Antibacterial Activity and Lantibiotic Post-Translational Modification Genes in Streptococcus Spp

Annals of Microbiology (2019) 69:131–138 https://doi.org/10.1007/s13213-018-1407-2

ORIGINAL ARTICLE

Antibacterial activity and lantibiotic post-translational modification genes in Streptococcus spp. isolated from ruminal fluid

Yasmin Neves Vieira Sabino1 & Romário Costa Fochat1 & Junior Cesar Fernandes Lima2 & Marlice Teixeira Ribeiro2 & Pedro Braga Arcuri2 & Jailton da Costa Carneiro2 & Marco Antônio Machado2 & Daniele Ribeiro de Lima Reis2 & Alessandra Barbosa Ferreira Machado3 & Humberto Moreira Húngaro1 & João Batista Ribeiro2 & Aline Dias Paiva3

Received: 17 May 2018 /Accepted: 11 November 2018 /Published online: 6 December 2018 # Springer-Verlag GmbH Germany, part of Springer Nature and the University of Milan 2018

Abstract The production of bacteriocins is frequently described in high microbial diversity environments. The aims of this study were to screen Streptococcus spp. isolated from rumen for their antibacterial potential and to determine the presence of post-translational modification genes for lantibiotic class of bacteriocins. The isolates were tested for production of antibacterial compounds by the spot-on-lawn assay. Presence of interfering factors and the sensitivity to proteinase K were evaluated. The ruminal bacteria were identified by 16S rRNA gene sequencing and the subspecific discrimination of the isolates belonging to the same specie was performed by PFGE. The presence of lantibiotic post-translational modification genes (lanB, lanC,andlanM)intobacterial genomes was performed by PCR. The bacteriocin-like inhibitory substances showed broad inhibitory activity and the producer cells were identified as S. equinus, S. lutetiensis,andS. gallolyticus. According to PFGE, the isolates identified as S. equinus belong to different strains. Three ruminal isolates showed at least one of the lantibiotic post-translational modification genes, and lanC was more frequently detected (75%). The production of broad-spectrum bacteriocin-like inhibitory substances by rumen strains suggests that antimicrobial peptides may play an important role in competition in the complex ruminal ecosystem.

Keywords Bacteriocin . Rumen . Streptococcus sp. . Antibacterial activity . Lantibiotic . lanC

Introduction Bacteriocins comprise a heterogeneous group of peptides based on size, molecular weight, structure, biochemical proper- Antimicrobial peptides are produced by several organisms, ties, thermostability, mechanism of action, presence of post- including plants, insects, mammals, and microorganisms (Li translational modified amino acid residues, and spectrum of in- et al. 2012). Antimicrobial peptides ribosomally synthesized hibitory activity (Kaškonienė et al. 2017). According to Alvarez- by bacteria are known as bacteriocins (Cotter et al. 2005), Sieiro et al. (2016), bacteriocins produced by lactic acid bacteria while antimicrobial peptides that were not fully characterized or other microorganisms can be classified into three main groups, regarding the amino acid sequence and biochemical properties based on the biosynthesis mechanism and biological activity: are defined as bacteriocin-like inhibitory substances (BLIS) (Settani and Corsetti 2008). Bacteriocins and BLIS act as an- – Class I: represented by ribosomally produced and post- tagonistic substances and show bactericidal or bacteriostatic translationally modified peptides (molecular weight < activity against target cells (Cleveland et al. 2001). 10 kDa). This class encompasses all the peptides that undergo enzymatic modification during biosynthesis, which provides molecules with uncommon amino acids * Aline Dias Paiva and structures that have an impact on their properties [email protected] (e.g., lanthionine, heterocycles, head-to-tail cyclization, glycosylation); 1 Faculdade de Farmácia, Universidade Federal de Juiz de Fora, Juiz – Class II: includes unmodified peptides with molecular de Fora, Minas Gerais, Brazil weight lower than 10 kDa, which do not require en- 2 Embrapa Gado de Leite, Embrapa, Juiz de Fora, Minas Gerais, Brazil zymes for their maturation other than a leader pepti- 3 Instituto de Ciências Biológicas e Naturais, Universidade Federal do dase and/or a transporter; Triângulo Mineiro, Uberaba, Minas Gerais, Brazil 132 Ann Microbiol (2019) 69:131–138

