SOMATIC EMBRYOGENESIS THROUGH CELL SUSPENSION CULTURE IN INDIAN COMMERCIAL CULTIVARS OF BANANA (MUSA SPP.)
THESIS SUBMITTED TO BHARATHIDASAN UNIVERSITY FOR THE AWARD OF THE DEGREE OF
DOCTOR OF PHILOSOPHY IN BOTANY
By A. AKBAR
P.G. AND RESEARCH DEPARTMENT OF BOTANY JAMAL MOHAMED COLLEGE (AUTONOMOUS) (ACCREDITED AT ‘A’ GRADE BY NAAC- CGPA 3.6 OUT OF 4.0) TIRUCHIRAPPALLI- 620 020 TAMIL NADU, INDIA
MARCH - 2011
Date:
DECLARATION
I do hereby declare that this work entitled “SOMATIC EMBRYOGENESIS THROUGH CELL SUSPENSION CULTURE IN INDIAN COMMERCIAL CULTIVARS OF BANANA (Musa spp.)”, has been originally carried out by me under the guidance of Dr. A. Shajahan, Lecturer (SG), PG and Research Department of Botany, Jamal Mohamed College, Tiruchirappalli- 620 020, and this work has not been submitted elsewhere for any other degree.
(A. AKBAR)
Dr. A. SHAJAHAN Lecturer (SG) & Principal Investigator (UGC Major Project) P.G. and Research Department of Botany Jamal Mohamed College (Autonomous) (Accredited at ‘A’ Grade by NAAC- CGPA 3.6 Out of 4.0) Tiruchirappalli- 620 020 Tamil Nadu, India
Date:
CERTIFICATE
This is to certify that the thesis entitled “Somatic embryogenesis through cell suspension culture in Indian commercial cultivars of Banana (Musa spp.)”, submitted to Bharathidasan University, Truchirappalli- 620 020, for the award of the degree of Doctor of Philosophy in Botany, is an authentic record of original work carried out by Mr. A. AKBAR under my guidance and supervision during the study period at the PG and Research Department of Botany, Jamal Mohamed College, Thiruchirappalli- 620 020, Tamil Nadu, India.
I further certify that no part of this thesis has been submitted any where else for the award of any degree, diploma, associateship fellowship or other similar titles to any candidate.
(A. SHAJAHAN)
Fax : +91 431 2331235 * Phone : +91 431 2422563 (Resi) * Mobile : + 944387431 * Email : [email protected] GRATITUDE
First of all, I would like to thank the Lord Almighty for his benevolent blessing and abundant mercy which enabled me to complete this piece of work in successful manner.
An accomplishment requires the effort of many people and this work is not different. I didn’t ask for it to be over, but then again, I never asked for it to begin. For that’s the way it is with life, as some of the most beautiful days come completely by chance. But even the most beautiful days eventually have their sunsets. Now its time to look back and remember those faces with a sense of gratitude.
I express my deepest sense of gratitude to my Research Supervisor, Dr. A. Shajahan, Senior Lecturer, PG & Research Dept. of Botany, Jamal Mohamed College, for his encouragement, valuable suggestions and support extended throughout my project work.
I thank Dr. S.Uma (Principal Scientist), Head of Crop Improvement Division, National Research Center for Banana (ICAR), Trichy, who has been a backbone to my success in completion of this work. Her untiring help, constant guidance and support extended throughout my work has made this possible.
I am profoundly grateful to Janab, M.J. Noorden Sahib, President, Janab. A.K. Khaja Nazeemudeen Sahib, Secretary and Correspondent, Janab Hajee. K.A. Khaleel Ahamed Sahib, Treasurer, Assistant Secretary and the management committee members of Jamal Mohamed College for their encouragement and also providing facilities to complete this research work.
I am grateful to Janab. Hajee. Dr. M. Sheik Mohamed, Principal Jamal Mohamed College for this motivation towards research and providing lab facilities to complete this work.
I extend my gratitude to Dr. S. Ahmed Johan, Head, PG & Research Dept. of Botany, Jamal Mohamed College for providing lab facilities during my research. I wish to express my heartiest gratitude to Dr. M.N. Abubacker, Head Dept. of Botany, National College for his guidance throughout this research work.
My sincere thanks to my professors Prof. A. Syed Ali, Prof. M. Purushothaman, Dr. A. Khaleel Ahamed, Dr. S. Mohamed Salique, Dr. Muhamed Ilyas, Dr. M. Ghouse Basha, Dr. M. Kamaraj, Dr. R. Ravikumar, Dr. K. Mohamed Rafi, Mr. A. Aslam, for their encouragement and constant support during the course of my research.
A special thanks to Dr. M.S. Saraswathi (Scientist, SC) and Dr. S. Backiayarani (Senior Scientist), National Research Center for Banana (ICAR), Trichy, for their encouragement and valuable suggestions throughout my project work.
I am deeply indebted to several persons for their tireless assistance. Without their aid and support, this research present format of thesis would not have been possible.
Here, I would like to express my gratitude to Dr. P. Durai (Technical Officer), Dr. B. Sudhakar (Research Associate) Mr. A. Kaliappan (Research Associate), Mr. R. Mohanraj, Mr. Periasamy, Mr. Peter, Mr. Balu, Mr. S.A. Shafi, Mr. A. Saravana Kumar, Mr. A. Saravanakumar, K.P. Hidayath, Mr. Arun, Mr. K.P. Sajith, Mr. M. Muthusamy, Mr. Punniakotti, Mr. Kannan, Mr. K. Ravi, Mr. C. Sourdar Raju, Mr. Senthil Kumar, Miss. K. Udhayanjali, Miss. Mr. P. Rahul Gandhi, R. Chitra devi, Mrs. Sarasamma, Mrs. Bakiyam and Mrs. Sarasu.
Last but not least, I would like to thank to my family members for their constant support to complete my research.
ABBREVIATION
% - percentage µg - microgram µl - microlitre µM - micromole 2,4-D - 2,4-diclorophenoxy acetic acid ABA - abscisic acid AS-AFLP - allele specific amplified fragment length polymorphism BAP - 6-benzyl adenine BSV - banana streak virus BBMV - banana bract mosaic virus BBTV - banana bunchy top virus bp - base pair (s) C - celsius cm - centimeter CMV - cucumber mosaic virus CTAB - N-Cetyl-N,N,N-trimethyl ammonium bromide cv - cultivar dNTP - deoxy nucleotide triphosphate ECS - embryogenic cell suspension FAO - food and agricultural organization FFF - photosynthetic photon flux G - gram g - gravity (relative centrifugal force)
GA3 - gibbrellic acid h - hour INIBAP - international network for the improvement of banana and plantain ISSR - inter simple sequence repeats IEDCs - induced embryogenic determined cells kg - kilo gram Kin - kinetin L - litre m - meter M - molar mg - milligram min - minute ml - millilitre mm - millimeter mM - millimolar MS - murashige & skoog’s medium MW - molecular weight NAA - α – naphthalene acetic acid NAD - nicotinamide adenosine dinucleotide NADP - nicotinamide adenosine dinucleotide phosphate PCR - polymerase chain reaction PCV - packed cell volume PEMs - proembryogenic masses PEDCs - pre-embryogenic determined cells PVP - polyvinyl pyrrolidone RAPD - random amplified polymorphic DNA RFLP - restriction fragment length polymorphism rpm - revolutions per minute RH - relative humidity SE - somatic embryo SH - schenk and hildebrant medium STRs - short tandem repeats SSR - simple sequence repeats s - second TAE - tris acetate ethylene diamine tetra acetic acid TBE - tris borate ethylene diamine tetra acetic acid TE - tris - ethylene diamine tetra acetic acid TDZ - thidiazuron Tris - tris hydroxyl methyl amino methane UV - ultra violet V - volt v - volume w - weight CONTENTS
Page No. 1.0. Introduction ...... 1 1.1. Taxonomy...... 2 1.2. Origin, Evolution and Diversity ...... 2 1.3. Indian commercial cultivars of banana ...... 4
1.4. Production constraints in Banana...... 6 1.5. Conventional method of propagation ...... 6 1.6. Importance of non conventional methods ...... 7 1.6.1 Importance of in vitro system in improvement of Musa ...... 8 1.6.2. Somatic embryogenesis ...... 8 1.6.3. Somaclonal variations in Musa...... 9 1.6.3.1. Identification of genetic variation...... 10 1.6.3.2. Use of microsatellite marker...... 10 1.7. Objectives...... 11
2.0 Review of literature...... 12 2.1. General Description...... 12
2.2. Somatic embryogenesis...... 13 2.2.1. Phenotypic plasticity in plants ...... 14 2.2.2. Morphogenic competence and morphological expression...... 14 2.2.3. Unicellular and multicellular origin of somatic embryos ...... 15 2.2.4. Application of somatic embryogenesis...... 16 2.2.4.1. Important applications ...... 16 2.2.4.2. Other applications ...... 16 2.3. Factors affecting somatic embyrogenesis ...... 17 2.3.1. Effect of genotype ...... 17 2.3.2. Effect of explant ...... 18 2.3.3. Effect of medium ...... 18 2.3.3.1. Carbon source ...... 19 2.3.3.2. Nitrogen source...... 19 2.3.3.3. Macro and microelements...... 20 2.3.3.4. Vitamins...... 22 2.3.3.5. Organic additives...... 22 2.4. Somatic embryogenesis in Musa ...... 22 2.4.1. Explant selection and induction...... 22 2.4.2. Male and female buds as explant...... 25 2.4.3. Factors controlling somatic embryogenesis...... 23 2.4.4. Embryogenic cells and their embryogenic capacity ...... 31 2.4.5. Field Performance of Tissue Culture Banana Plants ...... 34 2.4.6. Somoclonal variation ...... 35 2.4.7.1. Somaclonal variation in banana...... 37 2.4.7.2. Use of molecular markers to detect variation ...... 39
3.0 Materials and Methods ...... 44 3.1. Materials used ...... 44 3.1.1. Collection of disease free planting material...... 44 3.2. Medium ...... 45 3.2.1. Culture medium ...... 45 3.2.2. Preparation of medium and other requirements...... 45 3.3. Callus induction from immature male flower buds...... 46 3.3.1. Preparation and culturing of explant...... 46 3.3.2. Influence of various growth regulators on callus induction...... 46 3.3.2.1. Tested individually...... 46 3.3.2.2. Tested in combination...... 47 3.3.2.3. Combination of 2-4-D, IAA and NAA on embryogenic callus induction ...... 47 3.3.3. Effect of photoperiod on callus induction...... 48 3.3.3.1. Frequency of callus Induction ...... 48 3.3.3.2. Nature of callus ...... 48 3.3.4 Trials to overcome lethal blackening...... 49 3.3.4.1. Preculture and frequent subculture of explant...... 49 3.3.4.2 Use of antioxidants and absorbants ...... 49 3.3.5. Effect of carbon source on embryogenic callus induction...... 49 3.4. Establishment of embryogenic cell suspension ...... 50 3.4.1. Effect of various media ...... 50 3.4.2. Effect of different concentrations of sucrose on embryogenic response .. 50 3.4.3. Selection of model cultivars to study embryogenic pathway ...... 50 3.4.4. Factors affecting nature of cell suspension...... 51 3.4.4.1. Cell density in embryogenic cell suspensions ...... 51 3.4.4.2. Effect of cell density in the multiplication of embryogenic cell suspensions ...... 51 3.4.4.3. Assessment of viability of cell suspension ...... 51 3.5. Regeneration of somatic embryos from cell suspension...... 52
3.5.1. Influence of various growth regulators on somatic embryo formation 52 3.5.2. Selection of optimum regeneration medium ...... 52 3.5.3. Effect of substrate on regeneration efficiency ...... 53 3.5.4 Effect of cell density on regeneration capacity...... 53 3.6. Maturation of somatic embryos...... 53 3.6.1. Selection of medium for embryo maturation...... 53 3.6.2. Effect of incubation period on embryo maturation...... 54 3.7. Effect of modified regeneration medium on germination efficacy ...... 54 3.8. Histology of regenerating somatic embryos...... 54 3.9. Effect of age of ECS on regeneration and germination capacity ...... 55 3.10. Influence of various growth regulators on repetitive embryogenesis ...... 55 3.10.1. Tested individually...... 55 3.10.2. Tested in combination...... 55 3.10.3 Effect of initial inoculum density on multiplication of somatic embryos . 55 3.11. Preculture of embryos in liquid medium ...... 56 3.12. Plant recovery and acclimatization phase in net house ...... 56 3.13. Genetic fidelity study ...... 56 3.13.1. Molecular analysis for genetic fidelity ...... 56 3.13.2. Isolation of genomic DNA...... 57 3.13.3. Purification and elimination of RNase A...... 57 3.13.4. Quantification of DNA ...... 58 3.13.5. Microsatellite markers ...... 58 3.13.6. Polymerase chain reaction ...... 60 3.13.7. Agarose gel electrophoresis ...... 61 3.13.8. Visualization and Documentation...... 61 3.13.9. Data analysis ...... 61 3.14. Field evaluation of ECS derived plants...... 62 3.15. Statistical analysis ...... 62
4.0 Results and Discussion...... 63 4.1 Selection of explant...... 63 4.2 Surface sterilization and callus induction...... 64 4.3 Influence of various growth regulators on callus induction...... 65 4.3.1 Tested individually...... 65 4.3.2 Tested in combination...... 67 4.3.2.1. In combination with NAA ...... 67 4.3.2.2. In combination with IAA...... 69 4.3.2.3. 2,4-D in combination with IAA and NAA...... 71 4.3.2.4. Effect of combination of 2-4-D, IAA and NAA on embryogenic callus ...... 77 4.3.3. Effect of photoperiod on callus induction...... 83 4.3.3.1. Frequency of callus induction ...... 83 4.3.3.2. Nature of callus induction ...... 85 4.3.4. Trials to overcome lethal blackening...... 85 4.3.4.1. Preculture and frequent subculture of explant ...... 85 4.3.4.2. Use of antioxidants and absorbants...... 88 4.3.5. Effect of carbon source on embryogenic callus induction...... 89 4.3.6. Ideal callus used for suspension...... 92 4.4. Establishment of embryogenic cell suspension...... 92 4.4.1. Effect of various medium on the establishment of embryogenic cell suspension ...... 92 4.4.2. Effect of different concentration of sucrose on embryogenic response .... 93 4.4.3. Factors affecting nature of cell suspension...... 95 4.4.3.1. Cell density in embryogenic cell suspensions ...... 95 4.4.3.2. Constituents of embryogenic cell suspension...... 96 4.4.3.3. Effect of cell density in the multiplication of embryogenic cell suspensions ...... 98 4.4.3.4. Assessment of viability of cell suspension ...... 101 4.5. Regeneration of somatic embryos from cell suspension...... 101 4.5.1. Influence of various growth regulators on somatic embryo formation 101 4.5.2. Selection of best regeneration medium...... 103 4.5.3. Effect of substrate on regeneration efficiency ...... 104 4.5.4. Effect of cell density on regeneration capacity...... 105 4.6. Embryo maturation studies...... 107 4.6.1. Selection of best medium for embryo maturation...... 107 4.6.2. Effect of incubation period on embryo maturation...... 108 4.7. Effect of modified regeneration medium on germination efficacy ...... 109 4.8. Influence of age of suspension on regeneration and germination capacity ...... 111 4.9. Histology of regenerating somatic embryos...... 114 4.10. Influence of various growth regulators on repetitive embryogenesis ...... 114 4.10.1. Tested individually (2,4-D and BAP) ...... 114 4.10.2. BAP and 2,4-D in combination with IAA ...... 116 4.10.3. Effect of initial inoculum density on multiplication of somatic embryos 117 4.11. Preculture of embryos in liquid medium...... 119 4.12. Plant recovery and acclimatization phase in net house ...... 121 4.13. Genetic fidelity studies...... 122 4.13.1. SSR primer in genetic fidelity study...... 123 4.13.2. ISSR primer in genetic fidelity study...... 123 4.13.2.1. Rasthali...... 123 4.13.2.2. Nendran...... 125 4.14. Field evaluation of regenerated plants ...... 130 4.14.1. Vegetative characters ...... 130 4.14.2. Yield...... 132 4.15. Phenotypic variations ...... 134
Summary ...... 138
Bibliography ...... i-xxxiv LIST OF TABLES
Table Title No.
1 Comparative effect of various concentrations of 2,4-D, TDZ, Dicamba and NAA on callus induction from immature male flower buds of banana cultivars on MS medium
2 Effect of various concentrations of NAA (0.25-2.0mg/l) in combination with 2,4-D (4.0 mg/l), TDZ (1.0mg/l) and Dicamba (3 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium.
3 Effect of various concentrations of IAA (0.25-2.0mg/l) in combination with 2,4-D (4.0 mg/l), TDZ (1.0mg/l) and Dicamba (3.0 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium
4 Effect of different concentrations of NAA and IAA (0.25-2.0 mg/l) with 2,4-D (4.0 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium
5 Effect of position of explant on callus induction on MS medium fortified with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
6 Effect of position of explant on nature of callus on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
7 Influence of various concentrations of NAA and IAA (0.25-2.0 mg/l) in combination with 2,4-D (4.0 mg/l) on embryogenic callus induction from immature male flower buds of banana cultivars on MS medium
8 Effect of position of floral hands on embryogenic callus induction on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
9 Nature of embryogenic callus obtained from male floral hands on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
10 Effect of photo period on callus induction from immature male flower buds of banana cultivars on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
11 Effect of photo period on nature of callus obtained from immature male flower buds of banana cultivars on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA
12 Comparison between photo period (6 hrs) and complete darkness on callus induction from male flower buds of banana cultivars on callus induction medium
13 Nature of callus obtained from male floral hands in callus induction medium incubated in 6 hrs light and complete darkness 14 Effect of preculture (liquid medium) and frequent subculture of explant on reduction of explant blackening
15 Effect of preculture of explant on embryogenic response
16 Influence of antioxidants and absorbants (L-Ascorbic acid, Activated charcoal and Polyvenyl pyrolidone) on reduction of explant blackening.
17 Effect of carbohydrates on embryogenic complex induction from explants of banana cultivars on MS medium supplemented with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA
18 Effect of different media on successful establishment of embryogenic cell suspension from the ideal callus obtained from banana cultivars
19 Effect of different concentration of sucrose on embryogenic response of banana cultivars in MS liquid medium supplemented with 1 mg/l 2,4-D
20 Cell density in embryogenic cell suspension of cvs. Rasthali and Nendran in MS medium with 1 mg/l 2,4-D
21 Change in settled cell volume (SCV) in suspension medium containing with 1 mg/l 2,4-D, with respect to time
22 Influence of various growth regulators (Zeatin, BAP, TDZ and Picloram) on induction of somatic embryos from ECS derived cultivars Rasthali and Nendran in SH medium.
23 Selection of optimum regeneration medium for ECS derived from immature male flower buds banana cultivars Rasthali and Nendran
24 Effect of substrate on somatic embryo formation from ECS of cvs. Rasthali and Nendran in modified regeneration medium (RIII)
25 Effect of cell density on somatic embryo formation from ECS of cvs. Rasthali and Nendran in modified regeneration medium (RIII)
26 Selection of maturation medium for the somatic embryos of two cvs. Rasthali and Nendran
27 Influence of maturation period on germination capacity of somatic embryos of two banana cultivars Rasthali and Nendran in modified regeneration medium (RIII)
28 Influence of age of somatic embryos and regeneration medium on germination efficiency in two commercial cultivars of banana Rasthali and Nendran.
29 Effect of age of ECS on regeneration capacity of banana cultivars Rasthali and Nendran in modified regeneration medium (RIII)
30 Effect of age of ECS on germination capacity of banana cultivars Rasthali and Nendran in MS medium with 0.5 mg/l BAP + 2 mg/l IAA 31 Effect of 2,4-D and BAP on repetitive embryogenesis in banana cultivars Rasthali and Nendran in MS medium
32 Effect of various concentrations of IAA (0.1 – 0.5 mg/l) in combination with 2,4-D (0.75 mg/l) and BAP (2.0 mg/l) on repetitive embryogenesis in banana cultivars Rasthali and Nendran
33 Influence of initial innoculum density on multiplication of somatic embryos in banana cultivars Rasthali and Nendran in MS medium with BAP (2 mg/l) and IAA (0.2 mg/l)
34 Effect of preculture of somatic embryos in liquid medium (20 days) to increase the germination capacity of banana cultivars Rasthali and Nendran
35 Contribution of various ISSR primers to percent polymorphism in cv. Rasthali and Nendran
36 Biometric analysis of ECS derived plants (cvs. Rasthali and Nendran) in field conditions
37 Evaluation of ECS derived plants in field conditions for somaclonal variation in cvs. Rasthali and Nendran
LIST OF FIGURES
Figure Title No.
1 Vegetative and reproductive traits of banana (cv. Karpooravalli)
2 Explant preparation and callus induction from immature male flower buds of banana cultivar Grand Naine in MS medium
3a Types of callus obtained from male flower buds of different cultivars of banana in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 3-6 months
3b Types of friable callus obtained from male flower buds of different cultivars of banana on MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 3-6 months
4 Effect of position of floral hand on callus induction in banana cultivar Robusta, in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA
5 Influence of genotype on callus induction in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 1-2 months
6 Ideal embryogenic callus obtained from male flower buds on MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 6-9 months
7 Embryogenic cell suspension of commercial cultivars of banana derived from male flower buds in liquid MS medium with 1 mg/l 2,4-D
8 Change in composition of embryogenic cell suspension of test cultivars Rasthali and Nendran in liquid MS medium with 1 mg/l 2,4-D
9 Components of cell suspension culture obtained from male flower buds in commercial cultivars of banana in liquid MS medium with 1 mg/l 2,4-D
10 Various stages of cell division and varietal difference in cell proliferation in ECS of bananas cultivars in liquid MS medium with 1 mg/l 2,4-D
11 Regeneration of somatic embryos from viable embryogenic cells of banana cultivars in SH medium
12 Regeneration of somatic embryos from embryogenic cells of banana cultivars in modified SH medium with 0.50 mg/l picloram
13 Germination of somatic embryos incubated on various maturation medium for 30 days 14 Regeneration and germination capacity of embryogenic cell lines of banana cultivars Rasthali and Nendran at different interval of time
15 Histology of regenerating somatic embryos
16 Repetitive embryogenesis and germination of embryos obtained from immature male flower buds of commercial cultivars of Rasthali and Nendran
17 Differential germination of plantlet from embryogenic cell suspension culture of banana cultivars Rasthali and Nendran
18 Enhanced plantlet recovery through modified culture technique in cvs. Rasthali and Nendran
19 Germination, acclimatization and bunches of ECS derived plantlets in test cultivars Rasthali and Nendran
20a Genetic fidelity test in cv. Rasthali using ISSR primer
20b Dendrogram demonstrating the genetic relationship among ECS derived plants of cv. Rasthali based on microsatellite markers
21a Genetic fidelity test in cv. Nendran using ISSR primer
21b Dendrogram demonstrating the genetic relationship among ECS derived plants of cv. Nendran based on microsatellite markers
22 Schematic presentation plantlet regeneration through embryogenic cell suspension in banana
Chapter – I IInnttrroodduuccttiioonn
Banana and plantains (Musa spp. L.) are the important staple and cash crops that grow in the humid regions of Africa, America and Asia (Robinson, 1996). ‘Banana’ refers to those cultivars that are eaten raw when ripe, like the dessert bananas, while ‘plantain’ is those eaten green, or ripe, but cooked or fried. In other words green banana which becomes palatable after cooking, are popularly referred as plantain while the fresh fruit consumed after ripening, is referred as dessert banana. Worldwide annual production is estimated to exceed 100 million tones, which are distributed between Africa (40%), Asia (30%), Latin America and the Caribbean (30%). India is the largest producer of banana with 17.0 million tones from an area of 6.8 lakh hectares (FAO, 2005).
Banana and plantains are the source of staple food in the equatorial belt of Africa, where more than 70 million people derive in excess of 25% of their daily calorie intake from plantains (Robinson, 1996). They are known as wonder berry, forming staple food for millions of people across the globe and provide a more balanced diet than any other fruit or vegetable. Bananas and plantains are sources of dietary carbohydrate, vitamin C and number of minerals (Nweke et al., 1988). They are also a good source of major elements such as potassium, magnesium, phosphorous, calcium, iron and vitamins like A, B6 and C (Marriott and Lancaster, 1983).
Banana is referred as “Kalpatharu”, a plant of all virtues, with each and every part of the plant being used for various purposes. The importance of banana as a food- fruit crop can hardly be exaggerated adding to its multifaceted uses as food, fibre, fuel and therapeutic values. Leaf is the most popular hygienic bio-plate for dining, male flower is much preferred as vegetable and for making pickles, and stem is also a vegetable in demand with lot of therapeutic uses. Banana is also a good fiber yielding plant and its corm is mostly exploited as animal feed, as composite mixture with others (Uma et al., 2005). Bananas and plantains are therefore the important components of
1 food security in the tropical world and they provide income to the farming community through local and international trade.
1.1 Taxonomy Botanically, banana and plantains are perennial giant monocotyledonous herbs, belonging to the order Zingiberales (Scitaminae) and family Musaceae. The Musaceae consists of two genera Musa L. and Ensete L. The genus Ensete is monocarpic, with a basic chromosome number 9 and bears no edible fruits. The genus Musa is more widely distributed and comprises of four sections (Eumusa, Rhodochlalymis, Australimusa and Callimusa) with basic chromosome number between 9 and 14. The edible fruit bearing species are contained in the sections Eumusa and Australimusa. Simmond and Weatherup (1990) recently revised the morphological data, dividing Eumusa into two sub-sections: Eumusa (1) and Eumusa (2). The sections Rhodochalymus and Callimusa comprises a number of non-domesticated species, which are more of ornamental importance (Cheesman, 1947; Simmonds, 1966; Swennen and Rosales, 1994). Recently one more section has been added i.e. Ingentimusa (Simmonds and Weatherup, 1990). This detailed taxonomic classification done by Cheesman, (1947) is the revised form of the classification done by Baker (1893). It is based on chromosome number, pseudostem stature, inflorescence characters and seed morphology.
1.2 Origin, evolution and diversity Banana and plantains are believed to have originated from South and South East Asian countries along with Pacific Islands especially Papua New Guinea. India is considered as one of the major centres of origin for Musa and origin of wild bananas stretches from India upto Pacific Islands including Papua New Guinea, Micronesia, Melanesia, Samoa etc. (De Langhe et al., 2005). Besides India, African countries are assumed to be the cradle of banana diversity especially plantains where both cultivated and wild forms are found. The humid lowlands of West and Central Africa are the centre of diversification for plantains, while the highlands of East Africa are centres of diversification for cooking and beer bananas (Swennen and Vuylsteke, 1991).
The new cultivars evolved in a new environment faced fertility barriers, resulting in meiotic abnormality and mutations creating parthenocarpic cultivars. This natural hybridization and natural selection under varied ecological climates continued
2 resulting in Musa variability until the human intervention for selection of only desired cultivars (Valmayor, 2001). Both bananas and plantain are derived from intra and interspecific crosses between two diploid wild species Musa acuminata Colla (genome A) and Musa balbisiana Colla (genome B), which belongs to the same section Eumusa (Simmonds, 1995). This is the biggest section in the genus and the most geographically widespread, with species being found throughout Southeast Asia from India to the Pacific Islands (Horry et al., 1997). The different Musa cultivars and groups are designated by different combination of ‘A’ and ‘B’ to indicate the relative contributions of M. acuminata and M. balbisiana respectively, to their genomes.
Both M. acuminata and M. balbisiana serves as progenitor for majority of the cultivated bananas, which may be diploid (2n-22), triploid (2n=33) or tetraploid (2n=44). Most cultivated Musa are triploids (2n=3x=33) with characteristic genome constitutions (Lebot et al., 1993), while diploids and tetraploids are lesser in number. Simmonds and Shepherd (1955), proposed the following genomic classes for edible Musa AA, AB, AAA, AAB, ABB, AAAA and ABBB. These genomic groupings are almost exclusively used for the classification of edible Musa (Turner, 1994).
Within Eumusa the two species M. acuminata and M. balbisiana are widely distributed M. acuminata though originated either in Malaysia (Simmonds, 1962) or Indonesia (Nasution, 1991 and Horry et al., 1997), they are predominantly spread in Pacific Islands, Indonesia, Malaysia, Philippines, Myanmar and India. On the other hand, original populations of M. balbisiana are located in India and are widely distributed from there to Philippines and New Guinea (Simmonds, 1962). Nevertheless, few different accessions were known in the collections, and weak relative diversity has been observed (Horry, 1989 and Carreel et al., 1994).
The first step in the evolution of edible bananas was the development of parthenocarpy and seed sterility in M. acuminata. Parthenocarpy is the ability of the fruits to grow and develop into full and edible parenchymatous pulp without pollination. Seed sterility is due to cytogenetic factors and is very important, because banana seeds are stony and unpleasant to encounter. Edibility is, therefore, parthenocarpy plus seed sterility and human selection for these traits (Simmonds, 1987). The edible cultivars are in decreasing order of numerical importance, triploid
3 AAB and ABB, tetraploid AAAB and AABB, triploids AAA and tetraploid AAAA and ABBB. Triploids are predominant because they are superior to diploids in terms of vegetative vigour and yield. Tetraploids are as vigorous and productive as triploids and are also useful in breeding programmes (Simmonds, 1987).
Until recently only M. acuminata (A-genome) and M. balbisiana (B-genome) were thought to be the progenitors of present day bananas (Cheesman, 1948). But identification of M. schizocarpa and M. textiles represented by S and T genomes in cultivated and wild types, has added a new dimension to the evolutionary theory. A Philippine clone “Butuhan” (BT) is one such example which was considered to be formed by the hybridization between M. balbisiana (B) of section Eumusa and M. textilis (T genome) of section Australimusa (Carreel, 1994).
1.3 Indian commercial cultivars of banana 1.3.1 Grand Naine (AAA) It is a popular commercial cultivar grown extensively for table and processing purpose in the states of Maharashtra, Gujarat, Bihar and West Bengal. It is also popular in Tamil Nadu, Karnataka and Andhra Pradesh. Grand Naine is the leading commercial variety of Cavendish group. The bunch size, the fruit length and size is quite good though the keeping quality is poor. The average bunch weight with 6-7 hands and with about 13 fruits per hand is about 15-25 kg. The selection yields bunch weighing 60-70 kg. It is highly susceptible to Sigatoka leaf spot disease in humid tropics restricting its commercial cultivation.
1.3.2 Robusta (AAA) It is a semi-tall variety, grown mostly in Tamil Nadu and some parts of Karnataka for table purpose. It is a high yielding variety and produces bunch of large size with well developed fruits. Dark green fruits turn bright yellow depending on ripening conditions. Fruit is very sweet with a good aroma. Bunch weighs about 25-30 kg. Fruit has a poor keeping quality leading to a quick breakdown of pulp after ripening, hence not suited for long distance transportation. Robusta is highly susceptible to Sigatoka leaf spot disease in humid tropics.
4 1.3.3 Rasthali (Silk AAB) It is a medium tall variety commercially grown in Tamil Nadu, Andhra Pradesh, Kerala, Karnataka and Bihar. Its unique fruit quality has made Rasthali popular and a highly prized cultivar for table purpose. Fruits are yellowish green throughout their development, but turn pale yellow to golden yellow after ripening. Fruit is very tasty with a good aroma. Longer crop duration, severe susceptibility to Fusarium wilt, requirement of bunch cover to protect fruits from sun cracking and formation of hard lumps in fruits make the crop production more expensive.
1.3.4 Poovan (Mysore AAB) It is a leading commercial cultivar grown throughout the country specifically in Kerala, Tamil Nadu, Andhra Pradesh and North Eastern Region. Tamil Nadu is the leading producer of Poovan cultivar. Fruit is slightly acidic, firm and has typical sour- sweet aroma. Fruits turn to attractive golden yellow on ripening. Medium sized bunch, closely packed fruits, good keeping quality and resistant to fruit cracking are its plus points. But it is highly susceptible to Banana Bract Mosaic Viral (BBMV) disease and Banana Streak Virus, (BSV), which cause considerable reduction in yield.
1.3.5 Nendran (AAB) It is a popular variety in Kerala where it is relished as a dessert fruit as well as for processing. Commercial cultivation of Nendran has picked up rapidly in Tamil Nadu in the recent past. Bunch has 5-6 hands weighing about 12-15 kg. Fruits have a distinct neck with thick green skin turning buff yellow on ripening. Fruits remain starchy even on ripening. Nendran is highly susceptible to Banana Bract Mosaic Virus (BBMV), nematodes and borers.
1.3.6 Ney Poovan (AB) Ney Poovan is the choicest diploid cultivar, which is under commercial cultivation on a large scale especially in Karnataka and Tamil Nadu. Ney Poovan is a slender plant bearing bunches of 15-30 kg after 12-14 months. Dark green fruits turn golden yellow with a very good keeping quality. Fruit is highly fragrant, tasty, powdery and firm. Ney Poovan is tolerant to leaf spot but susceptible to Fusarium wilt and banana bract mosaic virus.
5 1.3.7 Monthan (ABB) It is a widely cultivated variety for culinary purpose. Monthan is a fairly tall and robust plant bearing bunches of 18-20 kg after 12 months. Fruits are bold, stocky, knobbed and pale green in colour. The skin is usually green. The new prolific 'Monthan' type clones of economic value namely 'Kanchi Vazhai' and 'Chakkia' are recently becoming popular in Tamil Nadu. It has many desirable qualities like immunity to Banana Bunchy Top Virus (BBTV) diseases, salt tolerance and normal bunch mass even under marginal condition, but it is highly susceptible to Fusarium wilt disease.
1.3.8 Karpooravalli (ABB) It is a popular variety grown for table purpose in medium rich soils. Its commercial cultivation is spread over in Central and Southern districts of Tamil Nadu and Kerala. It is also the sweetest among Indian bananas. Fruits are ashy coated with golden yellow, they are sweet with good keeping quality. Karpuravalli is highly susceptible to wilt disease, tolerant to leaf spot disease and well suited for drought, salt affected areas and for low input conditions.
1.4 Production constraints in Banana The yield of banana and plantain has been declining due to increasing pest and disease pressure (Vuylsteke et al., 1993). One of the major constraints is virulent forms of Sigatoka leaf spot diseases both black and yellow (Mycosphaerella fijiensis and M. musicola). Fusarium wilt or Panama disease (Fusarium oxysporum), banana weevil (Cosmopolites sordidus) infestation and compels of plant parasitic nematodes like (Radopholus similis, Pratylenchus coffeae, Meloidogyne incognita, Helicotylenchus multicinctus etc.) are also other important devastating factors in different regions. Cucumber mosaic virus (CMV), banana bunchy top virus (BBTV) and banana streak virus (BSV) diseases have also been reported in several parts of the world.
1.5 Conventional method of propagation Banana is propagated by suckers that arise from the underground rhizome. It is mandatory that the planting material should be free from insect pests and diseases so as to yield healthy and productive plants. However, propagating bananas by this method has some disadvantages like the bulkiness of planting materials and their difficulty in
6 transportation. In this method, proper identification of clones in younger stages may not be possible and rapid multiplication of new hybrid cultivars becomes difficult as the process is very slow and the multiplication rate of suckers is at 5-20 per year depending on the clone and the agroclimatic conditions and cultural methods followed (Shanmugavelu et al., 2000).
Conventional plant breeding and selection is of course, the common vehicle whereby improved cultivars are routinely produced. While this is acceptable for those plants that are fertile and produce viable embryos, species that do not do so pose special problem. In banana, intractable fertilization barriers such as moderate to high levels of female sterility and triploidy, slow propagation and complex pattern of gene inheritance make genetic improvement of parthenocarpic Musa clones slow and technically difficult. Owing to its plant-based constraints, banana breeding has also proven to be difficult, time consuming and very expensive. Moreover, hybrid plant production in the most common triploid clones is further complicated by low seed set and germination (Shepherd et al., 1996).
1.6. Importance of non conventional methods Genetic transformation technique seems to be an useful method to produce novel breeding materials because this can make a good use of isolated genes from a variety of plants species. The application of genetic engineering, transformation, molecular biology and other advanced techniques in the field of biology has allowed plant breeders to identify, select and transfer genes from one plant to another through a process called genetic transformation. This process is far faster, more efficient and more precise than conventional plant breeding techniques. It has also allowed the exchange of genes between organisms that cannot be crossed sexually.
The need for genetic engineering and the knowledge of biosystematic relation, and possibility to overcome crossability barriers can be greatly improved by in vitro techniques. Haploidization, protoplast fusion, gene transfer and exploitation of somoclonal variation are some examples of in vitro culture techniques of potential importance for crop improvement. However, there is no universally applicable method of culture, regeneration and transformation for all species, as tissues from different genotypes will differ in their response to culture. A procedure to produce shoots
7 through regeneration from one cultivar may be very different from that of another cultivar within the same species. Therefore culture and regeneration protocols must be modified appropriately for culture of each species (Walden and Wingender, 1995).
1.6.1. Importance of in vitro system in improvement of Musa Tissue culture technique and genetic engineering are of special value for banana. These techniques have been pivotal in Musa improvement at many research stations (Vuylsteke et al., 1993). It has unique advantage of rapid multiplication, uniformity of planting materials, availability of more number of plants in short time, disease-free and also possibility of non-seasonal production of plants over other propagation methods. These in vitro techniques can also potentially overcome some of the factors limiting traditional approaches to banana and plantain improvement. These techniques also enable plants to be regenerated from normal and genetically modified cells and tissues in an efficient way under sterile conditions.
In addition, there are several reports which proves that in vitro banana plants are superior to the conventional suckers due to their vigorous growth (Daniells, 1988), precosity and higher yields (Drew and Smith, 1990). Moreover, in vitro system forms the basis for the successful programme of plant genetic engineering. Plant genetic engineering requires the mastery of a regeneration process by means of organogenesis or somatic embryogenesis, preferably of unicellular origin to avoid the problem of chimeras (Grapin et al., 1996).
1.6.2. Somatic embryogenesis Somatic embryogenesis in Musa, using cell suspension has been the subject of research since 1960s (Krikorian and Scott 1995). Somatic embryogenesis is the formation of an embryo from a cell other than a gamete or the direct product of gametic fusion (Merkle et al., 1995). Somatic embryogenesis technique in the genus Musa is aimed at two main objectives-the development of high performance micropropagation and regeneration system useful for genetic improvement. Embryogenesis is considered as a model for testing the totipotency of crop tissues. It also provides an ideal system for the investigation of the whole process of differentiation of plants as well as the mechanisms of expression of totipotency in plants.
8 In the starting phase of banana genetic manipulation, research groups have focused both on the use of meristems (May et al., 1995) and embryogenic cells or protoplasts (Sagi et al., 1995) of banana as basic material for genetic manipulation. Generation of chimaeric transformants hamper the wide application of the techniques used. On the other hand, maximum works in genetic transformation, even when using Agrobacterium-mediated transformation (Perez Hernandez et al., 1998, 1999; Moy et al., 1999), are currently relying on embryogenic cells/tissues. At present, somatic embryogenesis in banana is carried out by making use of vegetative tissues such as rhizome fragments and leaf bases (Novak et al., 1989, Ganapathi and Higgs 1999), proliferating meristem cultures (Dhed’a et al., 1991; Dhed’a 1992; Schoofs 1997; Schoofs et al., 1998) and immature male and female flowers (Escalant and Teisson, 1994; Grapin et al., 1998). Although embryogenic cell suspensions were obtained and plants were regenerated from them by these groups (Dhed’a et al, 1991; Schoofs et al., 1998; Grapin et al., 1996; 1998; Cote et al., 1996), it would be an over statement to say that the production of embryogenic cell suspensions from meristem or immature flowers would be routine and free from problems.
1.6.3. Somaclonal variation in Musa To regenerate and multiply the existing clone, many micropropagation protocols are developed and a large number of plantlets are produced respectively (Bhagyalakshmi et al., 1995; Venkatachalam et al., 2007). But in banana, the genetic fidelity of regenerated plants is often questioned because there are frequent reports on the occurrence of somaclonal variations not only in regenerated plants but also in micropropagated ones (Smith 1988; Damsco et al., 1996; Martin et al., 2006). Such kind of variations is known as somoclonal variations.
Larkin and Scowcroft (1981) coined the term somaclonal variation to describe the occurrence of genetic variants derived from in vitro procedures. Factors such as explant source, time of culture, time of subculture, number of subcultures, phytohormones, genotype, media composition, the level of ploidy and genetic mosaicism are capable of inducing in vitro variability (Silvarolla, 1992).
9 1.6.3.1. Identification of genetic variation The major hindrance of somaclonal variation is the identification of genetic variations within the regenerated plants and their stability in succeeding generations. Genetic stability and maintenance of the variant germplasm are mandatory for crop improvement program. Tissue culture induced variations can be determined at the morphological, cytological, biochemical, and molecular levels with several techniques. Although the morphological traits can be used reliably to differentiate off types, mutants, specific clones. But the discriminating ability of these techniques weaken at in vitro level. Molecular markers suitable for generating DNA profiles have proved to be an effective tool in assessing the genetic stability of regenerated plants. These markers are not influenced by environmental factors and generate reliable and reproducible results. Molecular markers are widely used to detect and characterize somaclonal variation at the genetic level (Ford-Lloyd et al., 1992; Barrett et al.,1997). A number of such markers have been successfully used in Musa. They are:
Anthocyanin polymorphisms. Isozyme Analysis. Random Amplified Polymorphic DNA (RAPD) markers. Restriction Fragment Length Polymorphism (RFLP). Short Tandem Repeats (STRs). Simple Sequence Repeats (SSR). Inter Simple Sequence Repeats (ISSR) Allele specific Amplified Fragment Length Polymorphism (AS-AFLP).
1.6.3.2. Use of microsatellite marker The large number of alleles and high level of variability among closely related organisms made PCR amplified microsatellites, the marker system of choice for a wide variety of applications. Microsatellites are short nucleotide tandem repeats of a motif, usually one to six bases. They are present in bacterial, fungal, plant, animal and human genomes, and are often referred to simple sequence repeats (SSR). Microsatellites are easy to amplify and are highly abundant and evenly distributed throughout genome (Weising et al., 2005), which makes the method highly polymorphic and specific (Bornet and Branchard 2001). SSR are used for plant breeding, conservation biology and population genetics as forensics, paternity analysis and gene mapping (Coates and
10 Byrne 2005). The methods require little amount of DNA, which does not have to be of high quality. Similarly, Inter simple sequence repeat (ISSR) is a PCR based method, which involves amplification of DNA segments present at an amplifiable distance between two identical microsatellite repeat regions oriented in opposite direction. The technique uses microsatellites, usually 16–25 base pair long primers in a single primer PCR reaction targeting multiple genomic loci to amplify mainly the inter-SSR sequences of different sizes. This technique is simple, quick, and efficient. The primers are long resulting in high stringency and hence reproducibility. These primers can be successfully used to study the variations among the population of plantlets produced through different culture techniques.
1.7. Objectives Based on the aforesaid facts, the following objectives were designed to: Screen embryogenic capacity of Indian commercial cultivars of bananas. Study the factors controlling the phenomenon of somatic embryogenesis and embryogenic cell suspension in commercial cultivars of bananas. Develop an efficient regeneration and germination system for in vitro propagation and genetic improvement of bananas. Asses the genetic fidelity of suspension derived plants using molecular markers and morphotaxanomical evaluation in field condition.
11 Chapter- II RReevviieeww ooff LLiitteerraattuurree
2.1. General Description Banana and plantain develops from an underground stem called the ‘corm’ or ‘rhizome’. The rhizome is a stout, tuberous and storage organ which sustains the growth of the bunch and sucker. It has extremely short internodes covered by closely packed leaf scars. The roots emerge from the rhizome, most of which grow horizontally to a depth of 15 – 20 cm in the soil (Champion and Siossaram, 1970). They are whitish and healthy when newly formed, but turn grey or brown as they age. The position and distribution of roots is influenced by type of soil, compaction and drainage. The uptake of essential minerals from the soil depends on the size and effectiveness of the root system (Tezenas du Montcel, 1987). Suckers are formed less than nine months after planting, depending on the genotype. However, most hybrids can develop suckers earlier.
Depending on the height and morphology of leaves, suckers can be differentiated into peepers, sword, maiden and water suckers. The water suckers have broad leaves and a narrow rhizome base. Contrarily the sword suckers have narrow leaves and are ideal for planting. The mother plant with the suckers constitutes a mat or stool. After the crop has been harvested, the mother plant is cut down and the suckers thinner. The second harvest from the plantain is the first ratoon crop. The third is the second ratoon and so on. Most plantain show strong apical dominance which retards ratoon growth and leads to mutual competition between the suckers once the infructescence on the main pseudostem is harvested (Swennen and De Langhe, 1985).
The pseudostem is a cylindrical structure, originating from the rhizome and containing about 95% water and it bears the leaves. Like in most monocots, the pseudostem consists of a system of concentric, overlapping leaf bases. Plantain produces about 35 leaves under normal conditions (Brouhns, 1957), depending on the cultivar. The scale leaves are first produced from the central meristem as the suckers
12 develop. The leaf consists of a sheath, petiole and lamina. Leaf size and rate of leaf emission depend on edaphic condition, climate and clone (Tezenas du Montcel, 1987). When the crop has formed a number of leaves, the terminal bud of the corm develops from the pseudostem and produces the inflorescence. At this stage, leaf production ceases. The inflorescence emerges between the leaves and is held in position by the peduncle. The inflorescence comprises the male, female and hermaphrodite flowers. Ovaries of the female flower develop into edible parthenocarpic fruits.
2.2. Somatic embryogenesis Formation of an embryo from a cell other than a gamete or the direct product of gamete is known as somatic embryogenesis (Merkle et al., 1995). It is not an artificial phenomenon restricted to in vitro work, but also occurs in nature, known as apomixis. In such conditions embryos develop from seed cells and tissues such as nucellus, integument, synergids, antipodals and endosperm, or through budding (cleavage polyembryony) from suspensor cells or apical cells in the embryonic mass produced by zygote (Sharma and Thorpe, 1995). Normally, tissues inoculated in vitro have to be subjected to plant growth regulators and other stress factors in order to induce somatic embryogenesis.
Pioneers of in vitro somatic embryogenesis were Wiggan (1954) and Steward et al. (1958), describing bud formation and proembryo like forms in Daucus. They were not able to clearly observe SE, but rather organogenesis and filamentous proembryos, and the first to demonstrate totipotency in somatic plant cells. In the early 1960s, reports appeared on the formation of bipolar embryos and plant regeneration there from in cultures derived from mature organs of the carrot plant (Steward et al., 1963) or from cultured zygotic embryos (Norstog, 1961; Maheswari and Baldev, 1961).
Halperin (1967) introduced the term proembryogenic masses (PEMs) to describe the embryogenic cell masses from which somatic embryos can be formed. PEMs undergo cycles of growth and fragmentation until auxin is removed from the culture medium or drops below a threshold level in old cultures.
13 2.2.1. Phenotypic plasticity in plants Plants are sessile organisms. In order to survive, grow and reproduce they have developed strategies to circumvent environment extremes and to take maximum advantage when conditions improve (Trewavas, 1981; Smith, 1990). This phenomenon, called phenotypic plasticity, includes instability in morphogenic and developmental programs and ability to respond to damaging external conditions. Concepts of competence, induction and determination, introduced by animal biologist, were taken over by botanists. Competence is exhibited if a cell/tissues/organ is exposed to a signal and responds in the expected manner. Prior to becoming competent, cells have to dedifferentiate. Induction refers to the expression as a unique developmental response from competent cells due to that signal. Determination is shown if an induced cell or group of cells exhibit the same developmental fate whether grown in situ, in isolation or at a new place in or on the organism. Due to plant plasticity, determination in plant cells is not as rigidly fixed as in animal cells.
2.2.2. Morphogenic competence and morphological expression SE can be considered as an extreme case of phenotypic plasticity, where various states of development can be altered under appropriate conditions (Dudits et al., 1995; Yeung, 1995). Altering the growth conditions and subjecting inoculated tissues and/or organs to unuasal conditions (stress), can trigger plant to abolish or alter gene expression related to a specific function they had in the plant and to become competent to the inductive signals for somatic embryogenesis. Another characteristic of plant cells is totipotency. All somatic cells within a plant contain the entire set of genetic information to regenerate into a complete and functional plant (Merkle et al., 1995).
The three events (competence, induction and determination) enumerated above are usually tightly coupled and may be impossible to separate (Yeung, 1995). Hilbert et al., (1992) reported on two critical phases involved in morphological differentiation of somatic cells into whole plants, namely induction of cells for morphogenic competance and morphological expression of that competence. Cells that are embryogenic are more easily induced to undergo somatic embryogenesis. Such cells, were called pre-embryogenic determined cells (PEDCs) (Evans et al., 1981; Sharp et al., 1982). Growth regulators or favourable conditions are then simply ‘permissive’ for cell division and expression of embryogenesis. In contrast to direct embryogenesis from
14 PEDCs, highly differentiated vegetative cells require major epigenetic changes. Growth regulators and or other stress factors are required to induce dedifferentiation, cell division and to determine the embryogenic state. These cells are called induced embryogenic determined cells (IEDCs). Induction of SE from these cells is indirect because an intermediate callusing phase is involved. The directness of embryogenesis therefore depends on the epigenetic ‘distance’ of explant cells from the embryogenic state (Merkle et al., 1995). Once embryogenic determined cells are obtained, there appears to be no fundamental difference between direct and indirect SE (Williams and Maheswaran, 1986).
