626-14) 79 Gersemia rubiformis (ARCMI585-14) Gersemia rubiformis (KHA676-14) Gersemia rubiformis (KHA161-14) 79 Gersemia rubiformis (ARCMI585-14) Gersemia rubiformis (ARCMI587-14) 56 Gersemia rubiformis (KHA161-14) 52 Gersemia rubiformis (KHA125-14) Gersemia rubiformis (AAP1189) Gersemia rubiformis (ARCMI587-14) 56 Gersemia rubiformis (ARCMI589-14)BOLD: 52 Gersemia rubiformis (KHA125-14) Gersemia rubiformis (CCSMA117-08) GersemiaAAP1189 rubiformis (AAP1189) Gersemia rubiformis (ARCMI589-14) Gersemia rubiformis (KHA239-14) Gersemia rubiformis (CCSMA117-08) Gersemia rubiformis (CCSMA142-08) Gersemia rubiformis (KHA239-14) Gersemia rubiformis (CCSMA141-08) Gersemia rubiformis (CCSMA142-08)71 Gersemia rubiformis (CCSMA131-08) Gersemia rubiformis (CCSMA141-08) Gersemia rubiformis (CCSMA130-08) 71 Gersemia rubiformis (CCSMA131-08) Gersemia rubiformis (CCSMA118-08) Gersemia rubiformis (CCSMA130-08) 58 Gersemia rubiformis (CCSMA116-08) Gersemia rubiformis (CCSMA118-08) Gersemia rubiformis (CCSMA110-08) 58 Gersemia rubiformis (CCSMA116-08) Gersemia rubiformis (CCSMA105-08) 97 Gersemia rubiformis (CCSMA110-08) Gersemia rubiformis (CCSMA104-08) Gersemia rubiformis (CCSMA105-08) Gersemia rubiformis (CCSMA102-08) 97 Gersemia rubiformis (CCSMA104-08) Gersemia rubiformis (CCSMA041-07) Gersemia rubiformis (CCSMA102-08) Gersemia rubiformis (CCSMA040-07) Gersemia rubiformis (CCSMA041-07) Gersemia rubiformis (KHA003-14) Gersemia rubiformis (CCSMA040-07) Gersemia rubiformis (KHA002-14) Gersemia rubiformis (KHA003-14) Gersemia rubiformis (KHA005-14) Gersemia rubiformis (KHA002-14) Gersemia rubiformis (KHA006-14) Gersemia rubiformis (KHA005-14) Gersemia rubiformis (KHA007-14) Gersemia rubiformis (KHA006-14) Gersemia rubiformis (KHA009-14) Gersemia rubiformis (KHA007-14) Gersemia rubiformis (KHA010-14) Gersemia rubiformis (KHA009-14) Gersemia rubiformis (KHA011-14) Gersemia rubiformis (KHA010-14) Gersemia rubiformis (KHA008-14) Gersemia rubiformis (KHA011-14) Gersemia rubiformis (KHA012-14) Gersemia rubiformis (KHA008-14) Gersemia rubiformis (GBSP4484-12) Gersemia sp. (ACL6518) Gersemia rubiformis Gersemia (KHA012-14) sp. (KHBC039-13) Gersemia rubiformis (GBSP4484-12) Gersemia sp. (ACL6518) Drifa glomerata (KHA482-14) BOLD: ACL6518 Gersemia sp. (KHBC039-13) Gersemia antarctica (GBSP4483-12) Drifa glomerata (KHA482-14) Gersemia sp. (KHBC037-13) Gersemia sp. (ACI2162) Gersemia antarctica (GBSP4483-12) Gersemia sp. (KHBC038-13) Gersemia sp. (KHBC037-13)98 Gersemia sp. (KHBC040-13) BOLD: Gersemia sp. (ACI2162) Gersemia sp. (KHBC038-13) Gersemia juliepackardae (GBCI2168-13)ACI2162 98 Gersemia sp. (KHBC040-13) Primnoa sp. 99 Gersemia juliepackardae (GBCI2168-13) Primnoa sp. 0.01 99 1% 0.01 Figure 1.17 Neighbor-Joining Tree of Canadian Gersemia COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 708 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Pennatula aculeata (KHA510-14) 54 Pennatula aculeata (KHA511-14) 51 Pennatula aculeata (KHA509-14) 42 Pennatula Pennatula aculeata aculeata (KHA475-14) (KHA510-14) 19 54 ACM3244 Pennatula Pennatula aculeata aculeata (KHA521-14) (KHA511-14) 38 51 Pennatula Pennatula aculeata aculeata (KHA201-14) (KHA509-14) 54 42 Pennatula Pennatula aculeata aculeata (KHA508-14) (KHA475-14) 100 BOLD: Pennatula19 aculeata (KHA507-14) Pennatula aculeata (KHA521-14) ACM3244ACM3244 38 Pennatula Pennatula sp. (KHBC088-13) aculeata (KHA201-14) 54 Pennatula grandis (KHA516-14) Pennatula aculeata (KHA508-14) Pennatula grandis (KHA517-14) 100 98 Pennatula aculeata (KHA507-14) Pennatula grandis (KHA518-14) 24 Pennatula sp. (KHBC088-13) Pennatula grandis (KHA520-14) ACM3142 22 Pennatula grandis (KHA516-14) Pennatula grandis (KHA489-14) 70 Pennatula grandis (KHA517-14) 98 Pennatula grandis (KHA515-14) 67 Pennatula grandis (KHA518-14) 24 69 Pennatula grandis (KHA519-14) BOLD: Pennatula grandis (KHA520-14) ACM3142 22 ACM3142 Pennatula grandis (KHA489-14) Primnoa sp. (KBCSM621-14) 70 Outliers Pennatula grandis (KHA515-14) Primnoa sp. (KBCSM622-14) 67 100 Primnoa sp. (KBCSM623-14) 69 Pennatula grandis (KHA519-14) Primnoa sp. (KBCSM621-14) 0.005 0.5% Primnoa sp. (KBCSM622-14) Outliers 100 Primnoa sp. (KBCSM623-14) Figure 1.18 Neighbor-Joining Tree of Canadian Pennatula COI sequences. Neighbor-joining tree (Saitou0.005 & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 655 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

A B

C D

Figure 1.19 Anthopleura species from BOLD: AAK0746. (A) Anthopleura elegantissima (B) Anthopleura artemisia (C, D) Anthopleura xanthogrammisa.

Anthopleura xanthogrammica (KHBC247-13)

Anthopleura xanthogrammica (KHBC231-13) Anthopleura xanthogrammica (KHBC250-13) Anthopleura xanthogrammica (KHBC233-13) Anthopleura xanthogrammica (KHBC245-13) Anthopleura xanthogrammica (KHBC234-13) Anthopleura xanthogrammica (KHBC230-13) Anthopleura xanthogrammica (KHBC249-13) Anthopleura xanthogrammica (KHBC232-13) Anthopleura xanthogrammica (KHBC151-13) Anthopleura xanthogrammica (KHBC246-13) Anthopleura xanthogrammica (KHBC150-13) Anthopleura xanthogrammica (KHBC248-13) Anthopleura xanthogrammica (KHBC149-13) 52 Anthopleura xanthogrammica (KHBC253-13) Anthopleura xanthogrammica (KHBC251-13)

Anthopleura xanthogrammica (KHBC252-13) BOLD: Anthopleura xanthogrammica (KHBC235-13) AAK0746 Anthopleura xanthogrammica (KHBC152-13)

Anthopleura elegantissima (KBCSM603-14)

Anthopleura elegantissima (KHBC148-13)

Anthopleura elegantissima (KBCSM705-14) Anthopleura elegantissima (KBCSM599-14) Anthopleura elegantissima (KBCSM706-14) Anthopleura elegantissima (KBCSM707-14) Anthopleura elegantissima (KBCSM600-14) Anthopleura elegantissima (KBCSM604-14) Anthopleura elegantissima (KHBC267-13) Anthopleura elegantissima (KBCSM638-14) Anthopleura elegantissima (KBCSM640-14) Anthopleura elegantissima (KBCSM598-14) Anthopleura elegantissima (KBCSM602-14) Anthopleura elegantissima (KBCSM601-14) Anthopleura elegantissima (KBCSM641-14) Anthopleura elegantissima (KHMS073-14) Anthopleura elegantissima (KBCSM642-14) Anthopleura elegantissima (KHMS072-14) Anthopleura elegantissima (KHBC147-13)

Anthopleura elegantissima (KBCSM597-14)

Anthopleura elegantissima (KHBC146-13)

Anthopleura artemisia (KHBC192-13)

99 Anthopleura artemisia (KHBC191-13)

0.001 0.1%

Figure 1.20 Neighbor-Joining Tree of Canadian Anthopleura COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

A B C

D E F

G H I

J K

Figure 1.21 Urticina species from BOLD: AAJ8124. (A, B, C) Urticina crassicornis (D, E) Urticina piscovora (F) Urticina coriacea (G, H, I) Urticina feline (J, K) Urticina lofotensis.

65 Urticina lofotensis (KHBC189-13) Urticina lofotensis Urticina lofotensis (KHBC190-13) Cribrinopsis fernaldi (KHBC282-13) Cribrinopsis fernaldi Urticina crassicornis (KHBC244-13) Urticina crassicornis

65 Urticina lofotensis (KHBC189-13) Urticina crassicornis (KHBC240-13) Urticina crassicornis Urticina lofotensis Urticina lofotensis (KHBC190-13) Urticina piscovora (KHBC163-13) Urticina piscovora Cribrinopsis fernaldi (KHBC282-13) Urticina piscovora (KHBC162-13)Cribrinopsis fernaldi Urticina piscovora Urticina crassicornis (KHBC244-13) Urticina coriacea (KHBC109-13)Urticina crassicornis Urticina coriacea Urticina crassicornis (KHBC240-13)53 Urticina coriacea (KHBC108-13)Urticina crassicornis Urticina coriacea Urticina piscovora (KHBC163-13) Urticina felina (KHA153-14)Urticina piscovora Urticina felina Urticina piscovora (KHBC162-13) Urticina felina (KHA085-14)Urticina piscovora Urticina felina Urticina coriacea (KHBC109-13) Actiniaria sp. (KHA690-14)Urticina coriacea Misidentified 53 Urticina coriacea (KHBC108-13) Anthozoa sp. (KHBC212-13)Urticina coriacea Misidentified 26 Urticina felina (KHA153-14) Anthozoa sp. (KHBC215-13)Urticina felina Misidentified Urticina felina (KHA085-14) Actiniidae sp. (ARCMI611-14)UrticinaBOLD: felina Misidentified Actiniaria sp. (KHA690-14) 51 Actiniidae sp. (ARCMI612-14)MisidentifiedAAJ8124 Misidentified Anthozoa sp. (KHBC212-13) Misidentified 26 Actiniaria sp. (KHA691-14) Misidentified Anthozoa sp. (KHBC215-13) 38 Urticina sp. (CCSMA115-08)Misidentified Urticina sp. Actiniidae sp. (ARCMI611-14) Misidentified Urticina sp. 100 Urticina sp. (CCSMA124-08) 51 Actiniidae sp. (ARCMI612-14) Stomphia coccinea (KHA114-14)Misidentified Misidentified Actiniaria sp. (KHA691-14) Cribrinopsis fernaldi (KHBC284-13)Misidentified Cribrinopsis fernaldi 38 Urticina sp. (CCSMA115-08) Anthopleura artemisiaUrticina (KHBC191-13) sp. AAK0746 Urticina sp. 100 Urticina sp. (CCSMA124-08) Anthopleura xanthogrammica (KHBC235-13) Stomphia coccinea (KHA114-14) Misidentified A 0.005 Cribrinopsis fernaldi (KHBC284-13) Cribrinopsis fernaldi . 0.5% Anthopleura artemisia (KHBC191-13) AAK0746 Anthopleura xanthogrammica (KHBC235-13)

0.005

(N=104)

BOLD: AAJ8124

(N=6)

B 0.0001 0.01% .

Figure 1.22 Neighbor-Joining Tree of Canadian Urticina COI sequences. (A) This tree was constructed with a selection of samples chosen to represent each species and specimens identified to different taxonomic levels. (B) This tree contains sequences from all specimens within BOLD: AAJ8124 with sample size provided in brackets. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

87 Anthozoa sp. (KHA219-14) 87 Anthozoa sp. (KHA185-14) Anthozoa sp. (KHMS048-14) Anthozoa sp. (KHA150-14) Stomphia didemon (KBCSM465-14) Stomphia coccinea (KHA128-14) Anthozoa sp. (KHA181-14) Stomphia coccinea (KHA636-14) Stomphia coccinea (KHA633-14) Stomphia coccinea (KHA588-14) Anthozoa sp. (KHMS045-14) Stomphia coccinea (KHA589-14) Stomphia coccinea (KHA208-14) Stomphia coccinea (KBCSM306-14) Urticina crassicornis (KHA388-14) Anthozoa sp. (KHA147-14) Anthozoa sp. (KHA164-14) Stomphia coccinea (KHA637-14) Anthozoa sp. (KHA151-14) Anthozoa sp. (KHA677-140 Anthozoa sp. (KHA156-140 Anthozoa sp. (KHMS046-14) Stomphia sp. (KHA284-14) Anthozoa sp. (KHA632-14) Stomphia coccinea (KHA135-14) Anthozoa sp. (KBCSM627-14) Stomphia sp (KBCSM673-14) Anthozoa sp. (KBCSM385-14) Stomphia sp (KBCSM360-14) BOLD: 86 Stomphia sp (KBCSM373-14) ACO8748 Stomphia sp (KBCSM395-14) Urticina sp. (CCSMA121-08) Urticina sp. (CCSMA109-08) Urticina sp. (CCSMA122-08) Urticina sp. (CCSMA133-08) Urticina sp. (CCSMA132-08) Urticina sp. (CCSMA114-08) Urticina sp. (CCSMA120-08) Urticina sp. (CCSMA113-08) Urticina sp. (CCSMA134-08) Stomphia sp. (KHA306-14) Stomphia didemon (KHBC287-13) Stomphia didemon (KHBC144-13) 64 Stomphia didemon (KHBC286-13) Stomphia didemon (KHBC143-13) 7 Stomphia coccinea (KHA770-14) 10 Stomphia coccinea (KHA766-14) 65 Stomphia coccinea (KHA768-14) 62 Stomphia coccinea (KHA769-14) 22 Stomphia coccinea (KHA767-14) 23 87 Stomphia coccinea (ARCMI574-14) 87 Stomphia coccinea (ARCMI602-14)

0.0002 0.02%

Figure 1.23 Neighbor-Joining Tree of Canadian Stomphia COI sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There is a total of 654 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Fast Fast

Slow Slow

A. B.

Figure 1.24 Representation of possible evolutionary scenarios for slow mtDNA evolution in Anthozoa; (modified from Stampar 2014). (A) Fast evolution originated in the Ceriantharia, Medusozoa and Bilateria independently. (B) Fast evolution orginated uniquely in the common ancestor of Cnidaria + Bilateria, but was lost in Anthozoa. Black bars labeled “fast” and “slow” denote acceleration and deceleration of mitochondrial sequence evolution respectively.

Table 1.1 Preservation of cnidarian specimens and COI barcode sequencing success. *This table only includes information for specimens personally sampled by Kathryn Hotke. Similar information for other specimens on BOLD is unknown.

Preservative # of Specimens # of Sequences Age (years) TOTAL Age (years) TOTAL <5 5-10 >10 <5 5-10 >10 Formalin 19 19 0 95% EtOH 89 5 9 103 16 24 8 48 Formalin fixed, 89 89 4 1 5 95% EtOH 60% Isopropanol 7 164 171 0 Fresh 1353 866 Frozen in 388 295 Seawater

Table 1.2 Significant sources of specimens collected from Canada and their locations. Large numbers of specimens were collected at these locations; as well they provided bases of operations for collecting trips.

Institute Location Pacific Biological Station Nanaimo, British Columbia The Vancouver Aquarium Vancouver, British Columbia The Royal BC Museum Victoria, British Columbia The Huntsman Marine Center St. Andrews, New Brunswick The Department of Fisheries and Oceans – Moncton Moncton, New Brunswick Explos-Nature Les Escoumins, Quebec L’Aquarium du Quebec Quebec City, Quebec The Maurice Lamontagne Institute Mont-Joli, Quebec The Bedford Institute of Oceanography Halifax, Nova Scotia

Table 1.3 The number of cnidarian specimens collected, collection locations and sequences retrieved in this study.

# of # of # of Sequences Specimens Collection Locations TOTAL 2434 1401 Scyphozoa 385 361 293 Aurelia aurita 82 46 Phacellophora 12 9 camtschatica Hydrozoa 691 610 369 Sarsia 15 13 Hydra 20 19 Obelia 15 15 Staurozoa 13 13 9 Anthozoa 1272 1050 721 Pachycerianthus 28 6 Gersemia 81 58 Pennatula 22 16 Anthopleura 50 48 Urticina 189 75 Stomphia 62 27 Cnidaria 73 9

Table 1.4 Specimen contaminants and BOLD (www.boldsystems.org) Process IDs of source specimens.

Zooplankton (11) Cnidaria Anthozoa (79) Hydrozoa (18) Scyphozoa (21) Contaminant Process ID Contaminant Process ID Contaminant Process ID Contaminant Process ID Metridia KHMS077- Anthozoa KHBC051-13, Leuckartiara KBCSM411-14, Aurelia KHBC187-13, lucens 14, KHBC035-14 octona KBCSM406-14, KBCSM723-14, KHMS078- KBCSM687-14 KHA324-14, 14 KBCSM333-14 KHA325-14, KHA327-13, KHA331-14, KHA332-14, KHA336-14, KHA337-14, KHA338-14, KHA339-14, KHA340-14, KHA341-14 Artemia KBCSM252- Urticina KHA702-14, Obelia CAISNI1252- Cyanea KHA132-14, fransciana 14, KHMS001-14, 14, KHMS066- KHA155-14, KBCSM828- KBCSM035-14, 13, KHA370-14, KHA391-14, 14 KHA345-14, KHA346- KHA372-14, KBCSM408-14, 14, KHA347-14, KHA380-14, KHA611-14 KHA348-14, KHA353- KBCSM380-14, 14, KHA351-14, KHA437-14 KHA360-14, KHA364- 14, KBCSM235-14, KHA440-14, KHA441- 14, KBCSM653-14, KBCSM654-14, KBCSM655-14, KBCSM656-14, KBCSM657-14, KBCSM723-14, KBCSM727-14, KBCSM766-14,

KBCSM767-14, KBCSM768-14, KHA792-14, KHA100- 14, KHA101-14, KHA107-14 Phelloderma KHMS049- Ptilosarcus KBCSM686-14 Eucheilota KHA356-14, Aquorea KBCSM676-14, 14 gurneyi KHA355-14 KBCSM275-14 Nitrobacter KHA032-14 Hormathia KHBC214-13, Clytia KHA373-14 Phacellophora KBCSM055-14 hamburgensis KHBC219-13, camtschatica KHA113-14, KHA628- 14, KHA643-14, KHA644-14, KBCSM728-14 Rotifer KHA035-14 Paragorgia KHBC072-13 Eutonina KBCSM274-14 indicans Mytilus KHA075-14 Metridium KHMS028-14, Aglantha KBCSM792-14, trossulus KHA318-14, KHA350- digitale KBCSM792-14 14, KHA352-14, KHA357-14, KHA358- 14, KHA359-14, KHA361-14, KHA367- 14, KHA369-14 KHA376-14, KHA383- 14, KHA384-14, KBCSM824-14, KHA043-14, KHA044- 14, KHA045-14, KHA092-14, KHA093- 14, KHA094-14 Mimachylamys KHBC006- Maractis KHA145-14, KHA388- Stegopoma KHBC217-13 varia 13 14, KHA552-14, plicatile KHA572-14, KHA674- 14 Vibrio KHBC010- Bolocera KHA198-14, KHA212- slendidus 13 14, KHA222-14, KBCSM365-14,

KBCSM033-14 Stylodactylus KBCSM242- Anthopleura KHA304-14, 14 KBCSM750-14, KHMS044-15 Primnoa KBCSM236-14 Stephanauge KHA465-14, KHA466- 14 Gersemia KHA623-14, KHA023- 14, KHA024-14 Urtinopsis KBCSM677-14

Table 1.5 – Analysis of COI mtDNA Sequencing Failure Rate among Cnidarian Orders and Families.

Class Order Family Failed Total Failure Rate (%) Anthozoa Actiniaria 279 702 39.7% Actineridae 2 2 100% Actiniidae 112 307 36.5% Actinoscyphiidae 2` 2 100% Actinostolidae 39 88 44% Capneidae 1 1 100% Diadumenidae 4 10 40% Edwardsiidae 4 9 44.4% Halcampidae 3 3 100% Halcampoididae 1 1 100% Haloclavidae 1 1 100% Hormathiidae 27 78 34.6 Isanthidae 2 2 100% Liponematidae 6 6 100% Metriididae 67 184 34.8% Minyadidae 8 8 100% Alcyonacea 68 192 35.4% Acanthogorgiidae 2 6 33.3% Alcyoniidae 1 1 100% Clavularidae 1 3 33.3% Isididae 3 8 37.5% Neptheidae 21 80 26.2% Paragorgiidae 13 31 41.9% Paramuriceidae 10 12 83.3% Plexauridae 1 4 25% Primnoidae 16 46 34.8% Xeniidae 0 1 0% Ceriantharia Cerianthidae 19 29 65.5% Corallimorpharia Corallimorphidae 13 20 65% Pennatulacea 73 124 58.8% Anthoptilidae 14 17 82.4% Funiculinidae 0 1 0% Halipteridae 25 34 73.5% Pennatulidae 10 40 25% Protoptilidae 2 2 100% Stachyptilidae 2 2 100% Umbellulidae 15 21 71.4% Virgulariidae 5 7 71.4% Scleractinia 28 41 68.3% Caryophyliidae 6 6 100% Dendrophyliidae 6 16 37.5% Flabellidae 3 4 75% Epizoanthidae 12 13 92.3% Zoanthidae 54 1 2 50% Hydrozoa Anthoathecata 30 102 29.4%

Bougainvillidae 3 16 18.8% Corymorphidae 1 2 50% Corynidae 10 26 38.5% Hydractiniidae 2 8 25% Hydridae 1 20 5% Pandeidae 10 19 52.6% Rathkeidae 1 2 50% Sylasteridae 0 1 0% Tubulariidae 2 8 25% Leptothecata 126 266 47.4% Aequoreidae 15 63 23.8% Aglaopheniidae 12 12 100% Campanulariidae 29 45 64.4% Eirenidae 9 42 21.4% Haleciidae 18 23 78.3% Halopterididae 1 1 100% Laodiceidae 4 12 33.3% Lovenellidae 0 2 0% Melicertidae 0 4 0% Mitrocomidae 6 29 20.7% Phialellidae 1 1 100% Plumulariidae 10 10 100% Sertulariidae 19 19 100% Tiarannidae 2 3 66.7% Limnomedusae Olindidae 8 16 50% Narcomedusae 3 12 25% Aeginidae 3 8 37.5% Cuninidae 0 4 0% Siphonophorae 19 32 59.4% Agalmatidae 0 2 0% Diphyidae 2 4 50% Trachymedusae Rhopalonematidae 17 26 65.4% Scyphozoa Coronatae 21 39 53.9% Atollidae 7 7 100% Periphyllidae 14 32 43.8% Semaeostomeae 66 338 19.5% Cyaneidae 30 214 14.0% Pelagiidae 12 30 40% Ulmaridae 20 81 24.7% Staurozoa Stauromedusae Lucernariidae 4 13 30.8%

Table 1.6 Mean Pairwise Genetic Distances (K2P) among Cnidarian species based on mitochondrial COI. Ranges of genetic distances are displayed with the mean genetic distances in brackets.

Class Genus/Family Inter-Genera Inter-Specific Intra-Specific BIN Groups Distances (%) Distances (%) Distances (%) Scyphozoa 21.7-59.4 (33.6) 13.6-26.7 (22.0) 0.0-18.0 (10.6) Cyanea 5.9-18.0 (13.5) AAP1190 AAP1194 ACM6954 AAF9673 AAD3480 Chrysaora 13.6-26.7 (22.0) 0.0-0.7 (0.2) ACD2727 ACO9127 ACF6328 ACO7920 Aurelia 13.5-20.5 AAC2226 (17.1) AAN6775 AAC5462 AAA4675 Phacellophora 11.7 ACM3971 ACN0101 Hydrozoa 4.2-79.6 (27.9) 3.0-22.36 (15.0) 0.0-2.2 (0.5) Ectopleura 22.36 0.0-0.4 (0.2) ACF7228 ACH9116 Aglantha 3.0-6.6 (9.4) 0.0-1.15 (0.6) AAC2227 ACL8751 ABA2523 Sarsia 4.5-6.4 (5.4) 0.0-2.2 (0.7) AAD5402 AAN4843 AAF1632 Obelia 7.8-12.9 (11.2) 0.3-0.6 (0.4) AAE6029 AAA7089 ACN0372 Hydra 7.3-18.1 (14.5) 0.0-1.0 (0.3) AAI8740 AAN4537 AAX2382 ACJ0105 Staurozoa Lucernaridae 21.2-23.5 (22.6) 0.3-0.4 (0.4) AAN4494 AAG1976 AAN4493 Anthozoa 1.1-30.2 (17.7) 0.1-11.0 (1.85) 0.0-1.4 (0.2) Pachycerianthus 19.5 0.2 ACQ4502 AAI3719 Gersemia 1.6-2.0 (1.9) 0-0.6 (0.4) ACI2162 AAP1189 ACL6518 Pennatula 3.4-4.1 (3.9) 0.0 ACL7361 ACM3244 ACM3142

Anthopleura 0.1-1.1 (0.7) 0.0 AAK0746 Stomphia 0.2 0.1-0.2 (0.1) ACO8748 Urticina 0.0-0.2 (0.2) 0.0 AAJ8124

Chapter 2 Revealing Cryptic Diversity in the Scyphozoan Cyanea capillata

Abstract The world’s largest jellyfish, the lion’s mane (Cyanea capillata), is thought to be broadly distributed in boreal and polar marine waters throughout the northern hemisphere. However, six other species of Cyanea described from these oceans have been synonymised with it based upon morphological studies. The potential that some of these synonymies are unjustified makes C. capillata an important candidate for a re-examination of species boundaries based on the analysis of molecular diversity. This study employs sequence variation in the barcode region of mitochondrial cytochrome c oxidase subunit 1

(COI) gene to probe species boundaries in Cyanea from Canada’s oceans. Sequence analysis revealed five lineages of C. capillata s.l. with little overlapping geographical distributions and showing from 5.9-

18.0% divergence at COI. Analysis of one additional mitochondrial gene, 16S, and two nuclear ribosomal

DNA regions, ITS1 and ITS2, revealed divergences that were lower (2.7-10.8% for 16S, 1.3-8.3% for

ITS1, 2.2-11.0% for ITS2), but correlated with those at COI, strongly suggesting that each cluster represents a different species. A lineage common in both the Gulf of St Lawrence and Hudson Bay shows sequence congruence with C. capillata s.s., while a lineage from one northern site matches C. tzetlinii, recently described from the White Sea. A third lineage, and the only one found in Pacific waters, is likely

C. ferruginea. The other two lineages were found in Atlantic Canada; one may be C. fulva which is currently viewed as a synonym of C. capillata, while the other is likely new.

Introduction Incorporating all planktonic Cnidaria within the classes Hydrozoa, Scyphozoa and Cubozoa, the

Medusozoa includes approximately 3800 species (Daly et al. 2007, Ortman 2010). The class Scyphozoa, the “true jellyfish”, is thought to contain about 200 species (Mianzan & Cornelius 1999), but its diversity is likely greater. Most scyphozoans are believed to have broad or even cosmopolitan distributions, reflecting the lack of barriers to their dispersal (Mayer 1910, Kramp 1961, Brewer 1991, Palumbi 1992,

Dawson & Jacobs 2001, Kolbasova 2015). However, recent molecular studies have shown the fragility of this conclusion. For example, Dawson & Jacobs (2001) demonstrated that the presumptively cosmopolitan Aurelia aurita is actually a complex of seven sibling species and confirmed another two morphologically distinct species, A. limbata and A. labiata (Mayer 1910, Kramp 1968a, Russell 1970,

Wrobel & Mills 1998). The nine species within Aurelia have non-overlapping geographic distributions and possess pairwise sequence divergences at the mitochondrial cytochrome c oxidase subunit 1 (COI) gene ranging from 13-24%. Molecular studies on another scyphozoan, the upside-down jellyfish,

Cassiopea sp., with a presumptive global distribution (Holland et al. 2004) found COI divergences of up to 23% and indicated the likely existence of six species rather than the three (C. andromeda, C. frondosa, C. xamachana) that are currently recognized.

Members of the scyphozoan genus Cyanea (Peron and Lesueur 1809) are a conspicuous element of the marine zooplankton because their bell diameter reaches up to 2.3 m. Despite their large size, broad distribution and abundance, the taxonomy of the genus is uncertain. The World Register of Marine

Species recognizes two valid species in the genus, C. capillata and C. lamarckii, but lists 13 other species whose status is uncertain. Among these species, C. arctica (Fabricius 1780), C. fulva (Agassiz 1862), and

C. versicolor (Agassiz 1862) were described from western Atlantic waters, while C. ferruginea

(Eschscholtz 1829) and C. postelsi (Brandt 1838) were described from the northeast Pacific (Agassiz

1862, Kramp 1961; Table 2.1). However, the morphological characteristics used to discriminate these species have proven so variable that these taxa were subsequently synonymized with C. capillata (Stiasny

& Maaden 1943, Kramp 1961, 1965; Mayer 1910). Careful morphological studies have subsequently

revealed diagnostic characters in some species of Cyanea that were initially thought to lack them, such as the unique pit-like intrusions of the gastrovascular cavity that characterize C. annaskala (Larson 1986), a species common in Australian waters. However, other species, such as C. fulva and C. versicolor, have now been viewed as colour variants of C. capillata for nearly a century (Stiasny & Maaden 1943). Along with difficulties created by weak species descriptions, the identification of specimens of Cyanea is often complicated by damage during their collection and by the poor preservation of museum material (Hay &

Shanks 1990, Raskoff et al. 2003, 2010; Kolbasova et al. 2015).

Molecular analyses have begun to advance understanding of species boundaries in Cyanea, and also to aid specimen identification, and to reveal phylogeographic patterns (Dawson & Jacobs 2001,

Dawson 2004, Holland et al. 2004). They have firmly established that the genus Cyanea includes several species. For example, molecular studies on specimens from northern European waters confirmed the presence of two species, C. capillata s.s. and C. lamarckii, with deep sequence divergence (15.5-17.0%) at COI (Holst & Laakmann 2013). Subsequent studies on Cyanea from the White Sea revealed the occurrence of both C. capillata s. s. and a new species, C. tzetlinii, with 9.6-10.6% divergence at COI

(Kolbasova et al. 2015). Molecular analyses of Cyanea from southeastern Australian waters further established that C. annaskala and C. rosea are distinct from C. capillata (Dawson 2005a) with COI sequence divergences of 11.8-15.3%. Less work has been done on North American populations of the C. capillata complex, but analysis of sequence variation at the mitochondrial 16S rRNA gene (16S) revealed three lineages with deep divergences, two from Long Island Sound in the Atlantic and another from the

Pacific coast of British Columbia, with the latter taxon showing morphological similarity to C. ferruginea

(Sparmann 2012).

This study examines sequence variation in a 648 base pair region of the cytochrome c oxidase 1 gene, the barcode region, to ascertain the number of Cyanea species in Canada’s oceans. The extent of geographic variation in each of the Canadian taxa was examined through comparison with lineages of the

C. capillata complex from other regions such as Europe, Asia and Australia. As well, sequence variation was examined in two nuclear ribosomal DNA (rDNA) regions, internal transcribed spacer 1 and 2 (ITS1

and ITS2), and the mitochondrial 16S rRNA gene. The efficacy of COI in species diagnosis has been shown in many previous studies (Dawson 2005a, Costa et al. 2007, Steinke et al. 2009, Holst &

Laakmann 2013), but ITS1 and ITS2 have also been used for species identification of scyphozoans including Cyanea (Dawson 2005a). Because they are encoded by the nuclear genome, these regions strengthen support for clusters recognized in phylogenetic trees based on COI (Yao et al. 2010).

Methods

Specimen Collection and Taxonomy

Medusae of Cyanea that were in good condition after collection (N=61) were preserved as whole specimens, while tissue samples were taken from medusae that were either too large to transport or in poor condition (N=154). These 215 medusae were collected from 213 locations across Canada by various methods including dip nets, trawling and diving (Figure 2.1, Table C.1). Most specimens were derived from localities in proximity to the Pacific Biological Station (British Columbia), the Huntsman Marine

Center (New Brunswick), the Department of Fisheries and Oceans - Moncton (New Brunswick), the

Maurice Lamontagne Institute (Quebec), and the Bedford Institute of Oceanography (Nova Scotia).

Specimens were initially examined morphologically to verify their assignment to the genus Cyanea.

Whole specimens or parts of them were generally preserved immediately in 95% ethanol, but some medusae were initially frozen in seawater and then transferred to 95% ethanol.

