Lipid and Acetate Metabolism Influence Host Colonization by the Fungal Plant Pathogen

Ustilago maydis

Scott Cameron Lambie

BSc, Trent University, 2011

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Microbiology & Immunology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

December 2014

Ustilago maydis is an obligate fungal pathogen of maize that causes disease known as the common smut of corn. Haploids with compatible mating loci fuse to form a dikaryotic cell type that is filamentous and pathogenic; invasion of the host by this cell type leads to the formation of tumors which contain diploid teliospores. Colonization of the plant presents numerous challenges for U. maydis because the host environment may be limited in nutrients and plant defense responses lead to the creation of toxic molecules such as reactive oxygen species (ROS).

Understanding the mechanisms employed by U. maydis to overcome such obstacles is necessary to develop strategies to fight smut disease and protect crops from disease caused by fungal plant pathogens.

This study focused on the characterization of a group of genes encoding phospholipases

(PLs), enzymes which have been implicated in virulence, morphogenesis and nutrient acquisition of a number of pathogenic fungi. This work included a characterization of one PL, Lip2, which may function to repair ROS-induced damage of membranes that occurs during host colonization.

Mutants defective in lip2 were less virulent in maize seedlings, showed sensitivity to H2O2 and the drugs chloroquine and quinacrine, and were resistant to ionic stress. A transcriptional profile of a Δlip2 mutant suggested that Lip2 contributes to stress responses and carbon metabolism.

Furthermore, lipidomic profiles of the Δlip2 mutant revealed changes in lipid composition that may be linked to the mutant phenotypes.

Other aspects of central carbon metabolism were also explored including the utilization of acetate as a carbon source by U. maydis and the role of an ATP-citrate lyase, Acl1, in pathogenesis and fungal development. Acetate had a repressive effect on mating and filamentation, and promoted reduced growth and virulence compared to favorable carbon sources ii

such as glucose. Furthermore, Acl1 was shown to be essential to cause disease and for growth on glucose.

Overall, this study reveals potential mechanisms employed by U. maydis during plant colonization to resist the defense response. It also highlights the utility U. maydis as a model system to understand the metabolic and nutritional aspects of fungal phytopathogenesis.

iii

Preface

The design and execution of the experiments within were performed by myself, Scott

Cameron Lambie, under the guidance and supervision of Dr. James W. Kronstad with the following exceptions: primers designed to construct a deletion construct for the lip2 gene were designed by Dr. Jana Klose (Section 2.2.4). Generation and confirmation of acl1 deletion strains was performed by Dr. Emma Griffiths, who also contributed to the characterization of those strains by performing the growth measurements presented in Figure 16 (Sections 3.3.1 and

3.3.2). For the RNA-Seq experiments, library creation and initial bioinformatics processing was performed by Genewiz, Inc. with the assistance of Dr. Janet Chang; details regarding materials and methods for these experiments presented in sections 2.2.17 and 2.2.18 were provided by

Genewiz, Inc. GO enrichment analysis was performed by Dr. Daniel Croll, who also provided the details regarding the materials and methods in section 2.2.18. Lipidomics experiments and initial bioinformatics processing were performed by Dr. Jun Han at the Metabolomics Innovation

Center, who also provided the details regarding the materials and methods in sections 2.2.19 and

2.2.20.

Table of Contents

Abstract ...... ii

Preface ...... iv

Table of Contents ...... v

List of Tables ...... x

List of Figures ...... xii

List of Abbreviations ...... xiv

Acknowledgements ...... xvi

Dedication ...... xviii

Chapter 1: Introduction ...... 1

1.1 An Introduction to Ustilago maydis ...... 1

1.2 Metabolic Adaptations and Lipid Metabolism in U. maydis ...... 3

1.3 Phospholipases and Their Role in Fungal Pathogenesis ...... 4

1.3.1 An Introduction to Phospholipases ...... 4

1.3.2 Phospholipases as Virulence Factors in Pathogenic Fungi ...... 6

1.3.3 The Platelet Activating Factor Acetylhydrolase ...... 7

1.3.3.1 The PAFAH Family in Fungi ...... 8

1.3.3.2 Reactive Oxygen Species, Lipid Peroxidation and the Plant Defense Response

………………………………………………………...……………………….10

1.3.3.3 Dealing With the Oxidative Burst as a Fungal Pathogen ...... 12

1.4 Additional Aspects of Metabolic Adaptations in Fungal Pathogenesis ...... 16

1.4.1 Alternative Carbon Source Utilization ...... 16

1.4.2 Acetate Utilization ...... 17 v

1.4.3 Acetyl-CoA and its Role as a Central Metabolite ...... 19

1.4.3.1 ATP-Citrase Lyase ...... 20

1.4.3.2 The Role of Acl in Fungi ...... 21

1.5 Thesis Objectives ...... 22

Chapter 2: Lip2 ...... 25

2.1 Introduction ...... 25

2.2 Materials and Methods ...... 26

2.2.1 Strains and Growth Conditions ...... 26

2.2.2 DNA Isolation ...... 26

2.2.3 Identification of PLs in the U. maydis Genome ...... 27

2.2.4 Construction of Knockout Cassettes for Targeted Gene Deletion in U. maydis ...... 28

2.2.5 Biolistic Transformation of U. maydis...... 32

2.2.6 PCR Confirmation of Mutants ...... 33

2.2.7 Southern Blot Confirmation of Mutants ...... 33

2.2.8 RNA Isolation for qRT-PCR ...... 35

2.2.9 qRT-PCR Gene Expression Analysis ...... 37

2.2.10 Growth Measurements ...... 37

2.2.11 Mating Assays ...... 37

2.2.12 Virulence Assays ...... 38

2.2.13 Spot Assays ...... 39

2.2.14 Sensitivity to Oxidative Stress ...... 39

2.2.15 Microscopy ...... 40

2.2.16 RNA Isolation for RNA-Seq ...... 40 vi

2.2.17 Library Preparation for RNA-Seq ...... 41

2.2.18 RNA-Seq Bioinformatics Analysis ...... 41

2.2.19 Sample Preparation for Lipidomic Analysis ...... 42

2.2.20 Lipidomic Data Processing and Analysis ...... 43

2.3 Results ...... 43

2.3.1 In silico Identification of PLs Reveals a Diverse Gene Family in U. maydis ...... 43

2.3.2 PLs in U. maydis Are Expressed Throughout the Lifecycle ...... 46

2.3.3 The Genome of U. maydis Contains Two Genes Coding for PAFAHs ...... 47

2.3.4 Deletion of lip1 and lip2 in U. maydis ...... 50

2.3.5 Deletion of lip1 and lip2 Does Not Affect Vegetative Growth ...... 51

2.3.6 Deletion of lip1 and lip2 Does Not Affect Mating ...... 52

2.3.7 Deletion of lip2, but not lip1, Affects the Virulence of U. maydis ...... 53

2.3.8 Deletion of lip2 Increases Susceptibility to Oxidative Stress ...... 56

2.3.9 Mutants Defective in Lip2 Are Sensitive to Chloroquine and Quinacrine ...... 58

2.3.10 Mutants Defective in Lip2 Are Resistant to Ionic Stress ...... 59

2.3.11 Transcriptional Profiling of the Δlip2 Mutant And the WT Strain Grown in

Different Carbon Sources ...... 61

2.3.12 Lipidomics ...... 70

2.4 Discussion and Conclusions ...... 84

Chapter 3: The role of ATP-Citrate Lyase (Acl1) and Acetate in the Virulence of U. maydis ...... 91

3.1 Introduction ...... 91

3.2 Materials and Methods ...... 92 vii

3.2.1 Strains and Growth Conditions ...... 92

3.2.2 Construction of Knockout Cassettes for Targeted Gene Deletion of Acl1 in U.

maydis ………………………………………………………………………………………92

3.2.3 Mating Assays ...... 93

3.2.4 Virulence Assays, Library Preparation for RNA-Seq and RNA-Seq Bioinformatics

Analysis...... 93

3.2.5 Growth Measurements ...... 93

3.2.6 RNA Isolation for RNA-Seq ...... 94

3.3 Results ...... 95

3.3.1 Deletion of a Single acl1 Gene in U. maydis ...... 95

3.3.2 Acl1 is Required for Growth on Glucose ...... 95

3.3.3 The acl1 Gene is Required for Virulence in Maize Seedlings...... 96

3.3.4 Carbon Sources Affect the Ability of U. maydis to Cause Disease in Maize

Seedlings ...... 98

3.3.5 Carbon Source Utilization Affects Mating in U. maydis ...... 100

3.3.6 The growth of U. maydis on Acetate Is Reduced in Liquid and Solid Media ...... 101

3.3.7 RNA-Seq Analysis of WT Cells Grown on Difference Carbon Sources ...... 102

3.4 Discussion and Conclusions ...... 110

Chapter 4: Conclusions ...... 113

References ...... 119

Appendices ...... 127

Appendix A ...... 127

A.1 Strain List ...... 127 viii

A.2 Primers Used in This Study ...... 129

A.3 Deletion of lip1 and lip2 Does Not Affect Susceptibility to a Variety of Stressors 135

A.4 Deletion of lip2 Does Not Affect the Morphology of the Golgi Apparatus or

Endoplasmic Reticulum ...... 137

A.5 Deletion of lip2 Does Not Affect Host ROS Production ...... 139

A.6 Deletion of lip2 Does Not Affect Growth on Alternative Carbon Sources ...... 140

A.7 Deletion of lip1 and lip2 Does Not Affect the Filamentous Response to Oleic Acid

……………………………………………………………………………………..141

A.8 Deletion of the Candidate PLB Gene um11266 Does Not Affect Virulence or Mating

……………………………………………………………………………………..142

A.9 Deletion of the Candidate PLC Gene um00004 Does Not Affect Virulence or Mating

……………………………………………..………………………………………143

List of Tables

Table 1: S. cerevisiae Genes Used to Identify PLs in U. maydis ...... 28

Table 2: Identification and in Silico Characterization of Putative PLs in U. maydis ...... 45

Table 3: GO Enrichment for Molecular Function of Genes Downregulated in the Δlip2 Mutant

Grown in Glucose ...... 64

Table 4: GO Enrichment for Cellular Compartment for Genes Downregulated in the Δlip2

Mutant Grown in Glucose ...... 65

Table 5: GO Enrichment for Biological Processes of Genes Downregulated in the Δlip2 Mutant

Grown in Glucose ...... 65

Table 6: GO Enrichment for Molecular Function of Genes Downregulated in the Δlip2 Mutant

Grown in Oleic Acid ...... 66

Table 7: GO Enrichment for Biological Processes of Genes Downregulated in the Δlip2 Mutant

Grown in Oleic Acid ...... 67

Table 8: GO Enrichment for Cellular Compartment of Genes Upregulated in the Δlip2 Mutant

Grown in Glucose ...... 68

Table 9: GO Enrichment for Molecular Function of Genes Upregulated in the Δlip2 Mutant

Grown in Glucose ...... 69

Table 10: GO Enrichment for Biological Processes of Genes Upregulated in the Δlip2 Mutant

Grown in Glucose ...... 69

Table 11: GO Enrichment for Cellular Compartment of Genes Upregulated in the Δlip2 Mutant

Grown in Oleic Acid ...... 70

Table 12: GO Enrichment for Molecular Function of Genes Upregulated in the Δlip2 Mutant

Grown in Oleic Acid ...... 70 x

Table 13: GO Enrichment for Biological Processes of Genes Upregulated in the Δlip2 Mutant

Grown in Oleic Acid ...... 70

Table 14: Highly Abundant Lipid Species Found in the WT Strain ...... 73

Table 15: Highly Abundant Lipid Species Found in the Δlip2 Mutant ...... 75

Table 16: Other Lipid Species Identified as More Abundant in the Δlip2 Mutant ...... 77

Table 17: Other Lipid Species Identified as More Abundant in the WT Strain ...... 80

Table 18: GO Enrichment for Molecular Functions of Genes Upregulated in Acetate ...... 105

Table 19: GO Enrichment for Biological Processes of Genes Upregulated in Acetate ...... 106

Table 20: GO Enrichment for Cellular Compartment of Genes Upregulated in Acetate ...... 107

Table 21: GO Enrichment for Biological Processes of Genes Downregulated in Acetate ...... 108

Table 22: GO Enrichment for Molecular Function of Genes Downregulated in Acetate ...... 109

Table 23: GO Enrichment for Cellular Compartment of Genes Downregulated in Acetate ...... 109

Table 24: Strains Employed and Generated in This Study ...... 127

Table 25: Primers Used in This Study ...... 129

List of Figures

Figure 1: PL Sites of Action ...... 5

Figure 2: Schematic Representation for Generation of the lip1 Knockout Construct ...... 30

Figure 3: Schematic Representation for Generation of the lip2 Knockout Construct ...... 31

Figure 4: Schematic for Southern Blot Confirmation of Gene Deletions ...... 35

Figure 5: Gene Expression Analysis of PLs Thoughout the Lifecycle ...... 47

Figure 6: Domain Architecture of Lip1 and Lip2 ...... 48

Figure 7: Multiple Sequence Alignment of the Pafah Domain in Fungal and Human Genes ...... 49

Figure 8: Southern Hybridization Analysis of DNA from WT and Δlip2 Strains ...... 51

Figure 9: Growth of lip1 and lip2 Deletion Mutants ...... 52

Figure 10: Deletion of lip1 and lip2 Does Not Affect Mating in U. maydis ...... 53

Figure 11: Deletion of lip2 Reduces Virulence in U. maydis ...... 55

Figure 12: Deletion of lip2 Reduces Virulence in the Solopathogenic Strain SG200 ...... 56

Figure 13: Mutants Defective in Lip2 Are Sensitive to Oxidative Stress Caused by H2O2 ...... 57

Figure 14: Mutants Defective in Lip2 Are Sensitive to Chloroquine and Quinacrine ...... 59

Figure 15: Mutants Defective in Lip2 are Resistant to Ionic Stress ...... 60

Figure 16: Growth of acl1 Mutants ...... 96

Figure 17: Acl1 is Required for Virulence in U. maydis ...... 97

Figure 18: Growth in Acetate Reduces Virulence in Maize Seedlings ...... 99

Figure 19: Carbon Source Affects Mating and Filamentation in U. maydis ...... 101

Figure 20: Growth of U. maydis With Glucose or Acetate as the Sole Carbon Source ...... 102

Figure 21: Deletion of lip1 and lip2 Does Not Alter Susceptibility to Various Stressors ...... 135

Figure 22: Deletion of lip1 and lip2 Does Not Affect Growth at Different pH ...... 136 xii

Figure 23: Deletion of lip2 Does Not Affect the Structure of the Endoplasmic Reticulum ...... 137

Figure 24: Deletion of lip2 Does Not Affect the Structure of the Golgi Apparatus ...... 138

Figure 25: Deletion of lip1 or lip2 Does Not Affect Host Production of H2O2 ...... 139

Figure 26: Deletion of lip2 Does Not Affect Growth on Alternative Carbon Sources ...... 140

Figure 27: Deletion of lip1 or lip2 Does Not Affect the Filamentous Response to Fatty Acids 141

Figure 28: Deletion of the Candidate PLB Gene um11266 Does Not Affect the Virulence or

Mating of U. maydis ...... 142

Figure 29: Deletion of the Candidate PLC Gene um00004 Does Not Affect the Virulence or

Mating of U. maydis ...... 143

xiii

List of Abbreviations

ACL ATP- citrate lyase ACS Acetyl coenzyme A synthase ATP Adenosine triphosphate BLAST Basic local alignment search tool BP Biological process cAMP Cyclic adenosine monophosphate CC Cellular compartment CoA Coenzyme A cPLA2 Cytoplasmic phospholipase A2 DCM Double complete media DCM+C Double complete media + 1% activated charcoal DELTA-BLAST Domain enhanced lookup time accelerated basic local alignment search tool DIC Differential interference contrast DNA Deoxyribonucleic acid ETI Effector-triggered immunity EtOH Ethanol G3P Glyceraldehyde-3-phosphate G6P Glucose-6-phosphate GAPDH Glyceraldehyde 3-phosphate dehydrogenase GFP Green fluorescent protein GO Gene ontology GSH Glutathione GST Glutathione-S-transferase

H2O2 Hydrogen peroxide HAD Haloacid dehydrogenase iPLA2 Calcium-independent phospholipase A2

LpPLA2 Lipoprotein associated phospholipase A2 MAPK Mitogen activated protein kinase MF Molecular function xiv

MM Minimal media MM-C Minimal media with no carbon source MM+A Minimal media with 1% acetate MM+G Minimal media with 1% glucose MM+O Minimal media with 1% oleic acid PAF Platelet activating factor PAFAH Platelet activating factor acetylhydrolase PAMP Pathogen-associated molecular pattern PCR Polymerase chain reaction PDA Potato dextrose agar PDB Potato dextrose broth PKA Protein kinase A PL Phospholipase PTI PAMP-triggered immunity qRT-PCR Quantitative real time polymerase chain reaction RA Ricinoleic acid RNA Ribonucleic acid rRNA Ribosomal ribonucleic acid ROS Reactive oxygen species SDS Sodium dodecyl sulfate sPLA2 Secretory phospholipase A2 TBARS Thiobarbituric acid reactive substance TCA Tricarboxylic acid TE Tris-EDTA buffer UPLC-MS Ultra-performance liquid chromatography tandem mass spectrometry WT Wild type YNB Yeast nutrient broth

Acknowledgements

Too many people to thank. I would like to acknowledge all of the members of the

Kronstad lab, including Matthias Kretschmer, Erik Nielson, Melissa Caza, Rodgoun Attarion,

Jennifer Geddes, Guanggan Hu, Francois Mayer, Gaurav Bairwa, Erik Bakkeren, Daniel Croll,

Emma Griffiths, Brigitte Cadieux, Sanjay Saikia, Debora de Oliveira and Jaehuyk Choi. Thank you for welcoming me into the lab, for your support both inside and out - during the good times and the bad times. Thanks to Matthias, Daniel and Emma for their help with the work in this thesis.

I would like to thank my supervisor Jim Kronstad for giving me this opportunity and for his continued support and guidance throughout my graduate studies. I have learned so much throughout my time here and I appreciate the opportunities, patience, advice and guidance given to me.

I would also like to acknowledge by supervisory committee, Dr. Xin Li and Dr. Bill

Mohn, for their time and advice given to this project.

I would like to thank Dr. Michael Donaldson for his guidance and collaborative work.

Thanks to Dr. Gero Steinberg for providing the ER- and Golgi-GFP tagged strains, to Dr.

Michael Feldbrugge for providing us with a number of plasmids and to Dr. Regine Kahmann for providing strains as well.

Thanks to all of my friends in British Columbia, Ontario and throughout the world. You have each shaped my life in a unique way and I would not be the person I am today without all of you. I feel blessed to have the opportunity to know each and every one of you.

xvi

A special thanks goes out to my family, who have been the steadfast foundation in my life. Your love and support throughout the years does not go unnoticed, and I would not be in the position I am now without everything you have done for me.

xvii

Dedication

To Marnie and Brian.

To Mark, Erin and Laura.

xviii

Chapter 1: Introduction

1.1 An Introduction to Ustilago maydis

The fungal pathogen Ustilago maydis has been the subject of extensive scientific research for decades and represents one of today’s top model organisms to study fundamental cellular processes in the context of plant-pathogen interactions [1]. U. maydis is an obligate biotroph that infects maize (Zea mays) and its ancestor teosinte to cause a disease known as the common smut of corn. Fungi that cause smut diseases, such as U. maydis, are found in the phylum basidiomycota. Corn smut is characterized by the formation of prominent tumors on all aerial parts of the plant. Maize is one of the largest crops worldwide, with the most production coming from the United States with a crop valued at approximately 62.7 billion dollars [2]; therefore damage caused by pathogen attack can potentially represents a significant economic loss.

U. maydis has a dimorphic life cycle. The non-pathogenic sporidia are haploid, yeast-like in morphology, and grow saprophytically by budding. The filamentous cell type is established by mating between compatible haploid cells. Mating in U. maydis is mediated by a tetrapolar system controlled by two loci designated as the a mating-type locus and the b mating-type locus. The a locus encodes a pheromone recognition system while the b locus encodes transcription factors that control the formation of the filamentous cell type. Haploid cells fuse via conjugation tube formation, as mediated by the transmembrane receptors and lipopeptide pheromones encoded by the a-type recognition system [3, 4]. The resulting dikaryotic fusion product is unable to proliferate at this point due to a block in the G2 phase of the cell cycle [5]. Proliferation of the resulting filamentous dikaryon as well as the ability to infect maize is controlled by b mating locus which encodes proteins that form a 1

heterodimeric bE/bW transcription factor [6]. This transcription factor controls a network of more than 340 genes that contribute to the pathogenic development of the fungus [7].

On the plant surface the filamentous dikaryon establishes a biotrophic interaction with the host plant, beginning with the formation of a nonmelanized appresorium used to penetrate the plant tissue with the aid of lytic enzymes. The plasma membrane of the plant cell invaginates to surround the penetrating hyphae and form a biotrophic interface [6]. The fungus continues to proliferate in the host, accumulating the fungal biomass that is observed in tumor tissue. Eventually the fungal proliferation leads to hyphal fragmentation and sporulation as the U. maydis cells develop into melanized diploid teliospores. Tumors eventually break open allowing the release and dissemination of teliospores into the environment. Under appropriate nutritional and environmental conditions, the teliospores will germinate by a process that is temporally linked to meiosis, resulting in the formation of a basidia carrying four haploid progeny [8, 9].