2.2.3. Unicellular and multicellular origin of somatic embryos The question of a single- or multiple-cell origin for somatic embryoids is directly related to coordinated behaviour of neighbouring cells as a morphogenetic group. In agreement with Street and Withers (1974), Haccius, (1978) defined a non- zygotic embryo as a new individual arising from a single cell and having no vascular connection with maternal tissues. However, Raghavan, (1976) was more cautious in recognizing that a single cell origin had not been unequivocally demonstrated in many cases where apparently normal bipolar embryoids were formed cell from aggregates.
In both process, embryoids may arise from single cells (unicellular origin) or from a group of cells (multicellular origin), depending on whether or not neighbouring cells have the same interval development state and/or can communicate and behave as a group rather than as individual cells (Williams and Maheswaran, 1986). Unicellular or multicellular origin of the somatic embryos, is strictly related to the cell maturity or epigenetic distance from the embryogenic state in multicellular explants. Maheswaran and Williams (1985) illustrated this for induction of SE from epidermal cells. In their opinion, embryogenesis from a mature tissue is only possible by callus induction. In Cichorium however, direct embryogenesis was obtained from matured cortical cells in the root and from mesophyll cells in the leaf (Dubois et al., 1990; Verdus et al., 1993). Direct embryogenesis was also observed in mesophyll cells of Orchard grass (Conger et al., 1983) and Dactylis glomerata (Trigiano et al., 1987).
15 2.2.4. Application of somatic embryogenesis 2.2.4.1. Important applications One of the main uses of somatic embryogenesis constitutes its employment as an approach to investigate the initial events of zygotic embryogenesis in higher plants. The mass propagation of plants through multiplication of embryogenic propagules is the most commercially attractive application of somatic embryogenesis (Merkle et al., 1995).
Somatic embryogenesis over organogenesis: a) It is the best method to culture large numbers of ‘reproductive units’ (60,000 to 1.35 million somatic embryos per liter of medium) with the presence of both root and shoot meristems in the same element. b) This mode of culture permits easy scale-up transfers with low labor inputs since embryos can be grown individually and freely floating in liquid medium. c) Pure culture of homogenous material can be obtained through somatic embryogenesis since they frequently originate from single cells. d) Plants derived from somatic embryos are less variable than those derived by way of organogenesis (Ammirato et al, 1987; Merkle et al., 1995; Osuga and Komamine, 1994). This is due to the intolerance of somatic embryos to mutations in any of the numerous genes that might be necessary for a successful completion of ontogeny (Ozias-Akins and Vasil, 1988), while vegetative meristems may be more tolerant to mutations and epigenetic changes (Merkle et al., 1995).
2.2.4.2. Other applications a) Somatic embryogenesis has opened up the possibility for the use of somatic embryos in synthetic seed technology (Gray, 1995). b) Production of plants with different ploidy levels is another application of somatic embryogenesis i.e., obtaining haploid embryos by cultivating anthers and raising triploids from endosperm have been suggested and exploited to a very limited extent, exploited (Terzi and Lo Schiavo, 1990). c) Embryogenic callus, cell suspension as well as somatic embryos can be used as a source of protoplasts, taking advantage of the totipotency (Merkle et al., 1995).
16 d) Secondary or recurrent embryogenesis, which is reported in atleast 80 species (reviewed by Raemakers et al., 1995), offers a great potential for in vitro production of embryo metabolites, such as lipids and seed storage proteins. e) The embryogenic development of somatic cells appears to be more sensitive to the application of exogenous chemical compounds than the growth of whole plants or even callus cultures. This offers the possibility of using in vitro screening and selection procedures to identify plant genotypes resistant to certain factors, such as aluminum toxicity or toxins produced by pathogens (Merkle et al., 1995).
2.3. Factors affecting somatic embyrogenesis 2.3.1. Effect of genotype All plant cells contain the entire set of genetic information necessary to create a whole plant and, if proper induction conditions are provided, they can dedifferentiate into plants (Merkle et al., 1995). Somatic embryogenesis capacity was found to change with genotype and their responses between genotypes have been studied in some plants such as alfalfa (Brown and Atanassov, 1986) and soybean (Parrott et al., 1989). Genetic analysis suggested that this phenomenon is heritable and that one or more genes control the regeneration response. These genes belong to both nuclear and cytoplasmic genomes (McKersie and Brown, 1996). In nuclear genomes, the genes responsible for regeneration range from 1 to 2 in most tested plants (Henry et al, 1994). In both mono and dicotyledonous plants, the gene action of the nuclear genome is characterized as additive in regeneration and the regeneration-controlling genes vary among the different stages of the regeneration process. For instance, callus induction and somatic embryogenesis are controlled separately by one dominant gene and two complementary dominant genes in alfalfa (Hemandez-Femandez and Christie, 1989). These genes can be either recessive such as in wheat (De Buyser et al., 1992) or dominant as in alfalfa (Reisch and Bingham, 1980). It appears that only a few genes control regeneration ability. In plants, the cytoplasmic genome consists of genetic material in mitochondria and plastids. They exist and function uniquely in cells, but are partially controlled by the nuclear genome and it has been reported that these organelles take part in callus production and affect regeneration capacity (Henry et al., 1994).
17 2.3.2. Effect of explant Somatic embryogenesis has been achieved from explants such as leaves (dos Santos et al., 1980; Mezentsev and Karelina, 1982), petioles (Walker et al., 1978, 1979), stems (Walker et al., 1978, 1979), cotyledons (Atanassov and Brown, 1984; Stavarek et al., 1980) hypocotyls (Reisch and Bingham, 1980), protoplasts (Atanassov and Brown, 1984), microspores (Takahata et al., 1991 ), tuber (Krishnaraj and Vasil, 1995), ovary (Brown et al., 1995), ovule (Dunçtan et al., 1995), nucellus (Dunstan et al., 1995) and immature embryos ( Walker and Sato, 1981; Walker et al., 1978 and 1979). This is supported by the fact that though all organs, tissues and cells of plant body contain the same genetic information, but the reaction is different to in vitro tissue culture because of variation in their physiological state such as age (Takahata et al., 1991) and degree of differentiation (McKersie and Brown, 1996). In monocots, cells differentiate early and rapidly followed by loss of mitotic and morphogenetic ability and explant source is considered even more important than genotype (Krishnaraj and Vasil, 1995). Young and undifferentiated cells are easier to regenerate than mature and differentiated cells (Duntan et al., 1995; Krishnaraj and Vasil, 1995). Besides the degree of differentiation, levels of endogenous hormones differ among organs, tissues and cells, and some other unidentified factors may also determine the variation of regenerating responses (Brown et al., 1995; Krishnaraj and Vasil, 1995). It is noteworthy that embryogenic cells of explants that respond to culture environment vary along with the environmental factors (Wenzel and Brown, 199l), possibly because of their different requirements for competence such as exogenous growth regulators (McKersie and Brown, 1996). The difference in regenerating ability among various organs, tissues and cells of a plant suggests that somatic embryogenesis is not only controlled by regenerating genes, but to a certain degree, also controlled by other factors such as physiological state of explants and culture conditions.
2.3.3. Effect of medium The history of research in somatic embryogenesis can be described as a success story of medium development (Brown et al., 1995). Success in somatic embryogenesis from a genotype or explant of a plant usually depends on components of the medium either directly or indirectly. MS medium (Murashige and Skoog, 1962) is among media which have been most widely used in somatic embryogenesis (Brown et al., 1995; Dunstan et al., 1995). More than 2,000 medium formulations have been reported, but
18 half of them are modified MS medium (Brown et al., 1995). Other popular media include B5 (Gamborg et al., 1968), SH (Schenk and Hildebrant, 1972), N6 (Chu et al., 1975), and Linsmaier and Skoog, 1975) media (Brown et al., 1995; Krishnaraj and Vasil, 1995). The culture media vary in both type and concentration of the components, but all media have similar basic classes of components which consist of growth regulators, nitrogen, carbohydrates, inorganic macro and micronutrients, vitarnins, and organic additives (Brown et al., 1995). The interaction between genotype and medium components can greatly influence somatic embryogenesis. Among them, carbohydrates, growth regulators, nitrogen and growth regulators play the most important roles.
2.3.3.1. Carbon source Sugar is carbon and energy source and it also takes part in osmotic adjustment (Denchev et al., 1993). Its effects on somatic embryogenesis are dependent on the type and concentration of sugar, and the culture protocol. Through comparison and selection, it is now established that sucrose is the most suitable carbohydrate and widely used, followed by glucose, maltose, raffinose, fructose, mannitol and some other rarely used sugars (Denchev et al., 1993; Lippmann and Lippmann, 1993). In some protocols, maltose is applied in medium for embryo development because maltose promoted more normal morphology than sucrose (Denchev et al., 1993). The optimal concentration of sugar varies among sugar types, plant species and development stage of embryos. In terms of sucrose, optimal concentrations range from 58-88 µM (Brown et al., 1999) or 2-4% for rapid growth of callus (George, 2006).
2.3.3.2. Nitrogen source Nitrogen is indispensable to plant life and to somatic embryogenesis since it is required for the key components of plants namely structure and function and for materials such as proteins, nucleic acids, and plant hormones. The growth and morphogenesis of callus is greatly affected by the form (reduced or oxidized) and amount of nitrogen provided. Plants utilize reduced nitrogen for their metabolism; ammonia, NH3, and amino acids (glutamine, proline, glutathione, alanine, serine, etc. - and casein hydrolysates) are most commonly used in culture medium (Li, 1988). NO3 , a highly oxidized form of nitrogen, required in tissue culture. Plant cells cannot utilize nitrate ion directly, instead they first reduce nitrate ion into ammonium with energy - expense. There are three reasons for the use of nitrate ion. The first is NO3 is necessary
19 for embryogenesis, a lack of it in medium results in abnormal embryos or a reversal of embryogenesis to callus formation (George, 2006). The second is that the single - + application of NO3 or NH4 has latent toxicity and hence a combined application of - + NO3 and NH4 can prevent the toxicity. The third is that, through adjusting pH, nitrate ion promotes the absorption of NH4+ (George, 2006). Experiments have conformed that improved embryo results when both are used together rather than separately (e.g. - + Shetty and McKersie, 1993), and a suitable ratio of NO3 and NH4 is a key factor influencing somatic embryogenesis (McKersie and Brown, 1996). Like requirements for other nutrients, a suitable concentration of nitrogen is necessary for embryogenesis. A low level of nitrogen cannot meet the requirements of cell activity and growth; whereas, a high concentration of nitrogen inhibits embryogenesis due to the toxic effect of ammonium and nitrate ion (George, 2006).
2.3.3.3. Macro and microelements Carbon and nine other chemical elements were first established as "essential inorganic nutrients" for plant normal growth (Raven et al., 1992). By 1954, this family was expanded by six other members, manganese, zinc, copper, chlorine, boron, and molybdenum. These elements vary greatly in concentration, form of absorption and function in plants. However, the absence of any of these elements will result in characteristic abnormalities of growth or deficiency symptoms (Li, 1988; Raven et al., 1992). They are also essential for somatic embryogenesis. For instance, potassium influences the cell K4-ATPase activity, which in turn regulates nutrient uptake and metabolite allocation (Shetty and McKersie, 1993).
20 Table – I
Usual conc. Observed in plants cells Elements Main function forms (% of ppm/DW) Macroelements
Carbon CO2 about 44% Component of organic compounds
Oxygen H2O or O2 about 44% Same as above
Hydrogen H2O about 6% Same as above - Nitrogen NO3 or 1-4% Component of amino acids, proteins, - NH4 nucleotides, nucleic acids, chlorophylls, coenzymes Potassium K+ 0.5-6.0% Osmosis, ionic balance, opening and closing of stomata, activator of many enzymes Calcium Ca2+ 0.2-3.5% Component of cell walls, enzyme cofactor, involved in cellular membrane permeability; component of calmodulin, regulator of membrane and enzyme activities - Phosphorus H2PO4 of 0.1-0.8% Component of ATP and ADP, nucleic acids, 2+ HPO4 coenzymes, phospholipids Magnesium Mg2+ 0.1-0.8% Part of chlorophyll molecuIe and activator of many enzymes 2- Sulphur SO4 0.05-1.0% Component of some amino acids, proteins and of coenzyme A Microelements Iron Fe 2+or Fe 3+ 25-300 pprn Chlorophyll synthesis, component of cytochromes and nitrogenase Chlorine Cl- 10-10,000 Osmosis and ionic balance and pprn photosynthetic reactions Copper Cu2+ 4030-ppm Activator or component of some enzymes Manganese Mn2+ 15-800 ppm Activator of some enzymes, required for integrity of chloroplast membrane and for oxygen release in photosynthesis Zinc Zn2+ 15- 100 ppm Activator or component of many enzymes 2+ Molybdenum MoO4 0.1-5 ppm Nitrogen fixation and nitrate reduction Boron B(OH), or 5-75 ppm Influences Ca2+ utilization, nucleic acid - B(OH)4 synthesis, and membrane integrity
21 2.3.3.4. Vitamins Like animals, plant cells require vitamins as essential intermediates or metabolic catalysts. For instance, thiamine is an essential factor in carbohydrate metabolism, nicotinic acid provides the skeleton of NAD and NADP, which are the co- factors of dehydraogenase enzymes, and pyridoxine is one of the co-factor for amino acid metabolism (Nie et al., 1989). Plants produce their own vitamins; however, cultured plant tissues and cells can not produce their own requirements. As a result, it is necessary to supply vitamins in culture medium (George, 2006). The commonly applied vitamins are thiamine (Vit. B1), nicotinic acid (niacin, Vit. PP), pyridoxine (Vit.
B6) and myo-inositol (Vit. B complex) since they play an important role in metabolism but are deficient in cultured cells and tissues (Brown et al., 1995; George, 2006).
2.3.3.5. Organic additives Organic compounds, mainly amino acids, are beneficial for somatic embryogenesis. Amino acids serve as a supplemental nitrogen source to ammonia and nitrate ion, affect metabolism, and pH of the buffer medium (George, 2006 ; Shetty and McKersie, 1993; Stuart and Strickland, 1984; Trigiano and Conger, 1987). The addition of proline and its analogs such as thioproline were reported to be the most effective among amino acids to promote somatic embryogenesis and embryo morphology (Shetty and McKersie, 1993). Serine, alanine, glutamine, arginine, lysine, asparagine and ornithine also stimulated the quality and quantity of somatic embryos (Stuart and Strickiand, 1984). Casein hydrolysates and yeast extract contains several amino acids, vitamins and other nutrients and are widely used in culture media (Brown et al., 1995).
2.4. Somatic embryogenesis in Musa 2.4.1. Explant selection and induction Somatic embryogenesis has been reported in more than 200 species during the last 35 yrs (Vasil, 1994). Though somatic embryogenesis in Musa, is subject of research since 1960s (Krikorian and Scott, 1995), the first report of somatic embryogenesis in Musaceae was that of Cronauer and Krikorian (1983), who obtained somatic embryos from cell suspensions derived from apices cultured in vitro. Somatic embryogenesis which is a basis for genetic engineering has been successful in many banana cultivars such as Bluggoe, Pelipita (ABB) (Novak et al., 1989; Dhed’a et al., 1991; Panis and Swennen, 1993; Escalant and Teisson, 1994), Grand Naine (AAA)
22 (Novak et al., 1989; Escalant and Teisson, 1994; Cote et al., 1996; Becker et al., 2000), Mysore, Silk (AAB) (Escalant and Teisson, 1994), Rasthali (AAB) (Ganapathi et al., 2001a) and Mas (AA) (Mahanom et al., 2003; Wong et al., 2006) using various types of explants.
The choice of explant depends on the regeneration capacity of the cells. On the basis of difference in explant types, four main methods have been developed. Novak et al. (1989) used the bases of leaf sheaths or rhizome fragments of plants produced in vitro. Dhed’a et al. (1991) started from thin sections of a highly proliferating bud culture placed in a liquid medium. Marroquin et al. (1993) established embryogenic suspension from immature zygotic embryos.
Botti and Vasil (1983) developed embryogenic cell suspension from excised zygotic embryos. Similar work was done by Vasil et al. (1985). Escalant and Teisson, (1988) developed somatic embryos from the seeds of banana fruit by culturing them on basal medium supplemented with plant growth regulators. Further research was carried out to find the similarity between the zygotic and somatic embryos. Escalant and Teisson, (1993) found that calli from immature zygotic embryos and somatic embryos were good for induction of embryogenic cell suspension.
Cronauer and Krikorian (1983) reported the production of somatic embryos in liquid medium from cells derived from cultured shoots of two plantain clones, Saba and Pelipita. Cronauer Mitra and Krikorian (1988) also reported regeneration of plants via somatic embryogenesis in the seeded diploid banana Musa ornata Robx. In their study they observed that friable yellow callus began to form near the shoot of the zygotic embryos, which further produce tiny somatic embryos. These somatic embryos were formed profusely in the presence of relatively high levels of 2,4-D.
Escalant and Teisson (1989) found that the serial sections of zygotic and somatic embryos showed perfect homology in their structures which is similar to the finding of Rodriguez et al. (1999). But Rodriguez described that somatic embryos do not have well developed structures, when compared to mature zygotic embryos. Domingues et al. (1996) selected rhizome and pseudostems of banana (Musa spp.) cultivars Maca, Sanicao and GN60 as an explant to initiate cell suspension in
23 MS medium supplemented with vitamins and dicamba. They found that regeneration capacity of these embryogenic cells were very low.
Novak et al. (1989) reported somatic embryogenesis in liquid medium using callus obtained from leaf bases whereas the regeneration process in E. superbum started with the induction of vitrification using high levels of BAP followed by callusing, and the finding was in close conformity with an earlier reports (Afza et al., 1994) in the case of E.ventricosum (Kulkarni et al., 2002).
Schoofs et al. (1998) developed a widely applicable methodology for the initiation of embryogenic cell suspensions using scalps. Among the advantage of using scalps are that no frequent field-trips are required, unlike other methods (for instance, to collect immature flowers) and as such, virus-indexed plant material can be used and the response for embryogenesis is not season dependant. Similarly, Dhed’a et al. (1992) and Stross et al. (2005) focused on multiple meristem cultures as the starting material from which an approximate 3mm top layer (i.e., scalp) which was excised and cultured on embryogenesis induction medium. They also reported that the embryogenic induction was observed in scalp at 3-8 months and constituted of individual embryos, compact callus and/or friable embryogenic callus bearing numerous translucent proembryos (ideal embryogenic callus). Success rates in the establishment of Musa ECS and morphological characteristics of cell culture derived from multiple meristem culture are in accordance with results obtained in case of male flower buds (Panis et al.,1993; Cote et al., 1996; Schoofs 1997; Strosse et al., 2003).
Silvia et al. (2001) reported somatic embryogenesis induction in shoot meristematic apices of cv. Nanicao (AAA). Histological sections of embryogenic regions of the explant at 26 days in culture revealed the formation of meristematic regions, structures with multiple root meristems, and somatic embryos at early globular statges. Use of scalps for embryogenic response does not rely on time or season and this provides a useful tool to control the quality of the whole process (Strosse et al., 2006). However, this method that uses a high dose (100 mM) of N6-benzylaminopurine (BAP) produces scalps in the EAHBs only after nine subculture cycles and is cultivar dependant. The prolonged use of a high dose of BAP has the disadvantage of producing
24 somaclonal variation and/or an undesirable decrease in somatic embryogenesis (INIBAP, 2000).
Wang Xiao et al., (2007) reported that protoplasts of cv. Mas (AA) could divide and form cell colonies in liquid culture system contrasting previous reports that protoplasts of banana could not divide and form cell colonies when cultured in liquid medium (Panis et al., 1993; Assani et al., 2001). Panis et al. (1993) reported the plant regeneration through direct somatic embryogenesis from protoplasts of banana (Musa spp.). Their results proved that 50% of plant regeneration occurred from microcolonies via somatic embryos when high inoculation densities or nurse cell cultures were used. In the same year, Megia et al. (1993) regenerated plantlets from protoplast of cell suspension derived from meristematic buds in cv Bluggoe (ABB). It was also found that the protoplast developed directly into embryos without passing through callus phase. Whereas, Assani et al. (2001) reported the establishment and regeneration of protoplast derived cell suspension and microcalli in cv. Grand Naine.
2.4.2. Male and female buds as explant After transition from the vegetative to the floral stage, the banana meristem initially differentiates into female hands (group of flowers inserted at the same node). At this stage, the meristem remains active and produces hands of transitional flowers and then hands of male flowers. Hence, in Musa immature male buds are being used as explant for producing embryogenic cell suspensions (Stover and Simmonds, 1987). Ma (1991), Escalant and Teisson, (1994), Grapin et al. (1996, 2000) used young male flowers as starting material for initiating suspension culture. The female flower could also be used as explant for the development of ECS but it leads to the destruction of entire bunch (Grapin et al., 1998).
With Musa male flowers, 15 hands proximal to the terminal meristem were used as explants (Escalant and Teisson, 1994; Grapin et al., 1996). For this type of explant the number of flowers per hand does not change with the row and probably size was the only deciding factor for the explant response. The response of hands of male flowers depends strongly both on genotype and the time of year when it is initiated (Escalant and Teisson, 1994).
25 Escalant and Teisson, (1994), Cote et al. (1996) and Grapin et al. (1998) employed male and female flowers in cultivars of the groups AA, AAA, AAB and AAAB to develop embryogenic tissues which was later used to establish cell suspension cultures. Uma et al. (2007) studied the embryogenic capacity of eleven commercial Indian cultivars across the genome (AB, AAA, AAB and ABB) and reported that embryogenesis through male buds is genome dependant. Such genomic dependence has also been observed in scalp cultures (Schoofs et al., 1997).
Wirakarnain et al. (2008) developed a protocol for the establishement of competent multiple meristem cultures of banana, Musa acuminata cv. ‘Pisang Mas’ (AA) derived from male inflorescence which could be an alternative material for mass multiplication of bananas. The current trend has exploited the meristem inflorescences as explants for in vitro micro propagation techniques (Resmi and Nair 2007; Krikorian et al., 1993) because these materials reduce the contamination rate compared to soil grown suckers.
Lemos (1994) focused on somatic embryogenesis in two genomes of banana (Musa spp. AAA and AAB group). del-Sol et al. (1995) developed embryogenic callus from immature male flowers of Musa sapientum and Musa paradisiaca using different concentrations of 2,4-D and different types of gelling agent. They also proved that phytagel was the best gelling agent and concentration of 2,4-D required for the induction of embryogenic callus varied from cultivar to cultivar. Ganapathi et al. (1999) used male flowers in five cultivars of banana to produce embryogenic cultures. Grapin et al. (2000) reported indirect embryogenesis through the development of induced embryogenically determined cells as explained by Ammirato et al. (1987). Daniel et al. (2002) developed cell suspension from calli with embryogenic structures obtained from young male flowers of banana. Antra gosh et al. (2009) developed embryogenic cell suspension (ECS) using immature male flowers of cultivar Robusta. The embryogenic tissue can be obtained from female flowers or male flowers but both of them resemble in characters (Escalant and Teisson, 1994; Grapin et al., 1996).
Marroquin et al. (1993) mastered the regeneration of embryogenic suspension by using zygotic embryos and Ma (1991) reported regeneration using embryogenic suspension initiated from young male flowers. More efforts have been taken to
26 standardize the regeneration protocol for Cavendish banana. Navarro et al. (1997) reported plant regeneration via somatic embryogenesis in Grand Naine which include the combination of growth regulators like 2,4-D, IAA and NAA. Improved system for the mass propagation via somatic embryogenesis was described in cv. Grand Naine (Chong-perez et al., 2005) and hybrid FHIA-18 (AAAB) (Gomez kosky et al., 2002). And further secondary multiplication of somatic embryos was achieved in liquid medium in rotary shaker from which high regeneration of plants (89.3%) was obtained in one month. Khalil et al. (2002) studied and standardized the regeneration protocol for secondary somatic embryogenesis in cv. Dwarf Brazilian. Ganapathi et al. (2001b) proved that somatic embryos can be used as explant for the production of synthetic seeds. It was also reported that germination frequency of encapsulated embryos varied considerably on different gel matrices and subtrates used for plant development.
2.4.3. Factors controlling somatic embryogenesis According to Litz and Jarrett (1991), plant tissues have the ability to form callus under in vitro condition but relatively few explants have the ability to produce callus with embryogenic structures. By subjecting the explant culture to unusual conditions (stress), might be feasible to eliminate or lessen the proper gene expression for the development of somatic embryogenesis. Based on this, several methods have been used to induce somatic embryogenesis, such as heat, increasing the hypochlorite ion concentration, anaerobiosis, low temperature (4°C), high osmotic pressures and exposure to auxin (Merkle et al., 1995). Besides time, the efficiency of somatic embryogenesis and plant regeneration system through cell suspension cultures is determined by the following key factors: (i) the availability of embryogenic competent explants, (ii) the nature and frequency of embryogenic response, (iii) the success rate of suspension initiation, (iv) the plant regeneration frequency and (v) trueness-to-type (Schoofs et al., 1999).
Embryogenic response and high regeneration ability were shown to be under genetic control, sexually transferable to less responsive genotypes through hybridization in maize and wheat (Tomes and Smith, 1985; Higgins and Mathias, 1987), alfalfa, soybean, cotton and potato (Seitz and Bingham, 1988; Sonnino et al., 1989). Brown and Atanassov (1986) and Parrot et al. (1989) found that cultivars showing high levels of embryogenesis descended from a few specific ancestral
27 germplasm sources. Embryogenic responses can also vary among cultivars or even between individuals of a given cultivar (Chen et al., 1987; Szabados et al., 1987; Komatsuda and Ohyama, 1989; Feirer and Simon, 1991).
Medium composition or other culture effects, was found to affect embryogenic responses of less embryogenic genotypes (Chen et al., 1987- Brown, 1988). Monitoring these potential of culture would be useful for the stable production of somatic embryos (Ibaraki et al., 1998). Vasil (1987) and Close and Gallagher-Ludeman (1989) commented that in case monocots, highly recalcitrant plants or genotypes can be induced to undergo morphogenesis in culture, when suitable explants at defined developmental stages are excised from plants under optimal condition, and when the appropriate growth regulators and media are used.
Induction of callus towards embryogenesis is largely dependent on a reduced auxin-cytokinin balance in the culture media (Michaux Ferriere and Schwendiman 1992). But still auxin is considered to be the most important hormone in regulating somatic embryogenesis (Cooke et al., 1993). Both the endogenous contents and the application of exogenous auxins are determining factors during the induction and expression phases of somatic embryogenesis. The choice of auxin is very important in the induction process and can affect the frequency and morphology of somatic embryos (Levi and Sink 1991, Rodriguez and Wetzstein 1994). Among 65 dicot species reviewed by Raemakers et al., (1995), somatic embryogenesis was induced in 17 species on hormone-free media, in 29 species on auxin-containing media and in 25 species on cytokinin-supplemented media. Among auxins, the most frequently used was 2,4-D (49%) followed by naphthalene acetic acid (27%), indole- 3-acetic acid (IAA) (6%), indole-3-butyric acid (6%), Picloram (5%) and Dicamba (5%). In the case of cytokinins, N6-benzylaminopurine was used most often (57%), followed by kinetin (37%), zeatin (Z) (3%) and thidiazuron (3%).
The low production of callus with embryogenic structures remains as one of the major constraints in the process of somatic embryogenesis which is directly influenced by the concentrations of 2,4-D used (Dion daniels et al., 2002). It has been reported that the culturing of explants in 2,4-D-containing medium increases the endogenous auxin levels in the explants (Michalczuk et al., 1992). It has also been observed that polar
28 transport of auxin is essential for the establishment of bilateral symmetry during embryogenesis in dicotyledonous somatic (Schiavone & Cooke, 1987) and zygotic (Liu et al., 1993) embryos, and more recently it was also demonstrated for monocotyledonous zygotic embryos (Fischer & Neuhaus, 1996). Cote et al. (1996) and Gomez et al. (2000) used a concentration of 4.5 μM 2,4-D in the multiplication of cell suspensions of Grand Naine (AAA) and FHIA-18 (AAAB), respectively, while the highest cell growth was obtained at 13.5 μM 2,4-D.
Ivanova et al., (1994) found a relation between endogenous levels of growth regulators especially IAA levels, and the ability to respond to 2,4-D induction treatment. Fast embryogenic lines have endogenous IAA levels, 4 times higher than that of slow embryogenic lines and 30 times higher than that in non embryogenic lines. Non embryogenic lines moreover were found to have high endogenous levels of abscisic acid (ABA). Once the stimulus for the further development of the somatic embryos is given (i.e., through reduction or removal of 2,4-D from the culture medium), those levels must be reduced, to allow the establishment of the polar auxin gradient. If the levels are extremely low or high, or if they do not diminish after the induction treatment, the gradient cannot be formed and thus somatic embryogenesis cannot be expressed.
One of the most powerful aspects of somatic embryogenesis which allows its application in mass propagation and gene transfer (Merkle et al., 1995). These processes have been propagated several terms, as secondary embryogenesis, recurrent or repetitive (Gomez, 1998). Repetitive embryogenesis can occur in the absence of an exogenous auxin. This process is called autoembryogenesis and is sometimes referred to as proliferation or mass propagation (Merkle et al., 1995).
Cytokinin also plays a major role in embryo formation of banana ECS (Novak et al., 1989; Dheda et al., 1991; Ma 1991; Cote et al., 1996; Grapin et al., 1996). Arinaitwe (1999) also reported an increase in bud proliferation rate as the concentration of TDZ was increased from 0.045 to 6.81 mM. The higher cytokinin activity of TDZ was attributed to its ability to accumulate in cultured tissues to act as endogenous cytokinins (Huetteman and Preece, 1993). Nahamya (2000) reported higher multiple bud proliferation and earlier scalp formation in EAHBs with TDZ than with BAP when
29 the two cytokinins were used at concentrations of 10 mM and 100 mM, respectively. Similar work was carried out by Sales et al. (2001), in which effects of various benzyladenine concentration on scalp initiation was studied to produce embryogenic callus from them.
The choice of the explant might be the key factor that determines failure or success of an embryogenic protocol (Brown et al., 1995; Krishnaraj and Vasil, 1995). In monocots, cells differentiate rapidly, thereby loosing totipotency. Only meristematic cells and partially differentiated cells, that are developmentally uncommitted, reveal mitotic and regeneration ability (Krishnarraj and Vasil, 1995). The presence of mature and more differentiated tissues appears to inhibit the expression of embryogenic competence in uncommitted cells (Vasil, 1987). Merkle et al., (1995) relate the explant type and its developmental stage or age again to the epigenetic ‘distance’ of tissue cells from the embryogenic state. For pre-embryogenic determined cells and tissues (PEDCs), the use of a cytokinin only may be sufficient to induce embryogenic determined cells (IEDCs), an auxin, or auxin and cytokinin are needed. Cells in tissues can range anywhere between PEDC and IEDC, and often the cell population is very heterogenous.
Number of subcultures is another important factor controlling the rate of proliferation and friability of the callus produced. Fitchet (1987) reported that friability of callus increased with number of subcultures of callus. Formation of ideal calli also depends on the age of the explant and position of the explant. In banana cultivars, from 5th to 9th whorls formed more callus with high frequency of somatic embryogenesis than the 10th to 14th whorls (Gomez Kosky et al., 2001).
Mavituna and Buyukalaca (1996) described those oxygen uptake rates of cultures was the highest being in embryogenic suspension cultures and the lowest during embryo maturation. George et al. (2006) reported that the suspension induced in liquid medium will have varying regeneration capacities. Their results further indicated that quality of an embryogenic cell suspension decreased with the increased number of subcultures. This results in an increased probability of contamination and decreased growth rate and regeneration capacity, due to the fast growing dense cells rich in starch. This is similar to the findings of Ma et al. (1989) who also proved that the plant
30 regeneration frequency was dependent upon the cultivar and was also influenced by growth factors present in the culture medium. The suspension cell cultures retained their regeneration ability for more than a year.
Even though callus can be produced in the absence of light both from the vegetative and reproductive tissues in MS medium with 2,4-D, regeneration and germination capacity of the embryogenic cells depended largely on genotype and nature of explant. Quantitative regeneration is based on weight measurements and quantity of germinating embryos and plants per milliliter of settled cell volume (SCV). Hence, the germination capacity of embryogenic cells using different explants is same. Sharma and Millam (2004) stated that the key factor to the success of any somatic embryogenesis system is the ability to discriminate SE-specific cellular structures from those emerging through an organogenic route whereas, the response of hands of male flowers depends strongly on both the genotype and the time of the year when it was cultivated (Escalant and Teisson, 1994).
2.4.4. Embryogenic cells and their embryogenic capacity Examination with light and electron microscopy (Halperin and Jensen, 1967; Street and Withers, 1974) resulted in the definition of embryogenic cells: rounded cells with dense cytoplasm rich in starch reserves, a large nucleus with a single enlarged nucleolus. But Grapin et al. (1996) for the first time reported that cells devoid of starch and with only protein reserves also has embryogenic potential. William and Maheswaran (1986) mentioned that suspension with a great number of actively dividing spherical cells and heterogenous, irregular cell masses can be an indicator of the embryogenic condition of cell suspensions. On the other hand histological study revealed that the yellow globular compact structures developed from non-embryogenic suspensions were vacuolated with no accumulation of starch or protein reserves which was believed to be the factor of poor redevelopment of somatic embryos (Mahanom jalil et al., 2008).
Image analysis techniques are promising method for evaluation of cultures because it can non-destructively monitor the cultures and provide objective indices for visual information. Microscopic image analysis for suspension culture could be used to select proembryogenic masses. In some cases, the area was used directly as a cell
31 quantitative parameter; otherwise the area was correlated to normal quantitative parameters, such as fresh weight, dry weight, packed cell volume (PCV) and the number of cells (Ibaraki and Kurata, 2001).
Numerous internal cell divisions led to the formation of proembryos, distinct from each other, at the beginning of the embryos development phase. This probably indicates the unicellular origin of the embryos. It was also observed that embryogenesis could occur from nodules, as shown by Dhed’a et al. (1991) in respect of cv Bluggoe.
Culture density of cell suspensions could be another important factor that affects somatic embryogenesis. A high cell number is required to induce their transition into embryogenic cell clumps (Toonen et al., 1994). Cell density seems to have an impact on cell proliferation and maintenance of embryogenic characteristics. Best result were obtained by diluting the suspension to 1/3. Toonen et al. (1994) reported on cell densities as high as 10,000 cells/ml, needed to induce cell divisions in state 0 cells (partially embryogenic state). Similarly, Nomura and Komamine, (1986) proved that high cell density (105 cells/ml) is required for the formation of embryogenic cell clusters from single cells (Nomura & Komamine, 1986), whereas lower cell density (2 x 104 cell/ml) favors the development of embryos from embryogenic cells (Fujimura & Komamine, 1979). Gomez et al. (2000) stated that by using low densities in the hybrid cultivar FHIA-18 (Musa sp. AAAB) there is greater accumulation of reserve substance and lower multiplication.
Novak et al. (1989) found that both subculture interval and incubation temperature, influence the relative frequency of embryogenic cells, compared to non- embryogenic and partially embryogenic cells. When ECSs are not regularly subcultured, the suspension becomes mucilaginous (Nayak and Sen, 1989; Vasil and Vasil, 1982). The same observations were made in Musa ECSs (Panis, 1995). Upon culture time, cultures loose their embryogenic characteristic. The colour of the suspension changes, and cell are less densely packed. Histological studies revealed starch accumulation and vacuolation in older cells. To avoid this, media should be refreshed before reaching the end of the exponential phase of the growth curve. Ho and Vasil (1983) also reported on methods of subculturing, affecting the growth rate of cells and the density of cell clumps in sugarcane suspension cultures.
32 Daniels et al., (2002) stated that the embryogenic clusters release the cells in liquid medium upto 15th day of culture, after which there was no increase in cell growth and thereafter a decrease in the total number of cells in the suspension. This was due to cell death caused by high cell density and the oxidation of phenols. Further studies proved that structure of the cell suspension and the rate of cell growth were found to be dependent on the cultivar regardless of the hormone treatment in the induction medium. Cultivars ‘Musakala’, ‘Kibuzi’ and ‘Mbwazime’ produced cell culture of clustered and aggregated cells and high cell numbers, which are a prerequisite for embryo cells development (Sadik et al., 2007).
Domergue et al. (2000) reported five different types of cellular aggregates in embryogenic cell suspension of cv. Grande Naine. Type -1 corresponded to isolated cells or small aggregates. Type-2 was composed of embryogenic cells. Type-3 can be distinguished from type -2 due to the presence of peripheral proliferation zones with embryonic cells. Type-4 was composed of protodermic masses histologically comparable to proembryos. Type-5 composed of central zone meristematic cells and of an external zone of starchy cells.
In order to improve the synchrony of embryo development, a fixed cell aggregate size is often used to select proembryogenic masses (PEM) as materials for embryo production. However, a large variation in the size of PEMs used for somatic embryogenesis has been reported. Although it depends largely on plant species, a wide variation is sometimes observed in the same species. Large PEMs were reported to produce multiple embryos (Halperin and Jenson 1967; Osuga and Komamine, 1994), and this may cause asynchrony in the culture (Ibaraki et al., 2000).
For obtaining high quality and homogeneous embryos, sorting embryos on the basis of embryo quality, i.e., conversion potential is an effective technique. To obtain high conversion rates, it is often been necessary to select embryos manually (Molle et al., 1993; Paques et al., 1995; Gupta et al., 1999). While plating embryogenic cells in regeneration medium, the number of embryos obtained per volume of plated cells is the key criteria by which the quality of a suspension could be estimated (Grapin et al., 1996; Cote et al., 1996; Strosse, 2005). Reinert and Yeoman (1982) described method to determine the growth of cell lines using packed cell volume (PCV). They reported
33 that during each subculture of cell suspension, the initial density was adjusted to 3% of the PCV in 15 ml of culture medium.
Novak et al. (1989) reported numbers of 20-30X103 s somatic embryos in suspensions of diploid and triploid cultivars, Cote et al. (1996) obtained 370X103 somatic embryos per ml of plated packed cell volume of 10% in Grand Naine (AAA). The somatic embryo diameter in the cell suspensions varied from 0.5 to 1.2 mm with an average size of 0.86± 0.25 mm. The weight of these somatic embryos ranged from 0.65 to 0.90 mg, depending on the development stage (Gomez Kosky et al., 2002).
An indication for somatic embryos formation was the presence of protoderm, the outermost layer of a developing embryo. This fact is supported by West and Harada (1993) who stated that during embryogenesis, the first tissue that can be identified histologically is the protoderm. Similar results was obtained by Mahanom jalil et al. (2008) and reported that histological sections of somatic embryos in M. acuminata cv. Mas (AA) showed clear presence of protoderm surrounding the densely meristematic embryogenic cells with the accumulation of starch reserves. Recent study by Sharma and Millam (2004) confirmed the presence of protoderm since the early-globular stage in somatic embryogenesis.
2.4.5. Field performance of tissue culture banana plants The advantages of in vitro micropropagated banana plants included higher rates of multiplication, production of disease free planting material and small space required to multiply large numbers of plants.
Field performance of these micropropagated plants has been reported by a number of authors. Nokoe and Ortiz (1998) suggested the optimum plot size for banana field trials. It was observed that 16 ± 3 plants per plot were needed to evaluate the growth characteristics and yield potential of the cultivars. The recommended optimum plot size consisted on average, 13 ± 3 plants per plot for the plant crop, and 15 ± 2 plants per plot for the ratoon crop. Smith and Drew (1990) reported that tissue culture plants had bigger pseudostem and retained more healthy leaves than those originating from suckers.
34 Robinson et al. (1993) achieved 20.4% higher yield than conventional plants, due to larger bunches and a shorter cycle to harvest. On the other hand in vitro derived plants of plantain (Musa spp. AAB) did not show any higher yield (Vuylsteke and Ortiz 1996) and more phenotypic variation was observed in tissue culture plants.
Field performance of in vitro raised variants was compared with true-to-type plantains to evaluate their horticultural traits (Vuylsteke et al., 1996). Significant variation was observed for plant and fruit maturity, leaf size, yield and its components but not for leaf number, plant height, or suckering. Three of the four somaclonal variants were horticulturally inferior to the original clone from which they were derived. Only one variant which resembled an existing cultivar, out yielded the true-to- type clone. However, its fruit weight and size were lower. Optimum plantlet size for tissue culture banana plants was studied by Cote et al. (2000). They reported that small plants of 100 mm took three weeks longer to harvest and had six percent lower yields as compared to 300 mm size. Plants of 500 mm size showed slightly lower yields as compared with 300 mm plants. It was advisable that 200 mm plants should be planted at least 100 mm below soil surface, preferably in a furrow.
Cote et al., (2000) compared banana plants originated from embryogenic cell suspensions and plants produced by the conventional in vitro budding multiplication method. There were no significant differences between the plants produced by either micropropagation techniques for the plant height and circumference, the length of the reference leaf, the number of nodal clusters of the inflorescence and fruits, the bunch weight, the period of time between planting and flowering, and between planting and harvesting. This study showed that banana plants with agronomical behavior similar to those produced by the conventional in vitro budding method could be regenerated from embryogenic cell suspension.
2.4.6. Somaclonal variation Tissue culture techniques were considered to generate exact copies of the parent plant (Denton et al., 1977; Wright, 1983). Somaclonal variation, however, has been identified in a vast number of plant species and occurs in both sexually and asexually propagated plants and at all ploidy levels (Al-Zahim, 1996). Somaclonal variation is one of the great stumbling blocks for present day micropropagation and plant
35 regeneration via somatic embryos (De Klerk, 1990). It also hampers the application of biotechnological breeding techniques such as somatic hybridisation for recombining genomes of sexually incompatible species, modification of plants by recombinant DNA techniques and anther cultures to speed the attainment of homozygosity (Al-Zahim, 1996). Though reports exist on the selection of useful genetic variants induced by tissue culture (Larkin and Scowcroft, 1983; Sun et al., 1983; Jordan and Later, 1985; Smith and Drew, 1990), most somaclones reveal decreased vigour, yield etc. (Johnson et al., 1984; Lee and Philips, 1987; Jackson and Dale, 1989).
The term ‘somaclonal variation’ was introduced by Larkin and Scowcroft (1981) to describe the genetic variation in plants regenerated from any form of cell culture. It is believed that somaclonal variation occurs only in plants regenerated from adventitious or newly formed apical meristems (Hussey, 1983) whereas epigenetic (i.e. non-genetic) changes can also be observed in plants originating from pre-existing apical/axillary meristems (De Klerk, 1990). In contrast to somaclonal variation, epigenetic variation as a physiological response to stress conditions, is not heritable and is reversible during the life of a plant. Severe environment stress that lies beyond the capacity of plants to adopt by epigenetic changes, can cause ‘genome shock’ that activates transposons leading to meitiotically and mitotically transferable genetic changes (McClintock, 1984). Somaclonal variation was found to be induced upon stress application in flax (Cullis and Cleary, 1986). On the contrary, Heindorff et al., (1987) found that stress pretreatment of Vicia faba roots, rendered these meristem less susceptible to mutagenesis.
Somaclonal variants are an expression of pre-existing variation in the source plant or due to de novo variation via undetermined genetic mechanisms, likely to occur in tissue culture (Larkin and Scowcroft 1981). Effects of biological (genotype, explant type), medium (plant growth regulators) and physical (duration of cultue) factors on somaclonal variation have been noted, yet the basic knowledge remains fragmentary (De Klerk, 1990). Somaclonal variation is more likely to arise from polysomatic species and tissues, from older tissues, from highly differentiated structures such as nutritive and storage organs, and would be higher in species with large genome size, which increases the chance of replication errors (Bhatia et al., 1985).
36 The role of certain plant growth regulators like 2,4-D in somaclonal variation is highly debated. The most widespread view is that 2,4-D would cause abnormalities by stimulating rapid disorganized growth, without being directly mutagenic (Bayliss, 1980). Bayliss (1980) found that NAA and 2,4-D cause chromosomal aberrations only at very high concentrations (50 mg/l), and not at concentrations that are being used routinely in tissue culture (<10 mg/l). It was also reported that 2,4-D induced changes in the cell cycle, and increased the frequency of sister chromatid exchange at relatively low concentrations (Dolezel and Novak, 1986, Murate, 1989). Auxins are furthermore believed to affect the ploidy level in callus cells (Ghosh and Gadgil, 1979), and increase the frequency of aneuploidy and polyploidy (Sree Ramulu et al., 1983).
In general, the chance of variability increases with culture time or the number of successive multiplication (McCoy et al., 1982; Cote et al., 1993). Aberrations were most often linked with a progressive increase in the ploidy and aneuploidy of cells, resulting in the gradual loss of morphogenic potentialities (Murashige and Nakano, 1967). It has been demonstrated that mutations and changes in ploidy, can take place early in culture, and as such are not necessarily caused by long culture time (Torrey, 1959; Benzoin and Phillips, 1988). Polyploidisation is caused by spindle failure, chromosome lagging at anaphase or spindle fusion in binucleated cells (Mitra and Steward, 1961). Aneuploidy seems to be caused by non-disjunction, lagging chromosomes, non-polar anaphase, and aberrant spindle (D’Amato, 1978), and is believed to be tolerated better in polyploid than in diploid species (Al-Zahim, 1996). Other changes in DNA structure involve chromosome breakage, chromosomal translocation, partial duplication and deletion, single base changes, and activation of silent transposable elements (De Klerk, 1990, Al-Zahim, 1996).
2.4.6.1. Somaclonal variation in banana Somaclonal variation is a common phenomenon in both in vitro and in vivo propagated Musa plants. Such somolcones (off-types) are more common in bananas and plantains regenerated in vitro than in conventionally propagated Musa (Drew and Smith, 1990; Smith, 1988; Vuylsteke et al., 1988; Vuylsteke and Oritz, 1996). In banana and plantain, the off-types most often observed are concerned with variations in stature, foliage, colour, and morphology of pseudostem and reproductive organs (Israeli et al., 1995). Dwarfism is the most common variant in the Cavendish sub-group and
37 was found to account for 75-90% of the total variants (Stover, 1987). The occurence of two different variations on the same plant is not rare (Israeli et al., 1991; Vuylsteke et al., 1991). In micropropagated ‘False Horn’ plantains, variation in inflorescence type in the form of reversion to a typical ‘French’ plantain bunch type accounts for 40 – 100% of the total variability (Vuylsteke et al., 1988).
Hwang and Ko (1987) identified somoclonal variants of the cultivar ‘Giant Cavendish’ with putative field resistance to Fusarium wilt, but all had inferior horticultural characteristic, including poor yield and low fruit quality. Variants were mostly inferior to the ‘Cavendish’ clone from which they were derived, in that bunch and fingers of the somaclones were smaller and of little commercial value (Hwang and Ko, 1987; Smith and Drew, 1990; Stover, 1987). However, further evaluation among in vitro or sucker-propagated clones of these resistant variants resulted in the identification of plants with improved traits when compared to the original variant, yet slightly low yielding than the true-to-type cultivar (Hwang and Ko, 1987).
Vuylsteke et al., (1996) gave a comprehensive report on the agronomic performance of some somaclones obtained from the ‘False Horn’ plantain cultivar. The variants differed from true-to-type in inflorescence morphology. Variation was also observed in quantitative characters like plant and fruit maturity, leaf size, yield and yield components. Only the ‘French reversion’ variant, which resembled an existing cultivar, out yielded the true-to-type. However, its fruit weight and size, which affect consumer preference were lower. A better understanding of the nature and extent of somoclonal variation is necessary to assess its importance in Musa improvement. Hence, it would be useful to devise method to identify useful somalconal variations among large populations of variants (Evans and Sharp, 1986; Karp and Bright, 1985; Larkin and Scowcroft, 1981).
Dhed’a (1992) and Grapin (1995) were the first authors to report on somaclonal variations in banana plants regenerated from embryogenic cell suspensions. Dhed’a et al., (1991) reported on 5-10% abnormal somatic embryos recovered from a ‘Bluggoe’s suspension, which inspite of their abnormality could grow into normal plants. Out of 140 plants tested in the field, only one off-type (0.7%) with retarded growth and distorted leaves was found. Grapin (1995) reported 16-22% somaclonal
38 variants among plants regenerated from a ‘French Sombre’ suspension, whereas all plants obtained via in vitro clonal propagation were normal. Abnormalities encountered, were mosaic variants (partial discoloration of the leaf) with dropping leaves often revealing retarded growth. As variants with variegated leaves or with deformed laminae tend to revert to the source plant-type in the second or even the first cycle (Israeli et al., 1991 and 1995; Vuylsteke et al., 1991), banana plants need to be observed for at least three cycles, before a definite statements on off-type frequency can be made. Stover et al. (1987) stated that less than 5% off-types, are commercially acceptable.
Smith (1988) reviewed the factors influencing somaclonal variation in bananas and divided them into intrinsic and culture-induced factors. Genetic changes induced during micro-propagation can be influenced by choice of explant, the composition of culture media (nature and concentration of phytohormones), number of subcultures or length of time in culture, and the level of dedifferentiation, the tissues undergo in the culture. Intrinsic factors include the genetic stability of the cultivar or genotype used in micropropagation. A direct relationship exists between time spent in culture and the rate of somaclonal variation. To reduce the problems related to sub culturing, a cryopreservation protocol was developed, making it possible to store embryogenic cells for unlimited periods (Panis and Thinh, 2001). Schukin et al. (1997) exploited the embryogenic capacity of Grand Naine and their effects on somaclonal variation. They described that the rates of somaclonal variation were 0.5% and 3.6% respectively.