DNA Isolation, Extraction and Amplification

A small (~2mm2) tissue sample was excised from the subumbrellar muscle surface and placed in a well of a 96 well microtitre plate. Each tissue sample was placed in 45µL of cetyltrimethylammonium bromide (CTAB) lysis buffer (Ivanova et al. 2008) along with 5µL of proteinase K and incubated at 56oC for 12-18 hours. DNA was extracted following the manual protocol of Ivanova et al. (2008) using a 3 µm glass fibre plate and re-suspended in 40-50 µl of ddH2O. Cytochrome c oxidase subunit I (COI) was amplified in all specimens using newly designed primers AnthoF1 (5’-

ATTTTCTACTAATCATAARGATATHGG) and AnthoR1 (5’-

TGCCCAAAGAACCAAAAYARRTGY) developed on the basis of anthozoan sequences in GenBank.

The internal transcribed spacer region 1 of rDNA (ITS1) was amplified in 92 specimens using primers

CAS18sF1 (5’-TACACACCGCCCGTCGCTACTA) and CAS5p8sB1d (5’-

ATGTGCGTTCRAAATGTCGATGTTCA), while the internal transcribed spacer region 2 of rDNA

(ITS2) was amplified using primers CAS5p8sFc (5’-TGAACATCGACATTYGAACGCACAT) and

CAS28sB1d (5’-TTCTTTTCCTCCSCTTAYTRATATGCTTAA, Ji et al. 2003). The mitochondrial 16S region was amplified in 92 specimens using primers 16SF (5’-

TGTAAAACGACGGCCAGTTCGACTGTTTACCAAAAACATAGC) and 16SR (5’-

CAGGAAACAGCTATGACACGGAATGAACTCAAATCATGTAAG, Bridge et al. 1992; Kolbasova et al. 2015). 16S, ITS1 and ITS2 markers were amplified from a well plate of 95 Canadian Cyanea DNA extracts that had produced high quality COI sequences and represented members of each Cyanea BIN

(BOLD: AAP1190, AAP1194, AAD3480, AAF9673, ACM6954). Each polymerase chain reaction

(PCR) was carried out in a 12.5 µL reaction volume containing 6.25 µL 10% trehalose, 2µL ddH2O, 1.25

µL 10X PCR buffer (Invitrogen), 0.625 µL MgCl2 (50mM, Invitrogen), 0.125 µL of each primer (10µM),

0.0625 µl dNTPs (10mM, Invitrogen), 0.06 µl platinum Taq polymerase (Invitrogen) and 2 µl of DNA template (10-50ng). The thermocycling regime for COI included one cycle of 1 min at 94oC, five cycles of 40 s at 94oC, 40 s at 45oC, and 1 min at 72oC, followed by 45 cycles of 40s at 94oC, 40s at 48oC and 1 min at 72oC with a final extension for 5 min at 72oC. The thermocycling protocol for ITS1 and ITS2 consisted of one cycle of 4 min at 94oC, 35 cycles of 20s at 95oC, 40s at 60oC and 20s at 72oC followed by a final extension for 2 min at 72oC. The thermocycling protocol for 16S consisted of one cycle of 5 min at 94oC, followed by 40 cycles of 15s at 95oC, 15s at 52oC and 60s at 72oC with a final extension of 2 min at 72oC. PCR products were run on the E-Gel(R) 96-well system (Invitrogen) to check for amplicons.

Plates with more than 80% success for DNA amplification were bi-directionally sequenced using BigDye v3.1 (Applied Biosystems) on an ABI 3730XL DNA Analyzer (Applied Biosystems). In plates with lower success, wells with amplicons were removed from their plate and aggregated in a plate with other

amplicons for sequencing. Sequencing primers for COI as well as 16S, ITS1 and ITS2 were the same as those used for PCR. The 9.5 µL of PCR product remaining after E-gel screening was diluted with 15µL ddH2O as high amplicon concentrations led to the depletion of dNTPs, causing the loss of signal strength before sequencing was complete. Each sequencing reaction was carried out in a 9µL reaction volume containing 5 µL of 10% trehalose, 0.875 µL ddH2O, 0.25 µL BigDye, 1.875 µL 5x seq buffer, 1 µL of primer (10µM) and 2 µl of diluted PCR product. The thermocycling protocol consisted of one cycle of 2 min at 96oC, thirty cycles of 30s at 96oC, 15s at 55oC and 4 min at 60oC. Sequences of COI, 16S, ITS1 and ITS2 were manually edited using CodonCode Aligner 4.1.1 (CodonCode Corp., Dedham, MA) and aligned using Clustal W in MEGA 6.0 (Tamura et al. 2013). Primers for ITS1 and ITS2 included large sections of the coding regions 18S, 5.8S and 28S rDNA which helped with alignment. Sequences containing more than 1% ambiguous base calls or that were shorter than 220 bp were excluded from subsequent analyses. Sequences were also checked for stop codons, double peaks or insertions and deletions (indels) as a signal for putative pseudogenes. Each sequence that passed these screens was checked for a close match to species of Cyanea in GenBank by BLAST (Altschul et al. 1997) as well as identified on the BOLD (http://www.boldsystems.org) database to ensure that the sequence matched the source organism. This analysis revealed that sequences from ten specimens were derived from other cnidarian taxa, apparently reflecting contamination during sampling and one sequence from a museum specimen was contaminated by the pathogenic bacteria Vibrio splendidus. All valid sequences were deposited on BOLD in the project DS-CCKH (doi: dx.doi.org/10.5883/DS-CCKH).

Species Delineation

All COI sequences longer than 500bp were assigned a Barcode Index Number (BIN) by BOLD

(Ratnasingham & Hebert 2013). BINs are generated by the Refined Single Linkage (RESL) algorithm

(Ratnasingham & Hebert 2013) which employs a three-phased analysis to reach decisions on the number of BINs in the overall sequence data set on BOLD. Sequences assigned to different BINs are likely to represent separate species (Ratnasingham & Hebert 2013).

Sequence Analysis

Phylogenetic tree construction and calculation of pairwise genetic distances were performed in

MEGA 6.0 (Tamura et al. 2013). Neighbor-joining (NJ) trees were generated and distances were calculated using the K80 model (Kimura 2-parameter: equal base frequencies, one transition rate and one transversion rate; Kimura 1980) with 1000 bootstrap replicates chosen due to its use in other barcoding papers (Hebert et al. 2003; Ortman et al. 2010; Holst & Laakman 2013) therefore making this study comparable. Maximum likelihood analysis was performed on the DNA sequences with 1000 bootstrap replicates and the best-fit evolutionary models calculated using MEGA 6.0 (Tamura et al. 2013).

Maximum likelihood analysis was performed using the K80 model (Kimura 2-parameter; equal base frequencies, using all sites; Kimura 1980). Maximum likelihood analysis for ITS1 and ITS2 used partial deletion of alignment gaps and missing information (Figure 2.9, 2.10).

Homologous sequences from Aurelia aurita (COI: ARCMI614-14, KHA714-14, KHA343-14;

ITS1: AY935205, AY935206 ITS2: AY935205, AY935206; Dawson et al. 2005b) and Chrysaora melanaster (COI: KBCSM345-14) were included as outgroups as these taxa are members of families

(Ulmaridae and Pelagiidae respectively) that are closely related to the Cyanidae in the Semaestomeae.

COI sequences obtained in this study were analysed together with those from all congeneric taxa with barcode coverage including C. lamarckii (N=15, JX995347 – JX995362, Holst & Laakmann 2013;

BOLD: ABA2536), C. purpurea (N=2, JQ353737, JQ353736, Minxiao et al. 2012; BOLD: ACH6295),

C. nozakii (N=3, JX845350, JQ353734, JQ353735, Minxiao et al. 2012; BOLD: ACH7473), C. tzetlinii

(N=10, KM281985, KM281987, KM281990, KM281993, KM281994, KM281997, KM983286,

KM983288-KM983290, Kolbasova et al. 2014; BOLD: AAD3480), C. rosea (N=4, AY902919-

AY902922; BOLD: AAE7661) and C. annaskala (N= 5, AY902914-AY902917 and AY902923, Dawson

2005a; BOLD: AAE2931), as well as from specimens of C. capillata s.s. specimens from the White and

North Seas (N=48, JX995330-JX995346, Holst & Laakman 2014; AY902911, Dawson et al. 2005a;

HF930525-HF903526, Armani et al. 2012; KM983282-KM983393, KM281966-KM281972, Kolbasova et al. 2015; BOLD: AAP1190). ITS1 sequences obtained in the present study were also analysed with

those for C. annaskala (N=5, AY903061-AY90305), C. rosea (N=4, AY903057-AY903060; Dawson

2005a) and C. nozakii (N=4, AB377551-AB377554; Chow et al. 2008). 16S sequences were analysed along with those for C. capillata (N=12, KM250903, KM250904, KM250906, 251173-KM251176,

KM251178-KM251182; Kolbasova et al. 2015), C. nozakii (JX845345, Wang et al. 2012) and C. tzetliini

(N=4, KM114296, KM250905, KM251177, KM251183; Kolbasova et al. 2015; Table B.1). Analysis also included the 16S sequences obtained by Sparmann (2012) which were assigned to three lineages, one from the northeast Pacific (NEP, N=26, JX393205-JX393231) and two from the northwest Atlantic

(NWA1, N=14, JX393232-JX393244, JX393260; and NWA2, N=6, JX393245-JX393249, JX393270;

Table B.1).

Morphological Analysis

Specimens collected from the Gulf of St. Lawrence were examined for the characteristics diagnostic of C. capillata s. s. (Dawson 2005a, Holst & Laakmann 2013). The dorsal and lateral exumbrellar surfaces of each medusa were examined for the presence of exumbrellar papillae. Coronal muscles, the thick ring of subumbrellar muscle surrounding the oral arms and gonads, were observed and photographed using a Nikon AZ100 microscope and Nikon Digital Sight DS-Fil camera. The number and depth of muscle folds were measured and folds were examined for the presence of gastrovascular intrusions (Figure 2.2). Similarly, specimens from Labrador were examined and photographed for diagnostic characters of C. tzetlinii (Kolbasova et al. 2015) including the shape of rhopalar lappets, bell margins, gastrovascular canal branching patterns and the presence of gastrovascular intrusions into muscle folds (Figure 2.3).

Salinity Data

Surface salinity data for all specimens with collection locations was obtained from the World

Ocean Atlas 2013, the year when most specimens were collected. These high-resolution data derive from varied sources including bottle samples, ship-deployed Conductivity-Temperature-Depth packages, profiling floats, moored and drifting buoys, gliders and undulating oceanographic recorder profiles with

data integration performed by the National Oceanic and Atmospheric Administration (Zweng et al. 2013).

Surface salinities for the localities of each BIN were compared through random effect model analysis of variance (ANOVA) performed in R studio (RStudio Team 2015) with statistical significance set at

(α<0.05) to see if there was a significant difference in surface salinity between each distribution indicating different eco-physiological demands of jellyfish in separate BINs (Figure 2.14, Holst &

Laakman 2014).

Results

Collections and Sequence Recovery

A COI sequence was recovered from 176 of the 215 specimens (82%) of Cyanea collected from sites in British Columbia, Manitoba, New Brunswick, Newfoundland and Labrador, and Nova Scotia

(Figure 2.1). Two of the amplification failures involved specimens initially frozen in seawater, suggesting that DNA degradation was caused by the delayed transfer to 95% ethanol. Examination of nine sequence traces from the other failures revealed sequencing of multiple sequences at once, or “waterfalling”, preventing the calling of a single base. Nearly all sequences (97%) contained less than 1% ambiguous bases and none possessed a stop codon or other evidence of pseudogenes, such as double peaks or indels.

Most sequences (84%) were >600bp in length.

COI Phylogenetic Analysis

NJ analysis of the COI sequences revealed five clusters of Cyanea (Figure 2.4) with the members of each cluster assigned to a different BIN (Table 2.2). Each of the five lineages was assigned a vernacular name (Pacific, North, Gulf, Atlantic 1, Atlantic 2), reflecting the centroid of the localities where it was collected (coastal British Columbia, Labrador, Gulf of St Lawrence, Nova Scotia & New Brunswick,

Nova Scotia & New Brunswick). Pairwise genetic distances among the lineages ranged from of 5.9-

18.0% while within lineage distances varied from 0.0-0.5%. A barcode gap, the difference between the within and between lineage diversity, was pronounced for all five lineages (5.4% Figure 2.5, Table 2.3).

Maximum likelihood analysis (Figure 2.6) indicated that the Gulf of St. Lawrence lineage was most closely related to the Pacific lineage with the North lineage as their sister group. The other two lineages

(Atlantic 1, Atlantic 2) formed a separate group. Bootstrap analysis of the maximum likelihood (ML) tree generated from COI sequence data revealed that all five clusters had high bootstrap values (99%; Figure

2.6, 2.7).

Geographic Distribution and Collection

The five lineages from Canada had differing geographic ranges (Figure 2.4). Specimens of the Pacific lineage (BOLD: AAP1194) were collected from the Northeast Pacific from late May to early June, and it was also represented by a single specimen collected in southern Hudson Bay in August. The North lineage (BOLD: AAD3480) was apparently restricted to northerly waters as it as was only collected at one site in northern Labrador in early September. The Gulf lineage (BOLD: AAP1190) was common within the Gulf of St. Lawrence and along the eastern coast of Nova Scotia from late July to early

September, but it was also collected in Hudson Bay in July. The Atlantic 1 lineage (BOLD: ACM6954) appeared to have the most southerly distribution, being restricted to the eastern coast of Nova Scotia where it was collected from early June to mid-August. Finally, the Atlantic2 lineage (BOLD: AAF9673) showed a rather similar distribution, being found from New Brunswick to the eastern coast of Nova

Scotia and the Bay of Fundy from mid-June to early August (Figure 2.1).

Distribution of Lineages Relative to Salinity

Surface salinities were examined to ascertain if the five lineages occurred within differing salinity regimes (Figure 2.8). Members of Gulf lineage were found in slightly lower salinities on average and across the widest range of salinities; while specimens of the other lineages were found in similar ranges of higher salinity values (Figure 2.8). The difference of salinity values at which lineage distributions occurred was found significant according to a random effects model single factor ANOVA test

(α=0.00005, Figure A.1, 2, 3). The five Cyanea lineages likely have varying physiological attributes that

influence their abundance in waters of differing salinity as indicated by distributional patterns in eastern

Canada. However, differing temperature preferences and historical factors likely play a more important role in their distributions.

16S, ITS1 & ITS2 Analysis

Success in the recovery of 16S, ITS1 and ITS2 sequences was 93%, 92% and 93% respectively.

Success for 16S, ITS1 and ITS2 was slightly higher than for COI, but analysis was restricted to 95 DNA extracts that had generated a COI sequence. Neighbor-Joining of the ITS1 and ITS2 sequences also revealed five clusters (Figure 2.9, 2.10). Sequences from the North lineage were not obtained of 16S; however it did provide support for the Gulf, Pacific, Atlantic 1 and Atlantic 2 lineages (Figure 2.11).

Maximum likelihood analysis of ITS1 & ITS2 sequences showed support for the same tree topology as

COI (Figure 2.12, 2.13). Although 16S lacked sequences for the North lineage it did show support for the close relationships between the Gulf and Pacific lineages and between the Atlantic 1 and Atlantic 2 lineages (Figure 2.14). Pairwise genetic between lineage distances ranged from 2.0-11.6% (16S), 1.3-

8.3% (ITS1) and 2.2-11.0% (ITS2) with within lineage distance values of 0.1-0.2% (16S) 0.1-1.2%

(ITS1) and 0.0-3.6% (ITS2) (Table 2.3). Maximum likelihood (ML) bootstrap values were lower than for

COI, but 16S and ITS1 values were generally higher than those for ITS2. Bootstrap values for both ITS1 and ITS2 showed high support for three BINs (North, Atlantic 1, Atlantic 2), but support was low for the other two (Pacific, Gulf); whereas 16S showed high support for the Gulf, Pacific, Atlantic 1 and Atlantic

2 lineages (Figure 2.7).

Relationships between Canadian Cyanea and those from other Regions

COI and 16S sequences from the five lineages of Canadian C. capillata were compared with those from 83 specimens of C. capillata s.s. from the North and White Seas (Figure 2.4, 2.11). This analysis indicated that sequences from the Gulf lineage were very similar to those from C. capillata s.s.,

Figure 2.6, Figure 2.8) with a mean pairwise distance of 0.7% and 0.2% for COI and 16S respectively

(Table 2.3). Morphological examination of specimens from the Gulf of St. Lawrence confirmed their possession of the morphological characters diagnostic of C. capillata s.s.. Specifically, they possessed 13-

15 coronal muscle folds, which were shallow (~0.5-2mm) but with gastrovascular pits. As well, these specimens lacked exumbrellar papillae (Figure 2.2).

COI, 16S and ITS1 sequences from the five Canadian lineages were also compared with those for six other Cyanea species including C. annaskala (Dawson 2005a), C. lamarckii (Holst & Laakmann

2013), C. nozakii (Chow et al. 2008), C. purpurea (Minxiao et al. 2012), C. rosea (Dawson 2005a) and C. tzetlinii (Kolbasova et al. 2015; Figure 2.4, 2.9, 2.11, Table 2.3). COI sequences from the North lineage were identical to those for Cyanea tzetlinii (Figure 2.4, 2.9). Morphological examination of specimens of the North lineage revealed that they possessed the characters diagnostic for C. tzetlinii. Specifically, they had club-shaped rhopalia pits with a yellow pigment cell containing rhopallium and a rhopallar bulb at the base of the rhaplial stalk (Figure 2.3). The margin of the medusa bell was rounded with tertiary clefts adjacent to the secondary clefts containing rhopalia. Anastomoses between gastrovascular canals were absent while gastrovascular intrusions were present in the muscle folds (Figure 2.3). However, the remaining five Cyanea taxa were assigned to a different BIN with mean pairwise distances ranging from

6.3-28.6% at COI, 2.5-24.8% at 16S and 4.8-33.0% at ITS1. Within BIN distances were much lower for all three genes varying from 0.1-0.8% for COI, 0.0-0.2% for 16S and 0.4-4.8% for ITS1.

16S sequences from Canadian Cyanea were also compared with those from the northwest Pacific

(NEP) and two Atlantic (NWA1, NWA2) lineages analyzed by Sparmann (2012). 16S sequences from the

NEP lineage were identical to those for the Pacific lineage while sequences from the NWA1 lineage were identical of those from the Atlantic 2 lineage (Figure 2.11). However, phylogenetic analysis indicated that the Atlantic lineage, NWA2, clustered separately from all five Canadian lineages with mean pairwise distances ranging from 1.6-11.1% (Table 2.3).

Discussion

NJ analysis of COI sequences from Canadian specimens of C. capillata s.l. revealed five clusters which were each assigned to a different BIN. Sequence divergences among the members of each lineage were low, ranging from 0.0-0.5%, values typical for intraspecific variation in other jellyfish (see Chapter

1, Dawson 2005a). By contrast, COI divergences between the lineages ranged from 5.9-18.0%, values expected between different species (Dawson & Jacobs 2001, Holland et al. 2004, Dawson 2005a, b).

Results from COI were reinforced by those from mitochondrial 16S and two nuclear DNA regions, ITS1 and ITS2, as two regions revealed the presence of five lineages of C. capillata s.l. in Canadian waters.

While inter-specific distances were much lower for 16S, ITS1 and ITS2 than for COI, ranging from 2.0-

11.6%, 1.3-8.3% and 2.2-11.0%, respectively, the presence of divergence at these nuclear genes indicates the possibility of reproductive isolation between the lineages and thus potentially lower gene flow among than within the lineages. Moreover, the two lineages (Pacific, Gulf) with the lowest sequence divergence occurred in sympatry in Hudson Bay without evidence of introgression. The five BINs possessed differing geographic centroids with just one lineage in the Pacific (Pacific, AAP1194), one in the Arctic

(North, AAD3480), one in the Gulf of St. Lawrence (Gulf, AAP1190) and two in waters off New

Brunswick and Nova Scotia (Atlantic 1, ACM6954; Atlantic 2, AAF9673). In addition to these distributional differences, the Gulf lineage was more dominant in lower salinity environments than the others.

Sequence divergences between Atlantic 1 and Atlantic 2 were low: 7.3% (COI), 2.0% (16S) 2.3%

(ITS1) and 2.2% (ITS2). Assuming a divergence rate of 2% per million years at COI (Huang et al. 2008), these two lineages last shared a common ancestor approximately 3.5 million years. Given their co- occurrence in Atlantic Canada, further investigation into the basis of their reproductive isolation is justified. Perhaps the timing of their strobilization differs as specimens of Atlantic 2 were collected slightly earlier (mid-June to early August) than members of Atlantic 1 (early July to mid-August). If adults of each lineage reach sexual maturity at different times, reproductive isolation may be based on this

difference , similar to the situation in Aurelia (Schroth et al. 2002, Dawson & Jacobs 2004) and Cyanea

(Brewer 1991).

Divergences are also low between the Pacific and Gulf lineages: 5.9% (COI), 2.5% (16S), 1.3%

(ITS1), 5.3%% (ITS2), suggesting their divergence about 3 million years ago, perhaps reflecting allopatric speciation in the Atlantic and Pacific Oceans with subsequent secondary contact in Hudson

Bay. During the late Pliocene, a seaway opened between Alaska and Siberia allowing the dispersal of many Pacific species into the Atlantic (Briggs 1970, Vermeij 1991). This faunal interchange was facilitated by warmer climatic conditions in the Canadian Arctic (Briggs 1970) at this time (3.5Mya,

Vermeij 1991) allowing the exchange of numerous temperate marine species, possibly including a lineage of Cyanea that diversified once subsequent cooling isolated these boreal species in both oceans (Briggs

1970). However it is also very likely that specimens of both lineages collected from Hudson Bay represent the effects of ballast water allowing the invasion of species in regions of high shipping

(Greenberg et al. 1996).

The North lineage occurs as a sister species to the common ancestor of the Pacific and Gulf lineages in the COI, ITS1 and ITS2 maximum likelihood trees. Logically, mixing of species and genetic exchange would be most likely to occur within the Gulf and Atlantic (1, 2) lineages given their closest geographical distribution. However this is not apparent as large sequence divergences exist between these lineages similar to that shown previously in Aurelia (Schroth et al. 2002) and Cyanea (Brewer 1991). It is possible that these lineages are also separated by reproductive isolation and life history traits allowing for speciation in Cyanea despite close physical proximity.

Sequence comparisons with other species of Cyanea suggest that three and perhaps four of the five Canadian lineages represent named species. The Gulf lineage shows close genetic and morphological similarity to Cyanea capillata s.s., while the Pacific lineage is the only lineage found in coastal British Columbia so it likely represents C. ferruginea, which was described from this region.

Comparison of 16S sequences further indicates that this lineage corresponds to the NEP lineage recognized by Sparmann (2012). The North lineage is almost certainly conspecific with Cyanea tzetlinii,

as indicated by its morphological and sequence congruence with that species. As well, it was collected in late August, consistent with the timing reported for C. tzetlinii (Kolbasova et al. 2015). The discovery of

C. tzetlinii in northern Canada confirms the expectation that this species would not be restricted to the

White Sea (Kolbasova et al. 2015), but it also raises a potential taxonomic complexity. Given its northerly distribution and occurrence near Labrador, Cyanea tzetlinii may be conspecific with Cyanea arctica, which was described from waters near Greenland (Fabricius, 1780). Moreover, the latter species was subsequently reported as being abundant in late summer with a northerly distribution ranging from northern Atlantic coast of the USA to the Arctic (Agassiz 1862). Although the original description of C. arctica is vague, Mayer (1910) distinguished it from C. capillata by the shape of its rhopalial lappets and its larger bell size (>800 mm). Specifically, he noted that its lappets were elongated with a club-shaped ending in a swelling covered with papillae (the rhopallium) adjacent to which two pits projected into the floor of the exumbrella. Distal to the swelling, the club was described as terminating in a swollen knob- like structure (the rhopalar bulb). This description of lappet morphology in C. arctica closely matches the traits diagnostic for C. tzetlinii (Kolbasova et al. 2015), suggesting that the latter taxon is actually a synonym for C. arctica. Evidence for this conclusion would be strengthened if future studies of Cyanea in waters near Greenland reveal the presence of only a single species.

Two other species, Cyanea versicolor and C. fulva, described from the Atlantic coast of the USA

(Agassiz 1862), showed differing colouration patterns, largely non-overlapping distributions and seasonal occurrences (spring vs mid-summer, respectively). This differential timing of C. fulva corresponds to the peak collection period for Atlantic 2. Although not morphologically identified to a particular Cyanea species, 16S sequences from the Atlantic 2 lineage match those for the NWA1 lineage collected from

Long Island Sound and Chesapeake Bay having the same distribution as C. fulva (Agassiz 1862;

Sparmann 2012). Similarily Brewer (1991) reported two morphologically different species of Cyanea in

Nianactic Bay off Long Island Sound which he referred to as C. lamarckii and C. fulva, thus increasing the probability that Atlantic 2 is actually C. fulva. Because the other lineage (NWA2) recognized by

Sparmann (2012) from this region was distinct from Atlantic 1, it is possible that three species of Cyanea

occur along the eastern seaboard. It is likely that one of these taxa is actually C. versicolor, species described by Agassiz (1862) from this region; which should be verified as the syntype of C. versicolor is available in the Museum of Comparative Zoology. One of these lineages of Cyanea might possibility represent an entirely new species.

Among the many described species of Cyanea, only two are currently recognized as valid - C. capillata and C. lamarckii. However, molecular studies indicate that at least 11 species exist in temperate marine environments (Dawson 2005a, Bayha et al., 2010, Holst & Laakmann 2013). The present study has established the presence of five species of Cyanea in Canadian waters, and earlier work revealed one additional lineage in the eastern USA, indicating the occurrence of six species. Two of these species are also known from European waters (C. capillata, C. arctica) together with a third species (C. lamarckii) that has not been reported from any site in North America. Additionally, two species are known from

Chinese waters (C. nozakii, C. purpurea). Aside from these nine species in the northern hemisphere, at least two additional species occur in Australian waters (C. rosea, C. annaskala) with no geographic overlap between species of northern and southern hemispheres (Dawson 2005a, Armani et al. 2012,

Minxiao et al. 2012, Sparmann 2012, Wang et al. 2012, Holst & Laakmann 2013, Kolbasova et al. 2015).

This chapter confirms the results of the Chapter 1 by showing the ability of DNA barcodes to aid in cnidarian species identification and delineation, as well as revealing cases of cyptic species. This study aids in clarifying the taxonomy of the genus Cyanea and highlights the need for a comprehensive revision of this genus. .

55 5 5 6 8 39

29 58

B 74 C D E

Figure 2.1 Collection locations and number of Cyanea specimens. Each site is coloured according to Barcode Index Numbers (BIN, www.boldsystems.org). Pacific – orange ; Gulf of St. Lawrence – green ; North – red ; Atlantic 1 – purple ; Atlantic 2 – yellow . The number of specimens collected from each region is indicated within the black circle . . Refer to Figure 2.4 for tree lineage designations. (A) Collection locations across Canada, (B) British Columbia, (C) New Brunswick and Nova Scotia, (D) Newfoundland and Labrador. Sequences from GenBank are not included as they lack locality data.

B C 1 mm D 1 mm

Figure 2.2 Morphology of Cyanea capillata from Gulf of St. Lawrence (BOLD: AAP1190). (A) Cyanea medusa diagram redrawn and modified from Dawson (2005a). Subumbrellar (oral arms and gonads removed) and exumbrellar perspective (inset): gastrovascular pits in coronal muscle folds (gvpc); mean number of coronal muscles folds per group (ncmf); depth of coronal muscle folds (dcmf); nematocyst clusters on exumbrellar surface (ncp) (B) Exumbrellar surface of Cyanea specimen, displaying the typical scattered nematocyst clusters without exumbrellar papillae. (C, D) Cyanea specimen view at the subumbrellar musculature (oral arms and gonads removed), coronal muscle folds with gastrovascular intrusions (arrow) arising from the radial gastric canals.

rhb rhb rhs rhs st

rhp rhp

1 mm 1 mm

A B

gvc

sc 1 mm tc tc sc C tc D

1 mm 1 mm E F

Figure 2.3 Morphology of North Canada Cyanea lineage (BOLD:AAD3480). (A, B) Rhopalia; (C, D) view of marginal lobes of the bell including marginal gastrovascular canals; (E, F) coronal muscle folds with gastrovascular intrusions (arrows). Abbreviations: rhp, rhopalial pit; rhb, rhopalial bulb; rhs, rhopalial stalk; rh, rhopalium; st, statocyst; sc, secondary cleft of the marginal lobe; tc, tertiary cleft of the marginal lobe; gvc, gastrovascular canals.

54 Cyanea sp. (KBCSM400-14) 100 Cyanea sp. (KBCSM227-14) Pacific Cyanea sp. (KBCSM287-14) 99 Cyanea sp. (KHA167-14) 72 Cyanea sp. (KHA189-14) 100 Gulf of St. Cyanea sp. (KHA170-14) Lawrence 86 Cyanea capillata (GBCI3565-14) 96 91 Cyanea capillata (GBCI3564-14) Cyanea sp. (ARCMI607-14) 69 Cyanea sp. (ARCMI605-14) 66 57 Cyanea sp. (ARCMI603-14) North Cyanea tzetlinii (GBCI5251-15) 100 Cyanea tzetlinii (GBCI5252-15) 78 Cyanea rosea (GBCI0434-06) Cyanea rosea 100 Cyanea rosea (GBCI0436-06)

Cyanea annaskala (GBCI0431-06) Cyanea annaskala 100 100 Cyanea annaskala (GBCI0432-06)

100 Cyanea lamarckii (GBCI3611-14) Cyanea lamarckii Cyanea lamarckii (GBCI3623-14) 44 Cyanea sp. (KHA658-14) 100 100 Cyanea sp. (KHA651-14) Atlantic 1 Cyanea sp. (KHA657-14)

47 Cyanea sp. (KHA558-14) Cyanea sp. (KHA585-14) 100 Atlantic 2 97 Cyanea sp. (KHA584-14) 100 Cyanea purpurea (GBCI2266-13) Cyanea purpurea Cyanea purpurea (GBCI2267-13) Cyanea nozakii (GBCI2268-13) Cyanea nozakii 100 Cyanea nozakii (GBCI2269-13)

0.02 2%

Figure 2.4 Neighbor-Joining Tree of a selection of COI sequences with Cyanea sequences from GenBank. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There were a total of 889 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013). Specimens chosen from the dominant haplotypes calculated using DnaSPv5 (Librado & Rozas 2009) were used in order to reduce tree size with Genbank sequences indicated in bold font.

(%)

Frequency

Distance (%)

Figure 2.5 Barcode Gap of Canadian Cyanea Lineage COI Sequences. This histogram confirms the existence and magnitude of a barcode gap between mean pairwise within lineage (blue) and between lineage (red) genetic distances calculated from the 174 Canadian Cyanea COI sequences according to the Maximum Composite Likelihood Model.

99 Pacific (N=60)

99 99

Gulf / Cyanea capillata (N=108) 98 97 Gulf / Cyanea capillata (N=108) 98 97

25 North / Cyanea tzetlinii (N=23) 100 North / Cyanea tzetlinii (N=23) 100 Cyanea rosea (N=9) 100 80 Cyanea Cyanea annaskala rosea (N=9) (N=12) 100100 80 Cyanea annaskala (N=12) 100 Cyanea100 lamarckii (N=30)

100 5% Cyanea lamarckii (N=30)

99 99 57 Atlantic 1 (N=42) 99 99 57 Atlantic 1 (N=42) 63

Atlantic 2 (N=22) 7463 100 Atlantic 2 (N=22) Cyanea nozakii (N=6) 94 74 100 Cyanea Cyanea nozakii purpurea (N=6) (N=4) 94 100 54 Chrysaora sp. Cyanea purpurea (N=4) 100 54 Aurelia aurita Chrysaora sp. 100 Aurelia aurita KHA537-14|SABS-001|Cyanea capillata|COI-5P Outliers 100 KHA537-14|SABS-001|Cyanea capillata|COI-5P Outliers 1%0.1

0.1

Figure 2.6 Molecular phylogenetic analysis of Canadian Cyanea COI sequences with Cyanea sequences from GenBank. Maximum likelihood tree with sequence divergence estimates calculated according to the Kimura 2- parameter model (Kimura et al. 1980) with uniform rates and all positions included. Sample sizes are indicated at branch tips. The tree with the highest log likelihood (-3370.8) is shown. Bootstrap values are shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites. There were a total of 573 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

100 90 80 70 60 50 40 COI 30 16S 20 ITS1 10 ITS2

MaximumLikelihood Bootstrap (%) Value 0

Lineages

Figure 2.7 Maximum likelihood bootstrap comparisons between COI, 16S, ITS1 and ITS2 for five lineages of Cyanea capillata s. l., five other species in the genus from the literature (see Table A.1) and lineages investigated by Sparmann (2012).