– Class III: comprises unmodified peptides with a molecu- 85% N2, 10% H2,and5%CO2). Bacterial growth was deter- lar weight greater than 10 kDa that show bacteriolytic or mined by measuring the optical density at 600 nm. non-lytic mechanism of action. Antagonistic activity and exclusion of interfering In complex ecosystems, with high microbial diversity, as factors the ruminal environment, the production of bacteriocins oc- curs at high frequency (20–50%) (Mantovani et al. 2001; Antagonistic activity was evaluated by the spot-on-lawn Whitford et al. 2001), a feature that can be considered a com- method (Booth et al. 1977). The selected ruminal bacteria petitive advantage for the producer cells. Bacteria belonging were spotted onto BHI agar and incubated anaerobically to the genus Streptococcus, Enterococcus, Ruminococcus,and (37 °C, 18 h). Molten semi-solid BHI (0.75% agar), previous- Butyrivibrio have been characterized as the main bacteriocin ly inoculated with the indicator bacteria (105 CFU mL−1), was producers among ruminal strains (Whitford et al. 2001; poured over agar plates already containing the bacterial colo- Kalmokoff et al. 2003;Wangetal.2012; Chakchouk- nies. Plates were incubated at a suitable temperature and at- Mtibaa et al. 2014). mosphere for each indicator organism. The antimicrobial ac- Bacteriocins naturally produced by ruminal bacteria have tivity was determined by the presence of inhibition zones of shown an increased stability in the rumen, mostly because they the indicator organism growth around the colonies of selected had evolved in the same competitive environment, as well as a bacteria (> 6 mm diameter). As bacteriocins and BLIS are spectrum of activity similar to nisin, the most widely studied usually active against phylogenetically related bacteria or bacteriocin (Russell and Mantovani 2002). Thus, bacteriocins against bacteria belonging to the same ecological niche produced by ruminal isolates could be used in order to modify (Cotter et al. 2005), we selected Streptococcus macedonicus the microbial populations in the rumen and to induce changes and Streptococcus equinus, strains also isolated from rumen in ruminal fermentation parameters, similarly to ionophores and belonging to the same culture collection, to be used as (Mantovani and Russell 2002; Kisidayová et al. 2009). In ad- indicator bacteria. dition, the application of bacteriocins or even the bacteriocin- Ruminal bacterial isolates with proven antagonistic activity producing bacteria has been suggested in areas such as food were tested for the presence of interfering factors, in order to and pharmaceutical industry, odontology, agriculture, and hu- verify if the antagonistic activity observed was indeed due to man and veterinary medicine (Drider et al. 2016; Barbosa et al. the production of antimicrobial peptides and not to the activity 2017;Kaškonienė et al. 2017;Lietal.2017). of other factors, such as bacteriophage infection or production In the present study, we have evaluated the production of of acidic compounds. bacteriocin-like inhibitory substances by ruminal bacteria, as To evaluate the presence of bacteriophage, an agar piece well as detected several genes involved in post-translational (3 mm) of the inhibition zone observed in the spot-on-lawn modification of lantibiotics, a commonly reported class of method was aseptically removed, macerated in saline (NaCl bacteriocins. 0.9%, pH 7.0), and centrifuged (12,000g, 20 min). Then, an aliquot of 200 μL of the supernatant was transferred to 3 mL culture previously inoculated with the indicator microorgan- Materials and methods ism. After incubation for 10 min at room temperature, an aliquot of 200 μL was added to 3.5 mL of semi-solid BHI, Microorganisms and growth conditions which was poured over a prior layer of solid BHI (Turner and Jordan 1981). After incubation, the plates were visually Thirty Gram-positive bacteria, previously isolated from bo- inspected for the presence of lytic zones, indicative of bacte- vine ruminal fluid, and belonging to the culture collection of riophage action. the Laboratory of Rumen Microbiology, Embrapa Dairy To exclude the possibility of the production of acidic com- Cattle, Juiz de Fora, MG, Brazil, were randomly selected for pounds being responsible for the observed antagonism, after in vitro screening of antagonistic activity. The isolates were the spot-on-lawn test, the pH inside and outside of the growth maintained in glycerol containing brain heart infusion (BHI) inhibition zones was determined twice using pH test strips broth (10% final concentration), at − 80 °C, until use. (Advantec Narrow Range pH Test papers, from 5.4 to 7.0 pH). The selected bacteria were grown in BHI broth, under anaerobic conditions, at 39 °C, overnight. The culture media were Effect of proteinase K on the biological activity prepared anaerobically, under O2-free carbon dioxide flux, and of the antagonistic substances the final pH was adjusted to 6.5. Liquid media were distributed in tubes, under O2-free carbon dioxide flux, tightly closed with In order to evaluate the protein nature of antagonistic sub- rubber lids and sealed with an aluminum seal; solid media were stances detected on the spot-on-lawn method, sensitivity to distributed on plates, in an anaerobic chamber (atmosphere: proteolytic enzyme was carried out. Initially, the ruminal Ann Microbiol (2019) 69:131–138 133 bacteria for which the antagonistic activity has been demon- followed by 35 cycles of 95 °C for 30 s (denaturation), 60 °C strated were inoculated on BHI agar plates and incubated in for 30 s (annealing), and 72 °C for 30 s (polymerization). The anaerobiosis, at 37 °C, in duplicates. After 18 h of growth, in amplification cycle was followed by a final extension at 72 °C one of the plates, proteinase K (5 mg mL−1) was added (5 μL) for 7 min, and the tubes were kept at 4 °C. The PCR products next to each colony, and the plates were reincubated, at 37 °C, were analyzed by agarose gel electrophoresis (1.5% wv−1), for 3 h, in aerobiosis, to allow the enzymatic activity. stained with ethidium bromide (0.2 μgmL−1) and visualized Thereafter, a semi-solid medium containing S. macedonicus using UV transilluminator. or S. equinus as an indicator organism was poured over all the The 16S rRNA gene amplicons were purified by EasyPrep plates. The proteolytic activity on the antagonistic substances Gel/PCR Purification Kit (EasyPath), following the manufac- was observed by alterations of the inhibition zones of the turer’s instructions. Sample concentrations were measured by indicator growth (i.e., evidence of growth of the target organ- NanoDrop and the DNAwas used for sequencing by the chain ism where the proteinase K has been added), as compared to termination method, using a MegaBACE™ 1000 automated the control plates (no proteinase K added). sequencer (GE Healthcare). Two reactions were performed, using the forward primer and the reverse primer. All consen- Activity spectrum of the antagonistic substances sus sequences obtained were compared to those available in produced by the selected ruminal bacteria the GenBank database (NCBI). The alignment of the sequences was performed using the Basic Local Alignment The inhibitory activity of the antagonistic compounds was de- Search Tool algorithm for nucleotide (BLASTn) (Altschul termined against a range of bacteria, including Bacillus cereus et al. 1990). ATCC 14579, Bacillus cereus ATCC 33018, Enterococcus faecalis ATCC 29212, Escherichia coli ATCC 25922, Genetic characterization of the ruminal isolates Lactobacillus acidophilus ATCC 4356, Staphylococcus aureus by pulsed-field gel electrophoresis ATCC 25923, Lactococcus lactis DPC 3147, Listeria monocytogenes SLCC 5779, Streptococcus salivarius 20P3, Ruminal isolates belonging to the same specie were submitted and the ruminal strains Streptococcus uberis, Streptococcus to pulsed-field gel electrophoresis (PFGE), using the restric- equinus, Klebsiella sp., Pseudomonas fluorescens,and tion endonucleases SmaIandApaI (New England BioLabs), Pseudomonas sp. The spectrum of action was evaluated by according to Benson and Ferrieri (2001), with modifications. the spot-on-lawn method, as described above. The following conditions were used: initial pulse time of 1 s, final pulse time of 8 s, time running of 20 h, speed of 16S rRNA gene sequencing 6Vcm−1, and angle of 120°. Lambda Ladder Bio-Rad and Lambda Hind III were used as reference markers. Gels were The ruminal isolates were submitted to identification by 16S stained with ethidium bromide and visualized using UV trans- rRNA gene sequencing. Total DNA was extracted using the illuminator. The profiles obtained were analyzed using phenol-chloroform method, with modifications (Oliveira et al. BioNumerics software v. 3.0 (Applied Maths), considering 2002). The integrity of the extracted DNA was verified by maximum optimization of 1%, and based on Dice similarity agarose gel electrophoresis (1%) using 1× TBE buffer of bands, with a maximum position tolerance of 1%. (90 mM Tris base, 90 mM boric acid, and 0.1 mM EDTA— pH 8.0). The gel was stained with ethidium bromide Detection of lantibiotic post-translational (0.2 μgmL−1) and visualized using UV transilluminator. modification genes by PCR DNA concentration and purity were measured by NanoDrop (Thermo Scientific); the samples were diluted to 50 ng μL−1 The detection of the genes lanB, lanC,andlanM, involved in for PCR reactions. post-translational modification of lantibiotic class of bacterio- The 16S rRNA gene amplification reactions were per- cins, was performed using primers previously described by formed in DNA thermal cycler GeneAmp PCR System 9700 Hyink et al. (2005)andWirawanetal.(2006). (Applied Biosystems), using the pair of universal primers 27F The PCR reaction (25 μL)wascomposedby17.8μL (AGAGTTTGATCCTGGCTCAG) and 536R (GTATTACC Milli-Q water, 2.5 μL of 10× buffer, 0.625 μL of dNTPs