2.4.6.2. Use of molecular markers to detect variation Tissue culture induced variations can be determined at the morphological, cytological, biochemical, and molecular levels with several techniques. Molecular markers suitable for generating DNA profiles have proved to be an effective tool in assessing the genetic stability of regenerated plants. These markers are not influenced by environmental factors and generate reliable, reproducible results. DNA- based markers most frequently in use include restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP) and random amplified polymorphic DNA (RAPD). Among these techniques, RAPD is becoming a widely employed method in the detection of genetic diversity since it has the advantage of
39 being technically simple, quick to perform and requires only small amounts of DNA (Williams et al., 1990).
The genetic integrity of micropropagated plants can be determined with the use of various techniques. RAPD technique is employed, as it has the advantage of simplicity, rapidly and is of relatively low cost. It requires very little plant material and quick DNA extraction protocols are suitable (Rafalski et al., 1999). Various authors have found that RAPD technique useful in examining tissue culture induced variation. In vitro culture can induce genetic variability, termed somoclonal variation (Larkin et al., 1981). While this is considered as a problem within the use of RAPD markers, somaclonal variants were identified in Prunus persica (Hashmi et al., 1997) and Phalaenopsis (Chen et al., 1998). The clonal fedility of micropropagated plants has also been determined with RAPD technique in Pinus thunbergii (Goto et al., 1998), Lilium (Varshney et al., 2001) and Tylophora indica (Jayanthi and Mandal, 2001).
Phenotypic changes associated with genetic alterations were reported among tissue culture derived plants of several species from Pelargonium, Ananas, Phalaenopsis, Arachis and Musa (Cassels et al., 1997). Identifying variants during the early stages of plant development is essential to avoid propagation of mutant plant in species with extensive growing periods, like forest and fruit trees (Jaligot et al., 2000). Random amplified polymorphic DNA (RAPD) is an effective molecular technique for screening for genomic alterations among tissue culture derived plants (Heinze and Schmidt, 1995). In case of dicotyledonous woody plants, there are few reports of RAPD analysis being applied to monitor genomic changes (Heinze and Schmidt, 1995). Instead this method has been applied extensively to evaluate natural genetic diversity among plants (Deng et al., 1995). Chromosome evaluation is another approach that has been used successfully to study genetic abnormalities among tissue culture derived plants (Straus, 1954; Maluszynska et al.,1998). Most studies indicate that the common chromosomal abnormalities found are polyploidy, aneuploidy and breakages at heterochromatic regions (Fourre et al., 1997).
Genetic fidelity of micropropagated Arachis plants has been assessed by Random Amplified Polymorphic DNA (RAPD) and Amplified Fragment Length Polymorphism (AFLP) analysis, and no polymorphism was detected at the genomic
40 regions tested (Gagliardi et al., 2003). RAPD analysis using arbitrary oligonucleotide primers allows detection of changes in the plant genome at the DNA level. This technique has been used to analyze plants regenerated from cultured cells and tissues for the detection of somaclonal variants (Vidal and de Garcia, 2000). According to Tingey and del Tufo (1993), polymorphism is due to the presence or absence of an amplification product from a single locus. Apart from the marker DNA band, the differences in band intensity between variant and normal clone has also been detected.
Randomly amplified polymorphic DNA (RAPD) (Willams et al., 1990) and inter simple sequence repeats (ISSR) (Zietjiewicz et al., 1994) markers have proven to be efficient in detecting genetic variations. Both RAPD and ISSR markers have been successfully applied to detect the genetic similiarities or dissimiliarities in micropropagated material in various plants (Martin et al., 2006).
While experimenting with plantains (AAB), Cronauer and Krikorian (1983) observed that the frequency of the occurrence of variants in any variety was confined to individual primary explants rather than the genotype. Another common undesirable somoclonal variant observed in ‘Cavendish’ banana was the mosaic type, where the heterogeneity and incidence of variation were epigenetic (Israeli et al., 1991). All these reports inferred that such somoclonal variations were the resultants of three way interactions of initial explants, the culture conditions, and the genotype. The polymorphism in amplification products could result from changes in either the sequences of the primer binding sites or from changes that could have altered the sizes of the DNA fragments.
Inter simple sequence repeat (ISSR) is a PCR based method, which involves amplification of DNA segments present at an amplifiable distance between two identical microsatellite repeat regions oriented in opposite direction. The technique uses microsatellites, usually 16–25 base pair long primers in a single primer PCR reaction targeting multiple genomic loci to amplify mainly the inter-SSR sequences of different sizes.
The primers used can be either unanchored (Gupta et al., 1999; Wu et al., 1994) or anchored at the 3’ or 5’ end with 1 to 4 degenerate bases extended into the flanking
41 sequences (Zietkiewicz et al., 1994). The microsatellite repeats used as primers can be di-nucleotide, tri-nucleotide, tetra-nucleotide or penta-nucleotide. ISSRs have high reproducibility possibly due to the use of longer primers as compared to RAPD, which permits the subsequent use of a high annealing temperature (45–60° C) leading to higher stringency.
The sources of variation in ISSR markers could be: (1) mutations at the priming site (SSR), which could prevent amplification of a fragment as in RAPD markers and thus give a presence/absence polymorphism; (2) an insertion/deletion event within the SSR region or the amplified region would result in the absence of a product or length polymorphism depending on the amplifiability of the resulting fragment size. The ISSR marker technique is simple, quick, and efficient. The primers are long resulting in high stringency and hence reproducibility. The amplified products are usually 200-2000 bp long and amenable to detection by both agarose and polyacrylamide gel electrophoresis. The technique is not without limitations. For instance, there is a possibility as in RAPD that fragments with the same mobility may originate from non- homologous regions, which can contribute to some distortion in the estimates of genetic similarities (Sanchez et al., 1996).
Vendrame et al. (1999) reported that genetic variation in a culture line could be affected more by the genotype than by the period in culture. This genetic instability may be a risk associated with the application of in vitro culture techniques for germplasm handling and storage. Conversely, somaclonal variation may provide another source of novel and useful variability (Vuylsteke, 1998), which can be used in genetic improvement of banana (Sahijram et al., 2003). Rout et al. (2009) assessed the quality of in vitro derived regenerates with ten ISSR primers. The banding pattern of PCR amplified product from micropropagated plantlets was found to be monomorphic for most of the primer tested. Most of the primers showed identical DNA profiles as compared with mother plant. Very few plants showed variation at the DNA level but morphologically they were identical with each other. Shenoy and Vasil (1992) reported that micropropagation through meristem culture are generally less subjected to genetic changes that might occur during cell differentiation under in vitro conditions.
42 Ray et al. (2006) highlighted the genetic stability of the micropropagated plants of three banana cultivars i.e. Robusta (AAA), Giant Govenor (AAA) and Martaman (AAB) by using 21 RAPD and 12 ISSR primers. They found three somaclonal variants from ‘Robusta’ and three from ‘Giant Govenor”. Harirah and Khalid (2006) used eighteen arbitrary decamer primers to study the clonal fedility of Musa acuminata Cv. Berangan. They found that all the regenerated plants were monomorphic. No somaclonal variation was detected. In some cases, regeneration process is prone to somatic variation resulting in off-types as in case of Populus termuloides (Rahman and Rajora 2001) and tea clones (Devarumath et al., 2002). Variation is induced by different genetic and epigenetic mechanisms that are likely to be reflected in the banding pattern developed by employing different marker system. However, the reliability and efficiency of molecular markers in detecting large scale genome arrangements have been frequently questioned. Since simple sequence repeat based primer target the fast evolving and hyper variable DNA sequence, ISSR markers are considered suitable to detect variation among tissue cultured produced plants (Rahman and Rajora, 2001; Ray et al., 2006; Joshi and Dhawan, 2007). The thorough scanning of the available literature indicates that markers could be well exploited in the study the genetic fidelity of ECS derived plants.
43 Chapter- III MMaatteerriiaallss aanndd MMeetthhooddss
The present investigation was carried out to study the somatic embryogenic pathway for Indian commercial cultivars of banana. Embryogenic efficiency of cultivars across the genomes was studied and regeneration protocol was standardized. Plantlets produced through somatic embryogenesis were compared with plantlets obtained through shoot tip culture and conventional sucker, in terms of vegetative and fruiting characters and the genetic stability of the ECS derived plants were assessed by using ISSR and microsatellite markers.
3.1. Materials used Immature flower buds of eleven Indian commercial cultivars belonging to different genotypes were used as explants in the present study.
Sl. No. Cultivar name Genome 1 Grand Naine (GN) AAA 2 Robusta (RB) AAA 3 Rasthali (RS) AAB 4 Nendran (NN) AAB 5 Neypoovan (NP) AB 6 Karpooravalli (KP) ABB 7 Monthan (MN) ABB 8 Kallumonthan (KM) ABB 9 Bluggoe (BG) ABB 10 Chakkia (CK) ABB 11 Poovan (PV) AAB
3.1.1. Collection of disease free planting material Survey was carried out in fields in and around Tiruchirappalli (Athavathur, Mullikarumbur, Kulumani, Koppu, Neithalur colony, Yettarai), Erode and Theni
44 (Kambam, Cudalur) districts of Tamil Nadu to collect immature male flower buds from disease free plants for use as explants in the present study (Plate-1).
3.2. Medium 3.2.1. Culture medium For callus induction, establishment of suspension and germination of somatic embryos MS medium (Murashige and Skoog, 1962) was used. For regeneration of somatic embryos, SH medium (Schenk and Hildebrand, 1972) was used. Basal medium was manipulated with different auxins, cytokinins and various additives, both individually and in combinations.
3.2.2. Preparation of medium and other requirements The stock solutions of macro and micronutrients, iron chelates and vitamins of different media were prepared separately. The stock of iron was stored in an amber coloured bottle. The growth regulators were dissolved separately in respective solvents and volume made up with double distilled water. All the solutions were stored in the refrigerator. Required stock solutions were pipetted out and final volume of the medium was made up with double distilled water with or without the addition of carbohydrate sources and growth regulators / additives depending on the nature of the experiment.
The culture media were sterilized in an autoclave at 121ºC and 15 lbs pressure for 20 min. Zeatin was sterilized by filtration through cellulose acetate filters 0.22 µm (SARTORIUS). The glassware and other accessories used for initiation of explant and manipulation of the cell suspensions were sterilized in an oven at 180 ºC for two hours. The instrumental (forceps, spatulas and knives) was disinfected in an electric sterilizer (DENT-EQ) model fitted in the laminar flow chamber.
According to the requirement of the experiment, test tubes (50 x 25 mm) with 10 ml, glass bottles (250 ml) with 30 ml, Petri dishes (90 mm) with 30 ml, Petri dishes (60 mm) with 15 ml of culture medium were used. The gelling agents used in various culture media, are specified in each case. The pH was adjusted with 1.0 N NaOH and 1.0 N HCl before autoclaving. Composition of medium used in the study is given in Annexure – I and II.
45 PLATE 1 Vegetative and reproductive traits of banana (cv. Karpooravalli) a - Habitat of cv. Karpooravalli b - Fruits (bunch) c - Pseudo stem showing petiole arrangement d - Male flower bud e - Arrangement of male flowers f - Individual flower
PLATE 1
a b c
d e f 3.3. Callus induction from immature male flower buds 3.3.1. Preparation and culturing of explant Immature male buds were collected from the test cultivars 3-10 weeks after flowering and used for callus induction. The buds were used within 24 hrs after collection. In non-sterile conditions, size of the male buds was reduced until the explant is 0.8 x 2 cm. The reduced bud was kept in non-dehydrating conditions until sterilization (in a container with a few drops of water and sealed with a parafilm). The reduced buds were surface-sterilized with 70% ethyl alcohol for 1 minute and inoculated within an hour after disinfection.
Under a sterile hood, individual explant (floral hand) was isolated from flower buds using a stereomicroscope. The immature floral hands were taken from position 16 to 1 (1 being the immature flower closest to the meristematic dome) with fine scalpel. Flowers from 1st to 16th position were cultured on callus induction medium (MS medium supplemented with auxin, 30 g/l sucrose and solidified with 2.0 g/l phytagel (SIGMA) in 90 mm petridishes (Plate-2). The cut surface of the floral hands were placed in contact with the medium and the containers were sealed with parafilm to avoid evaporation (a low relative humidity reduces the chances of success) and to reduce contamination. Petridishes were incubated in total darkness or in various photoperiod provided by fluorescent tubes at density of photosynthetic photon flux (FFF) of 62-68 micromol m-2s-1 and high humidity conditions (>80% RH) at 27 ºC based on the experiment. This is of atmost importance as male flowers were left on the same culture medium during the entire embryogenesis induction phase (3 to 12 months) (Standard condition). Procedure for the isolation and initiation of floral hands in different experiments were the same as mentioned above. Fifty buds from each test cultivars were initiated for each experiment and the experiment was repeated five times.
3.3.2. Influence of various growth regulators on callus induction 3.3.2.1. Tested individually MS medium containing 2.0 g/l phytagel (SIGMA) and 3.0% sucrose was used in this study. Growth regulators 2,4-D (1.0-6.0 mg/l), TDZ (0.5-3.0 mg/l), NAA (1.0-5.0 mg/l) and Dicamba (1.0-5.0 mg/l) were tested individually for callus induction.
46 PLATE 2 Explant preparation and callus induction from immature male flower buds of banana cultivar Grand Naine in MS medium a - One month old male flower bud b-f - Preparation of explant g&h - Excision of male flower buds i - Initiation of explant in solid medium j - Serially arranged floral explant from position 1-18
PLATE 2
a b c
d e f g
15 1
10 5
h i j
3.3.2.2. Tested in combination Based on the results obtained in above study 2,4-D (4.0 mg/l), TDZ (1.0 mg/l), Dicamba (3.0 mg/l) were supplemented in combination with IAA (0.25-2.0 mg/l) and NAA (0.25-2.0 mg/l) in callus induction medium.
In order to induce calli from immature buds explants of the test cultivars, MS medium containing sucrose (3.0%), growth regulators 2,4-D (4.0 mg/l) IAA (0.25-1.0 mg/l) and NAA (0.25-1.0 mg/l) was used for the study. Medium was solidified with phytagel (2.0 g/l). Cultures were incubated in standard conditions without making changes of culture media during the course of the experiment. Percent of callus induction was taken into account after 12 weeks of induction of floral hands. Further experiments related to callus induction were carried out on same MS medium with best combination of 2,4-D, IAA and NAA obtained in this section.
3.3.2.2.1. Position of floral hands on frequency of callus induction The immature flowers of the test cultivars were taken from position 1st to 16th (1 being the immature flower closest to the meristematic dome) with fine scalpel and cultured on callus induction medium (MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and1.0 mg/l NAA) in 90 mm petri dishes. The cultures were incubated in standard conditions. After 12 weeks of initiation, effect of position of floral hands on frequency and nature of callus obtained was recorded.
3.3.2.2.2. Position of floral hands on nature of callus induction To determine the effect of position of floral hands on nature of callus, male buds of test cultivars were initiated on callus induction medium (MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and1.0 mg/l NAA) and incubated in standard condition. Nature of callus obtained from each floral hands of test cultivars belonging to same or different genome were recorded and tabulated after 4-12 weeks of initiation.
3.3.2.3. Combination of 2-4-D, IAA and NAA on embryogenic callus induction In order to induce the formation of calli with embryogenic structures, floral hands of the test cultivars were cultured on MS medium containing sucrose (3.0%), growth regulators 2,4-D (4.0 mg/l) IAA (0.25-1.0 mg/l) and NAA (0.25-1.0 mg/l) and solidified with phytagel (2.0 g/l). Cultures were incubated in standard conditions
47 without making changes of culture media during the course of the experiment. Development of embryogenic calli (EC) consisting of individual embryos or compact calli (CC) or friable embryogenic calli (IC- ideal calli) bearing many translucent proembryos (generally more than 10) were taken into account after 12 weeks culture initiation.
3.3.2.3.1 Position of floral hands on embryogenic callus induction In order to study the effect of position of floral hands on induction of embryogenic structures, flowers of test cultivars were isolated from position 1st to 16th and initiated in callus induction medium and incubated in standard conditions. Observations were taken after 12 weeks after initiation and result was tabulated.
3.3.2.3.2. Position of floral hands on nature of embryogenic callus To determine the effect of position of floral hands on nature of embryogenic callus, male buds of test cultivars were initiated on callus induction medium and incubated in standard condition. Nature of embryogenic callus obtained from each floral hand of test cultivars belonging to same or different genome were recorded and tabulated after 12 weeks of initiation.
3.3.3. Effect of photoperiod on callus induction 3.3.3.1. Frequency of callus Induction Effect of lighting conditions on callus induction frequency was calculated in this experiment. Light produced from fluorescent tubes at density of photosynthetic photon flux (PPF) of 62-68 micromol m-2s-1 was used. Collection of floral hands and initiation procedure was similar to those mentioned in section 3.3.1. Initiated floral hands were incubated in 24, 18, 12, 6 hrs light and also in complete darkness. Fifty floral buds from each test cultivars were used to isolate floral hands and cultures were incubated in respective photoperiod.
3.3.3.2. Nature of callus Effect of lighting conditions on nature of callus induction studied in this experiment. Culture initiation and culture conditions are same as mentioned in section 3.4.1. Nature of callus produced was studied after 4 weeks after initiation.
48 3.3.4 Trials to overcome lethal blackening 3.3.4.1. Preculture and frequent subculture of explant The objective of this experiment was to produce good quality base material (ideal callus without or less phenolics) for the establishment of embryogenic cell suspensions. This involved 25 ml Erlenmeyer flask, containing 10.0 ml of callus induction medium with floral hands of same position obtained from 50 flowers of same cultivar. The Erlenmeyer flasks were sealed with parafilm and placed on gyratory shaker (Orbitak, India), at a speed of 90 rpm under complete darkness.
Culture media was replenished on alternative days for a week and consisted of 50% renewal of culture medium from the top, which removes the phenolics produced from floral hands. The floral hands were transferred to solid callus induction medium at different time intervals and incubated in complete darkness.
In another trial, the floral hands of the test cultivars were initiated in callus induction medium following general procedure. Later, the floral hands were subcultured on fresh callus induction medium at monthly intervals. Subculturing was carried out for 4 cycles and observed for reduction in phenolics.
3.3.4.2 Use of antioxidants and absorbants L-Ascorbic acid (0.25-5.0%) and polyvinyl pyrolidone (PVP) (0.1-1.0%) and activated charcoal (0.25-2.0% ) were added individually to callus induction medium (solid) to study their effect on reduction of explant blackening. Medium devoid of any antioxidants or absorbant served as control.
3.3.5. Effect of carbon source on embryogenic callus induction Immature floral hands of test cultivars were inoculated on callus medium supplemented with different source of carbohydrates (glucose, fructose, sucrose and maltose) at various concentration ranging from 1% to 4%. Cultures were maintained in standard conditions. Their effect on embryogenic callus induction was recorded after 12 weeks of initiation.
49 3.4. Establishment of embryogenic cell suspension 3.4.1. Effect of various media The objective of this experiment was to establish cell suspensions from embryogenic calli containing translucent proembryos. For this experiment, five 25 ml Erlenmeyer flasks containing 4.0 ml of culture medium were used per treatment. Medium proposed by Strosse et al., (2003) (callus induction medium and suspension medium), Cote et al., (1996) and Dhed’a et al., (1991) and MS medium with 2,4-D (4.0 mg/l) were used.
Few embryogenic clusters (3.0-5.0 mg/l) with translucent structures (embryoids) produced from test cultivars were transferred to liquid medium and placed on a gyratory shaker at a speed of 90 rpm under complete darkness. During this stage, culture media was changed on alternative days and consisted of 50% renewal of medium from the top, which minimize the presence of non-embryogenic cells and cell aggregates.
3.4.2. Effect of different concentrations of sucrose on embryogenic response In this experiment, various concentrations (30-50 g/l) of sucrose was supplemented as carbohydrate source in MS liquid medium with 2,4-D (1.0 mg/l). Friable embryogenic cells with proembryos were initiated in liquid medium with desired concentrations of sucrose. Culture conditions and subculture procedure were similar as mentioned in above experiment. Observations were taken from 15 days after initiation of suspension. Percentage survival and proliferation rate of embryogenic cells was evaluated based on the score card prepared-
0- Less than 50% explant survived 1- More than 50% of explant turned brown with few globular embryos 2- More than 75% of explant survived with large meristematic globule 3- Increase in settled cell volume (SCV)
3.4.3. Selection of model cultivars to study embryogenic pathway Embryogenic callus was obtained from the immature male flower buds of test cultivars on callus induction medium. Different suspension medium were tried for successful establishment of embryogenic cell suspension in test cultivars. Two cvs.
50 Rasthali (AAB) and Nendran (AAB) were selected as model cultivars and complete regeneration, germination pathway were studied. Plantlets regenerated through embryogenic cell suspension (ECS) were subjected to genetic fidelity test using PCR based markers (SSR and ISSR).
3.4.4. Factors affecting nature of cell suspension 3.4.4.1. Cell density in embryogenic cell suspensions After 20 days of initiation, number of embryogenic aggregates formed per ml of culture was evaluated. Counts were made in Neubauer chamber 0.1 mm deep. For this, five samples were taken from each flask after homogenizing by shaking. The optical microscope model BX-50 (Olympus, Japan) was used for the study. Established cell cultures were filtered through metal mesh filters with a pore diameter of 500 µm and used for future studies.
3.4.4.2. Effect of cell density in the multiplication of embryogenic cell suspensions The objective was to evaluate the influence of cell density on growth dynamics of the cell suspensions and to determine the minimum inoculum that would allow a correct multiplication of suspension. Four initial inoculum densities of settled cell volume (2.0, 3.0, 5.0 and10.0%) was used and change in cell volume was measured every three days in each treatment using the methodology of evaluation proposed by Schoofs (1997). For each cell density, five replicates were used. Culture conditions were the same as described for the establishment of the cell suspensions in section 3.4.1 but without renewing the culture medium during 27 days of the experiment.
3.4.4.3. Assessment of viability of cell suspension Cultures were maintained under the same conditions as those used for initiation of cell suspension. Initially subcultures involved replacement of half of the medium of same formulation on alternate days in beginning. Cell cultures were observed every three days to determine cell viability by the use of fluorescence dye namely fluorescein diacetate (FDA). For viability test, few drops of fluorescein diacetate stock (-20 ºC, dissolved in acetone water) was added to distilled water until a blue shine was observed. From these one to two drops was added to the suspension sample. Viable tissue fluoresce bright green when observed under ultra-violet light.
51 3.5. Regeneration of somatic embryos from cell suspension 3.5.1. Influence of various growth regulators on somatic embryo formation Schenk and Hildebrant (SH) semisolid culture medium was supplemented with various growth regulators (Zeatin, BAP, TDZ and Picloram) to find out their effect individually on embryo induction from embryogenic cell suspension of test cultivars. Five replicates were used per trial. 200 µl of cells of the test cultivars (cv. Rasthali and Nendran) was added through Eppendroff micropipette with cut tips to the medium in 90 mm petriplates. Pertriplates were sealed with parafilm and stored in general condition. The number of somatic embryos produced in each trial was counted after 45 days of cultivation. For the purpose of counting, somatic embryos were transferred into known volume of sterile distilled water (5 ml). From this 1.0 ml was added to 0.2% phytagel. Later the mixture was poured into a petri plate of 70 mm diameter, was allowed to solidify left gelling and divided into quadrants. The counting was done under the stereomicroscope (Olympus, Japan).
3.5.2. Selection of optimum regeneration medium After 3 months from initiation, SCV was measured and adjusted to 3.0% with liquid regeneration medium to be tested. 200 µl of embryogenic cell suspension of test cultivars were platted on various regeneration medium to determine the optimum medium for the induction of somatic embryos. The percentage of somatic embryos formation was recorded in each treatment. The experiments were arranged in a randomized design with 5 replicates.
Control - SH medium without growth regulators RI - SH medium with 0.2 mg/l NAA, 0.05 mg/l Zeatin, 0.2 mg/l 2ip, 0.1 mg/l Kinetin, 100 mg/l Glutamine (Standard) RII - Standard medium with Picloram (0.25 mg/l) RIII - Standard medium with Picloram (0.50 mg/l) RIV - Standard medium with Picloram (0.75 mg/l) RV - Standard medium with Picloram (1.0 mg/l)
3.5.3. Effect of substrate on regeneration efficiency The objective of this experiment was to find out the effect of substrate on somatic embryos formation. Petriplates with regeneration medium were covered with
52 polystyrene meshes with a size of 1.0 cm2 and pores of 100 µm. Another set of medium was covered with Whatman filter paper No.1 which served as substrate for the regeneration of somatic embryos. 200 µl of cells were plated on regeneration medium. Regeneration medium without polystyrene meshes and filter paper were used as control. The culture conditions were the same as described in general procedures.
3.5.4 Effect of cell density on regeneration capacity The objective of the study was to evaluate the influence of cell density on somatic embryo formation. Four different inoculum densities (10, 15, 20 and 25%) were tested to determine the best density for regeneration of somatic embryos. SCV was measured and adjusted to required concentration with liquid regeneration medium. 200 µl of embryogenic cell suspension of test cultivars were plated on regeneration medium to determine the optimum cell density for highest yield of somatic embryos. Somatic embryos in globular stages were counted after 45 days, by using the methodology mentioned in section 3.5.1. The experiments were arranged in a randomized design with 5 replicates.
3.6. Maturation of somatic embryos 3.6.1. Selection of medium for embryo maturation In order to increase the germination percentage of somatic embryos, various maturation medium were tested. 30 days old somatic embryos regenerated on regeneration medium were transferred to respective maturation medium (M I to M IV) and maintained for 20 days. Somatic embryos regenerated and maintained on same medium (regeneration medium) for 50 days served as control. Germination capacity of somatic embryos were assessed in medium with MS salts and vitamins, 0.5 mg/l BAP and 2 mg/l IAA, 30 g/l sucrose and solidified with 2 g/l Phytagel.
M I - Culture medium with salts (reduced to 50%) and vitamins proposed by Murashige and Skoog (1962), sucrose (30 g/l), myo-inositol (100 mg/l), L- ascorbic acid (10.0 mg/l) , 6-BAP (0.22 mg/l) Culture medium RD2 (Dhed'a et al., 1991).
M II – Culture medium with salts and vitamins proposed by Murashige and Skoog (1962) and additional supplementation of ascorbic acid (10.0 mg/l), sucrose (45.0 g/l),
53 myoinositol (100 mg/l), biotin (1.0 mg/l), IAA (2.0 mg/l), 6-BAP (0.5 mg/l) (Gomez et al., 2000)
M III – Culture medium Half strength major salts and iron, full strength minor salts and vitamins and myoinositol (100 mg/l), ABA (0.6 mg/l) (Nasser et al., 2009)
M IV – Culture medium with MS salts and vitamins proposed by Murashige and Skoog (1962), sucrose (45.0 g/l), myoinositol (100 mg/l), ascorbic acid (10.0 mg/l), zeatin (0.22 mg/l) (Dhed'a et al., 1991)
3.6.2. Effect of incubation period on embryo maturation Standardized maturation medium obtained in section 3.6.1 was used in this experiment. 30 days old somatic embryos regenerated on regeneration medium were transferred to M IV media and maintained for various intervals (15, 30, 45 and 60 days) prior transferring to germination medium. For germination medium MS salts and vitamins supplemented with 0.5 mg/l BAP and 2.0 mg/l IAA was used.
3.7. Effect of modified regeneration medium on germination efficacy Germination capacity of embryos produced on standard regeneration medium was compared with modified regeneration medium. Somatic embryos produced on respective medium were transferred to germination medium at different intervals of time (30, 60, 90, 120 days). Germination efficacy was calculated after 30 days of transfer of somatic embryos.
3.8. Histology of regenerating somatic embryos For histological observations, the somatic embryos and somatic embryos with emerging shoot tip (10 days after inoculation) were fixed in FAA (Formaldehyde, acetic acid, alcohol, 0.5:0.5:9.0 (v/v/v) ratio) for 48 hrs and they were dehydrated in graded series of tertiary butyl alcohol (TBA) and finally embedded in paraffin wax. The blocks were sectioned at 10 µm thickness. The ribbons were placed on the slides smeared with Meyer’s albumin and flooded with 4% formalin. These slides were slightly warmed so as to stretch the sections. Sections were mounted using DPX and observed under light microscope (Olympus Japan).
54 3.9. Effect of age of ECS on regeneration and germination capacity Present experiment was carried out to study the relationship between the age of embryogenic cell suspension and their regeneration capacity. Regeneration and germination capacity of ECS of the test cultivars (Rasthali and Nendran) were tested at various time intervals (4-30 months). The experiment was carried out in a randomized design with 5 replicates.
3.10. Influence of various growth regulators on repetitive embryogenesis 3.10.1. Tested individually Embryogenic calli obtained on callus induction medium were selected and transferred to MS medium containing growth regulators 2,4-D (0.25-1.0 mg/l) and 6- BAP (0.5-3.0 mg/l). Medium devoid of growth regulator served as control. Cultures were maintained in complete darkness under standard culture conditions. Calli were subcultured on respective hormonal concentration at 21 days interval. Observations were taken and results were analyzed after 3 successive subcultures. The experiments were arranged in a randomized design with 5 replicates.
3.10.2. Tested in combination Based on the results obtained in the above study 2,4-D (0.75 mg/l) and 6- BAP (2.0 mg/l) were supplemented in combination with IAA (0.10-0.50 mg/l). Same methodology and culture conditions were followed as mentioned in section 3.10.1.
3.10.3 Effect of initial inoculum density on multiplication of somatic embryos One month old somatic embryos of test cultivars (Rasthali and Nendran) obtained on regeneration medium were used for present study. Required (0.25-3.0%) inoculum density was adjusted with liquid MS medium (medium used for repetitive embryogenesis) and transferred to 100 ml Erlenmeyer flasks containing 25 ml of MS medium. Flasks were kept in a gyratory shaker (Orbitek, India) at 90 rpm under complete darkness. Further subcultures involved the replacement of 50% of medium with fresh medium of same formulation at 7 days interval. The effect of inoculum density on multiplication of somatic embryos was recorded after 30 days interms of increase in fresh weight and total number of somatic embryos formed.
55 3.11. Preculture of embryos in liquid medium Two months old somatic embryos regenerated on regeneration medium (RIII) were used for the present study. Somatic embryos were transferred to 100 ml conical flask containing 15 ml of four different liquid medium. Conical flasks were sealed with parafilm and maintained at 90 rpm in a gyratory shaker. Half of the medium was renewed every week and cultures were maintained for three subcultures before transferring to solid germination medium (standard). Regeneration of plantlets was carried out in 16 hrs light/8 hrs dark photoperiod.
T I - Full strength modified regeneration medium T II - Half strength modified regeneration medium T III - Full strength germination medium T IV - Half strength germination medium
3.12. Plant recovery and acclimatization phase in net house Elongated shoots (3-6 cm in height) were transferred to MS medium containing 1 mg/l NAA and 2 mg/l IBA (root induction medium). The cultures were maintained in 16 hrs light/8 hrs dark photoperiod and temperature at 27±2 ºC. After three weeks of culture in root induction medium, the rooted plants were removed from the culture tubes and were washed in running tap water to remove agar residues from the root surface. Then the rooted plants were transplanted to plastic trays containing sterile soil, sand and vermiculite (1:1:1 w/w/w) and were placed in net house. Initially, the plants were covered with polythene bags to maintain high humidity (>80%). The plants were watered daily with Hoaglands’s nutrient solution (Hoagland and Arnon, 1950). The polythene bags were gradually removed once the plant has been acclimatized. After 4 weeks, the plants were transplanted to polythene bags for secondary hardening. After a month, plants with 3-5 well developed photosynthetic leaves were shifted to field.
3.13. Genetic fidelity study 3.13.1. Molecular analysis for genetic fidelity Twenty plantlets obtained thorugh ECS were selected randomly during acclimatization stage and used for PCR based marker analysis. Shoot tip and sucker derived plants of test cultivars (Rasthali and Nendran) were used as control. For control shoot tips of the test cultivars were initiated on medium containing MS salts and vitamins with 4.0 mg/l 6-BAP and 0.25 mg/l IAA and subcultured at 21 days time
56 interval for 7 cycles. The fresh samples of the cigar leaf required for the study were collected.
3.13.2. Isolation of genomic DNA The isolation of genomic DNA was done with CTAB as described by Gawel and Jarret (1991) with minor modifications. Leaf sample of about 2.0 g was weighed, cut into bits and transferred to a pre-chilled pestle and mortar. Leaf tissue was frozen with liquid nitrogen and ground to a fine powder. The powder was transferred to a centrifuge tube and emulsified with pre heated (at 65°C) extraction buffer containing 4.0 per cent (W/V) CTAB, 10 Mm Tris HCl, 1.4 M sodium chloride, 10M EDTA and 3 per cent (v/v) β -mercapto ethanol. The mixture was incubated in a water bath at 65°C for 30-45 min with occasional missing. Equal volume of chloroform: isoamyl alcohol (24:1) v/v was added, mixed well by gentle inversions for 15 minutes and then centrifuged at 8500 rpm (27°C) for 20 minutes. The clear aqueous phase was pipetted out into another centrifuge tube and equal volume of ice-cold iso-propanol (kept in - 20°C) was added and mixed gently by inversions for 10-20 seconds so as to precipitate the DNA. The precipitated DNA was hooked out using a sterile bent Pasteur pipette and air-dried. The dried pellet was suspended in 750μl of 0.1X TE buffer (1mM Tris + 0.1mM EDTA pH 8.0). The RNA contaminations were eliminated from DNA by treating the DNA with RNAase A (20μg) at 37°C for two hours.
3.13.3. Purification and elimination of RNase A Equal volume of phenol: chloroform: isoamylalcohol (25:24:1) was added to the DNA mixed by repeated inversions and the mixture was centrifuged at 10,000 rpm (27°C) for 10 minutes. The clear aqueous phase was transferred to a sterilized 1.5ml eppondorf tube, equal volume of chloroform: isoamylalcohol (24:1) was added, mixed by repeated inversions and then centrifuged at 10,000 rpm for 2-5 minutes at 14°C (Biofuge – Primo R, Heraeus, Germany). The aqueous phase obtained after centrifugation was added with 1/10 volume of 3M sodium acetate (pH- 8.0) and two volumes of absolute ethanol (99.9 per cent), mixed thoroughly and kept at -20°C for one hour. The DNA was pelleted by centrifugation at 13,000 rpm (4°C) for 5 minutes. The pellet obtained was finally dissolved in nuclease free water and stored at -20°C.
57 3.13.4. Quantification of DNA Genomic DNA was quantified in Spectrophotometer Perkin Elmer (UV-VIS Lambda 25, USA). The DNA samples were diluted (1:250), the absorbance was read at 260nm, and 280nm using distilled water as blank. The amount of DNA present in the samples was calculated by using the following formula.
OD at 260nm x 50 x Dilution factor Amount of DNA (μg /μl) = ––––––––––––––––––––––––––––––––– 1000
3.13.5. Microsatellite markers A total of 20 primer pairs flanking microsatellite previously identified in M. acuminata and M. balbisiana accessions were tested to assess the polymorphism within and among the plantlets regenerated through three different means in test cultivars Rasthali and Nendran. The above primers were developed by Lagoda et al. (1998) and were synthesized by Genei, India. Same DNA materials were subjected to fidelity test using 10 ISSR markers. The details of the primers used in the current study are as follows.
58 SSR markers used in the genetic fidelity testing of plants regenerated through embryogenic cell suspension.
Accn. No. Primer sequence AGMI 24 TTTGATGTCACAATGGTGTTCC AGMI 25 TTAAAGGTGGGTTAGCATTAGG AGMI 33 AGTTTCACCGATTGGTTCAT AGMI 34 TAACAAGGACTAATCATGGGT AGMI 35 TGACCCACGAGAAAAGAAGC AGMI 36 CTCCTCCATAGCCTGACTGC AGMI 67 ATACCTTCTCCCGTTCTTCTTC AGMI 68 TGGAAACCCAATCATTGATC AGMI 93 AACAACTAGGATGGTAATGTGTGGAA AGMI 94 GATCTGAGGATGGTTCTGTTGGAGTG AGMI 95 ACTTATTCCCCCGCACTCAA AGMI 96 ACTCTCGCCCATCTTCATCC AGMI 97 CTGCAGGCATAGGAT AGMI 98 TTCCAATGGAGACCCGATAG AGMI 99 ATTTCTTTCTTTTCATACCTTTA AGMI 100 TAATGAGACGCTATGGAGCAC AGMI 101 TGCAGTTGACAAACCCCACACA AGMI 102 TTGGGAAGGAAAATAAGAAGATAGA AGMI 103 ACAGAATCGCTAACCCTAATCCTCA AGMI 104 CCCTTTGCGTGCCCCTAA AGMI 105 TCCCAACCCCTGCAACCACT AGMI 106 ATGACCTGTCGAACATCCTTT AGMI 111 GCAGTCGCTAAGAGAAGGGTGTC AGMI 112 TTTCTTCTTCCCTGTGCTGCTAC AGMI 115 GTTTACTGGCATCTGTCCTC AGMI 116 TGCGATCAGAAGACCAAACAT AGMI 123 TTCATAATTGCAAGAAAGATAA AGMI 124 GGAGGTACAGGGGATGAGGACT AGMI 125 TCCCATAAGTGTAATCCTCAGTT AGMI 126 CTCCATCCCCCAAGTCATAAAG AGMI 127 AAGTTAGGTCAAGATAGTGGGTTT AGMI 128 CTTTTGCACCAGTTGTTAGGG AGMI 129 GGAGGCCCAACATAGGAAGAGGAAT AGMI 130 CATAAACGACAGTAGAAATAGCAAC AGMI 133 GTGGTTTGGCAGTGGAATGGAA
59 AGMI 134 TGACCCTCCGACACCTATTTGG AGMI 197 CTTTTGGATTATTGCCTACA AGMI 198 TGGAGTGAAGATGAGACGATTA AGMI 201 TGGTTGAGTAGATCTTCTTGTGT AGMI 202 TCATCTCACAATGCTTTCATAGTT
ISSR markers used in the genetic fidelity testing of plants regenerated through embryogenic cell suspension.
Accn. No. Primer sequence USB 807 AGAGAGAGAGAGAGAGT USB 808 AGAGAGAGAGAGAGAGC USB 811 GAGAGAGAGAGAGAGAC USB 818 CACACACACACACACACG USB 834 AGAGAGAGAGAGAGAGYT USB 836 AGAGAGAGAGAGAGAGYA USB 840 GAGAGAGAGAGAGAGAYT USB 841 GAGAGAGAGAGAGAGAYC USB 842 GAGAGAGAGAGAGAGAYG USB 868 GAAGAAGAAGAAGAAGAA
3.13.6. Polymerase chain reaction The PCR protocol of Lagoda et al. (1998) was adopted with minor modifications. Both normal and Touch Down PCRs (TD – PCR) were used depending on the availability of primer information. However, all the PCR reactions were performed on gradient master cycler (Eppendorf, Germany) in 25μl reaction containing 15ng of genomic DNA 100 μM of each of the dNTPs, 0.2 μM of each of the primer,
1X PCR buffer (100 mM Tris – HCl, pH 9.0, 500 mM KCl, 10 mM MgCl2, 0.1per cent gelatin) and 1U of Taq DNA polymerase. Those primer pairs whose specific annealing temperatures were known, PCR program consisted of an initial denaturation at 94°C for 4 minutes followed by 35 cycles at 94°C for 30 seconds, and extension at 72°C for 1 minutes terminated by a final extension at 72°C for 8 minutes followed by incubation at 4°C.
60 3.13.7. Agarose gel electrophoresis Required amount of agarose was weighed out (0.75% for genomic DNA and 1.5% for amplified products) and melted in 1X TAE buffer (40 mM Tris-acetate, 1mM EDTA (pH 8.0) as per the requirement. After melting, the volume of the gel mixture was made up to the final volume with water. After cooling to about 50 oC ethidium bromide was added to a final concentration of 0.5 mg/ml. The mixture was poured immediately on a preset template with appropriate comb. After solidification, the comb and the sealing tapes were removed and the gel was mounted in an electrophoresis tank. To the DNA sample, required volume of gel loading buffer (6X gel loading buffer: 40% sucrose, 0.25% Bromophenol blue) was added and the samples were loaded onto the gel (3% for SSR and 1.5% for ISSR). Electrophoresis was performed at 60 volts for 4-5 hours.
3.13.8. Visualization and Documentation The banding patterns were documented in Alpha innotech image Analyzer. The molecular weight of the amplicons was calculated by comparing the molecular weight standards with the help of the software Alpha image version 4.0.
3.13.9. Data analysis Each accession was evaluated for the presence (1) or absence (0) of an allele. Molecular sizes of the amplified fragments were estimated using a 100bp DNA Ladder Plus (Fermentas). The NTSYS Version 2.01e (Rohif, 1998) was used to calculate genetic similarities based on simple matching (SM) coefficients. Pair wise similarity matrix was generated using Nei - Li similarity index (Nei and Li, 1979). The relationship among the germplasm accessions was calculated with a phenotypic cluster analysis using Unweighted Pair Grouping Method with Arithmetic averages (UPGMA) and Sequential Agglomerative Hierarchical and Nested (SHAN) clustering method (Sneath and Sokal, 1973) and plotted in a phenogram using the same software.
The relative discriminatory value of the microsatellite marker was estimated by its Polymorphic Information Content (PIC), which measures the information content as a function of a marker system ability to distinguish between genotypes. According to Anderson et al. (1993) the PIC value was calculated using the following formula
61 PIC = 1- pi2 Where pi is the allele frequency for the ith allele. Putative alleles were arranged in a numerical order starting with the lowest size.
3.14. Field evaluation of ECS derived plants ECS derived plantlets (500 nos. each) of test cvs. Rasthali and Nendran were planted in field along with shoot tip and sucker derived plants as control. In field conditions, following biometric traits of ECS derived plants were compared with both controls. During field evaluation ECS derived plants were also screened for somaclonal variations.
List of vegetative and fruiting characters used in field evaluation
S. No Characters 1 Pseudostem Height (cm) 2 Pseudostem Girth (cm) 3 Petiole length (cm) 4 No. of leaves at shooting 5 Leaf Area (X104) 6 Days for shooting 7 Days for bunch maturation 8 Duration (Days) 9 Bunch weight (in Kg) 10 No. of hands per bunch 11 No. of fruits per hand 12 Total no. of fruits
3.15. Statistical analysis Each treatment consisted of at least 50 explants and each experiment was repeated 5 times. A completely randomized design was used in all experiments and analysis of variance and mean separations were carried out using Duncan’s Multiple Range Test (DMRT). Significance was determined at p = 0.05 level (Gomez and Gomez, 1976).
62 Chapter -IV RReessuullttss aanndd DDiissccuussssiioonn
The traditional method of mass multiplication of banana is slow and cumbersome as it requires large land areas and resources. In addition, varieties are found contaminated in the field with several diseases when exposed to adverse environmental conditions. In order to accelerate multiplication of stocks in a controlled environment, in vitro propagation is preferred. The propagation of plants from small tissues can be achieved by using different explants. The requirement for the production of plantlets of true to type to parental line is a crucial step for the mass multiplication program, of not only in banana but also in other crops. Therefore, an in vitro multiplication method has been attempted using different explants by different research groups. In vitro plant regeneration limited due to the need for large number of manual operations and low rates of multiplication, which greatly increases the production costs (Escalant et al., 2003; Savangikar, 2004). The use of somatic embryogenesis allows for higher multiplication in a shorter period and at a lower cost, which makes this method potentially more efficient than regeneration via organogenesis (Ibaraki and Kurata, 2001).
4.1. Selection of explant Success or failure in most of the methodologies of plant regeneration is determined by the selection of explant. Related to this, Vasil (1985) refered to the importance of the explants containing meristematic or undifferentiated cells and further turned the attention of researchers towards the use of shoot tips which gave good results in several plant species (Krikorian and Scott, 1995; Krishnaraj and Vasil, 1995). In general four procedures exist for the development of embryogenic cell suspensions in banana. They differ mainly in the source of the explant: zygotic embryos (Escalant, and Teisson 1989), rhizome slices, and leaf sheaths (Novak et al., 1989; Lee et al., 1997), immature flowers (Cote et al., 1996; Grapin et al., 1996), and multiple meristem cultures (Dhed,a et al., 1991; Schoofs, 1997). Whereas, somatic embryogenesis in commercial cultivars of Musa spp. mainly employed two explants: proliferating
63 meristems (Dhed'a et al., 1991; Schoofs, 1997) and immature male flower buds (Escalante and Teisson, 1994). To ensure success in somatic embryogenesis from proliferating meristems, multiple subcultures (5-14 months) in a culture medium supplemented with high concentrations of 6-benzylaminopurine (6-BAP) (22.5 mg/l) (Schoofs et al., 1999) was required. But high concentrations of cytokinins in Musa spp. increased the genetic variability by 4-10 times over the axillary buds regeneration (Reuveni et al., 1993) and immature male flower buds. Hence, the present study was conducted using immature male flower buds as explant which favors plant regeneration with low percentages of somaclonal variation.
4.2. Surface sterilization and callus induction Inflorescence of banana consists of tightly overlapping bracts with floral hands arranged in semi spiral manner. Due to this natural protection, flower buds were not damaged and desiccated during transportation to the lab. This cone like structure also protect the floral hands from different environmental contaminations. In the lab, floral hands were excised after removal of external bracts. Freshly excised explants were creamy white in color which started browning after excision. Surface sterilization was carried out after removing the external bracts and finally floral hands of each test cultivars were initiated in callus induction medium. It was observed that contamination in few floral hands was noticed even four weeks of culturing indicating the presence of systemic contaminants in the tissues. When solid callus induction medium was replaced by liquid medium, the contamination spread rapidly and medium became turbid within 48 hours of initiation. It was also observed that initially contamination was found around the explants alone and then slowly it started spreading. Explants initiated after surface sterilization using 70% ethyl alcohol exhibited 92% survival rate. Earlier reports showed that antibiotics used in banana which are sometimes strain specific (Habiba et al., 2002) and are phytotoxic to the plant tissues (Van den houwe et al.,
1998). Mercuric chloride (HgCl2) and sodium hypochlorite is being used individually or in combination (Banerjee and Sharma 1989) for sterilization but use of heavy metals is not recommended normally. From the results obtained, it was concluded that no specific antibiotic or sterilant is required to control contamination when male flowers are being used as explants, which are naturally protected.
64 Callus induction and regeneration of fertile banana plants meets two main goals i.e. for mass propagation and a tool for genetic improvement through genetic transformation. Initial work in banana callus induction did not accomplish organogenesis (Srinivasa-Rao et al., 1982) due to its highly recalcitrant nature but it provided the starting material for somatic embryogenesis. Mass propagation through callus induction and regeneration is not recommended due to higher level of somaclonal variation as compared to shoot tip culture. Hence, immature male flowers of test cultivars were cultured in MS medium supplemented with various growth regulators individually and also in combinations to check their efficiency towards callus induction which form base material for the establishment of embryogenic cell suspension. Present experiment showed that wounding-induced phenolic exudation. Hence, floral explants were excised with gentle cut at the base of stalk and placed vertically in callus induction medium. Except those placed in control medium, the floral explants cultured in different medium with PGR’s considerably curled within 7-14 days of culture. Irrespective of position, curling of floral hands was considered as initial response for callus induction.
4.3. Influence of various growth regulators on callus induction 4.3.1. Tested individually Callus is largely an unorganised proliferating mass of parenchyma cells. In the present study, young male flower buds were selected as explants for callus induction. Callusing response was observed in MS medium containing different concentrations of 2, 4-D (1.0 - 6.0 mg/l), TDZ (0.5 – 3.0 mg/l), Dicamba (1.0–5.0 mg/l) and NAA (1.0 - 5.0 mg/l). Whereas, MS basal medium which served as control failed to induce callus in test cultivars. Though all hormones responded for callus induction in most of the cultivars tested, yet their percentage differed with hormonal concentrations and genome of the test cultivars (Table-1).
Among the four growth regulators tested, TDZ was found effective in callus induction, followed by 2,4-D, Dicamba and NAA. Even lowest concentration of TDZ (0.5 mg/l) induced callus from floral explants of all cultivars and callus induction was found proportional to concentration TDZ till 1.0 mg/l, beyond which it decreased. Highest percentage of callus induction in MS medium fortified with 1.0 mg/l of TDZ was observed in Cavendish group (AAA) (cv. Grand Naine 42.4%, and Robusta 41.0%), followed by Rasthali (AAB) (39.0%) and Nendran (AAB) (28.3%).
65 Table 1. Comparative effect of various concentrations of 2, 4-D, TDZ, Dicamba and NAA on callus induction from immature male flower buds of banana cultivars on MS medium.