Figure 2.8 Surface salinity values at collection locations for five lineages of Cyanea S 33 a specimens. Surface salinity data was collected from National Oceanic and Atmospheric l 32 Administration (NOAA) using satellite information from the World Ocean Atlas 2013 i (the year when the majority of my samples were collected). Surface salinity between 31 lineages was found to be statistically significant (random effects ANOVA, p-value < n 0.05). The North lineage (BOLD: ACM3480) was not included in this analysis since it i 30 only consists of three specimens collected from the same location. The Gulf of St. t 29 Lawrence lineage (BOLD: AAP1190) shows the lowest salinity values and widest y

Salinity (PSU) Salinity range of values of all lineages. (A) Box and whisker plot of surface salinities for each 28 BIN (Microsoft Excel 2010). Salinity contour maps of (B) British Columbia, (C) ( 27 Hudson ’s Bay and the (D) North Atlantic coast of Canada. P S 26 U AAP1194 AAP1190 ACM6954 AAF9673 A )

B C D

Cyanea sp. (KBCSM227-14) 84 Pacific Cyanea sp. (KBCSM400-14)

Cyanea sp. (KBCSM443-14) 83 Cyanea sp. (KHA170-14)

Cyanea sp. (KHA189-14) Cyanea sp. (KHA167-14) Gulf of St. 70 80 Cyanea capillata (AY903054) Lawrence

Cyanea capillata (AY903053)

95 Cyanea rosea (AY903059) Cyanea rosea (AAE7661) 99 Cyanea rosea (AY903058)

Cyanea sp. (ARCMI603-14) 57 Cyanea sp. (ARCMI605-14) North 99 Cyanea sp. (ARCMI607-14) Cyanea annaskala (AY903064) Cyanea annaskala (AAE2931) 100 Cyanea annaskala (AY903061) Cyanea sp. (KHA658-14) 97 Cyanea sp. (KHA651-14) Atlantic 1

Cyanea sp. (KHA657-14) 72 Cyanea sp. (KHA558-14) Cyanea sp. (KHA585-14) Atlantic 2 95 37 Cyanea sp. (KHA584-14) Cyanea nozakii (AB377554) Cyanea nozakii (ACH7473)

100 Cyanea nozakii (AB377553)

0.05 5%

Figure 2.9 Neighbor-Joining Tree of a selection of ITS1 sequences with Cyanea sequences from GenBank. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There were a total of 385 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013). Specimens chosen from the dominant haplotypes calculated using DnaSPv5 (Librado & Rozas 2009) were used in order to reduce tree size with Genbank sequences indicated in bold font.

74 Cyanea sp. (KBCSM400-14) Pacific 100 Cyanea sp. (KBCSM227-14)

100 Cyanea sp. (KBCSM312-14) Cyanea sp. (KHA178-14) Gulf of St. Cyanea sp. (KHA167-14) 91 Lawrence 74 Cyanea sp. (KHA189-14) Cyanea sp. (ARCMI603-14)

Cyanea sp. (ARCMI605-14) North 100 Cyanea sp. (ARCMI607-14)

Cyanea sp. (KHA657-14) 74 98 Cyanea sp. (KHA651-14) Atlantic 1 Cyanea sp. (KHA658-14)

99 Cyanea sp. (KHA584-14) Atlantic 2 98 Cyanea sp. (KHA558-14) 39 Cyanea sp. (KHA585-14)

0.011%

Figure 2.10 Neighbor-Joining Tree of a selection of ITS2 sequences. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2- parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There were a total of 287 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013). Specimens chosen from the dominant haplotypes calculated using DnaSPv5 (Librado & Rozas 2009) were used in order to reduce tree size with Genbank sequences indicated in bold font.

72 Cyanea sp. (KBCSM287-14)

71 Cyanea sp. (KBCSM400-14)

99 Cyanea sp. (KBCSM227-14) Pacific Cyanea ferruginea (JX393206, NEP) 52 Cyanea ferruginea (JX393205, NEP) 83 93 Cyanea sp. (KHA189-14)

84 Cyanea sp. (KHA170-14) 89 Cyanea sp. (KHA167-14) Gulf of St. 100 Cyanea capillata (KM250904) Lawrence 99 Cyanea capillata (KM250903) Cyanea tzetlinii (KM250905) Cyanea tzetlinii 99 Cyanea tzetlinii (KM251177)

83 Cyanea sp. (KHA651-14) 99 Cyanea sp. (KHA658-14) Atlantic 1 Cyanea sp. (KHA657-14)

Cyanea sp. (KHA585-14) 51 Cyanea sp. (KHA584-14) 64 100 Cyanea sp. (KHA558-14) Atlantic 2 97 Cyanea sp. (JX393232, NWA1) Cyanea sp. (JX393234, NWA1) 64 Cyanea sp. (JX393245, NWA2) NWA2 74 Cyanea sp. (JX393246, NWA2)

Cyanea nozakii (JX845345) Cyanea nozakii

0.02 2%

Figure 2.11 Neighbor-Joining Tree of a selection of 16S sequences with Cyanea sequences from GenBank. Neighbor-joining tree (Saitou & Nei 1987) with bootstrap values shown next to the branches. The tree is drawn to scale, with branch given as a percentage of the number of base substitutions per 100 nucleotide sites computed using the Kimura 2-parameter method (Kimura 1980). All ambiguous positions were removed for each sequence pair. There were a total of 674 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013). Specimens chosen from the dominant haplotypes calculated using DnaSPv5 (Librado & Rozas 2009) were used in order to reduce tree size with Genbank sequences indicated in bold font.

(N=34)

(N=21)

North (N=3)

(N=4)

(N=13)

(N=19)

(N=34)

(N=5)

(N=4)

Figure 2.12 Molecular phylogenetic analysis of Canadia Cyanea ITS1 sequences with Cyanea sequences from GenBank. Maximum likelihood tree with sequence divergence estimates calculated according to the Kimura 2- parameter model (Kimura et al. 1980) with uniform rates and all positions included. Sample sizes are indicated at branch tips. The tree with the highest log likelihood (-1043.8) is shown. Bootstrap values are shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites. There were a total of 221 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013). With sample size provided in brackets.

54 Pacific / (N=29)Cyanea ferruginea

64 Gulf / (N=29)Cyanea capillata 49 ArcticNorth / Cyanea(N=3) tzetlinii 93 84 Atlantic 2 / Cyanea(N=18) fulva

88 Atlantic 1 (N=12) 68

Aurelia aurita 100

0.055% Figure 2.13 Molecular phylogenetic analysis of Canadian Cyanea ITS2 sequences. Maximum likelihood tree with sequence divergence estimates calculated according to the Kimura 2- parameter model (Kimura et al. 1980) with uniform rates and all positions included. Sample sizes are indicated at branch tips. The tree with the highest log likelihood (-1857.8) is shown. Bootstrap values are shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites. There were a total of 317 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

77 Pacific / Cyanea ferruginea (N=62)

96 GulfGulf of / St.Cyanea Lawrence capillata (N=36) 94

99 NorthCyanea tzetlinii (N=5) 95 99 Atlantic 1 (N=20)

99 (N=7) 99 NWA2

87 Atlantic 2 / NWA1 (N=22) 97 Cyanea nozakii (N=2)

OutliersPelagia noctiluca 99

50.05%

Figure 2.14 Molecular phylogenetic analysis of Canadian Cyanea 16S sequences with Cyanea sequences from GenBank. Maximum likelihood tree with sequence divergence estimates calculated according to the Kimura 2- parameter model (Kimura et al. 1980) with uniform rates and all positions included. Sample sizes are indicated at branch tips. The tree with the highest log likelihood (-2852.3) is shown. Bootstrap values are shown next to the branches. The tree is drawn to scale, with branch lengths given as a percentage of the number of base substitutions per 100 nucleotide sites. There were a total of 674 positions in the final dataset. Evolutionary analyses were conducted in MEGA 6.0 (Tamura et al. 2013).

Table 2.1 Summary of changes in taxonomy of Cyanea species reported from Canadian waters.

Source C. capillata C. arctica C. fulva C. versicolor C. postelsii C. ferruginea Von Sp. nov. Medusa Linnaeus capillata (North Sea) 1746, 1758 Fabricius Sp. nov. 1780 (Greenland) Peron and Cyanea gen. nov; White Sea Leuseur C.capillata as type 1809 species Eschscholtz C. capillata (North sp. nov. Cyanea (1829) Sea, Baltic Sea, Artic ferrugenia (coast of and Baffin Bay) Kamtschatka, Aleutian Islands, Alaska; Northwest coast of America, Northern Pacific) Brandt Kattegat, North Sea, Sp. nov. Cyanea Kamtschatka, (1838) Cape Horn, Bay of postelsi (between Northwest coast of Conception Sitka and the Aleutian America Islands, Alaska; North Pacific) Agassiz North of Cape Sp. nov. Sp. nov. Sitka and Aleutian Kamtschatika, Sitka (1862) Cod and Cyanea Cyanea Islands; Alaska, and Aleutian Islands; eastward along fulva.(South of versicolor Bering Strait; Alaska, Bering Strait the coast of Cape Cod, (Coast of Northwest coast of Maine, New Long Island South America Brunswick, Sound) Carolina) Nova Scotia Mayer 1910, North Atlantic, North C. capillata var. C. capillata C. capillata var C. capillata var C. capillata var 1914 Pacific and temperate arctica (North of var. fulva (east versicolor (east postelsii; considered ferruginea; considered regions of all oceans; Cape Cod) coast of USA coast of USA close in form to identical to Cyanea English channel, from Cape Cod from North Cyanea arctica (North arctica (North Pacific North sea, coast of to Carolina)90 Carolina to Pacific from Aleutian coasts of America and Norway southern Islands to Oregon; Asia)

Florida) between Sitka and Aleutian Islands, Alaska) Bigelow C.capillata var C. capillata var C. capillata 1917, 1920, capillata (northwest arctica (Gulf of var. fulva (New 1926 Pacific, east coast of Maine) York) USA, New England, Nova Scotia, Chesapeake Bay, Gulf of Maine, Hudson Bay) Stiasny 1919 C. capillata var. C. capillata var. capillata (Holland; ferruginea Bergen, Norway) Fraser 1938 Cyanea sp. (Queen Charlotte Islands, Pacific coast of Canada) Stiasny and North Atlantic, Doubtful Doubtful species Provisionally retained, van der Australia species (North Pacific, only represented by Maaden between Sitka and Escholtz`s original 1943 Alaska) specimen (North Pacific; Kamtschatka and Aleutian Islands, north west coast of North America) Kramp Almost cosmopolitan West and east Doubtful 1913- in arctic and Greenland species 15,1961, temperate seas; 1965 Australia, west coast of Africa Russell 1970 North Atlantic, North Eastern coast of Eastern coast Identity requires further Pacific, Circumpolar North America of North investigation (Pacific) to cosmopolitan; America North Sea, Irish Sea, Bay of Ambleteuse,

Baltic Sea, Gulf of Finland. Larson 1990 Synonymous with C. Synonymous with C. capillata (North capillata (North Pacific) Pacific) Dawson North Atlantic, North 2005 Pacific Ocean Sparmann North Atlantic Ocean North Pacific 2012

Table 2.2 BIN Nomenclature

BIN Name Collection Region AAP1194 Pacific North East Pacific AAP1190 Gulf of St. Lawrence Gulf of St. Lawrence AAD3480 North Labrador ACM6954 Atlantic 1 Eastern Nova Scotia AAF9673 Atlantic 2 Bay of Fundy, Eastern Nova Scotia

Table 2.3. Mean Pairwise Genetic Distances (K2P) among five BINs of Cyanea capillata s.l. and seven species within the genus Cyanea based on mitochondrial COI (A) 16S (D) and nuclear ITS1 (B) ITS2 (C).

C. C. C. C. C. C. C. Atlantic 2 Gulf of St. Atlantic 1 Pacific North, NEP NWA1 NWA2 tzetlinii purpurea nozakii lamarckii capillata annaskala rosea AAF9673 Lawrence ACM6954 AAP1194 AAD3480 Sparmann Sparmann Sparmann AAP1190 2012 2012 2012 A. COI C. tzetlinii 0.1 North, AAD3480 C. purpurea 24.2 0.0 ACH6295 C. nozakii 23.1 20.8 0.5 ACH7473 C. lamarckii 15.3 23.4 20.8 0.1 ABA2536 C. capillata 9.8 25.6 25.6 16.2 0.5 AAP1190 C. annaskala 15.3 27.5 23.2 16.4 17.4 0.5 AAE2931 C. rosea 15.6 28.6 25.1 16.0 15.7 17.8 0.8 AAE7661 Atlantic 2 16.5 25.2 21.7 6.3 16.6 18.7 15.6 0.2 AAF9673 Gulf of St. 9.8 25.3 25.6 16.3 0.7 17.9 16.1 16.6 0.5 Lawrence AAP1190 Atlantic 1 16.5 25.4 20.9 7.1 17.6 17.8 16.3 7.3 17.7 0.0 ACM6954 Pacific 9.9 27.4 25.5 17.0 5.9 17.0 14.7 16.5 5.9 18.0 0.1 AAP1194 North 0.0 24.1 23.1 15.3 9.8 15.2 15.6 16.4 9.8 16.5 9.9 0.0 AAD3480 B. ITS1 C. nozakii 4.8 C. annaskala 30.8 0.4 C. rosea 31.7 11.7 0.8 Atlantic 2 27.4 10.8 11.9 0.1 AAF9673 Gulf of St. 32.3 10.5 5.4 8.3 1.2 Lawrence AAP1190 Atlantic 1 28.0 10.8 10.6 2.3 7.4 0.0 ACM6954 Pacific 33.0 10.3 4.8 8.1 1.3 7.2 0.3 AAP1194

North 32.8 10.4 8.1 7.9 4.0 7.9 4.0 0.0 AAD3480 C. ITS2 Atlantic 2 0.4 AAF9673 Gulf of St. 10.3 2.5 Lawrence AAP1190 Atlantic 1 2.2 9.9 0.3 ACM6954 Pacific 11.0 5.3 11.0 3.6 AAP1194 North 8.1 8.2 8.1 9.2 0.0 AAD3480 D. 16S C. tzetlinii 0.1 AAD3480 C. nozakii 22.9 0.0 ACH7473 C. capillata 3.4 23.7 0.2 AAP1190 Atlantic 2 10.4 24.8 11.5 0.1 AAF9673 Gulf of St. 3.4 23.7 0.2 11.5 0.2 Lawrence AAP1190 Atlantic 1 10.1 24.7 11.2 2.0 11.2 0.0 ACM6954 Pacific 2.9 24.1 2.5 11.4 2.5 10.9 0.1 AAP1194 NEP 2.9 24.1 2.5 11.4 2.5 10.9 0.1 0.1 Sparmann 2012 NWA1 10.5 24.0 11.6 0.5 11.6 2.3 11.3 11.3 0.6 Sparmann 2012 NWA2 10.4 22.8 11.0 1.6 11.0 2.4 11.1 11.1 1.7 0.1 Sparmann 2012

General Conclusions

This thesis explored patterns of sequence variation in Canadian Cnidaria using the barcode region of the COI gene. Chapter 1 began the assembly of a DNA barcode reference library and examined COI sequence diversity in one quarter (119) of the known Canadian cnidarian species. Results of this study confirm that COI sequences are an effective tool for examining species delineation in the classes: Hydrozoa, Staurozoa, and

Scyphozoa as well as in certain anthozoan taxa. These results suggest that DNA barcoding will aid the recognition of species overlooked by the current taxonomic system. For example, this investigation revealed deep intraspecific divergence in the moon jellyfish, Aurelia aurita, the fried egg jellyfish, Phacellophora camtschatica, as well as the lion’s mane jellyfish, Cyanea capillata. Chapter 2 provided an in-depth analysis of the deep intraspecific divergences found in the genus Cyanea. This study established the presence of five species of Cyanea in Canadian waters and earlier work (Sparmann 2012) revealed one additional lineage in the eastern USA, indicating the occurrence of six species in North America. This study aids in clarifying the taxonomy of the genus Cyanea and highlights the need for a comprehensive revision of this genus.

DNA barcode records are available for 1522 morphologically identified species of the globally estimated 11,000 species of cnidarians (Daly et al. 2007), accentuating the need to extend species coverage.

Future work should aim to complete the DNA barcode reference library for Canadian cnidaria and expand efforts for global coverage of Cnidaria. This involves both the collection of remaining species and providing species-level morphological identification of specimens already collected. Future work should focus on providing coverage of cnidarians in northern Canada and the Arctic Ocean which were lightly sampled in this study. As well, studies should aim to provide species-level morphological identifications of the currently unidentified specimens of hydrozoans by consulting taxonomists and museum collections.

DNA barcoding has proven effective in delineating species boundaries across many animal groups.

This work examined the performance of the COI barcode in the diverse Canadian cnidarian taxa and revealed three cases of deep intraspecific divergence that likely represent cryptic species, potentially representing new

Canadian records. Future studies should perform morphological investigations by consulting taxonomists and museum type specimens of the possible cryptic species of Cyanea capillata, Aurelia aurita and Phacellophora

camtschatica. As well, detailed investigations of the seasonal abundances, distributions and morphology throughout the life-cycles of each species should be performed. These cases indicate the importance of integrating molecular and morphological approaches preventing cryptic species from going undetected and adding new species records.

Historically, anthozoans have been known to display low rates of mtDNA evolution resulting in low

COI sequence divergence. However, in this study, it was established that anthozoan taxa from the genera

Pachycerianthus, Gersemia and Pennatula, unlike most anthozoans, had interspecific COI sequence divergences similar to other Metazoa. These cases of high divergence have implications for future studies of mitochondrial DNA evolution at the base of the metazoan tree. Therefore, future studies should work towards discovering the reach of barcoding in this class; investigating what other anthozoan taxa display similar high sequence divergence. For example, COI sequences have also been used discriminated hexacorallian species of the order Zoantharia (Sinniger et al. 2008, 2010), but too few zoanthids were collected in this study to explore whether this held true in Canadian zoanthids. This study also encountered anthozoan taxa which exhibit lower divergences at COI; therefore other markers should be investigated.

This thesis is a discovery-based investigation which provides the foundation for future investigations of Canadian Cnidaria. Traditional discrimination of cnidarian species relies solely on morphological traits; however, variable life stages, subtle diagnostic characters and damage to specimens during collection hinder identification. This study began the development of a DNA barcode library for Canadian Cnidaria and demonstrated the efficacy of using DNA barcodes for delineating cnidarian species as well as for identifying mis-identified and fragmented specimens and specimens at different stages during their life cycles. This will act to accelerate ecological and distributional studies of Canadian cnidaria as specimen quality no longer need be a key concern. This work reveals the need of greater effort in species documentation to further understanding of marine biodiversity and to aid in conservation. In conclusion, this study highlights the value of DNA barcoding for delineating species of Cnidaria, providing insights into cryptic species and for increasing the speed, objectivity and efficiency of species identifications.

Literature Cited

Agassiz, L. (1862). Discophorae. Contributions to the natural history of the United States of America. vol IV. Second monograph. Little, Brown and Company, Boston.

Altschul, S.F., Madden, T.L., Schaeffer, A.A., Zhang, J., Zhang, Z., Miller, W., & Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25: 3389-3402. doi: 10.1093énaré25.17.3389

Archambault, P., Snelgrove, P.V.R., Fisher, J.A.D., Gagnon, J.M. & Garbary, D.J. (2010) From sea to sea: Canada’s three oceans of biodiversity. PLoS ONE, 5. doi: 10.1371/journal.pone.0012182

Armani, A., Tinacci, L., Giusti, A., Castigliego, L., Gianfaldoni, D. & Guidi, A. (2013). What is inside the jar? Forensically informative nucleotide sequencing (FINS) of a short mitochondrial COI gene fragment reveals a high percentage of mislabeling in jellyfish food produces. Food Research International, 54: 1383-1393.

Bavestrello, G., Puce, S., Cerrano, C., & Sarà, M. (2000) Phenotypic plasticity in hydrozoans: morphological reversibility. Rivista di Biologia 93: 283-294

Bayha, K.M., Dawson, M.N., Collins, A.G., Barbeitos, M.S. & Haddock, S.H.D. (2010). Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integrative and Comparative Biology, 50: 436-455.

Best, B.A & Thomas, W.K. (1993) Anthozoan mtDNA: a fundamentally different rate of evolution. American Zoologist, 33: 99A (abstract 459).

Bigelow, H.B. (1917) Explorations of the United States coast and geodetic survey steamer “Bache” in the western Atlantic, January-March, 1914, under the direction of the United States, Bureau of Fisheries Washington, D.C: U.S.G.P.O., doi: http://dx.doi.org/10.5962/bhl.title.16988

Bigelow, H.B. (1920) Canadian Arctic Expedition 1913-1918. Mollusks, Echinoderms, Coelenterates, etc. Part H Medusae and Ctenophora. Ottawa: T. Mulvey, doi: http://dx.doi.org/10.5962/bhl.title.64185

Bigelow, H.B. (1926). Plankton of the offshore of the Gulf of Maine. Bulletin of the Bureau of Fisheries, vol XL, part II. Government Printing Office, Washington

Bilewitch, J.P., & Degnan, S.M. (2011) A unique horizontal gene transfer event has provided the octocoral mitochondrial genome with an active mismatch repair gene that has potential for an unusual self- contained function. BMC Evolutionary Biology, 11: 228-260.

Brandt, J.F. (1938) Mémoires de L’académie impériale des Sciences de Saint-Pétersbourg Tome II. St.- Pétersbourg. L’académie impériale des Sciences.

Brewer, R.H. (1991) Morphological differences between, and reproductive isolation of, two populations of the jellyfish Cyanea in Long Island Sound, USA. Hydrobiologia, 216/217: 471-477.

Bridge D., Cunningham C.W., Schierwater B., DeSalle R. & Buss L.W. (1992) Class-level relationships in the phylum Cnidaria: evidence from mitochondrial genome structure. Proceedings of the National Academy of Science of the United States of America, 89: 8750-8753.

Bridge, D., Cunningham, C.W., DeSalle, R. & Buss, L.W. (1995) Class-level relationships in the phylum Cnidaria: molecular and morphological evidence. Molecular Biology and Evolution. 12: 679-689.

Briggs, J.C. (1970) A faunal history of the North Atlantic Ocean. Systematic Zoology, 19: 19-34

Brockman, S. & McFadden, C.S. (2012) The mitochondrial genome of Paraminabea aldersladei (Cnidaria: Anthozoa: Octocorallia) supports intramolecular recombination as the primary mechanism of gene rearrangement in octocoral mitochondrial genomes. Genome Biology and Evolution, 4: 882-894.

Brown, B.E. (1997) Coral bleaching: causes and consequences. Coral Reefs, 16: 129-138.

Brown, W.M., George, M. Jr & Wilson, A.C. (1979) Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Science of the United States of America, 76: 1967-1971.

Bolton, T.F., & Graham, W.M. (2004) Morphological variation among populations of an invasive jellyfish. Marine Ecology Progress Series 278: 125-139.

Bouillon, J., Gravili, C., Pages, F., Gili, J. & Boero, F. (2006) An Introduction to Hydrozoa. Paris, France: Publications Scientifiques du Muséum.

Bucklin, A., Steinke, D. & Blanco-Bercial, L. (2011) DNA barcoding of marine Metazoa. Annual Review of Marine Science, 3: 471-508.

Calder, D.R. (1971) Nematocysts of polyps of Aurelia, Chrysaora and Cyanea, and their utility in identification. Transactions of the American Microscopical Society 90: 269-274.

Calderon I, Garrabou J, & Aurelle D. (2006) Evaluation of the utility of COI and ITS markers as tools for population genetic studies of temperate gorgonians. Journal of Experimental Marine Biology and Ecology. 336: 184-97.

Calgren, O. (1921) Actiniaria, Part I. The Danish Ingolf-Expedition, 5: 1-241.

Calgren, O. (1934). Some Actinaria from Bering Sea and Arctic waters. Journal of Washington Academy of Science 24: 348-353.

Calgren, O. (1949) A survey of the Ptychodactiaria, Corallimorpharia and Actiniaria. Kungl. Svenska Vetenskapsakademiens Handlingar, 4: 1-121.

Carr, C., Hardy, S.M., Brown, T.M., Macdonald, T.A. & Hebert, P.D.N. (2011). A tri-oceanic perspective: DNA barcoding reveals geographic structure and cryptic diversity in Canadian polychaetes. PLoS ONE, 6. doi: 10.1371/journal.pone.0022232.

Choong, H.H.C., Calder, D.R., & Brinckmann-Voss, A. (2012) Sertularella maureenae, a new species of hydroid (Cnidaria: Hydrozoa: Sertulariidae) from the Pacific coast of Canada. Zootaxa, 3297: 57-63.

Chow, S., Toyokawa, M., Ohara, I., Ueno, Y., Hamaguchi, M., Yanagimoto, T., Clarke, S. & Takeyama, H. (2008) ITS1 sequences in marine invertebrates. National Research Institute of Fisheries Science, Coastal Fisheries and Aquaculture Division; Nagai 6-31-1, Yokosuka, Japan.

Cline E.L. & Wolowyk M.W. (1997) Cardiac stimulatory, cytotoxic and cytolytic activity of extracts of sea anemones. International Journal of Pharmacognosy, 35: 91-98.

Collins, A.G. (2009) Recent insights into cnidarian phylogeny. Smithsonian Contributions to Marine Sciences, 38: 139-149.

Collins, A.G., Bentlage, B., Gillan, W., Lynn, T.H., Morandini, A.C. & Marques, A.C. (2011) Naming the Bonaire banded box jelly, Tamoya ohboya, n. sp. (Cnidaria: Cubozoa: Carybdeida: Tamoyidae). Zootaxa, 2753: 53-68.

Cornelius, P.F.S. (1995a). North-west European thecate hydroids and their medusae. Part 1. Introduction, Laodiceidae to Haleciidae. Synopses of the British Fauna New Series, 50: 1-347.

Cornelius, P. F. S. (1995b). North-west European thecate hydroids and their medusae. Part 2. Sertulariidae to Campanulariidae. Synopses of the British Fauna New Series, 50: 1-386.

Costa, F.O., deWaard, J.R., Boutillier, J., Ratnasingham, S., Dooh, R.T., Hajibabaei, M. & Hebert, P.D.N. (2007). Biological identifications through DNA barcodes: the case of the Crustacea. Canadian Journal of Fisheries and Aquatic Sciences, 64: 272-295.

Costello, M.J., Emblow, C. & White, R.J. (2001) European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Natures. 50. Muséum National d’Histoire Naturelle: Paris.

Coyne, J.A., & Orr, H.A. (2004) Speciation. Sunderland, U.S.: Sinauer Associates, Inc.

Culligan, K.M., Meyer-Gauen, G., Lyons-Weiler, J. & Hays, J.B. (2000) Evolutionary origin, diversification and specialization of eukaryotic MutS homolog mismatch repair proteins. Nucleic Acids Research, 28: 463-471.

Cuvier G. (1798). Zoophytes. In: Tableau élémentaire de l’histoire naturelle des animaux. Baudouin, Paris.

Daly, M., Brugler, M.R., Cartwright, P., Collins, A.G., Dawson, M.N., Fautin, D.G., France, S.C., & Dawson, M.N. (2004) Some implications of molecular phylogenetics for understanding biodiversity in jellyfishes, with an emphasis on Scyphozoa. Hydrobiologia, 530: 249-260.

Daly, M., Brugler, M.R., Cartwright, P., Collins, A.G., Dawson, M.N., Fautin, D.G., France, S.C., McFadden, C.S., Opresko, D.M., Rodriguez, E., Romano, S.L. & Stake, J.L. (2007) The phylum Cnidaria: A review of phylogenetic patterns and diversity 300 years after Linnaeus. Zootaxa 1668: 127-182.

Dawson, M.N. (2003) Macro-morphological variation among cryptic species of the moon jellyfish, Aurelia (Cnidaria: Scyphozoa). Marine Biology, 143: 369-379.

Dawson, M.N., (2005a) Cyanea capillata is not a cosmopolitan jellyfish: morphological and molecular evidence for C. annaskala and C. rosea (Scyphozoa: Semaeostomeae: Cyaneidae) in south-eastern Australia. Invertebrate Systematics, 19: 361-370.

Dawson, M.N. (2005b) Morphological variation and systematics in the Scyphozoa: Mastigias (Rhizostomeae, Mastigiidae)—a golden unstandard? Hydrobiologia, 537: 185-206

Dawson, M.N., Cieciel, K., Decker, M.B., Hays, G.C., Lucas, C.H. & Pitt, K.A. (2014) Population-level perspectives on global change: genetic and demographic analyses indicate various scales, timing and causes of scyphozoan jellyfish blooms. Biological Invasions, 17: doi: 10.1007/s10530-014-0732-z

100

Dawson, M.N., Gupta, A.S. & England, M.H. (2005) Coupled biophysical global ocean model and molecular genetic analyses identify multiple introductions of cryptogenic species. Proceedings of the National Academy of Sciences of the United States of America, 102: 11968-11973. doi:10.1073/pnas.0503811102.

Dawson, M.N. & Jacobs, D.K. (2001) Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). The Biological Bulletin, 200: 92-96.

Danielssen, D.C. (1890) Actiniidae. Den Norske Nordhavs-Expedition. Zoologia, 19: 1-184.

Dolan, E., Tyler, P.A., Yesson, C. & Rogers, A.D. (2013) Phylogeny and systematics of deep-sea sea pens (Anthozoa: Octocorallia: Pennatulacea). Molecular Phylogenetics and Evolution, 69: 610-618.

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32: 1792-1797.

Eschscholtz, J.F. (1829) System der acalephen: eine ausführliche beschreibung aller medusenartigen strahlthiere. Berlin: Dummler F.

Fautin D.G., Kozloff, E.N. & Siebert A.E. (1987) Marine Invertebrates of the Pacific Northwest. Seattle and London: University of Washington Press.

Feder, H.M. & Jewett S.C. (1977). The distribution, abundance and diversity of the epifaunal benthic organisms in two bays (Alitak and Ugak) of Kodiak Island, Alaska. Environmental Assessment of the Alaskan Continental Shelf, Quarterly Reports, July-September 2: 655-739.

Ferris, S.D., Sage, R.D., Prager, E.M., Ritte, U. & Wilson, A.C. (1983) Mitochondrial DNA evolution in mice. Genetics, 105: 681-721.

Frabricius, O. (1780). Fauna Groenlandica: systematice sistens animalia Groenlandiae occidentalis hactenus indagata, quadnomen specificum, triviale, vernaculumque: synonyma auctorum plurium, descriptionem, locum, victum, generationem, mores, usum, capturamque singuli, prout detegendi occasio fuit: maximaque parte secundum proprias observationes. Hafniae; Impensis Ioannis Gottlob Rothe.

France, S.C. & Hoover, L.C. (2001) Analysis of variation in mitochondrial DNA sequences (ND3, ND4L, MSH) among Octocorallia (= Alcyonaria) (Cnidaria: Anthozoa). Bulletin of the Biological Society of Washington, 10: 110-118.

Fraser, C.M. (1938) Hydroids of the Allan Hancock Pacific Expeditions since March 1938. Allan Hancock Pacific Expeditions. volume 4 number 5. The University of Southern California Press. Los Angeles, California.

Gosse, P.H., (1860) Actinologia Britannica. A history of the British sea-anemones and corals. London: Van Voorst, pp. i-xi, 1-362.

Govindarajan, A.F., Halanych, K.M., & Cunningham, C.W. (2005a) Mitochondrial evolution and phylogeography in the hydrozoan Obelia geniculata (Cnidaria). Marine Biology 146: 213–222.

Govindarajan, A.F., Piraino, S., Gravili, C., & Kubota, S. (2005b) Species identification of bivalve-inhabiting marine hydrozoans of the genus Eugymnanthea. Invertebrate Biology 124: 1–10.

101

Greenberg, N., Garthwaite, R.L. & Potts, D.C. (1996) Allozyme and morphological evidence for a newly introduced species of Aurelia in San Francisco Bay, California. Marine Biology, 125: 401-410.

Haeckel, E. (1880) System der Acrapeden, Zweite Ha¨lfte des System der Medusen. Gustav Fischer, Jena, 361–672.

Hay, S.J., Hislop, J.R.G. & Shanks, A.M. (1990) North Sea scyphomedusae; summer distribution, estimated biomass and significance particularly for 0-group gadoid fish. Netherlands Journal of Sea Research, 25: 113-130.

Hebert, P.D.N., Ratnasingham, S. & deWaard, J.R. (2003a) Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London B, 270: 96-99.

Hebert, P.D.N., Cywinska, A., Ball, S.L. & deWaard, J.R. (2003b) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B, 270: 313-321.

Hebert, P.D.N. & Gregory, T.R. (2005). The promise of DNA barcoding for taxonomy. Systematic Biology, 54: 852-859

Hernroth, L. & Gröndahl, F. (1983) On the biology of Aurelia aurita (L.) 1. Release and growth of Aurelia aurita (L.) ephyrae in the Gullmar Fjord, western Sweden, 1982–83. Ophelia, 22: 189-199.

Higuchi, R., Bowman, B., Freiberger, M., Ryder, O.A. & Wilson, A.C. (1984) DNA sequences from the quagga, an extinct member of the horse family. Nature, 312: 282-284.

Hoegh-Guldberg O. (1999) Climate change, coral bleaching and the future of the world’s coral reefs. Marine and Freshwater Research, 50: 839-866.

Holland, B.S, Dawson, M.N., Crow, G.L. & Hofmann, D.K. (2004) Global phylogeography of Cassiopea (Scyphozoa: Rhizostomeae): Molecular evidence for cryptic species and multiple invasions of the Hawaiian Islands. Marine Biology, 145: 119-1128.

Holst, S. & Laakmann, S. (2013) Morphological and molecular discrimination of two closely related jellyfish species, Cyanea capillata and C. lamarckii (Cnidaria, Scyphozoa), from the northeast Atlantic. Journal of Plankton Research, 36: 48-63.