One major component of the biotropic interaction of U. maydis with maize is the secretion of effector proteins that suppress plant defense responses and redirect the flow of nutrients. The genome of U. maydis encodes 386 putatively secreted proteins without a predicted enzymatic function, 272 of which are U. maydis-specific or conserved but lack

InterPro domains; twelve gene clusters exist in the genome in which all of the genes code for novel secreted proteins [10]. These effectors presumably aid in the transcriptional and metabolic changes that are observed in maize upon infection with U. maydis. These changes lead to the downregulation of early maize defense responses, suppression of cell death, changes in hormone signaling, induction of antioxidants and prevention of source leaf establishment [11]. 2

1.2 Metabolic Adaptations and Lipid Metabolism in U. maydis

In general, knowledge of the mechanisms that allow plant pathogens to recognize and colonize host tissue, acquire nutrients, and survive within the plant can help guide targeted strategies to combat crop loss. In particular, an understanding of the metabolic adaptations that occur during disease, although currently lacking, is important for appreciating the mechanisms of in planta development of fungal pathogens.

For U. maydis it is known that the switch from yeast-like to filamentous growth is triggered by many factors including low pH, low nitrogen, phosphate and fatty acids [12-14].

Previous work in the Kronstad laboratory demonstrated the importance of lipids and β- oxidation in the pathogenicity of this fungus. In particular, defects in both mitochondrial and peroxisomal β-oxidation can affect virulence and sporulation [15, 16]. U maydis also has a filamentous response to fatty acids that may be relevant to maintenance of the hyphal morphology during proliferation in plant tissue [15, 16]. Furthermore, the involvement of both the cyclic-AMP/protein kinase A (cAMP/PKA) and mitogen activated protein kinase

(MAPK) pathways in this lipid-induced morphological transition has been demonstrated

[13].

Characterization of the cAMP/PKA and MAPK signaling pathways identified numerous downstream target genes that are implicated in the filamentous transition. One gene, hgl1, is a phosphorylation target of PKA that is required for the switch to filamentous growth and the formation of teliospores during infection [17]. A differential gene expression study was conducted with a Δhgl1 strain to identify changes in mRNA levels associated with the deletion of this gene [18]. This led to the identification of the gene um00133, which encodes a putative phospholipase (PL), as being highly upregulated in the Δhgl1 strain. This 3

finding implicated PLs in the morphological transition to the filamentous cell type in U. maydus and prompted the focus on PLs for the research presented in this thesis.

1.3 Phospholipases and Their Role in Fungal Pathogenesis

1.3.1 An Introduction to Phospholipases

PLs are a class of hydrolytic enzymes which catalyze the hydrolysis of one of more ester or phosphodiester bonds of glycerophospholipids. PLs are grouped into four main classes, A, B, C and D, depending on where they cleave the phospholipid molecule (Figure

1) [19]. These proteins can be found in all orders of life and are involved in many physiological and cellular processes such as lipid metabolism, membrane homeostasis and signal transduction [20].

Phospholipase A (PLA) can be subdivided further into two categories, phospholipase

A1 (PLA1) and phospholipase A2 (PLA2). These enzymes cleave the sn-1 acyl chain or the sn-2 acyl chain of the phospholipid, respectively, releasing a free fatty acid and a lysophopholipid. Phospholipase B (PLB), also known as lysophospholipase, cleaves at both the sn-1 and sn-2 positions of the phospholipid. Phospholipase C (PLC) and phospholipase

D (PLD) cleave before and after the phosphate group of the phospholipid, respectively. PLC enzymes release diacylglycerol and a phosphate-containing head group, while PLDs release phosphatidic acid and an alcohol [20].

Figure 1: PL Sites of Action The anatomy of a basic phospholipid includes the polar head group (blue), a phosphate molecule (purple), a glycerol backbone (orange) and two fatty acid chains (green). PLs grouped based on their site of catalytic action. PLA1 and PLA2 cleave the sn-1 and sn-2 fatty acid chains, respectively. PLB cleaves both sn-1 and sn-2 fatty acid chains. PLC and PLD cleave before and after the phosphate group, respectively.

1.3.2 Phospholipases as Virulence Factors in Pathogenic Fungi

PLs have been shown to be common virulence factors in bacteria and fungi. Their mechanisms of action vary, but several have been shown to facilitate invasion of host cells, participate in nutrient acquisition or modulate host immune responses via lipid second messengers [19, 21]. In fungi, the PLBs are the best characterized PLs with regard to roles in virulence. For example, a high level of PLB secretion is correlated with virulent isolates of the human pathogen Candida albicans [22]. PLB-deficient strains show reduced virulence in mice [23], and PL-inhibitors contribute to increased survival when administered with the antifungal drug fluconazole [24]. The human pathogen Cryptococcus neoformans (another fungus in the basidiomycota like U. maydis) also uses secreted PLB as a virulence factor. In this fungus extracellular PLB activity is positively correlated with virulence in a mouse model of cryptococcosis [25, 26]. Strains deficient in PLB are significantly less virulent in mice and rabbits and these mutants, as well as WT strains in the presence of PLB inhibitors, show decreased adhesion of the fungus to human lung epithelial cells [27]. It has also been shown that the PLB aids in fungal cell movement across the blood-brain barrier [28].

Finally, lecithin, a major component of lung surfactant, was shown to upregulate the expression of two PLB genes in the pathogen Aspergillus fumigatus [29].

PLs of other families have also been described in relation to virulence in pathogenic fungi. For example, clinical isolates of A. fumigatus show higher levels of extracellular PLC activity [30], and disruption of a PLD gene blocked internalization of the fungus into epithelial cells and attenuated virulence [31]. PLD-deficient strains of C. albicans were unable to form hyphae or invade agar, and were attenuated for virulence in a mouse infection model [32]. In the rice blast pathogen Magnaporthe oryzae, PLC genes may function in 6

appressorium formation for penetration of the host surface, and deletion of these genes led to a reduction in virulence [33].

In C. neoformans, the inositol-phosphoshingolipid-PLC encoded by the ISC1 gene likely plays a role in intracellular survival of the fungus in phagolysosomes by mediating resistance to acidic pH. This activity may be through an indirect mechanism involving the plasma membrane ATPase Pma1 [34]. Furthermore, the C. neoformans phosphatidylinositol-specific PLC, CnPLC1, is required for virulence and cell wall integrity.

This activity likely requires the IP3 synthesized by CnPlc1 for the inositol polyphosphate kinase Arg1 to maintain cellular homeostasis and virulence [35, 36].

1.3.3 The Platelet Activating Factor Acetylhydrolase

The PLA2 family is represented by a diverse set of proteins in fungi, but these enzymes have not been extensively characterized. The PLA2 enzymes can be split into 15 separate subgroups, of which many contain further subgroups. These groups have been determined based on sequence, molecular weight, disulfide bonding patterns, cellular

2+ localization and the requirement for Ca [37]. In general, PLA2 proteins are classified into

2+ five enzyme groups: secreted (sPLA2), cytosolic (cPLA2), Ca -independent (iPLA2), lysosomal PLA2 and the platelet-activating factor acetylhydrolases (PAFAH). However all of the enzymes possess the ability to cleave phospholipids at the sn-2 position, leading to the production of a free fatty acid and a lysophospholipid (Figure 1). The PAFAHs are found in

2+ PLA2 groups VII and VIII, based on sequence, size, Ca dependence and substrates [38, 39].

The human PAFAH PLA2G7, also known as lipoprotein associated PLA2 (LpPLA2) has been extensively studied due to its implicated involvement in numerous disease 7

conditions involving inflammation (e.g., atherosclerosis, arthritis and edema). Initially described as having the ability to catalyze the removal of the sn-2 acetyl group of the lipid platelet activating factor (PAF), this enzyme has since been shown to hydrolyze phospholipids with sn-2 acyl chains of up to 9 methylene groups or even longer if the ω-end is oxidized [40, 41]. In addition, this PAFAH has been shown to hydrolyze esterified isoprostanes, long fatty acyl chain phospholipid hydroperoxides and oxidized phospholipids

[42, 43]. All of these substrates hydrolyzed by PAFAH tend to have distorted molecular structures that are predicted to affect membrane fluidity and integrity [41].

The role of PAFAH in disease is delicately balanced because it plays both antioxidant and pro-inflammatory roles. As an antioxidant this enzyme acts to remove acyl chains that have been oxidized, and this results in a decrease in the biological activity and overall levels of these lipid species [37, 40, 41]. However, as a result of hydrolysis by PAFAH, the lysophospholipids that are usually generated have been shown to have negative inflammatory effects, contributing to disease progression of atherosclerosis and other cardiovascular events

[44-47]. This dual nature has thus muddled the answer to whether the PAFAH is beneficial or detrimental in disease, or whether the substrates are more or less damaging than the byproducts [37].

1.3.3.1 The PAFAH Family in Fungi

Fungal PAFAH have been identified and characterized, although not to the same extent as in humans. One of the best-characterized examples is the PAFAH plg7 in

Schizosaccharomyces pombe that appears to be involved in suppressing oxidative stress.

Overexpression of this gene in Saccharomyces cerevisiae, a yeast which does not possess a 8

homolog of the gene, increased its resistance to oxidative stress caused by CuSO4 [48]. In a transgenic strain of S. pombe designed to produce high levels of ricinoleic acid (RA), plg7 was identified as a multicopy suppressor of a growth defect caused by RA toxicity [49-51].

The overexpression of plg7 reduced toxicity likely via the removal of RA moieties from phospholipids. RAs are hydroxylated fatty acids that would likely disrupt lipid membrane function. This evidence, along with induction of expression by both heat and heavy metal

(Cd) stress, suggest that this enzyme may be involved in the general stress response of the yeast [52].

The fungus Trichoderma harzianum, a commonly used biocontrol agent, contains a

PAFAH which was identified during a restriction enzyme-mediated integration mutagenesis screen for sensitivity to different stress conditions [53]. This gene was shown to be upregulated in response to heat and cold, carbon starvation and after exposure to maize roots.

Mutant strains exhibited a slow growth phenotype and were found to be sensitive to H2O2 and growth at high temperatures, while overexpression strains showed more growth at the same temperatures and in 50mM H2O2 compared to the wild type (WT) strain. Fatty acid and sterol analysis by GC/MS led the authors to speculate that PAFAH helps combat the stress response associated with increased levels of eicosanoid and ergosterol. Interestingly, knockout strains had less antagonistic capacity against the fungus Rhizoctonia solani.

Furthermore, 15 proteins were regulated by PAFAH and these included the downregulation of a Cu/Zn superoxide dismutase and a metalloenzyme involved in cellular protection against superoxide. There was also an increase in cellular catalase activity, which is indicative of increased oxidative stress [54]. Together, this evidence led the authors to hypothesize that

the PAFAH is involved in the response to abiotic stress, mediating fungal antagonism and interactions with maize roots in the rhizosphere.

1.3.3.2 Reactive Oxygen Species, Lipid Peroxidation and the Plant Defense Response

The immune system of plants can be divided into two main resistance mechanisms.

Plants possess a general pathogen-associated molecular pattern (PAMP)-triggered immunity

(PTI), which acts as the “first line of defense” against pathogens; this system recognizes molecular signatures that are characteristic of broader classes of microbes. The second line of defense possessed by plants is termed effector-triggered immunity (ETI). This ETI is modulated by plant surveillance proteins, also known as resistance or R-proteins, which recognize specific pathogen effector proteins [55]. Each of these mechanisms informs the plant that it is under the threat of pathogens, triggering signal cascades that lead to a variety of defensive responses.

One of the earliest defense responses is the oxidative burst which involves the production of reactive oxygen species (ROS) by the plant at the site of the infection via a

NADPH-oxidase, or by other enzymes such as superoxide dismutase, oxalate oxidase, peroxidase, lipoxygenase and amine oxidase [55, 56]. There are two phases of oxidative bursts in plants, the first is associated with basal immunity and is observed in both resistant and susceptible plant-pathogen interactions while the second burst is only observed in resistant interactions, presumably due to the ability of a pathogenic organism to suppress the host immune response [57]. ROS production in plants is believed to act in a number of ways to mitigate disease during pathogen attack. ROS generation strengthens the cell wall and has general antimicrobial activity. ROS also act as second messengers to induce synthesis of 10

pathogen-related proteins and phytoalexins, and to trigger programmed cell death in neighbouring cells [58, 59].

ROS are incompletely reduced oxygen species that can act as powerful oxidants. The

·- · most common ROS are radicals which include superoxide (O2 ), nitric oxide (NO ), hydroperoxyl (HOO·) or hydroxyl (OH·), but non-radical ROS also exist such as hydrogen

- - peroxide (H2O2), peroxynitrite (ONOO ) and hypochlorite ( OCl) [60]. These oxidants can be generated though ionizing radiation, through biological reactions such as incomplete reduction of oxygen in the respiratory chain or enzymatically by various enzymes such as

NADPH oxidase, as mentioned above [60]. These molecules pose a threat in cells because they react with important macromolecules such as DNA, proteins, carbohydrates and lipids causing damage such as DNA mutations, protein oxidation and lipid peroxidation. This damage can be sufficiently severe to cause cell death [61].

Lipid peroxidation caused by ROS occurs in a chain reaction mechanism, beginning with a free radical capable of oxidizing lipid molecules creating a peroxyl or alkoxyl radical.

These radicals may oxidize neighbouring fatty acids to create more oxidized lipids and cause extensive damage because one radical can drive the oxidation of a large number of lipid molecules [60]. This chain reaction will continue until the radical reacts with another radical or with an antioxidant compound such as vitamin E to terminate the reaction [62].

Upon lipid peroxidation, the structure of the affected lipids can change drastically and affect the function of that lipid in the membrane. Altering the lipid composition of the membrane can potentially lead to changes in membrane permeability, ion leakage and membrane fluidity resulting in severe physiological effects [63]. Furthermore, altered lipids also have the potential to interfere with protein function through hydrophobic interactions 11

and act as reactive electrophile species to covalently link macromolecules [63]. Damage caused by lipid peroxidation is implicated in a wide variety of diseases in humans including neurodegenerative disease, diabetes, atherosclerosis, ageing, as well as renal and liver disease [64].

Since ROS are generally an unavoidable byproduct of aerobic life, organisms have evolved mechanisms to mitigate their damage. For example, cells employ ROS scavengers as an oxidative stress response mechanism. These scavengers include compounds such as gluthathione (GSH), ascorbic acid, phytochelatins, polyamines, flavonoids, alkaloids and carotenoids that are all capable of reacting with ROS to become oxidized and reduce the oxidative threat to the cell [65]. Cells also employ enzymatic mechanisms that act to counteract ROS accumulation. Superoxide dismutase, glutathione peroxidase, catalase and peroxiredoxin are common enzymes that act to remove various ROS species. For example there is an upregulation of several maize genes coding for GSH S-transferases (GSTs) within

12 hours of U. maydis infection, and by 24 hours there is an induction of Tau-class GSTs which are known to suppress cell death. Metabolomic studies also revealed an increase in

GSH throughout the infection; this is likely a mechanism to increase the antioxidant capacity of the colonized tissue [11].

1.3.3.3 Dealing With the Oxidative Burst as a Fungal Pathogen

Biotrophic pathogens such as U. maydis require living host material to acquire nutrients, making ROS generation by the PTI response an effective mechanism for plants to contain a biotrophic pathogen. To overcome this defense mechanism, biotrophic pathogens often have strategies to inhibit the PTI response and detoxify ROS. When U. maydis infects 12

maize early disease symptoms consist of tissue chlorosis, the production of anthocyanin and plant stunting. No other defensive responses are detectible, and it has been suggested that the plant senses and responds to colonization but is unsuccessful in mounting a full defensive response [66].

It is believed that the transcription factor Yap1 plays a major role in the oxidative stress response in U. maydis. The Δyap1 mutants exhibit sensitivity to oxidative stress, are less pathogenic than WT strains in maize and H2O2 accumulates around infecting fungal cells during establishment of infection – a phenomenon not observed with WT strains. Under oxidative stress and during infection the Yap1 protein was shown to localize to the nucleus and to regulate the expression of 221 genes including ROS detoxifying enzymes, genes involved in the biosynthesis of low molecular mass antioxidants and genes encoding enzymes which regenerate the reduced forms of antioxidants [67].

In addition to Yap1, the Ustilaginales-specific secreted effector Pep1 has also been shown to play an important role in the U. maydis – maize interaction with regard to ROS.

Deletion mutants lacking Pep1 showed differential regulation of 116 genes during infection of maize, of which many were related to plant defense. This change in gene expression also included a lack of induction of jasmonic acid responsive genes and an induction of salicylic acid marker genes, which is indicative of an incompatible biotrophic interaction. During infection, the Pep1 protein localizes in the apoplastic space and at sites of cell-to-cell passage. Mutants defective in Pep1 are capable of developing infection structures but cannot penetrate epidermal cells, and these plant cells elicit a strong host defense response including

H2O2 accumulation at the site of infection. Overall, the pep1 mutants are incapable of

causing disease in maize. Recent studies indicate that Pep1 functions by inhibiting the plant peroxidase POX12 [68, 69].

Strategies to cope with elevated levels of oxidative stress have also been well characterized in the pathogenic fungus M. oryzae, the causative agent of rice blast. For example, DES1 functions in the suppression of plant innate defense responses through a mechanism that likely involves regulation of the expression of an extracellular peroxidase.

Loss of DES1 function leads to failure to colonize the host, induction of strong plant defense responses such as ROS production, and increased sensitivity of the fungus to oxidative stress

[70]. Another virulence factor HYR1 is involved in disrupting plant generated ROS during early infection and this protein regulates the expression of GSH pathway-related genes.

Neither DES1 or HYR1 had an effect on intracellular ROS generation, suggesting that the fungus has separate mechanisms, such as GSH production, to deal with ROS from different sources [57, 71, 72].

The transcriptional regulators AP1 and ATF1 have both been implicated in the ability of M. oryzae to adapt ROS challenge upon infection of a host plant. Mutants in both genes result in decreased virulence on rice and increased sensitivity to H2O2. AP1 mutants show a defect in the growth of late intracellular infection hyphae, but not during earlier stages such as appressorium formation or host penetration, while mutants defective in ATF1 exhibit an increase in plant ROS production. It is believed that both of these proteins play a part in controlling the expression of many genes, including secreted peroxidases and laccases; these genes are downregulated in both mutant strains [73, 74].

A recent study also showed that the sirtuin SIR2 alters acetylation of JMJC, a repressor of superoxide dismutase. Mutants for SIR2 have decreased expression levels of the 14

superoxide dismutase and show decreased virulence in rice which is accompanied by an increase in detectable levels of host H2O2 production [75].

Overall, the ability to suppress the host defense response, specifically ROS generation, appears to be critical in successful colonization of the host. In susceptible interactions with M. oryzae metabolomics studies have shown a suppression of ROS generating pathways, including NAPD-malic enzyme, which affects activity of ROS producing NADPH oxidase [76].

Although necrotrophic phytopathogens have been known to induce host cell death through self-generated ROS and the induction of host ROS production, they still need to possess mechanisms to cope with the increased stress and damaged caused in the presence of these molecules. The thioredoxin system of the necrotrophic fungus Botrytis cinerea that causes gray mold disease on grapes is crucial for virulence as deletion of genes encoding a thioredoxin (TRX1) and a thioredoxin reductase (TRR1) led to a drastic reduction in virulence and an increased sensitivity to ROS. In contrast, the GSH system in B. cinerea appears to be dispensible for virulence because the components that have been examined so far only had minor contributions to virulence. TRR1 mutants also showed sensitivity to SDS, which led the authors to speculate that high ROS levels could lead to unstable membranes and restricted growth in these strains [77].

Transcriptional regulators that function in the response to oxidative stress have also been described in Fusarium graminearum, the causative agent of Fusarium head blight of wheat and barley. Specifically, a study by Jiang et al characterized three transcription factors, AP1, ATF1 and SKN7, which have been implicated in oxidative stress response in other fungi [78]. In F. graminearum ROS stress has been implicated in the production of 15

deoxynivalenol, a mycotoxin and virulence factor synthesized and used by the fungus. The authors found that mutants in any of the three genes showed sensitivities to oxidative stress, but only ATF1 mutants had defects in pathogenesis. Deoxynivalenol production was decreased in SKN7 mutants, likely due to the reduced expression of genes involved in the biosynthesis of the mycotoxin. Both ATF1 and SKN7 were also implicated in hyphal growth, ascosporogenesis, ascospore release and general stress responses [78].

1.4 Additional Aspects of Metabolic Adaptations in Fungal Pathogenesis

1.4.1 Alternative Carbon Source Utilization

In addition to withstanding the plant defense response described above, one of the main challenges that fungal pathogens face upon establishment of an infection is the acquisition of nutrients to provide energy and other important metabolic intermediates such as glucose-6-phosphate (G6P) and acetyl coenzyme A (acetyl-CoA). The most commonly preferred source of carbon is typically glucose and if it is available microorganisms will often use this source preferentially before using other less energetically favorable carbon sources [79]. However, glucose may not be readily available upon colonization of a host and other carbon sources must be exploited to provide energy. Depending on the environment these sources may include alternate sugars such as galactose, sucrose, arabinose and maltose or other carbon sources such as fatty acids, ethanol, lactate, glycerol or acetate [80]. Use of each of these carbon sources requires a specific metabolic pathway and the activation and repression of such pathways needs to be tightly controlled to ensure efficient energy usage.