Growth Cultivars regulators (mg/l) GN RB RS NN NP KP MN KM BG CK PV Control 0 0 0 0 0 0 0 0 0 0 0 2,4-D 1.0 5.6±0.25q 5.0±0.40q 4.4±0.30q 3.0±0.45p 0 3.0±0.65pq 1.0±0.95q 0 0 2.5±0.50pqr 2.0±0.85o 2.0 13.4±0.25l 12.7±0.60l 10.5±0.35l 8.7±0.60k 6.5±0.50k 8.4±0.45l 7.5±0.85lm 6.0±0.90m 6.5±0.45lm 8.4±0.68l 8.0±0.90j 3.0 20.4±0.15j 19.5±0.34j 16.6±0.40j 13.0±0.50i 10.4±0.60hi 12.7±0.50ij 11.0±0.80i 9.7±0.65j 10.6±0.50i 13.0±0.90h 11.4±0.75f 4.0 36.0±0.20c 34.5±0.25c 28.7±0.50d 23.5±0.55c 19.5±0.45b 23.5±0.75ab 21.9±0.75a 18.5±0.80c 20.2±0.25ab 25.0±0.85a 22.5±0.65a 5.0 24.0±0.26g 22.5±0.50g 19.0±0.60gh 15.5±0.47h 13.4±0.66f 14.7±0.65f 12.5±0.95fg 11.0±0.50gh 13.8±0.30f 16.5±0.90f 14.0±0.75de 6.0 8.6±0.24o 7.5±0.35p 6.0±0.55p 4.0±0.0.38o 3.0±0.75n 3.7±0.75o 2.0±0.65opq 1.6±0.75q 3.0±0.37no 4.7±0.75n 3.5±0.85l TDZ 0.5 33.4±0.25d 31.8±0.40d 30.5±0.45c 18.0±0.55f 7.6±0.50j 13.7±0.60h 8.9±0.55k 9.0±0.65k 8.6±0.50k 9.5±0.75k 8.0±0.80j 1.0 42.4±0.20a 41.0±0.24a 39.0±0.37a 28.3±0.75a 16.5±0.45e 20.0±0.25cd 17.0±0.65de 17.5±0.55d 16.4±0.45e 17.8±50e 15.0±0.65c 1.5 38.0±0.26b 38.4±0.50b 34.5±0.75b 25.3±0.80b 20.5±0.55a 23.6±0.85a 21.4±0.75b 22.0±0.65a 21.7±0.60a 22.8±0.75b 18.5±75b 2.0 29.0±0.25f 29.6±0.70ef 25.6±0.80e 19.5±0.46e 18.5±0.60d 20.4±0.75c 19.3±0.80c 19.3±0.85b 19.0±0.55c 19.6±0.60c 14.50.65d 3.0 17.3±0.50k 18.0±0.45k 13.7±0.65k 11.4±0.50j 11.0±0.75h 11.0±0.49k 10.9±0.85ij 10.7±0.90i 10.0±0.70ij 10.3±0.55j 6.0±0.45k Dicamba 1.0 10.8±0.30m 10.5±0.37m 9.4±0.40m 7.6±0.73l 6.0±0.45m 5.8±0.50n 3.7±0.65n 3.6±0.68n 3.5±0.30n 3.8±0.45o 2.0±0.60o 2.0 22.5±0.30hi 21.4±0.30i 18.0±0.54i 15.5±0.90h 12.3±0.65g 12.8±0.75i 11.8±0.60h 11.5±0.80g 12.0±0.38h 12.6±0.70i 10.5±0.75h 3.0 30.3±0.28e 30.2±0.29e 24.5±0.30f 21.0±0.80d 19.0±0.75bc 19.8±0.65cde 17.5±0.67d 17.4±0.67de 18.0±0.40d 19.5±0.60cd 15.0±0.77c 4.0 22.9±0.30h 22.0±0.55gh 19.5±0.50g 16.3±0.65g 14.0±0.80e 14.5±0.85fg 12.7±0.80f 13.3±0.50f 13.6±0.45fg 14.0±0.50g 11.3±0.80fg 5.0 8.5±0.36op 8.7±0.40o 6.9±0.65o 5.0±0.75mn 3.0±0.90n 3.3±0.90p 0 0 0 0 0 NAA 1.0 3.6±0.50s 3.5±0.50rs 3.0±0.45st 1.4±0.90qr 1.6±0.95op 1.8±0.78s 2.4±1.0op 2.0±1.3p 2.0±0.80q 2.4±1.0pq 2.9±0.90lmn 2.0 10.4±0.60mn 10.0±0.65mn 9.0±0.38n 5.6±0.85m 6.4±0.94kl 7.0±0.80m 7.6±1.2l 6.7±1.3l 7.0±0.70l 7.5±0.85m 8.5±1.0i 3.0 3.9±0.55r 4.4±0.70r 3.4±0.65r 1.7±0.80q 1.9±0.70o 2.0±1.0r 2.6±1.0o 2.4±1.0o 2.5±0.75p 2.7±0.80p 3.4±1.2lm 4.0 0 0 0 0 0 0 0 0 0 0 0 5.0 0 0 0 0 0 0 0 0 0 0 0 * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
66 Other commercial cultivars showed differential response at this concentration. The higher cytokinin activity of TDZ was attributed to its ability to accumulate in cultured tissues to act as endogenous cytokinins (Huetteman and Preece, 1993). Similar work was carried out Nahamya (2000) and reported that 10 mM TDZ increased the proliferation rate of cells during callus induction.
Explants of test cultivars except Neypoovan, Kallumonthan and Bluggoe produced calli when initiated on medium fortified with 1.0 mg/l 2,4-D. Callus induction percentage increased gradually and was found maximum when explants were cultured on MS medium with 4.0 mg/l 2,4-D. Similarly, 3.0 mg/l Dicamba was optimum among the concentrations tested in present trial. Results also showed that NAA proved poor for callus induction, among the hormones tested singly. Higher levels of 2,4-D (6.0 mg/l), TDZ (3.0 mg/l), Dicamba (4.0 mg/l) and NAA (3.0 mg/l) required more time for callus induction (more than 4 months) and subsequently resulted in reducing the frequency of explants forming callus (Table 1). Although 2,4-D (4.0 mg/l), TDZ (1.0 mg/l), dicamba (3.0 mg/l) proved efficient in callus induction, they were supplied in combinations with NAA and IAA to increase efficiency.
4.3.2. Tested in combination 4.3.2.1. In combination with NAA Response of explants towards callogenesis varied significantly when growth hormones were supplied in combinations. Results showed that callus induction percentage was proportional with concentration of NAA and was maximum when 4.0 mg/l 2.4-D was supplemented with 1.0 mg/l NAA. At this concentration 42.5% of initiated explants of cv. Grand Naine produced calli. Cultivar Robusta showed second maximum percentage in callus induction (38.9%). Though cvs. Rasthali, Nendran and Neypoovan belong to same genome ‘AAB’ yet varied in response (32.5%, 30.5% and 24.2%) was observed. Whereas, cvs. Karpporavalli, Monthan, Kallu monthan, Chakkia, and Bluggoe belonging to same genome ‘ABB’ showed response (29.4%, 25.5%, 23.5%, 26.6% and 32.0%) which was significantly different from control (4.0 mg/l 2,4-D). Further increase in concentration of NAA reduced the callus induction percentage in all test cultivars and was minimum when medium was supplemented with 4.0 mg/l of 2,4-D and 2.0 mg/l NAA (Table-2).
67 Table 2. Effect of various concentrations of NAA (0.25-2.0mg/l) in combination with 2,4-D (4.0 mg/l), TDZ (1.0mg/l) and Dicamba (3 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium.
Growth Cultivars regulators (mg/l) 2,4-D+ GN RB RS NN NP KP MN KM BG CK PV NAA Control 36.0±0.45d 34.5±0.60d 28.7±0.90d 23.5±0.55d 19.5±0.45d 23.5±0.50d 21.9±0.75d 18.5±0.50d 20.2±0.77d 25.0±0.50d 22.5±0.55d 0.25 38.5±0.50c 36.0±0.50bc 29.5±0.67bc 26.5±0.60c 21.4±0.56c 25.4±0.75c 22.7±0.80c 20.0±0.56c 23.4±0.46c 27.2±0.57c 24.7±0.56c 0.5 40.0±0.38b 37.2±0.49b 30.6±0.90b 28.6±0.65b 22.7±0.69b 26.0±0.80b 24.0±0.95b 23.9±0.75b 24.0±0.60b 29.5±0.70b 27.6±0.57b 1.0 42.5±0.40a 38.9±0.95a 32.5±1.0a 30.7±0.70a 28.3±0.75a 29.0±0.80a 32.0±90a 32.5±0.47a 33.5±0.86a 35.4±0.92a 28.6±0.65a 1.5 24.0±0.60e 22.5±0.90e 18.5±1.2e 13.6±0.75e 13.0±0.85e 17.5±0.75e 14.3±0.70e 13.4±0.68e 16.5±0.60e 18.8±0.56e 19.4±0.80e 2.0 10.8±0.38f 11.8±0.80f 8.7±0.95f 5.4±0.80f 5.0±0.69f 4.6±0.80f 4.0±0.80f 4.5±0.75f 5.4±0.55f 6.0±0.45f 7.5±0.65f Dicamba+ NAA Control 30.3±0.50d 30.2±0.90d 24.5±0.55e 21.0±0.85e 19.0±0.45e 19.8±0.65e 17.5±0.65e 17.4±0.70e 18.0±0.75e 19.5±0.50e 15.0±0.53e 0.25 35.7±0.45c 35.7±0.89c 31.6±0.65bc 28.3±0.67c 26.5±0.80c 26.6±0.70c 23.6±0.75d 23.4±0.75d 24.7±0.80d 25.6±0.69cd 20.0±0.60d 0.5 39.0±0.40a 38.5±0.80a 33.5±0.75a 30.5±0.70a 27.2±0.75a 29.4±0.95a 29.5±0.66a 30.5±0.80a 30.6±0.75a 32.0±0.73a 31.5±0.70a 1.0 37.5±0.56b 37.0±0.75b 32.4±0.80ab 29.3±0.75b 26.0±0.95b 27.5±0.45b 25.5±0.95b 23.0±0.65b 26.7±0.69b 27.7±0.80b 24.6±0.50b 1.5 29.0±0.64e 29.2±0.49e 27.0±0.95d 25.4±0.80d 24.0±0.80d 24.4±0.60d 24.7±0.78c 25.3±0.67c 25.5±0.78c 26.5±0.75c 24.5±0.68bc 2.0 11.6±0.47f 11.0±0.50f 4.8±1.0f 3.4±0.95f 3.0±0.67f 3.3±0.49f 3.4±0.80f 3.9±0.70f 3.0±0.50f 3.2±0.49f 2.9±0.70f TDZ+NAA Control 42.4±0.75ab 41.0±0.49a 39.0±1.2ab 28.3±0.58a 16.5±0.75a 20.0±0.85a 17.0±0.90ab 17.5±0.90a 16.4±0.60f 17.8±0.93a 15.0±0.75a 0.25 42.5±0.85a 40.7±0.80ab 39.3±1.3a 27.8±0.95ab 16.0±0.80ab 19.5±0.95ab 17.4±0.95a 17.0±0.75b 16.0±0.66ab 17.3±1.3ab 14.0±0.85b 0.5 39.0±0.80c 37.5±0.70c 35.0±1.0c 23.0±1.0c 12.6±0.80c 15.0±0.50c 12.5±1.0c 11.6±1.0c 11.4±0.80c 11.9±1.2c 9.6±65c 1.0 24.4±0.50d 21.5±0.66d 19.5±0.85d 14.0±1.2d 3.0±0.95d 4.5±0.56d 3.3±1.2d 3.0±1.4d 2.8±0.68d 3.5±1.0d 0 1.5 11.0±0.60e 10.5±0.54e 4.6±0.80e 3.0±0.95e 0 0 0 0 0 0 0 2.0 0 0 0 0 0 0 0 0 0 0 0 * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
68 Irrespective of genome, all concentrations of NAA in combination with Dicamba (3.0 mg/l) induced callus, yet maximum response was recorded from MS medium supplemented with 3.0 mg/l Dicamba and 0.5 mg/l NAA. Further increase in concentration of NAA reduced the level of callogenesis (Table-2). TDZ when used individually was found efficient in callus induction whereas, reduction in callus induction percentage was noticed when supplemented in combination with NAA. Among various concentrations tested, 0.25 mg/l and 0.5 mg/l NAA in combination with 1.0 mg/l TDZ induced calli from explants of all test cultivars. Further increase in concentration reduced the response of floral explants. Present result proves that 4.0 mg/l of 2,4-D in combination of 1.0 mg/l NAA was efficient compared to other hormonal combination and concentrations tried.
4.3.2.2. In combination with IAA MS medium with optimum concentration of 2,4-D, TDZ and Dicamba was used in combination with various concentrations of IAA and the results obtained are given in Table-3. In quantitative terms, average number of explants responded was maximum at 4.0 mg/l 2,4-D in combination with 1.0 mg/l of IAA. Further increase in IAA concentration decreased the response in all test cultivars. Response of IAA in combination with 2,4-D was similar to that of 2,4-D and NAA combination. In this hormonal combination (4.0 mg/l 2,4-D and 1.0 mg/l IAA), highest percentage of callus induction was recorded in cv. Grand Naine (41.6%) and least response was noticed in cv. Kallumonthan (20.0%). Decrease in response with increase in IAA concentration and failure of cvs. Bluggoe and Kallumonthan to produce callus at 2.0 mg/l IAA indicated that IAA affected callus induction adversely when used in concentration higher than optimal. Ivanova et al. (1994) found a relation between IAA levels and 2, 4-D towards callus induction and reported that fast embryogenic lines have endogenous IAA levels, 4 times higher than that of slow embryogenic lines, and 30 times higher than that in non embryogenic lines.
Callus induction percentage in all test cultivars increased gradually with increase in concentration of IAA and found maximum in the medium supplemented with 3.0 mg/l Dicamba with 1.5 mg/l IAA. Further increase in IAA concentration decreased the response irrespective of cultivar and genome.
69 Table 3. Effect of various concentrations of IAA (0.25-2.0mg/l) in combination with 2,4-D (4.0 mg/l), TDZ (1.0mg/l) and Dicamba (3.0 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium.
Growth Cultivars regulators (mg/l) 2,4-D+ GN RB RS NN NP KP MN KM BG CK PV IAA Control 36.0±0.28d 34.5±0.56d 28.7±0.28d 23.5±0.45d 19.5±0.34d 23.5±0.56e 21.9±0.35d 18.5±0.50d 20.2±0.35d 25.0±0.38d 22.5±0.28d 0.25 37.5±0.35c 35.9±0.57c 30.0±0.30c 25.6±0.50c 21.0±0.50c 24.5±0.37cd 22.5±0.40bc 19.0±0.60abc 21.9±0.50bc 27.0±0.65bc 25.6±0.30c 0.5 39.5±0.45b 38.0±0.60b 31.5±0.35b 27.5±0.55b 23.5±0.60b 26.7±0.50b 23.0±0.38b 19.6±0.58ab 22.7±0.54ab 27.5±0.50b 27.5±0.40ab 1.0 41.6±0.50a 39.0±0.65a 32.4±0.49a 30.5±0.60a 25.0±0.65a 28.0±0.53a 23.6±0.50a 20.0±0.47a 23.5±0.65a 28.5±0.45a 28.0±0.46a 1.5 29.5±0.39e 27.5±0.65e 20.6±0.50e 19.0±0.43e 16.7±0.75e 25.0±0.50c 12.9±0.55e 10.9±0.39e 11.0±0.60e 17.0±0.50e 15.6±0.50e 2.0 15.0±0.76f 13.4±0.60f 4.0±0.83f 3.8±0.80f 2.8±0.78f 9.5±0.49f 1.5±0.65f 0 0 3.6±0.60f 2.4±0.45f Dicamba+ IAA Control 30.3±0.50ef 30.2±0.65ef 24.5±0.60def 21.0±0.50ef 19.0±0.60def 19.8±0.40f 17.5±0.45ef 17.4±0.60ef 18.0±0.50f 19.5±0.28ef 15.0±0.37ef 0.25 30.7±0.60e 30.7±0.49e 25.0±0.45de 21.5±0.49e 19.6±0.65de 20.4±0.40e 17.9±0.57e 17.9±0.75e 18.5±0.55e 19.9±0.27de 15.5±0.40e 0.5 31.7±0.65d 32.0±0.70d 26.5±0.60c 22.7±0.55cd 21.7±0.45c 22.4±0.46c 20.0±0.65cd 20.3±0.60cd 20.5±0.46c 22.3±0.30c 17.7±0.45d 1.0 34.0±0.75b 32.6±0.80c 28.3±0.70b 24.9±0.60b 23.4±0.50b 25.0±0.75b 23.3±0.60b 23.5±0.45b 22.8±0.40b 24.4±0.48b 19.5±0.65b 1.5 36.3±0.80a 36.7±0.65a 30.6±0.75a 27.7±0.45a 25.7±0.55a 27.6±0.65a 25.0±0.65a 26.5±0.57a 26.3±0.38a 26.0±0.45a 22.7±0.75a 2.0 33.0±0.75c 33.3±0.69b 25.5±0.80d 23.8±0.53c 20.5±0.59cd 21.7±0.48d 20.2±0.85c 20.6±0.50c 20.0±0.50cd 21.3±0.65d 18.5±0.60c TDZ+IAA Control 42.4±0.48a 41.0±0.65a 39.0±0.45a 28.3±0.80a 16.5±0.66a 20.0±0.95a 17.0±0.95a 17.5±0.79a 16.4±0.65a 17.8±0.48a 15.0±0.75a 0.25 40.0±0.95b 39.3±0.50b 38.5±0.66ab 27.0±0.85b 15.0±0.75b 18.6±1.0b 14.6±0.90b 14.4±1.3b 14.0±0.70b 15.4±0.53b 13.4±0.80b 0.5 36.3±0.75c 37.0±0.75c 35.0±0.75c 24.3±0.75c 11.6±0.68c 15.3±1.3c 11.4±1.0c 11.0±1.2c 10.6±0.75c 11.5±0.75c 10.2±1.3c 1.0 26.6±0.80d 28.5±0.65d 23.4±0.80d 13.0±0.90d 3.4±0.75d 5.7±1.0d 0 0 0 0 0 1.5 13.6±0.90e 15.6±0.80e 10.4±0.69e 3.3±0.95e 0 0 0 0 0 0 0 2.0 6.9±1.0f 7.5±0.75f 3.0±0.85f 0 0 0 0 0 0 0 0 * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
70 Effect of IAA in combination with TDZ showed negative response towards callus induction. Results showed that callus obtained in all concentrations of IAA with TDZ was less than control. TDZ is a phenyl urea based cytokinin frequently used in tissue culture. Hamide and Mustafa (2004) reported that TDZ plays major role in shoot proliferation of banana and furthermore increased proliferation was recorded when used in combination with IAA. Whereas, similar combination failed to show positive results for callus induction in present experiment. The results showed that callus induction depends not only on type and concentration of growth regulators but also on the explants used.
4.3.2.3. 2,4-D in combination with IAA and NAA Different media are used for culture initiation in banana. Some investigators used same media for initiation and multiplication while other used different concentrations of hormones for two phases. Most common salt mixture used for culture initiation of banana was the MS (1962) with some modifications as reported by several workers (Cronauer and Krikorian, 1984; Hamill et al., 1993; Zaffari et al., 2000). In this trial MS salts and vitamins with 4.0 mg/l 2,4-D was supplemented with various concentrations and combinations of IAA and NAA. Variation in response was recorded between and within genotype (Table-4). Results showed that callus induction was minimum in control and increased with concentration of hormones and found maximum in medium supplemented with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA. At this concentration 70.3% of initiated floral hands of cv. Grand Naine produced callus, followed by cv. Robusta (68.4%) which belongs to same genome ‘AAA’. Among the cultivars of ‘AAB’ genome, cv. Rasthali showed highest response of 61.4% and lowest response was observed in cv. Neypoovan (52.5%).
Beyond 1.0 mg/l, both NAA and IAA decreased callus induction response in all test cultivars. Results also showed that callus induction percentage decreased with increase in ‘B’ genome and was minimum in cv. Kallumonthan (47.0%). Results clearly illustrated that callus induction response depends not only on plant growth regulator and type of explant used but also on the genome of the test cultivar.
71
Table 4: Effect of different concentrations of NAA and IAA (0.25-2.0 mg/l) with 2,4-D (4.0 mg/l) on callus induction from immature male flower buds of banana cultivars on MS medium.
Growth Callus induction in different cultivars (%) regulators GN RB RS NN NP KP MN KM BG CK PV (mg/l) IAA+NAA Control 36.0±0.95h 34.5±0.50h 28.7±0.09h 23.5±0.28h 19.5±0.38h 23.5±0.35h 21.9±0.08f 18.5±0.09g 20.2±0.09g 25.0±0.58g 22.4±0.4fg 1.0+0.25 45.5±1.0f 44.0±0.85f 37.5±0.25fg 36.5±0.65e 31.9±0.45e 33.0±0.50de 30.7±0.80e 26.0±1.0e 29.5±0.35e 34.6±1.3e 32.0±0.65e 1.0+0.5 54.5±0.75c 52.0±0.60c 44.7±0.58c 43.0±0.50c 39.4±0.55c 39.6±0.65b 35.0±0.50cd 34.6±0.60bc 36.4±0.50c 42.6±0.68c 40.5±1.5c 1.0+1.0 70.3±0.70a 68.4±0.35a 61.4±0.60a 58.7±0.30a 52.5±1.0a 52.9±0.45a 47.6±0.75a 47.0±0.50a 48.0±0.57a 54.0±0.53a 53.4±0.95a 1.0+1.5 48.2±0.45de 47.0±0.25e 38.5±0.56ef 28.0±0.26g 28.6±1.3f 28.7±0.48f 21.0±0.08fg 20.4±0.78= 24.0±0.38f 32.8±1.0f 22.5±0.90f 1.0+2.0 18.0±0.38i 15.0±0.13i 11.5±0.08i 9.0±0.09i 5.7±0.85i 3.5±0.59j 6.4±0.95i 1.5±0.75i 4.8±0.68i 1.8±0.50i 1.6±0.76i 0.25+1.0 49.5±0.55d 50.0±0.40d 41.5±0.95d 39.5±0.60d 35.9±0.90d 33.8±0.80d 35.5±0.50c 30.5±0.65d 32.5±0.50d 39.7±0.33d 35.0±0.65d 0.5+1.0 59.5±0.65b 56.0±1.3b 45.0±0.60b 47.4±0.48b 49.7±0.50b 39.0±1.0bc 44.0±0.65b 35.7±0.45b 40.5±0.65b 46.5±0.30b 42.9±0.45b 1.0+1.0 70.3±0.90a 68.4±0.67a 61.4±0.85a 58.7±0.40a 52.5±0.65a 52.9±1.25a 47.6±0.70a 47.0±0.50a 48.0±0.90a 54.0±0.28a 53.4±0.34a 1.5+1.0 41.9±0.93g 40.6±0.85g 39.4±0.20e 30.0±0.26f 25.5±0.20g 26.7±1.3g 19.4±1.28h 16.8±0.09g 19.5±0.75gh 23.0±0.15h 15.5±0.50h 2.0+1.0 7.5±1.5j 8.0±0.08j 7.4±0.05j 1.0±0.08j 1.2±0.25j 8.5±0.30i 2.5±0.67j 2.5±0.50h 2.0±0.40j 1.4±0.39ij 0.6±0.50j
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
72 Relationship between hormonal combination and genome were reported by earlier researchers like Sandra and Krikorian (1984), who achieved 9.0 shoots/explant during in vitro multiplication of cv. Philippine Lacatan and Grand Naine (AAA) on a modified MS medium supplemented with 5.0 mg/l BAP. Whereas, Rahman et al (2002) achieved only 4.0 shoots/explant on the same concentration of BAP on MS medium during in vitro multiplication of cv. Ban-I, indicating the genotypic response towards hormones.
4.3.2.3.1. Effect of position of floral hands on callus induction The response of explants at different developmental stage (various positions) on callus induction were recorded and given in Table-5. The callus induction frequency varied significantly with position of floral hands. Floral hands near meristematic dome (0-2) failed to survive and induce callus in most of the test cultivars. This failure in survival may be due to the necrosis. It was observed that less than 1.5% of explants near meristematic dome (0-2) induced callus. Callus induction percentage gradually increased with maturity of explants. Explants obtained from position 3-5 showed lowest response in cv. Rasthali (9.0%). No statistical difference was noticed in callus induction percentage in cvs. Grand Naine (AAA), Robusta (AAA) and Rasthali (AAB) at this level of explant maturity. Whereas, cultivars from same genome ‘AAB’ (Rasthali 9.0%, Nendran 13.0%) showed differential response towards callus induction. From same position (3-5), highest response of 18.5% was recorded from cooking banana Monthan (ABB). Results also show that more than 50% of cultured explants produced calli when obtained between positions 6-8. Further increase in maturity level showed negative correlation between position of explants and callus induction capacity (Table-5). Present results are supported by the finding of Gomez Kosky et al. (2001), who reported that in banana cultivars, from 5th to 9th whorls formed more callus compared to flowers obtained from position 10th to 14th. The floral explants obtained from position above 16 failed to induce callus in most of the test cultivars. Failure in response with increase in maturity of explants emphasizes the importance of explant selection. Earlier reports also show that in Musa male flowers, 15 hands proximal to the terminal meristem were used as explants (Escalant and Teisson, 1994). Similar result was obtained by Grapin et al. (1996), where response of floral hands was found dependent on their position.
73
Table 5: Effect of position of explant on callus induction on MS medium fortified with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Position Frequency of callus induction (%) of GN RB RS NN NP KP MN KM BG CK PV hands 0 - 2 1±0.7f 1±0.56ef 0.5±0.85ef 1.5±0.56e 0e 0e 0e 0e 0e 0e 0e 3 - 5 10±0.38cd 9.5±.37cd 9±0.65c 13±0.60c 13.5±0.45c 17.5±0.67b 18.5±0.75b 16.8±0.54c 16.4±0.57c 17.5±0.65bc 16±0.50c 6 - 8 52.5±0.58a 50±0.54a 50±0.50a 65.4±0.55a 63±0.35a 62.7±0.45a 61±0.45a 60.5±0.39a 61±0.50a 59±0.47a 62.5±0.40a 9 - 11 22±0.29b 26.5±0.65b 29.8±0.65b 14.2±0.63b 16±0.67b 16.2±0.85c 16.5±0.85c 17.5±0.55b 18.6±0.65b 18±0.35b 17±0.39b 12-15 11.5±0.75c 9.8±0.60c 8±0.70d 5.9±0.75d 6.5±1.25d 3.6±0.93d 4±0.90d 5.2±0.85d 4±0.76d 5.5±0.70d 4.5±0.85d >16 3±0.64e 3.2±0.78e 0.7±1.0e 0f 0e 0e 0e 0e 0e 0e 0e * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
74 Based on the results obtained it can be concluded that position of the floral hand was the only deciding factor since number of flowers per hand does not change with the row. Result also emphasize that somatic embryogenesis can be induced in recalcitrant genotypes when suitable explants at defined developmental stages are excised from plants under optimal condition and grown in appropriate medium as reported by Vasil, (1987).
4.3.2.3.2. Effect of position of floral hands on nature of callus obtained Plant tissues have the ability to form callus in in vitro condition but relatively few explants have the ability to produce callus with embryogenic structures (Litz and Jarrett 1991). When floral explants were cultured on callus induction medium, the tissues remained as such and no change in physical structure was observed up to one week. Later on browning was observed in youngest explants (closer to meristematic dome). This is followed by vitrification and degeneration which led to tissue death. As initial sign of response the floral hands curled between 10 - 15 days of initiation. Individual flowers in each hand started losing its identity and produced callus. Different types of callus obtained from explants were recorded and tabulated (Table-6 and Plate 3a and 3b). Vasil (1988) stated that the callus can be identified by their morphological and cytological features, a compact appearance, nodular surface, pale yellow and white with some organizational aspects. Based on the findings of Vasil (1988) callus obtained in present study was categorized mainly under four groups and named as Heterogeous complex (I to IV). Based on the morphological similarity and position of floral hands, present classification has been carried out. Results obtained shows that floral hands from position 0-5 produced Heterogenous complex I and II which comprises pale yellow compact, milky white viscous, white compact, whitish yellow friable, milky white, milky white viscous calli. Increase in maturity of explants changed the nature of callus produced. Explants obtained from position 6-8 produced only Heterogenous complex II. Results also showed that explants of cvs. Grand Naine, Robusta and Rasthali produced callus which mainly fall under Heterogenous complex II whereas, floral hands from position 9-15 of all other test cultivars produced Heterogenous complex III which mainly consists of whitish yellow friable, yellow friable calli. Brown friable and/or brown compact callus was obtained only from explants above 16th position (Plate 4).
75
Table 6: Effect of position of explant on nature of callus on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Position Nature of callus of GN RB RS NN NP KP MN KM BG CK PV hands 0 - 2 HCI HCI HCI HCI ------3 - 5 HCII HCII HCII HCI HCI HCI HCI HCI HCI HCI HCI 6 - 8 HCII HCII HCII HCII HCII HCII HCII HCII HCII HCII HCII 9 - 11 HCII HCII HCII HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII 12-15 HCII HCII HCII HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII > 16 HCIV HCIV HCIV ------
HCI- heterogenous complex 1(pale yellow compact, milky white viscous, white compact, brown compact) HCII- heterogenous complex 2(whitish yellow friable, milky white compact, milky white viscous) HCIII- heterogenous complex 3(whitish yellow friable, yellow friable and mucilaginous) HCIV- heterogenous complex 4(brown friable, brown compact and mucilaginous)
76 PLATE 3a Types of callus obtained from male flower buds of different cultivars of banana in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 3-6 months (bar 5 mm)
(I) (a - h) - Homogenous yellow, white and brown compact non embryogenic callus
(i - l) - Homogenous brown and white friable non embryogenic callus
(II) (a - e) - Heterogenous whitish yellow, brown friable and compact, non embryogenic callus
(f - k) - Heterogenous pale yellow mucilaginous, milky white compact, yellow friable non embryogenic callus
PLATE 3a
I
a b c d
e f g h
i j k l
II
a b c d
e f g h
i l j k PLATE 3b Types of friable callus obtained from male flower buds of different cultivars of banana on MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 3-6 months (bar 5 mm)
I (a - i) - Friable non embryogenic callus (j - l) - Friable embryogenic callus without embryos
II (a - k) - Friable embryogenic callus with one to many somatic embryos (l) - Friable embryogenic callus completely covered with embryos
PLATE 3b
I
a b c d
e f g h
i j k l
II
a b c d
e f g h
i j k l
PLATE 4 Effect of position of floral hand on callus induction in banana cultivar Robusta, in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA (bar 5 mm)
1-4 - Heterogenous complex I (pale yellow compact and mucilaginous, brown compact) 5-8 - Heterogenous complex II (whitish yellow friable, milky white compact, milky white viscous) 9-12 - Heterogenous complex III (whitish yellow compact, yellow friable and mucilaginous) 13-16 - Heterogenous complex IV (yellowish white mucilaginous brown friable, brown compact)
PLATE 4
1 2 3
4 5 6
7 8 9
10 11 12
13 14 15 16
4.3.2.4 Effect of combination of 2-4-D, IAA and NAA on embryogenic callus The formation of calli with embryogenic structures from floral explants was observed after four month of culture initiation. Highest percentages of callus with embryogenic structures was recorded when medium was supplemented with 4.0 mg/l 2,4-D, 1.0 mg/l NAA and 1.0 mg/l IAA from test cultivars (Table 7). The calli with embryogenic capacity were characterized by meristematic structures consisting of yellowish white nodular callus or/ friable with or/and without formation of somatic embryos on the surface as obtained by Dhed'a et al. (1991) and Schoofs, (1997).
The development of somatic embryogenesis in Musa is considered extremely recalcitrant by many researchers (Strosse et al., 2004). Results show that all test cultivars produced calli with embryogenic structures. Percent of embryogenic response varied considerably and found genome dependent (Plate-5). Highest embryogenic response was obtained in cv. Rasthali (17.4%) followed by cv. Robusta (10.3%) and Grand Naine (9.5%). It was also observed that cultivars which belongs to same genome showed considerable variation in embryogenic response (Table-7). Lowest percentage of embryogenic calli (0.1%) was obtained from the floral explants of cv. Chakkia (ABB). Similar results were obtained by Parrott (1993) where individual genotypes within a species differ widely in their ability to undergo somatic embryogenesis, and therefore such genotypic differences in embryogenic capacity, probably reflect differences in the ability to activate the embryogenic pathway. Schoofs (1997) carried out similar work by using proliferating meristems as explants for embryogenic pathway in 21 cultivars of different genomic groups, of which only 18 showed embryogenic response.
Earlier reports also emphasize the importance of nature of hormone and their concentrations in inducing the embryogenic pathway in Musa. The use of 1.0 mg/ l 2,4-D, to induce the embryogenic process in different genotypes of plantains and bananas has been reported by several workers (Dhed'a et al. 1991; Schoofs, 1997; Santos et al., 2002) and the genotypes which failed to show high embryogenic response may be due to high endogenous levels of abscisic acid (ABA).
77 Table 7: Influence of various concentrations of NAA and IAA (0.25-2.0 mg/l) in combination with 2,4-D (4.0 mg/l) on embryogenic callus induction from immature male flower buds of banana cultivars on MS medium.
Growth Embryogenic callus induction in different cultivars (%) regulators (mg/l) GN RB RS NN NP KP MN KM BG CK PV IAA+NAA Control 0 0 0 0 0 0 0 0 0 0 0 1.0+0.25 0.2±0.08g 1.2±0.09f 3.0±0.10f 0.4±0.04d 0 0 0 0 0 0 0 1.0+0.5 3.0±0.05bc 4.8±0.25b 8.4±0.30b 1.6±0.07b 0.6±0.08b 0 0.4±0.08b 0.3±0.08b 0.2±0.04c 0.1±0.05b 0.4±0.05b 1.0+1.0 9.5±0.6a 10.3±0.20a 17.4±0.35a 5.7±0.30a 3.4±0.24a 0.9±0.05a 2.5±0.40a 2.1±0.10a 2.6±0.24a 1.9±0.10a 2.0±0.09a 1.0+1.5 3.3±0.8b 2.9±0.57d 4.3±0.25d 0.9±0.1c 0.4±0.08c 0 0.3±0.06c 0.1±0.09c 0.3±0.03b 0 0.1±0.02c 1.0+2.0 0.5±0.07f 0.7±0.03g 0.2±0.06g 0 0 0 0 0 0 0 0 0.25+1.0 0 0 0 0 0 0 0 0 0 0 0 0.5+1.0 2.3±0.15e 2.4±0.8e 6.5±0.26c 1.6±0.09b 0.2±0.08d 0 0 0 0 0 0 1.0+1.0 9.5±0.6a 10.3±0.20a 17.4±0.35a 5.7±0.30a 3.4±0.24a 0.9±0.05a 2.5±0.40a 2.1±0.10a 2.6±0.24a 1.9±0.45a 2.0±0.90a 1.5+1.0 2.8±0.6cd 3.4±0.16c 3.7±0.15e 0.2±0.09e 0 0 0 0 0 0 0 2.0+1.0 0 0 0 0 0 0 0 0 0 0 0
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
78 PLATE 5 Influence of genotype on callus induction in MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 1-2 months (bar 5 mm)
I - Floral hands of test cultivars under AAA genome II - Floral hands of test cultivars under AAB genome III - Floral hands of test cultivars under ABB and AB genome
PLATE 5
a b c d I
e f g h
b c a d II
e f g h
a b c d III
e f g h However, Strosse et al. (2004) referred varied embryogenic response (0-5.8%) in AAB genome with the concentration of 2,4-D mentioned above. This is similar to the present finding where percentage of calli with embryogenic structures in the process of somatic embryogenesis was directly influenced by the concentrations of 2,4-D. Similar findings were made by Dion daniels et al. (2002). In present trial it was also found that the test cultivars, irrespective of the genome failed to produce calli with embryogenic structures when concentration of IAA or/ NAA reached 2.0 mg/l.
Proliferating meristems were the choice of explants in genotypes that fail to produce male inflorescences (Suprasanna et al., 2002; INIBAP, 2003). Formation of proliferating meristems on culture media supplemented with high concentrations of cytokinins may be associated with de novo bud formation from pre-existing meristems or from group of one or group of meristematic cells (Vuylsteke and De Langhe, 1985). However, using this explant for induction of somatic embryogenesis has the disadvantage of being a source of genetic variation (Reuveni et al., 1986). From the results obtained in this section, it is clear that immature male flower buds can be effectively used as explants to study embryogenic pathway in Musa spp.
4.3.2.4.1. Effect of position of explant on embryogenic callus induction Though explants at various maturity status produced callus, yet differed in embryogenic response. Floral hands obtained from 1st and 2nd position failed to produce calli with embryogenic structures. Results obtained (Table-8) shows that lowest embryogenic response from floral explants obtained from position 3-5 was recorded in cv. Poovan (AB) (13.5%) whereas cv. Nendran (AAB) showed maximum response (21%). Table- 8 clearly illustrates that floral explants revealing highest embryogenic capacity belongs to position 6-8. It ranged from 53.5% (cv. Grand Naine) to 77.5% (cv. Poovan). Except cvs. Grand Naine, Robusta and Rasthali, all other cultivars shows steep decrease in embryogenic response from floral explants beyond 6-8 whorls. Similar results were obtained by Gomez Kosky et al. (2001), who reported that in banana cultivars, from 5th to 9th whorls have frequency of somatic embryogenesis than the 10th to 14th.
79
Table 8: Effect of position of floral hands on embryogenic callus induction on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Position Frequency of embryogenic callus induction (%) of GN RB RS NN NP KP MN KM BG CK PV hands 0 - 2 0 0 0 0 0 0 0 0 0 0 0 3 - 5 16±1.0c 17.7±1.2c 15.7±0.60c 21±0.50b 18.5±0.65b 17±0.50b 15.5±0.55b 16±0.45b 15.7±0.45b 14.9±0.50b 13.5±0.50b 6 - 8 53.5±0.95a 53.5±1.0a 61.3±0.35a 69.5±0.57a 74±0.40a 76±0.38a 76±0.50a 76.7±0.50a 76.5±0.60a 76.4±0.75a 77.5±59a 9 - 11 24±1.3b 24.5±0.75b 21±0.90b 9±0.65c 6.5±0.80c 6±0.50c 7±0.75c 6.3±0.85c 6.4±0.50c 7±0.68c 8±1.0c 12-15 6.5±1.4d 4.3±0.85d 2±0.75d 0.5±1.0d 1±0.95d 1±1.0cd 1.5±1.0cd 1±0.94cd 0.4±0.55cd 0.7±0.85cd 1±1.3cd > 16 0 0 0 0 0 0 0 0 0 0 0
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
80 Embryogenic capacity of cultivars within and between the genome differed significantly. Present result is supported by Chen et al. (1987), Szabados et al. (1987), Komatsuda and Ohyama (1989), Feirer and Simon (1991). According to this research groups embryogenic responses can vary among cultivars or even between individuals of a given cultivar. No embryogenic callus was obtained in test cultivars, from floral explants above 16th position. Present finding is also supported by the finding of Brown and Atanassov (1985) who stated that cultivars showing high levels of embryogenesis descended from a few specific ancestral germplasm sources. Present results are also supported by the finding of Escalant and Teisson, (1994) who stated that embryogenic capacity of explants male flower bud depends on position of explants and time of year when experiment is been carried out. Hence, based on the results obtained it can be concluded that ideal calli formation depends mainly on the age and position of the explant.
4.3.2.4.2. Effect of position of explant on nature of embryogenic callus Though callus induction started after 15-30 days from initiation, yet formation of callus with embryogenic structures was noticed only after 4 months. It was also observed that embryogenic callus grows slowly than non-embryogenic callus. Embryogenic callus was often surrounded by a non-embryogenic, friable and semi- translucent callus. The calli with embryogenic structures were characterized by meristematic structures consisting of nodular callus (in general), with and without somatic embryos similar to those described by Dhed'a et al. (1991) and Schoofs (1997). Five types of embryogenic callus were produced from explants obtained from various positions and were in various developmental stages. Irrespective of the test cultivars immature flowers (0-2) failed to produce embryogenic callus whereas, floral hands obtained from 3rd – 5th position produced white compact as well as loosely arranged callus. It was observed that though percentage of embryogenic callus differed between test cultivars and position of explants, yet similarity was observed in nature of embryogenic callus (Table-9). Highest percentage of embryogenic callus was obtained from position 6-8, which was mainly occupied by milky white friable as well as viscous callus. Further increase in explants maturity resulted in change in nature of embryogenic callus from milky white to whitish yellow and friable. Floral explants obtained from position 16 and above failed to show embryogenic response.
81
Table 9: Nature of embryogenic callus obtained from male floral hands on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Floral Nature of callus hands GN RB RS NN NP KP MN KM BG CK PV
0 - 2 ------
3 - 5 WL WL WL WL WC WC WC WC WC WC WC
6 - 8 MWF, MWF, MWF, MWF, MWF, MWF, MWF, MWF, MWF, MWF, MWF, MWV MWV MWV MWV MWV MWV MWV MWV MWV MWV MWV
9 - 11 MWF MWF MWF MWF MWF MWF MWF MWF MWF MWF MWF
12-15 WYF WYF WYF WYF WYF WYF WYF WYF WYF WYF WYF
> 16 ------WC- white compact, WL- white loose, MWF- milky white friable, MWV- milky white viscous, WYF- whitish yellow friable
82 Present results are supported by the findings of KrishnarRaj and Vasil, (1995), who stated that mitotic activity and regeneration ability can be noticed only from meristematic and partially differentiated cells, which are developmentally uncommitted. Negative correlation between age of explants and embryogenic capacity was supported by work carried out by Vasil, (1987) which states that mature and more differentiated tissues, appears to inhibit the expression of embryogenic competence in uncommitted cells. Though the number of somatic embryos formed from embryogenic callus differed, yet ideal calli with many (more than 30) translucent proembryos were achieved mainly from whorls 6th – 11th.
4.3.3. Effect of photoperiod on callus induction 4.3.3.1. Frequency of callus induction Initiated explants were incubated under various photoperiods to study their effect on callus induction. Results obtained were analyzed and tabulated (Table-10). Results show that incubation of explants in 24 hrs photoperiod suppressed the callus induction. Under this culture condition, maximum response of 5.5% was recorded in cv. Robusta followed by 5% in cv. Grand Naine. Similar pattern of response was noticed in all test cultivars and present finding is supported by Sauvaire and Galzy (1980), where presence of light inhibited callus induction from root and shoot tip explants in sugarcane. Callus induction gradually increased in all test cultivars when photoperiod was decreased to 8/16 hrs (light/dark). These results are in accordance with findings of Bhansali and Singh (1982) where normal callus induction was achieved in 12 hrs darkness.
Steep increase in response was recorded when explants were incubated in complete darkness (Table 12). 71.0% of initiated floral hands of cv. Grand Naine had showed positive response towards callus induction. Similar response was noticed from cv. Robusta (69.5%) which belongs to same genome ‘AAA’. Next highest response was noticed in cultivars of genome ‘AAB’. In complete darkness lowest response in callus induction was noticed from the cultivars of ABB genome. Similar response towards lighting condition was noticed from the cultivars of same genome. The present experiment revealed the stimulation of callus induction from floral explants by light regime.
83 Table 10: Effect of photo period on callus induction from immature male flower buds of banana cultivars on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Light Frequency of callus induction (%) duration GN RB RS NN NP KP MN KM BG CK PV 24 hrs 5±0.90d 5.5±0.85d 4±0.95d 2.2±1.3d 2.0±1.0d 2.0±1.5d 1.8±0.60d 1.5±0.85d 1.5±1.5d 1±0.90d 1±1.0d 18 hrs 18±0.65c 17.5±0.75c 16.6±1.0c 11.5±.96c 11±1.4c 10±0.80c 8±0.75c 8.5±0.70c 8.4±0.95c 8.5±0.85c 7.4±0.75c 12 hrs 29±0.75b 28.4±0.5b 27.5±0.70b 24±0.75b 20.6±0.85b 17±0.75b 15.5±0.80b 15.7±1.0b 15.5±1.0b 15.4±1.3b 12±0.80b 6 hrs 49.5±0.75a 48±0.70a 43±0.90a 34.7±1.0a 33±0.95a 31.5±1.0a 28.5±0.80a 29±0.85a 29±9.5a 28.6±1.5a 25±1.0a * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Table 11: Effect of photo period on nature of callus obtained from immature male flower buds of banana cultivars on MS medium supplemented with 4.0 mg/l of 2,4-D, 1.0 mg/l of IAA and 1.0 mg/l of NAA.
Light Nature of callus duration GN RB RS NN NP KP MN KM BG CK PV 24 hrs PYC PYC PYC PYC PYC PYC PYC PYC PYC PYC PYC 18 hrs PYC PYC PYC PYC PYC PYC PYC PYC PYC PYC PYC 12 hrs WC WC WC WC WC WC WC WC WC WC WC 6 hrs MW MW MW MW MW MW MW MW MW MW MW PYC- pale yellow compact, MW- milky white, WC- white compact,
84 Lowest response from explants incubated in 24 hrs photoperiod and highest under complete darkness is in accordance with the earlier studies on banana which indicated that the callus induction required dark incubation (Mohatkar et al., 1993).
4.3.3.2. Nature of callus induction Complete darkness was found superior to various photoperiods tested. Along with the percentage of callus, nature of callus obtained also varied with photperiod. Under 24, 18, 12 and 6 hrs light, the initiated explants of various cultivars produced pale yellow compact, white compact and milky white callus respectively (Table-11). Predominantly single type of callus was obtained from the explants when they were incubated under particular photoperiod, whereas Heterogenous complex- III was obtained when explants were incubated under complete darkness (Table-13). It was also observed that prominent friable callus with many translucent proembryos (ideal callus) was obtained only when explants were incubated in complete darkness.
4.3.4. Trials to overcome lethal blackening 4.3.4.1 Preculture and frequent subculture of explant Physical state of the medium also plays an important role in tissue culture of banana. In most of the labs solid medium is being used. In banana tissue culture, blackening and necrosis of tissues is commonly observed which can be reduced by using absorbants or antioxidants in the medium. To overcome these problem, selective cultivars which show high phenolics in standard procedure for callus induction were selected. Explants of these cultivars were given liquid pretreatment before initiation on solid medium and also subcultured to fresh solid medium with same formulation at different interval of time and the results obtained were analyzed and tabulated (Table-14).
Subculture at the onset of phenolic exudation in same liquid callus induction medium at regular intervals of 24 hrs proved to be successful by circumventing the problem of dieback of somatic cells. The present results are in agreement with the earlier finding where reduction in necrosis or cell death was controlled by more frequent subcultures (Alderson et al., 1987). Five consecutive days of incubation of explants and renewal of liquid medium proved effective in reducing the phenolic secretion.
85 Table 12: Comparison between photo period (6 hrs) and complete darkness on callus induction from male flower buds of banana cultivars on callus induction medium.
Lighting Frequency of callus induction (%) conditions
GN RB RS NN NP KP MN KM BG CK PV 6 hrs 49.5±0.75b 48±0.70b 43±0.90b 34.7±1.0b 33±0.95b 31.5±1.0b 28.5±0.80b 29±0.85b 29±9.5b 28.6±1.5b 25±1.0b Complete darkness 71±0.90a 69.5±0.65a 60.8±0.70a 57±0.95a 50.6±0.90a 52±0.50a 47.5±1.0a 48±1.3a 48.3±1.0a 55±0.50a 54±0.85a * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Table 13: Nature of callus obtained from male floral hands in callus induction medium incubated in 6 hrs light and complete darkness.
Lighting Nature of callus conditions (Light) GN RB RS NN NP KP MN KM BG CK PV 6 hrs MW MW MW MW MW MW MW MW MW MW MW Complete darkness HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII HCIII
MW- milky white, HCIII- Heterogenous complex III(whitish yellow friable, pale yellow compact, yellow friable)
86
Table 14: Effect of preculture (liquid medium) and frequent subculture of explant on reduction of explant blackening
Treatments Mortality (%) due to phenolics GN NN NP KP MN PV Control 26.5±0.14g 33.0±0.15g 40.6±0.29g 42.0±0.45g 45.0±0.28g 39.0±0.30g Preculture 1 day 23.0±0.16e 26.2±0.15f 36.5±0.30f 35.0±0.35d 41.5±0.40f 33.5±0.36d 3 days 20.4±1.5d 24.4±0.70d 32.6±0.25d 31.6±0.30c 38.0±0.38d 29.9±0.35c 5 days 15.0±1.8a 21.0±0.54b 27.3±0.23b 26.5±0.57b 31.3±0.30b 22.0±0.25b 7 days 15.3±0.20b 20.8±0.80a 27.0±0.28a 26.3±0.45a 32.5±0.20a 21.7±0.14a Subculture 1 cycle 20.0±0.19c 23.6±0.24c 32.5±0.30c 37.0±0.35e 36.7±0.25c 35.0±0.20e 2 cycle 25.4±0.20f 26.0±0.20e 33.4±0.24e 39.5±0.30f 40.8±0.40e 37.4±0.38f 4 cycle 32.0±0.35h 35.4±0.19h 45.0±0.40h 55.6±0.60h 50.4±0.50h 56.4±0.40h 5 cycle 40.5±0.40i 42.3±0.45i 56.7±0.50i 69.4±0.65i 61.0±0.58i 65.0±0.70i
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
87 Among the cultivars tested maximum reduction in mortality due to phenolic was recorded in cv. Poovan (17.3%) followed by Karpooravalli (15.7%). Preculture of explant in liquid medium more than 5 days failed to show any appreciable reduction in mortality. Pretreatment in liquid medium was found to be effective not only in controlling the phenolics but also reducing the time delay in response, compared to standard method. It was observed that floral hands which have undergone pretreatment in liquid medium produced friable callus with translucent embryos between hands 3 to 10 after a period of 3-4 months whereas, as it took 4-7 months in standard medium (Table-15). Later, these calli turned into loose granular structure with numerous somatic embryos (15-20 nos.). Similar results were obtained by Chong Perez et al., (2005) where initiation of cell suspension through direct bulked cultivation of immature flowers in liquid medium reduces the total time required for their establishment. Present result is also in accordance with the finding of Bhagyalakshmi et al. (1995) where liquid medium proved best compared to solid medium in multiplication of explants in cv. Bluggoe and Silk.