Huang, D., Meier, R., Todd, P.A. & Ming Chou, L. (2008). Slow mitochondrial COI sequence evolution at the base of the metazoan tree and its implications for DNA barcoding. Journal of Molecular Evolution, 66: 167-174.

Hurst, G.D.D., & Jiggins, F.M. (2005) Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal Society of London B, 272: 1525-1534.

Ivanova, N.V., Fazekas, A.J. & Hebert, P.D.N. (2008). Semi-automated, membrane-based protocol for DNA isolation from plants. Plant Molecular Biology Reporter, 26: 186-198.

102

Ji, Y., Zhang, D. & He, L. (2003) Evolutionary conservation and versatility of a new set of primers for amplifying the ribosomal internal transcribed spacer regions in insects and other invertebrates. Molecular Ecology Notes, 3: 581-585.

Kayal, E., Bentlage, B., Collins, A.G., Kayal, M. & Pirro, S. (2011) Evolution of linear mitochondrial genomes in medusozoan Cnidarians. Genome Biology and Evolution, 4: 1-12.

Kayal, E., Roure, B., Philippe, H., Collins, A.G. & Lavrov, D.V. (2013) Cnidarian phylogenetic relationships as revealed by mitogenomics. BMC Evolutionary Biology, 13. doi: 10.1186/1471-2148-13-5.

Kerr, K.C.R., Lijtmaer, D.A., Barreira, A.S., Hebert, P.D.N. & Tubaro, P.L. (2009). Probing evolutionary patterns in Neotropical birds through DNA barcodes. PLoS ONE, 4. doi: 10.1371/journal.pone.0004379.

Keskin, E. & Atar, H.H. (2013) DNA barcoding commercially important aquatic invertebrates of Turkey. Mitochondrial DNA, 24: 440-450. doi:10.3109/19401736.2012.762576.

Ki, J., Hwang, D., Shin, K, Yoon, W.D., Lim, D., Kang, Y.S., Lee, Y. & Lee, J. (2008). Recent moon jelly (Aurelia sp. 1) blooms in Korean coastal waters suggest global expansion: examples inferred from mitochondrial COI and nuclear ITS-5.8S rDNA sequences. ICES Journal of Marine Science, 65: 443- 452.

Kimura, M. (1980) A simple model for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16: 111-120.

Knowlton, N. (1993) Sibling species in the sea. Annual Review of Ecology, Evolution, and Systematics, 24: 189-216.

Knowlton, N. (2000) Molecular genetic analyses of species boundaries in the sea. Hydrobiologia, 420: 73-90.

Kolbasova G.D., Zalevsky, A.O., Gafurov, A.R., Gusev, P.O., Ezhova, M.A., Zheludkevich, A.A., Konovalova, O.P., Kosobokova, K.N., Kotlov, N.U., Lanina, N.O., Lapashina, A.S., Medvedev, D.O., Nosikova, K.S., Nuzhdina, E.O., Bazykin, G.A., & Neretina, T.V.(2015) A new species of Cyanea jellyfish sympatric to C. capillata in the White Sea. Polar Biology, doi:10.1007/s00300-015-1707-y

Kramp, P.L. (1915) Medusae, Ctenophora and Chaetognathi from the Great Belt and the Kattegat in 1909. Meddr Kommn Havunders. Plankton, 112: 1-20.

Kramp, P.L. (1920) List of medusae collected by the M/S "Armauer Hansen" in the North Atlantic in 1913. Communication from Bergens Museums Biological Station (nr 53) and Zoological Department. Bergens Mus. Aarbok, 1917-18, 8: 1-7.

Kramp, P.L. (1961) Synopsis of the medusae of the world. Journal of the Marine Biological Association of the UK, 40: 337-342.

Kramp, P.L. (1965) Some medusae (mainly Scyphomedusae) from Australian coastal waters. Transactions of the Royal Society of South Australia, 89: 257-278.

Kramp, P.L. (1968a) The Hydromedusae of the Pacific and Indian oceans, sections II and III. Dana Report No. 72. Carlsberg Foundation, Copenhagen, Denmark.

103

Kramp, P.L. (1968b) The scyphomedusae collected by the Galathea expedition 1950-52. Vidensk. Medd. Dan Naturhist. Foren., 131: 67-98.

Kress, J.W. & Erickson, D.L. (2012) DNA barcodes: methods and protocols. Springer Science + Business Media, LLC. ISBN: 97801061779-591-6 (eBook).

Lamb, A. & Hanby, B.P. (2005) Marine Life of the Pacific Northwest. A Photographic Encyclopedia of Invertebrates, Seaweeds and Selected Fishes. Harbour Publishing. ISBN 1-55017-361-8.

Larson, R.J. (1990) Scyphomedusae and Cubomedusae from the Eastern Pacific. Bulletin of Marine Science, 47: 546-556.

Larson, R.J. (1986) Pelagic Scyphomedusae (Scyphozoa: Coronatae and Semaeostomeae) of the Southern Ocean. Biology of the Antarctic Seas XVI, 41: 59-165.

Layton, K. (2012) Examining patterns of genetic variation in Canadian marine molluscs through DNA barcodes. MSc. thesis University of Guelph.

Lewis, C. & Bentlage, B. (2009) Clarifying the identity of Japanese Habu-kurage, Chironex yamaguchii, sp. nov. (Cnidaria: Cubozoa: Chirodropida). Zootaxa, 2030: 59-65.

Librado, P. & Rozas, J. (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25: 1451-1452.

Linnaeus, C. (1761). Fauna Suecica sistens Animalia Sueciae Regni: Mammalia, Aves, Amphibia, Pisces, Insecta, Vermes. Distributa per Classes, Ordines, Genera, Species, cum Differentiis Specierum, Synonymis Auctorum, Nominibus Incolarum, Locis Natalium, Descriptionibus insectorum. Editio altera, auctior. Stockholmiae: L. Salvii.

Lumsden, S.E., Hourigan, T.F., Bruckner, A.W. & Dorr, G. (2007) The State of Deep Coral Ecosystems of the United States. NOAA Technical Memorandum CRCP-3: Silver Spring MD.

Mardulyn, P. & Whitfield, J.B. (1999) Phylogenetic signal in the COI, 16S, and 28S genes for inferring relationships among genera of Microgastrinae (Hymenoptera: Braconidae): evidence of a high diversification rate in this group of parasitoids. Molecular Phylogenetics and Evolution 12: 282-294.

Mayer, A.G. (1910) The Scyphomedusae. In Medusae of the world. Volume 3. Washington, D.C.: Carnegie Institution of Washington; pp 603-630.

Mayer, A.G. (1914) Effects of temperature on tropical marine animals. Pap. Tortugas Lab. 183: 1-24.

Mayr, E. &Ashlock, P.D. (1993) Principles of Systematic Zoology, 2nd edition. New York, U.S.: McGraw- Hill.

McMurrich J. P. (1901) Report on the Hexactiniae of the Columbia University Expedition to Puget Sound during the summer of 1896, Report of the Biological Survey of Mutsu Bay.

Messing J. (1983) New M13 vectors for cloning. Methods Enzymology, 101: 20-78.

Mianzan, H. W. & P. F. S. Cornelius. (1999). Cubomedusae and Scyphomedusae. In Mianzan, H.W (ed.), South Atlantic Zooplankton. Leiden. Backhuys Publishers. Pp 513-559.

104

Minxiao, W., Fanping, C., Yantao, W., Song, S. & Chaolun, L. (2013) DNA barcoding Medusozoa in the northern Chinese coastal region using COI. Haiyang Yu Huzhao, 43: 451-459.

Moura, C.J., Harris, D.J., Cunha, M.R. & Rogers, A.D. (2008) DNA barcoding reveals cryptic diversity in marine hydroids (Cnidaria, Hydrozoa) from coastal and deep-sea environments. Zoologica Scripta, 37: 93-108.

Müller O.F. (1776). Zoologiae Danicae Prodromus seu Animalium Daniae et Norvegiae indigenarum characteres, nomina, et synonyma imprimis popularium. Hafniae, Typiis Hallageriis, pp. xxii + 274.

Ogata, H., Ray, J., Toyoda, K., Sandaa, R.A. & Nagasaki, K. (2011) Two new subfamilies of DNA mismatch repair proteins (MutS) specifically abundant in the marine environment. ISME Journal 5: 1143-1151.

Ortman, B.D., Bucklin, A., Pages, F. & Youngbluthm, M. (2010). DNA barcoding the Medusozoa using mtCOI. Deep-Sea Research II, 57: 2148-2156.

Palumbi, S. R. (1992) Marine speciation on a small planet. TREE, 7: 114-118.

Park, E., Hwang, D., Lee, J., Song, J., Seo, T. & Won, J. (2012). Estimation of divergence times in Cnidarian evolution based on mitochondrial protein-coding genes in the fossil record. Molecular Phylogenetics and Evolution, 62: 329-345.

Péron, F. & Lesueur, C.A. (1809) Histoire générale et particulière de tous les animaux qui composent la famille des Méduses. Annales Muséum National D’Histoire Naturelle, 14: 312-366.

Pont-Kingdon, G.A., Okada, N.A., Macfarlane, J.L., Beagley, C.T. & Wolstenholme, D.R. (1995) A coral mitochondrial MutS gene. Nature, 375: 109-111.

Pont-Kingdon, G.A., Okada, N.A., Macfarlane, J.L., Beagley, C.T. & Watkins-Sims, C.D. (1998) Mitochondrial DNA of the coral Sarcophyton glaucum contains a gene for a homologue of bacterial MutS: a possible case of gene transfer from the nucleus to the mitochondrion. Journal of Molecular Evolution, 46: 419-431.

Radulovici, A.E., Archambault, P., & Dufresne, F. (2010) DNA barcodes for marine biodiversity: moving fast forward? Diversity 2: 450-472.

Ramsak, A., Stopar, K. & Malej, A. (2012) Comparative phylogeography of meroplanktonic species, Aurelia spp. and Rhizostoma pulmo (Cnidaria: Scyphozoa) in European Seas. Hydrobiologia, 690. doi: 10.1007/s10750-012-1053-9.

Raskoff, K.A., Sommer, F.A., Hamner, W.M. & Cross, K.M. (2003) Collection and culture techniques for gelatinous zooplankton. The Biological Bulletin, 204: 68-80.

Raskoff, K.A., Hopcroft, R.R., Kosobokova, K.N., Purcell, J.E., Youngbluth, M.Y. (2010) Jellies under ice: ROV observations from the Arctic 2005 hidden ocean expedition. Deep-Sea Research II. 57: 111-126.

Ratnasingham, S., & Hebert, P.D.N. (2007). BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes, 7: 355-364.

105

Ratnasingham, S., & Hebert, P.D.N. (2013). A DNA-based registry for all animal species: the Barcode Index Number (BIN) system. PLoS ONE 8: e66213. doi: 10.1371/journal.pone.0066213

Robson, E.A. (1966) Swimming in Actiniaria. In: W.J. Rees edition, The Cnidaria and Their Evolution, London: Academic Press, pp. 333-360.

Ross, D.M. & Sutton, L. (1967) Swimming sea anemones of Puget Sound: swimming of Actinostola new species in response to Stomphia coccinea. Science, 155: 1419-1421.

RStudio Team (2015). RStudio: Integrated Development for R. RStudio, Inc., Boston, Massachusettes. URL: http://www.rstudio.com/.

Russell, F.S. (1970) The Medusae of the British Isles. II Pelagic Scyphozoa with a supplement to the first volume on Hydromedusae. Cambridge: Cambridge University Press.

Sanamyan P. & Sanamyan K.E. (2006). The genera Urticina and Cribrinopsis (Anthozoa: Actiniaria) from the north-western Pacific. Journal of Natural History, 40: 359-393.

Sanamyan N.P., Sanamyan, K.E. & McDaniel, N. (2013). Two new shallow water sea anemones of the family Actiniidae (Cnidaria: Anthozoa: Actinaria) from British Columbia (NE Pacific). Invertebrate Zoology, 10: 199-216.

Schroth, W., Jarms, G., Streit, B., & Schierwater, B. (2002) Speciation and phylogeography in the cosmopolitan marine moon jelly, Aurelia sp. BMC Evolutionary Biology 2: 1.

Schuchert, P. (1993) Phylogenetic analysis of the Cnidaria. Zeitschrift fur Zoologische Systematik und Evolutionsforschung. 31: 5463-5467.

Schuchert, P. (2001) Survey of the family Corynidae (Cnidaria, Hydrozoa). Revue Suisse de Zoologie, 108: 739-878.

Schuchert, P. (2005) Taxonomic revision and systematic notes on some Halecium species (Cnidaria, Hydrozoa). Journal of Natural History, 39: 607-639.

Sebens, K.P. & Laakso, G. (1977) The genus Tealia (Anthozoa: Actiniaria) in the San Juan Archipelago and the coast of the Olympic Peninsula, Washington, with descriptions of Tealia piscovora sp. nov and Tealia lofotensis (Danielssen). The Wasmann Journal of Biology, 35: 152-168.

Shao, Z., Graf, S., Chaga, O.Y. & Lavroc, D.V. (2006) Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase. Gene, 381: 92-101.

Shearer, T., Van Oppen, M.J.H., Romano, S.L. & Worheide, G., (2002). Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Molecular Ecology 11: 2475-2487.

Siebert, A.E. (1973) A description of the sea anemone Stomphia didemon sp. nov. and its development. Pacific Science, 27: 363-376.

Siebert, A.E. & Spaulding, J.G. (1976) The taxonomy, development and brooding behaviour of the anemone, Cribrinopsis fernaldi sp. nov. Biological Bulletin, 150: 128-138.

106

Sinniger, F., Reimer, J.D. & Pawlowski, J. (2008) Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia). Zoological Science, 25: 1253-60.

Sinniger, F., Reimer, J.D. & Pawlowski, J. (2010) The Parazoanthidae (Hexacorallia: Zoantharia) DNA taxonomy: description of two new genera. Marine Biodiversity, 40: 57-70.

Sparmann, S. (2012) Contributions to the molecular phylogeny, phylogeography, and taxonomy of the scyphozoan jellyfish. MSc. thesis University of British Columbia.

Stampar, S.N., Morandini, A.C. & Lang Da Silveira, F. (2014) A new species of Pachycerianthus (Cnidaria, Anthozoa, Ceriantharia) from tropical southwestern Atlantic. Zootaxa, 3827: 343-354.

Steinke, D., Zemlak, T.S., Boutillier, J.A. & Hebert, P.D.N. (2009) DNA barcoding of Pacific Canada’s fishes. Marine Biology, 156: 2641-2647.

Stiasny, G. (1919) Die scyphomedusen-sammlung des naturhistoricshen reichmuseum in Leiden. Stauromedusae. Coronatae, Semaestomae. Zoologische Mededelingen, 5: 66-99.

Stiasny, G., Maaden, H. (1943) van der: Über Scyphomedusen aus dem Ochotskishen und Kamtschatka Meer nebst einer Kritik der Genera Cyanea und Desmonema. ZJAS, 76: 227-266.

Tamura K., Stecher G., Peterson D., Filipski A. & Kumar S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725-2729.

Thiel, M.E. (1962) Untersuchungen zur Artfrage von Cyanea lamarckii Péron et. Leseur. und Cyanea capillata. Abhandlungen und Verhandlungen des Naturwissenschaftlichen Vereins zu Hamburg N.F., 6: 277-293.

Thuesen, E.V. (2003) Crossota millsae (Cnidaria: Trachymedusae: Rhopalonematidae) a new species of viviparous hydromedusae from the deep sea off California and Hawaii. Zootaxa, 309: 1-12.

Totton, A.K. (1965) A Synopsis of the Siphonophora. London: British Museum of Natural History. van Oppen, M.J., Willis, B.L. & Miller, D.J. (1999) Atypically low rate of cytochrome b evolution in scleractinian coral genus Acropora. Proceedings of the Royal Society B: Biological Sciences, 266: 179- 183.

Veron, J.E.N. (1995). Corals in Space & Time. The Biogeography & Evolution of the Scleractinia. Ithaca, London: Cornell University Press. ISBN: 0-801-48263-1.

Verrill, A.E. (1922) Decapod Crustacea of Bermuda Part II, Macrura. Transactions of the Connecticut Academy of Arts and Sciences, 26: 1-179.

Verrill, A.E. (1864) List of the polyps and corals sent by the Museum of Comparative Zoology to other institutions in exchange, with annotations. Bulletin of the Museum of Comparative Zoology, 1: 29-60.

Vermeij, G.J. (1991) Anatomy of an invasion: the trans-Arctic interchange. Paleobiology, 17: 281-307. von Linnaeus, C. (1746) Fauna Suecica. Sumtu and literis Salvii L. Stockholm, Sweden. von Linnaeus, C (1758) Systema Naturae. 10th edn. Holmiae Salvii L. Stockholm, Sweden.

107

Wang, J., Zhen, Y., Wang, G., Mi, T. & Yu, Z. (2012) Detection of the moon jellyfish Aurelia sp. based on the mt-16S rDNA and mt-COI. College of Marine Life Science, Ocean University of China, 238 Songling Road, Qingdao, Shandong 266100, China.

Wang, J., Zhen, Y., Wang, G., Mi, T. & Yu, Z. (2013) Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI. Chinese Journal of Applied Ecology, 3: 847-852.

Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. & Hebert, P.D.N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360: 1847-1857.

Ward, R.D., Holmes, B.H. & O’Hara, T.D. (2008). DNA barcoding discriminates echinoderm species. Molecular Ecology Resources, 8: 1202-1211.

Watson, G.M. (1988) Ultrastructure and cytochemistry of developing nematocysts. In: D.A. Hessinger, and H.M. Lenhoff, The Biology of Nematocysts, San Diego: Academic Press.

Weill, R. (1934) Contribution a l’étude des cnidaries et de leur nematocysts. 1. Recherches sûr les nematocysts (Morphologie, Physiologie, Developpement). 2. Valeur taxonomique du cnidome. Travaux de station Zoologique Wimereux.

Werner, B. (2006) Effect of some environmental factors on differentiation and determination in marine Hydrozoa, with a note on their evolutionary significance. Annals of the New York Academy of Sciences, 105: 463-488.

Widmer, C.L. (2006). Life cycle of Phacellophora camtschatica (Cnidaria: Scyphozoa). Invertebrate Biology, 125: 83-90.

Willcox, S., Moltschaniwsky, N.A. & Crawford, C.M. (2008) Population dynamics of natural colonies of Aurelia sp. Scyphistomae in Tasmania, Australia. Marine Biology, 154: 661-670.

Willis, B.L., Van Oppen, M.J.H., Miller, D.J., Vollmer, S.V. & Ayre, D.J. (2006) The role of hybridization in the evolution of reef corals. The Annual Review of Ecology, Evolution and Systematics. 37: 489-517.

Wilson, A.C., Cann, R.L., Carr, S.M., Georgej, M. & Gyllenstenk, U.B. (1985) Mitochondrial DNA and two perspectives on evolutionary genetics. Biological Journal of the Linnean Society, 26: 375-400.

Witt, J.D.S., Threloff, D.L. & Hebert, P.D.N. (2006). DNA barcoding reveals extraordinary cryptic diversity in an amphipod genus: implications for desert spring conservation. Molecular Ecology, 15: 3073-3082.

Won, J.H., Rho, B.J. & Song, J.I. (2001) A phylogenetic study of Anthozoa (phylum Cnidaria) based on morphological and molecular characters. Coral Reefs. 20: 39-50.

Wrobel, D., & Mills, C. (2003) Pacific coast pelagic invertebrates: a guide to the common gelatinous animals. Monterey, California: Sea Challengers and Monterey Bay Aquarium.

Yao, H., Song, J., Liu, C., Luo, K., Han, J., Li, Y., Pang, X., Xu, H., Zhu, Y., Xiao, P. & Chen, S. (2010) Use of ITS2 Region as the universal DNA barcode for plants and animals. PLoS ONE, doi: 10.1371/journal.pone.0013102

108

Zweng, M.M, Reagan, J.R., Antonov, J.I., Locarnini, R.A., Mishonov, A.V., Boyer, T.P., Garcia, H.E., Baranova, O.K., Johnson, D.R., Seidov, D., Biddle, M.M., (2013) World Ocean Atlas 2013, Volume 2: Salinity. S. Levitus, Ed., A. Mishonov Technical Ed.; NOAA Atlas NESDIS

109

Appendix A: Chapter 2 Supplementary Information

Salinity (PSU) Figure A.1 Histogram of salinity frequencies from all Canadian Cyanea collection locations. This histogram displays that the salinity values in which Canadian Cyanea are found are normally distributed around a salinity of 31.5 PSU with outliers of 26PSU.

(A)

Degrees of Freedom Sum of Squares Mean Square F value P value Lineage 3 26.83 8.943 8.5 0.0000592 Residuals 78 82.07 1.052

2 푀푆푎푚표푛푔−푀푆푒푟푟표푟 (B) 휎퐴 = 푛0

82.07−26.83 휎2 = 퐴 19.96

2 휎퐴 = 2.77 - the added variance component among lineage distributions

2 (C) 휎 = 푀푆푒푟푟표푟

휎2 = 82.07

2 1 ∑ 푛푖 (D) 푛0 = (∑ 푛푖− ) where ni= the number of observations in the ith treatment group and a= 푎−1 ∑ 푛푖 number of treatment groups

1 (262 + 212 + 242 + 112) 푛 = [(26 + 21 + 24 + 11) − ] 0 4 − 1 (26 + 21 + 24 + 11)

1 (1814) 푛 = [(82) − ] 0 3 (82)

110

1 푛 = [(82) − 22.12] 0 3 1 푛 = [59.9] 0 3

푛0 = 19.96

2.77 (E) Percentage of variance due to lineages: 100 × ( ) = 3.26% 82.07+2.77

82.07 (F) Percentage of variance due to salinity: 100 × ( ) = 92.7% thus most of the variance is due 82.07+2.77 to error variation. Variation in surface salinity which is related to lineage distribution is 3.26%.

Figure A.2 Calculations of Variance for the Random Effects Model ANOVA of Salinities for each Lineage Distribution. These calculations show that there is a significant added variance component in salinity related to the difference of lineage distributions (F=8.5, p=0.00005). This added component is 3.26% of the total variance in the data, and the remainder (92.7%) due to the variance in salinity within each lineage distribution. (A) Summary of random effects single factor ANOVA (B) The added variance component among lineage distributions (C) The added variance component due to variation among salinities (within lineage distributions) (D) n0 calculations (E) Calculations of percentage variance due to lineage distributions (F) Calculations of percentage variance due to salinity.

(A) (B)

Figure A.3 Residuals Plots of Salinity Values for the Cyanea Lineages Geographic Ranges. These plots show that the residuals from the random effects model ANOVA of salinities for each lineage distribution appear normal and variances are approximately uniform. (A) Normal Q-Q plot (B) Residual plot with residuals randomly dispersed around the horizontal axis indicating that there is no pattern among the residuals as the lineages change.

111

Table A.1 GenBank sequence data

Species GenBank Accession BOLD Process Location Paper COI 16S ITS1 ID (COI sequences) Cyanea JQ353737 GBCI2266-13 China Minxiao et al. 2012 purpurea JQ353736 GBCI2267-13 Cyanea JX995347 GBCI3622-14 North Sea Holst & Laakmann lamarckii JX995348 GBCI3623-14 2014 JX995349 GBCI3624-14 JX995350 GBCI3611-14 JX995351 GBCI3612-14 JX995352 GBCI3613-14 JX995353 GBCI3614-14 JX995354 GBCI3615-14 JX995355 GBCI3616-14 JX995356 GBCI3629-14 JX995357 GBCI3625-14 JX995360 GBCI3626-14 JX995361 GBCI3627-14 JX995362 GBCI3628-14 Cyanea AY902912 Australia Dawson 2005a annaskala AY902913 AY902914 AY903061 GBCI0429-06 AY902915 AY903062 GBCI0430-06 AY902916 AY903063 GBCI0431-06 AY902917 AY903064 GBCI0432-06 AY902923 AY903065 GBCI0438-06 Cyanea AY902918 Australia Dawson 2005a rosea AY902919 AY903057 GBCI0434-06 AY902920 AY903058 GBCI0435-06 AY902921 AY903059 GBCI0436-06 AY902922 AY903060 GBCI0437-06 Cyanea JX845450 GBCI2214-13 China Minxiao et al. 2012 nozakii JQ353734 JX845345 GBCI2269-13 China Wang et al. 2012 JQ353735 GBCI2268-13 Cyanea KM281985 KM114296 GBCI5251-15 White Sea Kolbasova et al. tzetlinii KM281987 KM250905 GBCI5252-15 2015 KM281990 KM251177 GBCI5253-15 KM281993 KM251183 GBCI5254-15 KM281994 GBCI5255-15 KM281997 GBCI5256-15 KM983286 GBCI5260-15 KM983288 GBCI5261-15 KM983290 GBCI5263-15 Cyanea AY902911 GBC10426-06 North Sea Dawson et al. capillata 2005a HF930525 GBCI3754-14 North Sea Armani et al. 2012 HF903526 GBCI3755-14 JX995330 GBCI3566-14 North Sea Holst & Laakmann

112

JX995331 GBCI3567-14 2014 JX995332 GBCI3568-14 JX995333 GBCI3569-14 JX995334 GBCI3570-14 JX995335 GBCI3617-14 JX995336 GBCI3618-14 JX995337 GBCI3619-14 JX995338 GBCI3620-14 JX995339 GBCI3621-14 JX995340 GBCI3557-14 JX995341 GBCI3560-14 JX995342 GBCI3561-14 JX995343 GBCI3562-14 JX995344 GBCI3563-14 JX995345 GBCI3564-14 JX995346 GBCI3565-14 KM983282 KM250903 GBCI5371-15 White Sea Kolbasova et al. KM983283 KM250904 GBCI5370-15 2015 KM983284 KM250906 GBCI5369-15 KM983285 KM251173 GBCI5368-15 KM983287 KM251174 GBCI5367-15 KM983288 KM251175 GBCI5261-15 KM983289 KM251176 GBCI5262-15 KM983290 KM251178 GBCI5263-15 KM983291 KM251179 GBCI5366-15 KM983292 KM251180 GBCI5365-15 KM983393 KM251181 GBCI5364-15 KM281972 KM251182 GBCI5372-15 KM281973 GBCI5373-15 KM281974 GBCI5374-15 KM281975 GBCI5375-15 KM281976 GBCI5376-15 KM281977 GBCI5377-15 KM281978 GBCI5378-15 KM281979 GBCI5379-15 KM281980 GBCI5380-15 KM281981 GBCI5381-15 KM281982 GBCI5382-15 KM281983 GBCI5383-15 KM281984 GBCI5384-15 KM281986 GBCI5385-15 KM281988 GBCI5386-15 KM281989 GBCI5387-15 KM281991 GBCI5388-15 KM281992 GBCI5389-15 KM281995 GBCI5390-15 KM281996 GBCI5391-15 NEP JX393205 British Sparmann 2012 JX393206 Columbia JX393207 JX393208

113

JX393209 JX393210 JX393211 JX393213 JX393214 JX393215 JX393216 JX393217 JX393218 JX393219 JX393220 JX393221 JX393222 JX393223 JX393224 JX393225 JX393226 JX393227 JX393228 JX393229 JX393230 JX393231 NWA1 JX393232 Long Island Sparmann 2012 JX393233 Sound JX393234 JX393235 JX393236 JX393237 JX393238 JX393239 JX393240 JX393241 JX393242 JX393243 JX393244 JX393260 NWA2 JX393245 Long Island Sparmann 2012 JX393246 Sound JX393247 JX393248 JX393249 JX393270

114

Appendix B: Specimen Collection Information

Table B.1 Collection data for Cnidaria specimens used in this study.

Class BIN Process ID Sample ID Identification COI-5P Collection State/Province Latitude Longitude Sequence Date Length Anthozoa AAE3706 KHA477-14 MLI-023 Actinauge cristata 604 10-Aug-2013 Gulf of St. Lawrence 50.309 -58.06 KHA204-14 DFO-MONC-096 Actinauge sp. 648 04-Sep-2013 Gulf of St. Lawrence 48.5187 -62.1425 KHA214-14 DFO-MONC-106 Actinauge sp. 658 04-Sep-2013 Gulf of St. Lawrence 48.5187 -62.1425 KHA220-14 DFO-MONC-112 Actinauge sp. 658 04-Sep-2013 Gulf of St. Lawrence 48.0692 -61.8679 KHA218-14 DFO-MONC-110 Anthozoa 569 04-Sep-2013 Gulf of St. Lawrence 48.0692 -61.8679 KHA577-14 SABS-041 Anthozoa sp. 648 07-Jul-2013 Nova Scotia 42.326 -67.263 KHA148-14 DFO-MONC-040 Metridium farcimen 658 04-Sep-2013 Gulf of St. Lawrence 47.3912 -64.7161 AAF2832 KHBC165-13 BIOUG-KMH-031 Zoanthidae sp. 648 Vancouver Aquarium AAF8395 BIBOF039-10 SOP0039 Diadumene lineata 658 14-Oct-2009 St. Andrews, New Brunswick 45.162 -67.045 BIBOF040-10 SOP0040 Diadumene lineata 658 14-Oct-2009 St. Andrews, New Brunswick 45.162 -67.045 BIBOF041-10 SOP0041 Diadumene lineata 658 14-Oct-2009 St. Andrews, New Brunswick 45.162 -67.045 KBCSM695-14 HG13-7-06 Diadumene lineata 648 27-May-2013 Ayum Creek, Vancouver Island 48.3902 -123.659 KBCSM696-14 HG13-7-07 Diadumene lineata 648 27-May-2013 Ayum Creek, Vancouver Island 48.3902 -123.659 KBCSM697-14 HG13-7-08 Diadumene lineata 648 27-May-2013 Ayum Creek, Vancouver Island 48.3902 -123.659

KHA484-14 MLI-030 Actinauge cristata 618 07-Aug-2013 Gulf of St. Lawrence 50.57 -58.125 AAF8957 KHA485-14 MLI-031 Actinauge cristata 591 07-Aug-2013 Gulf of St. Lawrence 50.57 -58.125 KHA486-14 MLI-032 Actinauge cristata 572 07-Aug-2013 Gulf of St. Lawrence 50.57 -58.125 KHA530-14 MLI-076 Actinauge cristata 604 08-Aug-2012 Gulf of St. Lawrence 50.731 -57.674 KHA531-14 MLI-077 Actinauge cristata 564 08-Aug-2012 Gulf of St. Lawrence 50.731 -57.674 KHA534-14 MLI-080 Actinauge cristata 605 08-Aug-2012 Gulf of St. Lawrence 50.731 -57.674 KHA536-14 MLI-082 Actinauge cristata 578 08-Aug-2012 Gulf of St. Lawrence 50.731 -57.674 KHA209-14 DFO-MONC-101 Actinauge sp. 648 04-Sep-2013 Gulf of the St. Lawrence 48.3218 -62.0382 KHA210-14 DFO-MONC-102 Actinauge sp. 588 04-Sep-2013 Gulf of the St. Lawrence 48.3218 -62.0382 KHA221-14 DFO-MONC-113 Actinauge sp. 648 04-Sep-2013 Gulf of the St. Lawrence 48.3218 -62.0382 KHA237-14 DFO-MONC-129 Actinauge sp. 648 04-Sep-2013 Gulf of the St. Lawrence 47.4228 -60.5056 KHA586-14 SABS-050 Actinauge sp. 648 25-Jul-2013 Nova Scotia 44.751 -60.934 KHA592-14 SABS-056 Actinauge sp. 648 30-Jul-2013 Nova Scotia 46.24 -58.902 KHA629-14 SABS-093 Actinauge sp. 648 21-Jul-2013 Nova Scotia 44.645 -59.707 KHA630-14 SABS-094 Actinauge sp. 648 21-Jul-2013 Nova Scotia 44.645 -59.707