GCGGCTGCTG) (Suzuki et al. 1998). The reaction (25 μL) (10 mM), 1.25 μL of MgCl2 (50 mM), 1 μL of primer F was composed by 17.8 μL of Milli-Q water, 2.5 μLof10× (10 pM μL−1), 1 μL of primer R (10 pM μL−1), 0.3 μLof −1 buffer, 0.625 μL of dNTPs (10 mM), 1.25 μLofMgCl2 TaqDNApolymerase(5UμL ), and 0.6 μLofDNA (50 mM), 1 μL of primer F (10 pM μL−1), 1 μLofprimerR (50 ng μL−1). The PCR conditions included an initial dena- (10 pM μL−1), 0.3 μL of Taq DNA polymerase (5 U μL−1), turation step at 95 °C for 2 min, followed by 30 cycles of and 0.6 μL of template DNA (50 ng μL−1). The PCR condi- 95 °C for 30 s (denaturation), 40 °C for 30 s (annealing), tions included an initial denaturation step at 95 °C for 5 min, and 65 °C for 30 s (extension). The amplification cycle was 134 Ann Microbiol (2019) 69:131–138 followed by a final extension step at 65 °C for 10 min, and the Table 1 Inhibitory spectrum of the antagonistic substances produced by tubes were kept at 4 °C. As a control of the presence of the the selected ruminal isolates modification genes, we used Streptococcus salivarius 20P3 Target strains Isolates (for lanB and lanC)andLactococcus lactis DPC 3147 (for lanM). As negative control, we used Escherichia coli ATCC C6I8 C6I9 ISO37 AS1.5 25922. The PCR products were analyzed by agarose gel elec- Bacillus cereus ATCC 14579 + + + − trophoresis (1.5% wv−1),stainedwithethidiumbromide Bacillus cereus ATCC 33018 + + + − (0.2 μgmL−1) and visualized using UV transilluminator. Enterococcus faecalis ATCC 29212 + + + + Amplification products with the specific expected sizes Escherichia coli ATCC 25922 + + + + (400–500 bp for lanB gene, and fragments with 200–300 bp Lactobacillus acidophilus ATCC 4356 + + + + for both lanC and lanM genes) were recorded as positive Staphylococcus aureus ATCC 25923 + + + + results for each lantibiotic post-translational modification Lactococcus lactis DPC 3147 + + + + gene for each isolate (Perin and Nero 2014). To estimate the Listeria monocytogenes SLCC 5779 + + + − size of the amplified fragments, a 100-bp molecular weight Streptococcus salivarius 20P3 + + + + marker (Ludwig Biotech®) was used. Positive results were Streptococcus uberis +++ + confirmed by repeating the PCR reactions. Streptococcus equinus +++ + Klebsiella sp. + + + + Results Pseudomonas fluorescens +++ + Pseudomonas sp. + + + +