Table 15 : Effect of preculture of explant on embryogenic response
Position of floral Days taken for Induction procedure hands responded embryogenic response (average) (months) With pretreatment 3-10 3-4 Without retreatment 4-7 4-8 (standard method)
Blackening problem of seven Musa cultivars were overcome by frequent transfer of tissue to fresh medium (Banerjee and de Langhe 1985) was found contradictory to the results obtained in present experiment. Transferring of explants to fresh solid medium at regular interval of time increased the mortality percentage due to phenolics which shows that standard subculture procedure in banana was not effective when flower buds were used as explants in somatic embryogenesis.
4.3.4.2. Use of antioxidants and absorbants Banerjee and de Langhe (1985) reported that tissue blackening can be reduced by the use of ascorbic acid in the medium, whereas Wang and Huang (1976) overcome
88 this problem by the use of activated charcoal in the medium. Martin et al. (2006) controlled tissue necrosis of cvs. Grand Naine (AAA), Dwarf Cavendish (AAA), Nendran (AAB) and Quintal Nendran (AAB) by the addition of 50-100 mg/l calcium chloride in the MS medium. Titov et al. (2006) controlled oxidation of phenolic compounds secreted by flowers, by washing these in 0.125 percent potassium citrate: citrate solution before culturing. Though earlier research shows that various antioxidants can be effectively used to control phenolics but still very little information is available for the use of antioxidants in somatic embryogenesis pathway of banana. In present study except activated charcoal no other component could reduce the mortality rate of the explants in test cultivars (Table 16). Though mortality due to phenolics has been reduced in MS medium supplemented with activated charcoal, it was observed that explants failed to produce embryogenic callus. Hence, results obtained shows that the antioxidants used in present trial had no significant role in controlling tissue blackening.
4.3.5. Effect of carbon source on embryogenic callus induction Effect of carbon source on somatic embryogenesis was dependent on the kind and concentration of sugar in culture protocol. Results show that irrespective of the test cultivars, highest percentage of embryogenic complex was obtained on media containing sucrose as carbon source. Glucose ranks next to sucrose in inducing embryogenic complex in all test cultivars. Percent of embryogenic response obtained on media containing fructose and maltose were less, which may be due to explant blackening. Lower levels of sucrose (1%) reduced blackening but stimulated growth of fast growing non embryogenic friable callus, which turned necrotic within 1-2 months. Rate of explants blackening increased with concentration of sucrose and found maximum at 4% sucrose which affected survival percentage as well as embryogenic callus formation. Among various concentrations tested, 3% sucrose was found effective in the present trial. Explants of cv. Rasthali produced highest percentage of embryogenic complex (29.5%) when initiated in medium containing 3% sucrose. Test cultivars Grand Naine and Robusta shows similar response and produced 25% and 24.4% of embryogenic complex respectively (Table 17). This was followed by other test cultivars which showed embryogenic response ranging from 10.3-18.3% respectively. No significant differences were found in other concentration of sucrose tried.
89 Table 16: Influence of antioxidants and absorbants (L-Ascorbic acid, Activated charcoal and Polyvenyl pyrolidone) on reduction of explant blackening.
Treatments Mortality due to phenolics (%) GN NN NP KP MN PV Control 26.7±0.18m 33.0±0.15k 40.6±0.25lm 42.0±0.30lm 45.0±0.29lm 39.0±0.20m L-Ascorbic acid 0.25% 22.6±0.15gh 33.9±0.16m 40.3±0.20kl 41.8±0.18l 44.5±0.25kl 38.5±0.28kl 1.00% 22.5±0.18fg 32.8±0.20l 40.0±0.50k 41.5±0.45k 44.0±0.5k 37.8±0.30k 2.50% 22.4±0.20ef 30.6±0.30hi 35.5±0.39hi 39.7±0.48ij 40.4±0.55hi 35.7±0.34hi 5.00% 22.3±0.25e 30.5±0.40gh 35.4±0.65h 39.5±0.60i 40.0±0.60h 35.5±0.45gh ACH 0.25% 21.5±0.15d 21.4±0.18cd 24.7±0.20cd 25.0±0.24d 23.3±0.26cd 30.4±0.30cd 0.50% 17.0±0.20c 20.3±0.20c 24.5±0.36bc 24.7±0.40bc 23.0±0.30bc 30.2±0.45ab 1.00% 15.0±0.25b 18.0±0.30ab 24.4±0.40ab 24.5±0.35ab 22.8±0.33ab 30.3±0.50bc 2.50% 11.7±0.10a 20.8±0.15a 24.3±0.19a 24.3±0.30a 22.7±0.25a 30.0±0.60a PVP 0.10% 26.5±0.10kl 31.4±0.30j 36.3±0.29ij 38.4±0.27h 40.5±0.45ij 37.4±0.28ij 0.25% 26.4±0.13k 26.4±0.25g 30.5±0.35g 29.7±0.35g 31.6±0.36g 34.5±0.30g 0.50% 26.0±0.15ij 22.0±0.20f 25.7±0.40f 25.5±0.45ef 23.3±0.30de 31.0±0.40ef 1.00% 25.8±0.20i 21.5±0.25de 25.0±0.36de 25.3±0.25e 23.4±0.30ef 30.6±0.37de ACH - Activated charcoal PVP - Polyvenyl pyrolidone
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
90 Table 17. Effect of carbohydrates on embryogenic complex induction from explants of banana cultivars on MS medium supplemented with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA
Carbohydrate Embryogenic complex (%) (%) GN RB RS NN NP KP MN KM BG CK PV Sucrose 1 9.5±0.09l 9.0±0.60lm 11.2±0.50jk 5.6±0.45kl 1.8±0.50n 1.8±0.37n 1.0±0.50mn 0 0 0 0 2 20.3±0.2de 19.5±0.57e 22.6±0.45bc 14±0.40bc 9.5±0.70c 9.6±0.60cd 8.3±0.25cd 7.9±0.19de 7.7±0.25e 7.9±0.60de 8.0±0.9c 3 25.0±0.25a 24.4±0.45a 29.5±0.28a 18.3±0.18a 13.0±0.35a 13.3±0.30a 11.0±0.30a 10.4±0.50a 10.5±0.90a 10.9±0.50a 11.0±0.30a 4 21.4±0.30c 20.6±0.5c 23.3±0.57b 14.5±0.35b 9.4±0.40cd 9.3±0.24de 8.0±0.35ef 7.3±0.60ef 7.3±0.60ef 7.0±0.65f 7.5±0.18de Fructose 1 6.9±0.10m 7.3±0.18n 5.0±0.50n 3.0±0.37o 0 0 0 0 0 0 0 2 15±0.30g 15.3±0.60g 13.7±0.60f 8.4±0.18gh 4.8±0.50jk 6.0±0.75j 5.4±0.40gh 5.4±0.75gh 5.3±0.18gh 5.2±0.48gh 4.9±0.09gh 3 20.4±0.38d 20.5±0.45cd 17.6±0.70e 12.5±0.40e 8.9±0.46e 10.6±0.80c 8.5±0.49bc 8.9±0.75b 8.7±0.25b 8.6±1.0b 8.8±0.15b 4 11.3±0.25i 10.8±0.26j 12.5±0.45h 7.7±0.50ij 5.3±0.28i 7±0.8gh 3.3±1.0kl 2.9±0.75kl 2.9±0.30l 3.0±0.50kl 2.9±0.30k Glucose 1 13.5±0.19h 12.9±0.20i 11.4±0.24i 7.9±0.56i 6.7±0.57gh 6.9±0.27hi 4.8±0.90ij 4.5±0.26j 4.0±0.36j 4.4±0.56j 4.0±0.46ij 2 22.3±0.25b 21.5±0.5b 20.5±0.55cd 13.5±0.7cd 10.6±0.37b 11.6±0.50b 8.8±0.70b 8.7±0.50bc 8.3±0.40cd 8.5±1.0bc 8.3±0.50c 3 19.0±0.30f 18.6±0.30f 13.4±0.18fg 10.4±0.45f 7.0±0.70fg 7.5±0.40fg 5.7±0.95g 5.5±0.38g 5±0.80hi 5.3±0.85g 5.4±075g 4 10.5±0.3j 9.9±0.26kl 11.3±0.60ij 4.5±0.50m 3.4±1.0l 3.5±0.45l 1.5±0.80m 1.0±0.70m 0.7±0.95m 0.8±1.2m 0.9±0.95m Maltose 1 0 0 0 0 0 0 0 0 0 0 0 2 6.5±0.10mn 6.8±0.34o 6.3±0.10m 5.9±0.40k 5.0±0.75ij 4.7±0.37k 5.0±0.50hi 5.3±0.80ghi 5.6±0.26g 4.9±0.45hi 4.3±0.40i 3 10.7±0.45k 10.0±0.25jk 9.5±0.50l 8.5±0.35g 7.9±0.48f 7.4±0.25f 8.2±0.80de 8.3±0.60cd 8.5±0.30bc 8.0±0.65d 7.0±0.38ef 4 5.0±0.56o 4.7±0.35p 4.0±0.30o 3.5±0.25n 3.0±0.50lm 2.7±0.18m 3.4±0.90k 3.0±0.25k 3.5±0.50jk 3.3±0.80k 2.0±0.40l * Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
91 Though embryogenic responses were on an average lower on the maltose containing medium, the biggest embryogenic complex ever obtained was produced on this medium. When such embryogenic complex was transferred to liquid medium, an embryogenic cell suspension was obtained which consisted nearly 80% of embryogenic cell clusters.
4.3.6. Ideal callus used for suspension Irrespective of the test cultivars, the characteristics of ideal callus obtained from immature male flower buds was similar. Complex bearing tiny somatic embryos, were said to be ideal (Plate-6). Ideal complexes were found to contain many clusters of non organized embryogenic cells and hence suited for initiation ECSs. Complexes with most embryos at the stage of cotyledon outgrowth are more compact since embryos of that size often fuse at their bases. Embryogenic cell clusters only form a minority in such complexes, which by consequence are less suited for the initiation of ECSs. Complexes with some bigger embryos of which the bases are not fused though, were counted as ideal complexes.
4.4. Establishment of embryogenic cell suspension 4.4.1. Effect of various medium on the establishment of embryogenic cell suspension Efficiency of various medium were tested for the establishment of embryogenic cell suspension and found that MS salts and vitamins with 2,4-D, IAA and NAA (4:1:1 mg/l) (MI) or MS medium with 4.0 mg/l 2,4-D (MII), failed for the survival of embryogenic cells. This result illustrated that combination of auxins (MI) or higher concentration of auxin (MII) required for the induction of embryogenic callus is not suitable for the establishment and proliferation of embryogenic cells. Medium MIII, MIV and MV showed various level of success in cultivars under investigation. Among three medium, MIII i.e MS salts with vitamins and reduced level of 2,4-D (1.0 mg/l) was efficient for the survival of embryogenic complex obtained in most of the test cultivars (Plate-7). Embryogenic complexes of test cultivars other than Kallumonthan, Bluggoe and Chakkia survived in MIII medium. Survival of embryogenic complexes in liquid medium was found to be dependent on reduced level of 2,4-D and selection of ideal complex. Result shows that embryogenic complex of three test cultivars failed to
92 PLATE 6 Ideal embryogenic callus obtained from male flower buds on MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA after 6-9 months a - Grand Naine b - Robusta c - Neypoovan d - Rasthali e - Nendran f - Poovan g - Karpooravalli h - Monthan i - Kallumonthan j - Bluggoe k - Chakkia
PLATE 6
a b c
d e f
g h i
j k PLATE 7 Embryogenic cell suspension of commercial cultivars of banana derived from male flower buds in liquid MS medium with 1 mg/l 2,4-D a&b - Grand Naine c&d - Robusta e&f - Rasthali g&h - Nendran i&j - Poovan k&l - Karpooravalli m&n - Monthan o&p - Neypoovan
PLATE 7
a b c d
e f g h
i j k l
m n o p
survive in MIII medium and this may be due to the absence of high percentage of uncommitted embryogenic cells (Table 18).
Table 18. Effect of different media on successful establishment of embryogenic cell suspension from the ideal callus obtained from banana cultivars
Medium Establishment of ECS GN RB RS NN NP KP MN KM BG CK PV
MI MII MIII MIV MV
MI - MS medium with 4.0 mg/l 2,4-D, 1.0 mg/l IAA and 1.0 mg/l NAA M II - MS medium with 2, 4-D (4.0 mg/l) M III - MS medium with 2, 4-D (1.0 mg/l) (Strosse et al., 2003) M IV - MS basal salts and vitamins 0.1 mg/l d-biotin, 100 mg/l glutamine, 100 mg malt, 45 g/l sucrose (Cote et al., 1996) M V - Half strength MS macro micro Fe EDTA, Dhed’a vitamins with 1.0 mg/l 2,4-D and 10 mg L-Ascorbic acid 0.2 mg/l Zeatin and 20g/l sucrose (Dhed’a et al., 1991)
4.4.2. Effect of different concentration of sucrose on embryogenic response Efficiency of MIII medium for the establishment and proliferation of embryogenic complexes was tested with various concentrations of sucrose. Results were calculated in terms of survival and proliferation rate of embryogenic complex in liquid medium. Suspension medium supplemented with 30 g/l of sucrose showed very low response (less than 25%) for the survival of embryogenic complexes in most of the test cultivars except Grand Naine and Robusta, Rasthali and Nendran, where 25-50% of embryogenic complex survived with preglobular embryos. Suspension medium supplemented with 40 g/l sucrose proved beneficiary for most of the test cultivars, where 25-75% of ideal callus survived. Success rate gradually increased with concentration of sucrose till 45 g/l and further increase in concentration reduced the quality of embryogenic cell suspension (Table-19). Increase in settled cell volume in six test cultivars and 50-75% of explants survival in two cultivars was recorded when
93 suspension medium was supplemented with 45 g/l sucrose. It was also noticed that further tuning of culture media is required for the establishment of ECS in cvs. Kallumonthan, Bluggoe and Chakkia which shows high level of phenolics and low level of embryogenic complex in callus induction medium.
Table 19. Effect of different concentration of sucrose on embryogenic response of banana cultivars in MS liquid medium supplemented with 1 mg/l 2,4-D.
Carbohydrate Response of embryogenic cells in liquid medium (g/l) Sucrose GN RB RS NN NP KP MN KM BG CK PV 30 1 1 1 1 0 0 0 0 0 0 0 35 1 1 1 1 1 1 0 0 0 1 1 40 3 3 3 2 2 2 0 0 0 2 2 45 3 3 3 3 3 3 0 0 0 2 2 50 2 2 2 2 2 2 0 0 0 2 2
0 - Less than 25% explant survived 1 - 25-50% of explant with few preglobular embryos 2 - 50-75% of explant survived with meristematic globule 3 - Increase in SCV
Based on the results, it can be concluded that cultivars belonging to genome with high percentage of ‘A’ chromosome have high proliferation rate. Present finding is in line with the earlier finding of Banerjee et al. (1986) and Vuylsteke and De Langhe (1985), who reported that in vitro response of Musa is genome dependent. They stated that as the percentage of ‘B’ chromosomes in the genome decreases, the in vitro apical dominance becomes higher. Therefore, the state of the culture prior to culture on medium seems to depend on the genomic constitution. Results obtained also revealed that differential response of cultivars to produce cells, was attributed to genotypic differences related to variations in endogenous hormone levels as reported by (Norstog, 1970). The fewer cells produced by some cultivars in liquid medium was possibly due to the phenolic compounds released by the cells into the induction medium and which is known to inhibit cell division (Kenneth and Torres, 1989).
94 4.4.3. Factors affecting nature of cell suspension 4.4.3.1. Cell density in embryogenic cell suspensions Based on the results obtained in previous experiments, embryogenic cell suspension of test cultivars cvs. Rasthali and Nendran were established from ideal callus containing numerous translucent proembryos. Characteristics of cell suspensions were studied in terms of cell aggregates count. Table-20 showed number of embryogenic aggregates present in 1.0 ml of suspension after 45 days from initiation. Clone I, II, III specifies the replicates from each test cultivar. Results produced that embryogenic cell suspension derived from same embryogenic complex produced various number of cell aggregates. Present result is supported by the finding of Schoofs et al. (1999), who reported that not all embryogenic complexes gave good suspension and same success rate.
Table 20. Cell density in embryogenic cell suspension of cvs. Rasthali and Nendran in MS medium with 1 mg/l 2,4-D.
Number of cell aggregates/ml of cell suspension Suspensions Rasthali Nendran
4c 4a Clone I 3.4 x 10 2.6 x 10 4b 4b Clone II 3.7 x 10 2.5 x 10 4a 4c Clone III 3.9 x 10 2.4 x 10
Changes in composition of embryogenic cell suspension were observed under microscope. After 15-20 days of culture, embryogenic structures started to release cells in the liquid medium, forming heterogenous suspension. It consists of a great number of actively dividing spherical and irregular cell masses as observed by William and Maheswaran (1986) in Musa cell suspension. During the first few weeks of subculture, the amount of isolated parenchymal cells decreased to almost zero value. After 60-90 days of culture, homogeneous cell suspensions was obtained, which was characterized by isolated embryogenic cells as cell aggregates, consisting of small, spherical or ovoid embryogenic cells with a dense cytoplasm and a thick wall and a large nucleus in relation to the cell size (Plate 8). They also contain small starch grains, lipid droplets and numerous small vacuoles, gathered around the nucleus and have thin cell walls.
95 PLATE 8 Change in composition of embryogenic cell suspension of test cultivars Rasthali and Nendran in liquid MS medium with 1 mg/l 2,4-D (bar 0.1 mm)
(I) Rasthali (II) Nendran a - Two months old ECS b - Four months old ECS c - Six months old ECS d&e - Microscopic view of heterogenous cell suspension f - Microscopic view of homogenous cell suspension
PLATE 8
I
a b c
d e f
II
a b c
d e f These embryogenic cell aggregates were found to occupy between 70 and 90% of the cell suspension and their size varied between 80 and 300 μm.
Next to embryogenic cells, most often the cell suspension was occupied by non embryogenic cells. The non-embryogenic cells were larger than the others, had diverse shapes, predominantly elongated with little cytoplasmic contents, thin cellular walls, a large vacuole and a small nucleus (present or absent) (Plate 9 II). Characteristics of embryogenic cell suspension agreed with earlier reports (Grapin et al., 2000; Jalil et al., 2003; Quiroz et al., 2006; Dhed’a et al. 1991; Vasil 1987, Michaux-Ferriere and Schwendiman, 1992). In the present experiment, it was also found that procedure of starting ECS with few embryogenic pockets (ideal calli), subculturing of ECS exactly after every 24 hrs for the first fifteen days and gradual scaling up of medium from 4 ml to 15 ml in 60 days is beneficial for better uniformity of cell composition. The present result is supported by the finding of Panis (1995), who observed that Musa ECSs becomes turbid and mucilaginous when not regularly subcultured. The results are also in line with the report which emphasized the selection of base material and volume of initiation medium used for the good establishment of embryogenic cell suspension (Maribel et al., 2008).
4.4.3.2. Constituents of embryogenic cell suspension Microscopic observation of embryogenic cell suspension revealed following components.
4.4.3.2.1. Meristematic globules Irrespective of test cultivars, embryogenic complex transferred to liquid medium showed the presence of meristematic globules which were devoid of embryogenic cells. These globules as such had direct use in the embryogenic cell cultures. With time these cells released only starch rich cells, were later converted into elongated and highly vacuolated cells. It was also observed that meristematic globules that have not converted into heterogenous globules at the time of transfer to liquid medium, do not convert later on.
96 PLATE 9 Components of cell suspension culture obtained from male flower buds in commercial cultivars of banana in liquid MS medium with 1 mg/l 2,4-D (bar 0.1 mm)
(I) Non embryogenic cells a - Oval b&c - Elongated d - Spiral e - Sickle shaped f&g - Starch grain rich h - Vacuolated I&j - Cells with degenerating nucleus
(II) Embryogenic cells Embryogenic cells with distinct cell wall, compact protoplast and well developed nucleus
PLATE 9
I
a b c
d e f
g h i j
II
a b c
d e f
4.4.3.2.2. Heterogenous globules Heterogenous globules release embryogenic cells in liquid medium. These globules do not easily form embryos. Thus, heterogenous globules were not discarded initially, until after a culture period of 3-6 months, when they get depleted and revert into meristematic globules.
4.4.3.2.3. Somatic embryos Third component of ECS are preglobular embryos which disintegrated in liquid cultures to produce clumps which showed embryogenic characteristics. Similarly, more advanced somatic embryos also produced embryogenic cells through budding near the root pole. This phenomenon was regularly encountered in male flower derived Musa ECS by Escalant and Teisson, (1993). It was also observed that cell suspension initiated with minimal density of embryogenic cells produced embryos which usually abort after having reached the globular stage. Aborting embryos, with phenolic compounds sequestered in their peripheral cells caused blackening, starting liberating isolated non- regenerable cells. Based on this observation late globular embryos were removed from the cultures by discarding the fraction between 500 and 1000 µm.
4.4.3.2.4. Embryogenic cell aggregates Once depleted, heterogenous globules and somatic embryos were discarded, embryogenic cell suspensions consist merely of embryogenic cell clumps of variable size. Further growth of embryogenic cell suspension (increase in SCV) proceeds through the enlargement and fractionation of embryogenic cell aggregates. Whatever the aggregate size at the time of starting, after a cycle of 30 days, the suspension consists of a mixture of aggregates of variables size with a maximum distribution between 250 to 500 µm. A minimal inoculum density of embryogenic cells was required to maintain the embryogenic potential of ECSs.
4.4.3.2.5. Isolated cells Two types of isolated cells were noticed in the embryogenic cell suspension of test cultivars. Oval, starch rich cells and elongated, highly vacuolated cells. Both types of cells are with poor cytoplasm, and rarely found to divide in suspension medium. These cells find their origin mainly from the outer starch rich cells of meristematic globules. ECS of cv. Rasthali showed third type of isolated cells which measure
97 8-30 µm in diameter. These cells were round to elongated and had a relatively thick cell wall, often surrounded by a mucus layer. A first division in dense cells was most often transversal, whereby filaments of cells were formed. Mitiotic activity then continues in localized patches whereby cell clusters are formed (Plate 10 I).
Plate 10 II is showing a meristematic globule with many embryogenic cell clusters. Observation also revealed that cells at the periphery of the meristematic globules of cv. Nendran were generally starch rich and loosely attached. These cells were elongated, are more vacuolated and contain bigger starch grains. Such a differentiation in starch rich cells layers was not observed in cv. Rasthali.
In liquid cultures, meristematic globules change from yellow to yellowish at that time first embryogenic cell groups appear in the medium. Simultaneously, the surface of the globules becomes irregular. Outer cells in the starch rich cell layer of meristematic globules divide to produce embryogenic cells with tiny starch granules. Activation of superficial starch rich cells and their subsequent cell divisions were already reported in Musa by Megia et al. (1993). These starch rich cells revealed a central nucleus with a prominent nucleolus and storage proteins in their vacuoles. Present results are supported by the findings of Timmers (1993) who demonstrated that vacuolation of cells and starch accumulation in cells near the root pole starts much earlier in somatic embryos than in zygotic embryos. Many abnormalities were however observed during cell divisions. Cell plates that form between daughter cells, were often incomplete and their positioning unusual. In some cases, abnormally small daughter cells are thereby generated. Most of the starch rich cells that undergo internal segmentation degenerate precociously notable by plasmolysis and increased vacuolation.
4.4.3.4. Effect of cell density in the multiplication of embryogenic cell suspensions Results obtained in present experiment showed that culture density of cell suspensions have an impact on cell proliferation and maintenance of embryogenic characteristics. Change in colour and cell volume of cell suspension was found dependent on initial culture density and subculture period. Starch accumulation and vacuolation was recorded in older cells. To avoid this, growth rate of embryogenic cell suspension was characterized from the beginning till resting phase of latency. Cells
98 PLATE 10 Various stages of cell division and varietal difference in cell proliferation in ECS of bananas cultivars in liquid MS medium with 1 mg/l 2,4-D
(I) Stages of cell divisions in embryogenic cell suspension of bananas (bar 0.1 mm) a - Individual cells released from embryogenic complex b - f - Different stages of cell division g - l - Two celled to 8 celled stages m - o - Transverse division in elongated cells
(II) Change in morphology of embryogenic cells of test cultivars (bar 0.5 mm) a, b & c - Rasthali d, e & f - Nendran
PLATE 10
a b c
d e f
I
g h i
j k l
m n o
a b c II
d e f adapt to the new culture conditions to further initiate and increase the speed of cell division during the exponential phase. Nayak and Sen (1989) reported that subculture interval and incubation temperature, influence the relative frequency of embryogenic cells, compared to non-embrogenic and partially embryogenic cells.
The cell density of 3.0% SCV favored cell growth compared to growth curves of 2.0, 5.0 and 10% SCV in both test cvs. Rasthali and Nendran (Table-21). Results obtained showed that active proliferation of embryogenic cell suspension of test cvs. Rasthali and Nendran resulted in highest SCV value of 7.4 ml and 8.5 ml respectively. Graph plotted clearly illustrated that embryogenic cell suspension of both test cultivars reached exponential phase between 18-24 days. Well defined exponential growth phase without deterioration in the quality of ECS was noticed before this culture period (18-24 days). After this exponential phase, major constituent of cell suspension were elongated cells with few starch granules, which could be due to the depletion of nutrients and growth regulators in the culture medium, mainly 2, 4-D (Niubó et al., 2000).
When suspension was initiated with 5.0% SCV, cells doubled their initial cell volume after 24 days of culture in cv. Rasthali, however it took only 15-18 days for the ECS of cv. Nendran. Schoofs et al. (1999) established embryogenic cell suspension derived from proliferating meristem in cv. Williams (AAA) and found that 3.0 and 5.0% SCV were best compared to 10% SCV which revealed active multiplication of embryogenic cells in suspension. Similar results were obtained in the suspension established from male flower buds in cv. FHIA-18 (Ravine, 2001). Trang and Thanh (2004) observed a sigmoidal growth curve in the cell suspensions of cv. 'Cau man' which is characterized by a period of slow growth until the seventh day and then a period of rapid growth from 7-21 days.
Suspension initiated with 10.0% SCV failed to double interms of cell volume. Moreover, quality of the cell suspension declined sharply, which could be due to the selection of non suitable initial cell density. Poor growth of the cellular aggregates in suspension may be due to shortage or excess of primary metabolic precursors incorporated into culture medium.
99 Table 21. Change in settled cell volume (SCV) in suspension medium containing with 1 mg/l 2,4-D, with respect to time
Rasthali
SCV Change in SCV(ml) with days (%) 0 3 6 9 12 15 18 21 24 27 2 0 0.1±0.02b 0.2±0.04c 0.3±0.04c 0.5±0.03c 0.9±1.0c 1.5±0.07c 2.2±0.04c 3.0±0.13c 3.5±0.12c 3 0 0.2±0.04a 0.5±0.05a 1.0±0.02a 1.8±0.06a 3.0±0.07a 4.4±0.06a 6.0±0.12a 7.0±0.13a 7.4±0.15a 5 0 0.1±0.03b 0.3±0.04b 0.5±0.03b 1.0±0.04b 1.6±0.05b 2.5±0.09b 3.7±0.12b 4.7±0.14b 5.4±0.13b 10 0 0 0.1±0.02d 0.2±0.01d 0.4±0.05d 0.7±0.04d 1.3±0.05d 2.0±0.10d 2.6±0.12d 3.0±0.13d
Nendran
SCV Change in SCV (ml) with days (%) 0 3 6 9 12 15 18 21 24 27 2 0 0 0.2±0.07b 0.5±0.01c 1.2±0.08c 1.9±0.06c 3.0±0.12c 3.9±0.14c 4.4±0.19d 4.5±0.15c 3 0 0.2±0.03a 0.9±0.06d 1.7±0.07a 2.9±0.09a 4.7±0.07a 7.1±0.15a 7.8±0.13a 8.4±0.16a 8.5±0.24a 5 0 0.1±0.01b 0.7±0.01c 1.2±0.01b 2.3±0.06b 3.8±0.13b 5.5±0.10b 6.1±0.13b 6.2±0.14b 6.5±0.30b 10 0 0 0.1±0.01a 0.3±0.01d 0.8±0.01d 1.5±0.09d 2.6±0.09d 3.5±0.09d 3.9±0.17c 3.8±0.28d
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
100 Because of this, minimum and effective cell density is required for proliferation and maintenance of embryogenic cells. Present finding is also supported by the report of (Vasil and Vasil, (1982) which states that beyond the exponentional phase the rate of cell division decreases which is due to accumulate cellular metabolism wastes, pH changes of the medium. At this stage the cells have reach their maximum allowable density cultures. The present results show that initiating cell suspension with 3% SCV, subculturing at a phase when the cells are biologically active and reach their maximum division rate, was necessary for the continuous multiplication of ECS without linear phase.
4.4.3.5. Assessment of viability of cell suspension Prior to regeneration embryogenic cells were subjected to viability test using fluorescence dye namely fluorescein diacetate (FDA). Observation of embryogenic cell suspension under UV light showed that viable cells produced fluorescence bright green colour (Plate 11 I). Non embryogenic cells failed to produce fluorescence bright green colour. It was observed that both individual as well as embryogenic clumps stained and produced green colour whereas dead cells and vacuolated cells failed to show positive result in viability test.
4.5. Regeneration of somatic embryos from cell suspension 4.5.1. Influence of various growth regulators on somatic embryo formation Embryo development was achieved in medium supplemented with various growth regulators. The results obtained are given in Table-22. Lowest response in embryo induction was recorded in control (50 and 33 embryos in cvs. Rasthali and Nendran respectively). Embryogenic cells of test cultivars when exposed to picloram produced maximum number of somatic embryos compared to other hormones tested. Among various concentrations tested 1.0 mg/l picloram proved efficient and produced 8277 and 5577 somatic embryos from cvs. Rasthali and Nendran respectively (Plate11 II). Further increase in concentration failed to increase the somatic embryo count. Followed by picloram, TDZ ranks second in the present trial. Least number of somatic embryos was obtained cultured in medium supplemented with BAP and Zeatin.
101 PLATE 11 Regeneration of somatic embryos from viable embryogenic cells of banana cultivars in SH medium
(I) Viability test of ECS using FDA (bar 0.1 mm) a-e - Embryogenic complex f - Individual embryogenic cell
(II) & (III) Somatic embryos produced after 45 days from ECS of cvs. Rasthali and Nendran (bar 1 mm) a - Control b - Zeatin 0.05 mg/l c - BAP 0.05 mg/l d - TDZ 0.1 mg/l e - Picloram 0.5 mg/l f - Picloram 1.0 mg/l
PLATE 11
a b c I
d e f
a b c II
d e f
a b c III
d e f Table 22. Influence of various growth regulators (Zeatin, BAP, TDZ and Picloram) on induction of somatic embryos from ECS derived cultivars Rasthali and Nendran in SH medium.
Growth regulators No. of embryos (mg/l) Rasthali Nendran Control 50±0.95q 33±0.35p Zeatin 0.025 356±5.2o 195±1.9no 0.050 681±11.5k 286±4.5kl 0.10 507±12.5n 210±1.8m 0.20 230±4.3p 89±1.0o BAP 0.025 580±10.3l 320±2.8jk 0.050 1870±19.7h 501±6.0i 0.10 881±15.6j 360±4.8j 0.20 550±11.0lm 196±2.7mn TDZ 0.025 1270±13.5i 1156±12.0h 0.050 2303±22.5g 1850±19.6g 0.10 3070±33.0e 2935±31.2d 0.20 2200±22.4f 1950±20.3f Picloram 0.25 6170±55.5c 3256±32.6c 0.50 7055±61.3b 4150±53.9b 1.0 8277±82.7a 5570±50.1a 2.0 4930±95.1d 2457±34.4e
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Earlier reports showed that embryo formation in many plants species required a high cytokinin supplemented medium, e.g. Coffea canephora (Hatanaka et al., 1991), Coronilla varia (Moyer and Gustine 1984), Medicago truncatula (Nolan et al. 1989), Thevetia peruviana (Kumar, 1992) and Eleusina caracana (Eapen, 1998). Similarly, cytokinin was proved essential for embryo formation from banana ECS (Novak et al.,
102 1989; Dheda et al., 1991; Ma 1991; Cote et al., 1996; Grapin et al., 1996). Whereas, in the present trial maximum number of somatic embryos was obtained from a medium supplemented with auxin like picloram. Present results are supported by the findings of the other researchers who found that embryo formation from proembryogenic masses (PEMs) can be achieved either transferred to media with lower auxin concentrations (Ho and Vasil 1983, Vasil and Vasil 1982), or to media with less active auxins (Ma et al., 1987, Ozias-Akins and Vasil, 1982). These results indicated that the presence of growth regulators plays a key role in somatic embryos formation.
4.5.2. Selection of best regeneration medium First somatic embryo from ECS of both test cultivars was visible to naked eye between 12 to 20 days from plating. Among various media tested, RIII proved best and induced maximum number of somatic embryos in both test cultivars (Table- 23 and Plate 12).
Table 23. Selection of optimum regeneration medium for ECS derived from immature male flower buds banana cultivars Rasthali and Nendran
Treatments No. of somatic embryo Rasthali Nendran Control 110±1.20f 65± 1.70f RI 76,856±550.5b 49,070±390.4b RII 10,162±200.0e 7,350±158.0e RIII 1,50,350±725.5a 92,580±735.6a RIV 15,087±225.0d 10,025±245.3d RV 50,705±437.6c 35,610±350.5c
Control - SH medium without growth regulators RI - SH medium with 0.2 mg/l NAA, 0.05 mg/l Zeatin, 0.2 mg/l 2ip, 0.1 mg/l Kinetin, 100 mg/l Glutamine (Standard) RII - Standard medium with Picloram (0.25 mg/l) RIII - Standard medium with Picloram (0.50 mg/l) RIV - Standard medium with Picloram (0.75 mg/l) RV - Standard medium with Picloram (1.0 mg/l
103 PLATE 12 Regeneration of somatic embryos from embryogenic cells of banana cultivars in modified SH medium with 0.50 mg/l picloram (bar 1 mm)
Somatic embryos formation at different time interval (I) Rasthali (II) Nendran a - 10 days b - 12 days c - 15 days d - 20 days e - 30 days f - 45 days
PLATE 12
I
c a b
d e f
II
a b c
d e f RIII medium (standard regeneration medium supplemented with 0.50 mg/l picloram) induced 1,50,350 and 92,580 somatic embryos from cvs. Rasthali and Nendran respectively. SH medium devoid of growth regulators (control) induced least number of somatic embryos (110 in Rasthali and 65 in Nendran). Results showed that picloram was found more efficient in transforming the embryogenic cell into somatic embryos when it was supplemented in combination with other growth regulators present in the standard regeneration medium. Present results are supported by the earlier findings which state that picloram, an important synthetic auxin plays an important role in somatic embryogenesis (Groll et al., 2001) when used alone or in combination with other hormones. Earlier reports shows that numbers of 20-30x103 somatic embryos in suspensions of diploid and triploid cultivars (Novak et al., 1989) and 370x103 numbers per ml of plated packed cell volume of 10% in Grand Naine (AAA) were obtained (Cote et al., 1996). Similarly, Domergue et al. (2000) obtained an estimated number of 1,54,000 somatic embryos from 1 ml of PCV for ‘Grand Naine’ and Strosse et al. (2006) reported 48,000 and 20,000 regenerated plants per 1 ml of PCV, using cultivars from the subgroup Cavendish and plantains, respectively. Above results were obtained from medium containing cytokinins as a main source for embryo induction. Present results obtained emphasized that the combination of synthetic auxin like picloram with cytokinins can enhance the efficacy of embryo induction. Present result is contradictory to the earlier findings which indicated that picloram decreased the embryogenicity and regenerability compared to 2,4-D (Kulkarni, 2002).
4.5.3. Effect of substrate on regeneration efficiency After 45 days of culture, embryogenic cell suspension of test cultivars produced 50.5% (Rasthali) and 45.6% (Nendran) globular embryos when plated directly on regeneration medium (control) (Table-24). Compared to control, improved response in embryo induction was observed from medium covered with filter paper and nylon mesh. Although a little cell browning on the nylon mesh covered system was observed, it did not hinder the cells from producing embryos. ECS plated on nylon mesh covered medium increased the yield by 15.5% and 7.9% in cvs. Rasthali and Nendran respectively. Among three treatments, regeneration of somatic embryos on medium covered with filter paper was found significant over control and mesh covered system. In cv. Rasthali embryo yield on filter paper covered medium was increased by 30.3% and 15.8% compared to control and mesh covered medium respectively.
104 Table 24. Effect of substrate on somatic embryo formation from ECS of cvs. Rasthali and Nendran in modified regeneration medium (RIII)
Globular embryo formation (%) Substrate Rasthali Nendran No substrate 50.5±1.75c 45.6±1.71c Nylon mesh 65.0±0.98b 53.5±1.00b Filter paper 80.8±1.36a 71.3±1.4a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Whereas, this response was 25.7% and 8% in cv. Nendran. Besides both, mesh and filter paper system made the transfer of cells and embryos easier, not being necessary to pick them up one by one with forceps. Present result is in line with the finding of Kazumitsu Matsumoto et al. (2006) where filter paper system produced more (79.3%) somatic embryos in globular stage compared to regeneration medium without filter paper (57.6%). Hence, regeneration medium covered with Whatman No. 1 filter paper was beneficial for efficient regeneration of somatic embryos.
4.5.4. Effect of cell density on regeneration capacity Identification of somatic embryos where the attainment of globular appearance is regarded as one of the first key factors in somatic embryos development even though the SE processes had started earlier before its actual visibility by microscopic observation. Results obtained in the present trial emphasize the importance of initial cell density required for maximum regeneration percentage. When initial inoculum density used was 10%, 60,250 and 29,355 somatic embryos in globular stage were obtained from cv. Rasthali and Nendran respectively. Globular embryo count increased with increase in percentage of cell density used for regeneration and found maximum 15% in cv. Rasthali and 20% in Nendran respectively (Table-25). 1 ml of cell suspension from 15% SCV produced 98,655 somatic embryos (globular stage) in cv. Rasthali, whereas a total of 47,100 somatic embryos were obtained when 1 ml of ECS at 20% SCV in cv. Nendran.
105 Table 25 Effect of cell density on somatic embryo formation from ECS of cvs. Rasthali and Nendran in modified regeneration medium (RIII).
Cell density Globular embryo formation after 45 days Rasthali Nendran 10% 60,250±430.5d 29,355±350.0d 15% 98,655±595.6a 40,257±416.5b 20% 96,200±590.3b 47,100±504.3a 25% 65,866±608.8c 30,675±505.8c
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Similar results were obtained by Barranco, (2000) in the cultivar 'Gran Enano' (AAA) where 15% PCV, obtained 2,561.5 ± 95.3 somatic embryos in liquid medium whereas, Daniel et al., (2002) observed 20% cell density produced greatest number of somatic embryos with statistical difference when compared to 10 and 25% in FHIA-21 (AAAB). Strosse et al., (2006) found drastic variation in embryo induction capacity of ECS obtained in Cavendish (1.5x105 to 1.8x105) and plantain (3.6x104 to 4.7x105). Variation in regeneration capacity of ECS may be due to competition of cell aggregates for nutrients. Similar finding was made by Schoofs, (1997) where variation in regeneration capacity of embryogenic cells was found to depend on nutrients and space availability.
Initial inoculum densities above and below the optimum level in ECS of cv. Rasthali (15%) and cv. Nendran (20%) produced minimum number of globular embryo. Present result is in line with the finding of Gomez et al., (2000), who observed greater accumulation of reserve substance and lower multiplication when low densities of cell suspension was used in hybrid cultivar FHIA-18 (Musa sp. AAAB). Later same author (Gomez et al., 2002) obtained around 1883-1906 globular embryos from one ml of ECS of FHIA-18 after 30 days of culture. Earlier reports stated that embryo induction capacity of embryogenic cell suspension varied with initial inoculum density, age of suspension and cultivar under investigation. Novak et al., (1989) obtained 2 x 104– 4 x 104 somatic embryos per ml PCV of ECS derived from corm slices in cv. Grand Naine. Later Grapin et al. (1996) reported that upto 300 somatic embryos can be
106 obtained from a single cell aggregate of approximately 500 µm in diameter. They also reported that somatic embryos can also be formed directly from heterogenous globules or preformed somatic embryos present in young suspension cultures. In the same year Cote and his co workers obtained 3, 70,000 ± 65, 000 somatic embryos from cell density adjusted to 10.0 PCV, after 80 days of culture in semisolid medium. From above finding it can be concluded that role of cell density plays a major role in embryo induction. Though in present study globular stage embryos were taken as parameter to evaluate the regeneration capacity of embryogenic cell suspension yet were not suitable for germination and therefore need to be placed in a specific culture medium to promote the maturation of the same and the correct accumulation of reserve substances. Proper absorption of nutrients by somatic embryos to complete its structural and functional development can enhance the germination frequency as reported by Fuji et al. (1990).
4.6. Embryo maturation studies 4.6.1. Selection of best medium for embryo maturation Maximum germination (24.3% in Rasthali and 15.0% in Nendran) was achieved when somatic embryos maintained in culture medium containing 0.22 mg/l zeatin which was significantly high from the rest of the treatments (Table-26 and Plate 13). In bananas, zeatin has been frequently used in culture medium used for germination process (Novak et al., 1989; Strosse, et al., 2003). Dhed'a et al. (1991), reported the germination percentage raised from 10-11% when zeatin was used at a concentration of 0.22 mg/l-1 (MIV). Result obtained in present experiment is in line with the earlier findings which says that cytokinins in the culture medium play an important role in the maturation of somatic embryos (Rashid, 1988, De Wald, 1989; Onay et al., 2000; Sarasan et al., 2001, Lee et al., 2002).
Germination percentage obtained in MIV medium 18.0% followed by 10.6% in MIII culture medium containing 2.5 µM ABA (Nasser et al., 2009). ABA has been reported to induce expression of genes responsible for maturation as well as synchronization of maturation of embryos in wheat (Morris et al., 1990). Similarly, Bornman, (1993) reported the importance of ABA in suppressing abnormal embryo development, inhibiting precocious germination, conferring desiccation tolerance and promoting accumulation of storage lipid and proteins which enhances the germination
107 PLATE 13 Germination of somatic embryos incubated on various maturation medium for 30 days
Various medium used for embryo maturation a – Dhed'a et al., 1991a b – Gomez et al., 2000 c – Nasser et al., 2009 d – Dhed'a et al., 1991b PLATE 13
a a
b b
c c
d d capacity. Schuller et al. (2000), found increase in somatic embryos count and maturation percentage when 6-BAP was supplemented in combination with ABA in the culture medium in the species 'Abies alba'.
Table 26. Selection of maturation medium for the somatic embryos of two cvs. Rasthali and Nendran
Germinating capacity (%) Treatment (No. of days) Rasthali Nendran
Control 10.0±1.20e 6.5±0.09de
MI 13.5±1.29d 7.0±2.24d
MII 16.9±1.15bc 8.7±2.05c
MIII 18.0±0.95b 10.6±1.83b
MIV 24.3±1.30a 15.0±1.40a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Maturation medium (MI): Culture medium RD2 (Dhed'a et al., 1991). Maturation medium (MII): Maturation culture medium (Gomez et al., 2000). Maturation medium (MIII): Modified culture medium with 2.5µM ABA (Nasser et al., 2009) Maturation medium (MIV): Culture medium supplemented with zeatin (0.22 mg/l-1) Dhed'a et al. (1991).
Among the five media tried MIV ranks first followed by MIII, MII, MI and control. Somatic embryos maintained in control showed least germination response (10.0% and 6.5.0%). The results achieved in this research made it possible to improve the maturation of somatic embryos, with the use of semi solid culture medium supplemented with 0.22 mg/l zeatin.
4.6.2. Effect of incubation period on embryo maturation Interaction between incubation times of somatic embryos in the culture medium was assessed in terms of germination capacity. It was observed that somatic embryos incubated in culture medium (MIV) for a period of 30 days led 28.0% and 18.6%
108 germination in test cultivars Rasthali and Nendran respectively (Table-27). It was also observed that embryos incubated for a period beyond 30 days decreased the germination capacity in both cultivars. Present result is in line with the findings of Daniels, (2002) who reported that the germination capacity of somatic embryos in cv. FHIA-21 is highly influenced by the time spent in the maturation medium. He also found that somatic embryos formed 15% of cell density after 20 and 30 days spent in the maturation culture medium achieved a germination of 81.5 and 82.5% respectively. Similar kind of result was obtained by Barranco (2001) who obtained rapid maturation of somatic embryos in cv. FHIA-18 (AAAB) between 15 to 22 days of culture. Whereas, Santos et al. (2002) could achieve only 20.7% germination in cv. 'Navolean'.
Table 27. Influence of maturation period on germination capacity of somatic embryos of two banana cultivars Rasthali and Nendran in modified regeneration medium (RIII)
Treatment (No. of days) Germinating capacity (%) Rasthali Nendran 15 21.7±0.18c 13.5±0.14b 30 28.0±0.08a 18.6±0.15a 45 24.4±0.09b 11.0±0.20c 60 19.5±0.22d 8.8±0.19d
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Onay et al. (2000), while studying the maturation of somatic embryos in the pistachio tree determined that the best time to obtain mature embryos was at 40 days. The present result emphasizes the importance of incubation period in culture medium for maturation of somatic embryos and increase in germination percentage. Result also shows that 30 days incubation of somatic embryos in culture medium produced maximum germination percentage (28.0% and 18.6) in two test cultivars respectively.
4.7. Effect of modified regeneration medium on germination efficacy Normally, germination starts after 12-15 days of transfer of embryos to germination medium. In the present experiment also, irrespective of the age (30, 60, 90
109 and 120 days), embryos started regenerating after 15 days. Results indicated that embryos regenerated on modified regeneration medium (RIII) exhibited higher germination efficiency across the maturity status of embryos. Interestingly, no significant difference was observed in germination efficiency of 60 days old embryos regenerated on RIII medium (25.6% in Rasthali and 14.6% in Nendran) to that of 90 days old embryos regenerated on both standard (RI) (27.0% in Rasthali and 16.5% in Nendran) and RIII (28.5% in Rasthali and 16.8% in Nendran) medium respectively (Table-28). This result offers a time gain of 30 days, otherwise a long process from embryo formation to germination. Another important advantage is that the germination efficiency of embryos regenerated on RIII medium remained unchanged from 60 to 90 days of embryo maturity. This offers scope for prolonged availability of explants (embryos) for various experiments over a period of 30 days. The overall germination efficiency of embryos exhibited a normal curve with a maximum between 60 to 90 days of embryo maturity beyond which it declined irrespective of regeneration media tried (RI and RIII). Result showed that 120 days old embryos regenerated on RIII medium exhibit a germination percentage of 22.5% in Rasthali and 11.0% in Nendran which is significantly different from the result obtained from embryos regenerated in RI medium (13.7% and 3.6% in cvs. Rasthali and Nendran respectively).
Table 28. Influence of age of somatic embryos and regeneration medium on germination efficiency in two commercial cultivars of banana Rasthali and Nendran.
Treatment Embryos regenerated on RI Embryos regenerated on RIII (No. of days) Rasthali Nendran Rasthali Nendran 30 11.0±0.19c 8.0±0.16bc 13.5±0.20d 9.3±0.23d 60 17.4±0.20b 9.0±0.15b 25.6±0.17ab 14.6±0.24ab 90 27.0±0.15a 16.5±0.14a 28.5±0.29a 16.8±0.20a 120 13.7±0.22d 3.6±0.20d 22.5±0.19c 11.0±0.23c
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Present study reiterates that hormonal combination in the regeneration medium and age of somatic embryos play an important role in determining the regeneration and
110 germination efficiency. There are similar reports suggesting cell density and embryo size as factor determining the germination percentage (Cote et al., 1996). In this study, regeneration medium supplemented with picloram proved effective not only in increasing the embryo yield but also in increasing the germination parentage compared to standard medium proposed by Strosse et al., 2003). Hence, somatic embryos regenerated on RIII medium can be directly transferred to germination medium without transferring to maturation medium.
4.8. Influence of age of suspension on regeneration and germination capacity Loss of morphogenic potential in embryogenic calli and embryogenic cell suspensions (ECSs) with increasing culture time is often reported. Regeneration and germination capacity of embryogenic cell suspension was tested at different intervals of time and found that embryo count and plantlet production differed significantly among the time intervals under investigation. Lowest count for somatic embryos (12,100 in Rasthali and 7,350 in Nendran) was obtained when three month old suspension was used for regeneration (Table-29).
Table 29. Effect of age of ECS on regeneration capacity of banana cultivars Rasthali and Nendran in modified regeneration medium (RIII).