115

KHA116-14 DFO-MONC-008 Anthozoa 596 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 KHA191-14 DFO-MONC-083 Anthozoa 603 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA193-14 DFO-MONC-085 Anthozoa 592 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA194-14 DFO-MONC-086 Anthozoa 648 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA223-14 DFO-MONC-115 Anthozoa 595 04-Sep-2013 Gulf of the St. Lawrence 48.3218 -62.0382 KHA225-14 DFO-MONC-117 Anthozoa sp. 648 04-Sep-2013 Gulf of the St. Lawrence 47.4228 -60.5056 KHA670-14 DFO-MONC-130 Anthozoa sp. 646 27-Sep-2013 Gulf of the St. Lawrence 47.2105 -60.4012 KHA671-14 DFO-MONC-008- Anthozoa sp. 648 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 02 KHBC213-13 BIOUG-KMH-079 Anthozoa sp. 646 Vancouver Aquarium KHBC219-13 BIOUG-KMH-085 Anthozoa sp. 648 Vancouver Aquarium KHBC220-13 BIOUG-KMH-086 Anthozoa sp. 648 Vancouver Aquarium ARCMI601-14 BIOUG14664-C09 Hormathia nodosa 651 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 ARCMI608-14 BIOUG14664-D04 Hormathia nodosa 609 03-Sep-2014 Durban Harbour, Nunavut 67.072 -62.139 ARCMI609-14 BIOUG14664-D05 Hormathia nodosa 651 03-Sep-2014 Durban Harbour, Nunavut 67.072 -62.139 KHA068-14 PA-II-Nod_a-01 Hormathia nodosa 648 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA069-14 PA-II-Nod_a-02 Hormathia nodosa 648 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA070-14 PA-II-Nod_a-03 Hormathia nodosa 648 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA071-14 PA-II-Nod_a-04 Hormathia nodosa 648 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA072-14 PA-II-Nod_a-05 Hormathia nodosa 648 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA096-14 PA-I-HN-01 Hormathia nodosa 647 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA097-14 PA-I-HN-02 Hormathia nodosa 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA098-14 PA-I-HN-03 Hormathia nodosa 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA099-14 PA-I-HN-04 Hormathia nodosa 647 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA117-14 DFO-MONC-009 Hormathia nodosa 648 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 KHA235-14 DFO-MONC-127 Hormathia nodosa 648 04-Sep-2013 Gulf of the St. Lawrence 47.4228 -60.5056 KHA236-14 DFO-MONC-128 Hormathia nodosa 631 04-Sep-2013 Gulf of the St. Lawrence 47.4228 -60.5056 KHA243-14 KHM-S13-0085 Hormathia nodosa 650 31-Aug-2013 Les Escoumins, Quebec 48.3191 -69.4121 KHA248-14 KHM-S13-0090 Hormathia nodosa 651 01-Sep-2013 Les Escoumins, Quebec 48.3191 -69.4121 KHA497-14 MLI-043 Hormathia nodosa 648 27-Aug-2013 Gulf of St. Lawrence 49.892 -61.212 KHA587-14 SABS-051 Hormathia nodosa 648 30-Jul-2013 Nova Scotia 46.181 -58.952 KHBC205-13 BIOUG-KMH-071 Hormathia nodosa 646 Vancouver Aquarium KHBC208-13 BIOUG-KMH-074 Hormathia nodosa 648 Vancouver Aquarium KHBC210-13 BIOUG-KMH-076 Hormathia nodosa 643 Vancouver Aquarium AAG1974 KBCSM357-14 RICK-0073 Anthozoa 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594

116

KBCSM358-14 RICK-0074 Anthozoa 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 KHA580-14 SABS-044 Anthozoa sp. 647 12-Jul-2013 Nova Scotia 42.706 -64.14 KHA211-14 DFO-MONC-103 Bolocera sp. 648 04-Sep-2013 Gulf of the St. Lawrence 48.5187 -62.1425 KHA230-14 DFO-MONC-122 Bolocera sp. 647 04-Sep-2013 Gulf of the St. Lawrence 46.8642 -63.3318 KHA642-14 SABS-106 Bolocera sp. 603 17-Jul-2013 Nova Scotia 43.232 -60.934 KHA501-14 MLI-047 Bolocera tuediae 636 22-Aug-2013 Gulf of St.Lawrence 48.945 -67.624 KHA109-14 DFO-MONC-001 Urticina felina 658 04-Sep-2013 Cape Breton 46.9562 -60.8681 AAI3719 LABBI097-09 TBLABR-097 Cerianthus 600 12-Oct-2008 Anaktalak Fjord, Labrador 56.4583 -62.178 KHA717-14 PS Cerianthus Pachycerianthus 577 10-Sep-2013 Placentia Bay, Newfoundland 47.0309 -55.1725 borealis 01 borealis KHA718-14 PS Cerianthus Pachycerianthus 578 10-Sep-2013 Placentia Bay, Newfoundland 47.0309 -55.1725 borealis 02 borealis KHA719-14 PS Cerianthus Pachycerianthus 590 10-Sep-2013 Placentia Bay, Newfoundland 47.0309 -55.1725 borealis 03 borealis KHA720-14 PS Cerianthus Pachycerianthus 602 10-Sep-2013 Placentia Bay, Newfoundland 47.0309 -55.1725 borealis 04 borealis AAI5336 KHA683-14 PS Bunodactis stella Aulactinia stella 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 01 KHA686-14 PS Bunodactis stella Aulactinia stella 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 04 KHA687-14 PS Bunodactis stella Aulactinia stella 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 05 KHBC203-13 BIOUG-KMH-069 Epiactis lisbethae 648 Vancouver Aquarium KHBC204-13 BIOUG-KMH-070 Epiactis lisbethae 648 Vancouver Aquarium CCSMA029-07 07PROBE-05386 Urticina 658 26-Jul-2007 Churchill, Manitoba 58.794 -94.217 CCSMA030-07 07PROBE-05387 Urticina 658 26-Jul-2007 Churchill, Manitoba 58.794 -94.217 CCSMA031-07 07PROBE-05388 Urticina 658 26-Jul-2007 Churchill, Manitoba 58.794 -94.217 CCSMA032-07 07PROBE-05389 Urticina 658 17-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA033-07 07PROBE-05390 Urticina 658 17-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA039-07 07PROBE-05396 Urticina 658 19-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA112-08 06-PROBE-03492 Urticina 657 Churchill, Manitoba 58.74 -93.82 CCSMA143-08 07PROBE-04238 Urticina 658 08-Jul-2007 Churchill, Manitoba 58.787 -94.216 CCSMA144-08 07PROBE-04239 Urticina 658 08-Jul-2007 Churchill, Manitoba 58.787 -94.216 CCSMA157-08 08PROBE-1092 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA160-08 08PROBE-1095 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA161-08 08PROBE-1096 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 AAI8032 KHBC053-13 RBCM 010-00300- Isidella sp. 648 03-Sep-2002 Beresford Bay, British Columbia 53.9619 -133.699 001 KHBC055-13 RBCM 011-00075- Isidella tentaculum 600 09-Apr-2004 Bowie Seamount, British Columbia 51.2583 -135.708 001

117

KHBC056-13 RBCM 010-00219- Isidella tentaculum 648 31-Aug-2004 Brooks Peninsula, Vancouver Island 49.9416 -128.055 001 KHBC058-13 RBCM 010-00288- Keratoisis sp. 648 23-Oct-2005 Ucleulet, British Columbia 48.3625 -126.458 001 KHBC059-13 RBCM 010-00216- Keratoisis sp. 648 05-Sep-2004 Anthony Island, British Columbia 52.0798 -131.53 008 AAI8947 KHBC153-13 BIOUG-KMH-019 Corynactis 648 Vancouver Aquarium californica KHBC154-13 BIOUG-KMH-020 Corynactis 648 Vancouver Aquarium californica KHBC155-13 BIOUG-KMH-021 Corynactis 648 Vancouver Aquarium californica KHBC158-13 BIOUG-KMH-024 Corynactis 648 Vancouver Aquarium californica KHBC256-13 BIOUG-KMH122 Corynactis 648 Shaw Ocean Discovery Center californica KHBC257-13 BIOUG-KMH123 Corynactis 648 Shaw Ocean Discovery Center californica AAJ0939 KBCSM702-14 OCN-001-02 Anthozoa 643 13-May-2013 Vancouver Island 48.3104 -126.054

KBCSM703-14 OCN-001-03 Anthozoa 648 13-May-2013 Vancouver Island 48.3104 -126.054 KHMS063-14 OCN-001 Anthozoa 625 13-May-2013 Vancouver Island 48.3104 -126.054 AAJ8124 KHA505-14 MLI-051 Actiniaria sp. 598 27-Aug-2013 Gulf of St. Lawrence 49.892 -61.212

KHA689-14 PS Anemone1 02 Actiniaria sp. 650 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 KHA690-14 PS Anemone1 03 Actiniaria sp. 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 KHA691-14 PS Anemone1 04 Actiniaria sp. 650 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 ARCMI569-14 BIOUG14664-A01 Actiniidae 604 09-Sep-2014 Southern Alutasivik Island, Newfoundland 56.767 -61.33 ARCMI570-14 BIOUG14664-A02 Actiniidae 651 09-Sep-2014 Southern Alutasivik Island, Newfoundland 56.767 -61.33 ARCMI571-14 BIOUG14664-A03 Actiniidae 621 09-Sep-2014 Southern Alutasivik Island, Newfoundland 56.767 -61.33 ARCMI572-14 BIOUG14664-A04 Actiniidae 608 08-Sep-2014 Trouttrap Fjord, Labrador 59.294 -63.527 ARCMI611-14 BIOUG14664-D07 Actiniidae 651 02-Sep-2014 Qikiqtarjuaq Bay, Nunavut 67.554 -64.048 ARCMI612-14 BIOUG14664-D08 Actiniidae 651 11-Sep-2014 Makkovik, Labrador 55.085 -59.171 KHA688-14 PS Anemone1 01 Actiniidae 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8974 KHA772-14 PS Anemone 2 02 Actiniidae sp. 651 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.1 -52.8963 KHA551-14 SABS-015 Actinostola sp. 648 12-Jul-2013 Nova Scotia 42.571 -64.726 KBCSM337-14 RICK-0056 Anthozoa 649 04-Jun-2013 Hecate Strait, British Columbia 54.3072 -131.103 KBCSM342-14 RICK-0060 Anthozoa 649 04-Jun-2013 Hecate Strait, British Columbia 54.4774 -131.091 KBCSM343-14 RICK-0061 Anthozoa 649 04-Jun-2013 Hecate Strait, British Columbia 54.4774 -131.091 KBCSM344-14 RICK-0062 Anthozoa 649 04-Jun-2013 Hecate Strait, British Columbia 54.4774 -131.091 KBCSM451-14 RICK-1068 Anthozoa 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM452-14 RICK-1069 Anthozoa 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173

118

KBCSM455-14 RICK-1072 Anthozoa 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KHA124-14 DFO-MONC-016 Anthozoa 648 04-Sep-2013 Gulf of the St. Lawrence 46.6572 -61.4559 KHA192-14 DFO-MONC-084 Anthozoa 597 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA308-14 KHM-S13-0018 Anthozoa 651 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 KHA422-14 KHM-S13-0058 Anthozoa 651 14-Aug-2013 St. Andrews, New Brunswick KHMS047-14 L#12STAN006-03 Anthozoa 648 06-Aug-2012 St. Andrews, New Brunswick 47.7477 -64.7084 KHBC209-13 BIOUG-KMH-075 Anthozoa sp. 648 Vancouver Aquarium KHBC211-13 BIOUG-KMH-077 Anthozoa sp. 648 Vancouver Aquarium KHBC212-13 BIOUG-KMH-078 Anthozoa sp. 648 Vancouver Aquarium KHBC215-13 BIOUG-KMH-081 Anthozoa sp. 648 Vancouver Aquarium KHBC222-13 BIOUG-KMH-088 Anthozoa sp. 543 Vancouver Aquarium KHBC139-13 BIOUG-KMH-005 Cribnopsis fernaldi 645 Vancouver Aquarium KHBC140-13 BIOUG-KMH-006 Cribnopsis fernaldi 645 Vancouver Aquarium KHBC141-13 BIOUG-KMH-007 Cribnopsis fernaldi 645 Vancouver Aquarium KHBC142-13 BIOUG-KMH-008 Cribnopsis fernaldi 645 Vancouver Aquarium KHBC221-13 BIOUG-KMH-087 Cribnopsis fernaldi 648 Vancouver Aquarium KHBC281-13 BIOUG-KMH147 Cribnopsis fernaldi 645 Shaw Ocean Discovery Center KHBC282-13 BIOUG-KMH148 Cribnopsis fernaldi 645 Shaw Ocean Discovery Center KHBC283-13 BIOUG-KMH149 Cribnopsis fernaldi 645 Shaw Ocean Discovery Center KHBC284-13 BIOUG-KMH150 Cribnopsis fernaldi 642 Shaw Ocean Discovery Center KHBC285-13 BIOUG-KMH151 Cribnopsis fernaldi 645 Shaw Ocean Discovery Center KHA114-14 DFO-MONC-006 Stomphia coccinea 604 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 KHA635-14 SABS-099 Stomphia coccinea 648 20-Jul-2013 Nova Scotia 44.481 -59.01 CCSMA111-08 06-PROBE-03491 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA115-08 06-PROBE-03495 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA123-08 06-PROBE-03503 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA124-08 06-PROBE-03504 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA125-08 06-PROBE-03505 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA145-08 07PROBE-04240 Urticina 658 09-Jul-2007 Churchill, Manitoba 58.74 -93.82 CCSMA153-08 08PROBE-1088 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA154-08 08PROBE-1089 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.759 -94.323 CCSMA158-08 08PROBE-1093 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA159-08 08PROBE-1094 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA162-08 08PROBE-1097 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA163-08 08PROBE-1098 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755

119

CCSMA165-08 08PROBE-1100 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 CCSMA166-08 08PROBE-1101 Urticina 658 15-Jul-2008 Churchill, Manitoba 58.848 -93.755 KBCSM031-14 KHBC-S13-0126 Urticina coriacea 645 22-Jun-2013 Gulf Islands, British Columbia 48.7668 -123.368 KBCSM719-14 KHBC-S13-0126-02 Urticina coriacea 645 22-Jun-2013 Gulf of Islands, British Columbia 48.7668 -123.368 KHBC108-13 RBCM 011-00239- Urticina coriacea 645 19-Jun-2011 Hunter Island, British Columbia 51.9286 -128.175 007 KHBC109-13 RBCM 011-00230- Urticina coriacea 645 17-Jun-2011 Athlone Island, British Columbia 52.1813 -128.484 020 KBCSM029-14 KHBC-S13-0142 Urticina crassicornis 645 22-Jun-2013 Gulf Islands, British Columbia 49.4677 -123.398 KHBC111-13 RBCM 011-00243- Urticina crassicornis 654 20-Jun-2011 Hecate Island, British Columbia 51.6653 -128.079 007 KHBC112-13 RBCM 011-00244- Urticina crassicornis 615 20-Jun-2011 Calvert Island, British Columbia 51.6452 -128.087 009 KHBC159-13 BIOUG-KMH-025 Urticina crassicornis 645 Vancouver Aquarium KHBC200-13 BIOUG-KMH-066 Urticina crassicornis 645 Vancouver Aquarium KHBC223-13 BIOUG-KMH-089 Urticina crassicornis 642 Shaw Ocean Discovery Center KHBC224-13 BIOUG-KMH-090 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC225-13 BIOUG-KMH-091 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC226-13 BIOUG-KMH-092 Urticina crassicornis 642 Shaw Ocean Discovery Center KHBC227-13 BIOUG-KMH-093 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC228-13 BIOUG-KMH-094 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC229-13 BIOUG-KMH-095 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC240-13 BIOUG-KMH106 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC241-13 BIOUG-KMH107 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC242-13 BIOUG-KMH108 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC243-13 BIOUG-KMH109 Urticina crassicornis 648 Shaw Ocean Discovery Center KHBC244-13 BIOUG-KMH110 Urticina crassicornis 645 Shaw Ocean Discovery Center KHBC279-13 BIOUG-KMH145 Urticina crassicornis 645 Shaw Ocean Discovery Center KHA084-14 PA-II-Rouge-01 Urticina felina 645 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA085-14 PA-II-Rouge-02 Urticina felina 642 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA087-14 PA-II-Rouge-04 Urticina felina 645 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA130-14 DFO-MONC-022 Urticina felina 645 04-Sep-2013 Gulf of the St. Lawrence 46.1497 -61.953 KHA143-14 DFO-MONC-035 Urticina felina 658 04-Sep-2013 Gulf of the St. Lawrence 48.038 -64.8864 KHA153-14 DFO-MONC-045 Urticina felina 645 04-Sep-2013 Gulf of the St. Lawrence 46.8642 -64.4964 KHA157-14 DFO-MONC-049 Urticina felina 645 04-Sep-2013 Gulf of the St. Lawrence 47.5156 -64.2546 KHA162-14 DFO-MONC-054 Urticina felina 645 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA171-14 DFO-MONC-063 Urticina felina 613 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736

120

KHA245-14 KHM-S13-0087 Urticina felina 597 31-Aug-2013 Les Escoumins, Quebec 48.3191 -69.4121 KHA591-14 SABS-055 Urticina felina 645 27-Jul-2013 Nova Scotia 44.383 -58.188 KHA757-14 PS Urticina felina Urticina felina 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 01 KHA759-14 PS Urticina felina Urticina felina 651 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 03 KHMS057-14 Hagan-03 Urticina felina 547 St. Andrews, New Brunswick 47.7477 -64.7084 KHMS059-14 Hagan-05 Urticina felina 645 St. Andrews, New Brunswick 47.7477 -64.7084 KHBC189-13 BIOUG-KMH-055 Urticina lofotensis 645 Vancouver Aquarium KHBC190-13 BIOUG-KMH-056 Urticina lofotensis 645 Vancouver Aquarium KHBC288-13 BIOUG-KMH154 Urticina lofotensis 645 Shaw Ocean Discovery Center KHBC160-13 BIOUG-KMH-026 Urticina piscovora 645 Vancouver Aquarium KHBC161-13 BIOUG-KMH-027 Urticina piscovora 645 Vancouver Aquarium KHBC162-13 BIOUG-KMH-028 Urticina piscovora 645 Vancouver Aquarium KHBC163-13 BIOUG-KMH-029 Urticina piscovora 645 Vancouver Aquarium KHBC236-13 BIOUG-KMH102 Urticina piscovora 645 Shaw Ocean Discovery Center KHBC237-13 BIOUG-KMH103 Urticina piscovora 645 Shaw Ocean Discovery Center KHBC238-13 BIOUG-KMH104 Urticina piscovora 645 Shaw Ocean Discovery Center KHBC239-13 BIOUG-KMH105 Urticina piscovora 645 Shaw Ocean Discovery Center KHBC278-13 BIOUG-KMH144 Urticina piscovora 648 Shaw Ocean Discovery Center KBCSM030-14 KHBC-S13-0137 Urticina sp. 645 22-Jun-2013 Gulf Islands, British Columbia 49.4677 -123.398 KBCSM327-14 RICK-0051 Urticina sp. 645 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM335-14 KHBC-S13-0052 Urticina sp. 645 03-Jun-2013 Hecate Strait, British Columbia 54.2007 -131.069 KBCSM432-14 RICK-1042 Urticina sp. 645 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM708-14 KHBC-S13-0052-02 Urticina sp. 645 03-Jun-2013 Hecate Strait, British Columbia 54.2007 -131.069 AAK0118 KBCSM023-14 KHBC-S13-0103 Balanophyllia 570 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 elegans KBCSM034-14 KHBC-S13-0110 Balanophyllia 648 22-Jun-2013 Gulf Islands, British Columbia 48.7362 -123.366 elegans KBCSM643-14 KHBC-S13-0103-02 Balanophyllia 570 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 elegans KBCSM644-14 KHBC-S13-0103-03 Balanophyllia 573 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 elegans KBCSM645-14 KHBC-S13-0103-04 Balanophyllia 582 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 elegans KBCSM646-14 KHBC-S13-0103-05 Balanophyllia 588 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 elegans KHBC166-13 BIOUG-KMH-032 Balanophyllia 577 Vancouver Aquarium elegans KHBC299-13 BIOUG-KMH223 Balanophyllia 648 17-Jan-2013 British Columbia elegans

121

KHMS067-14 BMSC-0004 Balanophyllia 633 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegans KHMS071-14 BMSC-0008 Balanophyllia 648 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegans AAK0746 KHBC191-13 BIOUG-KMH-057 Anthopleura 645 Vancouver Aquarium artemisia KHBC192-13 BIOUG-KMH-058 Anthopleura 645 Vancouver Aquarium artemisia CQCS068-10 BCnid2010-049 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS069-10 BCnid2010-050 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS070-10 BCnid2010-051 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS072-10 BCnid2010-053 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS073-10 BCnid2010-054 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS074-10 BCnid2010-055 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima CQCS075-10 BCnid2010-056 Anthopleura 658 04-Jul-2010 Pacific Rim, British Columbia 48.981 -125.612 elegantissima KBCSM597-14 KHBC-S13-0091-02 Anthopleura 642 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM598-14 KHBC-S13-0092-01 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM599-14 KHBC-S13-0092-02 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM600-14 KHBC-S13-0092-03 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM601-14 KHBC-S13-0093-01 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM602-14 KHBC-S13-0093-02 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM603-14 KHBC-S13-0093-03 Anthopleura 648 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM604-14 KHBC-S13-0093-04 Anthopleura 645 16-Jun-2013 Victoria, British Columbia 48.4083 -123.37 elegantissima KBCSM638-14 KHBC-S13-0102-02 Anthopleura 645 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 elegantissima KBCSM640-14 KHBC-S13-0102-04 Anthopleura 645 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 elegantissima KBCSM641-14 KHBC-S13-0102-05 Anthopleura 645 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 elegantissima KBCSM642-14 KHBC-S13-0102-06 Anthopleura 645 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 elegantissima KBCSM705-14 BMSC-0011 Anthopleura 648 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegantissima KBCSM706-14 BMSC-0012 Anthopleura 645 20-Dec-2013 Vancouver Island 48.9295 -125.543

122

elegantissima KBCSM707-14 BMSC-0013 Anthopleura 645 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegantissima KHBC146-13 BIOUG-KMH-012 Anthopleura 564 Vancouver Aquarium elegantissima KHBC147-13 BIOUG-KMH-013 Anthopleura 645 Vancouver Aquarium elegantissima KHBC148-13 BIOUG-KMH-014 Anthopleura 648 Vancouver Aquarium elegantissima KHBC267-13 BIOUG-KMH133 Anthopleura 645 Shaw Ocean Discovery Center elegantissima KHMS072-14 BMSC-0009 Anthopleura 645 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegantissima KHMS073-14 BMSC-0010 Anthopleura 645 20-Dec-2013 Vancouver Island 48.9295 -125.543 elegantissima KHBC149-13 BIOUG-KMH-015 Anthopleura 645 Vancouver Aquarium xanthogrammica KHBC150-13 BIOUG-KMH-016 Anthopleura 645 Vancouver Aquarium xanthogrammica KHBC151-13 BIOUG-KMH-017 Anthopleura 645 Vancouver Aquarium xanthogrammica KHBC152-13 BIOUG-KMH-018 Anthopleura 645 Vancouver Aquarium xanthogrammica KHBC230-13 BIOUG-KMH096 Anthopleura 642 Shaw Ocean Discovery Center xanthogrammica KHBC231-13 BIOUG-KMH097 Anthopleura 603 Shaw Ocean Discovery Center xanthogrammica KHBC232-13 BIOUG-KMH098 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica KHBC233-13 BIOUG-KMH099 Anthopleura 639 Shaw Ocean Discovery Center xanthogrammica KHBC234-13 BIOUG-KMH100 Anthopleura 639 Shaw Ocean Discovery Center xanthogrammica KHBC235-13 BIOUG-KMH101 Anthopleura 654 Shaw Ocean Discovery Center xanthogrammica KHBC245-13 BIOUG-KMH111 Anthopleura 639 Shaw Ocean Discovery Center xanthogrammica KHBC246-13 BIOUG-KMH112 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica KHBC247-13 BIOUG-KMH113 Anthopleura 648 Shaw Ocean Discovery Center xanthogrammica KHBC248-13 BIOUG-KMH114 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica KHBC249-13 BIOUG-KMH115 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica KHBC250-13 BIOUG-KMH116 Anthopleura 615 Shaw Ocean Discovery Center xanthogrammica KHBC251-13 BIOUG-KMH117 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica

123

KHBC252-13 BIOUG-KMH118 Anthopleura 648 Shaw Ocean Discovery Center xanthogrammica KHBC253-13 BIOUG-KMH119 Anthopleura 645 Shaw Ocean Discovery Center xanthogrammica AAP1185 KBCSM259-14 KHBC-S13-0023 Ptilosarcus gurneyi 648 01-Jun-2013 Hecate Strait, British Columbia 53.0056 -130.885

KBCSM262-14 RICK-0010 Ptilosarcus gurneyi 649 01-Jun-2013 Hecate Strait, British Columbia 53.0689 -131.027 KBCSM290-14 RICK-0019 Ptilosarcus gurneyi 649 02-Jun-2013 Hecate Strait, British Columbia 53.4427 -131.115 KBCSM291-14 RICK-0020 Ptilosarcus gurneyi 649 02-Jun-2013 Hecate Strait, British Columbia 53.4427 -131.115 KBCSM292-14 RICK-0021 Ptilosarcus gurneyi 649 02-Jun-2013 Hecate Strait, British Columbia 53.4427 -131.115 KBCSM325-14 RICK-0049 Ptilosarcus gurneyi 649 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM326-14 RICK-0050 Ptilosarcus gurneyi 649 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM464-14 RICK-1064 Ptilosarcus gurneyi 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM480-14 RICK-1084 Ptilosarcus gurneyi 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM481-14 RICK-1085 Ptilosarcus gurneyi 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM508-14 RICK-2012 Ptilosarcus gurneyi 648 09-Jun-2013 Hecate Strait, British Columbia 53.6255 -131.24 KHBC193-13 BIOUG-KMH-059 Ptilosarcus gurneyi 621 Vancouver Aquarium KHBC198-13 BIOUG-KMH-064 Ptilosarcus gurneyi 648 Vancouver Aquarium AAP1189 KHA137-14 DFO-MONC-029 Anthozoa 601 04-Sep-2013 Gulf of St. Lawrence 46.8642 -63.3318

ARCMI585-14 BIOUG14664-B05 Gersemia rubiformis 648 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 ARCMI586-14 BIOUG14664-B06 Gersemia rubiformis 648 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 ARCMI587-14 BIOUG14664-B07 Gersemia rubiformis 604 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 ARCMI588-14 BIOUG14664-B08 Gersemia rubiformis 608 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 ARCMI589-14 BIOUG14664-B09 Gersemia rubiformis 604 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 CCSMA040-07 07PROBE-05397 Gersemia rubiformis 658 19-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA041-07 07PROBE-05398 Gersemia rubiformis 658 19-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA102-08 06-PROBE-03482 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA103-08 06-PROBE-03483 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA104-08 06-PROBE-03484 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA105-08 06-PROBE-03485 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA107-08 06-PROBE-03487 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA108-08 06-PROBE-03488 Gersemia rubiformis 658 24-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA110-08 06-PROBE-03490 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA116-08 06-PROBE-03496 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA117-08 06-PROBE-03497 Gersemia rubiformis 567 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA118-08 06-PROBE-03498 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA119-08 06-PROBE-03499 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243

124

CCSMA130-08 06-PROBE-03510 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA131-08 06-PROBE-03511 Gersemia rubiformis 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA135-08 06-PROBE-03515 Gersemia rubiformis 658 23-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA141-08 07PROBE-04236 Gersemia rubiformis 658 19-Jul-2007 Churchill, Manitoba 58.805 -94.214 CCSMA142-08 07PROBE-04237 Gersemia rubiformis 658 19-Jul-2007 Churchill, Manitoba 58.805 -94.214 KHA002-14 PA-II-Cor_a-01 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA003-14 PA-II-Cor_a-02 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA005-14 PA-II-Cor_a-04 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA006-14 PA-II-Cor_a-05 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA007-14 PA-II-Cor_a-06 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA008-14 PA-II-Cor_a-07 Gersemia rubiformis 644 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA009-14 PA-II-Cor_a-08 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA010-14 PA-II-Cor_a-09 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA011-14 PA-II-Cor_a-10 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA012-14 PA-II-Cor_a-11 Gersemia rubiformis 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA118-14 DFO-MONC-010 Gersemia rubiformis 648 04-Sep-2013 Gulf of St. Lawrence 46.9562 -60.8681 KHA123-14 DFO-MONC-015 Gersemia rubiformis 648 04-Sep-2013 Gulf of St. Lawrence 46.8248 -62.2524 KHA125-14 DFO-MONC-017 Gersemia rubiformis 577 04-Sep-2013 Gulf of St. Lawrence 46.6572 -61.4559 KHA159-14 DFO-MONC-051 Gersemia rubiformis 601 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA161-14 DFO-MONC-053 Gersemia rubiformis 626 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA187-14 DFO-MONC-079 Gersemia rubiformis 558 04-Sep-2013 Gulf of St. Lawrence 48.664 -63.6422 KHA188-14 DFO-MONC-080 Gersemia rubiformis 648 04-Sep-2013 Gulf of St. Lawrence 48.664 -63.6422 KHA207-14 DFO-MONC-099 Gersemia rubiformis 563 04-Sep-2013 Gulf of St. Lawrence 48.0141 -63.1698 KHA239-14 KHM-S13-0084 Gersemia rubiformis 603 31-Aug-2013 Les Escoumins, Quebec 48.3191 -69.4121 KHA624-14 SABS-088 Gersemia rubiformis 648 20-Jul-2013 Nova Scotia 44.481 -59.01 KHA625-14 SABS-089 Gersemia rubiformis 648 20-Jul-2013 Nova Scotia 44.481 -59.01 KHA626-14 SABS-090 Gersemia rubiformis 648 20-Jul-2013 Nova Scotia 44.404 -58.986 KHA675-14 DFO-MONC-010- Gersemia rubiformis 634 04-Sep-2013 Gulf of St. Lawrence 46.9562 -60.8681 02 KHA676-14 DFO-MONC-010- Gersemia rubiformis 648 04-Sep-2013 Gulf of St. Lawrence 46.9562 -60.8681 03 KHBC293-13 BIOUG-KMH217 Gersemia rubiformis 648 16-Jan-2013 British Columbia KHBC303-13 BIOUG-KMH227 Gersemia rubiformis 647 17-Jan-2013 British Columbia KHBC304-13 BIOUG-KMH228 Gersemia rubiformis 648 17-Jan-2013 British Columbia AAP1191 ARCMI592-14 BIOUG14664-B12 Actinauge 616 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 AAP1192 ARCMI610-14 BIOUG14664-D06 Actiniaria 648 03-Sep-2014 Durban Harbour, Nunavut 67.072 -62.139

125

KHA491-14 MLI-037 Actinostola callosa 601 27-Aug-2013 Gulf of St. Lawrence 49.62 -62.136 KHA163-14 DFO-MONC-055 Actinostola sp. 645 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA195-14 DFO-MONC-087 Actinostola sp. 604 04-Sep-2013 Gulf of St. Lawrence 48.874 -63.6312 KHA215-14 DFO-MONC-107 Actinostola sp. 605 04-Sep-2013 Gulf of St. Lawrence 48.5187 -62.1425 KHA573-14 SABS-037 Actinostola sp. 648 05-Jul-2013 Nova Scotia 42.558 -66.621 KHA574-14 SABS-038 Actinostola sp. 648 07-Jul-2013 Nova Scotia 42.326 -67.263 KHA575-14 SABS-039 Actinostola sp. 648 07-Jul-2013 Nova Scotia 42.326 -67.263 KHA578-14 SABS-042 Actinostola sp. 648 12-Jul-2013 Nova Scotia 42.706 -64.14 KHA598-14 SABS-062 Actinostola sp. 658 30-Jul-2013 Nova Scotia 46.473 -59.137 KBCSM240-14 KHBC-S13-0012 Anthozoa 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 KHA120-14 DFO-MONC-012 Anthozoa 605 04-Sep-2013 Gulf of St. Lawrence 46.8248 -62.2524 KHA141-14 DFO-MONC-033 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 46.8642 -63.3318 KHA180-14 DFO-MONC-072 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA203-14 DFO-MONC-095 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 48.5187 -62.1425 KHA217-14 DFO-MONC-109 Anthozoa 658 04-Sep-2013 Gulf of St. Lawrence 48.0692 -61.8679 KHBC206-13 BIOUG-KMH-072 Anthozoa sp. 648 Vancouver Aquarium KHA173-14 DFO-MONC-065 Bolocera sp. 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA175-14 DFO-MONC-067 Bolocera sp. 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA182-14 DFO-MONC-074 Bolocera sp. 612 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 AAW0534 KHBC045-13 RBCM 010-00193- Anthomastus ritteri 648 15-Oct-2006 Queen Charlotte Sound, British Columbia 51.2 -130.045 006 KHBC041-13 RBCM 010-00304- Anthomastus sp. 648 04-Sep-2002 Haida Gwaii, British Columbia 53.7038 -133.416 003 KHBC043-13 RBCM 010-00281- Anthomastus sp. 603 12-Apr-2003 Brooks peninsula, Vancouver Island 50.2234 -128.589 001 KHBC044-13 RBCM 010-00181- Anthomastus sp. 648 07-Sep-2004 Moresby Island, British Columbia 52.7524 -132.433 007 ABA2837 KHA631-14 SABS-095 Actinauge sp. 642 21-Jul-2013 Nova Scotia 44.645 -59.707 ABV1102 KHA458-14 MLI-004 Stephanauge nexilis 616 30-Aug-2013 Gulf of St. Lawrence 48.98 -63.398

KHA459-14 MLI-005 Stephanauge nexilis 648 31-Aug-2013 Gulf of St. Lawrence 48.762 -63.044 KHA462-14 MLI-008 Stephanauge nexilis 549 31-Aug-2013 Gulf of St. Lawrence 48.762 -63.044 KHA495-14 MLI-041 Stephanauge nexilis 570 31-Aug-2013 Gulf of St. Lawrence 48.791 -63.26 KHBC127-13 RBCM 010-00180- Stephanauge sp. 614 23-Oct-2005 British Columbia 48.3625 -126.458 001 ABX8941 KHA506-14 MLI-052 Anthoptilum 648 12-Aug-2012 Gulf of St. Lawrence 48.365 -59.972 grandiflorum KHA478-14 MLI-024 Halipteris 603 31-Aug-2013 Gulf of St. Lawrence 48.762 -63.044 finmarchica KHA480-14 MLI-026 Halipteris 648 30-Aug-2013 Gulf of St. Lawrence 48.98 -63.398