In S. cerevisiae the regulation of metabolic pathways occurs mainly at the transcriptional level. The Gal4 gene is a well-characterized example of this regulation. This 16

transcriptional activator is responsible for inducing expression of genes required for catabolism of galactose upon induction by the sugar, while the repressor Mig1 prevents transcription of these genes in the presence of glucose [81-83]. The pathways controlling the utilization of other carbon sources in S. cerevisiae has been extensively studied. For example, glycerol is imported into the cell and converted to G3P, transported to the mitochondria and then converted into dihydroacetone phosphate for entry into the glycolytic or gluconeogenic pathways [80, 84, 85]. Both D- and L-lactate are transported into the cell and converted to pyruvate by mitochondrial lactate cytochrome c oxidoreductases [80, 86,

87]. Ethanol and acetate are able to enter the cell through passive diffusion and ethanol is converted by an alcohol dehydrogenase to acetaldehyde, which is then converted to acetate by an aldehyde dehydrogenase [80, 86]. Acetate serves as substrate for the enzyme acetyl-

CoA synthase (Acs), which creates acetyl-CoA, a major central metabolite of the cell.

Regulation of all of these pathways, although ultimately not-well understood in many fungi, has been described in Aspergillus nidulans, C. albicans, S. cerevisiae and S. pombe among others, all of which employ a large number of regulatory transcription factors and cis- regulatory elements forming complex regulatory networks [82, 88, 89].

1.4.2 Acetate Utilization

In general, little is known about acetate utilization in most fungi although some information is available for S. cerevisiae and A. nidulans. Under aerobic conditions S. cerevisiae is able to use acetate as a sole carbon source to generate energy and this process requires the activity of the glyoxylate and gluconeogenesis pathways to produce oxaloacetate and sugar phosphates, both of which are regulated by glucose repression [86, 90, 91]. 17

Acetate is capable of diffusing into the cell, although a number of transporters are implicated in the uptake of acetate into the cell [80, 90]. Acetate is then metabolized by Acs to produce acetyl-CoA which is free to enter the mitochondria and the TCA cycle where it is oxidized and used to produce succinate. Succinate then enters the glyoxylate cycle, or acetyl-CoA can be used by gluconeogenesis for the synthesis of macromolecules [90, 92, 93]. Evidence also exists that the genes Gis1 and Rph1 regulate aspects of acetate metabolism [94]. These genes are induced in the diauxic shift after glucose depletion, deletion mutants have altered acetate accumulation and several genes involved in acetate metabolism are regulated by these two genes. In addition, genes involved in acetyl-CoA metabolism are downregulated by

Gis1 [94].

In A. nidulans acetate is known to repress other metabolic pathways through the actions of FacB, a transcriptional activator required for growth on acetate as a sole carbon source. FacB induces genes encoding Acs, isocitrate lyase, malate synthase, acetamidase and

NAP-isocitrate dehydrogenase [95, 96]. In this fungus acetate acts as a repressor of alternate carbon source metabolism through the actions of the repressor CreA and components of the

SAGA complex; a functional Acs is also required for the repression of some pathways such as the one responsible for proline metabolism [97, 98].

The FacB homolog, AcuB, has also been characterized in A. niger. In this fungus,

AcuB expression is glucose repressed and the protein is believed to regulate acetate uptake and metabolism; it may also affect other metabolic pathways not directly involved in acetate metabolism [99].

The transcriptional impact of growth on acetate as a carbon source has not been investigated in depth. In one published example, the effects of this carbon source on the 18

transcriptional profile of the bacteria Corynebacterium glutamicum has been investigated

[100]. Growth on acetate induces the expression of genes involved in acetyl-CoA formation, the glyoxylate cycle, the TCA cycle and gluconeogenesis, and it represses expression of genes involved in sugar metabolism and malic enzyme (involved in pyruvate metabolism)

[100].

Similar studies in Escherichia coli identified 185 up-regulated genes and 177 downregulated genes during growth on acetate. Of the up-regulated genes, many are involved in the glyoxylate cycle, the TCA cycle and gluconeogenesis as well as an ACS gene, while down-regulated genes included proteins for glycolysis, the phosphotransferase sugar transport system and the pyruvate dehydrogenase complex [101].

1.4.3 Acetyl-CoA and its Role as a Central Metabolite

Acetyl-CoA is one of the key metabolites in central carbon metabolism, because of its role as a substrate or product in numerous metabolic pathways. Its synthesis occurs through numerous different pathways which are often compartmentalized to specific organelles. The fact that acetyl-CoA is not able to cross membranes suggests that cellular compartmentalization may be one regulatory mechanism used to control the metabolic processes which involve this metabolite [102]. In the cytosol, acetyl-CoA is synthesized through the action of ATP-citrate lyase (Acl) using mitochondrial-derived citrate as a substrate, or though the action of acetyl-CoA synthase which uses acetate as a precursor. In the peroxisome acetyl-CoA is generated through the β–oxidation of fatty acids.

Mitochondrial acetyl-CoA is generated from pyruvate through the action of the pyruvate

dehydrogenase complex, or through the action of mitochondrial β-oxidation pathways [102-

104].

Perhaps the most significant role for acetyl-CoA is in the tricarboxylic acid (TCA) cycle where it is required for the synthesis of ATP. However it is also used in the cytosol during the elongation of fatty acids and in the production of other secondary metabolites such as steroids and isoprenoids; it is also the key substrate for protein acetylation [102, 105].

1.4.3.1 ATP-Citrase Lyase

As mentioned above, one of the main mechanisms for the synthesis of acetyl-CoA is via the enzyme Acl which catalyzes the conversion of citrate and CoA into acetyl-CoA and oxaloacetate, in the presence of ATP [106]. In general, Acl is localized in the cytoplasm making it the predominant source of cytoplasmic acetyl-CoA, however ER-bound and nuclear Acl have also has been described in some mammalian cells [107, 108].

Acl plays an important role in numerous cellular processes and is a major metabolic enzyme that represents the link between carbohydrate metabolism and fatty acid biosynthesis. Acl uses TCA-derived citrate to create acetyl-CoA for use in the biosynthesis of fatty acids through the creation of malonyl-CoA by acetyl-CoA carboxylase. It is also involved in the biosynthesis of terpenoids and sterols via the production of hydroxymethyl gluaryl-CoA through the mevalonate pathway [109]. It has also been shown that Acl is required for protein acetylation, including that of histones in mammalian cells; the enzyme produces a substantial amount of the acetyl-CoA required for histone acetylation [110].

1.4.3.2 The Role of Acl in Fungi

The role of Acl genes in fungi has been well characterized and the gene has been shown to play important roles in numerous cellular processes including sexual development and growth on glucose. There is a single gene encoding Acl1 in the basidiomycete fungus C. neoformans, an important pathogen of humans. Mutants lacking Acl1 show a growth defect on glucose, including an extended lag phase when grown in liquid culture. However, this phenotype is not seen upon growth in the presence of non-fermentable carbon sources such as acetate, ethanol and glycerol. Furthermore, deletion of acl1 affected the production of virulence factors; specifically, there was no observed production of capsule or melanin.

However, growth in the presence of acetate restored both of these phenotypes in the mutant.

The effect of the loss of Acl on virulence factor production likely accounts for the observed avirulence in mice when infected with acl1 deletion strains. Analysis of fungal burden revealed a reduction in cells in the lungs and an absence of fungi in the brain. The acl1 mutants also had reduced survival in macrophages and were also more susceptible to antifungal drugs [111].

The role of Acl genes has been characterized to a greater extent in ascomycete fungi.

In contrast to basiodiomycetes which typically contain one gene for Acl, there are generally two genes that each encode a subunit of the enzyme in ascomycetes [111]. For example, the deletion of acl genes in A. nidulans affected growth on glucose but not acetate, reduced production of asexual spores and resulted in a complete lack of sexual development [109].

The related fungus A. niger exhibits similar phenotypes when the acl1 and acl2 genes are deleted [108]. Growth defects are observed in media where glucose is the sole carbon source, but not in media supplemented with acetate. Mutants showed a defect in pigment 21

production, reduced conidia production and a delay in germination for those conidia which were formed [108]. The role of Acl has also been investigated in the fungus Sordaria macrospora. In this fungus Acl1 is essential for maturation of fruiting bodies, which is consistent with the induction of transcription of this gene at the beginning of the sexual cycle

[112].

In F. graminearum loss of Acl affected hyphal growth as well as germination rates when grown in glucose; the mutants also showed a reduction in conidia production, were incapable of asexual reproduction and had lower levels of histone acetylation. The presence of acetate was able to restore some phenotypes, including growth and conidia production, however sexual development was not restored. When assessed for the ability to cause disease symptoms on wheat, there were no visible symptoms of disease when the mutant strains were used for infection [113]. Analysis of trichothecene production also revealed a reduction in this mycotoxin in strains lacking Acl [113]. Further analysis of the role of Acl in trichothecene production failed to elucidate the exact connection, however it is likely related to a reduction in cellular acetyl-CoA levels which may be required for biosynthesis of the mycotoxin [114].

1.5 Thesis Objectives

The overall objectives of this thesis work was to provide insights into the mechanisms of virulence for U. maydis. This work is timely and important because fungal plant pathogens such as U. maydis represent a substantial threat to worldwide crop health and production, with a potential impact that has both economic and social implications.

Unfortunately, current strategies to combat these types of plant pathogens are inadequate and 22

unsustainable. Therefore, understanding the molecular interplay during the interaction between pathogenic fungi and their plant hosts is critical for developing strategies to mitigate disease and protect crops.

The relationship between plants and pathogenic microbes has evolved as a so-called molecular arms race, plants evolve mechanisms to stop pathogenic colonization and development, and pathogens acquire new virulence mechanisms to circumvent or disarm host defenses. Upon initial colonization of the host, the fungus is present in an environment that is scarce in nutrients and hostile due to the initiation of host defense responses such as the production of ROS. U. maydis has developed strategies to cope with plant defenses, although the mechanisms by which it does so are just now being characterized.

In the first part of this thesis, the goal was to elucidate the role of PLs during the pathogenesis of U. maydis. This work was initiated first through identification and in silico characterization of PL-encoding genes identified in the genome. Following this, a functional characterization of a PLA2, designated Lip2, was performed through a targeted gene deletion strategy in order to address the hypothesis that Lip2 is involved in the virulence of U. maydis. Strains lacking the lip2 gene were less virulent in maize seedlings, exhibited sensitivities to agents that trigger oxidative stress such as H2O2 and the vacuolar- accumulating drugs chloroquine and quinacrine; the mutants also showed increased tolerance to ionic stress caused by NaCl and LiCl. Transcriptional profiling by RNA-Seq and lipidomic analysis of WT and mutant strains were also performed to gain insight into the function of Lip2.

The goal for the second part of this thesis was to characterize the role of an ATP- citrate lyase, Acl1, in U. maydis. This enzyme turned out to be essential for growth on 23

glucose and pathogenic development. Furthermore, information from the study of Acl1 in U. maydis led to an investigation of acetate metabolism. Acetate represents an unfavourable carbon source for U. maydis, as growth in acetate leads to reduced virulence and a repression of mating and filamentous growth. Transcriptional profiling of cells grown in different carbon sources was used to help elucidate the effects of this carbon source on the cell.

Overall, these studies provide insights into a novel mechanism by which U. maydis copes with oxidative stress via the Lip2 PL as well as connections between carbon metabolism and virulence. This knowledge furthers the understanding of mechanisms employed by fungal phytopathogens to cause disease.

Chapter 2: Lip2

2.1 Introduction

A number of pathogenic fungi have been shown to employ PLs as virulence factors.

That is, these enzymes are necessary for pathogenic development in some cases because they have roles in host invasion, nutrient acquisition, or defense against the host immune response

(as described in Chapter 1). Despite being a model pathogenic fungus, the potential roles of

PLs in the virulence of U. maydis have not previously been assessed. This chapter presents the identification of candidate PL genes in the genome of U. maydis and a characterization of their transcript levels during growth in culture and in the plant host.

The analysis of the predicted PLs is then followed by a focused characterization of the function of a PLA2, Lip2, to address the hypothesis that this protein is involved in the virulence of U. maydis.

To address this hypothesis, a targeted gene deletion approach was used to construct a lip2 mutant for phenotypic characterization. The mutant was used to assess the role of Lip2 in virulence and to explore other phenotypes relevant to uncovering the function of the protein. The latter experiments revealed a role for Lip2 in the response to oxidative and ionic stress. Whole transcriptome sequencing and lipidomic analysis of WT and Δlip2 strains were also performed to gain a more holistic view of the impact that deletion of this gene had on U. maydis. These experiments supported the conclusion that one component of

Lip2 function has to do with the response to stress.

Overall, the experiments presented in the chapter suggest that U. maydis employs

Lip2 in a novel mechanism for withstanding the oxidative burst that is a well-documented component of the plant immune response. 25

2.2 Materials and Methods

2.2.1 Strains and Growth Conditions

The strains of U. maydis generated and employed in this study are listed in Table 24.

Unless otherwise noted, strains were grown at 30°C in potato dextrose broth (PDB [BD

Difco]) with shaking at ~200rpm in liquid culture or on solid plates containing 2% agar

(PDA). The haploid strains 001 and 002 were used for the majority of the experiments. The

SG200 strain is a haploid strain engineered to be pathogenic due to the presence of both alleles of the mating type genes, as a result the strain will grow as a yeast in liquid medium but is capable of forming pathogenic filaments on maize without a mating partner [10].

2.2.2 DNA Isolation

Strains used for isolation of genomic DNA were grown overnight in PDB at 30°C, centrifuged and washed once in sterile water. Cells were pelleted in a 2.0ml twist cap centrifuge tube, the supernatant was decanted and the cell pellet was re-suspended in 300µl

Triton solution (2% Trition X-100, 1% SDS, 100mM NaCl, 10mM Tris pH 8.0, 1mM EDTA pH 8.0), followed by the addition of 200µl glass beads and 300µl phenol:chloroform:isoamylalcohol (25:24:1 v/v) saturated with Tris-EDTA (Sigma). Cells were homogenized by vortex at max speed for 4 minutes. 200µl TE (10mM Tris pH 8.0, 0.1 mM EDTA pH 8.0) was added and samples were centrifuged at max speed for 5 minutes.

The upper aqueous layer was transferred to a new tube and DNA was precipitated by the addition of 1ml ice cold 100% EtOH and incubation at -4°C for 30 minutes to 72 hours.

Samples were centrifuged at maximum speed for 2 minutes at 4°C, and the DNA pellet was re-suspended in 1ml ice cold 100% EtOH and 10µl 4M ammonium acetate. Samples were 26

centrifuged at maximum speed for 2 minutes at 4°C, the supernatant was decanted and the

DNA pellet was rinsed with 500µl 70% EtOH. The sample was centrifuged at maximum speed for 2 minutes at 4°C, the supernatant was decanted and the pellet was allowed to air dry at room temperature for 10 minutes or until all traces of EtOH were gone. The DNA pellet was re-suspended in 50µl water or TE and DNA was visualized by loading 2µl onto a

0.8% agarose gel and electrophoresis at 100V for 60 minutes.

2.2.3 Identification of PLs in the U. maydis Genome

Putative PLs in the genome of U. maydis were identified using a reciprocal BLASTx

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) search of the genome using sequences of 15 PLs from S. cerevisiae (Table 1). U. maydis genes identified in this search were then used as a query for a DELTA-BLAST search

(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LI

NK_LOC=blasthome).

Multiple sequence alignments were performed using the COBALT multiple alignment tool (http://www.st-va.ncbi.nlm.nih.gov/tools/cobalt/re_cobalt.cgi?). Sequence alignments were visualized using the JalView software [115].

Transmembrane domains predictions were performed using the TMHMM 2.0 software [116]. Protein localization was predicted using the YLoc software [117]. Signal peptide scores were predicted using SignalP v4.1 [118]. Images of protein domain conservation were generated using the Comparative Fungal Genomics Platform v2.0 [119].

Table 1: S. cerevisiae Genes Used to Identify PLs in U. maydis PL genes identified in S. cerevisiae were used in a reciprocal BLAST search to identify PLs in the genome of U. maydis

S. cerevisiae Gene Gene Description YPL268W Phospholipase C YOL011W Phospholipase B YMR006C Phospholipase B YPL206C Phosphatidylglycerol Phospholipase C YMR008C Phospholipase B YER019W Inositol phosphosphingolipid phospholipase C TKR031C Sporulation PLD1 YOR022C Similar to bovine phospholipase A1 YGR110W Cardiolipin-specific deacylase YDL133W Spo14 regulatory factor YPL103C Found in mitochondrial proteome YNL012W SPOrulation YKR089C Triacylglycerol Lipase STC1 YPL110C Glycerophosphodiesterase YJR008W Memo Homolog

2.2.4 Construction of Knockout Cassettes for Targeted Gene Deletion in U. maydis

For targeted gene replacement in U. maydis, knockout cassettes were generated using a PCR overlap strategy (See Figure 2 and Figure 3) [120]. PCR primers were designed to amplify fragments of ~1kb flanking the 5’ upstream region (P1+P2) and 3’ downstream region of the target gene (P3+P4). In addition, the 5’ upstream region and the 3’ downstream region also contained DNA sequence complimentary to the 5’ and 3’ end of the selectable resistance marker. In the first round of PCR three fragments of DNA are amplified, the 5’ upstream region of the gene, 3’ downstream region of the gene and the resistance marker.

Primers Hyg2693 F + Hyg 2693 R were used to amplify the HygB resistance marker, primers

NAT1438 F and NAT1438 R were used to amplify the NAT resistance marker. PCR conditions varied slightly with each reaction, with regards to annealing temperature and

extension time, but in general reactions were carried out with the Herculase II enzyme

(Agilent) with the conditions [95°C for 10 minutes, followed by 35 rounds of 95°C for 30 seconds, 60°C for 30 seconds and 72°C for 1 minute per kb, then 72°C for 10 minutes] using gDNA isolated from WT strains, unless otherwise noted. DNA fragments from the first round were subject to gel electrophoresis on a 0.8% agaraose 1X TAE gel and the appropriate size band was cut out and DNA was purified using a gel purification kit

(BioBasic).

A second round of PCR is used to join the three fragments of DNA together via the overlapping regions of sequence. In this reaction, 50ng of total DNA from the three first- round PCR products were used in ratios of 1:1:1, 1:3:1 and 1:6:1 (5’ upstream region : resistance marker : 3’ downstream region) for PCR amplification using Herculase II polymerase (Agilent) with the reaction conditions [96°C for 4 minutes, 20 rounds of 96°C for

20 seconds, 58°C for 10:00, 72°C for 5:00 followed by one round at 72°C for 10:00].

A third round of PCR is employed to amplify the knockout cassette consisting of the flanking genomic regions fused to the resistance marker. For this reaction, 1µl of PCR product is used as template and nested primers (P5+P6) are used for amplification with the

Herculase II polymerase (Agilent) with the following reaction conditions [95°C for 10 minutes, followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 1 minute per kb being amplified, followed by one round at 72°C for 10 minutes]. PCR products were then analyzed on a 0.8% agarose 1X TAE gel and the band corresponding to the correct size for the knockout construct was cut out and purified using a gel purification kit (BioBasic) and stored at -20°C until transformation via biolistic bombardment.

Figure 2: Schematic Representation for Generation of the lip1 Knockout Construct Gene deletion constructs were created using an overlap-PCR based method. In the first round of PCR three DNA fragments were amplified with primers containing overlapping DNA sequence, yielding the left arm (P1 and P2), right arm (P3 and P4) and Nat-resistance gene (Nat FWD and Nat Rev). In the second round of PCR DNA fragments were joined together via the overlapping DNA sequence, and the subsequent resistance cassette was amplified using nested primers (P5 and P6) in the third round of PCR. The DNA construct was then transformed in U. maydis cells via biolistic transformation and integrated into the genome at the appropriate locus via homologous recombination. See Table 25 for primer details.

Figure 3: Schematic Representation for Generation of the lip2 Knockout Construct Gene deletion constructs were created using an overlap-PCR based method. In the first round of PCR three DNA fragments were amplified with primers containing overlapping DNA sequence, yielding the left arm (P1 and P2), right arm (P3 and P4) and Hygromycin resistance gene (Hyg FWD and Hyg Rev). In the second round of PCR DNA fragments were joined together via the overlapping DNA sequence, and the subsequent resistance cassette was amplified using nested primers (P5 and P6) in the third round of PCR. The DNA construct was then transformed in U. maydis cells via biolistic transformation and integrated into the genome at the appropriate locus via homologous recombination. See Table 25 for primer details. 31

2.2.5 Biolistic Transformation of U. maydis

Gene deletion constructs were transformed into U. maydis cells via a biolistic bombardment technique. Upon introduction of the construct into the WT cells, a fraction of these cells undergo homologous recombination with the introduced DNA, allowing for a targeted integration of the resistance marker into the genome of the fungus and replacement of the WT locus.

Purified constructs were adhered to 0.6µm tungsten beads (BioRad) by adding 1µg of DNA to 10 µl washed beads, followed by the addition of 10 µl 2.5M CaCl2 and 2 µl of

1M spermidine (Sigma). DNA was allowed to precipitate onto the beads for 10 minutes at room temperature, then beads were centrifuged, the supernatant was removed and the beads were rinsed once in 100% EtOH and re-suspended in 10 µl 100% EtOH. The DNA-coated beads were then loaded onto macro carrier disks (BioRad) and dried to allow excess EtOH to evaporate.

Target cells were grown overnight in 50ml DCM+G, centrifuged to pellet cells and washed twice in sterile water. The cell pellet was re-suspended in 1ml water and spread onto

3 DCM plates containing 1% glucose and 0.75M sorbitol.

Plates containing target cells were bombarded with DNA-coated tungsten beads using a biolistic transformation apparatus (BioRad) at a helium gas pressure of 13500 psi under vacuum of 2800 psi. Bombarded cells were allowed to recover for 24 hours at room temperature. Cells were then scraped off the plates, re-suspended in 1ml PDB+ antibiotic selection (200µg/ml hygromycin B or 100 µg/ml nourseothricin), spread onto DCM+G plates containing antibiotic selection (200µg/ml hygromycin B or 100 µg/ml nourseothricin), and incubated at 30°C for 3-5 days until colonies were present. Clonal transformants were 32

isolated by successive rounds of streaking single colonies onto PDA containing antibiotic selection.