Of the 30 ruminal isolates evaluated, four (13.8%) inhibited B+^ presence or B−^ absence of antagonistic activity the growth of Streptococcus equinus and Streptococcus Spectrum of action of the antagonistic substances produced by the rumi- macedonicus, which were initially used as indicator bacteria. nal isolates C6I8, C6I9, ISO37, and AS1.5. Different bacterial strains Since the antagonistic activity has been proven, the ruminal were used as indicator microorganisms on the spot-on-lawn method bacteria identified as C6I8, C6I9, ISO37, and AS1.5 were selected for the subsequent experiments. were evaluated for their peptidic character. The antagonistic The inhibitory spectrum of the ruminal isolates C6I8, C6I9, compounds produced by the four ruminal bacteria were sen- ISO37, and AS1.5 are summarized in Table 1. The antibacte- sitive to proteinase K, since they lost the ability to inhibit the rial substance produced by C6I8, C6I9, and ISO37 inhibited growth of indicator bacteria, as evidenced by altering the in- the growth of all indicator bacteria tested (n = 14), while hibition zones (Fig. 1). The inactivation of the antimicrobial AS1.5 inhibited the growth of 11 indicators. The ruminal iso- substances after treatment with proteinase K confirmed the lates also inhibited the growth of the Gram-negative bacteria protein nature of such compounds, which suggests that the Escherichia coli (ATCC 25922), Klebsiella sp., Pseudomonas inhibitory compounds produced by the ruminal bacteria eval- fluorescens,andPseudomonas sp., a feature that, combined uated could be bacteriocins. with the growth inhibition of bacteria belonging to different The amplification of the 16S rRNA gene, using the 27F genera, demonstrates the broad spectrum of activity of the and 536R universal primers, generated amplicons in the size antagonistic compounds produced by these ruminal isolates. range of 500 to 600 bp (expected size of 527 bp). The purified Streptococcus equinus (also isolated from ruminal fluid) PCR products were sequenced and the 16S rRNA gene se- and Listeria monocytogenes SLCC 5779 were the most sen- quences obtained from the four isolates (from 514 to 523 bp in sitive bacteria to the antagonistic substances produced by the length) were compared to the sequences available in the ruminal isolates evaluated, as the largest inhibition zones were GenBank database. The percentages of identity for the best observed on spot-on-lawn assays when these bacteria were score in GenBank were always equal to 100% with the size of used as target strains. the analyzed fragment. The presence of bacteriophages was not observed in any of Analyses of similarity among the 16S rRNA gene sequences the ruminal bacteria evaluated, since no lysis plates were vi- showed that all the ruminal isolates evaluated belonged to the sualized after culture. Inside the growth inhibition zones, a pH Streptococcus genus and had a 100% sequence identity to three of 6.2 was observed, while pH 6.0 was detected in the outer different species: Streptococcus equinus (C6I8 and C6I9), portion of the inhibition zone, confirming that the antimicro- Streptococcus lutetiensis (ISO37), and Streptococcus bial activity was not due to the production of acidic com- gallolyticus (AS1.5). The 16S rRNA gene sequences of the pounds along the bacterial metabolism. ruminal isolates were deposited in the GenBank sequence da- Since the interference of bacteriophage presence and acid tabase under accession numbers MF045075 (S. equinus C6I9), production on the antagonistic activity were excluded, the MF045076 (S. equinus C6I8), MF045078 (S. gallolyticus antimicrobial compounds produced by the ruminal isolates AS1.5), and MF045079 (S. lutetiensis ISO37). Ann Microbiol (2019) 69:131–138 135