Age of ECS No. of somatic embryo (months) Rasthali Nendran 3 121,00±150e 7,350±75.8e 6 1,49,500±455.5ab 91,405±238.5ab 12 1,54,350±475.6a 94,100±270.0a 24 1,10,060±350.4bc 74,970±250.3bc 48 40,040±280.6d 16,750±190.0d 60 9,500±178.0f 2,900±50.5f
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Steep increase in embryos count was observed when six month old ECS were tested for their regeneration capacity. Rasthali ECS produced 1,49,500 somatic embryos from one ml SCV whereas, only 91,405 embryos were obtained when same
111 volume suspension from cv. Nendran was plated. Though, 12 month old ECS produced maximum somatic embryos in both test cultivars (1,54,350 in Rasthali and 94,100 in Nendran) yet no significant difference was noticed in response between the regeneration capacity of 6, 12 and 24 (1,10,060 in Rasthali and 74,970 in Nendran) months old ECS. Further increase in age of the ECS affected the regeneration capacity in both cultivars and lowest embryo count was recorded from 60 months old ECS (10,500 in Rasthali and 2,900 in Nendran).
Suspension observed under microscope revealed change in morphology and cell components within same cultivar. Varied level of starch grains were observed in embryogenic complex obtained from suspension at of different age group. Earlier findings says that starch grains in embryogenic cells of Musa varied among the test cultivars, and in different cultivars, and in different cell lines of same cultivars (Dhed’a et al., 1991). ECS of test cultivars which produced maximum somatic embryos showed the presence of cells containing very few starch grain with prominent nucleus. Present finding is in line with the earlier reports which stated that cell lines with highest embryogenic potential either were starch free, or contained only very tiny grains clusters around the nucleus (Panis 1995). Similarly it was also reported that male flower bud derived cell lines contain protein reserves only (Grapin et al., 1996; Cote et al., 1996). Decrease in regeneration capacity of ECS of both test cultivars can be attributed by the starch accumulation in these cells which is linked to cell differentiation and loss of embryogenic potency, as such cells additionally increase in vacuole content, acquire a more spherical shape and tend to become isolated as found by Panis, (1995 and Cote et al., (1996). Panis (1995) also reported that starch accumulation and relative vacuole content increases in majority of the embryogenic cells of late to post exponential phase of Musa ECSs.
Differential response in germination capacity was observed when somatic embryos obtained from ECS of different age group. Somatic embryos regenerated from 3 months old ECS showed germination percentage of 13.5% (cv. Rasthali) and 10.4% (cv. Nendran) respectively. Steep increase in germination capacity was noticed from 6 months old ECS (41.0% Rasthali and 32.4% Nendran) and no significant change were observed till 12 months (42.4% Rasthali and 34.5 Nendran). Further increase in age of ECS negatively affected the germination capacity of somatic embryos. 39.3% and
112 31.5% of initiated embryos germinated when 24 months old ECS of cvs. Rasthali and Nendran were used. Table-30 shows that the change in germination capacity of ECS of test cvs. Rasthlai and Nendran ECS. Lowest response was observed when 60 months old ECS in both test cultivars were used as source, which proves that regeneration capacity of ECS decreases with age of culture. Reports also show that risk of chromosomal variations, eg. Polyploidy and aneuploidy, increased upon culture time in embryogenic calluses of pearl millet (Swedlund and Vasil 1985) and tobacco (Murashige and Nakano, 1967), and in ECS of wheat (Kao et al 1970), Glycine max (Kao et al., 1970) and carrot (Halperin and Jenson, 1967).
Table 30. Effect of age of ECS on germination capacity of banana cultivars Rasthali and Nendran in MS medium with 0.5 mg/l BAP + 2 mg/l IAA
Treatments Germination capacity (%)
Rasthali Nendran
3 13.5± 0.23f 10.4±0.20e 6 41.0±1.2ab 32.4±0.73ab 12 42.4±1.0a 33.5±0.55a 24 39.3±0.9bc 30.4±0.9bc 48 26.8±0.8d 17.5±0.35d 60 12.5±0.4e 6.9±0.08f
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Reports also suggest that cold storage might retard cell division, thereby preventing the occurrence of chromosomal aberrations, and that upon transfer to normal incubation temperature, demethylation of DNA might increase regeneration frequencies (Creemers-Molenaar et al 1992). In cotton, histologically, no distinction could be made between embryogenic lines, and lines that had lost their morphogenic competence. Adding a cytokinin to the maintenance medium, delayed the loss of regeneration capacity in calli. In perennial ryegrass cultures, lines in which part of the callus remained as large aggregates, morphogenic capacity was retained longer than in finely dispersed cell suspensions. Results obtained in the present experiment demonstrated
113 correlation between age of ECS and germination capacity and also shows that ECS of both test cultivars can be successfully used for mass multiplication upto two years, beyond which competency decreases (Plate 14).
4.9. Histology of regenerating somatic embryos After 5 to 10 in germination medium medium the somatic embryos showed a circular invagination with opaque center (arrow marked) and the presence of a dense meristematic zone (Plate 15). Its further development took place through asymmetrical division, which results in the formation of embryo cotyledons (Plate 15 Ia) which is characteristic of monocot species (Natesh and Rau, 1984). The mature somatic embryos in torpedo state show an apical dome and leaf primordia region (Plate 15 II b). Khalil et al. (2002), indicated the presence of secondary somatic embryos (cv. 'Dwarf Brazilian'), with characteristics similar to those described in Plate 16, which managed to increase their germination. Histological sections of differentiated somatic embryos, showed a bipolar structure with the shoot and root apices with trifid vascularization, and entirely surrounded by an epidermis. Sections also revealed distinct cell types, a parenchyma in the outer cells layer and several vascular tissues in the central zone. The parenchyma cells are large in size and the vascular tissues are small cells which exhibited a marked contrast between the tissues. The section reveals further development of vascular traces.
4.10. Influence of various growth regulators on repetitive embryogenesis 4.10.1. Tested individually (2,4-D and BAP) Results obtained in previous experiments shows that embryogenic response obtained from test cultivars was very low and further subculture of embryogenic complex to callus induction medium failed to enhance proliferation. Present observation is supported by the findings of Escalant and Teisson, (1994) which states that translucent and friable embryogenic tissue can be maintained in same medium for 2 to 3 months without subculturing. They also found that subculture of embryogenic cultures onto fresh callus induction medium does not permit proliferation. Hence, prolonged availability of explants required improved medium.
Present objective was circumvented by the supplement of favorable medium for the active proliferation of embryogenic complex. Calli with primary somatic embryos
114 PLATE 14 Regeneration and germination capacity of embryogenic cell lines of commercial cultivars Rasthali and Nendran at different interval of time
(I) Rasthali (II) Nendran
Regeneration of somatic embryos from- a - One year old ECS b - Two year old ECS c - Three year old ECS d - Four year old ECS
Germination of somatic embryos regenerated from- e - One year old ECS f - Two year old ECS g - Three year old ECS h - Four year old ECS
PLATE 14
I
a b c d
e f g h
II
a b c d
e f g h
PLATE 15 Histology of regenerating somatic embryos (Bar 0.5 mm)
(I) Transverse section of somatic embryo a - Complete embryo b&c - Magnified view of xylem vessels
(II) Germinating somatic embryo a - c - Embryos showing shoot primordia d - Scattered vascular bundle e - Embryo showing root primordial
(III) Transverse section of shoot tip a - Inner and outer pattern of vascular development b - Detailed view of cellular arrangement c - Magnified view of vascular arrangement
PLATE 15
I
a b c
II
a b c
d e
III
a b c transferred to MS medium with different concentrations of 6-BAP and 2,4-D, showed various degree of proliferation. Irrespective of the type and concentrations of hormones tested, highest percentage of non-embryogenic calli was observed in both test cultivars. Transfer of ideal callus to fresh medium, led to a 4-5 fold increase in the size after 30 days of culture. Embryogenic complex when exposed to 0.75 mg/l of 2,4-D produced 76.4% and 82% of non-embryogenic callus alone from the test cultivars Rasthali and Nendran respectively (Table-31). Whereas, same concentration of 2,4-D produced 23.6% and 18.0% of non-embryogenic clumps with few secondary somatic embryos in cvs. Rasthali and Nendran respectively.
Table 31. Effect of 2,4-D and BAP on repetitive embryogenesis in banana cultivars Rasthali and Nendran in MS medium
Hormone Non embryogenic calli (%) Non-embryogenic calli and (mg/l) secondary embryos (%) Rasthali Nendran Rasthali Nendran 2,4-D 0.25 94.5±0.13a 97.7±0.20a 5.5±0.19h 2.3±0.18h 0.5 83.0±0.11cd 90.0±0.17d 17.0±0.17e 10.0±0.18e 0.75 76.4±0.33g 82.0±0.26f 23.6±0.18b 18.0±0.13bc 1.0 79.5±0.15e 84.7±0.27e 20.5±0.10d 15.3±0.14d BAP 0.5 89.0±0.14b 94.0±0.22b 11.0±0.17g 6.0±0.19g 1.0 77.0±0.20f 80.4±0.16g 23.0±0.16bc 19.6±0.13b 2.0 72.5±0.16h 76.6±0.14h 27.5±0.15a 23.4±0.17a 3.0 83.5±0.15c 93.0±0.19bc 16.5±0.16ef 7.0±0.13f
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Further increase or decrease in concentration of 2,4-D reduced the induction of embryogenic calli with secondary somatic embryos. Results obtained shows that BAP proved best in secondary somatic embryo production. Both 1.0 mg/l and 2.0 mg/l of BAP showed good response in secondary embryo formation. Highest response of 27.5% and 23.4% non-embryogenic calli with somatic embryos was obtained when the
115 test cultivars (cvs. Rasthali and Nendran) were subjected to 2 mg/l BAP, beyond which it shows negative response. When observed under stereo zoom microscope multiplication of cell material proceeds mainly via the sprouting of new embryogenic groups on heterogenous globules and the rapid growth of embryogenic cell clusters.
4.10.2. BAP and 2,4-D in combination with IAA Based on the results obtained in section 4.10.1. 0.75 mg/l of 2,4-D and 2.0 mg/l of 6-BAP was supplemented with various concentrations of IAA. Primary embryos proved best on MS medium containing 6-BAP in combination with IAA whereas 2,4- D in combination with IAA resulted predominantly in non-embryogenic callus production, with a low percentage of explants producing some somatic embryos in addition to non-embryogenic callus and no explants produced somatic embryos alone (Table-32).
Table 32. Effect of various concentrations of IAA (0.1 – 0.5 mg/l) in combination with 2,4-D (0.75 mg/l) and BAP (2.0 mg/l) on repetitive embryogenesis in banana cultivars Rasthali and Nendran
Non embryogenic calli Non embryogenic calli Secondary embryos Growth and few secondary (%) only (%) regulators embryos (%) (mg/l) Rasthali Nendran Rasthali Nendran Rasthali Nendran 2,4-D+ IAA 0.1 85.3± 0.18a 93.0±0.19b 14.7±0.15e 7.0±0.19d - - 0.2 79.5±0.19bc 85.5±0.18d 20.5±0.10c 14.5±0.22b - - 0.3 69.0±0.21e 80.4±0.17e 31.0±0.17a 19.6±0.15a - - 0.4 74.6±0.17d 87.0±0.18c 25.4±0.19b 13.0±0.19c - - 0.5 80.0±0.15b 94.0±0.20a 20.0±0.26cd 6.0±0.25e - - BAP+ IAA 0.1 40.0±0.22d 48.5±0.10d 29.0±0.15ab 24.5±0.13b 31.0±0.25b 20.5±0.16b e e a a a a 0.2 21.4±0.20 27.0±0.22 29.6±0.08 32.5±0.23 49.0±1.8 40.5±0.25 0.3 60.5±0.23c 73.3±0.16c 19.5±0.20c 13.7±0.25d 20.0±0.20c 13.0±0.12c 0.4 78.8±0.22b 85.0±0.20b 15.7±0.25d 15.0±0.26c 5.5±0.13d - 0.5 90.0±0.22a 95.3±0.18a 10.0±0.29e 4.7±0.22e - -
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
116 High percentage of (49.0% in Rasthali and 40.5% in Nendran) explants produced only secondary somatic embryos and additional 29.6% and 32.5% of non embryogenic callus with few somatic embryos were produced when explants were cultured in media containing 2 mg/l BAP with 0.2 mg/l IAA. Followed by this 0.3 mg/l IAA in combination with 6-BAP induced 20.0% and 13.0% of secondary somatic embryos (alone) from test cultivars Rasthali and Nendran respectively. In several monocotyledon species, including Dactylis glomerata, Oryza sativa, Triticum aestivum and Zea mays, the induction of secondary somatic embryogenesis has been found to require continuous exposure to growth regulators (reviewed in Raemakers et al., 1995). Escalant and Teisson, (1993) reported that increased percentage of somatic embryogenesis from callus obtained in male buds can be achieved through secondary somatic embryogenesis. In present study the secondary somatic embryo occurred in clusters (Plate-16 I), initially appearing as small, hyaline protuberances on the surface of the clusters. Dhed’a et al., (1991) described the disorganization of the epidermis and subsequent formation of adventitious embryos through budding from such embryos, which produced embryo clusters as noticed in present trial. The embryos passed through a recognizable globular and torpedo stage and finally green plumules emerged from these embryos when shifted to germination medium (Plate16 II). Khalil et al. (2002), indicated the presence of secondary somatic embryos (cv. 'Dwarf Brazilian'), with characteristics similar to those described in Plate 16 (I), which managed to increase their germination. Present experiment demonstrates a way to induce secondary somatic embryos from embryogenic callus in MS medium supplemented with 2.0 mg/l BAP and 0.2 mg/l IAA, for prolonged availability of explants.
4.10.3. Effect of initial inoculum density on multiplication of somatic embryos Effect of initial innoculum density on repetitive embryogenesis was studied and the results obtained were analysed and tabulated in Table-33. Best results were obtained with density of 0.5 g in 25 ml of liquid medium, which resulted in a 14-fold increase in fresh weight after 30 days in test cultivar Rasthali. Whereas, cv. Nendran which belong to same genome (AAB) required 0.75 g of initial inoculum density for maximum increase (20 fold) in fresh weight. Further increase in initial inoculum density was found to have negative correlation with fresh weigh. Surprising results were obtained in somatic embryo count in both test cultivars.
117 PLATE 16 Repetitive embryogenesis and germination of embryos obtained from immature male flower buds of banana cultivars Rasthali and Nendran (bar 1 mm)
(I) Secondary somatic embryos obtained on MS with BAP + IAA a - 2.0 mg/l BAP + 0.4 mg/l IAA c - 2.0 mg/l BAP + 0.1 mg/l IAA b - 2.0 mg/l BAP + 0.3 mg/l IAA d - 2.0 mg/l BAP + 0.2 mg/l IAA
(II) Active proliferation and germination of secondary somatic embryos a - c – Rasthali d - f – Nendran
PLATE 16
I
a b
c d
II
a b c
a b c
Table 33. Influence of initial innoculum density on multiplication of somatic embryos in banana cultivars Rasthali and Nendran in MS medium with BAP (2 mg/l) and IAA (0.2 mg/l)
Initial density Total fresh weight of SE after Total number of SE after 30 of innoculum 30 days (g) days SE per 25 ml (g) Rasthali Nendran Rasthali Nendran 0.25 2.50± 0.17e 3.73± 0.27e 3530±30.9e 2990±26.3e 0.5 6.75± 0.21d 7.52± 0.51d 6560±42.0d 4750±34.6d 0.75 9.25± 0.37c 14.75± 0.21c 15920±150.0a 13500±86.4a 1.5 15.50± 0.37b 22.70± 0.58b 15450±109.8b 13050±85.5b 3.0 22.00± 0.65a 30.50± 0.69a 15000±95.5bc 12050±84.6c
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Though test cultivars required different level of initial inoculums density (0.5 g in Rasthali and 0.75 g in Nendran) to show maximum fresh weight gain, yet highest result in somatic embryo count was obtained from the same initial inoculums density (0.75 g). 30 days of culture in liquid medium resulted in the formation of 15,920 and 13,500 somatic embryos in cvs. Rasthali and Nendran respectively. Dhed'a et al. (1991) in cv. 'Bluggoe' (ABB) obtained somatic embryos in liquid culture medium, but did not mention the number of somatic embryos formed. Correlation between fresh weight gain and embryo count shows that cv. Nendran (20 fold increase) was best compared to cv. Rasthali (12 fold) in terms of fresh weight gain whereas, cv. Rasthali was found best interms of somatic embryo counting. Somatic embryos obtained in cv. Rasthali ranged between 0.40 to 0.75 mm in diameter and weighed 0.60 to 0.70 mg whereas, in cv. Nendran it ranged from 0.5 to 1.5 mm in diameter and 0.65 to 1.2 mg in weight. Though somatic embryos of cv. Nendran increased in fresh weight yet failed to show maximum embryo count and its because of larger size and more weight than cv. Rasthali embryos. Size and weight of somatic embryos obtained in present experiments is in line to the finding of Gogez kosky et al., (2002) in cv. FHIA – 18 (AAAB) where embryos diameter ranged from 0.5 to 1.2 mm with average weight of 0.76 ± 0.16 mg. Present reports are supported by earlier findings where weight or size of the embryos indicate quality or maturity of them (Parrott et al., 1988).
118 Merkle et al., (1995) reported that repetitive embryogenesis can occur even in the absence of an exogenous auxin. This process is called as autoembryogenesis and is sometimes referred as proliferation or mass propagation. Although some authors as Georget et al. (2000) refer the importance of cell density in somatic embryos formation but others (Barranco, 2001) reported that inoculum density in different stages of somatic embryogenesis in Musa is not necessary. Strosse et al., (2003) noted the need to establish common criteria for evaluating the development of different stages in somatic embryogenesis of plantain and banana, which may facilitate their comparative study with other methods applied for the same purpose. In accordance to these earlier findings the present experiment emphasizes the importance of initial inoculums density for active multiplication of somatic embryos in liquid medium.
4.11. Preculture of embryos in liquid medium Variable response in germination was recorded even when standard protocol for plant regeneration is being used (Plate 17). Hence, to synchronized and high germination response preculture of somatic embryos in liquid media was tried. Germination percentage of 25.6% and 14.6% was recorded in cvs. Rasthali and Nendran when somatic embryos were transferred to germination medium without liquid preculture (control) (Table-34). Whereas, preculture of somatic embryos in liquid medium showed differential response with respect to culture media. Among the treatment tried, 21 days preculture of somatic embryos in half strength germination medium (TIV) increased the germination capacity by 16.9% in cv. Rasthali and 18.8% in cv. Nendran, compared to control (Plate 18). Results also showed that no appreciable change was noticed when full strength germination medium (TIII) was used for preculture of somatic embryos. Preculture of somatic embryos in full (TI) and half strength regeneration medium (TII) showed negative correlation with respect to germination capacity.
119 PLATE 17 Differential germination of plantlet from embryogenic cell suspension culture of banana cultivars Rasthali and Nendran (bar 5 mm)
(I-II) - Abnormal shoot and root formation from somatic embryos on germination medium IIIa - Absence of shooting from somatic embryos on germination medium after 21 days (cv. Rasthali) IIIb - Greening and recallusing of somatic embryos on germination medium after 21 days (cv. Nendran) IIIc - Multiple root formation from somatic embryos in cv. Rasthali after 15 days on germination medium IIId - Multiple roots produced from somatic embryos in cv. Nendran after 15 days on germination medium
PLATE 17
I II
a a
b b
c c
d d
e e
III
a b c d PLATE 18 Enhanced plantlet recovery through modified culture technique in cvs. Rasthali and Nendran
(I) Rasthali (II) Nendran a - Synchronized somatic embryos in Half strength liquid germination medium b - 5 days after transfer to solid germination medium c - Synchronized emergence of chrolophyllous plumule after 14 days d - Shoots ready to transfer to rooting medium PLATE 18 I II
a a
b b
c c
d d Table 34. Effect of preculture of somatic embryos in liquid medium (20 days) to increase the germination capacity of banana cultivars Rasthali and Nendran
Treatment Germination capacity (%) Rasthali Nendran Control 25.6±0.9b 14.6±0.75b TI 22.6±0.7c 13.3±0.48bc TII 15.0±0.65d 10.5±0.53e TIII 27.3±0.83bc 15.4±0.45d TIV 42.5±1.4a 33.4±1.20a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
TI - Full strength modified regeneration medium TII - Half strength modified regeneration medium TIII - Full strength germination medium TIV - Half strength germination medium
Two factors which decided success in present experiment were gelling agent and media components. Gelling agents have been reported to contribute elemental content to medium and to bind medium components making them unavailable to the growing tissue (Debergh 1983; Scholten and Pierik 1998; Van Winkle and Pullman 2003). Scholten and Pierik (1998) reported agar impurities, trace elements, and up to 30% of the Murashigae and Skoog salts were immobilized in agar medium. Hence, removal of gelling agent alter plant cell metabolism through several mechanisms including increased plant tissue surface area for nutrients uptake, altered medium water potential and water availability, increased diffusion of nutrients and growth substances to growing tissues, increased diffusion of waste products and growth inhibitors away from growing tissue (Gerald et al., 2007). Earlier reports also states that tissue grown in liquid medium not only grows faster and often produces more desired plants propagules, but also produces tissues with different characteristics compared to those produced on gelled medium (Maene and Debergh, 1985).
Use of culture medium for pretreatment is another important factor which decides the success rate in this experiment. Germination medium when supplied in half
120 strength for a period of 21 days produced synchronized somatic embryos which enhanced the germination frequency. Similarly, use of temperory immersion to obtain synchronized somatic embryos were reported by Etienne et al., (1997) in Hevea brasiliensis (Mull Arg) and Cabasson et al., (1997) in Citrus deliciosa (Ten.). After 21 days in preculture medium somatic embryos detached from the explant and initial development of a root primordium was observed. However, lower germination percentage in control (without pretreatment) observed may probably due to a lack of development of the shoot apical meristem. Similar results were obtained by Lee et al. (1997) with banana somatic embryos, Nickle and Yeung (1993) with Daucus carota L. The results in present experiments demonstrated a modified culture technique for enhanced germination (42.5% and 33.4% in cvs. Rasthali and Nendran) through synchronized embryos after preculture in half strength germination medium.
4.12. Plant recovery and acclimatization phase in net house In the present study characteristic of plants raised through somatic embryogenesis and shoot tips culture of test cultivars were assessed in net house. It was observed that in vitro raised plants were delicate and sensitive to external environment as these were produced in a closed, sterile environment and grown on nutrient rich artificial media under controlled conditions. In vitro raised plants have to adjust with reduced humidity, changing temperature and lower nutrient availability when shifted net house. Moreover, these plants have limited photoautotrophic capacity, so their energy requirements are met by reserves of starch accumulated during in vitro culture. When rooted plants were removed from glass jars, the roots were fragile and were easily damaged during removal of medium from the roots.
Wilting started when plants were left uncovered initially for certain period (10-15 days). This wilting was due to loss of water. Wardle et al. (1983) reported that this loss of water was due to poorly deposited epicuticular wax and non active stomatal system. Sometimes synthetic wax is applied to prevent the water loss through leaves and Zaid and Hughes (1995) applied polyethylene glycol during acclimatization of in vitro raised date palm plantlets, through increased wax deposition on the leaves. The exogenous application of wax to banana plants was not possible due to tender and broader leaves of banana and also not cost effective when number of plants was more. Jasrai et al. (1999) was able to acclimatize more than 92 percent in vitro raised banana
121 plants without net house, with spray of water after every two hours and the base of pots was dipped in water. In present experiment result, survival rate of seedlings raised through somatic embryogenesis in cvs. Rasthali and Nendran was between 91.0 to 92.5% (Plate 19 f) and similar to the results obtained from seedlings raised through shoot tip culture (92.0 to 93.0%).
During hardening of in vitro raised banana plants in the green house, small variation in their height and growth was observed. This variation in plant height might be due to differences in nutrients available in the substrate in which plants were hardened. Apart from plant height variation in leaves was recorded interms of blotch. Generally, 0.2-0.75% of variegated leaves were recorded in plants obtained through shoot tip culture whereas plantlets, obtained through somatic embryogenesis showed 0.5-1.3% variegated leaves in test cultivars. Around 0.5% and 0.3% of seedlings initiated through somatic embryogenesis and shoot tips showed narrow leaf sheath (Plate 19 g-i). This type of variant was described by Reuveni and Israeli (1990) as "axillary mosaic-like" and note that it represents 10.0% of all variations. Other types of somaclonal variants were not observed in plants under study; however, Sandoval et al. (1997) stated that at this stage only around 60.0% of somaclonal variants can be detected, i.e, that does not mean they were not present, making it necessary to continue the evaluations of these plants in the field until complete its development cycle. The plants of test cultivars (Rasthali and Nendran) were shifted in the field for detailed study on characteristic features.
4.13. Genetic fidelity studies True-to-type clonal fidelity is one of the most important prerequisites in the micropropagation of any crop species. A major problem encountered with the in vitro culture is the presence of somaclonal variation amongst sub-clones of one parental line, arising as a direct consequence of in vitro culture of plant cells, tissues or organs. A better analysis of genetic stability of plantlets can be made by using a combination of two types of markers which amplify different regions of the genome (Martins et al. 2004). Hence, in the present study, two PCR based techniques, SSR and ISSR were adopted for evaluation of clonal fidelity of ECS derived plants in cvs. Rasthali and Nendran.
122 PLATE 19 Germination, acclimatization and bunches of ECS derived plantlets in test cultivars Rasthali and Nendran (bar 5 mm) a - Emergence of chlorophyllous plumule b - Plantlet with well developed root and shoot system c - Plantlets in primary hardening stage d - Plantlets in secondary hardening stage e - g - Somaclonal variation in hardening stage h - Rasthali bunch from ECS derived plant i - Nendran bunch from ECS derived plant
PLATE 19
a b c d
e f
g h i
j k
4.13.1. SSR primer in genetic fidelity study In order to confirm the genetic fidelity, a comparison of SSR and ISSR patterns of 20 plants chosen from 500- plus plantlets of test cultivars with respect to two controls (shoot tip and sucker). Initial screening for SSR primers resulted in selection of 16 primers (out of 20 primer pair) which produced clear and reproducible amplification products. SSR primers failed to generate any polymorphism in the present study in both test cultivars. A total of 484 and 418 bands (numbers of plantlets analysed x number of band classes with all the SSR primers) were generated, giving rise to monomorphic patterns across all the plantlets analysed in both test cultivars Rasthali and Nendran respectively. Samples of the monomorphic band classes obtained for SSR.
This study has not detected any genetic change, it is possible that some changes might have occurred that go undetected as there is a possibility of point mutations occurring outside of the priming sites. The exact cause of somaclonal variation in in vitro cultures are still unknown, although it is believed that alterations in auxin- cytokinin concentrations and their ratio, duration of in vitro culture, in vitro stress due to unnatural conditions, altered diurnal rhythm and nutritional conditions (Modgil et al. 2005) together or independently are responsible. Cultured plant tissues are also known to undergo high levels of oxidative stress due to reactive oxygen species formed within the cells and the latter is known to cause DNA damage (Jackson et al. 1998). Probably due to some of such reasons, morphological variations have been a common feature as long as the plants were in in vitro and net house conditions, with reversal to normal state when such plantlets are transferred to soil. Since, no such variations were obtained among somaclones using SSR markers, hence were subjected to ISSR markers for the confirmation of genetic fedility.
4.13.2. ISSR primer in genetic fidelity study 4.13.2.1. Rasthali In ISSR analysis, 10 anchored microsatellite primers, including di and trinucleotide repeat motifs were tested individually to check genetic fidelity in test cultivars, where all primers generated well resolved reproducible banding profile. All 10 ISSR primers produced 78 scorable band classes, ranging from 316 bp to 1856 bp in size in cv. Rasthali. The number of bands for each primer varied from 4 (USB 807) to 11 (USB 808) with an average of 7.8 bands per primer (Table 35 a). A total of 1628
123 bands (numbers of plantlets analysed x number of band classes with all the ISSR primers) were generated, giving rise to both monomorphic (USB 807, 818, 834, 836, 841 and 842) and polymorphic (USB 808, 811, 836, 840 and 868) pattern across all the plantlets analysed (Table 35 a). Polymorphic classes ranged from 7.4% to 10% with an average of 3.6% whereas, 95.9% monomorphism was observed from 10 primers tested. Samples with monomorphic and polymorphic band classes obtained for cv. Rasthali is shown Plate 20 (a).
Table 35. Contribution of various ISSR primers to percent polymorphism in cv. A) Rasthali
Total Percentage Monomorphic Polymorphic Primers no. of bands bands bands Monomorphism Polymorphism
USB 807 4 0 4 100 0 USB 808 10 1 11 90.9 7.14 USB 811 8 1 9 88.8 10 USB 818 8 0 8 100 0 USB 834 7 0 7 100 0 USB 836 6 0 6 100 0 USB 840 9 1 10 90.0 9.09 USB 841 6 0 6 100 0 USB 842 7 0 7 100 0 USB 868 9 1 10 90 10 Total 74 4 78 959.7 36.23 Average 7.4 0.4 7.8 95.9 3.6
4.13.2.1.1. Cluster analysis The dendrogram showing the relatedness of the 20 clones (R1 to R20) obtained through ECS with two controls (C1- sucker control, C2- shoot tip control) was constructed using a similarity coefficient (Plate 20 b). The clustering in the dendrogram agreed with the known mode of propagation of the plantlets of the study and was divided into two main clusters (A and B) (Plate 20 b).
124 Plate 20a Genetic fidelity test in cv. Rasthali using ISSR primer
(I) - Monomorphic banding pattern obtained using primer UBC 807 (II) - Polymorphic banding pattern obtained using primer UBC 811
M - Marker C1 - Control 1 (sucker derived plant) C2 - Control 2 (shoot tip derived plant) Lane 1 to Lane 20 - ECS derived plant
PLATE 20a
M C1 C2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
5000 3000 2500 2000 1500
1000
500
M C1 C2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
5000 3000 2500 2000 1500
1000
500
Plate 20b
Dendrogram demonstrating the genetic relationship among 20 clones of cv. Rasthali (AAB) (ECS derived) along with sucker (C1) and shoot tip (C2) as controls based on microsatellite markers, generated by unweighed pair group method (UPGMA), NTSYS statistical package
PLATE 20b
C1
C2
R1
R9
R10
R11
R16
R13
R2
R20
R18
R3
R4
R14
R15
R17
R19
R8
R7
R6
R5
R12
0.95 0.96 0.97 0.99 1.00 Coef f icient
Cluster Members Cluster I ECS derived plants (R1 to R20) Subcluster I a R1, R9, R10, R11, R16, R13 Subcluster I b R2, R3, R4, R5, R6, R7, R8, R12, R14, R15, R17, R18, R19, R20 Cluster II C1 and C2 (sucker and shoot tip derived)
Cluster I Cluster I consists ECS derived plantlets. 20 clones selected for the study were segregated in two subclusters (Ia and Ib).
Subclusters Ia and Ib Subcluster Ia consists of 6 plantlets which were 97.4% similar to subcluster Ib (14 plants). This close relationship within two subclusters shows genetic similarity among the plantlets derived from common source (embryogenic cell suspension).
Cluster II Cluster II consists of two controls (C1 and C2) that have a high degree of relatedness within them. Both sucker derived and shoot tips derived plants were identical and get segregated from ECS derived plantlets
Relationship between cluster I and cluster II Genetic dissimilarity between the plants obtained through ECS (cluster I) with two controls (conventional sucker derived and shoot tip derived plants) was obtained in fedility test which emphasize the selection of mode of plant propagation. ECS derived plants (cluster I) shows 96.5% similarity to conventional sucker and shoot tip derived plants (cluster II).
4.13.2.2. Nendran Similar results were obtained in cv. Nendran. Totally 64 scorable band classes, ranging from 393 bp to 1760 bp in size were produced by 10 ISSR primer tested. The number of bands for each primer varied from 3 (USB 807) to 10 (USB 834) with an average of 6.4 bands per primer (Table 35 b). A total of 1408 bands were generated,
125 where USB 807, 811, 836, 840, 841, 842, 868 primers produced monomorphic patterns and USB 808, 818 and 834 gave polymorphic banding patterns. Of the two types of patterns obtained, polymorphic classes ranged from 10% to 25%. As a result 4.6% loci were found to be polymorphic between somaclones of cv. Nendran. ISSR primers produced monomorphic banding patterns of 95.3%. Plate 21(a) shows monomorphic and polymorphic banding pattern obtained in cv. Nendran.
Table 35. Contribution of various ISSR primers to percent polymorphism in cv. B) Nendran
Total Percentage Monomorphic Polymorphic Primers no. of bands bands bands Monomorphism Polymorphism USB 807 3 0 3 100.0 0 USB 808 6 2 8 75.0 25.0 USB 811 7 0 7 100.0 0 USB 818 8 1 9 88.8 11.1 USB 834 9 1 10 90.0 10.0 USB 836 5 0 5 100.0 0 USB 840 6 0 6 100.0 0 USB 841 8 0 8 100.0 0 USB 842 4 0 4 100.0 0 USB 868 5 0 5 100.0 0 Total 61 3 64 953.8 46.1 Average 6.1 0.3 6.4 95.3 4.6
4.13.2.2.1. Cluster analysis The NTSYS software derived dendrogram for 20 randomly selected clones (ECS derived plants) with two control (sucker and shoot tip derived plants) resulted in the formation of two clears clusters (Plate 21b).
126 Plate 21a Genetic fidelity test in cv. Nendran using ISSR primer
(I) - Monomorphic banding pattern obtained using primer UBC 840 (II) - Polymorphic banding pattern obtained using primer UBC 818
M - Marker C1 - Control 1 (sucker derived plant) C2 - Control 2 (shoot tip derived plant) Lane 1 to Lane 20 - ECS derived plant
PLATE 21a
M C1 C2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
5000 3000 2500 2000 1500
1000
500
M C1 C2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
5000
3000 2500 2000
1500
1000
500
Plate 21b Dendrogram demonstrating the genetic relationship among 20 clones of cv. Nendran (AAB) (ECS derived) along with sucker (C1) and shoot tip (C2) as controls based on microsatellite markers, generated by unweighed pair group method (UPGMA), NTSYS statistical package
PLATE 21b
C1 C2 N1 N2 N20 N19 N17 N18 N3 N14 N13
N12 N11 N10 N9 N8 N7 N6 N5 N4 N15 N16
0.94 0.95 0.97 0.98 1.00 Coefficient
Cluster Members Cluster I ECS derived plants (N1 toN20) Subcluster I a N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, N11, N12, N13, N14, N17, N18, N19, N20 Subcluster I b N15, N16 Cluster II C1 and C2 (sucker and shoot tip derived)
Cluster I Clones derived from ECS came in present cluster. 20 clones selected for the study has clustered into two subclusters Ia and Ib.
Subclusters Ia and Ib Subcluster I a consists of 18 plantlets which were 97.9% similar to subcluster Ib (2 plants). The validity of present result needs further check with enhanced morphotaxonomic classification in field condition.
Cluster II Cluster II consists of two controls (C1 and C2) which get segregated from ECS derived plantlets (cluster). Present result obtained is similar to the results obtained in cv. Rasthali where sucker and shoot tip derived plants shows 100% similarity.
Relationship between cluster I and cluster II Cluster I is distinguishable from cluster II with 2.9% of dissimilarity. This strange clustering pattern obtained between ECS derived plants with respect to control needs to be further evaluated in field conditions.
ISSR PCR can be used as a simple, fast and relatively inexpensive method to produce useful DNA markers in genetic fidelity study in banana. Apart from this ISSR markers have been found to be linked to disease resistance genes in chickpea (Ratnarparkhe et al., 1998; Santra et al., 2000) and major and minor genes for seed weight in wheat (Ammiraju et al., 2001). Important traits that could be mapped or are linked to ISSR markers, or SSR markers developed from them, which could be studied
127 including seed dormancy along a moisture gradient (Wu et al., 1987); life history traits as related to stress (Cline, 2001), earliness of flowering (Heide, 2001), seasonal vs. continual flowering (Johnson and White, 1998), vernalization and photoperiodic requirements for flowering (Johnson and White, 1997a and 1997b), dwarfness; herbicide resistance (Mengistu et al., 2000) and disease resistance.
Use of ISSR markers in present study showed variation in banding patterns. Presence of negligible variation in the banding pattern of ECS derived plants in both test cultivars clearly indicates that the extreme growth conditions with high suppression of shoot growth and exudation of phenolics do not have much effect of genetic level. Variation in the band intensities for certain fragments in present results has also been observed in other studies (Rynanen and Aronen 2005). Hence, ISSR markers can be successfully used in genetic fidelity study not only in banana. ISSR markers are used in genetic fedility test in other crops such as Chlorophytum arundinaceum (Lattoo et al., 2006), Betula pendula (Ryynanen and Aronen 2005), Prunus dulcis (Martins et al., 2005), apple (Modgil et al. 2005), Pinus thunbergii (Goto et al., 1998) and Digitalis obscura (Gavidia et al., 1996). In banana, there are reports of somaclonal variation especially in cultivars Williams (AAA) (Damasco et al. 1996; Israeli et al. 1996), Robusta (AAA), and Giant Governor (AAA) (Ray et al. 2006). In present study it was observed that shoot tip derived plants were genetically identical to the sucker derived plantlets. Shoot tips, maintain strict genotypic and phenotypic stability under tissue culture conditions (Bennici et al. 2004), which appears applicable also to present results because no variations were observed for the primers tested. In both test cultivars (cvs. Rasthali and Nendran) sucker and shoot tips derived plants get segregated from ECS derived plantlets.
This polymorphism observed by ISSR in ECS clones may be due to recurrent subculture for indefinite period. Regeneration of plantlets through ECS pathway requires long duration (nearly 8 months to 24 months) which may be the reason for differential response to molecular markers. Variations observed in plantlets derived from cell suspension in cvs. Rasthali and Nendran was negligible compared to the results obtained by Grapin (1995) who reported on 16-22% somaclonal variants among plants regenerated from a ‘French Sombre’ suspension, whereas all plants obtained via in vitro clonal propagation were normal. Moreover, Orton (1984) and Hartmann et al.
128 (1989) have also reported that the time of in vitro culture could promote somaclonal variation. Earlier finding (Smith, 1988 and Vuylsteke et al., 1991) shows that somaclonal variation in banana may vary from 0–70% according to genotype.
When all the in vitro conditions like duration of culture, hormone concentrations and in vitro stress which may induce somaclonal variation were same during the culture of micropropagated plants, it can be said that it is the genetic constitution in each clone which determined the stability/variation of micropropagated plants of banana cultivars. It has also been reported by Vendrame et al., (1999) that genetic variation in a culture line could be affected more by the genotype than by the period in culture. Similar results were obtained in present experiment where the test cultivars belonging to same genotype (AAB) showed similar kind of polymorphic patter (less than 5%) when same explants and culture technique was used.
The present variation in polymorphic pattern of classes obtained may be due to in vitro stress which may revert back to normal with time. Some dwarf somaclonal variants in in vitro cultures of banana var. Williams (Cavendish banana), have been reported (Israeli et al. 1996) and such dwarf somaclones were relatively stable and did not generally revert to a normal phenotype (Ramage et al., 2004). It has been reported in Musa that the extent of instability caused by in vitro culture was related to cultivar rather than the culture condition (Ray et al., 2006). Whereas, some researchers (Vuylsteke et al., 1991; Martin et al., 2006) reported that the extent of instability in Musa was found to depend on the interactions between the genotype and the tissue culture conditions. While experimenting with plantains (AAB), Cronauer and Krikorian (1983) observed that the frequency of the occurrence of variants in any variety was confined to individual primary explants rather than the genotype. Ray et al., (2006) reported complete genetic stability in micropropagated “Martaman” banana also having genotype AAB. From all these reports it can be concluded that somaclonal variations are the resultants of three-way interactions of initial explants, the culture conditions, and the genotype and can occur within the clone, different explants within a plant, inter-clonal and inter-varietal, which need to be further evaluated in field condition. In conclusion, the regenerant were was successfully acclimatized and transferred to the field where further morphological characterization will tell whether or not the variation has any effect on plant morphology and agronomic traits.
129
4.14. Field evaluation of regenerated plants 4.14.1 Vegetative characters Parameters like pseudostem height and girth, petiole length, number of leaves at shooting and leaf area of the plants produced through somatic embryogenesis was compared with shoot tip and sucker derived plantlets (Table-36 a).
Table 36. Biometric analysis of ECS derived plants (cvs. Rasthali and Nendran) in field conditions
(a) Vegetative characters
Rasthali
Parameters No. of Source Pseudostem Pseudostem Petiole Leaf area leaves at height (cm) girth (cm) length (cm) (x 104) shooting Sucker 271.0±2.9c 72.7±1.0b 14.5±0.6b 54.1±0.7bc 12.70±0.6b Shoot tips 291.4± 3.50a 72.3±1.0bc 14.4±0.5bc 53.7±0.5a 12.33±0.4bc ECS 288.5±2.8b 68.5±0.9a 15.6±0.5a 54.4±0.6b 13.12±0.4a
Nendran
Parameters No. of Source Pseudostem Pseudostem Petiole Leaf area leaves at height (cm) girth (cm) length (cm) (x 104) shooting Sucker 287.7±3.0ab 56.2±0.8bc 13.9±0.4b 42.4±0.8b 12.5±0.7b Shoot tips 281.89±3.3c 56.3±0.5b 12.7±0.09c 42.3±0.8bc 10.0±0.3c ECS 289.3±2.8a 60.8±0.5a 13.9±0.3a 43.9±0.6a 12.8±0.5a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
130 At the time of field plantation, plants derived from shoot tip and suspension derived plants (in both test cultivars) were of height between 25 -30 cm but with the passage of time, in vitro derived plants grew faster as compared to shoot tip and sucker derived plants. It was observed that mean height of the plants derived from three different source was 288.5 cm in cv. Rasthali and 286.67 cm in cv. Nendran respectively. Among three sources, pseudostem height was maximum in ECS derived plants (288.5 cm Rasthali and 289.3 cm Nendran) in both test cultivars, followed by shoot tip derived plants in cv. Rasthali (291.4 cm) and sucker derived plants in cv. Nendran (287.7 cm) respectively. Lowest pseudostem height was recorded in sucker derived plants in cv. Rasthali (271.0 cm), whereas in cv. Nendran shoot tip derived plants revealed least height of 281.89 cm. In general, plant height of in vitro raised plants was more than conventional sucker derived plants. Robinson et al. (1993) and Vuylsteke and Oritz (1996), they found plant height difference of 30 and 23 cm in cv. Grand Nain and cv. Agbagba between tissue culture and sucker derived plants, whereas no such difference was noticed in present experiment.
Pseudostem thickness was another parameter which represented the growth of banana plants. At the time of field plantation suckers had more circumference than tissue culture raised plants. With the passage of time, in vitro raised plants established earlier and grew more vigorously, this difference went on decreasing and at the time of flowering, sucker derived plants in Rasthali (72.7 cm) and ECS derived plants (60.8 cm) in cv. Nendran showed maximum pseudostem thickness. The mean pseudostem thickness of in cv. Rasthali and Nendran was 71.17 cm and 57.73 cm respectively.
Total number of leaves at the time of flowering is another important parameter to study the growth of the plant body. At the time of plantation, in vitro raised plants had 3-5 leaves and suckers derived plants had no functional leaves. During evaluation mean number of leaves produced in cvs. Rasthali and Nendran were 14.67 and 13.43 respectively. In cv. Rasthali ECS derived plants regenerated 15.6 leaves followed by sucker and shoot tip derived plants (14.5 and 14.4). Whereas, in cv. Nendran, sucker and ECS derived plants produced equal number of leaves (13.9), followed by shoot tip derived plants which produced only 12.7 numbers. During a field study of Grand Nain Robinson et al. (1993) achieved 41.4 and 48.1 number of leaves from sucker and in
131 vitro derived plants respectively. The difference in present result to earlier finding may be due to genome dependence. Since in vitro plants were established as undisturbed with several of their leaves already present at planting, may be reason for more number of leaves production.
Other parameters like petiole length and leaf area were also recorded and analyzed (Table-36 a). In cv. Rasthali no significant difference was recorded in petiole length among the plants regenerated through three different source of explants, whereas ECS derived plantlets had maximum leaf area (13.12x104) compared to sucker (12.72x104) or shoot tip (12.22x104) derived plants. In cv. Nendran petiole length of ECS derived plants measured 43.9 cm followed by sucker (42.3 cm) and shoot tip (42.2 cm) derived plants. Similar to the results obtained in cv. Rasthali, ECS derived plants produced leaves with more leaf area (12.8x104) followed by plants obtained from conventional sucker (12.5 x104). Least leaf area was recorded from the plants produced through shoot tips (10.0x104).
Plant growth is a measure of vigor. Results obtained show no negative effect on the vegetative characteristic of plantlets derived through suspension culture. Moreover, these plantlets established more quickly and grew vigorously compared to conventional sucker or shoot tip derived plantlets. The phenomenon of more vigor was reported by Drew and Smith (1990) and Robinson et al. (1993) and resulted from the fact that in vitro raised plants are disease free and already possess an active root and shoot system at planting. These plants also had physiologically efficient leaves which start functioning immediately after planting in the field. Plants propagated through suckers on the other hand have to develop roots and leaves from rhizome and these plants can only start photosynthesizing 4-6 weeks after planting.
4.14.2. Yield In vitro raised plants flowered earlier than sucker derived plants. In cv. Rasthali, on average, ECS and shoot tip derived plants flowered after 314.6 days and 314.0 days of plantation respectively (Table-36 b). Whereas, sucker derived plants took 316.7 days for emergence of inflorescence. Similar results were obtained from cv. Nendran where ECS derived plants flower earlier (271.5 days) followed by shoot tip (273.2 days) and sucker (277.6 days) derived plants respectively. This early flowering from ECS derived
132 plants may be due to vigorous growth of in vitro raised plants as reported by Vuylsteke and Oritz (1996). On an average 128.2 days and 100 days were taken for the bunch maturity in ECS derived plants in cvs. Rasthali and Nendran respectively. Whereas, it took 1.8 and 2.0 days in excess for bunch maturity in shoot tip derived plants of cvs. Rasthali and Nendran respectively. Results obtained shows that bunch produced from in vitro raised plants matured at same time.
Table 36. Biometric analysis of ECS derived plants (cvs. Rasthali and Nendran) in field conditions (b) Yield
Rasthali
Parameters Days for Bunch Hands Source Days for Duration Fruits Total no. bunch weight per shooting (Days) per hand of fruits maturation (Kg) bunch Sucker 316.7 130.2 446.9 12.33 7.4 12.5 95.2 ±4.7c ±1.5bc ±6.4c ±0.7abb ±0.5ab ±0.8bc ±1.0b Shoot tips 314 128.5 442.5 13.18 7.3 12.6 94.6 ±4.5b ±1.3b ±5.0b ±0.5a ±0.6abc ±0.7b ±1.0bc ECS 314.6 128.2 435.8 13.48 7.7 13.2 102.6 ±4.8a ±1.4a ±4.8a ±0.6ab ±0.5a ±0.7a ±0.8a
Nendran
Parameters Days for Bunch Hands Source Days for Duration Fruits Total no. bunch weight per shooting (Days) per hand of fruits maturation (Kg) bunch 277.6 102 379.6 11.6 6.4 12.8 85.9 Sucker ±4.3a ±1.6a ±6.3b ±0.7abc ±0.8ab ±0.5c ±1.0a
Shoot 273.2 99.7 372.9 11.8 6.3 13.5 85.8 tips ±3.6ab ±1.3bc ±4.8bc ±0.4ab ±0.7abc ±0.6ab ±0.5ab 271.5 100 371.5 12.3 6.5 13.7 89.4 ECS ±3.0c ±1.0b ±4.5a ±0.3a ±0.7a ±0.4a ±0.6a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
133 Bunch with maximum weight in cvs. Rasthali and Nendran were obtained from ECS derived plants (13.48 kgs and 12.3 kgs). In cv. Rasthali ECS derived plants produced an average of 7.7 hands per bunch which is higher compared to shoot tips (7.3) and sucker (7.4) derived plants. Similar results were obtained in cv. Nendran, where ECS derived plants produced an average of 6.5 hands per bunch, followed by shoot tip and sucker propagated plants (6.4). Other parameters like total number of fruits per hand and in single bunch showed that ECS derived plants proved efficient compared to shoot tip and sucker derived plants in both test cultivars Rasthali and Nendran (Table-36b). In terms of yield potential, there is wide spread agreement that tissue culture plants produce larger bunches than conventionally propagated plants. Similar results were obtained by Eckstein and Robinson (1995), who demonstrated that tissue culture plants had a higher photosynthetic rate, dry matter assimilation rate and root growth rate than conventional plants.
These results were contrary to the findings of Vuylsteke and Ortiz (1996) who reported lower yield from tissue culture plants during field study of plantain (Musa spp., AAB group). Later Cote et al., (2000) compared banana plants originated from embryogenic cell suspensions and in vitro budding multiplication method and no significant differences was observed in plant height and circumference, length of the reference leaf, number of nodal clusters of the inflorescence and of fruits, bunch weight, period of time between planting and flowering, and between planting and harvesting. But the results obtained in present experiment shows that though ECS derived plants of test cultivars revealed improved vegetative characters and yield characters discussed above. Their fruiting characters were similar to that of plants obtained from conventional sucker and shoot tips. Results also demonstrate that banana plants with agronomical behavior, similar to those produced by the conventional method and shoot tip propagation could also be regenerated from embryogenic cell suspension.