2.2.6 PCR Confirmation of Mutants

Putative transformants were grown overnight in PDA at 30°C and DNA was isolated as previously described. This DNA was used as template for two PCR screens; the first to confirm integration of the marker at the appropriate locus (positive screen) and the second to confirm absence of the gene targeted for deletion (negative screen).

For the positive screen, a primer located just outside of the left arm (P1) is used with a reverse screening primer designed in the middle of the resistance marker (pHygScreen for

HygB resistance or pNATScreen for nourseothricin resistance). For the negative screen, primers designed for qRT-PCR were used to probe the coding region of the target gene

(um00133 FWD/REV for lip1, um01927 FWD/REV for lip2). See Table 25 for primer details.

2.2.7 Southern Blot Confirmation of Mutants

Once transformants had been confirmed via PCR they were used in following experiments. Lip2 mutants were then confirmed by Southern blot hybridization, using P32- radiolabelled DNA to probe for a 4225 bp HindIII fragment in Lip2 mutants or a 1751 bp

HindIII fragment in WT strains (Figure 4).

DNA was isolated from strains as described previously with the addition of a 30 minute RNase A treatment after EtOH precipitation. DNA was re-suspended in 400µl TE +

30µg RNase A (Qiagen) and incubated for 30 minutes at 37°C. DNA was precipitated with

1ml ice cold 100% EtOH and 10µl 4M ammonium acetate.

Approximately 5µg DNA was digested with 100 units HindIII (New England

Biolabs) in 200µl reactions for 6 hours at 37°C followed by heat inactivation at 80°C for 20 minutes. To each reaction 20µl 3M sodium acetate (pH 5.2) and 750µl 100% EtOH was added and incubated at -20°C overnight to precipitate DNA. Samples were centrifuged at

4°C for 20 minutes, the supernatant was removed and the pellet was air-dried for 15 minutes before re-suspension in 20µl water.

Equal amounts of DNA was loaded into a 0.8% agarose 1X TAE gel subject to electrophoresis for 2 hours at 80V. Following electrophoresis the gel was rinsed once with water and DNA was denatured with two 15 minute washes in denaturing buffer (0.5M

NaOH, 1.5M NaCl), a 2 minute wash in 2X SSC (0.3M NaCl, 30mM sodium citrate), two 15 minute neutralization washes in neutralization buffer (0.5M tris, 3M NaCl) and a 2 minute wash in 2X SSC. DNA was transferred to a high bond N+ membrane through capillary action overnight, followed by UV crosslinking at 150,000 µJ.

The DNA probe was amplified using the primers Lip2 Probe FWD and Lip2 Probe

REV to yield a 511 bp DNA fragment. 50 ng of probe was labeled using a DECAprime II kit

(Ambion) and non-incorporated P32 was removed using a MicroSpin G25 column

(Amersham). Radiolabelled probe was incubated at 90°C for 10 minutes and then added to the hybridization tube along with the membrane and 25ml hybridization buffer (6X SSC, 5X

Denhardt’s solution, 0.5% SDS) in a 55°C hybridization oven incubated overnight.

Following hybridization the membrane was washed twice for 5 minutes with preheated

(55°C) wash buffer I (2X SSC, 0.1% SDS) and once for 10 minutes and once for 30 minutes 34

with preheated (55°C) wash buffer II (0.1X SSC, 0.1% SDS). The washed membrane was then exposed using a phosphor screen and the laser-scanning Pharos system.

Figure 4: Schematic for Southern Blot Confirmation of Gene Deletions Genomic DNA was isolated from WT and mutant strains and digested with HindIII, which cuts at the sites indicated by a red X. A radiolabelled DNA probe was designed to a region next to the WT gene and the hygromycin resistance gene, with fragment sizes of 1751 bp and 4225 bp, respectively.

2.2.8 RNA Isolation for qRT-PCR

RNA was isolated from U. maydis cells at various points throughout the lifecycle and in different morphological states. For isolation of RNA from budding U. maydis cells, WT strains were grown overnight in PDB at 30°C. Cells were centrifuged, washed twice in water and homogenized using glass beads in a bead mill using 3 cycles of 1 minute disruption followed by 1 minute on ice. For isolation of RNA from the filamentous cell type, cells were spotted onto DCM+C plates to induce filamentation. Filamentous colonies were scraped off and ground in liquid nitrogen. For RNA from different time points throughout the infection,

7-day old maize seedlings were infected with U. maydis and samples were taken at the

indicated time points and ground in liquid nitrogen. Tissue samples from the 1dpi time point were harvested from maize leaves spotted with mating culture.

Total RNA was isolated with TRIZOL (Invitrogen) or a low-pH isolation method

(Gentra Systems). For isolation with TRIZOL, the cell pellet was re-suspended in 1ml

TRIZOL and cells were homogenized in a bead beater as described above. The sample was centrifuged at 12,000xg at 4°C for 10 minutes to remove cell debris and the supernatant was transferred to a new tube along with 200µl chloroform.

For isolation with the low-pH method, approximately 1ml Buffer 1 (2% SDS, 68mM tri-sodium citrate dihydrate, 132mM citric acid, 10mM EDTA) was added per 50mg of sample ground in liquid nitrogen. To this, 340µl Buffer 2 (4M NaCl, 17mM tri-sodium citrate dihydrate, 33mM citric acid) was added; samples were inverted to mix and put on ice for 5 minutes. The samples were then centrifuged at maximum speed for 10 minutes to remove cell debris and the supernatant was transferred to a new tube along with 250µl chloroform.

Samples in chloroform were centrifuged at 12,000xg for 15 minutes at 4°C and the upper layer was transferred to a clean RNase-free tube. The chloroform wash was repeated at least 2 more times to increase RNA purity. One volume of isopropanol was added and samples were incubated at -20°C for 30 minutes, centrifuged at maximum speed for 5 minutes and the supernatant was decanted. The RNA pellet was washed once with 70%

EtOH, centrifuged at 7500xg for 5 minutes at 4°C and the supernatant was decanted. The

RNA pellet was air dried for 10 minutes and re-suspended in 30-50µl DEPC-treated water.

2.2.9 qRT-PCR Gene Expression Analysis

Total isolated RNA used as template for cDNA synthesis was DNase treated (Life

Technologies) and cDNA was synthesized using the SuperScript first strand synthesis kit

(Invitrogen). PCR reactions were monitored using the 7500 system (Applied Biosystems) using primers listed in Table 25. Relative gene expression was quantified using the SDS software (Applied Biosystems) based on the 2-ΔΔCT method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and actin were used for normalization.

2.2.10 Growth Measurements

Strains used for growth measurements were grown overnight in 5ml PDB, cells were pelleted via centrifugation, washed twice in sterile water and re-suspended in 1ml MM-C.

The cells were counted using a haemocytometer, 50mL of MM+G was inoculated to a final concentration of 5x104 cells/ml in a 250ml flask and incubated at 30°C shaking at 200 rpm.

Every 12 hours 1ml of culture was sampled from each flask and an OD600 measurement was taken using a DU530 Life Science UV/Visible spectrophotometer (Beckman Instruments) for

144 hours. Strains were grown in triplicate and OD600 values were averaged for each set.

2.2.11 Mating Assays

Mating between strains was determined by production of white aerial hyphae during mating reactions on double complete medium plus 1% activated charcoal (DCM+C); unless otherwise noted the carbon source in DCM+C plates was 1% glucose. Haploid cells were grown overnight in PDB at 30°C, washed twice in sterile water and counted with a haemocytometer. Cells were diluted in sterile water to a final concentration of 1.0x107 37

cells/ml, mating cultures contained equal numbers of compatible strains (5.0x106 cells/ml +

5.0x106 cells/ml) and 10μl aliquots were spotted onto DCM+C plates. Solopathogenic and diploid strains were prepared in the same manner as haploids, diluted to 1.0x107 cells/ml and

10µl aliquots were spotted. Spots were allowed to dry and then were double-wrapped in parafilm and placed face-down at room temperature or 30°C for 2 to 5 days.

2.2.12 Virulence Assays

WT and mutant strains were grown overnight in PDB or in MM with the indicated carbon source (1% glucose or 1% acetate) at 30°C with shaking at 200 rpm, cells were collected via centrifugation, washed twice and re-suspended in sterile water. Cells were counted with a haemocytometer and compatible haploid pairs were diluted in water to a final concentration of 1x107 cells/ml (5x106cells/ml each haploid strain) while solopathogenic

SG200 strains were diluted to a final concentration of 1x107 cells/ml. These cell preparations were used to infect 7-day old maize seedlings (Golden Bantam, West Coast

Seeds) using a 26.5 gauge needle (BD) injecting approximately 100µl into each plant, or until the inoculum was visible within the plant stem.

Disease ratings fall into six categories, each assigned a weighted value used to calculate a disease index. Healthy plants show no symptoms of infection of disease and have a weighted value of 0, plants which show signs of a defense response from the plant in the form of anthocyanin, a purple-red pigment produced by the plant, are scored with a value of

1. Disease symptoms produced by the fungus include formation of tumors on the leaf, which are generally small in size (<2mm), small stem tumors less than 1 mm and large stem tumors greater than 1mm; these symptom classes are assigned a weighted value of 2, 3 and 4, 38

respectively. Finally, plant death is ranked as the most severe symptom, and is assigned a value of 5. Disease index scores were calculated using the following formula:

(# ℎ푒푎푙푡ℎ푦 푥 0)+(# 푎푛푡ℎ표푐푦푎푛𝑖푛 푥 1)+(#푙푒푎푓 푡푢푚표푟푠 푥2)+(#푠푚푎푙푙 푠푡푒푚 푡푢푚표푟푠 푋3) 퐷퐼 = +(# 푙푎푟푔푒 푠푡푒푚 푡푢푚표푢푟푠 푥 4)+(# 푑푒푎푑 푥 5) 푡표푡푎푙 푝푙푎푛푡푠 𝑖푛푓푒푐푡푒푑

Approximately 60-100 plants were scored for each strain combination and for three biological replicates.

2.2.13 Spot Assays

WT and mutant strains were grown overnight in PDB, washed with water and re- suspended in MM-C. Cells were counted with a haemocytometer and diluted with MM-C to

2.5x107 cells/ml, from which 1/10 serial dilutions were made 4 times. 4µl (105 cells) of each strain was then dropped onto agar plates consisting of MM and various stressors and/or carbon sources; all plates contained 1% glucose as a carbon source unless otherwise noted.

Spots were allowed to dry in a biosafety cabinet before incubation at 30°C for 2-5 days.

Plates were visualized and images were captured using a scanner.

2.2.14 Sensitivity to Oxidative Stress

WT and mutant strains were grown overnight in PDB, washed with water and

~1.0x104 cells were plated onto PDA with a 5mm piece of Whatmann paper (Fisher

Scientific) soaked with 10µl H2O2. Plates were left to incubate at 30°C for 48 hours. The

zone of clearance was measured from 4 points on each plate and averaged. The experiment was repeated with three independent biological samples.

2.2.15 Microscopy

Fluorescence microscopy was performed using a Zeiss Axioplan 2 imaging system at

100X magnification using the MetaMorph software. Cells used for microscopy were grown overnight in PDB under standard conditions. Staining of fungal cell walls was performed with Calcofluor-white (Sigma) which binds to cellulose and chitin and has an absorbance peak at 347 nm [121]. A FTIC filter was used to visualize calcofluor white stain, and a GFP filter was used to visualize GFP.

2.2.16 RNA Isolation for RNA-Seq

WT 002 or Δlip2 strains were grown overnight in PDB, washed with water, re- suspended in MM-C and counted with a haemocytometer. These cells were used to inoculate

50ml MM+G at a final concentration of 5.0x104 cells/ml and grown for 36 hours shaking at

30°C until the exponential phase. These cells were centrifuged, washed twice with water and re-suspended in MM-C. 50ml of MM+G, MM+A or MM+O were inoculated with cells at a final concentration of 1.0x106 cells/ml and incubated shaking at 30°C for 24 hours.

Cells were harvested by centrifugation, washed once in water and RNA was isolated using the RNeasy Mini Kit (QIAGEN) according to the manufacturers directions. Cells were disrupted in RTL buffer using a bead beater consisting of 3 cycles of 1 minute disruption followed by 1 minute on ice. RNA isolation included an on-column DNase digestion

(QIAGEN). RNA was eluted in DEPC-treated water and stored at -80°C. 40

RNA quality was assessed by running ~500ng on a 1% agarose formaldehyde denaturing gel (20mM MOPS, 5mM sodium acetate, 1mM EDTA, 1M formaldehyde) and assessing the integrity of the 28S and 18S rRNA bands.

2.2.17 Library Preparation for RNA-Seq

Total RNA was shipped on dry ice to Genewiz for library preparation. Briefly, mRNAs were purified using poly(A) selection and fragmented. First strand synthesis of cDNA was primed with random primers and double-stranded cDNA was end-repaired, phosphorylated and A-tailed. Adaptors were ligated and PCR amplification was performed.

These DNA libraries were used for sequencing on HiSeq with 1x50bp configuration

2.2.18 RNA-Seq Bioinformatics Analysis

Fastq files were obtained and sequence reads were trimmed to remove low quality bases at ends. These reads were then mapped to the reference genome (U. maydis genome file p3_t237631_Ust_maydi_v2 obtained from http://mips.helmholtz- muenchen.de/genre/proj/ustilago/) and hit counts and RPKM values for genes were calculated. These values were used to compare gene expression between samples.

Gene annotation data for the U. maydis reference genome was acquired from the

Hemlholtz Zentrum Munchen PEDANT 3 database (http://pedant.helmholtz-muenchen.de).

Gene ontology (GO) term enrichment was performed using hypergeometric tests implemented in R Bioconductor packages GSEABase (v1.28.0) and GOstats [122].

Benjamini and Hochberg multiple testing correction (false discovery rate p<0.05) implemented in the R packages. 41

2.2.19 Sample Preparation for Lipidomic Analysis

WT and Δlip2 cells were grown overnight in PDB, centrifuged, washed twice with sterile water and re-suspended in water. These cells were counted with a haemocytometer and used to inoculate 50ml MM+G to a final concentration of 5.0x104 cells/ml. Strains were grown to mid-exponential phase and 5.0x107 cells were pelleted in ice cold 100% methanol.

Cell pellets were shipped in 100% methanol on dry ice to the Metabolomics Innovation

Center. Cells were homogenized at 30Hz for 1 minute with two 5-mm metal balls in a

MM400 mill mixer at -10°C. 800µl of cold methanol:chloroform (3:1 v/v) and homogenized again for 1 minute. Samples were centrifuged at 13,000 rpm at 4°C for 15 minutes. The supernatant was collected and dried under N2 flow in a nitrogen evaporator at room temperature. The residue was dissolved in 40µl of 60% methanol.

15µl of the sample was injected onto a reversed-phase UPLC column (C8, 2.1 I.D. x

50mm, 1.7µm) and chromatographed using water-0.01% formic acid and acetonitrile-0.01% formic acid as the mobile phase for binary gradient elution at a column temperature of 50°C and a flow rate of 0.35ml/min.

A Thermo LTQ-Orbitrap Velos Pro mass spectrometer with a heated ESI source was used for lipid detection in the FTMS scan mode. The mass resolution was set at 60,000 at m/z 400 and the mass range was m/z 150 to 1200. Lock mass calibration was applied to ensure mass accuracy throughout LC-MS runs. Two LC-MS runs per sample were performed in the (+) and (-) ion detection modes, respectively.

2.2.20 Lipidomic Data Processing and Analysis

Datasets were converted into mzXML files and processed using the XCMS module

(http://metlin.scripps.edu/xcms/) in R for correction of retention time shifts, peak detection/integration, peak grouping and peak filling. The results were saved as two- dimensional data matrix tables (m/z, RT and peak area) amenable to statistical analysis.

Chromatographic peaks originating from LC-MS solvents and instrument background noises were removed and manual de-isotoping was applied during data processing.

Metabolite assignment was performed by querying the METLIN database

(http://metlin.scripps.edu/metabo_batch.php?&return=yes) with m/z values using an allowable mass error of ≤3 ppm. Ion forms of (M+H)+ and (M+Na)+ were considered for positive-ion detection mode and the ion forms of (M-H)- and (M+Na-2H)- were considered for the negative-ion detection mode. Further characterization of these metabolites was performed by querying the LIPID Metabolite and Pathway Strategy (LIPID MAPS) database

(http://www.lipidmaps.org).

2.3 Results

2.3.1 In silico Identification of PLs Reveals a Diverse Gene Family in U. maydis

As a first step to characterize PLs in U. maydis, an in silico approach was taken to identify genes coding for potential PLs in the genome sequence. PLs previously identified in

S. cerevisiae were used as queries for a reciprocal amino acid BLAST searches against the U. maydis genome (Table 1); PLs identified in this search were then used as input for DELTA-

BLAST searches of the genome. The final results of these searches identified 11 genes encoding putative PLs, including multiple members of each main PL family (Table 2). 43

Of the genes identified, three were predicted to encode putative PLAs (um00133, um01927 and um01017). A patain/phospholipase A2-related domain (IPR002641) was identified in the gene um01017. Two of these genes, um00133 and um01927, have a conserved platelet-activating factor acetylhydrolase plasma/intracellular isoform II domain

(IPR005065) and um01927 also contains a haloacid dehydrogenase (HAD)-like domain

(IPR023214); as these two genes will be the focus of much of the subsequent work, we have designated them lip1 and lip2, respectively.

Two genes were predicted to code for PLBs (um01035/um11266 and um05871); both genes encode a polypeptide with predicted lysophospholipase catalytic domain (IPR002642) and um05871 also contains a 4’-phosphopantetheinyl transferase domain (IPR008278).

Three genes were identified which encode candidate PLCs (um00004, um02982 and um01895/um10263). A PLC-like phosphodiesterase, TIM beta/alpha-barrel domain

(IPR017946) was identified in um00004 while both um02982 and um01865/um11266 contain a phospholipase C, phosphatidylinositol-specific X and Y domain (IPR000909 and

IPR001711). The um02982 protein also contained a pleckstrin homology-type, EF-hand-like domain (IPR015359) and a C2 calcium-dependent membrane targeting domain (IPR000008).

Three genes were identified which encode potential PLDs (um00370, um01120 and um06066). All three genes contain a phospholipase D/transphosphatidylase domain

(IPR001736); um00370 also contains a phox-like domain (IPR001683) and pleckstrin-like domain (IPR001849).

Of the 11 predicted PL genes, two contain transmembrane domains (um01017 and um05871) and only one (um01035/um11266) contained an identifiable signal peptide

(SignalP D-Score 0.747) that predicted secretion to the extracellular space. Eight proteins 44

had predicted localizations with varying degrees of probability and confidence, of which 4 were cytoplasmic (um00004, um02982, um01865/um10263 and um00370), two were nuclear

(um00133 and um06066) and one was mitochondrial (um01120). A summary of the in silico analysis, which reveals a diverse family of genes in the genome, can be found in Table 2.

Table 2: Identification and in Silico Characterization of Putative PLs in U. maydis Summary of in silico characterization of PLs identified in the genome of U. maydis, including likely PL family, protein length (aa), predicted secretion signal likelihood, number of predicted transmembrane domains and predicted subcellular localization.

Gene ID PL Length Signal Transmembrane Localization Family (aa) Peptide Domains (Probability/ Confidence) D-Score

um00133 A2 716 0.112 0 Nucleus (87.62/0.64)

um01927 A2 829 0.133 0 -

um01017 A2 990 0.106 1 - um05871 B 954 0.313 1 - um11266 B 713 0.747 0 Extracellular Space (um01035) (96.04/0.99) um00004 C 354 0.124 0 Cytoplasm (66.58/0.62) um02982 C 1491 0.184 0 Cytoplasm (99.93/0.97)

um10263 C 588 0.111 0 Cytoplasm (99.88/0.99) (um01865) um00370 D 1807 0.135 0 Cytoplasm (99.98/1.00)

um01120 D 571 0.127 0 Mitochondria (99.98/1.00)

um06066 D 1033 0.106 0 Nucleus (80.49/0.60)

2.3.2 PLs in U. maydis Are Expressed Throughout the Lifecycle

To further characterize PLs in U. maydis, gene expression analysis was performed to determine if these genes exhibit differential regulation throughout the lifecycle. RNA expression analysis was conducted using RNA isolated from haploid and dikaryotic cell types and at different stages of infection in maize seedlings. Quantitative real-time PCR

(qRT-PCR) was used to determine RNA levels (Figure 5). The results show minimal differential regulation in the filamentous dikaryon, however a number of PLs did have higher expression values at early (1 dpi) and/or late (12 dpi) stages of infection; the only exception to this observation is the PLA2 encoded by the gene um01927 (lip2). Trends within the families show little to no regulation of PLAs during late stages of infection. PLBs appear to have increased expression during both early and late stages of infection, with no differential regulation in the filamentous dikaryon. This trend is similar in PLCs and PLDs which also have highest RNA levels during infection and no differential regulation in RNA expression at 0 dpi and in the dikaryon.

The regulation of numerous PLs throughout the lifecycle, especially during infection of maize, suggests that one or more of these genes may play a role in the virulence of the fungus; either directly by acting as a virulence factor, or indirectly by being involved in a morphological transition necessary to complete the lifecycle.