Fig. 1 Sensitivity to proteinase K of the antagonistic compounds produced by the isolates C6I8 (1), C6I9 (2), AS1.5 (3), and ISO 37 (4). a Inhibition zone around the bacterial colony. b Changes in the inhibition zone after proteinase K application. Streptococcus macedonicus was used as indicator microorganism on the spot-on-lawn method. The figure is representative of three replicate plates

The subspecific discrimination of the isolates identified as The presence of post-translational modification genes of Streptococcus equinus (C6I8 and C6I9) was made by the lantibiotics was evaluated in genomic DNA of the selected PFGE technique and resulted in different profiles of polymor- ruminal isolates. Three isolates showed at least one of the phism after cleavage of the genomic DNA by the endonucle- screened genes (Table 2). ases SmaIandApaI. The DNA macrofragments obtained for Only the isolate identified as Streptococcus gallolyticus each isolate varied in size, and eight to ten fragments were (AS1.5) showed an amplicon of 400 to 500 bp, suggesting detected when ApaI was used, while when SmaI was used, the presence of lanB gene into the genome. Three isolates, eight fragments were observed in PFGE (Fig. 2a). Streptococcus equinus (C6I8), Streptococcus lutetiensis The PFGE patterns were analyzed in Bionumerics, and two (ISO37), and Streptococcus gallolyticus (AS1.5), showed distinct clusters, at a similarity level of 98%, were observed. fragments ranging from 200 to 300 bp, suggesting that they The isolates C6I8 and C6I9 showed a similarity of 72% when carry the lanC gene. Regarding lanM gene, DNA fragments in SmaI was used; on the other hand, 40% similarity was observed the size range of 200 to 300 bp were solely found in the isolate when the genomic DNA of the same isolates was cleaved by identified as Streptococcus equinus (C6I8) (Table 2). ApaI endonuclease (Fig. 2b). These differences in the percent- age results among the endonucleases are due to the number of DNA fragments generated after their respective DNA cleavage, Discussion being the difference between the S. equinus isolates more evidenced using the ApaI endonuclease. Taken together, these re- Growth promoters, including antibiotics, have been used sults indicate that the bacteria are genetically distinct from each for several years aimed to alter ruminal fermentation pro- other, representing different strains of Streptococcus equinus. cess and to increase feed conversion efficiency (Russell

Fig. 2 a Pulsed-field gel electrophoresis of the isolates identified as fragment patterns of Streptococcus equinus isolates (C6I8 and C6I9) at a Streptococcus equinus (C6I8 (1, 3) and C6I9 (2, 4)) after cleavage by 98% similarity level. Cluster analysis was performed with Bionumerics by ApaI (1, 2) and SmaI (3, 4) endonucleases. M—Lambda Hind III; M using the Dice correlation coefficient and the unweighted pair group math- ′—Lambda Ladder Bio-Rad. b Cluster analysis of SmaIandApaI-PFGE ematical average (UPGMA) clustering algorithm 136 Ann Microbiol (2019) 69:131–138