4.15. Phenotypic variations Plants obtained through somatic embryogenesis showed growth patterns similar to that of shoot tips and conventional suckers derived plants in terms of pseudostem height and girth, number of leaves, leaf size and area and fruiting characteristic features, yet some morphological variations were observed. In cv. Rasthali plants
134 regenerated through ECS showed 1.0% variation whereas, in cv. Nendran 0.90% variants were recorded (Table-37). Followed by ECS, shoot tip derived plants showed 0.79% and 0.85% variation in test cvs. Rasthali and Nendran respectively. Plants propagated through conventional suckers revealed minimum variation (0.57% in Rasthali and 0.60% in Nendran respectively).
Table 37. Evaluation of ECS derived plants in field conditions for somaclonal variation
Rasthali
Types of variations (%)
Source Variegated Deformed Change in Total variation leaves leaves colour
Sucker 0.60±0.85c 0.55±0.90c 0 0.57±0.50c
Shoot tip 0.8±0.75b 0.75±1.0b 0.82±1.0b 0.79±1.2b
ECS 0.90±0.90a 1.0±0.95a 1.2±1.3a 1.0±0.95a
Nendran
Types of variations (%)
Source Variegated Deformed Change in Total variation leaves leaves colour
Sucker 0.70±0.86c 0.50±0.80b 0 0.60±1.0c
Shoot tip 0.85±0.80a 0.45±0.95c 1.2±0.86a 0.85±1.3b
ECS 0.80±0.65b 0.87±0.75a 1.0±1.3b 0.9±1.2a
* Each value represents the treatment means of five independent replicates. Values with same letter with in columns are not significantly different according to DMRT at p = 0.05 level.
Change in colour of leaves in in vitro derived plants was recorded in higher percentage compared to other variations like deformed and variegated leaves (Table- 37). 1.2% and 1% of cvs. Rasthali and Nendran showed change in leaf colour whereas, no such observations were recorded plants obtained through conventional methods. Second highest percent of variation were recorded interms of varietaged leaves. In cv.
135 Rasthali 0.90% of plants regenerated from ECS produced variegated leaves. Similar results were obtained in cv. Nendran where 0.80% of variegated leaves were obtained from ECS derived plants. Present result is in line to earlier finding where Cote et al. (2000), obtained 0.5-1.3% variegated leaves in plants regenerated from somatic embryos in cv. Grand Naine (AAA) and further recorded that variation disappeared when plants were shifted to field. They also reported that morphological changes like this perhaps may be due to epigenetic changes. Earlier reports states that variations interms of variegated leaves or deformed limbs tend to decline in its second growing season until the first (Israeli et al., 1995). But no such deformed limbs were observed during field evaluation of two test cultivars. Grapin, (1995) reported 16-22.1% of somaclonal variants from cell suspensions of male inflorescences in cv. 'French Shadow' (AAB) whereas, Shchukin et al. (1997) obtained values between 1.6-7.9% of somaclonal variants in cv. 'Grand Naine' (AAA), when used same system of plant regeneration.
Vuylsteke (2001) noted that variations found in inflorescence were stable over bananas tubers, which suggests that this variation is genetic. Dwarfisms have been reported as one of the most common variants in banana (Reuveni et al., 1986; Stover, 1987), but in present investigation no such variations were observed. Vuylsteke et al. (1988) observed variation of 6.0% in cv. 'Agbagba' (AAB) without the presence of stunting among the variants detected.
Earlier reports states that use of adventitious buds for mass multiplication produces greater genetic instability compared to axillary buds (Scowcroft, 1984). Later Schoofs et al. (1999) identified an extreme case of off-type plants (99.5%) in terms of long and narrow leaves in the plants obtained from embryogenic cell suspension of cv. 'Williams' (AAA 'Cavendish') derived through proliferating meristems. They also reported that these variation may be due to the usage of high concentration of 6-BAP (22.5 mg/l) in callus induction medium. Related to the use of high concentrations of growth regulators in culture media, Sahijram et al. (2003) argued that growth regulators and especially the 6-BAP, should be used in minimum quantities necessary to decrease the production of somaclonal variants in in vitro propagation methods. In recent past Gomez et al. (2006) recorded only 0.13% of total phenotypic variation of plants obtained from somatic embryos in cv. 'FHIA-18' (AAAB). Whereas, in plantain,
136 Krikorian et al. (1993) reported that frequency of variants in a certain cultivar was confined to individual primary explant rather than clones, where same chimeric heterogeneity of the primary explant was retained (Reuveni and Israeli, 1990).
The variations found in ECS derived plants may also be due to continuous availability of high levels of nutrients which have been noted to induce hyper-hydricity and alterations in morphology. Hyper-hydricity, otherwise known as vitrification phenomenon, has also been prevalent in xerophytic plants. Such morphological changes, however, were found un-associated with the genetic change (Goto et al., 1998), as also observed in ECS derived banana plants in present study. According to Ishii et al. (1987), absence of change in isozyme patterns of morphological off-type plants indicates that there could be temporary alterations in the physiological states of the shoots. Though, minute variations were observed in ECS derived plants of cvs. Rasthali and Nendran, in field conditions, these plants were found to be with much vigour and improved yield compared to conventional sucker and shoot tip derived plants. This genetic dissimilarity coupled with phenotypic similarity may represent the potential for particular paternal alleles, which are not necessarily exhibited phenotypically, to accumulate during the process of advancement through multiple generations of selfing and selection. Similar results were obtained by Dhed’a et al., (1991) where 5-10% abnormal somatic embryos recoverd from a ‘Bluggoe suspension, which in spite of their abnormality could also grow into normal plants.
The results in this investigation indicated that apart from genome, type of explant used (immature male flower buds) in the cultivars (Rasthali and Nendran) and media composition is the deciding factor in occurrence of somaclonal variants. 0.57-1.0% of variations observed in plants regenerated in test cultivars through three different sources was significantly less compared to results obtained by other researchers. Although the methodology (ECS) used for plant propagation produced somaclonal variants, yet is considered low in the literature sited above where banana plants with less than 5.0% of off-type plants, are considered commercially acceptable (Stover, 1987) (Figure 22). In conclusion, ECS derived plants in Indian commercial banana have been genetically analyzed using molecular markers and further subjected to morphotaxonomic analysis and found genetically stable with improved vigour and yield.
137 Plate 22 Schematic presentation plantlet regeneration through embryogenic cell suspension in banana a - Banana field b - Male flower bud c - Explants in callus induction medium d - Ideal callus e - Cell lines in shaker f - Homogenous suspension g - Somatic embryos h - Germination of somatic embryos i - Rooted plantlet obtained from ECS j - Plants in primary hardening k - Plants in secondary hardening l - Plant ready for planting in field
PLATE 22
SSuummmmaarryy
Embryogenic cell suspension pathway in banana plants meets two main goals i.e. for mass propagation and a tool for genetic improvement through genetic transformation. With following objective the present investigation was carried out to screen embryogenic capacity of 11 commercial Indian cultivars of bananas. Factors controlling embryogenesis was studied and repeatable protocols for indirect somatic embryogenesis through embryogenic cell suspension was developed for two commercial cultivars of bananas Rasthali and Nendran respectively. Regenerated plants were subjected to fidelity test and evaluated for the agronomical characteristic features. From the present study following conclusions were made-
Callus induction Immature male flowers of test cultivars from position 1-16 (1 being the flower next to floral meristem) were used as explants for callus induction.
Irrespective of the genome, maximum callus induction frequency (47.0 in cv. Kallumonthan to 70.3% cv. Grand Naine) was obtained in MS media supplemented with 4 mg/l 2,4-D, 1 mg/l IAA and 1 mg/l NAA.
Floral hands near meristematic dome (0-2) failed to survive in most of the test cultivars. More than 50% of cultured explants produced calli (yellowish white compact/friable) obtained from position 6-8.
Embryogenic frequency of explants obtained from position 6-8 was found maximum (53.5% cv. Grand Naine - AAA to 77.5% cv. Poovan - AB). Overall embryogenic capacity ranged from 0.1% (cv. Chakkia - ABB) to 17.4% (cv. Rasthali - AAB).
Irrespective of the genome, complete darkness was found favorable for callus induction. Embryogenic callus obtained was yellowish white and friable nature.
138 Preculture of explants in liquid callus induction medium for 5 days showed maximum reduction (17.0%) in mortality due to phenolic in cv. Poovan (AB).
3% Sucrose (carbon source) was found best for somatic embryogenesis where low levels of sucrose (1%) reduced blackening but stimulated growth of non embryogenic friable callus whereas higher concentration (4%) increased explants blackening.
Ideal complexes were found to contain many clusters of non organized embryogenic cells suitable for initiation of cell suspension.
Embryogenic cell suspension Liquid medium with MS salts, vitamins and 2,4-D (1 mg/l) was efficient for the survival of embryogenic complex obtained in most of the test cultivars.
Increase in settled cell volume of suspension in six test cultivars (Grand Naine, Robusta, Rasthali, Nendran, Ney poovan and Karpooravalli) and 50-75% of explants survival in two cultivars (Chakkia and Poovan) was recorded when suspension medium with 45 g/l sucrose.
Embryogenic structures consist of actively dividing cell masses with small, spherical or ovoid embryogenic cells with a dense cytoplasm, thick wall and a large nucleus in relation to the cell (80 and 300 μm in size).
Starting ECS with few embryogenic pockets (ideal calli), subculturing of ECS exactly after every 24 hrs for the first fifteen days and gradual scaling up of medium from 4 ml to 15 ml in 60 days is beneficial for better uniformity of cell composition.
The cell density of 3.0% of SCV favored cell proliferation cvs. Rasthali and Nendran. Exponential phase without deterioration in the quality of ECS was noticed between 18-21 days.
139 Regeneration of somatic embryos Picloram (1 mg/l) produced maximum number of somatic embryos (8277 nos. in cv. Rasthlai and 5577 in cv. Nendran) when supplemented with SH salts and MS vitamins. Addition of 0.25 mg/l picloram to standard SH medium increased the embryo count drastically in both cultivars (1,56,000 and 95,600 cvs. Rasthali and Nendran).
Somatic embryos incubated in culture medium with MS salts and vitamin with 0.22 mg/l-1 zeatin for a period of 30 days led to 28.0% and 18.6% germination in cvs. Rasthali and Nendran.
Somatic embryos regenerated on modified regeneration medium can be directly transferred to germination medium without transferring to maturation medium which gives a time gain of 30 days and increase the longevity of availability of explant for other experiments.
ECS can be successfully used for mass multiplication upto two years (39.3% in Rasthali and 30.4% in Nendran germination), beyond which competency decreased.
Repetitive embryogenesis MS salts and vitamins with 2 mg/l BAP with 0.2 mg/l IAA produced highest percentage of secondary somatic embryos in Rasthali (49.0%) and Nendran (40.5%).
For multiplication of somatic embryos in liquid medium, 0.5 g and 0.75 g innoculum density was required to show maximum increase in fresh in cvs. Rasthali (14-fold) and Nendran (20 fold) respectively after 30 days.
Synchronized growth pattern Liquid preculture of somatic embryos in half strength germination medium for 21 days increased the germination capacity by 16.9% in cv. Rasthali and 18.8% in cv. Nendran.
Acclimatization phase Plants regenerated through embryogenic cell suspension showed survival rate of 91.0 to 92.5%. During this phase plantlets showed 0.5-1.3% variegated leaves.
140 Genetic fidelity study Comparison of SSR (20 nos.) and ISSR (10 nos.) molecular markers were used against 20 plants (from each cultivar) regenerated through ECS were chosen from 500- plus plantlets of test cultivars with respect to two controls (shoot tip and sucker).
SSR primers produced total 484 and 418 bands in cvs. Rasthali and Nendran respectively, giving rise to monomorphic patterns across all the plantlets.
10 ISSR primers produced 78 scorable bands between 316 bp to 1856 bp in size in cv. Rasthali. 95.9% monomorphism and 7.4% to 10% polymorphism with average of 3.6% was observed.
Totally 64 scorable band classes ranging from 393 bp to 1760 bp in size were produced by 10 ISSR primer in cv. Nendran. Polymorphic classes ranged from 10% to 25% with an average of 4.6% whereas, 95.3% monomorphic bands were obtained.
Biometric analysis Parameters like pseudostem height and girth, petiole length, number of leaves at shooting and leaf area of the plants produced through somatic embryogenesis was compared with shoot tip and sucker derived plantlets.
Among three sources, pseudostem height was maximum in ECS derived plants (288.5 cm Rasthali and 289.3 cm Nendran), followed by shoot tip derived plants in cv. Rasthali (291.4 cm) and sucker derived plants in cv. Nendran (287.7 cm) respectively.
In vitro raised plants established earlier and grew more vigorously, this difference went on decreasing and at the time of flowering, sucker derived plants in Rasthali (72.7 cm) and ECS derived plants (60.8 cm) in cv. Nendran showed maximum pseudostem thickness.
In cv. Rasthali ECS derived plants regenerated 15.6 leaves followed by sucker and shoot tip derived plants (14.5 and 14.4). Whereas, in cv. Nendran, sucker and ECS derived plants produced equal number of leaves (13.9), followed by shoot tip derived plants (12.7).
141
ECS derived plantlets had maximum leaf area (13.12x104) compared to sucker (12.72x104) or shoot tip (12.22x104) derived plants in cv. Rasthali and similar results were obtained in cv. Nendran (12.8x104 ECS derived plant).
In cv. Rasthali, on the average, ECS and shoot tip derived plants flowered after 314.6 days and 314.0 days of plantation respectively whereas, sucker derived plants took 316 days for emergence of inflorescence. Similar results were obtained from cv. Nendran where ECS derived plants flower earlier (271.6 days) followed by shoot tip (273.2 days) and sucker (277.6 days) derived plants respectively.
Bunch with maximum weight in cvs. Rasthali and Nendran were obtained from ECS derived plants (13.48 kgs and 12.3 kgs). In cv. Rasthali ECS derived plants produced an average of 7.7 hands per bunch followed by sucker (7.4) and shoot tips (7.3) derived plants. Similar results were obtained in cv. Nendran where ECS derived plants produced an average of 6.5 hands per bunch, followed by shoot tip and sucker propagated plants (6.4).
Other parameters like total number of fruits per hand and in single bunch showed that ECS derived plants proved efficient compared to shoot tip and sucker derived plants in both test cultivars Rasthali and Nendran
Somoclonal variations In general cv. Rasthali plants regenerated through ECS showed 1.0% of variation whereas, 0.90% variants were recorded cv. Nendran.
Shoot tip derived plants showed 0.79% and 0.85% of variation in cvs. Rasthali and Nendran respectively.
Plants propagated through conventional suckers revealed minimum variation (0.57% in Rasthali and 0.60% in Nendran).
142 1.2% of 1% of variation was recorded in leaf colour of cvs. Rasthali and Nendran whereas, no such observations was observed in plants obtained thorough conventional method.
Rasthali 0.90% of plants regenerated from ECS produced variegated leaves. Similar results were obtained in cv. Nendran where 0.80% of variegated leaves were produced in ECS derived plants.
In conclusion, ECS derived plants in Indian commercial banana have been genetically analyzed using molecular markers and further subjected to morphotaxonomic analysis and found genetically stable with improved vigor and yield.
143 BBiibblliiooggrraapphhyy
Afza, R., Roux. N., Brunner. H., Van Duren, M. and Morpurgo, R. (1994). Musa mutation Techniques for Musa. In: Jones, D. R., ed. The improvement and testing of Musa: a global partnership. Honduras: INIBAP., 207–208
Alderson, P.G., Harbour, M. A. and Patience, P. A. (1987). Micropropagation of Prunus tenella cv. Firechill, Acta Horticulture., 212: 463-468.
Al-Zahim, M. (1996). Induction of somatic embryogenesis and the use the RAPD to classify and to detect somaclonal variation in garlic (Allium sativum L.), pp.184. Ph.D. thesis, University of Birmingham, UK.
Ammiraju, J. S. S., Dholakia, B. B., Santra, D. K., Singh, H., Lagu, M. D., Tamhankar, S. A., Dhaliwal, H. S., Rao, V. S., Gupta, V. S. and Ranjekar, P. K. (2001). Identification of inter simple sequence repeat (ISSR) markers associated with seed size in wheat. Theor. Appl. Genet., 102: 726-732.
Ammirato, P.V., Sommers, D.A., Hackett, W.R. and Biesboer, D.D. (eds). (1987). Organizational events during somatic embryogenesis. In: Green Plant Tiss. and Cell Cult., 57-81.
Anderson, J.A., Churchill, G.A., Autroque, J.E., Tanksley, S.D., Swells. M.E. (1993) Optimising selection for plant linkage map. Genome., 36 : 181-186.
Antra Ghosh, T., Ganapathi, R., Pravendra Nath, V. and Bapat, A. (2009). Establishment of embryogenic cell suspension cultures and Agrobacterium- mediated transformation in an important Cavendish banana cv. Robusta (AAA). Plant Cell Tiss. and Org. Cult., 97: 131-139.
Argent,G.C.G.(1976). The wild bananas of Papua New Guinea. Notes from Royal Botanic Garden Edinburgh., 35: 77-114.
Arinaitwe, G (1999). Determination of appropriate In vitro micropropagation protocols for recalcitrant banana cultivars. MSC. Thesis, Makerere University, Kampala, Uganda.
Assani, A., Haicour, R., Wenzel, G., Cote, F., Bakry, F., Foroughi Wehr, B., Ducreux, G., Ambroise, A. and Grapin, A. (2001). Plant regeneration from protoplasts of dessert banana cv. Grand Naine (Musa spp., Cavendish sub-group AAA) via somatic embryogeneis. Plant Cell Rep., 20: 482-488.
i Atanassov, A. and Brown, D.C.W. (1984). Plant regeneration from suspension culture and mesophyll protoplast of Medicago sativa L. Plant Cell Tiss. and Org. Cult., 3 : 149-1 62.
Baker, J.G. (1893). A synopsis of the genera and species of Musaceae. Ann. of Bot., (Oxford) 7: 189–229.
Banerjee, N. and De Langhe, E. (1985). A tissue culture technique for rapid clonal propagation and storage under minimal growth conditions of Musa (banana and plantain). Plant Cell Rep., 4: 351-354.
Banerjee, N. and Sharma, A.K. (1989). Chromosome constitution and alkaloid content in Rauwolfiia L. (Apocynaceae). Cytologia., 54: 723-728.
Banerjee, N. and Sharma, A. K. (1988). In vitro response as a reflection of genomic diversity in long-term cultures of Musa. Theor. Appl. Genet., 76:733-736.
Banerjee, N., Vuylsteke, D. and De Langhe E. (1986). Meristem tip culture of Musa: histomorphological studies of shoot bud proliferation, pp. 139-147. In: Plant Tissue Culture and its Agricultural Applications. Withers LA and Anderson PG (eds). UK: Butterworth Scientific Ltd.
Barranco, L.A. (2000). Development of somatic embryogenesis in liquid media (Musa AAA cv. Great Dwarf). Thesis for the scientific degree of Master of Science in Plant Biotechnology. Institute of Plant Biotechnology. Universidad Central de Las Villas. Santa Clara, Cuba; 57p.
Barranco, L.A. (2001). Somatic embryogenesis in banana (Musa AAAB, cv. 'FHIA- 18') using liquid culture media. Option to the thesis presented in scientific degree of Doctor of Agricultural Sciences. Institute of Plant Biotechnology. Universidad Central de Las Villas. Santa Clara, Cuba; 107p.
Barrett, C., Lefort, F. and Doughlas, G.C. (1997). Genetic characterization of oak seedlings, epicormic, crown and micropropagated shoots from mature trees by RAPD and microsatellite PCR. Sci. Horti., 70:319-330.
Bayliss, M.W. (1980). Chromosomal variation in plant tissues in culture. International Review on Cytol., 11: 113-114.
Becker, D. K., Dugdale, B., Smith, M. K., Harding. R. M. and Dale, J. L. (2000). Genetic transformation of Cavendish banana (Musa spp. AAA group) cv. Grand Naine via microprojectile bombardment. Plant Cell Rep., 19: 229-234.
ii Bennici Andrea., Anzidei Maria. and Vendramin Giovanni G. (2004). Genetic stability and uniformity of Foeniculum vulgare Mill. regenerated plants through organogenesis and somatic embryogenesis. Plant Sci., 166: 221-227.
Benzoin, B. and Phillips, R.L. (1988). Cytogenetic stability of maize tissue cultures; a cell line pedigree analysis. Genome., 30: 318-325.
Bhagyalakshmi, N. and Singh., Narendra, S. (1995). Role of liquid versus agar-gelled media in mass propagation and ex vitro survival in bananas. Plant Cell. Tiss. and Org. Cult., 41: 71-73.
Bhansali, R. and Singh, K. (1982). Callus and shoot formation from leaf of sugarcane in tissue cultures. Phytomorph., 12: 167-170.
Bhatia, C.R., Joshua, D.C. and Mathew, H. (1985). Somaclonal variation: a genetic interpretation based on the rates of spontaneous chromosomal aberrations and mutations. Trends in Plants Res., 317-326.
Bornet, B. and Branchard, M. (2001). Nonanchored inter simple sequence repeat (ISSR) markers: reproducible and specific tools for genome fingerprinting. Plant Mol. Biol. Rep., 19: 209 -215.
Bornman, C.H. (1993). Micropropagation and somatic embryogenesis. In: Hayward, M.D., Bosemark, N.O. and Romagosa, I. (Eds.). Plant Breeding, Principles and Prospects. Chapman and Hall, London, pp. 247–260
Botti, C. and Vsail, I.K. (1983). Z Pflanzenphysiol., 111: 319-325.
Brouhns, G. (1957). Note sur la croissance du bananier Gros Michel. Fruits., 12: 261 – 268.
Brown, D. and Atanassov, A. (1985) Role of genetic background in somatic embryogenesis in Medicago. Plant Cell Tiss. Org. Cult., 4: 111-122.
Brown, D.C.W. (1988). Germplasm determination of In vitro somatic embryogenesis in alfalfa. Horti. Sci., 23:526-531.
Brown, D.C.W. and Atanassov, A. (1986). Role of genetic background in somatic embryogenesis in Medicago. Plant Cell Tiss. and Org. cult., 4: 111-122.
Brown, D.C.W., Finstad, K.I., and Watson, E.M. 1995. Somatic embryogenesis in Academic Publishers. Dordrecht, The Netherlands, 345-416.
Brown, R.C., Lemmon, B.E., Nguyen and Olsen, O.A. (1999). Development of endosperm in Arabidopsis thaliana. Sex Plant Reprod., 12: 32-42.
iii Cabasson, C., Alvard, D., Dambier, D., Ollitrault, P. and Teirsson, C. (1997). Improvement of citrus somatic embryo development by temporary immersion. Plant Cell. Tiss. Org. Cult., 50:33-37.
Carreel, F. (1994). Etude de la diversite des bananiers (genera Musa) al aide des masquers RFLP. These de la Institut, National Agronomiques, Paris, Grignon. Pp. 90.
Carreel, F., Faure, S., Gonzales de Leon, D., Lagoda, P. J. L. Perrier, X., Bakry, F., Tezenas du Montcel, H. Lanaud, C. and Horry, J. P. (1994). Evaluation de la diversite genetique chez les bananiers diploids. Gene. Selec. Evol., 26: 125-136.
Champion, J. and Siossaram, D. (1970). L’enrancinement du bananier das les conditions de la station Neufchateau (Guadeloupe). Fruits., 25: 847 – 859.
Cheesman, E. E. (1948). Calssification of the bananas II. The genus Musa L., Kew Bulletin, 2: 106-117.
Cheesman, E.E. (1947). Classification of the bananas. II. The Genus Musa L. Kew Bulletin 2:106–117.
Chen, T.H.H., Marowitch, J. and Thompson, B.G. (1987). Genotypic effects on somatic embryogenesis and plant regeneration from callus cultures of alfalfa. Plant Cell, Tiss. and Org. Cult., 8:73-81.
Chen, W. H., Chen, T. M., Fu, Y. M., Hsieh, R. M. and Chen, W. S. (1998). Studies on somaclonal variation in Phalaenopsis. Plant Cell Rep., 18:7–13.
Chong-perez, B., Gomez-kosky, R., Reyes-vega, M., Bermudez-Carballosa, I., Gallardo-colina, J., Freire-seijo, M., Posada-perez, I., Herrera-o’farril, I. and Swennen, R. (2005). New methodology for the establishment of cell suspensions of ‘Grand Naine’ (AAA). Info Musa., 14: 13-18.
Chu, CC., Wang, C.C., Sun, C.S., Hsu, C., Yin, K.C., Chu, C.Y. and Bi, F.Y. (1975). Establishment of an efficient medium for another culture of rice through comparative experiments on the nitrogen sources. Sci. Sin., 18 :650- 659.
Cline, V.W. (2001). Population dynamics of Poa annua L. on a northern golf course. Ph.D. diss. Univ. of Minnesota, USA.
Close, K.R. and Gallagher-Ludeman, L.A. (1989). Structure activity relationship of auxin-like plant growth regulators and genetic influences on the culture induction response in maize (Zea mays. L). Plant Sci., 61:245-252.
iv Coates, D.J. and Byrne, M. (2005). Genetic variation in plant populations: assessing cause and pattern. In Plant Diversity and Evolution: Genotypic and Phenotypic Variation of Higher Plants (ed RJ Henry). CAB International, Wallingford. pp. 139–164.
Conger, B.V., Hanning, G. E., Gray, D. J. and MC Daniel, J. K. (1983). Direct Embryogenesis from mesophyll cells of Orchardgrass. Sci., 221: 850-851.
Cook,T.J., Racusen, R.H and Cohen, J.D. (1993). The role of auxin in plant embryogenesis. Plant Cell., 5:1494-1495.
Cote, F. X, Domergue, R., Monmarson, S. Schwendiman, J., Teison, C. and Escalant, J. V. (1996). Embryogenic cell suspensions from the male flower of Musa AAA. Cv. Grand naine. Physiol. Plant., 97: 285-290.
Cote, F. X., Folliot, M., Domergue, R. and Dubois. C. (2000). Field performance of embryogenic cell suspension-derived banana plants (Musa AAA, cv. Grande naine) Euphytica., 112: 245-251.
Cote, F. X., Sandavol, J. A., Marie, P. and Auboiron, E. (1993). Variations in micropropagated banana and plantains. Literature survey. Fruits., 48: 15-22.
Creemers-Molenaar, J., Loeffen, J.P.M., vna Rossum , M. and Colijn-Hooymans, C.M. (1992). The effect of genotype, cold storage and ploidy level on the morphogenic respone of perennial ryegrass (Lolium perenne L.) suspension cultures. Plant Sci., 83:87-94.
Cronauer, S.S. and Krikorian A.D. (1984). Multiplication of Musa from excised stem tips. Ann. Bot., (London) 53 : 321 - 328.
Cronauer, S.S. and Krikorian, A. D. (1983). Somatic embryo from cultured tissue of triploid plantains (Musa ABB). Plant Cell Rep., 2: 289-291.
Cronauer-Mitra, S.S. and Krikorian, A. D. (1988). Plant regeneration via somatic embryogenesis in the seeded diploid banana Musa ornate Roxb. Plant Cell Rep., 7: 23-25.
Cullis, C. A. and Cleary, W. (1986). DNA variation in flax tissue culture. Can. J. of Gen. and Cytol., 28: 247-251.
D’Amato, F. (1978). Chromosome number variation in cultured cells and regenerated plants. In T. A. Thorpe (ed.). Frontiers of plant tissue culture. Pp. 287 – 295. IAPTC/ University of Calgary, Calgary.
v Damasco, O. P., Graham,G.C., Henry, R.J., Adkins, S.W., Smith, M.K., Godwin, I.D. (1996). Random amplified polymorphic DNA (RAPD) detection of dwarf off- types in micropropagated Cavendish Musa spp.ABB group). Plant Cell Rep., 16: 118-123.
Daniells, J.W. (1988). Comparison of growth and yield of bananas derived from tissue culture and conventional planting material. Banana Newsletter. 11 :2.
Daniels, D., Gomez Kosky, R. and Reyes Vega, M. (2002). Plant regeneration system via somatic embryogenesis in the hybrid cultivar FHIA-21 (Musa sp. AAAB group). In-Vitro Cell and Develop. Biol.-Plant, 38: 330-333.
De Klerk G.J. (1990). How to measure somaclonal variation. Acta Botanica Neerlandica 39: 129-144.
De Langhe, E., Pillay, M., Tenkouano, A., Swennen, R., Suleiman, M. and Gisil, J. (2005). Integrating morphological and molecular taxonomy in Musa: the African plantains (Musa spp. AAB group). Plant Syst. and Evol., 225:225-236.
De Wald,S, G., Luz, R. E, Moore, G.A. (1989). Optimizing somatic embryo production in mango. J. Am. Soc. Hort, Sci., 114:712-716.
Debergh, P.C. (1983). Effects of agar brand and concentration on the tissue culture medium. Physiol. Plant. 59: 270-276. del-Sol, L., Gomez, G., Escalant, Reyas, M., Freire, M., Cordeiros, M. and Herrera, I. (1995). Somatic embryogenesis in banana and plantain using immature male flowers. Advance Modern Biotechnol., 3:13.
Denchev P.D., Kuklin, A.I., Atanassov, A.I. and Scragg, A.H. (1993). Kinetic studies of embryo development and nutrient utilization in an alfalfa direct somatic embryogenic system. Plant Cell Tiss. and Org. Cult. 33: 67–73
Deng, Z.N., Gentile, A., Nicolosi, E., Domina, E., Vardi, A. and Tribulato, E. (1995). Identification of In vitro and in vivo lemon mutants with RAPD markers. J. Hort. Sci., 70: 117-125.
Denton, I.R., Westcott, R.J. and Ford-Lloyd, B.V. (1977). Phenotypic variation of solanum tuberosum. cv. Dr McIntosh regenerated directly from shoot tip culture. Potato Res. 20: 131-136.
Devarumath, R.M., Nandy, S., Rani, V., Marimuthu, S., Muraleedharan, N. and Raina, S.N. (2002). RAPD, ISSR and RFLP fingerprints as useful markers to evaluate genetic intergrity of diploid and triploid elite tea clones representing Camellia
vi sinensis (China type) and C. assamica ssp. assamica (Assam type). Plant Cell Rep., 21: 166-173.
Dhed’a, D. (1992). Culture de suspensions cellularies embryogeniques et regeneration en plantules par embryogenese somatique chez le bananier et le bananier plantain (Musa spp). PhD thesis, K.U.Leuven, Belgium. 171 pp.
Dhed’a, D., Dumortier, F., Panis, B., Vuylsteke, D. and De Langhe, E. (1991). Plant regeneration in cell suspension cultures of the cooking banana cv. ‘Bluggoe’ (Musa spp. ABB group). Fruits., 46: 125-135.
Dion Daniels, Rafael Gomez Kosky, and Maritza Reyes vega. (2002). Plant regeneration system via somatic embryogenesis in the hybrid cultivar FHIA-21 (Musa spp. AAAB group). In vitro Cell. Dev. Biol. Plant., 38: 330-333.
Dolezel, J. and Novak, F.J. (1986). Sister chromatid exchanges in garlic (Allium sativum L.) callus cells. Plant Cell Rep., 5: 280-283.
Domergue, F.G.R., Ferriere, N. and Cote, F.X., (2000). Morphohistological study of the different constituents of a banana (Musa AAA, cv. Grand naine) embryogenic cell suspension. Plant Cell Rep., 19: 748-754.
Domingues, E.T., Tulmann-Neto, A. and Mendes, B. N. J. (1996). Induction of embryogenic structures on rhizome and pseudostem tissue of banana. Bragantia., 55:1-8. dos Santos, A.V.P., Outka D.E., Cocking, E.D. and Davey, M.R. (1980). Organogenesis and somatic embryogenesis in tissues derived from leaf protoplasts and leaf explants of Medicago saliva. Z Pflarizenphysiol., 99:26 1- 270.
Drew, R. A. and M. K. Smith. (1990). Field evaluation of tissue-cultured bananas in south-eastern Queenland. Austrl. J. Expt. Agr., 30: 569 – 574.
Dubois, T., Guedira, M. and Vasseur, J. (1990). Direct somatic embryogenesis in roots of cicorium:: Is callose an early marker? Ann. of Bot., 65: 539-545.
Dudits, D., Gyorgyey, J., Bogre, L. and Bako, L. (1995). Molecular and cellular approaches to the analysis of plant embryo development from somatic cells in vitro. J. of Cell Sci., 99:475-484.
Dunstan, D.I., Tautorus, T.E. and Thorpe, T.A. (1995). Somatic embryogenesis in woody plants. In: Thorpe TA (ed.): In vitro Embryogenesis in Plants. Kluwer Academic Publishers. Dordrecht, The Netherlands.47 : 1-53 8.
vii Eapen, S., Kale, D. M. and George, L. (1998) Embryonal shoot tip multiplication in peanut: clonal fidelity and variation in regenerant plants. Tropical Agric. Res. Exten., 1:23–27.
Eckstein, K. and Robinson, J.C. (1995). Physiological responses of banana (Musa AAA; Cavendish sub-group) in the subtropics. IV. Comparison between tissue culture and conventional planting material during the first months of development. Journal for Horticultural Science., 70: 549-559.
Escalant, J. V., Teisson, C. and Cote, F. X. (1994). Amplified somatic embryogenesis from male flowers of triploid banana and plantain cultivars (Musa sp.). In vitro Cell and Develop. Biol., 30:181-186.
Escalant, J.V. and Teisson, C. (1988). Somatic embryogenesis in Musa sp. C.R. Seances-Acad. Sci. Ser., 306: 277-281.
Escalant, J.V. and Teisson, C. (1989). Somatic embryogenesis and plants from immature zygotic embryos of the species Musa acuminata and Musa balbisiana. Plant Cell Rep., 7: 665-668.
Escalant, J.V. and Teisson, C. (1993). Somatic embryogenesis and cell suspension in Musa. In Proceeding of the workshop on biotechnology applications for banana and plantain improvement held on San Jose, Costa Rica., 27-31. pp. 177-180.
Escalant, J.V. Chatelet,-Paduschek, C., Babeau, J., Grapin, A. and Teisson, C. (2003). Somatic embryogenesis in banana from young male flowers. In-Vitro cult. of trop. plants., P.61-63.
Etienne, H., Berger, A. and Carron, M.P. (1997). Water status of callus from Hevea brasilensis during induction of somatic embryogenesis. Physiol Plantaarum., 82: 213-218.
Evans, D. A. and W. R. Sharp. (1986). Applications of somoclonal variation. Biotech., 4: 528 – 532.
Evans, D. A., Sharp, W. R. and Flick, C. E. (1981). Growth and behaviour of cell cultures: Embryogenesis and organogenesis. In: Thorpe TA (ed) Plant Tissue Culture: Methods and Applications in Agriculture (pp. 45-113). Academic Press, New York.
FAO stat (2005). Food and Agricultural Organization of the United Nations Statistical Database. http://faostat. fao.org.
Feirer, R.P. and Simon, P.W. (1991). Biochemical difference between carrot inbreds differing in plant regeneration potential. Plant Cell Rep., 10:152-155.
viii Fischer, C. and Neuhaus, G. (1996). Influence of auxin on the establishment of bilateral symmetry in monocots. The Plant J., 9:659-669.
Fitchet, M. (1987). Somatic embryogenesis in callus of Dwarf Cavendish banana. Information Bulletin, Citrus and Subtropical Fruit Research Institute, South Africa 176: 1-2.
Ford-Lloyd, B.V, Sabir, A., Newbury, H.J., Todd, C. and Catty, J. (1992) Determination of genetic stability using isozymes and RFLPs in beet plants regenerated in vitro. Theor. Appl. Genet. 84:113-117.
Fourre, J. L., Berger, P., Niquet, L. and Andre, P. (1997). Somatic embryogenesis and somaclonal variation in Norway spruce: morphogenetic, cytogenetic and molecular approaches. Theor. Appl. Genet., 94:159–169.
Fujimura, T. and Komamine, A. (1979). Synchronization of somatic embryogenesis in a carrot cell suspension culture. New Phytol., 86: 162-164.
Gagliardi. R.F, Pacheco, G.P., Carneiro, L.A., Valls, J.F.M., Vieira, M.L.C., Mansur, E. (2003). Cryopreservation of Arachis species by vitrification of in vitro-grown shoot apices and genetic stability of recovered plants. Cryo Letters., 24: 103- 110.
Gamborg, O.L., Miller, R.A. and Ojirna, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res., 50: 151-158.
Ganapathi, T. R., Higgs, N. S., Balint Kurti, P. J., Arntzen, C. J., May, J. M. and Van Eck. (2001a). Agrobacterium mediated transformation of embryogenic cell suspension of the banana cultivar Rasthali (AAB), Plant Cell Rep., 157-162.
Ganapathi, T. R., Srinivas, L., Suprasanna, P. and Bapat, V. A. (2001b). Regeneration of plants from alginate encapsulated somatic embryos of banana cv. Rasthali (Musa spp. AAB group). In-Vitro Cell. and Develop. Biol. Plant., 37: 178-181.
Ganapathi, T. R., Suprasanna, P., Bapat, V. A., Kulkarni V.M. and Rao, P.S. (1999). Somatic embryogenesis and plant regeneration from male flower buds in banana. Curr. Sci., 76: 1228-1231.
Ganapathi, T.R. and Higgs, N. (1999). Transformation and regeneration of the banana cultivar Rasthali (AAB). Proceeding of the Intervational symposium on the molecualar and cellular biology of bananas. March 22-25. Ithaca. NY. USA. InfoMusa. 8 (1): XIII.
ix Gavidia, I., del Castillo Agudo, L., Perez-Bermudez, P. (1996). Selection and longterm cultures of high-yielding Digitalis obscura plants: RAPD markers for analysis of genetic stability. Plant. Sci., 121:197–205.
George, E. F. (2006). Plant propagation by tissue culture. Edington, Wilts: Exegetics Ltd.; 1993. Rafael G´omez Kosky, Luis Antonio Barranco, Borys Chong P´erez, Dion Daniels, Maritza Reyes Vega & Manuel de Feria Silva (2006). Trueness- to-type and yield components of the banana hybrid cultivar FHIA-18 plants regenerated via somatic embryogenesis in a bioreactor. Euphytica., 150: 63–68.
Georget, R., Domergue, R. Ferriere, N. and Cote, F. X. (2000). Morpho-histological study of the different constituents of a banana (Musa AAA, Cv. Grande naine) embryogenic cell suspension. Plant Cell Rep., 19: 748-754.
Ghosh, A. and Gadgil, V.N. (1979). Shift in ploidy level of callus tissue: A function of growth substances. Ind. J. of Exp. Biol., 17: 562-564.
Gomez Kosky, R., de Feria, M.S., Posada, L.P., Gilliard, T., Bernal, F.M., Chavez, M. M. and Quiala, E. M. (2002). Somatic embryogenesis of the banana hybrid cultivar FHIA-18 (AAAB) in liquid medium and scale-up in a bioreactor. Plant Cell Tiss. Cult., 68: 21-26.
Gomez, K.A. and Gomez, K.A. (1976). Statistical procedure for agricultural research with emphasis of rice. International Rice Research Institute. Los Bauos, Phillippines.
Gomez-Kosky, R., Gilliard, T., Barranco, L. A. and Reyas, M. (2000). Somatic embryogenesis in liquid media. Matuaration and enhancement of germination of the hybrid cultivar FHIA-18 (AAAB). InfoMusa., 9: 16-27.
Gomez-Kosky, R., Sol, L.D., Reyes, V.M., Seijo, M., Posada, P. L., Herrera, I. and Vincent, E.J. (2001). Somatic embryogenesis in banana and plantain (Musa sp.) from male immature flowers. Biotech-Veg., 1: 29-35.
Goto, S., Thakur, R. C. and Ishii, K. (1998). Determination of genetic stability in long- term micropropagated shoots of Pinus thunbergi Parl. using RAPD markers. Plant Cell Rep., 18:193–197.
Grapin, A. (1995). Regeneration par embryogenese somatique en milieu liquide et transformation genetique par biolistique de bananiers di-et triploids. Ph.D. thesis, Montpellier, France, 90 pp.
x Grapin, A., Oritz, J.L., Domergue, R., Babeau, J., Monmarson, S., Escalant, J.V., Teisson, C. and Cote, F. (1998). Escablishment of embryogenic callus and initiation and regeneration of embryogenic cell suspension from female and male immature flower of Musa. InfoMusa., 7: 13-15.
Grapin, A., Ortiz, J. L., Lescot, T., Ferriere, N. and Cote, F. X. (2000). Recover and regeneration of embryogenic culture from female flowers of False Horn Plantain. Plant Cell Tiss and Org Cult., 61: 237-244.
Grapin, A., Schwendiman, J. and Teisson, (1996). Somatic embryogenesis in plantain banana. In vitro Cell and Devlop. Biol., 32: 66-71.
Gray, D. J. (1995). Quiescence in monocotyledonous and dicotyledonous somatic embryos induced by dehydration. Horti. Sci., 22: 810-814.
Gray, D. J., Compton, M.E., Harrell, R.C. and Cantliffe, D.J. (1995). Somatic embryogenesis and the technology of synthetic seed. Biotechnology in Agriculture and Forestry., 30: 127–151.
Groll, J., Mycock, D. J., Gray, V. M. and Laminski, S. (2001). Secondary somatic embryogenesis of cassava in picloram supplemented media. Plant Cell Tiss. and Org. Cult., 65: 201-210.
Gupta, P. K. and Timmis, R. (1999). Conifer somatic embryo production from liquid culture. In: Altman A et al. (eds.) Plant Biotechnology and In vitro Biology in the 21st Century (pp.49-52), Kluwer Academic Publishers, Dordrecht.
Habiba, U., Reza, S., Saha, M.L., Khan, M.R. and Hadiuzzaman, S. (2002). Endogenous bacterial contamination during In vitro culture of table banana: Identification and prevention. Plant Tiss. Cult., 12 : 117-124.
Haccius, B. (1978). Question of unicellular origin of non zygotic embryos in callus cultures. Phytomorphology., 28:74-81.
Halperin, H. and Jensen, W. A. (1967). Ultrastructural changes during growth and embryogenesis in carrot cell cultures. J. Ultrastruct. Res., 18: 428-443.
Hamill, S. D., M. K. Smith and W. A. Dodd. 1992. In vitro induction of banana autotetraploids by colchicines treatment of micropropagated diploids. Austral. J. Bot 40: 887 – 896.
Hartmann, C., Henry, Y., De Buyser, J., Aubry, C., Rode, A. (1989). Identification of new mitochondrial genome organizations in wheat plants regenerated from somatic tissue cultures. Theor. Appl. Genet., 77:169–175.
xi Hashmi, G., Huettel, R., Meyer, R., Krusberg, L. and Hammerschlag, F.A. (1997). RAPD analysis of somaclonal variants derived from embryo callus cultures of peach. Plant Cell Rep., 16: 624-627.
Hatanaka T., Arakawa O., Yasuda T., Uchida N., Yamaguchi T. (1991). Effect of plant growth regulators on somatic embryogenesis in leaf cultures of Coffea canephora. Plant Cell Rep., 10:179-182.
Heide, O.M. (2001). Flowering responses of contrasting ecotypes of Poa annua and their putative ancestors Poa infirma and Poa supina. Ann. Bot., 87:795-804.
Heindorff, K., Reiger, R., Schubert, I., Michaelis, A and Aurich, O. (1987). Clastogenic adaptation of plant cells – reduction of the yeild of clastogen-induced chromatid aberrations by various pretreatment procedure. Mutation Res., 181: 157-171.
Heinze, B. and Schmidt, J. (1995). Monitoring genetic fidelity vs. somaclonal variation in Norway spruce (Picea abies) somatic embryogenesis by RAPD analysis. Euphytica., 85:341–345.
Henry, Y., Vain, P. and De Buyser, J. (1994). Genetic analysis of Musa plant tissue culture responses and regeneration capacities. Euphytica., 79: 45-48.
Higgins, P. and Mathias, R.J. (1987). The effect of the 4B chromosomes of hexaploid wheat on the growth and regeneration of callus cultures. Theor. Appl. Genet., 74: 439-444.
Hilbert, J.L., Dubois, T. and Vasseur, J. (1992). Detection of embryogenesis-related proteins during somatic embryo formation in Cichorium. Plant Physiol. and Biochem., 30: 733-741.
Ho, W., Vasil, I.K. (1983). Somatic embryogenesis in sugarcane (Saccharum officinarum L.) I. The morphology and physiology of callus formation and the ontogeny of somatic embryos. Protoplasma., 118:169–180.
Horry, J.P. (1989). Chemiotaxonomie et organization genetique dans le genre Musa. Fruits., 44:455-74.
Horry, J.P., Ortiz, R., Arnaud, E., Crouch, J.H., Fernis, R.S.B., Jones, D.R. Mateo, N., Picq, C. and Vylsteke. D. (1997). Banana and Plantain – In :Biodiversity in trust.Conservation and use of Plant genetic resources in CGIAR centers (D.Fuccillo, L.Sears and P.Stapleton, eds.). Cambridge University Press.
Huetteman, C.A. and Preece, J.E. (1993). Thidiazuron: a potent cytokinin for woody plant tissue culture. Plant Cell Tiss. and Org. Cult., 33: 105–19.
xii Hussey, G. (1983). In vitro propagation of horticultural and agricultural crops, pp.111- 138. In: Plant Biotechnology, Mantell S.H. and Smith, H (eds). Cambridge: Cambridge University Press.
Hwang, S. C. and W. H. Ko. (1987). Somaclonal variation of bananas and screening for resistance to Fusarium wilt. pp. (151 - 156). In: (eds. Persley G. J. and E. A. De Langhe) Proc. Intl. Wkshp. Cairns, Australia, 13 – 17 Oct. 1986. ACIAR Proc No. 21. Aust. Cent. Intl. Agr. Res., Canberra.
Ibaraki, Y. and Kurata, K. (2001). Automation of somatic embryo production. Plant Cell Tiss and Org Cult., 65: 179-199.
Ibaraki, Y., Kaneko, Y. and Kurata, K. (1998). Evaluation of embryogenic potential of cell suspension culture by texture analysis. Transaction of the ASAE. 41: 247- 252.
Ibaraki, Y., Matsushima, R. and Kurata, K. (2000). Analysis of morphological changes in carrot somatic embyogenesis by serial observation. Plant Cell Tiss and Org Cult., 61: 9-14.
INIBAP. (2000). Networking Banana and plantain: INIBAP Annual Report 1999. International Network for improvement of Bananas & plantain Montpellier, France.
INIBAP. 2003. Networking Banana and Plantain: INIBAP Annual Report 2002. International Network for the Improvement of Banana and Plantain, Montpellier, France, 40p.
Ishii, K., Moran, G.F., Bell, J.C.and Hartney, V. (1987). Genetic stability examination of micropropagated radiata pine (Pinus radiata) using isozyme assays. Journal of Japanese ForestSociety., vol. 69, p. 487-488.
Israeli, Y., Lahav, E. and Reuveni, O. (1995). In vitro culture of bananas. In: Bananas and Plantains pp. 147 – 178 (ed. S. Gowen). Chapman and Hall, London.
Israeli, Yair., Ben-Bassat., Dahlia. and Reuveni.(1996). Selection of stable banana clones which do not produce dwarf somaclonal variants during In vitro culture. Scientia Horti., 67:197-205.
Israelli Y., Reuveni, O. and Lahav, E. (1991). Qualitative aspects of somaclonal variations in banana propagated by in vitro techniques. Scientia Horti., 48: 71- 88.
xiii Ivanova, A., Velcheva, M., Denchev, P., Atanassov, A. and Van Onckelen, H.A., (1994). Endogenous hormone levels during direct somatic embryogenesis in Medicago falcata. Physiol. Plantarum., 92: 85-89.
Jackson Aimee, l., Ru Chen. and Lawrence Loeb, A.( 1998). Induction of Microsatellite instability by oxidative DNA damage. Proceedings of the National Academy of Sciences of the United States of America., 95:12468-12473.
Jackson, J. A. and Dale, P.J. (1989). Somaclonal variation in Lolium multiflorum L. and tumulentum L. Plant Cell Rep., 8: 161-164.
Jackson, J.A. and R.F. Lyndon. (1998). Habituation: Cultural curiosity or development determination? Physiol. Planta., 79: 579 583.
Jaligot, E., Rival, A., Beule. T., Dussert, S., Verdeil, J.L. (2000). Somaclonal variation in oil palm (Elaeis guineensis Jacq.): the DNA methylation hypothesis. Plant Cell Rep., 19: 684-90.
Jalil, M., Khalid, N. and Othman, R. (2003). Plant regeneration from embryogenic suspension cultures of Musa acuminate cv. Mass (AA). Plant Cell Tiss. and Org. Cult., 75: 209-214.
Jasrai, Y.T, Kannan, R.V, Ramakanthan. A. and George, M.M. (1999). Ex vitro survival of in vitro derived banana plants without greenhouse facilities. Plant Tiss. Cult., 9: 127 - 132.
Jayanthi, M. Mandal, P. K. (2001). Plant regeneration through somatic embryogenesis and RAPD analysis of regenerated plants in Tylophora indica (Burm. F. merrill.). In vitro Cell. Dev. Biol. Plant., 37:576–580.
Johnson, L.B. Stutevile, D.L., Schlarbaum, S.E. and Skinner, D.Z. (1984). Variation in phenotype and chromosome number in alfalfa protoclones regenerated from non-mutagenized callus. Crop Sci. 24: 948-951.
Johnson, P.G. and D.B White. (1998). Inheritance of flowering pattern among four annual bluegrass (Poa annua L.) genotypes. Crop Sci., 38(1):163-168. Johnson, P.G. and D.B. White. (1997a). Vernalization requirements among selected genotypes of annual bluegrass (Poa annua L.).Crop Sci., 37:1538-1542.