Figure 5: Gene Expression Analysis of PLs Thoughout the Lifecycle Real time quantitative PCR (RT-qPCR) expression analysis of PL genes. RNA was isolated from budding haploid cells, cells of the filamentous dikaryon (DIK – blue), the mating culture used for infection (0 dpi – green) and from mixed tissue at early (1 dpi – yellow) and late (12 dpi – red) stages of infection in maize seedlings. Expression values were normalized to GAPDH and relative to the expression in the budding haploid cells.

2.3.3 The Genome of U. maydis Contains Two Genes Coding for PAFAHs

As mentioned, we identified two genes in the genome of U. maydis that encode putative PAFAHs, um00133 (lip1) and um01927 (lip2). Further characterization showed that these genes contain a conserved PAFAH plasma/intracellular isoform II domain

(IPR005065), while lip2 also contains a HAD-like domain (IPR023214) (Figure 6).

Multiple sequence alignments with U. maydis Lip1 and Lip2, T. harzianum PAF-AH,

S. pombe plg7+, and the human genes PLA2G7 and PAFAH2 revealed domain conservation within the fungal proteins and extending to the human proteins. The sequence alignment 47

also revealed conserved motifs, including the GXSXG lipase sequence that was present in all six sequences. Furthermore, the amino acids Ser343/289 and Asp366/313 for Lip1 and Lip2, respectively, were conserved in all aligned sequences, and Lip1 contained a conserved

His432 (Ser257/272/273/236, Asp291/323/296/259 and His368/413/351/314 for plg7+, PLA-

AH, PLA2g7 and PAFAH2, respectively) (Figure 7). These amino acids have previously been shown to be critical for enzyme activity as they form a catalytic triad found in esterases and lipases [123, 124]. This level of domain conservation suggests that these genes are most likely homologs.

Figure 6: Domain Architecture of Lip1 and Lip2 Depictions of the proteins encoded by the genes um00133 and um01927 in U. maydis. Both genes contain a PAFAH plasma/intracellular isoform II domain; lip2 also contains a haloacid dehydrogenase (HAD)-like domain.

Figure 7: Multiple Sequence Alignment of the Pafah Domain in Fungal and Human Genes The PAFAH domains from U. maydis, T. harzianum, S. pombe and Homo sapiens were aligned and percentage identity of conserved residues is indicated with blue highlights. The PAFAH domain in Lip1 and Lip2 show homology to those in other fungi as well as the human PAFAH genes, suggesting that these genes are most likely homologs based on domain conservation. 49

2.3.4 Deletion of lip1 and lip2 in U. maydis

As a first step to assess the contribution of Lip1 and Lip2 to virulence, a targeted gene deletion approach was used to create single and double gene deletion mutants that could be used in subsequent experiments. Transformation of U. maydis with gene deletion constructs delivered via a biolistic particle bombardment technique led to the isolation of two independent mutants in each 001 and 002 background for the deletion of lip1, lip2 and a lip1 lip2 double-mutant was also constructed (See Table 24 for strains generated in this study).

Alleles of the genes with deletions are designated as Δlip1 and Δlip2.

Genomic DNA was isolated from each putative transformant and integration of the gene deletion construct was confirmed via PCR for all strains. Gene deletion of strains lacking lip2 was also confirmed via Southern hybridization to ensure integration at a single locus (See Figure 4 and Figure 8).

Figure 8: Southern Hybridization Analysis of DNA from WT and Δlip2 Strains Genomic DNA isolated from WT and Δlip2 strains was digested with HindIII, separated on a 1X TAE 0.8% agarose gel and transferred to a positively charged nylon membrane. A radiolabelled DNA probe was hybridized to the DNA on the membrane and detected using a phosphor screen. Hybridization of the probe was predicted to occur to a DNA fragment of 1751 bp in strains with a WT lip2 locus and to a 4225 bp fragment of DNA in strains with a correctly integrated lip2 deletion construct.

2.3.5 Deletion of lip1 and lip2 Does Not Affect Vegetative Growth

To assess if the deletion of Lip1 and Lip2 affects growth of U. maydis growth kinetics of WT, Δlip1, Δlip2 and Δlip1Δlip2 were measured. Each strain was grown in 51

MM+G for 144 hours and OD600 measurements were taken, using culture turbidity as an indicator of cell growth. Mutant strains showed no significant differences in growth rate when compared to the WT strains of the same background, indicating that neither Lip1 or

Lip2 contribute to vegetative growth on glucose (Figure 9).

Figure 9: Growth of lip1 and lip2 Deletion Mutants The growth rates of WT and lip1 or lip2 deletion strains were measured in both 001 (left) and

002 (right) backgrounds. Strains were grown in 50ml of MM+ 1% glucose and OD600 readings were taken at 12 hour intervals for 144 hours.

2.3.6 Deletion of lip1 and lip2 Does Not Affect Mating

To assess the contribution that Lip1 and Lip2 may have to the ability to produce mating pheromones, recognize compatible mating partners and fuse to form a filamentous dikaryon, compatible mating pairs of WT and mutant strains were co-spotted onto DCM+C plates and growth was observed at 48 hours. On appropriate media, compatible haploid pairs will sense each other and with time fuse to create a dikaryon. This mating dikaryon is a filamentous cell type, and its growth therefore appears macroscopically as a white and fuzzy colony surface in contrast to the flat, gray growth of haploid colonies.

In all mating combinations tested (WTxWT, ΔxΔ and both WTxΔ crosses) filamentous growth was observed by 48 hours of incubation, suggesting that Lip1 and Lip2 are not involved in mating or in filamentous growth (Figure 10).

Figure 10: Deletion of lip1 and lip2 Does Not Affect Mating in U. maydis Cultures of solo haploids or compatible mating pairs were spotted onto charcoal-containing media and incubated at room temperature for 48 hours. Formation of a white fuzzy colony is indicative of filamentous growth and a compatible mating pair. The WT strain and the deletion strains are as indicated, and the mutants include Δlip1 (left), Δlip2 (middle) and Δlip1 Δlip2 (right).

2.3.7 Deletion of lip2, but not lip1, Affects the Virulence of U. maydis

To assess the impact that Lip1 and Lip2 have on virulence, 7-day old maize seedlings were infected with a mating culture containing compatible crosses of WT and mutant strains.

Disease symptoms were then assessed 14-days post infection and each plant was scored for the severity of disease observed.

Deletion of lip1 did not have an effect on the virulence of U. maydis. As seen in the left side of Figure 11, maize seedlings infected with Δlip1xΔlip1 crosses exhibited a similar severity in disease symptoms as the plants infected with the WTxWT crosses. Plants 53

inoculated with the Δlip1xΔlip1 cross did have a slightly higher proportion of healthy plants, but they also had an increased proportion of plants showing severe symptoms such as plant death and large stem tumors.

Deletion of lip2 led to a reduction in the virulence of U. maydis. Maize seedlings infected with the Δlip2xΔlip2 combination of strains had a much higher proportion of healthy plants, and a much lower proportion of plants with any tumor formation (Figure 11, middle). WTxΔlip2 crosses also provided an intermediate phenotype with similar levels of healthy plants to WT but with an overall lower severity in observable disease symptoms.

Furthermore, lip2 was deleted in the solopathogenic haploid strain SG200 to confirm that the virulence phenotype observed in Δlip2 strains was independent of mating. Maize seedlings infected with these solopathogenic strains also showed a higher proportion of healthy plants and a lower degree of symptom severity in strains with a lip2 deletion (Figure 12). This result indicates that the virulence defect observed in Δlip2 strains is not due to a defect in mating and thus consistent with the outcomes of the mating tests in Figure 10.

The Δlip1Δlip2 double mutant was created to assess whether Lip1 played a role in virulence in the background of a lip2 deletion. When maize seedlings were infected with the double mutants, they exhibited similar levels of disease symptoms as maize plants infected with the Δlip2 strains. This result indicated that Lip1 does not play a role in the virulence of the fungus even when lip2 is deleted (Figure 11, right).

Figure 11: Deletion of lip2 Reduces Virulence in U. maydis Virulence assays were performed with seven-day old maize seedlings infected with compatible mating cultures of WT or mutant strains, including reciprocal WTxΔ crosses. Disease symptoms were scored 14 days post-infection. The disease index was calculated based on the frequency of symptoms that included plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease ratings and the total number of plants infected for each cross are indicated at the top. Comparison of WTxWT vs Δlip2xΔlip2 infections show a significant difference in disease index between the two infections (p=0.0087).

Figure 12: Deletion of lip2 Reduces Virulence in the Solopathogenic Strain SG200 Virulence assays were performed with seven-day old maize seedlings infected with WT and mutant strains of the solopathogenic SG200 strain and the disease symptoms were scored 14 days post-infection. The disease index was calculated based on frequency of symptoms that included plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease ratings and total number of plants infected for each cross are indicated at the top.

2.3.8 Deletion of lip2 Increases Susceptibility to Oxidative Stress

To further elucidate the role of Lip2 we investigated potential sensitivities to a variety of stressors. Based on the role of PAFAH in other organisms and the observation that deletion of genes encoding these enzymes often cause susceptibility to oxidative stress [48,

50, 51, 53], we tested the hypothesis that Lip2 may be involved in response to oxidative

stress. The prediction was that strains deficient in Lip2 would be sensitive to agents that cause oxidative stress.

Sensitivity to oxidative stress was assessed by plating WT and mutant strains onto

PDA plates and incubating with a paper disk soaked in H2O2. Cells were grown for 48 hours and the zone of clearance caused by H2O2 was measured. Strains with a deletion in the lip2 gene showed a significant increase in the size of the halo indicating an increased sensitivity

to oxidative stress relative to the WT strains (Figure 13). )

) 3 ** *** 3 m

m ** *

(

c c

n 2

1 1

o o

Z 0

1 .2 3 2 2 2 1 1 0 1 3 4 0 A 2 2 0 A A 0 A C A 1 2 L p 2 L 1 p i p ip i B L i B L L D L D

Figure 13: Mutants Defective in Lip2 Are Sensitive to Oxidative Stress Caused by H2O2

WT and mutant strains were plated onto PDA and incubated with 10µl H2O2 spotted onto a 5mm piece of Whatman paper for 48 hours. The radius of the zone of clearance was measured from four points per plate and averaged. The experiment contained two plates per strain and was repeated in three biological replicates. Statistical analysis was carried out using the unpaired two-tailed Student t test (* denotes p<0.05, ** denotes p < 0.005 and *** denotes p<0.0005).

2.3.9 Mutants Defective in Lip2 Are Sensitive to Chloroquine and Quinacrine

To further elucidate the role of Lip2, we examined the effects of the vacuolar- accumulating drugs chloroquine and quinacrine, which have been reported to have broad- spectrum toxicity against viruses, bacteria and fungi [125]. These drugs are weak bases that accumulate in acidic compartments including endosomes, lysosomes and Golgi vesicles; they are also reported to be inhibitors of PLA2 [125, 126]. Links between these drugs and oxidative stress also exist, as chloroquine also has been shown to have synergistic effects with H2O2 in inhibiting the growth of Plasmodium falciparum in culture, yet other reports show it has protective effects in mice against oxidative stress caused by pristane [127, 128]

An increased sensitivity to both drugs was observed in lip2 deletion mutants in the

001 background but no obvious differences in sensitivity were observed for any mutants in the 002 background (Figure 14). The lip1 lip2 double mutant may show slightly increased sensitivity relative to the single mutants.

Figure 14: Mutants Defective in Lip2 Are Sensitive to Chloroquine and Quinacrine Spot assays were performed by placing 105 cells of WT and mutant strains onto MM+ chloroquine (left) or quinacrine (right) in 10-fold serial dilutions from left to right. The plates were incubated at 30°C and growth was monitored for 2-5 days.

2.3.10 Mutants Defective in Lip2 Are Resistant to Ionic Stress

Damage caused by both oxidative stress and drugs such as chloroquine is known to be linked to plasma membrane and cell wall integrity, suggesting that sensitivities to these agents may be linked to the state of the plasma membrane or fungal cell wall [63, 129]. To further elucidate the role of Lip2 we examined a number of cell wall and membrane stressors and their effect on Δlip2 strains.

In addition to the sensitivities to oxidative stress, chloroquine and quinacrine, lip2 mutants also exhibited a phenotype of increased resistance to ionic stress in the form of sodium or lithium ions. These strains had increased resistance to NaCl in both backgrounds.

However WT and mutants strains of the 001 background showed no difference in sensitivity to LiCl (Figure 15). This further supports the hypothesis that Lip2 may be involved, either directly or indirectly, in maintaining the structural integrity of the cell.

Figure 15: Mutants Defective in Lip2 are Resistant to Ionic Stress Spot assays were performed by placing 105 cells of WT and mutant strains onto MM+ 1M NaCl (left) or 10mM LiCl (right) in 10-fold serial dilutions from left to right. The plates were incubated at 30°C and growth was monitored for 2-5 days.

2.3.11 Transcriptional Profiling of the Δlip2 Mutant And the WT Strain Grown in

Different Carbon Sources

To assess the possibility that a Lip2 deletion could influence the expression of other genes, we obtained transcriptional profiles of WT and Δlip2 strains grown in glucose or oleic acid using RNA-Seq. RNA was isolated from these strains 24 hours after being shifted into the indicated carbon source during exponential growth in glucose.

Of the libraries constructed and sequenced in this project there was a minimum read depth of 34,273,646 reads and an average Q score of 37.13 (indicating a base call accuracy between 99.9% to 99.99%). To analyze the data, a gene ontology (GO) enrichment approach was used to obtain a functional profile of the genes that are differentially regulated under different conditions. GO terms are a classification system that allows the binning of genes into functional categories relating to three different categories: cellular component (CC), molecular function (MF) and biological process (BP). CC relates to the part of the cell which the protein is associated, MF to the molecular activities of the protein and BP refers to processes which relate to function of a living entity. GO enrichment analysis identifies higher proportions of genes with specific annotations among the differentially regulated genes than among all of the genes in the genome [130].

GO enrichment analysis identified numerous GO terms associated with genes that were differentially regulated in each strain and culture condition. The MFs of genes downregulated in the Δlip2 mutant during growth in glucose were mainly enriched in genes with transporter activity; CCs associated with genes enriched in this comparison were the

Golgi apparatus and the extracellular region (Table 3 and Table 4). BPs for genes downregulated in the Δlip2 strain during growth in glucose included many involved in 61

carbon metabolism processes, such as “carbohydrate metabolic process”, “cellular carbohydrate metabolic transport”, “carbohydrate biosynthetic process”, “polysaccharide metabolic process”, “carbohydrate transport” and “carbohydrate derivative transport” (Table

5).

Comparisons between the transcript profiles were also performed for the same strains growing in oleic acid. GO enrichment did not identify any CCs associated with genes downregulated in the Δlip2 mutant during growth on oleic acid. However similarly to growth in glucose the MFs of these genes were enriched in categories such as “transporter activity”, “lipid transporter activity”, “L-amino acid transmembrane transporter activity”,

“solute:cation symporter activity”, “sodium ion transmembrane activity”, “monocarboxylic acid transmembrane transporter activity”, “peptide transporter activity”, “macromolecular transmembrane transporter activity” and “oligopeptide transporter activity” in addition to other categories with “oxidoreductase activity” (Table 6).

Again comparable to the same strains grown in glucose, the BPs of genes enriched in the Δlip2 mutant with growth on oleic acid included many processes associated with carbon metabolism including “catabolic processes”, “organonitrogen compound metabolic process”,

“organic substance catabolic process”, “cellular amino acid metabolic process”, “organic hydroxy compound metabolic process”, “small molecule catabolic process”, “carboxylic acid catabolic process”, “alcohol metabolic process” and “amine metabolic process”. Other enrichments were observed for processes such as “oxidation-reduction process” and broader functions including “cellular homeostasis”, “chemical homeostasis” and “ion homeostasis”

(Table 7).

The enrichment of genes upregulated in the Δlip2 mutant during growth on glucose identified BPs involved in “transmembrane transport” and “response to oxidative stress” as the most highly enriched, with the CC of “anchored component of membrane” being the only enriched term (Table 8). The MFs of the genes enriched in this set were most highly represented by “cation binding” and “metal ion binding” but also “hydrolase activity, acting on glycosyl bonds” as well as “dioxygenase activity” and “oxidoreductase activity” (Table

9).

The comparison of genes upregulated in the Δlip2 mutant during growth on oleic acid identified an enrichment in BPs for “carbohydrate metabolic process” and “D-xylose metabolic process” (Table 10) and an enrichment for the CC “fungal-type cell wall” (Table

11). There was also an enrichment of genes with MFs for “hydrolase activity, acting on glycosyl bonds”, “hydrolase activity, hydrolyzing O-glycosyl compounds”, “UDP-N- acetylmuramate dehydrogenase activity” and “triglyceride lipase activity” (Table 12).

Overall, this transcriptional data shows that in Δlip2 mutants there were large transcriptional changes relative to the WT strain. These changes reflect a broad variety of functions and processes, however regulated processes included a downregulation of transporter activity, an upregulation of genes related to membrane function and hydrolase activity, and both up- and downregulation of genes involved in carbon metabolic processes.

Table 3: GO Enrichment for Molecular Function of Genes Downregulated in the Δlip2 Mutant Grown in Glucose GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count transporter activity GO:0005215 3 121 0.03680 substrate-specific transporter activity GO:0022892 3 105 0.02533 transmembrane transporter activity GO:0022857 3 104 0.02469 substrate-specific transmembrane 0.01828 transporter activity GO:0022891 3 93 ion transmembrane transporter activity GO:0015075 3 83 0.01340 cation transmembrane transporter activity GO:0008324 3 45 0.00236 active transmembrane transporter activity GO:0022804 3 40 0.00167 anion transmembrane transporter activity GO:0008509 2 37 0.02199 secondary active transmembrane 0.00024 transporter activity GO:0015291 3 21 inorganic anion transmembrane transporter 0.00325 activity GO:0015103 2 14 phosphate transmembrane transporter 0.00199 activity GO:1901677 2 11 phosphate ion transmembrane transporter 0.00131 activity GO:0015114 2 9 symporter activity GO:0015293 2 9 0.00131 solute:cation symporter activity GO:0015294 2 7 0.00077 copper ion binding GO:0005507 1 6 0.03803 carbohydrate derivative transporter activity GO:1901505 1 5 0.03178 NAD binding GO:0051287 1 5 0.03178 nucleotide transmembrane transporter 0.03178 activity GO:0015215 1 5

Table 4: GO Enrichment for Cellular Compartment for Genes Downregulated in the Δlip2 Mutant Grown in Glucose

GO Term GO Identity Effecti Total Enrichment ve GO Proteins p-value Term per GO Count Golgi apparatus GO:0005794 4 114 0.00296 extracellular region GO:0005576 3 98 0.01668 Golgi apparatus part GO:0044431 2 26 0.00943 Golgi membrane GO:0000139 2 14 0.00274

Table 5: GO Enrichment for Biological Processes of Genes Downregulated in the Δlip2 Mutant Grown in Glucose GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count carbohydrate metabolic process GO:0005975 4 136 0.00556 single-organism carbohydrate metabolic process GO:0044723 3 114 0.02468 cellular carbohydrate metabolic process GO:0044262 2 63 0.04990 anion transport GO:0006820 2 46 0.02790 carbohydrate biosynthetic process GO:0016051 2 45 0.02677 polysaccharide metabolic process GO:0005976 2 40 0.02142 carbohydrate transport GO:0008643 2 17 0.00401 nucleotide transport GO:0006862 1 8 0.04604 Wnt signaling pathway GO:0016055 1 7 0.04039 carbohydrate derivative transport GO:1901264 1 7 0.04039 response to xenobiotic stimulus GO:0009410 1 5 0.02900 manganese ion transport GO:0006828 1 5 0.02900 extracellular polysaccharide metabolic process GO:0046379 1 5 0.02900

Table 6: GO Enrichment for Molecular Function of Genes Downregulated in the Δlip2 Mutant Grown in Oleic Acid GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count oxidoreductase activity GO:0016491 5 178 0.00290 transition metal ion binding GO:0046914 4 157 0.01292 transporter activity GO:0005215 3 121 0.03680 substrate-specific transporter activity GO:0022892 3 105 0.02533 transferase activity, transferring acyl groups other than amino-acyl groups GO:0016747 2 52 0.04158 oxidoreductase activity, acting on CH- OH group of donors GO:0016614 2 43 0.02920 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor GO:0016616 2 37 0.02199 lipid transporter activity GO:0005319 1 7 0.04424 L-amino acid transmembrane transporter activity GO:0015179 1 7 0.04424 oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor GO:0016620 1 7 0.04424 solute:cation symporter activity GO:0015294 1 7 0.04424 sodium ion transmembrane transporter activity GO:0015081 1 7 0.04424 copper ion binding GO:0005507 2 6 0.00055 monocarboxylic acid transmembrane transporter activity GO:0008028 1 6 0.03803 peptide transporter activity GO:0015197 1 6 0.03803 oxidoreductase activity, acting on the CH-NH2 group of donors GO:0016638 1 6 0.03803 macromolecule transmembrane transporter activity GO:0022884 1 5 0.03178 oligopeptide transporter activity GO:0015198 1 5 0.03178