Table 2 Post-translational modification genes of lantibiotic class of The antimicrobial substances produced by the four ruminal bacteriocins (lanB, lanC, lanM) in ruminal bacteria bacteria were sensitive to proteinase K, demonstrating the Isolate code Identification Lantibiotic biosynthesis genes protein nature of these bioactive compounds. The in vitro evaluation of the sensitivity to proteolytic enzymes is indica- lanB lanC lanM tive of the sensitivity to the gastrointestinal tract enzymes, an important feature for selecting biopreservatives (Chen and C6I8 Streptococcus equinus − ++ Hoover 2003), a potential application field for antimicrobial C6I9 Streptococcus equinus −−− peptides produced by bacteria. ISO37 Streptococcus lutetiensis − + − All the BLIS-producing bacteria evaluated in this study be- AS1.5 Streptococcus gallolyticus ++− long to the genus Streptococcus. Production of broad-spectrum B+^ presence or B−^ absence of characteristic fragments on agarose gel antimicrobial peptides has been reported by this bacterial ge- electrophoresis nus, such as the G32 peptide produced by S. salivarius Post-translational modification genes of lantibiotic class of bacteriocins (Wescombe et al. 2012), mutacin 1140 from S. mutans (lanB, lanC, lanM), detected in the ruminal isolates C6I8, C6I9, ISO37, JH1000 (Hillman et al. 1998;Escanoetal.2015), thermophilin and AS1.5. The presence of characteristic fragments was visualized on agarose gel electrophoresis 1277 from S. thermophilus SBT1277(Kabukietal.2011), and suicin 3908 from S. suis (Vaillancourt et al. 2015). Two of the ruminal isolates were identified as and Strobel 1989). However, the use of antibiotics as Streptococcus equinus, which is very prevalent in bovine ru- growth promoters in animals is discouraged because of men (Whitford et al. 2001), and according to some authors, the spread of antimicrobial resistance genes and the pres- more than 20% of these isolates show antimicrobial activity ence of antibiotic residues in animal products. In this con- (Mantovani et al. 2001; Whitford et al. 2001 , Joachimsthal text, bacteriocins and BLIS have been evaluated as prom- et al. 2010). Among the bacteriocins produced by S. equinus ising molecules to be used as substitutes or co-adjuvants to stands out bovicin HC5, produced by S. equinus HC5 the use of antibiotics, being useful in the control of infec- (Mantovani et al. 2002), bovicin HJ50 from S. equinus HJ50 tions and in the reduction or elimination of enteric patho- (Wang et al. 2014), and SB15 produced by S. equinus Sb15 gens, as well as in the reduction of losses during ruminal (Joachimsthal et al. 2010). fermentation (reducing methane and ammonia production) PFGE is widely used as a molecular fingerprinting tech- (Joerger 2003). nique for bacterial identification (Zou et al. 2010, 2013). Usually, bacteriocins and BLIS produced by Gram-positive Cluster analysis is useful to group bacterial isolates based on bacteria have low activity against Gram-negative bacteria, PFGE patterns to understand their differences and similarities, since the presence of the outer membrane in the last group as well as to characterize the relationships among them. limits the activity of bacteriocins that act on the target cell According to the results obtained by PFGE, the isolates membrane (Ortolani et al. 2010), such as the case of many C6I8 and C6I9, identified as S. equinus, belong to different bacteriocins and BLIS produced by Gram-positive strains. strains. In addition, differences in the spectrum of action of the The antagonistic compounds produced by the ruminal isolates antimicrobial compounds produced by such isolates, as well evaluated in this study showed broad spectrum of action, since as in the detection of post-translational modification genes of they were capable of inhibiting the growth of phylogenetically lantibiotics, were observed. Taken together, these results clear- related bacteria (such as S. equinus), as expected for bacterio- ly show that the isolates C6I8 and C6I9 are different strains of cins produced by Gram-positive bacteria (Rodriguez et al. S. equinus, which produce antimicrobial compounds with dis- 2000), but also inhibited Gram-negative strains, which is con- tinct physicochemical properties. sidered less common. The genes that encode the most different classes of bacte- Among the bacteria that were sensitive to the antagonistic riocins in Gram-positive bacteria can be present in plasmidial substances evaluated, we can highlight Escherichia coli, or chromosomal DNA, or, occasionally, in transposable ele- Staphylococcus aureus, Streptococcus species, Klebsiella ments or DNA derived from bacteriophage. The set of genes sp., Pseudomonas sp., and Bacillus cereus. Escherichia coli, related to these peptides includes structural, immunity, and S. aureus,andStreptococcus spp. belong to the resident mi- regulatory genes, and genes that promote post-translational crobiota of humans and animals, although they can cause dis- modifications and those that encode the export apparatus of eases during dysbiosis (microbial imbalance) or alterations of the peptides (Diep and Nes 2002). the immune system. Klebsiella sp. and Pseudomonas sp. are Lantibiotics are post-translationally modified peptides, that opportunistic pathogens, commonly found in the hospital en- belong to the class I bacteriocins; the enzymatic apparatus in- vironment. Bacillus cereus, a thermophilic and endospore- volved in modifying the lantibiotics is composed by LanB/ forming bacterium, is important in the industrial environment LanC modification apparatus, responsible for dehydration re- and it is usually related to food poisoning. actions and formation of lanthionine rings, respectively, or by Ann Microbiol (2019) 69:131–138 137