126

finmarchica KHBC073-13 RBCM 010-00230- Halipteris sp. 648 08-Sep-2004 Moresby Island, British Columbia 53.1198 -132.792 002 KBCSM341-14 KHBC-S13-0055 Halipteris 648 04-Jun-2013 Hecate Strait, British Columbia 54.4921 -131.035 willemoesi KBCSM356-14 RICK-0072 Halipteris 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 willemoesi KBCSM362-14 KHBC-S13-0063 Halipteris 647 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 willemoesi KBCSM377-14 RICK-0087 Halipteris 649 05-Jun-2013 Hecate Strait, British Columbia 54.1898 -132.307 willemoesi KBCSM382-14 RICK-0090 Halipteris 649 06-Jun-2013 Hecate Strait, British Columbia 54.1658 -132.488 willemoesi KBCSM410-14 RICK-1021 Halipteris 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 willemoesi KHBC089-13 RBCM 011-00264- Halipteris 569 08-May-2011 Vancouver Island 49.283 -126.897 001 willemoesi ABY9710 KHBC201-13 BIOUG-KMH-067 Epizoanthus 648 Vancouver Aquarium scotinus ACB4625 KHBC196-13 BIOUG-KMH-062 Clavularia sp. 603 Vancouver Aquarium ACB5982 KHBC081-13 RBCM 010-00287- Anthozoa 648 17-Oct-2005 Ucluelet, British Columbia 48.7013 -126.944 001 ACE4272 KHBC314-13 BIOUG-KMH238 Anthozoa sp. 648 20-Jan-2013 British Columbia KHBC317-14 BIOUG-KMH237- Anthozoa sp. 648 20-Jan-2013 British Columbia 02 KHBC296-13 BIOUG-KMH220 Epiactis prolifera 648 17-Jan-2013 British Columbia KHBC318-14 BIOUG-KMH220- Epiactis prolifera 648 17-Jan-2013 British Columbia 02 KHBC290-13 BIOUG-KMH214 Epiactis sp. 648 16-Jan-2013 British Columbia KHBC297-13 BIOUG-KMH221 Epiactis sp. 589 17-Jan-2013 British Columbia KHBC298-13 BIOUG-KMH222 Epiactis sp. 647 17-Jan-2013 British Columbia KHBC310-13 BIOUG-KMH234 Epiactis sp. 642 20-Jan-2013 British Columbia KHBC311-13 BIOUG-KMH235 Epiactis sp. 648 20-Jan-2013 British Columbia KHBC312-13 BIOUG-KMH236 Epiactis sp. 645 20-Jan-2013 British Columbia KHBC319-14 BIOUG-KMH213- Epiactis sp. 648 16-Jan-2013 British Columbia 03 ACH6471 KHBC195-13 BIOUG-KMH-061 Calcigorgia 648 Vancouver Aquarium spiculifera ACH6793 KHBC094-13 RBCM 001-00299- Funiculina armata 648 25-Aug-2001 Barkley Canyon, British Columbia 48.368 -126.217 019 ACH7301 KBCSM531-14 KHBC-S13-0089 Psammogorgia 633 10-Jun-2013 Hecate Strait, British Columbia 53.0428 -130.131 torreyi KBCSM630-14 KHBC-S13-0089-02 Psammogorgia 648 10-Jun-2013 Hecate Strait, British Columbia 53.0428 -130.131 torreyi KBCSM631-14 KHBC-S13-0089-03 Psammogorgia 648 10-Jun-2013 Hecate Strait, British Columbia 53.0428 -130.131

127

torreyi KBCSM632-14 KHBC-S13-0089-04 Psammogorgia 647 10-Jun-2013 Hecate Strait, British Columbia 53.0428 -130.131 torreyi KHBC064-13 RBCM 010-00222- Swiftia sp. 596 04-Sep-2004 Queen Charlotte Sound, British Columbia 51.2083 -130.059 002 KHBC065-13 RBCM 010-00223- Swiftia sp. 609 04-Sep-2004 Queen Charlotte Sound, British Columbia 51.187 -130.137 003 ACI0005 KBCSM658-14 KHBC-S13-0000-02 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM659-14 KHBC-S13-0000-03 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM661-14 KHBC-S13-0000-05 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM663-14 KHBC-S13-0000-07 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM664-14 KHBC-S13-0000-08 Paragorgia arborea 634 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM665-14 KHBC-S13-0000-09 Paragorgia arborea 632 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM666-14 KHBC-S13-0000-10 Paragorgia arborea 637 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM667-14 KHBC-S13-0000-11 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM668-14 KHBC-S13-0000-12 Paragorgia arborea 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KHBC050-13 RBCM 011-00160- Paragorgia arborea 648 23-Apr-2009 Bowie Seamount, British Columbia 53.3067 -135.578 001 KHBC294-13 BIOUG-KMH218 Paragorgia arborea 647 17-Jan-2013 British Columbia KHBC321-14 BIOUG-KMH218- Paragorgia arborea 596 17-Jan-2013 British Columbia 02 KHBC060-13 RBCM 010-00260- Paragorgia pacifica 648 03-Sep-2001 British Columbia 48.3325 -126.396 009 KHBC046-13 RBCM 010-00225- Paragorgia sp. 648 05-Sep-2004 Anthony Island, British Columbia 52.0274 -131.594 009 KHBC047-13 RBCM 010-00076- Paragorgia sp. 648 20-Jun-2009 British Columbia 002 KHBC048-13 RBCM 010-00281- Paragorgia sp. 648 12-Apr-2003 Brooks Peninsula, British Columbia 50.2234 -128.589 003 KHBC049-13 RBCM 011-00067- Paragorgia sp. 604 04-Apr-2004 Bowie Seamount, British Columbia 53.33 -135.66 002 KHBC054-13 RBCM 010-00290- Paragorgia yutlinux 648 15-Oct-2006 Queen Charlotte Sound, British Columbia 51.1861 -130.135 005 ACI1060 KBCSM610-14 KHBC-S13-0069 Primnoa sp. 648 Hecate Strait, British Columbia

KBCSM611-14 KHBC-S13-0069-02 Primnoa sp. 648 Hecate Strait, British Columbia KBCSM612-14 KHBC-S13-0069-03 Primnoa sp. 648 Hecate Strait, British Columbia KBCSM621-14 KHBC-S13-0082-02 Primnoa sp. 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM622-14 KHBC-S13-0082-03 Primnoa sp. 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM623-14 KHBC-S13-0082-04 Primnoa sp. 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM669-14 KHBC-S13-0013-02 Primnoa sp. 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 KBCSM670-14 KHBC-S13-0013-03 Primnoa sp. 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28

128

KBCSM671-14 KHBC-S13-0013-04 Primnoa sp. 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 KBCSM672-14 KHBC-S13-0013-05 Primnoa sp. 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 KBCSM690-14 KHBC-S13-0060-02 Primnoa sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM691-14 KHBC-S13-0060-03 Primnoa sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM231-14 RICK-2029 Primnoidae 648 30-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM233-14 RICK-2031 Primnoidae 647 30-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM241-14 KHBC-S13-0013 Primnoidae 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 KBCSM361-14 KHBC-S13-0060 Primnoidae 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM366-14 RICK-0076 Primnoidae 649 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM367-14 RICK-0077 Primnoidae 649 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM368-14 RICK-0078 Primnoidae 649 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM389-14 RICK-0094 Primnoidae 649 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.256 KBCSM390-14 RICK-0095 Primnoidae 649 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.256 KBCSM392-14 RICK-1002 Primnoidae 648 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.422 KBCSM393-14 RICK-1003 Primnoidae 648 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.422 KBCSM394-14 RICK-1004 Primnoidae 648 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.422 KBCSM524-14 KHBC-S13-0082 Primnoidae 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM525-14 RICK-2026 Primnoidae 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 KBCSM527-14 RICK-2028 Primnoidae 648 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 ACI2162 KHA482-14 MLI-028 Drifa glomerata 648 13-Aug-2013 Gulf of St. Lawrence 47.846 -59.769

KHBC037-13 RBCM 010-00233- Gersemia sp. 648 09-Sep-2004 Haida Gwaii, British Columbia 53.3856 -133.202 002 KHBC038-13 RBCM 010-00279- Gersemia sp. 648 12-Apr-2003 Brooks Peninsula, British Columbia 50.1731 -128.492 002 KHBC039-13 RBCM 010-00292- Gersemia sp. 643 18-Oct-2006 Moresby Island, British Columbia 51.8568 -131.309 002 KHBC040-13 RBCM 010-00223- Gersemia sp. 648 04-Sep-2004 Queen Charlotte Sound, British Columbia 51.187 -130.137 004 ACL7067 KHA522-14 MLI-068 Anthoptilum 648 14-Aug-2011 Gulf of St. Lawrence 48.25 -60.517 grandiflorum KHBC082-13 RBCM 010-00233- Ombellulidae sp. 648 09-Sep-2004 Graham Island, British Columbia 53.3856 -133.202 005 KHBC083-13 RBCM 011-00080- Umbellula cf. 648 12-Apr-2004 Bowie Seamount, British Columbia 53.3367 -135.588 001 lindahli KHBC084-13 RBCM 001-00298- Umbellula lindahli 648 25-Aug-2001 Barkley Canyon, British Columbia 48.3687 -126.183 051 KHBC076-13 RBCM 010-00271- Umbellula sp. 603 31-Aug-2001 Tofino, British Columbia 48.6959 -126.557 001 ACL7361 KHBC085-13 RBCM 009-00067- Balticina sp. 551 28-Jul-1999 Vancouver Island 48.9947 -126.888 003 KHBC086-13 RBCM 010-00239- Stylatula elongata 648 28-Aug-2004 British Columbia

129

001 ACM3142 KHA489-14 MLI-035 Pennatula grandis 629 25-Aug-2013 Gulf of St. Lawrence 49.91 -66.801

KHA515-14 MLI-061 Pennatula grandis 621 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA516-14 MLI-062 Pennatula grandis 648 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA517-14 MLI-063 Pennatula grandis 648 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA518-14 MLI-064 Pennatula grandis 648 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA519-14 MLI-065 Pennatula grandis 587 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA520-14 MLI-066 Pennatula grandis 643 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 ACM3244 KHA475-14 MLI-021 Pennatula aculeata 542 06-Aug-2013 Gulf of St. Lawrence 49.594 -60.097

KHA507-14 MLI-053 Pennatula aculeata 658 19-Aug-2012 Gulf of St. Lawrence 49.476 -66.32 KHA508-14 MLI-054 Pennatula aculeata 648 19-Aug-2012 Gulf of St. Lawrence 49.476 -66.32 KHA509-14 MLI-055 Pennatula aculeata 602 19-Aug-2012 Gulf of St. Lawrence 49.476 -66.32 KHA510-14 MLI-056 Pennatula aculeata 603 10-Aug-2013 Gulf of St. Lawrence 50.309 -58.06 KHA511-14 MLI-057 Pennatula aculeata 596 10-Aug-2013 Gulf of St. Lawrence 50.309 -58.06 KHA521-14 MLI-067 Pennatula aculeata 645 15-Aug-2011 Gulf of St. Lawrence 48.981 -63.369 KHA201-14 DFO-MONC-093 Pennatula sp. 648 04-Sep-2013 Gulf of St. Lawrence 48.874 -63.6312 KHBC088-13 RBCM 010-00280- Pennatula sp. 603 11-Apr-2003 Brooks Peninsula, British Columbia 50.2586 -128.441 001 ACM6770 KHA583-14 SABS-047 Stephanauge sp. 648 27-Jul-2013 Nova Scotia 44.31 -57.746 ACM7064 KHA576-14 SABS-040 Actinostola sp. 648 07-Jul-2013 Nova Scotia 42.326 -67.263 ACO2650 KHA692-14 PS Edwardsia Edwardsia elegans 650 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0998 -52.8968 elegans 01 KHA693-14 PS Edwardsia Edwardsia elegans 648 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0998 -52.8968 elegans 02 KHA694-14 PS Edwardsia Edwardsia elegans 647 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0998 -52.8968 elegans 03 KHA695-14 PS Edwardsia Edwardsia elegans 633 05-Jun-2013 Southern Avalon Peninsula, Newfoundland 47.0998 -52.8968 elegans 04 ACO8622 KHA144-14 DFO-MONC-036 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.3912 -64.7161

KHA379-14 HUNT-1052 Anthozoa 556 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA381-14 HUNT-1054 Anthozoa 556 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA386-14 HUNT-1059 Anthozoa 647 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA387-14 HUNT-1060 Anthozoa 651 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHBC262-13 BIOUG-KMH128 Anthozoa sp. 627 Shaw Ocean Discovery Center KHBC305-13 BIOUG-KMH229 Anthozoa sp. 648 20-Jan-2013 British Columbia KHBC315-13 BIOUG-KMH239 Anthozoa sp. 647 20-Jan-2013 British Columbia KHMS058-14 Hagan-04 Metridium 648 Bay of Fundy 47.7477 -64.7084 KHMS060-14 Hagan-06 Metridium 550 Bay of Fundy 47.7477 -64.7084

130

KBCSM032-14 KHBC-S13-0128 Metridium farcimen 648 22-Jun-2013 Gulf Islands, British Columbia 48.7362 -123.366 KBCSM243-14 RICK-0006 Metridium farcimen 649 31-May-2013 Hecate Strait, British Columbia 52.7128 -130.75 KBCSM244-14 RICK-0001 Metridium farcimen 646 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM245-14 RICK-0002 Metridium farcimen 649 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM246-14 RICK-0003 Metridium farcimen 649 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM247-14 RICK-0004 Metridium farcimen 644 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM248-14 RICK-0005 Metridium farcimen 595 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM249-14 KHBC-S13-0015 Metridium farcimen 648 31-May-2013 Hecate Strait, British Columbia 52.7616 -130.904 KBCSM255-14 RICK-0007 Metridium farcimen 649 31-May-2013 Hecate Strait, British Columbia 52.7718 -130.845 KBCSM257-14 RICK-0009 Metridium farcimen 649 31-May-2013 Hecate Strait, British Columbia 52.7718 -130.845 KBCSM263-14 RICK-0011 Metridium farcimen 649 01-Jun-2013 Hecate Strait, British Columbia 53.1226 -130.978 KBCSM264-14 RICK-0012 Metridium farcimen 649 01-Jun-2013 Hecate Strait, British Columbia 53.1226 -130.978 KBCSM265-14 RICK-0013 Metridium farcimen 649 01-Jun-2013 Hecate Strait, British Columbia 53.1226 -130.978 KBCSM289-14 RICK-0018 Metridium farcimen 649 02-Jun-2013 Hecate Strait, British Columbia 53.4427 -131.115 KBCSM293-14 KHBC-S13-0044 Metridium farcimen 648 02-Jun-2013 Hecate Strait, British Columbia 53.4848 -131.024 KBCSM302-14 RICK-0030 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 53.845 -130.999 KBCSM307-14 RICK-0034 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 53.9134 -131.053 KBCSM308-14 RICK-0035 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 53.9134 -131.053 KBCSM309-14 RICK-0036 Metridium farcimen 646 03-Jun-2013 Hecate Strait, British Columbia 53.9134 -131.053 KBCSM328-14 RICK-0052 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM330-14 RICK-0054 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM331-14 RICK-0055 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM448-14 RICK-1061 Metridium farcimen 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM449-14 RICK-1062 Metridium farcimen 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM450-14 RICK-1063 Metridium farcimen 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM475-14 RICK-1079 Metridium farcimen 648 08-Jun-2013 Hecate Strait, British Columbia 53.8772 -131.133 KBCSM477-14 RICK-1081 Metridium farcimen 648 08-Jun-2013 Hecate Strait, British Columbia 53.8772 -131.133 KBCSM479-14 RICK-1083 Metridium farcimen 648 09-Jun-2013 Hecate Strait, British Columbia 53.8772 -131.133 KBCSM492-14 RICK-1093 Metridium farcimen 648 09-Jun-2013 Hecate Strait, British Columbia 53.7726 -131.038 KBCSM493-14 RICK-1094 Metridium farcimen 648 09-Jun-2013 Hecate Strait, British Columbia 53.7726 -131.038 KBCSM494-14 RICK-1095 Metridium farcimen 605 09-Jun-2013 Hecate Strait, British Columbia 53.7726 -131.038 KBCSM521-14 RICK-2025 Metridium farcimen 648 09-Jun-2013 Hecate Strait, British Columbia 53.6099 -131.154 KBCSM530-14 RICK-2032 Metridium farcimen 648 10-Jun-2013 Hecate Strait, British Columbia 53.0428 -130.131 KBCSM734-14 KHBC-S13-0128-02 Metridium farcimen 629 22-Jun-2013 British Columbia 48.7362 -123.366 KHA133-14 DFO-MONC-025 Metridium farcimen 658 04-Sep-2013 Gulf of St. Lawrence 46.6572 -61.4559

131

KHA138-14 DFO-MONC-030 Metridium farcimen 648 04-Sep-2013 Gulf of St. Lawrence 46.5365 -63.3703 KHA139-14 DFO-MONC-031 Metridium farcimen 648 04-Sep-2013 Gulf of St. Lawrence 46.5365 -63.3703 KHA140-14 DFO-MONC-032 Metridium farcimen 658 04-Sep-2013 Gulf of St. Lawrence 46.5365 -63.3703 KHA238-14 KHM-S13-0083 Metridium farcimen 648 31-Aug-2013 Quebec 48.3191 -69.4121 KHBC135-13 BIOUG-KMH-001 Metridium farcimen 648 Vancouver Aquarium KHBC136-13 BIOUG-KMH-002 Metridium farcimen 648 Vancouver Aquarium KHBC137-13 BIOUG-KMH-003 Metridium farcimen 648 Vancouver Aquarium KHBC138-13 BIOUG-KMH-004 Metridium farcimen 648 Vancouver Aquarium KHBC259-13 BIOUG-KMH125 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC263-13 BIOUG-KMH129 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC264-13 BIOUG-KMH130 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC265-13 BIOUG-KMH131 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC266-13 BIOUG-KMH132 Metridium farcimen 646 Shaw Ocean Discovery Center KHBC271-13 BIOUG-KMH137 Metridium farcimen 627 Shaw Ocean Discovery Center KHBC272-13 BIOUG-KMH138 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC273-13 BIOUG-KMH139 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC274-13 BIOUG-KMH140 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC275-13 BIOUG-KMH141 Metridium farcimen 648 Shaw Ocean Discovery Center KHBC276-13 BIOUG-KMH142 Metridium farcimen 647 Shaw Ocean Discovery Center KHBC277-13 BIOUG-KMH143 Metridium farcimen 646 Shaw Ocean Discovery Center BIBOF005-10 SOP0005 Metridium senile 658 05-Oct-2009 St. Andrews, New Brunswick 45.162 -67.045 BIBOF045-10 SOP0045 Metridium senile 658 14-Oct-2009 St. Andrews, New Brunswick 45.162 -67.045 KHA019-14 PA-II-Plum_a-01 Metridium senile 646 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA020-14 PA-II-Plum_a-02 Metridium senile 615 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA049-14 PA-II-Plum_b-01 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA050-14 PA-II-Plum_b-02 Metridium senile 598 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA051-14 PA-II-Plum_b-03 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA061-14 PA-II-Plum_c-01 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA063-14 PA-II-Plum_c-03 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA064-14 PA-II-Plum_c-04 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA065-14 PA-II-Plum_c-05 Metridium senile 612 06-Aug-2013 Ile Bonaventure, Gulf of Lawrence 48.5076 -64.163 KHA088-14 PA-I-MS-01 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA089-14 PA-I-MS-02 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA090-14 PA-I-MS-03 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA091-14 PA-I-MS-04 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129

132

KHA378-14 HUNT-1051 Metridium senile 551 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA678-14 PS Metridium senile Metridium senile 648 10-Apr-2013 Conception Bay, Newfoundland 47.4414 -53.1567 01 KHA681-14 PS Metridium senile Metridium senile 651 10-Apr-2013 Conception Bay, Newfoundland 47.4414 -53.1567 04 KHBC258-13 BIOUG-KMH124 Metridium senile 648 Shaw Ocean Discovery Center KBCSM027-14 KHBC-S13-0127 Metridium sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KBCSM724-14 KHBC-S13-0127-06 Metridium sp. 592 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KBCSM731-14 KHBC-S13-0127-13 Metridium sp. 545 21-Jun-2013 Gulf, Islands, British Columbia 48.8037 -128.6 KBCSM732-14 KHBC-S13-0127-14 Metridium sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KBCSM733-14 KHBC-S13-0127-15 Metridium sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KHA300-14 HUNT-1001 Metridium sp. 582 05-Aug-2013 St. Andrews, New Brunswick 44.9639 -67.0083 KHA301-14 HUNT-1002 Metridium sp. 648 05-Aug-2013 St. Andrews, New Brunswick 44.9639 -67.0083 KHA326-14 KH-S13-0107 Metridium sp. 648 06-Aug-2013 St. Andrews, New Brunswick 45.0714 -67.0546 KHA377-14 HUNT-1050 Metridium sp. 575 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA389-14 HUNT-1062 Metridium sp. 575 08-Aug-2013 St. Andrews, 45.085 -67.0803 New Brunswick KHMS064-14 BMSC-0001 Metridium sp. 648 20-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KHMS065-14 BMSC-0002 Metridium sp. 658 20-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KHMS069-14 BMSC-0006 Metridium sp. 648 20-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KHMS070-14 BMSC-0007 Metridium sp. 648 20-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KBCSM607-14 KHBC-S13-0096 Stomphia sp. 648 30-May-2013 Gulf Islands, British Columbia 48.7815 -123.558 KHA376-14 HUNT-1049 Urticina crassicornis 647 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 ACO8748 KBCSM385-14 KHBC-S13-0034 Anthozoa 648 06-Jun-2013 Hecate Strait, British Columbia 54.2366 -132.313

KHA147-14 DFO-MONC-039 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5156 -64.2546 KHA150-14 DFO-MONC-042 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5156 -64.2546 KHA151-14 DFO-MONC-043 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5156 -64.2546 KHA156-14 DFO-MONC-048 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5156 -64.2546 KHA164-14 DFO-MONC-056 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA181-14 DFO-MONC-073 Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 KHA185-14 DFO-MONC-077 Anthozoa 615 04-Sep-2013 Gulf of St. Lawrence 48.0141 -63.1698 KHA219-14 DFO-MONC-111 Anthozoa 632 04-Sep-2013 Gulf of St. Lawrence 48.0692 -61.8679 KHA677-14 DFO-MONC-033- Anthozoa 648 04-Sep-2013 Gulf of St. Lawrence 46.8642 -63.3318 02 KHMS045-14 L#12STAN006-01 Anthozoa 648 06-Aug-2012 Bay of Fundy 47.7477 -64.7084 KHMS046-14 L#12STAN006-02 Anthozoa 648 06-Aug-2012 Bay of Fundy 47.7477 -64.7084 KHMS048-14 L#12STAN006-04 Anthozoa 643 06-Aug-2012 Bay of Fundy 47.7477 -64.7084

133

KBCSM627-14 KHBC-S13-0086 Anthozoa sp. 648 10-Jun-2013 Hecate Strait, British Columbia KHA632-14 SABS-096 Anthozoa sp. 648 17-Jul-2013 Nova Scotia 42.968 -61.958 KHBC214-13 BIOUG-KMH-080 Anthozoa sp. 648 Vancouver Aquarium ARCMI574-14 BIOUG14664-A06 Stomphia coccinea 611 03-Sep-2014 Durvan Harbour, Nunavut 67.072 -62.139 ARCMI602-14 BIOUG14664-C10 Stomphia coccinea 604 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 KHA128-14 DFO-MONC-020 Stomphia coccinea 648 04-Sep-2013 Gulf of St. Lawrence 46.6572 -61.4559 KHA135-14 DFO-MONC-027 Stomphia coccinea 647 04-Sep-2013 Gulf of St. Lawrence 46.6572 -61.4559 KHA208-14 DFO-MONC-100 Stomphia coccinea 648 04-Sep-2013 Gulf of St. Lawrence 48.0141 -63.1698 KHA588-14 SABS-052 Stomphia coccinea 648 27-Jul-2013 Nova Scotia 44.322 -58.095 KHA589-14 SABS-053 Stomphia coccinea 648 26-Jul-2013 Nova Scotia 45.074 -58.938 KHA633-14 SABS-097 Stomphia coccinea 648 20-Jul-2013 Nova Scotia 44.481 -59.01 KHA636-14 SABS-100 Stomphia coccinea 647 20-Jul-2013 Nova Scotia 44.481 -59.01 KHA637-14 SABS-101 Stomphia coccinea 648 21-Jul-2013 Nova Scotia 44.532 -59.874 KHA766-14 PS Stomphia Stomphia coccinea 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 coccinea 01 KHA767-14 PS Stomphia Stomphia coccinea 619 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 coccinea 02 KHA768-14 PS Stomphia Stomphia coccinea 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 coccinea 03 KHA769-14 PS Stomphia Stomphia coccinea 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 coccinea 04 KHA770-14 PS Stomphia Stomphia coccinea 650 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0999 -52.8961 coccinea 05 KBCSM465-14 KHBC-S13-0033 Stomphia didemon 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KHBC143-13 BIOUG-KMH-009 Stomphia didemon 648 Vancouver Aquarium KHBC144-13 BIOUG-KMH-010 Stomphia didemon 648 Vancouver Aquarium KHBC286-13 BIOUG-KMH152 Stomphia didemon 648 Shaw Ocean Discovery Center KHBC287-13 BIOUG-KMH153 Stomphia didemon 648 Shaw Ocean Discovery Center KBCSM306-14 KHBC-S13-0045 Stomphia sp. 648 03-Jun-2013 Hecate Strait, British Columbia 53.845 -130.999 KBCSM360-14 KHBC-S13-0059 Stomphia sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM373-14 KHBC-S13-0020 Stomphia sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.2788 -131.94 KBCSM395-14 KHBC-S13-0042 Stomphia sp. 648 06-Jun-2013 Hecate Striat, British Columbia 54.3288 -132.422 KBCSM673-14 KHBC-S13-0020-02 Stomphia sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.2788 -131.94 KHA284-14 KH-S13-0102 Stomphia sp. 648 05-Aug-2013 St. Andrews, New Brunswick 44.9931 -67.0373 KHA306-14 KHM-S13-0014 Stomphia sp. 651 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 CCSMA109-08 06-PROBE-03489 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA113-08 06-PROBE-03493 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA114-08 06-PROBE-03494 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243

134

CCSMA120-08 06-PROBE-03500 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA121-08 06-PROBE-03501 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA122-08 06-PROBE-03502 Urticina 658 25-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA132-08 06-PROBE-03512 Urticina 658 23-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA133-08 06-PROBE-03513 Urticina 658 23-Aug-2006 Churchill, Manitoba 58.79 -94.243 CCSMA134-08 06-PROBE-03514 Urticina 658 23-Aug-2006 Churchill, Manitoba 58.79 -94.243 KHA388-14 HUNT-1061 Urticina crassicornis 647 08-Aug-2013 St. Andrews, New brunswick 45.085 -67.0803 ACQ0119 KHBC070-13 RBCM 010-00298- Callogorgia sp. 583 02-Sep-2002 Langara Island, British Columbia 54.1713 -134.041 006 ACQ4502 KHMS055-14 Hagan-01 Pachycerianthus 648 Bay of Fundy 47.7477 -64.7084 fimbriatus ACR4682 ARCMI593-14 BIOUG14664-C01 Edwardsiidae 647 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 KHBC217-13 BIOUG-KMH-083 Anthozoa sp. 648 Vancouver Aquarium KHA113-14 DFO-MONC-005 Bolocera sp. 612 04-Sep-2013 Gulf of St. Lawrence 46.9562 -60.8681 KHA582-14 SABS-046 Bolocera sp. 646 12-Jul-2013 Nova Scotia 42.706 -64.14 KHA640-14 SABS-104 Bolocera sp. 648 18-Jul-2013 Nova Scotia 43.433 -61.346 KHA643-14 SABS-107 Bolocera sp. 648 17-Jul-2013 Nova Scotia 43.232 -60.934 KHA145-14 DFO-MONC-037 Gersemia rubiformis 559 04-Sep-2013 Gulf of St. Lawrence 47.5156 -64.2546 KHA627-14 SABS-091 Gersemia rubiformis 648 20-Jul-2013 Nova Scotia 44.404 -58.986 KHA595-14 SABS-059 Hormathia nodosa 648 31-Jul-2013 Nova Scotia 46.889 -60.201 LABBI096-09 TBLABR-096 Metridium 512 04-Aug-2008 Saglek Fjord, Labrador 58.4866 -62.374 KBCSM301-14 RICK-0029 Metridium farcimen 649 03-Jun-2013 Hecate Strait, British Columbia 53.845 -130.999 KHA198-14 DFO-MONC-090 Metridium farcimen 648 04-Sep-2013 Gulf of St. Lawrence 48.874 -63.6312 KHA212-14 DFO-MONC-104 Metridium farcimen 609 04-Sep-2013 Gulf of St. Lawrence 48.5187 -62.1425 KHA222-14 DFO-MONC-114 Metridium farcimen 580 04-Sep-2013 Gulf of St. Lawrence 48.3218 -62.0382 KHA581-14 SABS-045 Metridium farcimen 647 12-Jul-2013 Nova Scotia 42.706 -64.14 KHA023-14 PA-II-Plum_a-05 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA024-14 PA-II-Plum_a-06 Metridium senile 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA100-14 PA-I-MS-05 Metridium senile 626 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA101-14 PA-I-MS-06 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA107-14 PA-I-MS-07 Metridium senile 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KBCSM726-14 KHBC-S13-0127-08 Metridium sp. 63 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KBCSM728-14 KHBC-S13-0127-10 Metridium sp. 570 21-Jun-2013 Gulf Islands, British Columbia 48.8037 -128.6 KHA043-14 PA-II-Ceri-01 Pachycerianthus 603 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 borealis KHA044-14 PA-II-Ceri-02 Pachycerianthus 594 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 borealis

135

KHA045-14 PA-II-Ceri-03 Pachycerianthus 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 borealis KBCSM365-14 RICK-0075 Primnoidae 649 05-Jun-2013 Hecate Striat, British Columbia 54.4322 -131.468 KHA638-14 SABS-102 Stomphia coccinea 648 21-Jul-2013 Nova Scotia 44.532 -59.874 KBCSM346-14 RICK-1016 Stomphia sp. 648 04-Jun-2013 Hecate Strait, British Columbia 54.6685 -131.418 KHA391-14 HUNT-1064 Urticina crassicornis 628 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA092-14 PA-I-UF-01 Urticina felina 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA093-14 PA-I-UF-02 Urticina felina 648 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA094-14 PA-I-UF-03 Urticina felina 601 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA095-14 PA-I-UF-04 Urticina felina 590 20-May-2013 Saguenay Marine Park, Quebec 48.3184 -69.4129 KHA132-14 DFO-MONC-024 Urticina felina 648 04-Sep-2013 Gulf of St. Lawrence 46.6572 -61.4559 KHA594-14 SABS-058 Urticina felina 648 31-Jul-2013 Nova Scotia 46.889 -60.201 Cnidaria AAP1206 KHA722-14 PS Jellyfish 1 01 Cnidaria sp. 648 08-Jul-2013 Bonavista Bay, Newfoundland 48.5704 -53.9125

KHA723-14 PS Jellyfish 1 02 Cnidaria sp. 648 08-Jul-2013 Bonavista Bay, Newfoundland 48.5704 -53.9125 KHA724-14 PS Jellyfish 1 03 Cnidaria sp. 648 08-Jul-2013 Bonavista Bay, Newfoundland 48.5704 -53.9125 KHA725-14 PS Jellyfish 1 04 Cnidaria sp. 621 08-Jul-2013 Bonavista Bay, Newfoundland 48.5704 -53.9125 KHA726-14 PS Jellyfish 1 05 Cnidaria sp. 647 08-Jul-2013 Bonavista Bay, Newfoundland 48.5704 -53.9125 KHMS077-14 170812-4E-250-04 Cnidaria 651 17-Aug-2012 Foxe Basin, Nunavut 70.262 -78.442 KHMS078-14 170812-4E-250-04- Cnidaria 590 17-Aug-2012 Foxe Basin, Nunavut 70.262 -78.442 02 Hydrozoa AAA7089 CAISN1255-13 BIOUG04842-B08 Obelia 644 20-Aug-2011 Churchill, Manitoba 58.7 -94.2

KHA001-14 PA-II-Hydr_a-01 Obelia 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 CCSMA168-08 08PROBE-1103 Obelia geniculata 658 15-Jul-2008 Churchill, Manitoba 58.85 -93.753 KHA747-14 PS Obelia sp 01 Obelia sp. 648 23-Oct-2013 Southern Avalon Peninsula, Newfoundland 47.3136 -52.8125 KHA749-14 PS Obelia sp 03 Obelia sp. 648 23-Oct-2013 Southern Avalon Peninsula, Newfoundland 47.3136 -52.8125 KHA750-14 PS Obelia sp 04 Obelia sp. 648 23-Oct-2013 Southern Avalon Peninsula, Newfoundland 47.3136 -52.8125 KHA751-14 PS Obelia sp 05 Obelia sp. 648 23-Oct-2013 Southern Avalon Peninsula, Newfoundland 47.3136 -52.8125 AAC2227 CAISN185-12 BIOUG01747-H06 Aglantha digitale 657 02-Dec-2011 Strait of Juan de Fuca, British Columbia 48.413 -123.414