Table 7: GO Enrichment for Biological Processes of Genes Downregulated in the Δlip2 Mutant Grown in Oleic Acid GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count catabolic process GO:0009056 4 246 0.04350 organonitrogen compound metabolic process GO:1901564 4 237 0.03849 organic substance catabolic process GO:1901575 4 212 0.02653 oxidation-reduction process GO:0055114 5 192 0.00269 cellular amino acid metabolic process GO:0006520 3 104 0.01929 nitrogen compound transport GO:0071705 3 82 0.01006 organonitrogen compound catabolic process GO:1901565 4 77 0.00066 organic hydroxy compound metabolic process GO:1901615 2 56 0.04022 cellular homeostasis GO:0019725 2 49 0.03140 chemical homeostasis GO:0048878 2 48 0.03021 small molecule catabolic process GO:0044282 3 47 0.00205 ion homeostasis GO:0050801 2 43 0.02457 cellular chemical homeostasis GO:0055082 2 43 0.02457 organic acid catabolic process GO:0016054 3 42 0.00148 carboxylic acid catabolic process GO:0046395 3 42 0.00148 alcohol metabolic process GO:0006066 2 42 0.02350 cellular ion homeostasis GO:0006873 2 39 0.02041 amine metabolic process GO:0009308 2 38 0.01943 cellular amino acid catabolic process GO:0009063 3 25 0.00031 alpha-amino acid catabolic process GO:1901606 2 19 0.00502 cellular response to nutrient GO:0031670 1 8 0.04604 tube development GO:0035295 1 8 0.04604 nucleotide transport GO:0006862 1 8 0.04604 amine transport GO:0015837 2 7 0.00064 NAD metabolic process GO:0019674 1 7 0.04039 regulation of hormone levels GO:0010817 1 7 0.04039 anterior/posterior pattern specification GO:0009952 1 7 0.04039 oligopeptide transport GO:0006857 1 7 0.04039 isoleucine metabolic process GO:0006549 1 7 0.04039 aspartate family amino acid catabolic process GO:0009068 1 7 0.04039 central nervous system development GO:0007417 1 6 0.03471 67

GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count multicellular organismal signaling GO:0035637 1 6 0.03471 carbon catabolite regulation of transcription GO:0045990 1 6 0.03471 branched-chain amino acid catabolic process GO:0009083 1 6 0.03471 primary alcohol metabolic process GO:0034308 2 5 0.00031 ethanol metabolic process GO:0006067 2 5 0.00031 renal system development GO:0072001 1 5 0.02900 wound healing GO:0042060 1 5 0.02900 carbon catabolite activation of transcription GO:0045991 1 5 0.02900 terpenoid metabolic process GO:0006721 1 5 0.02900 gamma-aminobutyric acid transport GO:0015812 1 5 0.02900 threonine catabolic process GO:0006567 1 5 0.02900 urogenital system development GO:0001655 1 5 0.02900 transmission of nerve impulse GO:0019226 1 5 0.02900 short-chain fatty acid transport GO:0015912 1 5 0.02900 fatty acid transport GO:0015908 1 5 0.02900

Table 8: GO Enrichment for Cellular Compartment of Genes Upregulated in the Δlip2 Mutant Grown in Glucose GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count anchored component of membrane GO:0031225 2 30 0.03113

Table 9: GO Enrichment for Molecular Function of Genes Upregulated in the Δlip2 Mutant Grown in Glucose GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count cation binding GO:0043169 8 434 0.01994 metal ion binding GO:0046872 8 422 0.01677 hydrolase activity, acting on glycosyl bonds GO:0016798 3 63 0.01676 dioxygenase activity GO:0051213 2 15 0.00739 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen GO:0016701 2 13 0.00555 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen GO:0016702 2 13 0.00555 Ras guanyl-nucleotide exchange factor activity GO:0005088 1 5 0.04426

Table 10: GO Enrichment for Biological Processes of Genes Upregulated in the Δlip2 Mutant Grown in Glucose GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count transmembrane transport GO:0055085 4 124 0.02439 response to oxidative stress GO:0006979 2 38 0.04764 urea metabolic process GO:0019627 1 5 0.04607 response to purine-containing compound GO:0014074 1 5 0.04607 response to water deprivation GO:0009414 1 5 0.04607 response to water GO:0009415 1 5 0.04607 pollen development GO:0009555 1 5 0.04607 salicylic acid metabolic process GO:0009696 1 5 0.04607 myeloid cell differentiation GO:0030099 1 5 0.04607 positive regulation of secondary metabolite biosynthetic process GO:1900378 1 5 0.04607

Table 11: GO Enrichment for Cellular Compartment of Genes Upregulated in the Δlip2 Mutant Grown in Oleic Acid GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count fungal-type cell wall GO:0009277 1 8 0.04630

Table 12: GO Enrichment for Molecular Function of Genes Upregulated in the Δlip2 Mutant Grown in Oleic Acid GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count hydrolase activity, acting on glycosyl bonds GO:0016798 3 63 0.00620 hydrolase activity, hydrolyzing O- glycosyl compounds GO:0004553 2 22 0.00803 UDP-N-acetylmuramate dehydrogenase activity GO:0008762 1 7 0.04424 triglyceride lipase activity GO:0004806 1 5 0.03178

Table 13: GO Enrichment for Biological Processes of Genes Upregulated in the Δlip2 Mutant Grown in Oleic Acid GO Term GO Identity Effective Total Enrichment GO Proteins p-value Term per GO Count carbohydrate metabolic process GO:0005975 3 136 0.03923 D-xylose metabolic process GO:0042732 1 5 0.029

2.3.12 Lipidomics

The phenotypes observed with the lip2 mutant with regard to altered sensitivities to oxidative stress, vacuole accumulating drugs and ionic stress suggested that the function of

Lip2 maybe be related to membrane integrity and composition. Mutations in Lip2 homologs in other fungi have resulted in alterations to the lipid profiles in mutant strains. For example, 70

a reduction in levels of eicosanoic acid and ergosterol is speculated to be related to the stress- associated phenotypes observed in T. harzianum PAFAH mutants [53]. Also, S. pombe strains which overexpress the PAFAH plg7 also have differential lipid profiles which is characterized by a reduction of membrane phospholipid-associated RA moieties [51]. This reduction in RA is believed to be linked to the stress-responsive functions of this enzyme.

To further investigate this potential membrane connection, a lipidomic profile was obtained of both WT and mutant strains using UPLC-FTMS. The goal was to gain a global view of the lipid composition for these strains and determine whether there were any differences in the mutant lacking Lip2.

Overall, the lipidomic analysis identified 310 putative lipid species corresponding to

38 m/z values that were at least 2-fold more abundant in the WT strain than in the lip2 mutant. In addition, 850 putative lipid species corresponding to 101 m/z values that were at least 2-fold more abundant in the lip2 mutant than in the WT (Table 14 and Table 15, respectively). In total a wide variety of lipids were identified which represent a broad and diverse number of species. One challenge in this analysis is that more than one lipid species may have the same m/z value thus creating ambiguity in the identification of specific lipids.

Therefore, the identifications that were obtained must be considered preliminary predictions until additional confirmation can be obtained in future experiments.

In the Δlip2 background a number of fatty acyls were identified as the most abundant lipid species; in addition we observed a number of hydroxylated lipids, glycerolipids and glycerophospholipids with a higher abundance than in WT (Table 15 and Table 16).

In the WT background, the most abundant lipid species were classified as eicosanoids and diacylglycerols and, in addition, a number of species of glycerolipids and 71

glycerophospholipids were identified. Similar to the Δlip2 background, there were some hydroxylated lipids with differential abundance. Furthermore, the m/z value of 353.1358 yielded interesting putative lipids including a number of gibberellins, which are plant hormones that regulate many aspects of plant development, and the strigolactone 5- deoxystrigol which has recently been shown to regulate plant development and stimulate hyphal branching in arbuscular mycorrhizal fungi (Table 14 and Table 17) [131-135].

Table 14: Highly Abundant Lipid Species Found in the WT Strain The table lists the most abundant lipid species in the WT strain relative to the Δlip2 mutant. Lipids were identified by querying the LIPID MAPS database with the indicated input mass value; all potential lipid species for each m/z value are listed. LM ID is the assigned LIPD MAPS class identifier.

Lipid Name Fold Category Main Class Sub Class Input Mass Change [LM ID] [LM ID] [LM ID] Docusate 20.55 N/A N/A N/A 445.22204 Strophanthidinic acid lactone acetate 20.55 N/A N/A N/A 445.22204 Austalide J 20.55 Prenol Lipids N/A N/A [PR] 445.22204 17,18-dehydro-clavulone I 20.55 Fatty Acyls Eicosanoids Clavulones and [FA] [FA03] derivatives [FA0312] 445.22204 DG(14:0/20:3(5Z,8Z,11Z)/0:0) 12.85 Fatty Acyls Eicosanoids N/A [FA] [FA03] 613.47996 DG(14:0/20:3(8Z,11Z,14Z)/0:0) 12.85 Fatty Acyls Eicosanoids N/A [FA] [FA03] 613.47996 DG(14:1(9Z)/20:2(11Z,14Z)/0:0) 12.85 Fatty Acyls Eicosanoids N/A [FA] [FA03] 613.47996 DG(16:0/18:3(6Z,9Z,12Z)/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(18:2(9Z,12Z)/16:1(9Z)/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(18:3(6Z,9Z,12Z)/16:0/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(18:3(9Z,12Z,15Z)/16:0/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(20:2(11Z,14Z)/14:1(9Z)/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996

Lipid Name Fold Category Main Class Sub Class Input Mass Change [LM ID] [LM ID] [LM ID] DG(20:3(5Z,8Z,11Z)/14:0/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(20:3(8Z,11Z,14Z)/14:0/0:0) 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(17:1(9Z)/17:2(9Z,12Z)/0:0)[iso2] 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(16:1(9Z)/18:2(9Z,12Z)/0:0)[iso2] 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(16:0/18:3(9Z,12Z,15Z)/0:0)[iso2] 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996 DG(12:0/22:3(10Z,13Z,16Z)/0:0)[iso2] 12.85 Glycerolipids Diradylglycerols Diacylglycerols [GL] [GL02] [GL0201] 613.47996

Table 15: Highly Abundant Lipid Species Found in the Δlip2 Mutant The table lists the most abundant lipid species in the Δlip2 mutant relative to the WT strain. Lipids were identified by querying the LIPID MAPS database with the indicated input mass value; all potential lipids for each m/z value are listed. LM ID is the assigned LIPD MAPS class identifier.

Lipid Name Fold Category Main Class Sub Class Input Mass Change [LM ID] [LM ID] [LM ID] 1-Octen-3-yl glucoside Fatty Acyls Fatty acyl 28.57 [FA] glycosides [FA13] N/A 291.18018 HOMIDIUM 27.86 N/A N/A N/A 314.16543 1-Octen-3-yl glucoside Fatty Acyls Fatty acyl 18.31 [FA] glycosides [FA13] N/A 289.16522 1-Octen-3-yl glucoside Fatty Acyls Fatty acyl 16.50 [FA] glycosides [FA13] N/A 313.16209 Chelirubine 15.26 N/A N/A N/A 362.10216 1α,25-dihydroxy-11α- Vitamin D3 and phenylvitamin D3 / 1α,25-dihydroxy- Sterol Secosteroids derivatives 11α-phenylcholecalciferol 13.51 Lipids [ST] [ST03] [ST0302] 491.35227 1α,25-dihydroxy-11β- Vitamin D3 and phenylvitamin D3 / 1α,25-dihydroxy- Sterol Secosteroids derivatives 11β-phenylcholecalciferol 13.51 Lipids [ST] [ST03] [ST0302] 491.35227 C21:1n-9 Unsaturated Fatty Acyls Fatty Acids and fatty acids 11.30 [FA] Conjugates [FA01] [FA0103] 325.31001 6,8-Heneicosanedione 11.30 N/A N/A N/A 325.31001 4,6-Heneicosanedione 11.30 N/A N/A N/A 325.31001 18:1(5Z)(9Me,13Me,17Me) C15 isoprenoids Prenol (sesquiterpenes) 11.30 Lipids [PR] Isoprenoids [PR01] [PR0103] 325.31001

Lipid Name Fold Category Main Class Sub Class Input Mass Change [LM ID] [LM ID] [LM ID] 21:1(7Z) Unsaturated Fatty Acyls Fatty Acids and fatty acids 11.30 [FA] Conjugates [FA01] [FA0103] 325.31001 12Z-heneicosenoic acid Unsaturated Fatty Acyls Fatty Acids and fatty acids 11.30 [FA] Conjugates [FA01] [FA0103] 325.31001 2-propyl-9Z-octadecenoic Acid Fatty Acyls Fatty Acids and Branched fatty 11.30 [FA] Conjugates [FA01] acids [FA0102] 325.31001 2-methyl-2-eicosenoic acid Fatty Acyls Fatty Acids and Branched fatty 11.30 [FA] Conjugates [FA01] acids [FA0102] 325.31001 3-Methyl-3-butenyl hexadecanoate Fatty Acyls Wax monoesters 11.30 [FA] Fatty esters [FA07] [FA0701] 325.31001 Isopropyl 9Z-octadecenoate Fatty Acyls Wax monoesters 11.30 [FA] Fatty esters [FA07] [FA0701] 325.31001

Table 16: Other Lipid Species Identified as More Abundant in the Δlip2 Mutant The table lists other lipid species identified in the lipidomics screen as more abundant in Δlip2 background relative to WT. Lipids were identified by querying the LIPID MAPS database with the indicated input mass value. If the single m/z yielded multiple putative lipid variants within the same main class, the first lipid was listed and the total number of lipid variants is indicated in the “count” column. LM ID is the assigned LIPD MAPS class identifier. Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass MG(16:0/0:0/0:0) 9.53 Glycerolipids Monoradylglycerols Monoacylglycerols 329.26908 3 [GL] [GL01] [GL0101] 1,2-Distearoyl 8.18 Glycerophospho Glycerophosphoserines Diacylglycerophospho 812.54271 22 phosphatidyl serine lipids [GP] [GP03] serines [GP0301] Myristoleic acid 5.88 Fatty Acyls - - 225.18572 51 [FA] PI(13:0/22:2(13Z,16Z)) 5.84 Glycerophospho Glycerophosphoinositol Diacylglycerophospho 871.52997 14 lipids [GP] s [GP06] inositols [GP0601] PS(13:0/22:1(11Z)) 5.11 Glycerophospho Glycerophosphoserines Diacylglycerophospho 774.52702 16 lipids [GP] [GP03] serines [GP0301] PI(16:0/22:3(10Z,13Z,16 4.93 Glycerophospho - - 887.56308 26 Z)) lipids [GP] DG(14:1(9Z)/20:1(11Z)/ 4.75 Glycerolipids Diradylglycerols Diacylglycerols 615.49583 12 0:0) [GL] [GL02] [GL0201] PI(12:0/17:1(9Z)) 4.66 Glycerophospho Glycerophosphoinositol Diacylglycerophospho 789.45071 8 lipids [GP] s [GP06] inositols [GP0601] MG(0:0/15:0/0:0) 4.59 Glycerolipids Monoradylglycerols Monoacylglycerols 315.25346 2 [GL] [GL01] [GL0101] 2,3-dihydroxy stearic 4.59 Fatty Acyls Octadecanoids [FA02] Other Octadecanoids 315.25346 16 acid [FA] [FA0200] 9,10-Dihydroxy-12,13- 4.51 Fatty Acyls Octadecanoids [FA02] Other Octadecanoids 353.23015 15 epoxyoctadecanoate [FA] [FA0200] 77

Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass 13- 4.34 Fatty Acyls Fatty acyl glycosides Sophorolipids 787.44442 sophorosyloxydocosanoa [FA] [FA13] [FA1302] te 6\',6\'\'-diacetate Kurilensoside J 4.34 Sterol Lipids Steroid conjugates Other Steroid 787.44442 [ST] [ST05] conjugates [ST0505] PI-Cer(d18:0/20:0) 4.30 Sphingolipids Phosphosphingolipids Ceramide 860.60044 2 [SP] [SP03] phosphoinositols [SP0303] (25R)-spirost-5en-3beta- 4.21 Sterol Lipids Sterols [ST01] Spirostanols and 883.50704 2 ol 3-O-alpha-L- [ST] derivatives [ST0108] rhamnopyranosyl-(1-2)- [alpha-L- rhamnopyranosyl-(1-4)]- beta-D-glucopyranoside PS(13:0/22:1(11Z)) 4.20 Glycerophospho Glycerophosphoserines Diacylglycerophospho 776.54341 16 lipids [GP] [GP03] serines [GP0301] Momordin Ia 4.04 Prenol Lipids Isoprenoids [PR01] C30 isoprenoids 799.42318 [PR] (triterpenes) [PR0106] Azelaoyl PAF 4.01 Glycerophospho Glycerophosphocholine 0 674.43835 lipids [GP] s [GP01] (20R)-24-Hydroxy-19- 3.68 Sterol Lipids Secosteroids [ST03] Vitamin D3 and 507.40416 2 norgeminivitamin D3 [ST] derivatives [ST0302] 1α-hydroxy-3- 3.54 Sterol Lipids Secosteroids [ST03] Vitamin D3 and 383.33124 2 deoxyvitamin D3 / [ST] derivatives [ST0302] 1α-hydroxy-3- deoxycholecalciferol

Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass 1α,25-dihydroxy- 3.47 Sterol Lipids Secosteroids [ST03] Vitamin D3 and 455.35226 12 22,23-didehydro- [ST] derivatives [ST0302] 24a,24b,24c- trihomovitamin D3 / 1α,25-dihydroxy- 22,23-didehydro- 24a,24b,24c- trihomocholecalciferol PC(16:0/20:4(5Z,8Z,10E 3.16 Glycerophospho Oxidized Oxidized 820.54553 2 ,14Z)(12OH[S])) lipids [GP] glycerophospholipids glycerophosphocholin [GP20] es [GP2001] 1α,25-dihydroxy- 3.12 Sterol Lipids Secosteroids [ST03] Vitamin D3 and 491.37283 10 2β-(3- [ST] derivatives [ST0302] hydroxypropoxy)vitamin D3 / 1α,25- dihydroxy-2β-(3- hydroxypropoxy)choleca lciferol 7β- 2.22 Sterol Lipids - - 401.34178 25 Hydroxycholesterol [ST] 17beta-Hydroxy- 2.13 Sterol Lipids Steroids [ST02] - 317.24823 7 2alpha,17-dimethyl- [ST] 5alpha-androstan-3-one (2E,5E,12Z,15Z)-1- 2.13 Fatty Acyls Fatty alcohols [FA05] N/A 317.24823 Hydroxy-2,5,12,15- [FA] heneicosatetraen-4-one

Table 17: Other Lipid Species Identified as More Abundant in the WT Strain The table lists other lipid species identified in the lipidomics screen as more abundant in the WT background relative to the Δlip2 mutant. Lipids were identified by querying the LIPID MAPS database with the indicated input mass value. If the single m/z yielded multiple putative lipid variants within the same main class, the first lipid was listed and the total number of lipid variants is indicated in the “counts” column. LM ID is the assigned LIPD MAPS class identifier. Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass Capsoside A 7.03 Glycerolipids [GL] N/A N/A 693.3697 Farfugin A 6.75 Prenol Lipids [PR] Isoprenoids C15 isoprenoids 237.1247 [PR01] (sesquiterpenes) [PR0103] Polysorbate 60 5.70 N/A N/A N/A 435.2952 Neryl glucoside 5.53 Prenol lipids [PR] N/A N/A 317.1957 4 PI(16:0/16:1(9Z)) 5.40 Glycerophospholipids Glycerophosphoi Diacylglyceroph 807.5015 14 [GP] nositols [GP06] osphoinositols [GP0601] TG(22:5(7Z,10Z,13Z,16Z,19Z)/ 4.19 Glycerolipids [GL] Triradylglycerols Triacylglycerols 1023.739 6 20:4(5Z,8Z,11Z,14Z)/22:6(4Z,7 [GL03] [GL0301] Z,10Z,13Z,16Z,19Z))[iso6] PG(22:2(13Z,16Z)/22:4(7Z,10Z, 4.04 Glycerophospholipids Glycerophosphog Diacylglyceroph 899.5801 4 13Z,16Z)) [GP] lycerols [GP04] osphoglycerols [GP0401] DG(14:0/20:1(11Z)/0:0) 4.00 Glycerolipids [GL] Diradylglycerols Diacylglycerols 617.5113 14 [GL02] [GL0201] MG(16:0/0:0/0:0) 3.79 Glycerolipids [GL] Monoradylglycer Monoacylglycer 331.2842 3 ols [GL01] ols [GL0101] Gamma-linolenyl carnitine 3.63 Fatty Acyls [FA] Fatty esters N/A 408.3471 2 [FA07]

Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass 3-DESHYDROXYSAPPANOL 3.59 N/A N/A N/A 353.1358 TRIMETHYL ETHER 5-Deoxystrigol 3.59 Prenol Lipids [PR] N/A N/A 353.1358 Gibberellin A105 3.59 Prenol Lipids [PR] N/A N/A 353.1358 Gibberellin A108 3.59 Prenol Lipids [PR] N/A N/A 353.1358 Gibberellin A62 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] Gibberellin A121 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] Gibberellin A88 3.59 Prenol Lipids [PR] N/A N/A 353.1358 Gibberellin A95 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] Gibberellin A51-catabolite 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] Gibberellin A7 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] Gibberellin A5 3.59 Prenol Lipids [PR] Isoprenoids C20 isoprenoids 353.1358 [PR01] (diterpenes) [PR0104] PS(18:2(9Z,12Z)/18:2(9Z,12Z))[ 3.26 Glycerophospholipids Glycerophosphos Diacylglyceroph 806.4926 14 U] [GP] erines [GP03] osphoserines [GP0301] 15(S)-HpEDE 3.23 Fatty Acyls [FA] Fatty Acids and N/A 363.2504 Conjugates [FA01] 81

Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass 11-deoxy-PGF1α 3.23 Fatty Acyls [FA] Eicosanoids - 363.2504 6 [FA03] Ricinoleic Acid methyl ester 3.13 Fatty Acyls [FA] N/A N/A 313.2736 10-oxo-nonadecanoic acid 3.13 Fatty Acyls [FA] Fatty Acids and Oxo fatty acids 313.2736 4 Conjugates [FA0106] [FA01] DG(18:0e/2:0/0:0) 3.05 Glycerolipids [GL] - - 407.3136 3 2-oxo-heneicosanoic acid 3.01 Fatty Acyls [FA] Fatty Acids and Oxo fatty acids 341.3049 4 Conjugates [FA0106] [FA01] Hydroxyprogesterone acetate 2.96 Sterol Lipids [ST] N/A N/A 395.22 3alpha-Hydroxy-5beta-pregn- 2.96 N/A N/A N/A 395.22 16-ene-11,20-dione 3-acetate 6-Hydroxy-8-heneicosanone 2.86 Fatty Acyls [FA] Fatty alcohols N/A 325.3107 4 [FA05] 10,20-Dihydroxyeicosanoic acid 2.61 Fatty acyls [FA] Fatty Acids and Hydroxy fatty 367.2817 2 Conjugates acids [FA0105] [FA01] Ethyl 3-(N- 2.60 N/A N/A N/A 216.1593 butylacetamido)propionate (24R)-1α,24-dihydroxy- 2.53 Sterol Lipids [ST] Secosteroids Vitamin D3 and 419.3155 9 22-oxavitamin D3 / (24R)- [ST03] derivatives 1α,24-dihydroxy-22- [ST0302] oxacholecalciferol 10,20-Dihydroxyeicosanoic acid 2.35 Fatty acyls [FA] Fatty Acids and Hydroxy fatty 345.2998 2 Conjugates acids [FA0105] [FA01] 9alpha-(Angeloyloxy)-4S- 2.13 Prenol lipids [PR] Isoprenoids C15 isoprenoids 377.2322 2 hydroxy-10(14)-oplopen-3-one [PR01] (sesquiterpenes) 4-acetate [PR0103] 82

Lipid Name Fold Category Main Class Sub Class Input Count Change [LM ID] [LM ID] [LM ID] Mass 4S-hydroperoxy-17S-HDHA 2.13 Fatty Acyls [FA] Docosanoids 0 377.2322 [FA04] 11beta,20-Dihydroxy-3- 2.13 Sterol Lipids [ST] Steroids [ST02] C21 steroids 377.2322 oxopregn-4-en-21-oic acid (gluco/mineralo corticoids, progestogins) and derivatives [ST0203]

2.4 Discussion and Conclusions

This chapter presents the identification of 11 U. maydis genes that encode candidate PLs.