LanM, a single protein that carries out both modification reac- Funding This work was supported by Minas Gerais State Funding tions (McAuliffe et al. 1998; Zhao and van der Donk 2016). Agency (FAPEMIG) and Brazilian National Council for Scientific and Technological Development (CNPq). In the present study, the target fragments expected were amplified by PCR reactions, using the primers for the genes Compliance with ethical standards lanB, lanC,andlanM, as also reported by other authors (Hyink et al. 2005; Wirawan et al. 2006;Especheetal. Conflict of interest The authors declare that they have no conflict of 2009;Moraesetal.2012; Perin and Nero 2014). Regarding interest. the presence of lanB, lanC,andlanM genes, none of the ruminal isolates evaluated in this study showed only lanM gene. The modification apparatus LanB/LanC was detected in Publisher’sNote Springer Nature remains neutral with regard to jurisdic- tional claims in published maps and institutional affiliations. Streptococcus gallolyticus (AS1.5), the only isolate that carried both genes lanB and lanC. Their co-existence was already expected, since these two genes are usually located within the References same operon in lantibiotic-producing strains. However, Wirawan et al. (2006) indicate that the amplification of lanB Altschul SF, Gish W, Miller W et al (1990) Basic local alignment search and lanC may not occur at the same time in several tool. J Mol Biol 5:403–410 bacteriocin-producing strains, and the amplification of only Alvarez-Sieiro P, Montalbán-López M, Mu D et al (2016) Bacteriocins of one of the genes could be common. lactic acid bacteria: extending the family. Appl Microbiol According to Hyink et al. (2005)andWirawanetal. Biotechnol 100:2939–2951 (2006), the amplification of any post-translational modifica- Barbosa AA, Mantovani HC, Jain S (2017) Bacteriocins from lactic acid bacteria and their potential in the preservation of fruit products. Crit tion gene of lantibiotics would already be sufficient to consid- Rev Biotechnol 3:1–13 er a bacterial isolate as a potential producer of class I bacte- Benson JA, Ferrieri P (2001) Rapid pulsed-field gel electrophoresis meth- riocins. In the present study, three of the four ruminal isolates od for group B streptococcus isolates. J Clin Microbiol 39:3006– evaluated could be considered potential lantibiotic producers. 3008 The other isolate identified as S. equinus (C6I9) did not Booth SJ, Johnson JL, Wilkins TD (1977) Bacteriocin production by strains of Bacteroides isolated from human feces and the role of show amplification products corresponding to any of the these strains in the bacterial ecology of the colon. Antimicrob post-translational modification genes of lantibiotics analyzed. Agents Chemother 11:718–724 However, the antimicrobial potential of a bacterial strain can- Chakchouk-Mtibaa A, Elleuch L, Smaoui S et al (2014) An not be only verified by the detection of bacteriocin biosynthe- antilisterial bacteriocin BacFL31 produced by Enterococcus sis genes, being also necessary identify the inhibitory activity faecium FL31 with a novel structure containing hydroxyproline residues. Anaerobe 27:1–6 of the compound in vitro (Hyink et al. 2005; Wirawan et al. Chen H, Hoover DG (2003) Bacteriocins and their food applications. 2006;Especheetal.2009;Yietal.2010). Streptococcus Compr Rev Food Sci Food Saf 2:82–100 equinus (C6I9) inhibited the growth of 14 indicator microor- Cleveland J, Montville TJ, Nes IF, Chikindas ML (2001) Bacterioicns: ganisms tested in this study using the spot-on-lawn assay, and safe, natural antimicrobials for food preservation. Int J Food – the absence of lanB, lanC,orlanM gene detection may indi- Microbiol 71:1 20 Cotter PD, Hill C, Ross RP (2005) Bacteriocins: developing innate im- cate that this bacterium has other lantibiotic post-translational munity for food. Nat Rev Microbiol 3:777–788 modification enzyme(s) or indicate that the produced bioac- Diep DB, Nes IF (2002) Ribosomally synthesized antibacterial peptides tive compound(s) belong(s) to other classes of peptides. in Gram positive bacteria. Curr Drug Targets 3:107–122 Drider D, Bendali F, Naghmouchi K et al (2016) Bacteriocins: not only antibacterial agents. Probiotics Antimicrob Proteins 8:177–182 Escano J, Stauffer B, Brennan J et al (2015) Biosynthesis and transport of the lantibiotic mutacin 1140 produced by Streptococcus mutans.J Conclusions Bacteriol 197:1173–1184 Espeche MC, Otero MC, Sesma F et al (2009) Screening of surface In this study, we demonstrated the wide inhibitory spectrum of properties and antagonistic substances production by lactic acid bac- bacteriocin-like inhibitory substances produced by four rumi- teria isolated from the mammary gland of healthy and mastitic cows. Vet Microbiol 135:346–357 nal streptococci: the peptides were active against other rumi- Hillman JD, Novák J, Sagura E et al (1998) Genetic and biochemical nal bacteria and foodborne and opportunistic pathogens. analysis of mutacin 1140, a lantibiotic from Streptococcus mutans. Three of the isolates showed at least one lantibiotic post- Infect Immun 66:2743–2749 translational modification gene, suggesting that the com- Hyink O, Balakrishnan M, Tagg JR (2005) Streptococcus rattus strain pounds produced may belong to the lantibiotic class of bacte- BHT produces both a class I two-component lantibiotic and a class II bacteriocin. FEMS Microbiol Lett 252:235–241 riocins. Broad-spectrum antimicrobial peptides naturally oc- Joachimsthal EL, Reeves RK, Hung J et al (2010) Production of bacte- curring in the rumen have the potential to be used as feed riocins by Streptococcus bovis strains from Australian ruminants. J additives to promote changes in rumen microbial ecology. Appl Microbiol 108:428–436 138 Ann Microbiol (2019) 69:131–138