RDMPC120-10 10PROBE-19080 Aglantha digitale 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC121-10 10PROBE-19081 Aglantha digitale 643 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC124-10 10PROBE-19084 Aglantha digitale 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC146-10 10PROBE-28106 Aglantha digitale 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC147-10 10PROBE-28107 Aglantha digitale 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 AAD5402 RDMPC026-10 10PROBE-18986 Sarsia tubulosa 658 09-Aug-2010 Churchill, Manitoba 58.7908 -94.2464 RDMPC038-10 10PROBE-18998 Sarsia tubulosa 658 09-Aug-2010 Churchill, Manitoba 59.8012 -94.2496 RDMPC039-10 10PROBE-18999 Sarsia tubulosa 658 09-Aug-2010 Churchill, Manitoba 59.8012 -94.2496

136

AAE6029 ABMMC6253- GWS006590 Obelia longissima 658 30-May-2007 British Columbia 49.81 -126.982 10 CAISN171-12 BIOUG01747-G04 Obelia longissima 625 13-Jul-2011 Strait of Juan de Fuca, British Columbia 48.416 -123.424 CAISN176-12 BIOUG01747-G09 Obelia longissima 657 13-Jul-2011 Strait of Juan de Fuca, British Columbia 48.415 -123.396 CAISN181-12 BIOUG01747-H02 Obelia longissima 657 13-Jul-2011 Strait of Juan de Fuca, British Columbia 48.414 -123.393 AAF1632 CAISN1248-13 BIOUG04842-B01 Hybocodon prolifer 657 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62 ARCMI584-14 BIOUG14664-B04 Hydrozoa 651 09-Sep-2014 South Alutasivik Island, Labrador 56.767 -61.33 AAG178 KLMPC019-09 09PROBE-08019 Hydrozoa 647 27-Jul-2009 Churchill, Manitoba 58.856 -94.23 AAG4834 KHMS014-14 030812-2E-250-02 Bougainvillia sp. 648 03-Aug-2012 Hudson Strait, Quebec 62.142 -74.688 KHMS024-14 120812-4E-250-02 Bougainvillia sp. 646 30-Jul-2012 Hudson Strait, Quebec 62.248 -74.857 KHMS025-14 120812-4E-250-03 Bougainvillia sp. 648 30-Jul-2012 Hudson Strait, Quebec 62.248 -74.857 KHMS031-14 170812-4E-80-01 Bougainvillia sp. 648 17-Aug-2012 Foxe Basin, Nunavut 70.262 -78.442 KHMS037-14 290712-3E-250-01 Bougainvillia sp. 648 29-Jul-2012 Hudson Strait, Quebec 62.203 -74.804 KHMS039-14 300712-5E-250-01 Bougainvillia sp. 648 30-Jul-2012 Hudson Strait, Quebec 62.258 -74.69 KHMS040-14 300712-5E-250-02 Bougainvillia sp. 648 30-Jul-2012 Hudson Strait, Quebec 62.258 -74.69 KHMS041-14 300712-5E-250-03 Bougainvillia sp. 648 30-Jul-2012 Hudson Strait, Quebec 62.258 -74.69 KHMS044-14 300712-5E-250-06 Bougainvillia sp. 594 30-Jul-2012 Hudson Strait, Quebec 62.258 -74.69 CAISN1253-13 BIOUG04842-B06 Bougainvillia 657 20-Aug-2011 Churchill, Manitoba 58.7 -94.2 superciliaris CAISN1254-13 BIOUG04842-B07 Bougainvillia 642 20-Aug-2011 Churchill, Manitoba 58.7 -94.2 superciliaris KHMS017-14 030812-2E-250-05 Bougainvillia 658 03-Aug-2012 Hudson Strait, Quebec 62.142 -74.688 superciliaris CCSMA200-10 09PROBE-02091 Hydrozoa 658 17-Jul-2009 Churchill, Manitoba 58.75 -94.383 CCSMA201-10 09PROBE-02092 Hydrozoa 658 17-Jul-2009 Churchill, Manitoba 58.75 -94.383 CCSMA202-10 09PROBE-02093 Hydrozoa 658 17-Jul-2009 Churchill, Manitoba 58.75 -94.383 CCSMA205-10 09PROBE-02792 Hydrozoa 658 24-Jul-2009 Churchill, Manitoba 58.8014 -93.8195 CCSMA207-10 09PROBE-02794 Hydrozoa 658 24-Jul-2009 Churchill, Manitoba 58.8014 -93.8195 CCSMA235-10 09PROBE-CC015 Hydrozoa 658 24-Jul-2009 Churchill, Manitoba 58.8014 -93.8195 CHMEP131-12 CCDB-08227-C12 Hydrozoa 658 29-Jul-2010 Churchill, Manitoba 58.791 -94.21 KLMPC033-09 09PROBE-08035 Hydrozoa 640 27-Jul-2009 Churchill, Manitoba 58.856 -94.23 RDMPC021-10 10PROBE-18981 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.7908 -94.2464 RDMPC058-10 10PROBE-19018 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 59.8012 -94.2496 RDMPC060-10 10PROBE-19020 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 59.8012 -94.2496 RDMPC061-10 10PROBE-19021 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 59.8012 -94.2496 RDMPC119-10 10PROBE-19079 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC125-10 10PROBE-19085 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549

137

RDMPC126-10 10PROBE-19086 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC127-10 10PROBE-19087 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC128-10 10PROBE-19088 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC131-10 10PROBE-19091 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC132-10 10PROBE-19092 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC133-10 10PROBE-19093 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC141-10 10PROBE-28101 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC143-10 10PROBE-28103 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC144-10 10PROBE-28104 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC145-10 10PROBE-28105 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC148-10 10PROBE-28108 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC151-10 10PROBE-28111 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC184-10 10PROBE-28144 Hydrozoa 658 09-Aug-2010 Churchill, Manitoba 58.8377 -94.2376 AAG8540 KHMS030-14 170812-3E-250-02 Hydrozoa 648 17-Aug-2012 Foxe Basin, Nunavut 70.188 -78.421 KHMS029-14 170812-3E-250-01 Leuckartiara nobilis 647 17-Aug-2012 Foxe Basin, Nunavut 70.188 -78.421 AAI8740 GBCI3776-14 GU722865 Hydra oligactis 654 British Columbia RBNII097-13 ON13-C0129-0001 Hydra oligactis 658 14-Sep-2013 Ontario RBNII103-13 ON13-C4215-0001 Hydra oligactis 658 14-Sep-2013 Ontario KBCSM704-14 BIOUG-KMH155- Hydra sp. 648 29-Sep-2012 Narrow Lake, Alberta 02 KHMS011-14 BIOUG-KMH155 Hydra sp. 648 29-Sep-2012 Narrow Lake, Alberta AAJ7391 CAISN188-12 BIOUG01747-H09 Agalmatidae 654 02-Dec-2011 Strait of Juan de Fuca, British Columbia 48.414 -123.393 AAN2778 KBCSM324-14 KHBC-S13-0048 Gonionemus vertens 648 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM334-14 KHBC-S13-0051 Gonionemus vertens 648 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044

KBCSM419-14 KHBC-S13-0071 Gonionemus vertens 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM485-14 KHBC-S13-0076 Gonionemus vertens 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM491-14 KHBC-S13-0080 Gonionemus vertens 648 09-Jun-2013 Hecate Strait, British Columbia 53.7308 -131.18 KBCSM495-14 KHBC-S13-0081 Gonionemus vertens 648 09-Jun-2013 Hecate Strait, British Columbia 53.7726 -131.038 KBCSM619-14 KHBC-S13-0080-02 Gonionemus vertens 648 09-Jun-2013 Hecate Strait, British Columbia 53.7308 -131.18 KBCSM620-14 KHBC-S13-0081-02 Gonionemus vertens 648 09-Jun-2013 Hecate Strait, British Columbia 53.7726 -131.038 AAN4537 SAHYD001-10 08BBCNI-0001 Hydra 656 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967

SAHYD002-10 08BBCNI-0002 Hydra 658 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967 SAHYD003-10 08BBCNI-0003 Hydra 658 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967 SAHYD004-10 08BBCNI-0004 Hydra 658 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967 SAHYD005-10 08BBCNI-0005 Hydra 658 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967

138

SAHYD006-10 08BBCNI-0006 Hydra 658 08-Aug-2008 Crandell Lake, Alberta 49.088 -113.967 AAN4843 KHMS004-14 L#12BBAY-0011- Hydrozoa 658 08-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.517 -57.876 01 CCSMA169-08 HLC-26760 Sarsia princeps 658 20-Aug-2002 Churchill, Manitoba 58.74 -93.82 KHMS016-14 030812-2E-250-04 Sarsia princeps 638 03-Aug-2012 Hudson Strait, Quebec 62.142 -74.688 KHMS019-14 030812-2E-250-07 Sarsia princeps 638 03-Aug-2012 Hudson Strait, Quebec 62.142 -74.688 KHMS038-14 290712-6E-250-01 Sarsia princeps 638 29-Jul-2012 Hudson Strait, Quebec 62.196 -74.735 KHMS042-14 300712-5E-250-04 Sarsia princeps 648 30-Jul-2012 Hudson Strait, Quebec 62.258 -74.69 NRMMC155- 10PROBE-28265 Sarsia princeps 658 11-Aug-2010 Churchill, Manitoba 58.7627 -93.868 10 RDMPC183-10 10PROBE-28143 Sarsia princeps 658 09-Aug-2010 Churchill, Manitoba 58.8377 -94.2376 AAO4013 ABMBS256-10 10BPBS-0256 Hydrozoa 658 15-Aug-2010 Beaufort Sea, Northwest Territories 70.932 -133.562

AAP1198 KHBC164-13 BIOUG-KMH-030 Hydrozoa sp. 631 Vancouver Aquarium AAP1206 KBCSM332-14 KHBC-S13-0049 Hydrozoa 648 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM435-14 KHBC-S13-0039 Hydrozoa 648 08-Jun-2013 Hecate Strait, British Columbia 54.4132 -131.252 KHMS013-14 030812-2E-250-01 Hydrozoa 648 03-Aug-2012 Hudson Strait, Quebec 62.142 -74.688 KHMS023-14 120812-4E-250-01 Leuckartiara octona 648 30-Jul-2012 Hudson Strait, Quebec 62.248 -74.857 AAP1358 KBCSM381-14 KHBC-S13-0066 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM416-14 RICK-1027 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM417-14 RICK-1028 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM418-14 RICK-1029 Eutonina indicans 647 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM427-14 RICK-1037 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM428-14 RICK-1038 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM429-14 RICK-1039 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM430-14 RICK-1040 Eutonina indicans 636 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM431-14 RICK-1041 Eutonina indicans 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM490-14 KHBC-S13-0079 Eutonina indicans 648 09-Jun-2013 Hecate Strait, British Columbia 53.7308 -131.18 KBCSM500-14 KHBC-S13-0084 Eutonina indicans 630 09-Jun-2013 Hecate Strait, British Columbia 53.6431 -131.256 KBCSM616-14 KHBC-S13-0079-02 Eutonina indicans 503 09-Jun-2013 Hecate Strait, British Columbia 53.7308 -131.18 KBCSM618-14 KHBC-S13-0079-04 Eutonina indicans 603 09-Jun-2013 Hecate Strait, British Columbia 53.7308 -131.18 KBCSM681-14 KHBC-S13-0030-01 Eutonina indicans 648 01-Jun-2013 Hecate Strait, British Columbia 53.2481 -131.164 KBCSM682-14 KHBC-S13-0030-02 Eutonina indicans 648 01-Jun-2013 Hecate Strait, British Columbia 53.2481 -131.164 KBCSM688-14 KHBC-S13-0050-03 Eutonina indicans 602 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM709-14 KHBC-S13-0066-02 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM710-14 KHBC-S13-0066-03 Eutonina indicans 599 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM711-14 KHBC-S13-0066-04 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644

139

KBCSM712-14 KHBC-S13-0066-05 Eutonina indicans 566 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM713-14 KHBC-S13-0066-06 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM714-14 KHBC-S13-0066-07 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KBCSM715-14 KHBC-S13-0066-08 Eutonina indicans 648 05-Jun-2013 Hecate Strait, British Columbia 54.0031 -132.644 KHBC167-13 BIOUG-KMH-033 Eutonina indicans 648 Vancouver Aquarium AAR9450 KHBC320-14 BBAY-0009-01 Clytia sp. 648 08-Jun-2012 Gulf of St. Lawrence AAX2382 RBNII098-13 ON13-C0129-0002 Hydra circumcincta 657 14-Sep-2013 Ontario ABA2523 CAISN1015-13 BIOUG01748-F05 Aglantha digitale 657 31-Aug-2011 Bedford Basin, Nova Scotia 44.651 -63.568 KBCSM529-14 KHBC-S13-0088 Hydrozoa 646 10-Jun-2013 Hecate Strait, British Columbia 53.0652 -130.166 ABW2174 CAISN537-13 BIOUG03171-F02 Muggiaea atlantica 626 07-Dec-2011 Burrard Inlet, British Columbia 49.293 -123.038 ACF7228 KHBC001-13 RBCM 011-00032- Ectopleura larynx 648 05-Jul-2008 Dixon Entrance, British Columbia 54.5395 -133.048 011 ACH4931 KHMS002-14 L#12BBAY-0012- Hybocodon prolifer 648 09-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.515 -57.859 02 ACH9116 KHA727-14 PS Ectopleura Ectopleura crocea 648 08-Sep-2013 Southern Avalon Peninsula, Newfoundland 46.9229 -52.9334 crocea 01 KHA728-14 PS Ectopleura Ectopleura crocea 648 08-Sep-2013 Southern Avalon Peninsula, Newfoundland 46.9229 -52.9334 crocea 02 KHA731-14 PS Ectopleura Ectopleura crocea 648 08-Sep-2013 Southern Avalon Peninsula, Newfoundland 46.9229 -52.9334 crocea 05 KHA319-14 KHM-S13-0040 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 ACI2118 KBCSM652-14 KHBC-S13-0115 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia ACJ0105 RBNII102-13 ON13-C4202-0001 Hydra 658 14-Sep-2013 Ontario ACL8220 CAISN1280-13 BIOUG04842-D09 Rathkea 575 15-Aug-2012 Foxe Basin, Nunavut 70.252 -78.85 octopunctata ACL8339 CAISN139-12 BIOUG01747-D08 Euphysa 657 20-Aug-2011 Churchill, Manitoba 58.7 -94.2 ACL8346 CAISN108-12 BIOUG01747-B01 Hydrozoa 657 07-Dec-2011 Burrard Inlet, British Columbia 49.299 -123.066

ACL8523 CAISN1236-13 BIOUG04842-A01 Aeginopsis laurentii 654 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62

CAISN1237-13 BIOUG04842-A02 Aeginopsis laurentii 654 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62 CAISN1238-13 BIOUG04842-A03 Aeginopsis laurentii 654 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62 CAISN1239-13 BIOUG04842-A04 Aeginopsis laurentii 654 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62 CAISN1318-13 BIOUG04842-G11 Aeginopsis laurentii 654 03-Aug-2012 Hudson Strait, Quebec 62.123 -74.62 KHMS043-14 300712-5E-250-05 Hydrozoa 647 30-Jul-2012 Hudson Strait, Quebec Quebec 62.258 -74.69 CAISN1256-13 BIOUG04842-B09 Hydrozoa 651 20-Aug-2011 Hudson Bay 58.7 -94.2 ACL8638 CAISN110-12 BIOUG01747-B03 Agalmatidae 657 07-Dec-2011 Burrard Inlet, British Columbia 49.299 -123.066

KBCSM017-14 KHBC-S13-0117 Siphonophorae sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549

ACL8751 CAISN1013-13 BIOUG01748-F03 Aglantha digitale 657 31-Aug-2011 Bedford Basin, Nova Scotia 44.651 -63.568

140

ACM3194 KBCSM014-14 KHBC-S13-0112 Aequorea sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 KBCSM026-14 KHBC-S13-0118 Aequorea sp. 648 21-Jun-2013 British Columbia 48.782 -123.557 KBCSM282-14 RICK-1005 Aequorea sp. 648 02-Jun-2013 Hecate Strait, British Columbia 53.3404 -131.14 KBCSM295-14 RICK-0023 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 53.7425 -130.63 KBCSM296-14 RICK-0024 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 53.7425 -130.63 KBCSM298-14 RICK-0026 Aequorea sp. 585 03-Jun-2013 Hecate Strait, British Columbia 53.7969 -130.703 KBCSM299-14 RICK-0027 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 53.7969 -130.703 KBCSM310-14 RICK-0037 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 53.9134 -131.053 KBCSM311-14 RICK-0038 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 53.9134 -131.053 KBCSM318-14 RICK-0045 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM320-14 RICK-0047 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM321-14 RICK-0048 Aequorea sp. 649 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM323-14 KHBC-S13-0047 Aequorea sp. 648 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM353-14 RICK-0069 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 KBCSM354-14 RICK-0070 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 KBCSM355-14 RICK-0071 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 KBCSM369-14 RICK-0079 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.3177 -131.728 KBCSM370-14 RICK-0080 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.3177 -131.728 KBCSM371-14 RICK-0081 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.3177 -131.728 KBCSM378-14 RICK-0088 Aequorea sp. 649 05-Jun-2013 Hecate Strait, British Columbia 54.1898 -132.307 KBCSM398-14 RICK-1008 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.2317 -132.871 KBCSM399-14 RICK-1009 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.2317 -132.871 KBCSM405-14 RICK-1015 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.2281 -132.376 KBCSM409-14 RICK-1020 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.2408 -132.229 KBCSM413-14 RICK-1024 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM414-14 RICK-1025 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM415-14 RICK-1026 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1186 -132.057 KBCSM421-14 RICK-1031 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM422-14 RICK-1032 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM423-14 RICK-1033 Aequorea sp. 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM444-14 RICK-1054 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.2996 -131.208 KBCSM445-14 RICK-1055 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.2996 -131.208 KBCSM446-14 RICK-1056 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.2996 -131.208 KBCSM460-14 RICK-1065 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM461-14 RICK-1066 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173

141

KBCSM462-14 RICK-1067 Aequorea sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM482-14 RICK-1086 Aequorea sp. 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM483-14 RICK-1087 Aequorea sp. 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM503-14 RICK-2005 Aequorea sp. 648 09-Jun-2013 Hecate Strait, British Columbia 53.6431 -131.256 KBCSM504-14 RICK-2006 Aequorea sp. 648 09-Jun-2013 Hecate Strait, British Columbia 53.6431 -131.256 KBCSM512-14 RICK-2016 Aequorea sp. 648 09-Jun-2013 Hecate Strait, British Columbia 53.6255 -131.24 KBCSM716-14 KHBC-S13-0112-02 Aequorea sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 KBCSM717-14 KHBC-S13-0118-02 Aequorea sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.2832 -124.468 KBCSM718-14 KHBC-S13-0118-03 Aequorea sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.2832 -124.468 KHBC170-13 BIOUG-KMH-036 Aequorea sp. 648 Vancouver Aquarium ACM3552 KHA527-14 MLI-073 Hydrozoa sp. 556 12-Aug-2011 Gulf of St. Lawrence 48.03 -59.884 KHA528-14 MLI-074 Hydrozoa sp. 638 12-Aug-2011 Gulf of St. Lawrence 48.03 -59.884 KHA529-14 MLI-075 Hydrozoa sp. 582 12-Aug-2011 Gulf of St. Lawrence 48.03 -59.884 ACM3778 KBCSM267-14 RICK-2010 Earleria cellularia 648 01-Jun-2013 Hecate Strait, British Columbia 53.1268 -131.099 KBCSM270-14 RICK-0014 Earleria cellularia 649 01-Jun-2013 Hecate Strait, British Columbia 53.2116 -131.22 KBCSM271-14 RICK-0015 Earleria cellularia 649 01-Jun-2013 Hecate Strait, British Columbia 53.2116 -131.22 KBCSM272-14 RICK-0016 Earleria cellularia 649 01-Jun-2013 Hecate Strait, British Columbia 53.2116 -131.22 KBCSM294-14 KHBC-S13-0040 Earleria cellularia 648 02-Jun-2013 Hecate Strait, British Columbia 53.5084 -130.892 KBCSM317-14 RICK-0044 Earleria cellularia 649 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 KBCSM379-14 RICK-0089 Earleria cellularia 648 05-Jun-2013 Hecate Strait, British Columbia 54.1898 -132.307 KBCSM407-14 RICK-1017 Earleria cellularia 648 07-Jun-2013 Hecate Strait, British Columbia 54.2408 -132.229 KBCSM424-14 RICK-1034 Earleria cellularia 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM425-14 RICK-1035 Earleria cellularia 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM426-14 RICK-1036 Earleria cellularia 648 07-Jun-2013 Hecate Strait, British Columbia 54.1573 -131.751 KBCSM469-14 RICK-1073 Earleria cellularia 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 KBCSM470-14 RICK-1074 Earleria cellularia 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 KBCSM471-14 RICK-1075 Earleria cellularia 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 KBCSM486-14 RICK-1089 Earleria cellularia 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM487-14 RICK-1090 Earleria cellularia 648 09-Jun-2013 Hecate Strait, British Columbia 53.7331 -131.187 KBCSM502-14 RICK-2004 Earleria cellularia 610 09-Jun-2013 Hecate Strait, British Columbia 53.6431 -131.256 KBCSM514-14 RICK-2018 Earleria cellularia 648 09-Jun-2013 Hecate Strait, British Columbia 53.6255 -131.24 KBCSM515-14 RICK-2019 Earleria cellularia 648 09-Jun-2013 Hecate Strait, British Columbia 53.6255 -131.24 KHA703-14 PS Staurostoma sp. Staurostoma sp. 648 07-Jul-2013 Bonavista Bay, Newfoundland 48.5541 -53.9652 02 KHA704-14 PS Staurostoma sp. Staurostoma sp. 648 07-Jul-2013 Bonavista Bay, Newfoundland 48.5541 -53.9652 03

142

KHA705-14 PS Staurostoma sp. Staurostoma sp. 651 07-Jul-2013 Bonavista Bay, Newfoundland 48.5628 -53.9625 04 KHA706-14 PS Staurostoma sp. Staurostoma sp. 648 07-Jul-2013 Bonavista Bay, Newfoundland 48.5628 -53.9625 05 ACM3961 KBCSM251-14 KHBC-S13-0017 Polyorchis 648 31-May-2013 Hecate Strait, British Columbia 52.7667 -131.021 penicillatus KBCSM447-14 KHBC-S13-0073 Polyorchis 640 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 penicillatus KBCSM626-14 KHBC-S13-0085-02 Polyorchis 648 09-Jun-2013 Hecate Strait, British Columbia 53.6431 -131.256 penicillatus KHBC176-13 BIOUG-KMH-042 Polyorchis 579 Vancouver Aquarium penicillatus KHBC177-13 BIOUG-KMH-043 Polyorchis 645 Vancouver Aquarium penicillatus ACM4381 KHBC218-13 BIOUG-KMH-084 Hydrozoa sp. 648 Vancouver Aquarium ACM6633 KBCSM009-14 HG13-9-2 Neoturris breviconis 648 28-May-2013 Spectacle Creek, Vancouver Island 48.56 -123.535 KBCSM699-14 HG13-9-2-04 Neoturris breviconis 648 28-May-2013 Spectacle Creek, Vancouver Island 48.56 -123.535 KBCSM700-14 HG13-9-2-05 Neoturris breviconis 648 28-May-2013 Spectacle Creek, Vancouver Island 48.56 -123.535 KBCSM387-14 KHBC-S13-0067 Pandeidae 648 06-Jun-2013 Hecate Strait, British Columbia 54.2925 -132.286 KBCSM609-14 KHBC-S13-0067-02 Pandeidae sp. 648 06-Jun-2013 Hecate Strait, British Columbia 54.2925 -132.286 ACM6649 KBCSM364-14 KHBC-S13-0062 Neoturris breviconis 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 KBCSM388-14 KHBC-S13-0068 Pandeidae 648 06-Jun-2013 Hecate Strait, British Columbia 54.3288 -132.256 ACM6659 KBCSM253-14 KHBC-S13-0019 Hydrozoa 637 31-May-2013 Hecate Strait, British Columbia 52.8055 -131.021 KBCSM261-14 KHBC-S13-0025 Hydrozoa 508 01-Jun-2013 Hecate Strait, British Columbia 53.0363 -131.033

KBCSM467-14 KHBC-S13-0075 Hydrozoa 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM615-14 KHBC-S13-0075-02 Hydrozoa sp. 648 08-Jun-2013 Hecate Strait, British Columbia 54.1131 -131.173 KBCSM678-14 KHBC-S13-0019-02 Hydrozoa sp. 648 31-May-2013 Hecate Strait, British Columbia 52.8055 -131.021 KBCSM679-14 KHBC-S13-0019-03 Hydrozoa sp. 648 31-May-2013 Hecate Strait, British Columbia 52.8055 -131.021 KBCSM680-14 KHBC-S13-0025-03 Hydrozoa sp. 648 01-Jun-2013 Hecate Strait, British Columbia 53.0363 -131.033 ACM7076 CCSMA262-14 BIOUG09877-G01 Hydridae 658 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 CCSMA263-14 BIOUG09877-G02 Hydridae 656 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 CCSMA264-14 BIOUG09877-G03 Hydridae 658 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 CCSMA265-14 BIOUG09877-G04 Hydridae 658 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 CCSMA266-14 BIOUG09877-G05 Hydridae 658 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 CCSMA268-14 BIOUG09877-G07 Hydridae 657 09-Aug-2010 Churchill, Manitoba 58.663 -94.166 ACM7666 KHA036-14 PA-II-Hydr_b-09 Halecium halecinum 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163

KHA052-14 PA-II-Hydr_d-01 Halecium halecinum 618 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163

KBCSM685-14 KHBC-S13-0041-02 Hydrozoa sp. 648 02-Jun-2013 Hecate Strait, British Columbia 53.3404 -131.14 ACM8177 KBCSM266-14 KHBC-S13-0026 Hydrozoa 607 01-Jun-2013 Hecate Strait, British Columbia 53.1226 -130.978

143

ACM9406 KHMS003-14 L#12BBAY-0012- Hydrozoa 648 09-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.515 -57.859 03 KHMS001-14 L#12BBAY-0012- Laodicea undulata 648 09-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.515 -57.859 01 ACN0372 KBCSM022-14 KHBC-S13-0111 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7668 -123.551 KBCSM649-14 KHBC-S13-0111-02 Hydrozoa sp. 647 21-Jun-2013 Gulf Islands, British Columbia 48.7668 -123.551 KBCSM650-14 KHBC-S13-0111-03 Hydrozoa sp. 647 21-Jun-2013 Gulf Islands, British Columbia 48.7668 -123.551 KBCSM651-14 KHBC-S13-0111-04 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7668 -123.551 ACN0373 KBCSM033-14 KHBC-S13-0106 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7362 -123.366 KBCSM647-14 KHBC-S13-0106-02 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7362 -123.366 KBCSM648-14 KHBC-S13-0106-03 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7362 -123.366 ACN0374 KBCSM260-14 KHBC-S13-0024 Hydrozoa 648 01-Jun-2013 Hecate Strait, British Columbia 53.0312 -130.995 KBCSM674-14 KHBC-S13-0024-02 Hydrozoa sp. 648 01-Jun-2013 Hecate Strait, British Columbia 53.0312 -130.995

KBCSM675-14 KHBC-S13-0024-03 Hydrozoa sp. 648 01-Jun-2013 Hecate Strait, British Columbia 53.0312 -130.995 ACN0557 KBCSM007-14 HG13-8 Earleria cellularia 648 28-May-2013 Vancouver Island 48.5375 -123.452

KBCSM698-14 HG13-8-03 Earleria cellularia 648 28-May-2013 Vancouver Island 48.5375 -123.452 KBCSM016-14 KHBC-S13-0119 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 ACN0558 KHBC301-13 BIOUG-KMH225 Hydrozoa sp. 648 17-Jan-2013 British Columbia KHBC316-14 BIOUG-KMH225- Hydrozoa sp. 648 17-Jan-2013 British Columbia 02 ACO2504 KHA737-14 PS Yellow Jellyfish Melicertum 648 12-Sep-2013 Trinity Bay, Newfoundland 47.8796 -53.3712 01 octocostatum KHA738-14 PS Yellow Jellyfish Melicertum 648 12-Sep-2013 Trinity Bay, Newfoundland 47.8796 -53.3712 02 octocostatum KHA739-14 PS Yellow Jellyfish Melicertum 650 12-Sep-2013 Trinity Bay, Newfoundland 47.8796 -53.3712 03 octocostatum KHA741-14 PS Yellow Jellyfish Melicertum 648 12-Sep-2013 Trinity Bay, Newfoundland 47.8796 -53.3712 05 octocostatum ACO3399 KHA311-14 KHM-S13-0036 Hydrozoa 627 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 ACO4122 KHA321-14 KHM-S13-0042 Hydrozoa 651 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 ACO7472 KHA316-14 KHM-S13-0038 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254

ACO8204 KHA280-14 KH-S13-0123 Hydrozoa 644 05-Aug-2013 St. Andrews, New Brunswick ACO8375 KHA275-14 KHM-S13-0002 Hydrozoa 638 04-Aug-2013 St. Andrews, New Brunswick 45.0697 -67.0364

KBCSM274-14 KHBC-S13-0030 Aequorea sp. 648 01-Jun-2013 Hecate Strait, British Columbia 53.2481 -131.164 KBCSM319-14 RICK-0046 Aequorea sp. 524 03-Jun-2013 Hecate Strait, British Columbia 54.0569 -131.145 CAISN1252-13 BIOUG04842-B05 Bougainvillia 714 20-Aug-2011 Churchill, Manitoba 58.7 -94.2 superciliaris KHBC006-13 RBCM 011-00135- Clytia 588 23-Sep-2010 Vancouver, British Columbia 49.2885 -123.122 001 hemisphaerica

144

KBCSM408-14 RICK-1018 Earleria cellularia 648 07-Jun-2013 Hecate Strait, British Columbia 54.2408 -132.229 KBCSM613-14 KHBC-S13-0070 Eucheilota maculata 648 Hecate Strait, British Columbia KBCSM614-14 KHBC-S13-0070-02 Eucheilota maculata 648 Hecate Strait, British Columbia KBCSM275-14 KHBC-S13-0031 Eutonina indicans 648 01-Jun-2013 Hecate Strait, British Columbia 53.2481 -131.164 KBCSM333-14 KHBC-S13-0050 Eutonina indicans 648 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM687-14 KHBC-S13-0050-02 Eutonina indicans 648 03-Jun-2013 Hecate Strait, British Columbia 54.1473 -131.044 KBCSM003-14 HG13-4-1 Eutonina sp. 648 25-May-2013 Amai Inlet, Vancouver Island 50.0227 -127.101 KHA028-14 PA-II-Hydr_b-01 Halecium halecinum 60 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA032-14 PA-II-Hydr_b-05 Halecium halecinum 638 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA013-14 PA-II-Fur-01 Hydractinia echinata 647 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA014-14 PA-II-Fur-02 Hydractinia echinata 648 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA016-14 PA-II-Fur-04 Hydractinia echinata 634 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KHA017-14 PA-II-Fur-05 Hydractinia echinata 647 06-Aug-2013 Ile Bonaventure, Gulf of St. Lawrence 48.5076 -64.163 KBCSM252-14 KHBC-S13-0018 Hydrozoa 658 31-May-2013 Hecate Strait, British Columbia 52.7667 -131.021 KHA155-14 DFO-MONC-047 Hydrozoa 648 04-Sep-2013 Gulf of St. Lawrence 46.8642 -64.4964 KHA166-14 DFO-MONC-058 Hydrozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5787 -61.8981 KHA318-14 KH-S13-0003 Hydrozoa 658 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 KHA320-14 KHM-S13-0041 Hydrozoa 97 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 KHA324-14 KHM-S13-0024 Hydrozoa 646 06-Aug-2013 St. Andrews, New Brunswick 45.0714 -67.0546 KHA327-14 KHM-S13-0017 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 KHA331-14 KHM-S13-0035 Hydrozoa 650 05-Aug-2013 St. Andrews,New Brunswick 44.9749 -67.0254 KHA332-14 KHM-S13-0048 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9749 -67.0254 KHA336-14 HUNT-1013 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA337-14 HUNT-1014 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA338-14 KHM-S13-0011 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA339-14 HUNT-1015 Hydrozoa 648 05-Aug-2013 St. Andrews,New Brunswick 44.9402 -67.0025 KHA340-14 HUNT-1016 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA341-14 KHM-S13-0049 Hydrozoa 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA383-14 HUNT-1056 Hydrozoa 651 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHA384-14 HUNT-1057 Hydrozoa 647 08-Aug-2013 St. Andrews, New Brunswick 45.085 -67.0803 KHMS005-14 L#12BBAY-0011- Hydrozoa 647 08-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.517 -57.876 02 KHMS006-14 L#12BBAY-0011- Hydrozoa 648 08-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.517 -57.876 03 KHMS007-14 L#12BBAY-0011- Hydrozoa 648 08-Jun-2012 Bonne Bay Fjord, Gulf of St. Lawrence 49.517 -57.876 04 KHMS028-14 150812-1E-03 Hydrozoa 658 15-Aug-2012 Foxe Basin, Nunavut 70.252 -78.85