The in silico analysis revealed a diverse group of genes that encode PLs of each class with multiple homologs for a number of the genes suggesting the potential for functional redundancy.

Furthermore, gene expression analysis of the transcripts for the PL genes during different points of the life cycle showed differential regulation of some PLs. The regulation of numerous PLs throughout the lifecycle, especially during infection of maize, suggests that a subset of these PLs may play a role in the virulence of U. maydis, however functional characterization of a PLB

(um11266) and a PLC (um00004) did not implicate these genes in virulence or mating (Figure 28 and Figure 29). Numerous functions are possible including a requirement for developmental transitions, secretion of a protein with effector function, exploitation of host tissue as a potential carbon source during colonization or completion of the life cycle via sporogenesis.

This work presented in this chapter also included characterization of two genes encoding for PAFAH-class PLA2s, which have been named Lip1 (um00133) and Lip2 (um01927). These genes share sequence similarity with PAFAHs that have been described in both fungi and in humans [40, 41, 48, 53].

The functional characterization of these genes did not reveal a significant role for lip1 in any of the phenotypes examined. However, our analysis did indicate a role for lip2 in the virulence of U. maydis. Importantly, lip2 mutants were less virulent than WT strains, and inoculations resulted in a greater proportion of healthy plants and an overall reduction in the severity of disease symptoms.

Further characterization revealed that lip2 mutants had an increased sensitivity to oxidative stress and to the vacuolar-accumulating drugs chloroquine and quinacrine. The 84

mutants also showed increased resistance to ionic stress caused by NaCl and LiCl. The nature of these phenotypes suggests that there may be alterations to the composition or integrity of membranes, either the plasma membrane or the membranes of intracellular organelles. A test of the Δlip2 mutant containing endoplasmic reticulum- or Golgi apparatus-specific GFP-tagged proteins did not show any observable morphological changes in those organelles in the absence of Lip2. This suggests that Lip2 is not essential for the integrity of the membranes of either of these organelles (Figure 23 and Figure 24).

We also tested the hypothesis that Lip2 may be involved in the trafficking or secretion of intracellular cargo to the plasma membrane but no differential sensitivities were observed for brefeldin A, monensin or N-ethylmaleimide, which inhibit ER to Golgi protein transport, intracellular protein transport and vesicular transport, respectively (Figure 21) [136-138].

It is also unlikely that Lip1 or Lip2 play a major role in fatty acid metabolism in the context of an energy source or a signal for pathogenic development. The ability of mutants to grow on various carbon sources was examined with no differences from WT strains (Figure 26), and there were no observed differences in the lipid-induced transition between budding and filamentous growth caused by oleic acid (Figure 27). This last observation in conjugation with the ability of haploid lip2 mutants to mate and form filaments at the WT level also suggest that lip2 does not play a role in morphological transitions in U. maydis.

The observed sensitivity of the lip2 mutant to oxidative stress may be relevant to the ability of the fungus to withstand the host defense response. In particular, the production of ROS is one of the first innate responses that plants have as a defense mechanism upon challenge with a microbial pathogen [55, 56]. ROS are bifunctional molecules because they are potent stressors to cells, causing damage to cell membranes, proteins and DNA, but they also act as signalling 85

molecules which may trigger other defense responses in the plant and strengthen cell walls through oxidative cross-linking [58, 59, 61]. Upon infection of maize by U. maydis it is known that the plant perceives the pathogen but the fungus is able to rapidly suppress the defense responses and successfully colonize the host tissue [66]. One well characterized mechanism by which U. maydis does counteract ROS as a defense response is through the secretion of the effector protein Pep1. This protein is secreted into the biotrophic interface and functions by inhibiting the plant peroxidase POX12, thereby neutralizing the ability of the host to effectively produce ROS and suppress colonization by the pathogen [68, 69].

Although we did not observe any differences in host H2O2 production upon infection with lip2 mutants, it is possible that Lip2 functions as a detoxification mechanism against the initial level of ROS (Figure 25). This amount of ROS may be produced prior to full suppression of the host defense response, or the amount that occurs at basal levels during a normal U. maydis – maize interaction.

Given the information on the lip2 mutant phenotypes and the role of ROS, it is tempting to speculate that Lip2 may function as a PLA2 to remove potentially detrimental oxidized polyunsaturated fatty acids from the cell membrane, thereby mitigating negative physiological effects caused by plant ROS-triggered lipid peroxidation. Repair functions of PLA2s have been reported previously and lipid peroxidation is known to stimulate PLA2 activity [37, 40, 139,

140]. This hypothesis is also consistent with the described function of Lip2 homologs in other fungi. Specifically, the PAFAH PLG7 in S. pombe is involved in tolerance to oxidative stress caused by CuSO4 and RA. Similarly, phenotypes associated with a PAFAH mutant in T. harzianum such as sensitivity to oxidative stress as well as altered expression and activity of

superoxide dismutase and catalase suggest that the PAFAH enzyme is involved in oxidative stress tolerance [48, 50, 51, 53].

Damage caused by lipid peroxidation can have widespread effects on membrane permeability, ion leakage and membrane fluidity. Damaged lipids can also cause unfavourable hydrophobic interactions with proteins, create covalent linkages on macromolecules and modify nucleic acids.

As a result, cells need to have mechanisms in place to deal with such scenarios.

Transcriptional changes which occur under oxidative stress commonly induce genes involved in detoxifying ROS as well as a number of heat shock proteins, which may function as chaperones which protect other proteins from damaging hydrophobic interactions with oxidized lipids [63].

Lipid peroxidation most frequently affects lipids that contain polyunsaturated fatty acid moieties, which are preferably bound to phospholipid head groups at the sn-2 position [63, 141].

As described earlier, oxidation of polyunsaturated fatty acids can drastically alter the shape and function of lipid molecules. With this in mind a “lipid whisker model” has been proposed as a modification to the conventional “fluid mosaic model” which described membrane composition and function [142]. In this model the authors describe instances where oxidized sn-2 fatty acid moieties protrude into the aqueous phase instead of remaining in the interior of the lipid bilayer, causing the cell to “grow whiskers.” This model represents a mechanism by which other cells such as macrophages can sense lipid peroxidation in neighbouring cells through pattern recognition receptor proteins.

In an attempt to gain a global perspective and further support for a potential role for Lip2 in lipid homeostasis in U. maydis we used UPLC-MS to obtain an untargeted lipid profile of both

WT and Δlip2 strains during exponential growth. This experiment yielded a wealth of data and 87

identified 38 unique m/z values that were at least 2-fold more abundant in the WT strain and 101 m/z values that were at least 2-fold more abundant in the Δlip2 mutant (Table 14 and Table 15).

It was possible to query metabolomics databases with these m/z values to obtain a list of candidate metabolites. However, it was common in this experiment for one m/z value to identify

5-15 different lipid species making it difficult to definitively identify the specific lipids. To illustrate this problem, it was found that the 38 m/z values abundant in WT corresponded to 310 putative lipids and the 101 m/z values in the Δlip2 background corresponded to 850 putative lipids.

Despite this caveat, the screen was very informative with regards to the potential biological function of Lip2. In both the WT and mutant strains, there was a shift in abundance of various glycerophospholipids, the major constituents of the plasma membrane [143]. The shift in these types of lipids supports the idea that in the absence of Lip2 there is a change in the lipid composition of the plasma membrane which could potentially compromise its integrity and/or normal function; this is consistent with other phenotypes observed with the Δlip2 mutant such as sensitivities to oxidative stress and resistance to ionic stress.

In addition to glycerophospholipids, a shift was observed in numerous glycerolipids; in general these lipids function for energy metabolism as a source of fatty acids and as precursors for phospholipid biosynthesis. This shift in abundance of a potential energy source could accompany a change in carbon source utilization related to energy production, and the RNA-Seq data described below is consistent in this because major shifts in the expression of functions for carbon metabolism were observed between the WT and Δlip2 strains.

It is also possible that the alteration in the lipid composition of the plasma membrane or within the cell itself in the absence of lip2 affects other processes such as membrane trafficking, 88

anchoring of membrane proteins or lipid-based signalling which could contribute to the observed phenotypes.

The lipidomic screen also identified a number of hydroylated lipids in both the WT and

Δlip2 backgrounds. Although it is difficult to say if there was a differential abundance of these types of lipids in the two strains, the presence alone of these lipids is interesting in the context of the H2O2 sensitivity we observed with lip2 mutants. As mentioned above, PAFAH enzymes in other organisms, e.g. the gene plg7 in S. pombe, contribute to resistance to oxidative stress, likely through the cleavage of peroxidized lipids which compromise membrane integrity [48]. In humans, the PAFAH PLG7 homolog has also been shown to hydrolyze long chain fatty acyl phospholipid hydroperoxides and oxidized phospholipids [43].

The lipidomics analysis also revealed an unexpected connection between U. maydis and plant hormones. Specifically, the potential lipids for one m/z value (353.1358) in the WT lipidomics dataset consisted mainly of prenol lipids such as gibberellins and the strigolactone 5- deoxystrigol. Gibberellins are hormones which play important roles in plants as they regulate many processes including major development switches and fertility, and their production can be induced in response to a number stimuli including temperature, light and abiotic stresses [131-

133]. Strigolactones are also emerging as important plant hormones which regulate shoot branching and stimulate hyphal branching in symbiotic arbuscular mycorrhizal fungi [134, 135].

It is tempting to hypothesize that U. maydis synthesizes these hormones as a means to modulate host growth or stimulate its own hyphal growth. This speculation needs to be assessed experimentally and the possible role of Lip2 in these processes, if any, needs to be elucidated.

To further understand the function of Lip2 in U. maydis we obtained transcriptional profiles of the WT and Δlip2 strains grown in glucose or in the fatty acid oleic acid. Of the 89

genes we observed downregulated in the Δlip2 mutant, GO enrichment identified functions involved in transporter activity and carbon metabolism as significantly enriched regardless of carbon source. This suggests that in the absence of Lip2 there is a perturbation in carbon metabolism, potentially due to lack of a fatty acid substrate liberated by Lip2 that would be catabolized for energy production. This is consistent with an upregulation of genes with functions in carbohydrate metabolic processes, including those with MFs for hydrolase activity on glycosyl bonds, which was observed in oleic acid and glucose.

Another interesting observation from the transcriptional profiles was an upregulation of genes in the Δlip2 mutant associated with the response to oxidative stress and biological functions of dioxygenase activity and oxidoreductase activity. This is consistent with the sensitivity to oxidative stress that we observed thus further supporting the hypothesis that Lip2 may play a protective role against such stresses.

The work presented in this chapter identified a role for the PAFAH Lip2 in the virulence of U. maydis. Evidence from functional assays, cellular transcriptional and lipid profiles suggests that Lip2 plays a protective role against damage induced by ROS, specifically through peroxidation of membrane lipids.

Chapter 3: The role of ATP-Citrate Lyase (Acl1) and Acetate in the Virulence of U. maydis

3.1 Introduction

Understanding the metabolic processes that occur during pathogenesis is critical for furthering our knowledge of fungal plant pathogen interactions. Two aspects of metabolism were investigated in this chapter, the necessity of production of acetyl-CoA for virulence and the influence of the carbon source on mating and virulence. As a central metabolite, acetyl-CoA is essential for many cellular functions including a key role in the citric acid cycle. One of the main ways the cell synthesizes this molecule is through the action of the enzyme Acl. In this chapter the acl1 gene encoding Acl in U. maydis was deleted and the impact of this mutation on virulence was characterized. The experiments revealed that Acl1 is essential for pathogenic development in U. maydis. During this analysis, it was found that growth on acetate allows the proliferation of acl1 mutants relative to growth on glucose.

This result prompted an investigation of aspects of alterative carbon source utilization and revealed that acetate is generally an unfavorable carbon source for U. maydis. That is, growth in acetate lead to lower cell densities, reduced virulence in maize seedlings and inhibition of filamentous growth. To examine the influence of carbon source in more detail, transcriptional profiles of WT cells grown in glucose and acetate were obtained by RNA-Seq. A comparison of these profiles revealed major changes in carbon metabolic processes that further supported the conclusion that acetate is an unfavorable energy source.

3.2 Materials and Methods

3.2.1 Strains and Growth Conditions

Strains of U. maydis used in this study are listed in Table 24 and were grown on solid

PDA plates (2% agar w/v). Overnight cultures for the strains were grown in PDB and strains containing a mutation for acl1 were grown in PDB or MM supplemented with 1% acetate.

Strains grown in liquid culture were incubated at 30°C shaking at ~200rpm.

3.2.2 Construction of Knockout Cassettes for Targeted Gene Deletion of Acl1 in U. maydis

For targeted gene replacement in U. maydis, knockout cassettes were generated using a

PCR overlap strategy [120]. PCR primers were designed to amplify fragments of ~1kb flanking the 5’ upstream region (UM_ACL1 and UM_ACL3) and 3’ downstream region of the target gene (UM_ACL4 and UM_ACL6) (See Table 25 for primer information). Primers UM_ACL2 and UM_ACL5 were used to amplify the NAT resistance marker. DNA fragments from the first round were subject to gel electrophoresis on a 0.8% agaraose 1X TAE gel and the appropriate size band was cut out and using a gel purification kit (BioBasic). The three fragments were combined via overlap PCR to replace the original open reading frame of the gene with the resistance marker. Biolostic transformation was performed as described in Chapter 2. Clonal transformants were isolated by successive rounds of streaking single colonies onto PDA containing antibiotic selection. Resistant colonies were screened using primers UM_ACL7 and

UM_ACL8 to detect integration of the knockout cassette into the appropriate genomic locus.

3.2.3 Mating Assays

Mating between strains was determined by production of white aerial hyphae during mating reactions on double complete medium plus 1% activated charcoal (DCM+C) plus indicated amounts of different carbon sources (1% glucose, acetate, glycerol, ethanol or 1% glucose and 1% acetate).

Haploid cells were grown overnight in PDB at 30°C, washed twice in sterile water and counted with a haemocytometer. Cells were diluted in sterile water to a final concentration of

1.0x107 cells/ml, mating cultures contained equal numbers of compatible strains (5.0x106 cells/ml + 5.0x106 cells/ml) and 10μl aliquots were spotted onto charcoal plates. Solopathogenic strains were prepared in the same manner as haploids, diluted to 1.0x107 cells/ml and 10µl aliquots were spotted. Spots were allowed to dry and then were double-wrapped in parafilm and placed face-down at room temperature or 30°C for 2 to 5 days.

3.2.4 Virulence Assays, Library Preparation for RNA-Seq and RNA-Seq Bioinformatics

Analysis

The materials and methods for virulence assays, RNA-Seq library preparation and RNA

Seq bioinformatics analysis were described in Chapter 2.

3.2.5 Growth Measurements

For growth on solid media WT 002 cells were grown overnight in PDB, harvested by centrifugation, washed twice in sterile water and re-suspended in MM-C. These cells were counted with a haemocytometer and 10-fold serial dilutions were prepared. 4µl of each dilution

(105 cells) was spotted onto MM+G and MM+A (both 1%) agar plates; spots were allowed to dry, and were then incubated at 30°C for 48 hours at which images were taken.

For liquid growth curves cells were prepared as described above and 50mL of MM+G or

MM+A (both 1%) was inoculated to a final cell count of 5x104 cells/ml. Flasks were incubated in a shaking incubator at 30°C and 200 rpm. For 144 hours growth was monitored every 12 hours; flasks were removed from the incubator and 1ml of the culture was removed and an OD600 measurement was taken with a DU530 Life Science UV/Visible spectrophotometer (Beckman

Instruments). Cultures were grown in triplicate and an average OD600 reading for each time point was used.

For growth kinetic measurements of Acl1 mutants, strains were grown overnight in PDB and then inoculated into yeast nutrient broth (YNB) supplemented with either 1% glucose or 1% acetate at a density of 105 cells/ml. Growth was measured in 24 hour intervals spectrophotometrically using OD600 measurements taken with a DU530 Life Science UV/Visible spectrophotometer (Beckman Instruments).

3.2.6 RNA Isolation for RNA-Seq

WT 002 strains were grown overnight in PDB, washed with water, re-suspended in MM-

C and counted with a haemocytometer. These cells were used to inoculate 50ml MM+G at a final concentration of 5.0x104 cells/ml and grown for 36 hours shaking at 30°C until the exponential phase. These cells were centrifuged, washed twice with water and re-suspended in

MM-C. 50ml of MM+G, MM+A or MM+O were inoculated with cells at a final concentration of 1.0x106 cells/ml and incubated shaking at 30°C for 24 hours.

Isolation of RNA from these cells is described in materials and methods of Chapter 2. 94

3.3 Results

3.3.1 Deletion of a Single acl1 Gene in U. maydis

A single U. maydis homolog, um01005, was identified by BLAST search using available sequence data. In order to assess the importance of this gene in U. maydis, we used a targeted gene deletion strategy to create mutants lacking Acl1 for further functional characterization.

Biolistic transformation of U. maydis 001, 002 and SG200 strains with a knockout construct led to the isolation of independent mutants for Acl1 which were confirmed by PCR screening and selected for further functional characterization. The creation of the acl1 mutants was performed by Dr. Emma Griffiths.

3.3.2 Acl1 is Required for Growth on Glucose

To assess the impact of the deletion of Acl1 on the growth of U. maydis, growth kinetics were measured. Strains were grown in YNB media containing glucose (Figure 16, left) or acetate (Figure 16, right). The acl1 mutants showed a significant reduction in growth rate and maximum cell density when grown in the presence of 1% glucose; these mutants achieve only

10% of the growth of WT strains after 100 hours of incubation. Consistent with reports in other fungi, the addition of exogenous acetate restored the growth in acl1 mutants to WT levels. These results indicate that Acl1 is important for utilization of specific carbon sources, such as glucose, but is dispensable for growth in other carbon sources such as acetate.

Figure 16: Growth of acl1 Mutants

The growth kinetics of acl1 mutants were measured by OD600; cells were grown in YNB media containing 1% glucose (left) or 1% acetate (right) as the sole carbon source. This experiment was performed by Dr. Emma Griffiths.

3.3.3 The acl1 Gene is Required for Virulence in Maize Seedlings

To assess the role of ACL1 in the virulence of U. maydis, 7-day old maize seedlings were inoculated with WT or Δacl1 strains pre-cultured in MM+A media. At 14-days post inoculation the WT SG200 strain had established an infection, and the infected plants had developed the typical range of disease symptoms such as anthocyanin production, tumor formation and plant death (Figure 17). In contrast, the Δacl1 mutants were unable to establish an infection and no disease symptoms were observed in any of the inoculated plants. Therefore Acl1 appears to be essential for the fungus to cause disease.

Figure 17: Acl1 is Required for Virulence in U. maydis Virulence was assessed by inoculating seven-day old maize seedlings with WT or mutants SG200 strains of U. maydis and disease symptoms were evaluated 14 days post infection. The disease index was calculated based on frequency of symptoms including plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease index and the total number of plants infected for each cross are at the top of the graph.