Johnson, P.G. and D.B. White. (1997b). Flowering responses of selected annual bluegrass genotypes under different photoperiod and cold treatments. Crop Sci., 34:1643-1747.
xiv Jordan, M.C., and Larter, E.N. (1985). Somaclonal variation in triticle (x Triticosecale Wittmack) cv. Carmen. Can. J. of Genet and Cytol., 27: 151-158.
Joshi, P. and Dhawan, V. (2007). Assessment of genetic fidelity of micropropagated Swertia chirayita plantlets by ISSR marker assay. Biol. Plant., 51:22–26
Kao, K.N., Miller, R.A., Gamborg, O.L. and Harvey, B.L. (1970). Variation in chromosome number and structure in plant cells grown in suspension cultures. Canadian J. of Cytol., 12: 180-191.
Karp, A. and Bright. S. W. J. (1985). On the causes and origins of somoclonal variation. Oxford surveys. Plant Mol. Cell Biol., 2: 199 – 234.
Kazumitsu Matsumoto, Marly Catarina felipe Coelho, Manoel Teixeira Souza Junior, and Batista Teixeira, (2006). Plantlet regeneration from suspension cells of a diploid hybrid banana. Joinville-Santa Catanna- BRASIL.
Kenneth, C., Torres. (1989). Tissue culture technique for horticultural crops. Chapman & Hall, New York London.
Khalil, S. M., Cheah, K. T., Perez, E. A., Gaskill, D. A. and Hu, J. S. (2002). Regeneration of banana (Musa spp. AAB cv. Dwarf Brazilian) via secondary somatic embryogeneisis. Plant Cell Rep., 20: 1128-1134.
Komatsuda, T. and Ohyama, K. (1988). Genotypes of high competence for somatic embryogenesis and plant regeneration in soybean Glycine max. Plant Cell Rep., 75: 695–700.
Krikorian, A. D. and Scott, M. E. (1995). Somatic embryogenesis in bananas and plantain (Musa clones and species). In Biotechnology in Agriculture and foresty, Somatic Embryogenesis and Synthetic Seed II (Y. P.Bajaj, ed.), Vol 1, pp. 183-195. Springer-Verlag, New York, NY. ISBN 0-387-57449-2.
Krikorian, A. D., Irizarry, H. Cronauer-Mitra, S. S. and Rivera, E. (1993). Clonal fidelity and variation in plantain (Musa AAB) regenerated from vegetative stem and floral axis tip in vitro. Ann. Bot., 71: 519 – 535.
KrishnaRaj, S. and Vasil, I.K. (1995). Somatic embryogenesis in herbaceous monocots. In: Thorpe TA (ed.): In Vitro Embryogenesis in Plants. Kluwer Academic Publishers. Dordrecht, The Netherlands. Pp 4: 17-470.
Kulkarni, V. M., Varshney, L. R., Bapat, V. A. Rao, P. S. (2002). Somatic embryogenesis and plant regeneration in a seeded banana (Ensete superbum (Roxb.) Cheesman). Current Sci., 83 : 939-941.
xv Kumar, V., Laour, A., Davey, M.R., Mullegun, B.J. and Lowe, K.C (1992). Pluronic F- 68 stimulates growth of solanum dulcamara in culture. J. Expt.Bot., 43: 487- 493.
Lagoda P.J.L., Dambier, D., Grapin, A., Baurens, F.C., Lanaud,C. and Noyer, J.L. (1998). Nonradioactive sequence-tagged microsatellite site analyses: A method transferable to the tropics. Electrophoresis., 19:152-157.
Lattoo, S.K., Bamotra, S., Dhar, R.S., Khan, S., Dhar, A.K. (2006). Rapid plant regeneration and analysis of genetic fidelity of in vitro derived plants of Chlorophytum arundinaceum Baker-an endangered medicinal herb. Plant Cell Rep., 25(6): 499-506.
Lebot, V., Aradhya, K. M., Manshard,T. R. and Meilleur, B. (1993). Genetic relationships among cultivated bananas and plantains from Asian and Pacific. Euphytica., 67: 163-76.
Lee, K., Jeon, H. and Kim M. (2002). Optimization of a mature embryo-based In vitro culture system for high-frequency somatic embryogenic callus induction and plant regeneration from japonica rice cultivars. Plant Cell Tiss. and Org. Cult., 71: 237-244.
Lee, M and Philips, R.L. (1987). Genetic variants in progeny of regenerated maize plants. Genome., 29: 834-838.
Lee, M., Zapata arias, F.J., Brunner, H. and Afza, R. (1997). Histology of somatic embryo initiation and organogenesis from rhizome explants of Musa spp. Plant Cell Tiss. and Org. cult., 51: 1-8.
Lemos, O.F. (1994). Somatic embryogenesis in three cultivars of banana crops (Musa spp., AAA and AAB groups). Piracicaba, SP (Brazil). pp. 159.
Levi, A. and Sink, K.C. (1991). Somatic embryogenesis in asparagus: the role of explants and growth regulators. Plant Cell Rep., 10:7 1-75.
Linsmaier, E.M. and Skoog, F. (1975). Organic growth factor requirements of tobacco tissue cultures. Physiol. Plant., 18: 100.
Lippmann, B. and Lippmann, G. (1993). Soybean embryo culture: factors influencing plant recovery from isolated embryos. Plant Cell Tiss. and Org. Cult., 32:83-90.
Litz, R. E. and Jarret, R. L. (1991). Regeneración de plantas en el cultivo de tejidos: embriogénesis somática y organogénesis. In: Roca W. M., Mroginski L. A. (Eds.). Cultivo de Tejidos en la Agricultura – Fundamentos Aplicaciones.Centro Internacional de Agricultura Tropical, Cali: 143-172.
xvi Liu, C.M., Xu, Z.H. and Chua, N.H. (1993). Proembryo culture: In vitro development of early globular-stage zygotic embryos from Bms- sica juncea. Plant J., 3: 291-300.
Liu, W., Moore, P.J. and Collins, G.B. (1993). Somatic embryogenesis in soybean via somatic embryo cycling. In vitro Cell. Dev. Biol., 28: 153- 160.
Ma, S. S. (1991). Somatic embryogenesis and plant regeneration from cell suspension culture of banana. In Proceedings of Symposium on Tissue culture of horticultural crops, Taipei Taiwan, 8-9 March 1988, pp. 181-188.
Maene, L . and de Bergh, P. (1985). Liquid medium additions to established tissue cultures to improve elongation and rooting in vivo Plant Cell Tiss. and Org. Cult., 5:23 - 33.
Mahanom Jalil, (2003). Plant regeneration from embryogenic suspension cultures of Musa acuminata cv. Mas (AA). Plant Cell Tiss. and Org. Cult., 75: 209-214.
Mahanom Jalil, Wong Wei Chee, Rofina Yasmin Othman, and Norzulaani Khalid. (2008). Morphohistological examination of somatic embryogenesis of Musa acuminate cv. Mas (AA). Scientia Horti., 117: 335-340.
Maheswaran, G. and Williams, E.G. (1985). Origin and development of somatic embryoids formed directly on immature embryos of Trifolium repens in vitro. Annals of Bot., 56: 619-630.
Maluszynska, J., Hasterok, R. and Weiss, H. (1998). rRNA genes their distribution and activity in plants. In: Maluszynska J (ed) Plant cytogenetics., pp.75–95.
Maribel Ramirez-villalobos. and Eva De Garcia. (2008). Obtainment of embryogenic cell suspension from scalps of the banana CIENBTA-03 (Musa sp., AAAA) and regeneration of the plants. Plant biotech., 5: 1-9.
Marriott, H. and Lancaster, P.A. (1983). Bananas and plantains. In handbook of Tropical foods. 85-143.
Marroquin, C. G., Paduscheck, C., Escalant, J. V. and Teisson, C. (1993). Somatic embryogenesis and plant regeneration through cell suspension in Musa acuminate. – In vitro Cell Dev. Biol., 29: 43-46.
Martin M, Sarmento D, Oliveira MM (2004). Genetic stability of micropropagated almond plantlets, as assessed by RAPD and ISSR markers. Plant Cell Rep., 23:492–496.
xvii Martin, K.P., Pachathundikandi, S.K., Zhang, C.L., Slater,A. and Madassery, J. (2006). RAPD analysis of a variantof banana (Musa sp.) cultivar Grande naine and its propagation via shoot tip culture. Musa Cell. Dev. Biol. Plant., 42(2): 188-192.
Martin, K.P., Sunandakumar, C., Chithra, M., Madhusoodanan, P.V (2005). Influence of auxins in direct In vitro morphogenesis of Euphorbia nivulia, a lectinaceous plant. In vitro Cell. and Devel. Biol.-Plant., 41:314-319
Mavituna, F., and Buyukalaca, S. (1996). Somatic embryogenesis of pepper in bioreactors: a study of bioreactor type and oxygen uptake rates. Appl. Microbiol. Biotech., 46: 327-333.
May, G.D., Afza, R., Mason, H.S., Wiecko, A., Novak, F. J. and Arntzen, C. J. (1995). Generation of transgenic banana (Musa acuminata) plants via Agrobacterium- mediated transformation. Biotechnol., 13: 486-492.
McClintock, B. (1984). The significance of responses of the genome to challenge. Sci., 226: 792-801.
McCoy, T.J., Phillips, R.L. and Rines, H.W. (1982). Cytogenetic analysis of plants regenerated from oat (Avena sativa) tissue culture: High frequency of partial chromosome loss. Can. J. of Gene. and Cytol., 24: 37-50.
McKersie, B.D. and Brown, D.C.W. (1996). Somatic embryogenesis and artificial seeds in forage legumes. Seed Sci. Res., 6: 109- 126.
Megia, R., Hacur, R., Tizroutine, S., Bui Trang, V., Rossignol, L., Sihachakr, D. and Schwendiman, J. (1993). Plant regeneration from cultured protoplasts of the cooking banana cv. Bluggoe (Musa spp., ABB group). Plant Cell Rep., 13: 41- 44.
Merkle, S.A., Parrott, W.A. and Flinn, B.S. (1995). Morphogenic aspects of somatic embryogenesis. In: Thorpe TA ed.: In vitro Embryogenesis in Plants. Kluwer Academic Publishers. pp 155-203.
Mezentsev, A.V. and Karelina, N.A. (1982). Effects of genotypic variations on callus formation and somatic embryogenesis in tissue culture of alfalfa in normal and extreme environment. Genetics., 18: 999- 1003.
Michaux-Ferriere, N., Schwendiman, J., Y (ed.). Dattee, C (ed.). Duman, A. Gallais. (1992). Histology of somatic embryogeneisis. Reprod. boil. and plant breeding., pp.247-259.
xviii Mitra, J and F.C. Steward (1961). Growth induction in cultures of Haplo pappus gracilis. II. The behavior of the nucleus. Am. J. Bot., 48: 358-368.
Modgil, M., Mahajan, K., Chakrabarti, S.K., Sharma, D.R. and Sobti, R.C. (2005). Molecular analysis of genetic stability in micropropagated apple root stock MM106. Scientia Horti., vol. 104(2): 151-160.
Mohatkar, L. C., Chaudhari, A. N., Deokar, A. B. and Shah, B. S. (1993). Organogenesis in Saccharum officinarum L. variety 'Co 740'. Curr. Science, 64 : 604-605.
Molle, F., Dupuis, J. M., Ducos, J. P., Anselm, A., Crolus-Savidan, I., Petiard, Y . and Freyssinet, G. (1993). Carrot somatic embryogenesis and its application to synthetic seeds. In: Redenbaugh K (ed.) Synseeds (pp.257-287). CRC Press, Boca Raton.
Morris, P.C., Kumar, A., Bowles, D.J and Cuming, A.C. (1990). Osmotic stress and abscisic acid induce expression in wheat Em genes. Eur J Biochem., 190: 625- 630.
Moy, Y., Hanson, D., Enger, D and Gutterson, N (1999). Analysis of uid A gene expression form transgenes in field grown Grand Naine (AAA) banana plants. Proceeding of the intervational symposium on the molecular and cellular biology of bananas, March 22-25. Ithaca, NY, USA (Abstracts). InfoMusa., 8 (1): XIII.
Moyer, B.G., Gustine, D.C (1984). Regeneration of coronilla varila L. (crown vetch) plants from callus culture. Plant Cell Tiss. and Org. Cult., 3: 143-148.
Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant., 15: 473-497.
Murashige, T., and Nakano, R. (1967). Chromosome complement as a determinant of the morphogenic potential of tobacco cells. Am. J. of Bot., 54: 963-970.
Nahamya, P (2000). Development of embryogenic cell suspensions for East African Highland bananas. MSC. Thesis, Makerere University, Kampala, Uganda.
Nasser, J., Sholi, Y., Anjana chaurasia., Anuradha agarwal and Neera bhalla sarín. (2009). ABA enhances plant regeneration of somatic embryos derived from cell suspensión cultures of plantain cv. Spambia (Musa sp.). Plant Cell Tiss. Org. Cult., 99:133-140.
xix Nasution, R.E. (1991). A taxonomic study of the species M.acuminata with its intraspecific taxa in Indonesia. Memoirs of Tokyo University of Agriculture, 23: 1-22.
Natesh, S., and Rau, M.A. (1984). The embryo. In Embryologyof An- giosperms, B.M. Johri, ed (Berlin: Springer-Verlag). pp. 377-443
Navarro, C., Escobedo, R.M. and Mayo, A. (1997). In-vitro plant regeneration from embryogenic cultures of a diploid and a triploid, Cavendish banana. Plant Cell Tiss. and Org. Cult., 51: 17-25.
Nayak, P. and Sen, S.K. (1989). Plant regeneration through somatic embryogenesis from suspension cultures of a minor millet, Paspalum scrobiculatum L. Plant Cell Rep., 8: 296.
Nei M. and Li, W.H. (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Nat. Acad. Sci., 76:5269–5273.
Nickle, T.C. and Yeung, E.C. (1993). Failure to establish a functional shoot meristem may be a cause of conversion failure in somatic embryos of Daucus carota (Apicaeae). Am. J. of Bot., 80:1284-1291.
Nie, J.C., Wu, G.L., Zhang, Y.S., Yang, S.Z., Liu, H.M. (1989). Biochemistry. 2nd ed. Higher Education Press. Beijing.
Niubó E, Maribona R & Sánchez C. 2000. Morphometric characterization of a cell line from sugar cane. CENIC Sciences., 31 (3) :173-176.
Nokoe, S. and Ortiz, R. (1998). Horti. Sci (USA)., 33: (1): 130-132.
Nolan, K.E., Rose, R.J., Gost, J.R (1989). Regeneration of Medicago truncatula from tissue culture: increased somatic embryogenesis using explants from regenerated plant. Plant Cell Rep., 8: 279-281.
Nomura, K and Komamine, A. (1986). Polarized DNA synthesis and cell division in cell clusters during somatic embryogenesis form single carrot cells. The New Phytologist., 104: 25-32.
Norstog, K. (1961). The growth and differentiation of cultured barley embryos. Am. J. of Bot., 48: 876-884.
Norstog, K. (1970). Induction of embryo like structures by kinetin in cultured barley embryos.
xx Novak, F. J., Afza, R., Van Duren, M., Perea-Dallos, M., Comger, B. V. and Tang Xiolang. (1989). Somatic embryogenesis and plant regeneration in suspensions cultures of dessert (AA and AAA) and cooking (ABB) bananas (Musa spp.). Biotechnol., 46: 125-135.
Nweke, F., Njoku, J. and Wilson, G.F. (1988). Productivity and limitations of plantain (Musa spp. cv AAB) production in compound gardens in South-eastern Nigeria. Fruits., 43: 161-166.
Onay, A., Jeffree, C.E,, Theobald, C. and Yeoman, M.M. (2000). Analysis of the effects of maturation treatments on the probabilities of somatic embryo germination and plantlet regeneration in pistachio using a linear logistic method. Plant Cell Tiss. and Org. Cult., 60: 121-129.
Orton, T. J. (1984). Somaclonal variation: Theoritical and practical considerations, pp. 427 – 468. In: (ed. J. P. Gustafson)
Osuga, K. and Komamine, A. (1994). Synchronization of somatic embryogenesis from carrot cells a high frequency as a basis for the mass production of embryos. Plant Cell Tiss. and Org. Cult., 39: 125-135.
Ozias-Akins, P. and I.K. Vasil. (1988). In vitro regeneration and genetic manipulation of grasses. Physiol. Plant., 73:565-569.
Ozias-Akins, P., Vasil, I. K., (1982)., Plant regeneration from cultured immature embryos and inflorescences of Triticum aestivum L. (wheat): Evidence for somatic embryogenesis. Protoplasma., 110: 95-105.
Panis, B. (1995). Crypreservation of banana (Musa spp.) germplasm, p. 201 PhD thesis, K.U. Leuven, Belgium.
Panis, B. and Swennen, R. (1993). Embryogenesis Musa plant cell culture: current and future applications. InfoMusa., 2: 3-6.
Panis, B. and Thinh, N.T. (2001). Cryopreservation of Musa germplasm. INIBAP Technical Guidelines 5 (Escalant, J.V and Sharoock, S. eds). International Network for the Improvement of Banana and Plantain. Montpellier. France. 44pp.
Panis, B., Van-Wauwe, A. and Swennen, R. (1993). Plant regeneration through direct somatic embryogenesis from protoplasts of banana (Musa spp.). Plant Cell Rep., 12: 403-407.
xxi Parrott W, Dryden G, Vogt S, Hildebrand D, Collins G & Williams E. (1988). Optimization of somatic embryogenesis and embryo germination in soybean. In Vitro Cell. Dev. Biol., 24: 817-820.
Parrott, W. (1993). Cell-culture Techniques: Cell Culture, In vitro Selection, and Somaclonal Variation. In: Proceeding Biotechnology applications for banana and plantain improvement. INIBAP Meeting (1992, San Jose, Costa Rica). Montpellier, pp 183-191.
Parrott, W.A., Williams, E.G., Hildebrand, D.F. and Collins, G.B. (1989). Effect of genotype on somatic embryogenesis from immature cotyledons of soybean. Plant Cell Tiss and Org Cult., 16: 15-21.
Perez Hernandez, J.B., Remy, B., Galan Sauco, V., Swennen, R. and Sagi, L. (1999). Agrobacterium-mediated transformation of banana embryogenic cell suspension cultures. Proceedings of the International symposium on the molecular and cellular biology of banana. March 22-25, Ithaca, NY, USA (Abstracts). INFOMUSA 8(1): XIII.
Perez Hernandez, J.B., Remy, B., Galan Sauco, V., Swennenm, R. and Sagi, L. (1998). Chemotactic movement to wound exudates and attachment of Agrobacterium tumefaciens to single cells and tissues of banana. Acta Horti., 490: 463-468.
Perez, E. A., Brunner, H. and Afza, R. (1998). Somatic embryogenesis in banana (Musa ssp.) cv. Lakatan and latundan. Philippine-Journal of Crop-Science., 23: 85.
Quiroz, F., Rojas, R. and Loyola, V. (2006). Embryo production through somatic embryogenesis can be used to study cell differentiation in plants. Plant Cell Tiss. and Org. Cult., 86: 285-301.
Raemakers, C. J. J. M., Jacobsen, E., and Visser, R. G. F. (1995). Secondary somatic embryogenesis and applications in plant breeding. Euphytica, 81, 93-107.
Rafalski, A., Tingey, S., Williams, J. G. K. (1999). Random amplified polymorphic DNA (RAPD) markers. In: Gelvin, S. B.; Schilperoort, R. M. S.; Verma, D. P. S., eds. Plant molecular biology manual, suppl. 6. Dordrecht: Kluwer Academic Publishers pp: 1–9.
Raghavan, V. (1976). Experimental embryogenesis in vascular plants. Academic Press, London.
Rahman, M., Hussain, D. and Zafar, Y. (2002). Estimation of genetic divergence among elite cotton cultivars-genotypes by DNA fingerprinting technology. Crop Sci., 42: 2137-2144.
xxii Rahman, M.H. and Rajora, O.P. (2001).Microsatellite DNA somaclonal variation in micropropagated trembling aspen (Populus tremuloides). Plant Cell Rep., 20: 531-536. Ramage, C.M., Borda, A.M., Hamill, S.D. and Smith, M.K. (2004). A simplified PCR test for early detection of dwarf off-types in micropropagated Cavendish banana (Musa spp. AAA). Scientia Horti., 103(1) 145-151.
Rashid, A. (1988). Cell physiology and genetics of higher plants. 1: CRC Press, Boca Raton, Fla., 1-38, 67-103.
Ratnaprakash, M.B., Santra, D.K., Tullu, A., Muehlbauer, F.J. (1998). Inheritance of inter simple sequence repeat polymorphism and linkage with fusarium wilt resistance gene in chickpea. Theor. Appl. Genet., 96: 348-353.
Raven, P.H., Evert, R.E. and Eichhom, S.E. (1992). Biology of Plants. Worth Publishers.
Ray, T., Dutta, I., Saha, P., Das, S. and Roy, S.C. (2006). Genetic stability of three economically important micropropagated banana (Musa spp.) cultivars of lower Indo-Gangetic plains, as assessed by RAPD and ISSR markers. Plant Cell Tiss. Org. Cul., 85:(1),11–18.
Reinert, J. A. and Yeoman, M. M. (1982). Plant Cell and Tissue Culture. A Laboratory Manual (25 p).
Reisch, B. and Bingham, E.T. (1980). The genetic control of bud formation from callus cultures of diploid alfalfa. Plant Sci. Lett. 20:71-77.
Resmi. L, and Nair, A.S. (2007). Plantlet production from the male inflorescence tips of Musa acuminata cultivars from South India. Plant Cell Tiss. Org. Cult., 88: 333-338.
Reuveni, O, Israeli, Y. and Eshadat Deganya H. (1986). Genetic variability in banana plants multiplied via In vitro techniques. IBPGR Final Report. 36p.
Reuveni, O. & Israeli, Y. (1990). Measures to reduce somaclonal variation In vitro propagated bananas. Acta Horti., 257: 307-313.
Reuveni, O., Israeli, Y. and Golubowicz, S. (1993). Factor influencing the occurrence of somaclonal variation in micropropagated bananas. Acta Horticul., 336: 357- 384.
Robinson, J. (1996). Bananas and plantains. Crop production sciencie in horticulture series. CAB International, University Press, Cambridge, UK 238p.
xxiii Robinson, J.C., Fraser, C. and Eckstein, K. (1993). A field comparision of conventional suckers with tissue culture banana planting material over three crop cycles. J. of Horti. Sci., 68: 831-836.
Rodriguez, A.P.M. and Mendes, B.M.J. (1999). Embryogenesis in Musa spp.: comparative microscopical analysis of zygotic and somatic embryos. In Vitro Cell and Devel. Biol., 35-1095-1101.
Rodriguez, A.P.M. and Wetstein, H.Y. (1994). The effect of auxin type and concentration on pecan (Carya illinoensis) somatic embryo morphology and subsequent conversion into plants. Plant Cell Rep., 13: 607-611.
Rohif, F.J. (1998). NTSYS-pc: Numerical taxonomy and multivariate analysis system, version 2.1.Applied Biostatics., New York.
Rynänen, L. and Aronen, T. (2005). Genome fidelity during short- and long-term tissue culture and differentially cryostored meristems of silver birch (Betula pendula). Plant Cell, Tiss. and Org. Cult., 83: 21-32.
Sadik, K., Rubaihayo, P.R., Magambo, M.J.S. and Pillay, M. (2007). Generation of cell suspension of East African highland bananas through scalps. Af. J. of Biotechnol., 6 (11):1352-1357.
Sagi, L., Panis, B., Remy, S., Schoofs, H., De Smet, K., Swennen, R. and Cammue, B. P. A. (1995). Genetic transformation of banana and plantain (Musa spp.) via particle bombardment. Biotechnol., 13: 481-485.
Sahijram, L., Soneji,J.R. and Bollama, K.T. (2003). Analyzing somaclonal variation in micropropagated bananas (Musa spp.). In vitro Cellular and Developmental Biology-Plant., 39: 551-556.
Sales, E. K., Carlos, L. R. and. Espino, R. R. C. (2001). Initiation of meristematic buds by benzyl amino purine on banana (Musa spp.) cultivars for somatic embryogenesis. Philippine-Agricultural- Scientist., 84: 72-75.
Sanchez, M.C., San-Jose, M.C., Ballester, A. and Vieitez, A.M. (1996). Requirements for in vitro rooting of Quercus robur and Qrubra rubra shoots derived from mature trees. Tree Physilo., 16:673-680.
Sandoval, J., Perez, L. and Cote, F. (1997). Estudio morfologico y de la estabilidad gene´tica de plantas variantes de banano (Musa AAA cv ‘‘Gran Enano’’) Etapas de cultivo in vitro, aclimatizacio´n y campo. CORBANA., 22(48): 41–60.
Sandra, S., Cronauer,A. and Krikorian,D. (1984). Multiplication of Musa from excised stem tips. Ann Bot., 53 (3): 321-328.
xxiv Santos, A., Lopez, J., Cabrera, M,, Montano, N., Reynaldo, D., Ventura, J.C., Medero, V., Garcia, M. M. and Stripes Basail, A. (2002). Obtaining embryos and establishment of embryogenic cell suspensions in banana clone 'Navolean' (AAB). Plant Biotechnol., 2 (2): 107-109.
Sarasan,V., Roberts, A.V. and Rout, G.R. (2001) . Methyl laurate and 6-benzyladenine promote the germination of somatic embryos of a hybrid rose. Plant Cell Rep., 20: 183-186. Sauvaire, D. and Galzy, R. (1980). Une method de plantification expreimental appliquee aux culture de tissue vegetaux. Example de la canne a sucre (Saccharum sp.). Can. J. Bot., 58: 264-269. Develop. Biol., 23: 665-670.
Savangikar, V.A. (2004). Role of low cost options in tissue culture. Proceedings of low cost options for tissue culture technology in developing countries. FAO / IAEA Vienna, Austria 26-30 August 2002. pp 11-15.
Schenk, R. U. and Hildebrant, A. C. (1972). Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot., 50: 199-204.
Schiavone, F.M and Cooke, T.J. (1987). Unusual patterns of somatic embryogenesis in the domesticated carrot: developmental effects of exogenous auxins and auxin transport inhibitors. Cell Differentiation, 21: 53-62.
Scholten, H.J. and Pierik, R.L.M. (1998). Agar as a gelling agent: chemical and physical analysis. Plant Cell Rep., 17: 230-235.
Schoofs, H. (1997). The origin of embryogenic cells in Musa, Ph.D thesis, Dissertationes de Agricultura 330, Faculty of Agricultual and Applied Biological Science, K.U.Leuven, Belgium.
Schoofs, H., Panis, B. and Swennen, R. (1998). Competence of scalps for somatic embryogenesis in Musa. Proceeding of the first International Symposium on Banana in the Subtropics. 10-14 November 1997. Puerto de la Cruz, Tenerife. Spain. Acta Horti., 490: 475-483.
Schoofs, H., Panis, B., Strosse, H., Mayo, Mosqueda, A., Lopez, Torres, J., Roux, N., Dolezel, J. and Swennen, R. (1999). Bottlenecks in the germination and maintenance of morphogenic banana cell suspension and plant regeneration via somatic embryogenesis therfrom. Infomusa., 8: 3-7.
Schoofs, H., Panis, B., Swennen, R. and Galan-Sauco, V. (1997). Competence of scalps for somatic embryogenesis in Musa. Acta Horti., 490: 475-483.
xxv Schukin, A., Ben Bassat, D., Israeli, Y. and Altman, A. (1997). Plant regeneration via somatic embryogenesis in Grand Naine banana and its effect on somaclonal variation. Acta Horticulturae., 447: 317-318.
Schuller. A., Kirchner-Ness, R. and Reuther, G. (2000). Interaction of plant growth regulators and organic C and N components in the formation and maturation of Abies alba somatic embryos Plant Cell Tiss and Org Cult., 60: 23-31.
Seitz, K.M.H and Bingham, E.T. (1988). Interactions of highly regenerative genotypes of alfalfa (Medicago sativa) and tissue culture protocols. In vitro Plant Cell. and Develop Biol., 24: 1047-1052.
Shanmugavelu, M., Baytan, M.R., Chesnut, J.D. and Bonning, B.C., (2000). A novel protein that binds juvenile hormone esterase in fat body and pericardial cells of the tobacco horn worm Manduca sexta L. J. Biol. Chem., 275: (3) 1802–1806.
Sharma, K.K. and Thorpe, T.A. (1995). Asexual embryogenesis in vascular plants in nature, pp. 17-71. In: In vitro embryogenesis in plants. TA Thorpe (ed). London: Kluwer Academic Publishers.
Sharma, S.K. and Millam, S. (2004). Somatic embryogenesis in Solanum tuberosum: A histological examination of key developmental stages. Plant Cell Rep., 23:115- 119.
Sharp, W.R., Evans, D.A. and Sondahl, M.R. (1982). Application of somatic embryogenesis to crop improvement, pp. 759-762. In: Plant Tissue Culture 1982. A. Fujimura (ed). Proceedings 5th International Congress of Plant Tissue and Cell Culture, Japan, Japanese Association for Plant Tissue Culture.
Shenoy, V. B. and Vasil, I. K., Theor. Appl. Genet., 1992. 83: 947–955.
Shenoy, V.B. and Vasil, I.K. (1992). Biochemical and molecular analysis of plants derived from embryogenic tissue cultures of napier grass (Pennisetum purpureum K. Shurn), Theor ApplGenet., 83: 947-955.
Shepherd, K. (1996). Mitotic instability in banana varieties. Aberrations in conventional triploid plants. Fruits, 51: 99-103.
Shetty, K. and McKersie, B.D. (1993). Proline, thioproline and potassium mediated stimulation of somatic embryogenesis in alfalfa (Medicago sativa L.). Plant Sci., 88: 185-193.
Silvarolla, M.B. (1992). Plant genomic alterations due to tissue culture. J. Brazil. Assoc. Adv. Sci., 44:329-335.
xxvi Silvia balboa filippi., Beatriz appezzato-da-Gloria, Adriana pinheiro., and Martinelli Rodriguez. (2001). Histological changes in banana explants, cv. Nanicao (Musa spp., Group AAA), submitted to different auxins for induction of somatic embryogenesis.
Simmonds, N. W. (1962). The evolution of bananas. Longmans, London.
Simmonds, N. W. (1966). Bananas, 2nd. Edition. Longmans, London.
Simmonds, N. W. (1987). Classification and breeding of bananas. In: Banana and Plantain Breeding Strategies (ed. G. J. ersley and E. A. De :Langhe), pp. 78 – 83. INIBAP & ACIAR Proceeding No. 21. Cairns, Australia.
Simmonds, N. W. (1995). Bananas. In: J. Smartt and N. W. Simmonds (eds). Evolution of Crop Plants, pp. 370 – 374, Longman Scientific & Technical/John Wiley & Sons, New York.
Simmonds, N. W. and Shepherds, K. (1955). The taxonomy and origins of cultivated banana. Jour. Linn. Soc. Lond. Bot., 55: 302 – 312.
Simmonds, N. W. and Weathrup, S. T. (1990). Numerical taxonomy of the wild bananas (Musa). New Phytology, 115: 567-571.
Simmonds, N.W., Weatherup, S.T.C. (1990). Numerical taxonomy of the cultivated bananas. Tropical Agri., 67 (1):90-92.
Smith, M. K. (1988). A review of factors influencing the genetic stability of micropropagated bananas. Fruits., 43: 219 – 223.
Smith, M. K. and Drew, R.A. (1990). Current application of tissue culture for the propagation and improvement of bananas and plantain. Australian Journal of Plant Physiology. 17:267-269.
Sneath, P.H.A. and Sokal, R.R. (1973). A statistical method for evaluation systematic relationships. University Kansas Sci. Bull., 38: 1409-1438.
Sonnino, A., Tanaka, S., Iwanaga, M and Schilde-Rentschler, L. (1989). Genetic control of embryo formation in anther culture of diploid potatoes. Plant Cell Rep., 8:105-107.
Sree Ramulu, K., Dijkhuis, P. and Roest, S. (1983). Phenotypic variation and ploidy level of plants regenerated from protoplast of tetraploid potato (solanum tuberosum L. cv. ‘Bintje’). Theoretical and Applied Genetics, 65: 329-338.
xxvii Srinivasa Rao, N. K., Chacko, E. K., Dore Swamy, R. and Narayanasamy, S. (1982). Induction of growth in explanted inflorescence axis of banana. Curr. Sci., 51: 666-667.
Stavarek, S.J., Croughan, T.P. and Rains, D.W. 1980. Regeneration of plants from long-term cultures of alfalfa cells. Plant Sci. Lett., 19: 253-261.
Steward, F. C., Sci. Am., (1963). 209: 104–113.
Steward, F.C., Mapes, M.O. and Smith, J. (1958). Growth and organized development of cultured cells. Am. J. of Bot., 45: 693-704.
Stover, R. H. (1987). Somaclonal variation in Grand Naine and Saba bananas in the nursery and in the field, pp. 136-139. In: Banana and Plantain Breeding Strategies. Persly, G.J and De Langhe, E.A. (eds). ACIAR Proceeding No.21, ACIAR, Canberra/
Stover, R. H. (1988). Variation and cultivar nomenclature in Musa AAA group, Cavendish subgroup. Frutis., 43: 353-357.
Stover, R. H. and Simmonds, N. W. (1987). Bananas, 3rd ed. Longman Scientific and Technical, New York.
Straus. J. (1954). Maize endosperm tissue grown in vitro.II. Culture requirements. Am. J. Botany.,41:643-647.
Street, H. and Withers, L. A. (1974). The anatomy of embryogenesis in cultre. In: Street, H. E., ed. Tissue culture and plant science. London: Academic Press. pp71-100.
Strosse H, Van den Hauwe I & Panis B. (2004). Banana cell and tissue culture-review. In: Jain SM & R. Swennen (eds). Banana Improvement: Cellular, Molecular Biology and Induced Mutations.
Strosse, H., Domergue, R., Panis, B., Escalant, J. V. and Cote, F. (2003). Banana plantain embryogenic cell suspensions. INIBAP technical guidelines 8, in Vezina A, Picq C, International Network for the Improvement of Banana and Plantain, Montpellier, France. P.32
Strosse, H., Schoofs, H., Panis, B., Andre, E., Reyniers, K. and Swennen, R. (2006). Development of embryogenic cell suspensions from shoot meristematic tissue in banana and plantain (Musa spp.) Plant Sci., 170: 104-112.
xxviii Stuart, D.A. and Strickland, S.G. (1984). Somatic embryogenesis from cell cultures of Medicago saliva L. The role of amino acid additions to the regeneration medium. Plant Sci. Lett., 34: 165- 1 74.
Sun, Z., Zhoo, C., Zheng, K., Xi, K. and Fu, Y. (1983). Somaclonal genetics of rice Oryza sativa L. Theoretical and Applied Genetics., 67: 67-73.
Suprasanna, P., Panis, B., Sagi, l. and Swennen, R. (2002). Establishment of embryogenic cell suspension cultures from Indian banana cultivars, 3rd and Final Research Cordination Meeting of the FAO/IAEA on Cellular biology of banana. KUL, Leuven, Belgium.
Swedlund, B. and Vasil,1.K. (1985). Cytogenetic characterizationof embryogenic callus and regenerated plants of Pennisetum americanum (L.) K. Schum. Theor. Appl. Genet., 69: 575 -581.
Swennen, R. and D. Vuylsteke. (1991). Bananas in Africa: Diversity, Uses and Prospects for Improvement. In: Crop Genetic Resources for Africa. (eds. N. Q. Ng, P. Perrino, F. Attere and H. Zedan), Vol. 2: 151.
Swennen, R. and E. De Langhe. (1985). Growth parameters of yield of plantain (Musa cv. AAB). Ann. Bot., 56: 197 – 204.
Swennen, R. and F. Rosales. (1994). Bananas. In: C. Arntzen (Ed.) Encyclopedia of Agricultural Science.,Vol. 1. Academic Press, New York, pp. 215-232.
Szabados, R., Hoyos, R and Roca, W. (1987). In vitro somatic embryogenesis and plant regeneration of cassava. Plant Cell Rep., 6:248-251.
Takahata, Y. and Keller, W.A. (1991). High frequency embryogenesis and plant regeneration in isolated microspore culture of Brassica oleracea L. Plant Science., 74: 235-242.
Takahata, Y., Brown, D.C. W., Keler, W.A. and Kainima, N. (1993). Dry artificial seeds and desiccation toleamce induction in microspore-derived embryos of broccoli. Plant Cell Tiss and Org Cult., 235: 121 - 129.
Terzi, M, Loschiavo F. 1990. Somatic embryogenesis. In: Bhojwani SS, ed. Plant Tissue Culture: Applications and Limitations. Elsevier, Amsterdam, pp. 54-56.
Tezenas du Montcel, H. (1987). Plantain bananas. The Agriculturist. CTA, Macmillan, 106 pp.
Tezenas du Montcel, H. and Devos, P. 1978. Proposal for establishing a plantain determination card. Paradisiaca., 3: 14 – 17.
xxix Timmers, A.C.J. (1993). Imaging of polarity during zygotic and somatic embrogenesis of carrot (Daucus carota L.), 123 p. Ph D thesis. Wageningen, The Netherlands.
Tingey, S. V. and del Tufo. J. P. (1993). Genetic analysis with random amplified polymorphic DNA markers. Plant Physiol., 101: 349-352.
Titov, S., Bhowmik, S.K., Mandal, A., Alam, M.S. and Uddin, S.N. (2006). Control of phenolic compound secretion and effect of growth regulators for organ formation from Musa spp. Cv Kanthali floral bud explants. Am. J. Biochem Biotechnol 2 (3):97 – 104
Tomes, D.T. and Smith, O.S. (1985). The effect of parental genotype on initiation of embryogenic callus from elite maize (Zea mays L.) germplasm. Theoretical and Applied Genetics., 70: 505-509.
Toonen, M.A.J., Hendriks, T., Schmidt, E.D.L., Verhoeven, H.A.,Van Kammen, A. and De Vries, S.C. (1994). Description of somatic embryo forming single cells in carrot suspensioncultures employing video cell tracking. Planta., 194:565– 572.
Torrey, J.G. (1959). Experimental modificaion of development in the root, pp. 189-222. In: Cell, organism and milieu. D Rudnick (ed). New York: Ronald Press.
Trewavas, A. (1981). How do plant growth substances work. Plant Cell Environ., 4:203–228.
Trigiano, R.N. and Conger, B.V. (1987). Regdation of growth and somatic embryogenesis by proline and serine suspension cultures of Dactylis glomerata. J. Plant Physiol., 130:49-55.
Turner, D. W. (1994). Bananas and Plantains. In: Handbook of Environment Physiology of Fruits Crops. Vol. 11: Subtropical and Tropical Crops. (eds. Schaffer, B. and P. C. Anderson). CRC Press Inc. pp. 37 – 64.
Uma, S., Akbar, A., Saraswathi, M.S. and Mustaffa, M. M. (2007). Response of Indian banana cultivars to plant regeneration through embryogenic cell suspension. In Promusa symposium- Recent advances in banana crop protection for sustainable production and improved livelihoods. September 10-14. pp 80.
Uma, S., S. Sathiamoorthy and P. Durai, (2005). Banana – Indian genetic resources and catalogue NRCB (ICAR), Tiruchirapalli, India. Pp. 237.
Valmayor, R.V. (2001). Classification and characterization of Musa exotica, M.alinsanaya and M. acuminata ssp. The Philippine Agricultural Scientist 84:325-331.
xxx Van Den Howe, (1998). Bacterial contamination in Musa shoot tip cultures, Acta Hort. 490: 485-492.
Van Winkle, S. and Pullman, G.S. (2003). The combined impact of pH and activated carbon on the elemental composition of plant tissue culture media. Plant Cell Rep., 22:303-311.
Varshney, A., Lakshmikumaran, M., Srivastava, P. S., Dhawan, V. (2001) Establishment of genetic fidelity of in vitro-raised Lilium bulbets through RAPD markers. In vitro Cell. Dev. Biol. Plant., 37:227–231.
Vasil, I. K. (1987). Developing cell and tissue culture systems for the improvement of cereal and grass crops. J. of Plant Physiol., 128:193-218.
Vasil, I. K., Lu, C. and Vasil, V. (1985). Protoplasma., 127: 18.
Vasil, I.K. (1988). Progress in the regeneration and genetic manipulation of cereal crops. Biotech., 6:397-402.
Vasil, I.K. (1994). Automation of plant propagation. Plant Cell Tiss. Org. Cult., 39:105-108.
Vasil, V. and Vasil, I.K. (1982). Somatic embryogenesis and plant regeneration from tissue cultures of Pennisetum americanum and P. americanum x P.purpureum hybrid. American J of Bot., 68:864-872.
Vendrame, W.A., Kochert, G. and Wetzstein, H.Y. (1999). AFLP analysis of variation in pecan somatic embryos. Plant Cell Rep., 18: 853–857
Venkatachalam, L., Sreedhar, R. V., Bhagyalakshmi, N. (2007). Genetic analysis of micropropagated and regenerated plantlets of banana as assessed by RAPD and ISSR markers. In vitro Cell Dev. Biol.-Plant., 43: 267-274.
Verdus, M.C., Dubois, T., Dubois, J and Vasseur, J. (1993). Ultrastructural changes in Leaves of Cichorium during somatic embryogenesis. Ann. of Bot., 72:375-383.
Vidal MDC and De Garcia E (2000). Analysis of Musa spp. Somaclonal variant resistant to yellow Sigatoka. Plant Mol Biol Reptr 18: 23-31.
Vuylsteke, D. (1998). Field performance of banana micropropagules and somaclones. In: Jain SM, Brar DS & Ahloowalia BS (eds) Somaclonal Variation and Induced Mutation in Crop Improvement (pp 219–231). Kluwer, Academic Publishers, Dordrecht
xxxi Vuylsteke, D. (2001).Strategies for utilization of genetic variation in plantain improvement.Ph.D Thesis, Leuven,K U Belgium,PP:207.
Vuylsteke, D. and De Langhe, E. (1985). Feasibility of In vitro propagation of bananas and plantain. Tropical Agricultura (Trinidad) 62: 323-328.
Vuylsteke, D. and Ortiz. R. (1996). Field performance of conventional vs. In vitro propagules of plantain (Musa spp., AAB group). Hort. Sci., 31 (5): 862 – 865.
Vuylsteke, D. and Swennen, R. (1993). Genetic improvement of plantains. In: (INIBAP) Proceeding of the workshop on Biotechnology Applications for Banana and Plantain Improvement, San Jose, Costa Rica, 27-31 January. pp. 169-176.
Vuylsteke, D., R. Swennen and E. De Langhe. (1991). Somaclonal variation in plantains (Musa spp. AAB group) derived from shoot-tip culture. Fruits., 46: 429 439.
Vuylsteke, D., Swennen, R., Wilson, G. F. and De Langhe, E. (1988). Phenotypic variation among In vitro propagated plantain (Musa spp. Cv. AAB). Scientia Hort., 36: 79 – 88.
Walden, R. and Wingender, R. (1995). Gene-transfer and plant-regeneration techniques. Trends in Biotechnology. 13:324–331.
Walker, K.A. and Sato, S.J. (1981). Morphogenesis in callus tissue of Medicago sativa: the role of ammonium ion in somatic embryogenesis. Plant Cell Tiss. and Org. Cult., 1: 109-121.
Walker, KA., Wendeln, M.L. and Jaworski, E.G. (1979). Organogenesis in callus tissue of Medicago sativa. The temporal separation of induction processes from differentiation processes. Plant Sci. Lett., 16: 23-30.
Walker, KA., Yu, P.C., Sato, S.J. and Jawoski, E.G. (1978). The hormonal control of organ formation in callus of Medicago sativa L. cultured in vitro. Am. J. Bot., 65: 654-659.
Wang Xiao, Xue-Lin Huang, Xia Huang, Ya-Ping Chen, Xue-Mei Dai, and Jie-Tang Zhao. (2007). Plant regeneration from protoplasts of Musa acuminate cv. Mas (AA) via somatic embryogenesis. Plant Cell Tiss. and Org. Cult., 90: 191-200.
Wang, P.J. and Huang, L.C. (1976). Beneficial effects of activated charcoal on plants tissue and organ culture. In vitro., 12: 260- 262.
xxxii Wardle, K., Dobbs, E.B. and Short, K.C. (1983). In vitro acclimatization of aseptically cultured plantlets to humidity. J. Am. So.c Hort Sci., 108: 386–389.
Wei, Y.R., Hung, X,L., Li, J., Hung, X., Li, Z and Li, X.J. (2005). Establishment of embryogenic cell suspension culture and plant regeneation of edible banana Musa acuminata cv. Mas (AA). Chin. J. of Biotech., 21:58-65.
Weising, K., Nybom, H., Wolf, K. and Kahl, G. (2005). DNA Finger Printing in Plants. Second edition. CRC Press, Taylor & Francis, pp. 444. Wenzel, C.L. and Brown, D.C.W. (1991). Histological events leading to somatic embryo formation in cultured petioles of alfalfa. In Vitro Cell, Dev. Biol., 27: 190- 196.
West, M.A.L and Harada, J.J. (1993). Embryogenesis in higher plants. The Plant Cell. 5:1361-1369.
Wiggans, S.C. (1954). Growth and organ formation in callus tissues derived from Daucus carota. I. Growth and division of freely suspended cells. Am. J. of Bot., 41: 321-326.
Williams E.G., and Maheswaran, G. (1986). Somatic embryogenesis: Factors influencing coordinated behaviour of cells as an embryogenic group. Ann. Bot. 57: 443-462.
Williams, E.G., Taylor, N.L., Van den Bosch, J. and Williams, W.M. (1990). Registration of tetraploid hybrid clover germplasm from the cross of Trifolium ambiguum and T repens. Crop Sci., 30: 427.
Wirakarnain, S., Hossain, A.B.M.S. and Chandran, S. (2008). Plantlet production through development of competent multiple meristem cultures from male inflorescence of banana, Musa acuminate cv. ‘Pisang Mas’ (AA).
Wong, W. C., Jalil, M., Ong-Abdullah, M., Othman, R. Y., Khalid, and N., (2006). Enhancement of banana plant development by incorporating a liquid-based embryo development medium for embryogenic cell suspension. J. for Horti. Sci. and Biotechnol., 81: 385-390.
Wright, N.S. (1983). Uniformity among virus-free clones of ten potato cultivars. Am. Potato J. 60: 381-388.
Wu, S. Kriz, A.L.and Widholm, J.M. (1994). Nucleotide sequence of amaize cDNA for a class II, acidic 13-1,3-glucanase. Plant Physiol., 106:1709-1710.
xxxiii Xu, C. X., Panis, B., Strosse, H., Li, H. P., Xiao, H. G., Fan, H. Z. and Swennen, R. (2005). Establishment of embryogenic cell suspensions and plant regeneration of the dessert banana ‘Williams’ (Musa AAA group). J.of Horti. Sci. and Biotechnol., 80: 523-528.
Yeung, E.C. (1995). Structural and developmental patterns in somatic embyogenesis, pp. 203-247. In: In vitro embryogenesis in plants. TA Thorpe (ed). London: Kluwer Academic Publishers.
Zaffari, G., Kerbauy, G., Kraus, J. and Romano, E. (2000). Hormonal and histological studies related to in vitro banana bud formation. Plant Cell, Tissue and Organ Culture., Vol. 63, no. 3, p. 187-192.
Zaid, A., Hughes, H.: Water loss and polyethylene glycol-mediated acclimatization of In vitro grown seedlings of 5 cultivars of date palm (Phoenix dactylifera L.) plantlets. - Plant Cell Rep., 14: 385-388.
Zietjiewicz, E., Rafalski, A. and Labuda, D. (1994). Genome fingerprinting by simple sequence repeat (SSR) - anchored Polymerase chain reaction amplification. Genomics. 20:176-183.
xxxiv ANNEXURE - I COMPOSITION OF MS (MURASHIGE AND SKOOG, 1962) MEDIUM
Ingredients Quantity (mg/l)
(NH4)NO3 1650.00
K NO3 1900.00
CaCl2.2 H2O 332.00
MgSO4.7 H2O 180.54
KH2PO4 170.00
CoCl2.6 H2O 0.025
Cu SO4.5 H2O 0.025
FeNaEDTA 36.70
H3BO3 6.20
KI 0.83
Mn SO4.H2O 16.90
Na2MoO4.2 H2O 0.25
Zn SO4.7 H2O 8.60
Myo-inositol 100.00
Nicotinic acid 0.50
Pyridoxine HCl 0.50 Thiamine HCl 0.10
Glycine 2.00 ANNEXURE – II COMPOSITION OF SH (SCHENK AND HILDEBRAND, 1972) MEDIUM
Ingredients Quantity (mg/l)
K NO3 2500.00
CaCl2.2 H2O 151.00
MgSO4.7 H2O 195.05
(NH4)H2PO4 300.00
CoCl2.6 H2O 0.10
Cu SO4.5 H2O 0.20
FeNaEDTA 19.80
H3BO3 5.00
KI 1.00
Mn SO4.H2O 10.00
Na2MoO4.2 H2O 0.10
Zn SO4.7 H2O 1.00
Myo-inositol 1000.00
Nicotinic acid 5.00
Pyridoxine HCl 0.50 Thiamine HCl 5.00