Joerger RD (2003) Alternatives to antibiotics: bacteriocins, antimicrobial Rodriguez E, Gonzalez B, Gaya P et al (2000) Diversity of bacteriocins peptides and bacteriophages. Poult Sci 82:640–647 produced by lactic acid bacteria isolated from raw milk. Int Dairy J Kabuki T, Kawai Y, Uenishi H et al (2011) Gene cluster for biosynthesis 10:7–15 of thermophilin 1277–a lantibiotic produced by Streptococcus Russell JB, Mantovani HC (2002) The bacteriocins of ruminal bacteria thermophilus SBT1277, and heterologous expression of TepI, a nov- and their potential as an alternative to antibiotics. J Mol Microbiol el immunity peptide. J Appl Microbiol 110:641–649 Biotechnol 4:347–355 Kalmokoff ML, Cyr TD, Hefford MA et al (2003) Butyrivibriocin AR10, Russell JB, Strobel HJ (1989) Effect of ionophores on ruminal fermenta- a new cyclic bacteriocin produced by the ruminal anaerobe tion. Appl Environ Microbiol 55:1–6 Butyrivibrio fibrosolvens AR10: characterization of the gene and Settani L, Corsetti A (2008) Application of bacteriocins in vegetable food peptide. Can J Microbiol 49:763–773 preservation. Int J Food Microbiol 121:123–138 Kaškonienė V, Stankevičius M, Bimbiraitė-Survilienė K et al (2017) Suzuki M, Rappe MS, Giovannoni SJ (1998) Kinetic bias in estimates of Current state of purification, isolation and analysis of bacteriocins coastal picoplankton community structure obtained by measure- produced by lactic acid bacteria. Appl Microbiol Biotechnol 101: ments of small-subunit rRNA gene PCR amplicon length heteroge- 1323–1335 neity. Appl Environ Microbiol 64:4522–4529 Kisidayová S, Lauková A, Jalc D (2009) Comparison of nisin and Turner JW, Jordan HV (1981) Bacteriocin–like activity within the genus monensin effects on ciliate and selected bacterial populations in Actinomyces. J Dental Res 60:1000–1007 artificial rumen. Folia Microbiol 54:527–532 Vaillancourt K, LeBel G, Frenette M et al (2015) Suicin 3908, a new Li SW, Chen YS, Lee YS et al (2017) Comparative genomic analysis of lantibiotic produced by a strain of Streptococcus suis serotype 2 bacteriocin-producing Weissella cibaria 110. Appl Microbiol isolated from a healthy carrier pig. PLoS One 10:e0117245 Biotechnol 101:1227–1237 Wang HT, Chen IH, Hsu JT (2012) Production and characterization of a Li Y, Xiang Q, Zhang Q et al (2012) Overview on the recent study of bacteriocin from ruminal bacterium Ruminococcus albus 7. Biosci antimicrobial peptides: origins, functions, relative mechanisms and Biotechnol Biochem 76:34–41 application. Peptides 37:207–215 Wang J, Ma H, Ge X et al (2014) Bovicin HJ50-like lantibiotics, a novel Mantovani HC, Kam DK, Ha JK et al (2001) The antibacterial activity subgroup of lantibiotics featured by an indispensable disulfide and sensitivity of Streptococcus bovis strains isolated from the ru- bridge. PLoS One 9:e97121 men of cattle. FEMS Microbial Ecol 37:223–229 Wescombe PA, Dyet KH, Dierksen KP et al (2012) Salivaricin G32, a Mantovani HC, Russell JB (2002) The ability of a bacteriocin of homolog of the prototype Streptococcus pyogenes nisin-like Streptococcus bovis HC5 (bovicin HC5) to inhibit Clostridium lantibiotic SA-FF22, produced by the commensal species aminophilum, an obligate amino acid fermenting bacterium from Streptococcus salivarius. Int J Microbiol 2012:1–10 the rumen. Anaerobe 8:247–252 Whitford MF, McPherson MA, Forster RJ et al (2001) Identification of Mantovani HC, Hu H, Worobo RW et al (2002) Bovicin HC5, a bacteri- bacteriocin-like inhibitors from rumen Streptococcus spp. and isola- ocin from Streptococcus bovis HC5. Microbiology 148:3347–3352 tion and characterization of bovicin 255. Appl Environ Microbiol McAuliffe O, Ryan MP, Ross RP et al (1998) Lacticin 3147, a broad- 67:569–574 spectrum bacteriocin which selectively dissipates the membrane po- Wirawan RE, Klesse NA, Jack RW et al (2006) Molecular and genetic tential. Appl Environ Microbiol 64:439–445 characterization of a novel nisin variant produced by Streptococcus Moraes PM, Perin LM, Todorov SD et al (2012) Bacteriocinogenic and uberis. Appl Environ Microbiol 72:1148–1156 virulence potential of Enterococcus isolates obtained from raw milk Yi H, Zhang L, Tuo Y et al (2010) A novel method for rapid detection of and cheese. J Appl Microbiol 113:318–328 class IIa bacteriocin-producing lactic acid bacteria. Food Control 21: Oliveira SD, Santos LR, Schuch DM et al (2002) Detection and identifi- 426–430 cation of salmonellas from poultry-related samples by PCR. Vet Zhao X, van der Donk WA (2016) Structural characterization and bioac- Microbiol 87:25–35 tivity analysis of the two-component lantibiotic Flv system from a Ortolani MB, Moraes PM, Perin LM et al (2010) Molecular identification ruminant bacterium. Cell Chem Biol 18:246–256 of naturally occurring bacteriocinogenic and bacteriocinogenic-like Zou W, Chen HC, Hise KB et al (2013) Meta-analysis of pulsed-field gel lactic acid bacteria in raw milk and soft cheese. J Dairy Sci 93:2880– electrophoresis fingerprints based on a constructed Salmonella da- 2886 tabase. PLoS One 8:e59224 Perin LM, Nero LA (2014) Antagonistic lactic acid bacteria isolated from Zou W, Lin WJ, Foley SL et al (2010) Evaluation of pulsed-field gel goat milk and identification of a novel nisin variant Lactococcus electrophoresis profiles for identification of Salmonella serotypes. lactis. BMC Microbiol 14:1–9 J Clin Microbiol 48:3122–3126