145

KBCSM019-14 KHBC-S13-0116 Hydrozoa sp. 540 21-Jun-2013 Gulf Islands, British Columbia 48.7495 -123.549 KBCSM025-14 KHBC-S13-0095 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 KBCSM035-14 KHBC-S13-0136 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM633-14 KHBC-S13-0095-02 Hydrozoa sp. 648 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 KBCSM634-14 KHBC-S13-0095-03 Hydrozoa sp. 643 21-Jun-2013 Gulf Islands, British Columbia 48.782 -123.557 KBCSM653-14 KHBC-S13-0136-02 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM654-14 KHBC-S13-0136-04 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM655-14 KHBC-S13-0136-05 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM656-14 KHBC-S13-0136-06 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM657-14 KHBC-S13-0136-07 Hydrozoa sp. 648 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KBCSM686-14 KHBC-S13-0041-03 Hydrozoa sp. 643 02-Jun-2013 Hecate Strait, British Columbia 53.3404 -131.14 KHA226-14 DFO-MONC-118 Hydrozoa sp. 648 04-Sep-2013 Gulf of St. Lawrence 47.4228 -60.5056 KHA234-14 DFO-MONC-126 Hydrozoa sp. 648 04-Sep-2013 Gulf of St. Lawrence 46.8642 -63.3318 KHA593-14 SABS-057 Hydrozoa sp. 541 29-Jul-2013 Nova Scotia 45.504 -59.301 KHA599-14 SABS-063 Hydrozoa sp. 609 30-Jul-2013 Nova Scotia 46.473 -59.137 KHA623-14 SABS-087 Hydrozoa sp. 648 18-Jul-2013 Nova Scotia 43.761 -61.151 KHA628-14 SABS-092 Hydrozoa sp. 648 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA732-14 PS Hydroid 1 01 Hydrozoa sp. 640 19-Jul-2013 Fortune Bay, Newfoundland 47.5472 -54.8801 KHA733-14 PS Hydroid 1 02 Hydrozoa sp. 648 19-Jul-2013 Fortune Bay, Newfoundland 47.5472 -54.8801 KHA734-14 PS Hydroid 1 03 Hydrozoa sp. 648 19-Jul-2013 Fortune Bay, Newfoundland 47.5472 -54.8801 KHA735-14 PS Hydroid 1 04 Hydrozoa sp. 650 19-Jul-2013 Fortune Bay, Newfoundland 47.5472 -54.8801 KHA736-14 PS Hydroid 1 05 Hydrozoa sp. 648 19-Jul-2013 Fortune Bay, Newfoundland 47.5472 -54.8801 KBCSM359-14 KHBC-S13-0058 Modeeria rotunda 648 05-Jun-2013 Hecate Strait, British Columbia 54.4974 -131.594 KHBC010-13 RBCM 011-00135- Obelia dichotoma 636 23-Sep-2010 Vancouver, British Columbia 49.2885 -123.122 002 KBCSM750-14 BMSC-0005-03 Obelia sp. 658 19-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KHMS066-14 BMSC-0003 Obelia sp. 658 20-Dec-2013 Bamfield, British Columbia 48.836 -125.136 KHA465-14 MLI-011 Ptychogena lactea 605 11-Aug-2013 Gulf of St. Lawrence 49.592 -59.228 KHA466-14 MLI-012 Ptychogena lactea 549 11-Aug-2013 Gulf of St. Lawrence 49.592 -59.228 KBCSM766-14 KHBC-S13-0007-02 Solmissus sp. 658 29-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM767-14 KHBC-S13-0007-03 Solmissus sp. 658 29-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM768-14 KHBC-S13-0007-04 Solmissus sp. 658 29-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KHA702-14 PS Staurostoma sp. Staurostoma sp. 648 07-Jul-2013 Bonavisa Bay, Newfoundland 48.5541 -53.9652 01 Scyphozoa AAA4674 KHBC175-13 BIOUG-KMH-041 Aurelia aurita 644 Vancouver Aquarium AAC2226 ARCMI614-14 BIOUG14664-D10 Aurelia aurita 651 11-Sep-2014 Makkovik, Labrador 55.085 -59.171

146

ARCMI615-14 BIOUG14664-D11 Aurelia aurita 617 11-Sep-2014 Makkovik, Labrador 55.085 -59.171 ARCMI616-14 BIOUG14664-D12 Aurelia aurita 648 11-Sep-2014 Makkovik, Labrador 55.085 -59.171 ARCMI617-14 BIOUG14664-E01 Aurelia aurita 606 11-Sep-2014 Makkovik, Labrador 55.085 -59.171 ARCMI618-14 BIOUG14664-E02 Aurelia aurita 606 11-Sep-2014 Makkovik, Labrador 55.085 -59.171 CAISN135-12 BIOUG01747-D04 Aurelia aurita 657 20-Aug-2011 Churchill, Manitoba 58.7 -94.2 KHA305-14 KHM-S13-0013 Aurelia aurita 648 05-Aug-2013 St. Andrews, New Brunswick 44.9402 -67.0025 KHA342-14 HUNT-1017 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA343-14 HUNT-1018 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA344-14 HUNT-1019 Aurelia aurita 647 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA371-14 KHM-S13-0050 Aurelia aurita 647 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA712-14 PS Aurelia aurita 01 Aurelia aurita 650 21-Jul-2013 Bonavista Bay, Newfoundland 48.5677 -53.9567 KHA713-14 PS Aurelia aurita 02 Aurelia aurita 651 21-Jul-2013 Bonavista Bay, Newfoundland 48.5677 -53.9567 KHA714-14 PS Aurelia aurita 03 Aurelia aurita 651 21-Jul-2013 Bonavista Bay, Newfoundland 48.5677 -53.9567 KHA715-14 PS Aurelia aurita 04 Aurelia aurita 650 21-Jul-2013 Bonavista Bay, Newfoundland 48.5677 -53.9567 KHA716-14 PS Aurelia aurita 05 Aurelia aurita 652 21-Jul-2013 Bonavista Bay, Newfoundland 48.5677 -53.9567 KHMS074-14 NBA-0001 Aurelia aurita 648 Shippagan, New Brunswick 47.7477 -64.7084 KHMS075-14 NBA-0002 Aurelia aurita 648 Shippagan, New Brunswick 47.7477 -64.7084 KHMS076-14 NBA-0003 Aurelia aurita 648 Shippagan, New Brunswick 47.7477 -64.7084 KHA323-14 KHM-S13-0044 Aurelia sp. 648 06-Aug-2013 St. Andrews, New Brunswick 45.0714 -67.0546 KBCSM637-14 KHBC-S13-0100-02 Aurelia aurita 647 22-Jun-2013 Gulf Islands, British Columbia 48.7698 -123.117 KHBC268-13 BIOUG-KMH134 Aurelia aurita 648 Shaw Ocean Discovery Center GBCI0218-06 AY319474 Aurelia labiata 612 British Columbia GBCI0566-06 AY903068 Aurelia labiata 657 Sooke Basin, British Columbia GBCI0567-06 AY903069 Aurelia labiata 657 Sooke Basin, British Columbia GBCI0568-06 AY903070 Aurelia labiata 656 Sooke Basin, British Columbia GBCI0569-06 AY903071 Aurelia labiata 657 Sooke Basin, British Columbia GBCI0570-06 AY903072 Aurelia labiata 657 Todd Inlet, British Columbia GBCI0571-06 AY903073 Aurelia labiata 657 Todd Inlet, British Columbia AAC5462 KHBC307-13 BIOUG-KMH231 Aurelia sp. 633 20-Jan-2013 British Columbia KHBC308-13 BIOUG-KMH232 Aurelia sp. 648 20-Jan-2013 British Columbia AAG4832 EKDFO107-07 ATLANCRUS107 Scyphozoa 658 01-Aug-2007 Maritimes Region 43.7319 -58.7647 AAN6775 CCSMA233-10 09PROBE-CC013 Aurelia 658 24-Jul-2009 Churchill, Manitoba 58.8014 -93.8195 RDMPC122-10 10PROBE-19082 Aurelia 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC130-10 10PROBE-19090 Aurelia 658 09-Aug-2010 Churchill, Manitoba 58.8406 -94.2549 RDMPC162-10 10PROBE-28122 Aurelia 658 09-Aug-2010 Churchill, Manitoba 58.8377 -94.2376

147

AAP1190 EKDFO109-07 ATLANCRUS109 Scyphozoa 658 01-Aug-2007 Maritimes Region 43.7319 -58.7647 KHA160-14 DFO-MONC-052 Scyphozoa 648 04-Sep-2013 Gulf of St. Lawrence 47.5675 -63.0736 ACD2727 KHBC184-13 BIOUG-KMH-050 Chrysaora 648 Vancouver Aquarium fluoresens AAG4832 KHBC185-13 BIOUG-KMH-051 Chrysaora 568 Vancouver Aquarium fluoresens AAN6775 KHBC186-13 BIOUG-KMH-052 Chrysaora 600 Vancouver Aquarium fluoresens KHBC171-13 BIOUG-KMH-037 Chrysaora pacifica 648 Vancouver Aquarium KHBC172-13 BIOUG-KMH-038 Chrysaora pacifica 645 Vancouver Aquarium KHBC173-13 BIOUG-KMH-039 Chrysaora pacifica 643 Vancouver Aquarium KHBC174-13 BIOUG-KMH-040 Chrysaora pacifica 648 Vancouver Aquarium ACF6328 KHBC280-13 BIOUG-KMH146 Chrysaora 648 Shaw Ocean Discovery Center fluoresens ACG1305 CHMEP114-12 CCDB-08227-B07 Scyphozoa 658 13-Jul-2010 Churchill, Manitoba 58.803 -94.122

ACM3971 KBCSM011-14 HG13-10-2 Phacellophora 630 28-May-2013 Vancouver Island 48.546 -123.54 camtschatica KBCSM013-14 HG13-12 Phacellophora 646 28-May-2013 Vancouver Island 48.6898 -123.534 camtschatica KBCSM258-14 KHBC-S13-0022 Phacellophora 648 31-May-2013 Hecate Strait, British Columbia 52.8258 -130.786 camtschatica KBCSM472-14 RICK-1076 Phacellophora 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 camtschatica KBCSM473-14 RICK-1077 Phacellophora 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 camtschatica KBCSM701-14 HG13-10-2-02 Phacellophora 646 28-May-2013 Vancouver Island 48.546 -123.54 camtschatica KHBC182-13 BIOUG-KMH-048 Phacellophora 648 Vancouver Aquarium camtschatica ACN0101 KBCSM229-14 KHBC-S13-0003 Phacellophora 648 30-May-2013 Hecate Strait, British Columbia 52.7262 -129.801 camtschatica KBCSM237-14 KHBC-S13-0009 Scyphozoa 648 30-May-2013 Hecate Strait, British Columbia 52.7037 -130.05 ACO4014 KBCSM234-14 KHBC-S13-0006 Scyphozoa 658 30-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 ACO7920 KBCSM228-14 KHBC-S13-0002 Periphylla 648 30-May-2013 Hecate Strait, British Columbia 51.3444 -127.965 periphylla KBCSM238-14 KHBC-S13-0010 Periphylla 648 30-May-2013 Hecate Strait, British Columbia 52.7037 -130.05 periphylla KBCSM239-14 KHBC-S13-0011 Periphylla 648 30-May-2013 Hecate Strait, British Columbia 52.6896 -130.28 periphylla KBCSM363-14 KHBC-S13-0061 Periphylla 648 05-Jun-2013 Hecate Strait, British Columbia 54.4322 -131.468 periphylla KBCSM523-14 KHBC-S13-0087 Periphylla 604 10-Jun-2013 Hecate Strait, British Columbia 53.1133 -130.245 periphylla KBCSM532-14 KHBC-S13-0090 Periphylla 648 10-Jun-2013 Hecate Strait, British Columbia 52.9732 -130.245 periphylla

148

KBCSM628-14 KHBC-S13-0087-02 Periphylla 648 10-Jun-2013 Hecate Strait, British Columbia 53.1133 -130.245 periphylla KBCSM629-14 KHBC-S13-0087-03 Periphylla 648 10-Jun-2013 Hecate Strait, British Columbia 53.1133 -130.245 periphylla KHA233-14 DFO-MONC-125 Periphylla 648 04-Sep-2013 Gulf of St. Lawrence 46.8642 -63.3318 periphylla KHA490-14 MLI-036 Periphylla 604 14-Aug-2013 Gulf of St. Lawrence 47.681 -60.451 periphylla KHA494-14 MLI-040 Periphylla 632 11-Aug-2013 Gulf of St. Lawrence 49.474 -59.4 periphylla KHA541-14 SABS-005 Periphylla 612 05-Jul-2013 Nova Scotia 42.571 -66.208 periphylla KHA567-14 SABS-031 Periphylla 648 12-Jul-2013 Nova Scotia 42.706 -64.14 periphylla ACO9127 KBCSM438-14 RICK-1048 Chrysaora fuscens 648 08-Jun-2013 Hecate Strait, British Columbia 54.2996 -131.208 KBCSM474-14 RICK-1078 Chrysaora fuscens 648 08-Jun-2013 Hecate Strait, British Columbia 53.9685 -131.142 KBCSM345-14 RICK-1022 Chrysaora 648 04-Jun-2013 Hecate Strait, British Columbia 54.4907 -131.229 melanaster KHA345-14 HUNT-1020 Aurelia aurita 646 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA346-14 HUNT-1021 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA347-14 HUNT-1022 Aurelia aurita 651 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KHA348-14 HUNT-1023 Aurelia aurita 647 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA350-14 HUNT-1025 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA351-14 HUNT-1026 Aurelia aurita 648 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KHA352-14 HUNT-1027 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA353-14 HUNT-1028 Aurelia aurita 652 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA355-14 HUNT-1030 Aurelia aurita 648 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KHA357-14 HUNT-1032 Aurelia aurita 633 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA358-14 HUNT-1033 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA359-14 HUNT-1034 Aurelia aurita 575 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KHA360-14 HUNT-1035 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA361-14 HUNT-1036 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA364-14 HUNT-1039 Aurelia aurita 647 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KHA367-14 HUNT-1042 Aurelia aurita 633 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA369-14 HUNT-1044 Aurelia aurita 648 07-Aug-2013 St. Andrews, New Brunswick 45.1019 -67.0528 KHA370-14 HUNT-1045 Aurelia aurita 648 07-Aug-2013 St. Andrews,New Brunswick 45.1019 -67.0528 KBCSM380-14 KHBC-S13-0065 Aurelia sp. 648 05-Jun-2013 Hecate Strait, British Columbia 54.1898 -132.307 KBCSM406-14 KHBC-S13-0057 Chrysaora 648 07-Jun-2013 Hecate Strait, British Columbia 54.2281 -132.376 fluoresens KHBC187-13 BIOUG-KMH-053 Chrysaora 648 Vancouver Aquarium fluoresens

149

KBCSM411-14 KHBC-S13-0056 Chrysaora 648 07-Jun-2013 Hecate Striat, British Columbia 54.1186 -132.057 melanaster KBCSM336-14 KHBC-S13-0053 Chrysaora sp. 625 04-Jun-2013 Hecate Strait, British Columbia 54.3072 -131.103 KBCSM235-14 KHBC-S13-0007 Cuninidae 658 30-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM824-14 KHBC-S13-0002-02 Periphylla 658 29-May-2013 Hecate Strait, British Columbia 51.3444 -127.965 periphylla KHA596-14 SABS-060 Periphylla 648 30-Jul-2013 Nova Scotia 46.473 -59.137 periphylla KHA611-14 SABS-075 Periphylla 648 27-Jul-2013 Nova Scotia 44.31 -57.746 periphylla KBCSM236-14 KHBC-S13-0008 Scyphozoa 648 30-May-2013 Hecate Strait, British Columbia 52.7082 -129.889 KBCSM242-14 KHBC-S13-0014 Scyphozoa 648 30-May-2013 Hecate Strait, British Columbia 52.742 -130.261 KHA437-14 BIO-012 Scyphozoa 648 15-Jun-2013 Nova Scotia 45.379 -60.01 KHA523-14 MLI-069 Scyphozoa sp. 648 26-Aug-2011 Gulf of St. Lawrence 49.286 -66.642 Staurozoa AAG1976 KHA762-14 PS Lucernaria Lucernaria 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8967 quadricornis 02 quadricornis KHA764-14 PS Lucernaria Lucernaria 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8967 quadricornis 04 quadricornis KHA765-14 PS Lucernaria Lucernaria 648 03-Jun-2014 Southern Avalon Peninsula, Newfoundland 47.0997 -52.8967 quadricornis 05 quadricornis CCSMA156-08 08PROBE-1091 Lucernariidae 658 15-Jul-2008 Churchill, Manitoba 58.85 -93.753 CCSMA199-10 09PROBE-02090 Lucernariidae 658 26-Jul-2009 Churchill, Manitoba 58.8555 -93.805 AAN4493 CCSMA208-10 09PROBE-02795 Lucernariidae 658 26-Jul-2009 Churchill, Manitoba 58.8492 -93.7596 AAN4494 ARCMI613-14 BIOUG14664-D09 Lucernariidae 625 03-Sep-2014 Durban Harbour, Nunavut 67.072 -62.139

CCSMA155-08 08PROBE-1090 Lucernariidae 658 15-Jul-2008 Churchill, Manitoba 58.85 -93.753

CCSMA209-10 09PROBE-02796 Lucernariidae 658 26-Jul-2009 Churchill, Manitoba 58.863 -93.8675

150

Table B.2 Collection data for Cyanea specimens used in this study.

BIN BOLD ID (process COI 16S 18S ITS1 ITS2 Sampling Sampling Site Latitude Longitude ID) Sequence Sequence Sequence Sequence Sequence Date Length Length Length Length Length

North ARCMI603-14 648 547 489 472 12-Sep-2014 Makkovik, Labrador 55.085 -59.171 (AAD3480) ARCMI605-14 658 547 489 472 12-Sep-2014 Makkovik, Labrador 55.085 -59.171 ARCMI607-14 658 547 489 472 12-Sep-2014 Makkovik, Labrador 55.085 -59.171 Atlantic 2 KHA322-14 648 06-Aug- Bay of Fundy, New 44.0059 -67.0389 (AAF9673) 2013 Brunswick KHA558-14 651 547 489 472 25-Jul-2013 Nova Scotia 44.517 -62.052 KHA561-14 552 03-Jul-2013 Nova Scotia 43.447 -63.75 KHA584-14 648 547 489 472 28-Jul-2013 Nova Scotia 45.271 -57.654 KHA585-14 648 547 489 472 28-Jul-2013 Nova Scotia 45.271 -57.654 KHA590-14 648 489 472 26-Jul-2013 Nova Scotia 45.074 -58.938 KHA601-14 648 547 489 472 27-Jul-2013 Nova Scotia 44.959 -57.401 KHA602-14 648 28-Jul-2013 Nova Scotia 45.109 -57.884 KHA603-14 622 30-Jul-2013 Nova Scotia 46.474 -59.707 KHA606-14 648 547 489 472 24-Jul-2013 Nova Scotia 44.388 -62.699 KHA607-14 648 547 489 472 25-Jul-2013 Nova Scotia 45.127 -60.262 KHA608-14 648 25-Jul-2013 Nova Scotia 45.127 -60.262 KHA618-14 648 15-Jul-2013 Nova Scotia 43.362 -63.013 KHA619-14 648 547 489 472 24-Jul-2013 Nova Scotia 44.388 -62.699 KHA620-14 648 26-Jul-2013 Nova Scotia 44.79 -58.705 KHA707-14 648 489 472 19-Jun-2013 New Bridge, 47.1554 -53.6607 Newfoundland KHA708-14 648 489 472 19-Jun-2013 New Bridge, 47.1554 -53.6607 Newfoundland KHA709-14 649 489 472 19-Jun-2013 New Bridge, 47.1554 -53.6607 Newfoundland KHA710-14 648 489 472 19-Jun-2013 New Bridge, 47.1468 -53.4708 Newfoundland KHA711-14 649 489 472 19-Jun-2013 New Bridge, 47.1468 -53.4708 Newfoundland Gulf of St. CCSMA230-10 657 24-Jul-2009 Gordon Point, Manitoba 58.792 -93.751 Lawrence CCSMA231-10 658 24-Jul-2009 Gordon Point, Manitoba 58.792 -93.751 (AAP1190) CCSMA232-10 658 24-Jul-2009 Gordon Point, Manitoba 58.792 -93.751

CCSMA239-10 658 26-Jul-2009 Gordon Point, Manitoba 58.875 -93.8004

151

CCSMA241-10 640 27-Jul-2009 Hudson's Bay, Manitoba 58.8556 -94.23

KHA037-14 648 547 489 472 06-Aug- Pérce, Gulf of the St. 48.5076 -64.163 2013 Lawrence KHA110-14 648 614 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.2105 -60.4012 KHA111-14 658 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.4005 -60.9286 KHA112-14 459 04-Sep-2013 Gulf of the St. Lawrence 47.4005 -60.9286 KHA115-14 648 614 547 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 KHA119-14 566 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 46.9562 -60.8681 KHA129-14 632 489 472 04-Sep-2013 Gulf of the St. Lawrence 46.6572 -61.4559 KHA136-14 646 614 547 04-Sep-2013 Gulf of the St. Lawrence 46.8248 -62.2524 KHA158-14 570 614 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA167-14 613 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.5787 -61.8981 KHA168-14 648 04-Sep-2013 Gulf of the St. Lawrence 47.5787 -61.8981 KHA169-14 643 614 492 489 489 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA170-14 613 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA178-14 621 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA183-14 649 614 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 47.5675 -63.0736 KHA189-14 638 489 472 04-Sep-2013 Gulf of the St. Lawrence 48.664 -63.6422 KHA197-14 648 547 04-Sep-2013 Gulf of the St. Lawrence 48.874 -63.6312 KHA205-14 570 547 489 472 04-Sep-2013 Gulf of the St. Lawrence 48.0141 -63.1698 KHA213-14 648 489 472 04-Sep-2013 Gulf of the St. Lawrence 48.5187 -62.1425 KHA444-14 648 16-Aug- Nova Scotia 44.362 -59.203 2013 KHA499-14 533 538 11-Aug- Gulf of the St. Lawrence 49.732 -59.319 2013 KHA566-14 642 547 16-Jul-2013 Nova Scotia 43.096 -62.246 KHA568-14 648 614 547 489 472 16-Jul-2013 Nova Scotia 42.933 -63.118 KHA569-14 648 547 26-Jul-2013 Nova Scotia 44.698 -58.439 KHA570-14 512 614 547 489 472 26-Jul-2013 Nova Scotia 44.698 -58.439 KHA571-14 643 489 472 26-Jul-2013 Nova Scotia 44.698 -58.439 KHA597-14 648 30-Jul-2013 Nova Scotia 46.473 -59.137 KHA605-14 648 547 30-Jul-2013 Nova Scotia 46.474 -59.707 KHA609-14 648 489 472 28-Jul-2013 Nova Scotia 45.35 -57.784 KHA610-14 658 547 28-Jul-2013 Nova Scotia 45.35 -57.784 KHA613-14 648 24-Jul-2013 Nova Scotia 44.388 -62.699 KHA622-14 627 525 547 19-Jul-2013 Nova Scotia 43.424 -60.355

152

KHA646-14 648 489 472 16-Jul-2013 Nova Scotia 43.254 -62.682 KHA665-14 642 547 459 459 19-Jul-2013 Nova Scotia 43.626 -60.32 KHA672-14 574 04-Sep-2013 Gulf of the St. Lawrence 46.8248 -62.2524 Pacific CCSMA129-08 648 24-May- Klaskino Inlet, British 50.2965 -127.72 (AAP1194) 2013 Columbia KBCSM002-14 648 614 547 24-May- Klaskino Inlet, British 50.2965 -127.72 2013 Columbia KBCSM227-14 648 489 472 30-May- Hecate Strait, British 51.3444 -127.965 2013 Columbia KBCSM276-14 648 457 489 472 01-Jun-2013 Hecate Strait, British 53.2481 -131.164 Columbia KBCSM277-14 648 547 489 472 01-Jun-2013 Hecate Strait, British 53.2663 -131.055 Columbia KBCSM284-14 643 614 547 489 472 02-Jun-2013 Hecate Strait, British 53.3404 -131.14 Columbia KBCSM287-14 649 614 547 489 472 02-Jun-2013 Hecate Strait, British 53.4427 -131.115 Columbia KBCSM312-14 649 489 472 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM313-14 648 614 547 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM314-14 649 547 472 472 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM315-14 649 489 472 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM316-14 649 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM322-14 649 492 472 03-Jun-2013 Hecate Strait, British 54.0569 -131.145 Columbia KBCSM338-14 649 614 547 04-Jun-2013 Hecate Strait, British 54.4187 -131.087 Columbia KBCSM339-14 649 489 472 04-Jun-2013 Hecate Strait, British 54.4187 -131.087 Columbia KBCSM340-14 649 614 547 04-Jun-2013 Hecate Strait, British 54.4187 -131.087 Columbia KBCSM347-14 649 488 472 05-Jun-2013 Hecate Strait, British 54.6306 -131.502 Columbia KBCSM348-14 648 614 547 05-Jun-2013 Hecate Strait, British 54.6306 -131.502 Columbia KBCSM349-14 644 489 472 05-Jun-2013 Hecate Strait, British 54.6306 -131.502 Columbia KBCSM350-14 649 05-Jun-2013 Hecate Strait, British 54.4974 -131.594 Columbia KBCSM351-14 649 547 05-Jun-2013 Hecate Strait, British 54.4974 -131.594 Columbia KBCSM352-14 649 489 472 05-Jun-2013 Hecate Strait, British 54.4974 -131.594 Columbia

153

KBCSM374-14 648 614 547 05-Jun-2013 Hecate Strait, British 54.1898 -132.307 Columbia KBCSM375-14 649 489 472 05-Jun-2013 Hecate Strait, British 54.1898 -132.307 Columbia KBCSM376-14 649 05-Jun-2013 Hecate Strait, British 54.1898 -132.307 Columbia KBCSM383-14 649 614 547 06-Jun-2013 Hecate Strait, British 54.1856 -132.426 Columbia KBCSM386-14 649 489 472 06-Jun-2013 Hecate Strait, British 54.2925 -132.286 Columbia KBCSM391-14 643 614 547 06-Jun-2013 Hecate Strait, British 54.3196 -132.378 Columbia KBCSM400-14 648 489 472 07-Jun-2013 Hecate Strait, British 54.2317 -132.871 Columbia KBCSM401-14 553 07-Jun-2013 Hecate Strait, British 54.2317 -132.871 Columbia KBCSM403-14 648 07-Jun-2013 Hecate Strait, British 54.2317 -132.871 Columbia KBCSM404-14 648 614 547 07-Jun-2013 Hecate Strait, British 54.2281 -132.376 Columbia KBCSM412-14 614 547 489 472 07-Jun-2013 Hecate Strait, British 54.1186 -132.057 Columbia KBCSM420-14 648 489 472 07-Jun-2013 Hecate Strait, British 54.1573 -131.751 Columbia KBCSM436-14 643 614 547 08-Jun-2013 Hecate Strait, British 54.4132 -131.252 Columbia KBCSM437-14 648 489 472 08-Jun-2013 Hecate Strait, British 54.4132 -131.252 Columbia KBCSM440-14 642 547 08-Jun-2013 Hecate Strait, British 54.2996 -131.208 Columbia KBCSM441-14 648 489 472 08-Jun-2013 Hecate Strait, British 54.2996 -131.208 Columbia KBCSM442-14 643 547 08-Jun-2013 Hecate Strait, British 54.2996 -131.208 Columbia KBCSM443-14 643 547 489 472 08-Jun-2013 Hecate Strait, British 54.2996 -131.208 Columbia KBCSM456-14 648 489 08-Jun-2013 Hecate Strait, British 54.1131 -131.173 Columbia KBCSM457-14 643 547 08-Jun-2013 Hecate Strait, British 54.1131 -131.173 Columbia KBCSM458-14 648 547 489 472 08-Jun-2013 Hecate Strait, British 54.1131 -131.173 Columbia KBCSM459-14 648 547 487 472 08-Jun-2013 Hecate Strait, British 54.1131 -131.173 Columbia KBCSM463-14 643 614 547 489 472 08-Jun-2013 Hecate Strait, British 54.1131 -131.173 Columbia KBCSM488-14 648 489 09-Jun-2013 Hecate Strait, British 53.7331 -131.187 Columbia KBCSM489-14 648 547 09-Jun-2013 Hecate Strait, British 53.7331 -131.187

154

Columbia KBCSM496-14 648 489 472 09-Jun-2013 Hecate Strait, British 53.721 -130.984 Columbia KBCSM497-14 648 09-Jun-2013 Hecate Strait, British 53.721 -130.984 Columbia KBCSM498-14 648 547 09-Jun-2013 Hecate Strait, British 53.721 -130.984 Columbia KBCSM505-14 648 285 09-Jun-2013 Hecate Strait, British 53.6431 -131.256 Columbia KBCSM506-14 648 614 547 09-Jun-2013 Hecate Strait, British 53.6431 -131.256 Columbia KBCSM507-14 648 547 489 472 09-Jun-2013 Hecate Strait, British 53.6431 -131.256 Columbia KBCSM509-14 648 547 489 472 09-Jun-2013 Hecate Strait, British 53.6255 -131.24 Columbia KBCSM692-14 643 547 489 472 24-May- Klaskino Inlet, British 50.2965 -127.72 2013 Columbia KBCSM693-14 648 614 547 489 472 24-May- Klaskino Inlet, British 50.2965 -127.72 2013 Columbia KBCSM694-14 648 547 24-May- Klaskino Inlet, British 50.2965 -127.72 2013 Columbia KHBC180-13 648 547 489 472 Vancouver Aquarium, British Columbia KHBC181-13 648 489 472 Vancouver Aquarium, British Columbia Atlantic 1 KHA442-14 648 15-Aug- Nova Scotia 44.048 -59.596 (ACM6954) 2013 KHA443-14 648 13-Aug- Nova Scotia 42.486 -63.464 2013 KHA447-14 648 13-Aug- Nova Scotia 42.513 -64.026 2013 KHA449-14 646 15-Aug- Nova Scotia 44.048 -59.596 2013 KHA450-14 647 13-Aug- Nova Scotia 42.486 -63.464 2013 KHA538-14 622 03-Jul-2013 Nova Scotia 43.403 -64.552 KHA542-14 648 03-Jul-2013 Nova Scotia 43.3 -64.14 KHA544-14 648 03-Jul-2013 Nova Scotia 43.432 -64.58 KHA546-14 648 12-Jul-2013 Nova Scotia 42.924 -64.095 KHA547-14 648 03-Jul-2013 Nova Scotia 43.64 -63.875 KHA555-14 650 25-Jul-2013 Nova Scotia 44.517 -62.052 KHA559-14 642 547 25-Jul-2013 Nova Scotia 44.517 -62.052 KHA564-14 648 489 472 12-Jul-2013 Nova Scotia 42.747 -64.406 KHA612-14 648 547 24-Jul-2013 Nova Scotia 44.388 -62.699 KHA614-14 648 547 489 472 19-Jul-2013 Nova Scotia 43.676 -60.143

155

KHA615-14 648 547 489 472 19-Jul-2013 Nova Scotia 43.676 -60.143 KHA616-14 547 489 472 15-Jul-2013 Nova Scotia 43.488 -63.07 KHA617-14 648 547 489 472 15-Jul-2013 Nova Scotia 43.362 -63.013 KHA621-14 648 547 489 472 19-Jul-2013 Nova Scotia 43.424 -60.355 KHA645-14 648 489 472 16-Jul-2013 Nova Scotia 43.254 -62.682 KHA647-14 647 547 16-Jul-2013 Nova Scotia 43.254 -62.682 KHA648-14 648 403 489 419 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA649-14 648 489 472 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA650-14 603 533 547 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA651-14 602 547 489 472 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA652-14 648 459 18-Jul-2013 Nova Scotia 43.754 -61.388 KHA653-14 648 18-Jul-2013 Nova Scotia 43.676 -61.037 KHA654-14 648 547 18-Jul-2013 Nova Scotia 43.676 -61.037 KHA655-14 648 489 472 18-Jul-2013 Nova Scotia 43.676 -61.037 KHA656-14 648 615 547 18-Jul-2013 Nova Scotia 43.676 -61.037 KHA657-14 648 615 547 489 472 18-Jul-2013 Nova Scotia 43.676 -61.037 KHA658-14 648 615 547 489 472 18-Jul-2013 Nova Scotia 43.718 -60.64 KHA659-14 615 489 472 18-Jul-2013 Nova Scotia 43.718 -60.64 KHA660-14 648 18-Jul-2013 Nova Scotia 43.718 -60.64 KHA661-14 648 547 29-Jul-2013 Nova Scotia 45.52 -60.11 KHA662-14 648 489 472 22-Jul-2013 Nova Scotia 44.467 -60.621 KHA663-14 648 615 547 22-Jul-2013 Nova Scotia 44.651 -60.408 KHA664-14 648 547 489 472 19-Jul-2013 Nova Scotia 43.626 -60.32 KHA666-14 642 547 489 472 18-Jul-2013 Nova Scotia 43.761 -61.151 KHA667-14 648 547 489 472 18-Jul-2013 Nova Scotia 43.761 -61.151

156

Appendix C: R Code

Histogram Construction taxa<-read.csv(file.choose(),header=TRUE) taxa attach(taxa) head(taxa) hist(Distances)

ANOVA

Salinity1<-read.csv(file.choose(),header=TRUE) Salinity1 boxplot(Salinity1) Salinity1.aov<-aov(Salinity1$salinity~Salinity1$lineage) summary(Salinity1.aov)

157