3.3.4 Carbon Sources Affect the Ability of U. maydis to Cause Disease in Maize Seedlings

While evaluating the ability of acl1 mutants to cause disease it was noticed that WT strains pre-cultured in media containing acetate generated symptoms at a lower level than typical glucose-grown cells. To further explore this observation seven-day old-maize seedlings were inoculated with WT haploids (001x002) or solopathogenic strains grown overnight in MM with either 1% glucose or 1% acetate as the sole carbon source. When symptoms of disease were evaluated 14-days post infection, those plants infected with U. maydis pre-cultured in acetate showed an overall reduction in severity of disease; symptoms included a larger number of health plants and a reduction in the most severe symptoms such as large tumor formation and plant death. This trend was observed in both haploid and solopathogenic infections, although the reduction in disease severity was greater in the haploid infections (Figure 18). These results suggest that nutritional state before infection has an impact on the extent of pathogenesis upon infection.

Figure 18: Growth in Acetate Reduces Virulence in Maize Seedlings Virulence was assessed in seven-day old maize seedlings infected with strains of U. maydis haploids (001x002) or solopathogenic SG200 pre-cultured in MM with either glucose or acetate as the sole carbon source and disease symptoms were evaluated 14 days post infection. The disease index was calculated based on frequency of symptoms including plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease index and total plants infected for each cross are indicated at the top of the graph. 99

3.3.5 Carbon Source Utilization Affects Mating in U. maydis

The observation that the severity of disease was more significantly reduced in a mixture of haploids infecting maize compared with the solopathogenic strain, it was hypothesized that the ability of cells to mate could be related to this phenotype. To examine this possibility the ability of haploid cells to mate and solopathogenic strains to form filaments was assessed on charcoal media with different carbon sources. WT cells were pre-cultured in PDB overnight and spotted onto charcoal plates with different fermentable and non-fermentable carbon sources, and filament formation was assessed after 48 hours (Figure 19).

The presence of acetate had an inhibitory effect of mating and filament formation, as no fuzzy colony morphology was observed when acetate was present as a sole carbon source

(Figure 19, d) or when acetate and glucose were present in equal amounts (Figure 19, e).

However, similar effects were not observed when other non-fermentable carbon sources were present such as glycerol (Figure 19, b) and ethanol (Figure 19, c).

100

Figure 19: Carbon Source Affects Mating and Filamentation in U. maydis WT haploids and solopathogenic SG200 strains were spotted onto charcoal media containing different carbon sources (a-e). Plates were incubated at room temperature for 48 hours and filament formation was observed by the formation of white fuzzy colonies. The order of spots is indicated in the legend in the bottom right.

3.3.6 The growth of U. maydis on Acetate Is Reduced in Liquid and Solid Media

The growth of U. maydis cells with glucose and acetate as the sole carbon source was observed in both solid and liquid media to gain further insight into the influence of acetate.

When spotted onto MM+A in 10-fold serial dilutions a reduction in growth of the WT strain was observed which included a reduced spot size despite an equal number of cells being plated in each instance. When grown in liquid media, cells with acetate as the sole carbon source exhibited a delayed lag phase of ~12 hours and the density of cells at the end of exponential

101

growth was drastically lower than those of cells grown in media with glucose as the sole carbon source (Figure 20).

Figure 20: Growth of U. maydis With Glucose or Acetate as the Sole Carbon Source The growth kinetics of WT 002 cells were observed in both solid (left) and liquid (right) culture. For solid plate growth cells were spotted in 10-fold serial dilutions onto MM+G (top) or MM+A (bottom) agar plates and growth was documented after 48 hours. Growth in shaking flasks containing liquid MM+G (red line) and MM+A (blue line) was monitored for 144 hours and

OD600 measurements were taken in 12 hour intervals.

3.3.7 RNA-Seq Analysis of WT Cells Grown on Difference Carbon Sources

Reports from other organisms regarding growth on acetate revealed major transcriptional effects affecting carbon metabolic pathways [90, 94, 97, 100]. As an attempt to understand the effects that acetate has on U. maydis, we performed RNA-Seq using RNA isolated from WT cells grown on glucose or acetate as the sole carbon source. This was done to identify genes that are differentially regulated during growth on these carbon sources. GO enrichment was performed on these datasets to identify genes within specific GO categories that are differentially regulated, which may hint to functional changes that are occurring in the cell.

102

GO enrichment analysis of genes differentially regulated by acetate revealed numerous metabolic processes. A number of BPs which exhibited the highest degree of up-regulation by acetate were involved in carbon metabolism and include “carbohydrate metabolic process”,

“transmembrane transport”, “carbohydrate derivative biosynthetic process”, “cellular carbohydrate metabolic process”, “carbohydrate biosynthetic process”, “polysaccharide metabolic process”, “polysaccharide biosynthetic process”, “membrane lipid metabolic process”,

“membrane lipid biosynthetic process”, “carbohydrate transport”, “response to carbohydrate”,

“beta-glucan metabolic process”, “glycolipid biosynthetic process”. Other interesting categories which were highly up-regulated by acetate include “cell wall organization or biogenesis”, “cell wall macromolecule metabolic process” (Table 19).

There was an enrichment in MF of these genes up-regulated by acetate for the categories involving membrane transport; “substrate-specific transporter activity”, “substrate-specific transmembrane transporter activity”, “ion transmembrane transporter activity”, “cation transmembrane transporter activity”, “active transmembrane transporter activity”, “anion transmembrane transporter activity”, “secondary active transmembrane transporter activity”,

“inorganic anion transmembrane transporter activity”, “phosphate transmembrane transporter activity”, “symporter activity”. In addition, there was an enrichment of proteins with other metabolic functions being up-regulated (“hydrolase activity; glycosyl bonds”, “transferase activity; glycosyl groups”, “oxidoreductase activity”, “monooxygenase activity”, “heme binding”, “tetrapyrrole binding”, “iron ion binding” and “electron carrier activity”) (Table 18).

For the proteins which were up-regulated by acetate there was a significant enrichment in

CCs for “membrane” and “intrinsic component of membrane” with 585 and 398 total proteins regulated, respectively, and a modest enrichment of proteins associated with “external 103

encapsulating structure”, “cell wall”, “intermediate filament cytoskeleton” and “fungal-type cell wall” (Table 20).

BPs enriched in genes down-regulated by acetate include numerous metabolic processes such as “organic acid metabolic process”, “oxoacid metabolic process”, “cellular amino acid metabolic process”, “carboxylic acid biosynthetic process”, “ncRNA metabolic process”,

“organonitrogen compound catabolic process”, “cellular macromolecular complex assembly”,

“cellular amino acid biosynthetic process”, “small molecule catabolic process”, “amine metabolic process”. Other BPs enriched in genes down-regulated by acetate include “ribosome biogenesis”, “rRNA processing”, “establishment of protein localization to organelle”,

“mitochondrion organization”, “cellular protein complex assembly”, “protein transmembrane transport”, “protein import”, tRNA processing”, “RNA modification”, “maturation of 5.8S rRNA” and “ribosomal large subunit biogenesis” (Table 21).

The MFs that were enriched in genes down-regulated by acetate include “transferase activity; transferring one-carbon groups”, “methyltrasnferase activity”, “cofactor binding”,

“unfolded protein binding”, “pyridoxal phosphate binding”, “heme binding”, “tetrapyrrole binding”, “peroxidase activity”, “oxidoreductase activity, acting on peroxide as acceptor”,

“oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor” and “macromolecule transmembrane transporter activity” (Table 22).

Enrichment of CCs associated with genes down-regulated by acetate include

“mitochondrion”, “nucleolus” and the “preribosome” (Table 23).

104

Table 18: GO Enrichment for Molecular Functions of Genes Upregulated in Acetate GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO substrate-specific transporter activity GO:0022892 7 105 0.02812 substrate-specific transmembrane GO:0022891 6 93 0.04778 transporter activity ion transmembrane transporter GO:0015075 6 83 0.02941 activity hydrolase activity, acting on glycosyl GO:0016798 6 63 0.00819 bonds cation transmembrane transporter GO:0008324 5 45 0.00833 activity active transmembrane transporter GO:0022804 4 40 0.02615 activity transferase activity, transferring GO:0016757 4 38 0.02203 glycosyl groups anion transmembrane transporter GO:0008509 4 37 0.02013 activity oxidoreductase activity, acting on GO:0016705 3 21 0.02092 paired donors, with incorporation or reduction of molecular oxygen secondary active transmembrane GO:0015291 3 21 0.02092 transporter activity monooxygenase activity GO:0004497 3 19 0.01587 heme binding GO:0020037 3 15 0.00808 tetrapyrrole binding GO:0046906 3 15 0.00808 iron ion binding GO:0005506 3 15 0.00808 inorganic anion transmembrane GO:0015103 3 14 0.00660 transporter activity electron carrier activity GO:0009055 3 12 0.00415 phosphate transmembrane GO:1901677 2 11 0.03816 transporter activity UDP-glycosyltransferase activity GO:0008194 2 10 0.03180 symporter activity GO:0015293 3 9 0.00169 phosphate ion transmembrane GO:0015114 2 9 0.02591 transporter activity solute:cation symporter activity GO:0015294 3 7 0.00073 transferase activity, transferring GO:0016763 2 7 0.01568 pentosyl groups

105

Table 19: GO Enrichment for Biological Processes of Genes Upregulated in Acetate GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO carbohydrate metabolic process GO:0005975 10 136 0.00480 transmembrane transport GO:0055085 8 124 0.02491 single-organism carbohydrate GO:0044723 9 114 0.00473 metabolic process carbohydrate derivative biosynthetic GO:1901137 6 71 0.01562 process cell wall organization or biogenesis GO:0071554 6 65 0.01030 cellular carbohydrate metabolic GO:0044262 8 63 0.00035 process external encapsulating structure GO:0045229 5 47 0.01069 organization anion transport GO:0006820 4 46 0.04309 carbohydrate biosynthetic process GO:0016051 6 45 0.00159 polysaccharide metabolic process GO:0005976 7 40 0.00011 ion transmembrane transport GO:0034220 4 40 0.02744 cytokinetic process GO:0032506 4 39 0.02523 cellular polysaccharide metabolic GO:0044264 6 32 0.00024 process cell wall biogenesis GO:0042546 4 32 0.01282 cellular carbohydrate biosynthetic GO:0034637 5 30 0.00145 process polysaccharide biosynthetic process GO:0000271 6 29 0.00013 cellular polysaccharide biosynthetic GO:0033692 5 27 0.00088 process cell wall macromolecule metabolic GO:0044036 3 21 0.02173 process membrane lipid metabolic process GO:0006643 3 20 0.01901 membrane lipid biosynthetic process GO:0046467 3 18 0.01418 cell wall polysaccharide metabolic GO:0010383 3 18 0.01418 process carbohydrate transport GO:0008643 3 17 0.01206 sphingolipid metabolic process GO:0006665 3 14 0.00687 sphingolipid biosynthetic process GO:0030148 3 12 0.00433 response to carbohydrate GO:0009743 2 12 0.04607 regulation of response to biotic GO:0002831 2 12 0.04607 stimulus beta-glucan metabolic process GO:0051273 2 11 0.03911 cellular divalent inorganic cation GO:0072503 2 10 0.03260 homeostasis 106

GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO divalent inorganic cation GO:0072507 2 10 0.03260 homeostasis beta-glucan biosynthetic process GO:0051274 2 9 0.02658 glycolipid biosynthetic process GO:0009247 2 9 0.02658 response to fungus GO:0009620 2 9 0.02658 inorganic anion transport GO:0015698 2 9 0.02658 calcium ion homeostasis GO:0055074 2 8 0.02106 cellular calcium ion homeostasis GO:0006874 2 8 0.02106 glycosphingolipid metabolic process GO:0006687 2 7 0.01609 response to jasmonic acid GO:0009753 2 6 0.01171 extracellular polysaccharide GO:0046379 3 5 0.00023 metabolic process

Table 20: GO Enrichment for Cellular Compartment of Genes Upregulated in Acetate GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO membrane GO:0016020 23 585 0.04593 intrinsic component of membrane GO:0031224 18 398 0.02371 external encapsulating structure GO:0030312 4 37 0.02014 cell wall GO:0005618 4 36 0.01835 intermediate filament cytoskeleton GO:0045111 2 11 0.03808 intermediate filament GO:0005882 2 10 0.03174 fungal-type cell wall GO:0009277 2 8 0.02049

107

Table 21: GO Enrichment for Biological Processes of Genes Downregulated in Acetate GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO organic acid metabolic process GO:0006082 15 175 0.00721 oxoacid metabolic process GO:0043436 15 173 0.00647 carboxylic acid metabolic process GO:0019752 15 169 0.00517 cellular amino acid metabolic process GO:0006520 11 104 0.00460 organic acid biosynthetic process GO:0016053 8 93 0.04745 carboxylic acid biosynthetic process GO:0046394 8 93 0.04745 ncRNA metabolic process GO:0034660 10 89 0.00448 mycelium development GO:0043581 9 85 0.01034 monocarboxylic acid metabolic process GO:0032787 9 83 0.00887 ncRNA processing GO:0034470 10 78 0.00164 organonitrogen compound catabolic process GO:1901565 8 77 0.01729 ribosome biogenesis GO:0042254 7 72 0.03541 alpha-amino acid metabolic process GO:1901605 10 67 0.00048 cellular macromolecular complex assembly GO:0034622 6 61 0.04792 cellular amino acid biosynthetic process GO:0008652 7 59 0.01296 rRNA metabolic process GO:0016072 6 58 0.03875 rRNA processing GO:0006364 6 58 0.03875 small molecule catabolic process GO:0044282 7 47 0.00365 establishment of protein localization to organelle GO:0072594 5 45 0.04440 mitochondrion organization GO:0007005 5 43 0.03744 organic acid catabolic process GO:0016054 7 42 0.00187 carboxylic acid catabolic process GO:0046395 7 42 0.00187 amine metabolic process GO:0009308 5 38 0.02314 alpha-amino acid biosynthetic process GO:1901607 5 38 0.02314

108

Table 22: GO Enrichment for Molecular Function of Genes Downregulated in Acetate GO Term GO Identity Effective Total Enrichment GO Protein p-value Term per Count GO transferase activity, transferring one- carbon groups GO:0016741 7 78 0.04651 methyltransferase activity GO:0008168 7 76 0.04121 cofactor binding GO:0048037 7 67 0.02229 unfolded protein binding GO:0051082 4 23 0.01501 pyridoxal phosphate binding GO:0030170 4 18 0.00610 heme binding GO:0020037 3 15 0.02399 tetrapyrrole binding GO:0046906 3 15 0.02399 peroxidase activity GO:0004601 2 8 0.04330 oxidoreductase activity, acting on peroxide as acceptor GO:0016684 2 8 0.04330 oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor GO:0016620 2 7 0.03339 RNA methyltransferase activity GO:0008173 2 5 0.01681 acid phosphatase activity GO:0003993 2 5 0.01681 macromolecule transmembrane transporter activity GO:0022884 2 5 0.01681

Table 23: GO Enrichment for Cellular Compartment of Genes Downregulated in Acetate GO Term GO Identity Effective Total Enrichment p- GO Proteins value Term per GO Count mitochondrion GO:0005739 16 229 0.03723 nucleolus GO:0005730 9 96 0.02274 mitochondrial part GO:0044429 9 94 0.02005 mitochondrial envelope GO:0005740 7 70 0.03179 preribosome GO:0030684 8 23 0.00000 mitochondrial membrane part GO:0044455 4 15 0.00332 90S preribosome GO:0030686 3 11 0.01061 nucleolar part GO:0044452 2 8 0.04545 mitochondrial intermembrane space GO:0005758 2 8 0.04545 methyltransferase complex GO:0034708 2 8 0.04545 small-subunit processome GO:0032040 3 7 0.00256 preribosome, large subunit precursor GO:0030687 2 6 0.02579 respiratory chain GO:0070469 2 5 0.01769

109

3.4 Discussion and Conclusions

The significance of the Acl1 protein in the vegetative growth, sexual development and virulence of pathogenic fungi has been demonstrated in several cases [111, 114]. The role of the single acl1 gene found in U. maydis was characterized in this chapter. Deletion of acl1 abolished vegetative growth in glucose-containing media, and this contrasts to the growth of the

C. neoformans acl1 mutant, which reached WT levels of growth after an extended lag phase

[111]. Consistent with reports in other fungi, the presence of 1% acetate as a carbon source restores the growth of acl1 mutants to near the level observed with glucose as the sole carbon source (Figure 16) [108, 109].

Acl1 is required for full virulence in the pathogenic fungi C. neoformans and F. graminearum [111, 114]. We assessed the ability of solopathogenic acl1 mutants of U. maydis to cause disease in maize seedlings and found that Acl1 is required for pathogenesis because the mutants were completely avirulent and no symptoms of disease were observed. This is in contrast to the WT infection that produced a range of disease symptoms including anthocyanin production, tumor formation and plant death. This illustrates the importance of this enzyme and of acetyl-CoA metabolism to virulence in this pathogen and is consistent with other observations made with mutants in the β-oxidation pathway, which also exhibit a reduction in virulence [16,

144].

Another observation was that different carbon sources influence the virulence of U. maydis. Specifically, pre-growth in acetate caused a reduction in the ability of the fungus to produce WT levels of disease in maize when compared to the same strains grown in glucose.

This is likely related to the inhibitory effect that acetate has on mating and filamentation in U. maydis. However it is also possible that pre-culture in an unfavourable carbon source such as 110

acetate could cause the fungus to deplete intracellular storage molecules such as glycogen or trehalose. This depletion could put the fungus at a metabolic disadvantage before establishment of an infection in a host environment, which is already scarce in nutrients [13, 15]. This is consistent with the reduced growth observed in acetate-grown cells and demonstrates that acetate is an unfavorable source of carbon for this fungus.

The utilization of alternate carbon sources is often repressed in the presence of favorable carbon sources such as glucose in fungi [83]. The results in this chapter indicate that acetate has repressive effects because it suppressed filamentation and mating even in the presence of a favorable carbon and energy source like glucose. It is also interesting that this effect is acetate- specific, as other non-fermentable carbon sources such as ethanol and glycerol had no effect on filamentation and mating.

To further elucidate these acetate-associated observations and understand the underlying molecular functions and pathways that could be responsible for these phenotypes, a transcriptional profile of WT cells grown in glucose or acetate for 24 hours was obtained.

Growth in acetate had an effect on mitochondrial functions as was evident with a downregulation of a number of mitochondrial-associated proteins with oxidoreductase activity which are part of the respiratory chain. The biological functions enriched in the down-regulated genes included numerous pathways involved in carbon metabolism (Table 21) and also in the function and biogenesis of the ribosome. This suggests that in response to an unfavourable carbon source such as acetate the cell undergoes massive metabolic reprogramming to shut down metabolism of certain carbon sources and a reduction in the level of protein synthesis, possibly as a mechanism to conserve energy.

111

Among those genes up-regulated by growth in acetate, there was a large proportion associated with the membrane or cell wall. Furthermore the MFs which were enriched included many different proteins with transporter and symporter activity. Although the significance of this is not clear, it could be a mechanism by the cell to acquire other nutrients from the extracellular environment that would be more favorable than acetate. There was also an enrichment in proteins with hydrolase and transferase activity associated with glycosyl bonds which is consistent with a shift in carbon metabolism and many proteins with biological functions associated with carbohydrate metabolism and biosynthesis. This is again consistent with a large metabolic shift in the cell to adapt to and utilize a new and unfavorable carbon source such as acetate.

This chapter highlights the importance of the cellular metabolite acetyl-CoA and the Acl1 protein which is responsible for its synthesis. U. maydis mutants lacking acl1 are unable to cause disease symptoms in maize and therefore incapable of completing the lifecycle. Also described is the unfavorable nature of acetate as a source of energy for the cell. Cells using acetate as a carbon source grow to lower cell densities, are less virulent and cannot mate or transition into a filamentous cell type. This is likely related to observed transcriptional changes which seem to indicate reduced cellular energy expenditure and utilization of energy sources other than acetate.

112

Chapter 4: Conclusions

Previous work in the Kronstad laboratory has been instrumental in understanding important metabolic aspects of the U. maydis infection process, including elucidation of different aspects of lipid metabolism and signal transduction [13, 15, 16]. The work presented in this thesis further expands upon these previous findings by examining PLs that have potential roles in metabolism, virulence and signaling. In particular, the first part of this thesis included an in silico and transcriptional characterization of 11 candidate PL genes found in the genome of U. maydis. This study revealed that U. maydis contains multiple PL enzymes representative of the four main PL families (Table 2 and Figure 5).

To investigate the functional contributions of a subset of these PLs, subsequent work focused on the characterization of two PLA2s (encoded by lip1 and lip2) belonging to the

PAFAH subfamily. One important reason for focusing on the PLA2s was that homologs in other fungi have been implicated in general stress responses and are required for WT levels of resistance to oxidative stress. For example, it is believed that the PAFAH in S. pombe functions to remove damaging RA moieties from membrane phospholipds [48, 53]. In humans, two

PAFAHs implicated in numerous diseases, have been shown to function in the removal of oxidized membrane lipids which have been damaged by peroxidation [41-43]. With this information in mind, mutants of U. maydis with deletions in a one or both genes were created and those containing a mutation for lip2 were found to be less virulent in maize seedlings (Figure

11 and Figure 12). Furthermore, the lip2 mutants exhibited sensitivities to H2O2 and the chemicals chloroquine and quinacrine while showing resistance to NaCl and LiCl stress. These results suggest there may be changes in the composition or structure of membrane lipids in the lip2 mutants, which could in turn alter membrane function resulting in the observed phenotypes. 113

To examine the possibility of lipid changes in more detail, a lipidomic analysis of the composition of the WT strain and lip2 mutant using UPLC-MS was performed. This analysis revealed a shift in 139 m/z values, indicating that Lip2 is indeed involved in maintenance of lipid homeostasis in U. maydis. Although additional future work is needed to identify specific lipids, the data suggest that the majority of the lipids with differential abundance were glycerophospholipids and glycerolipids, i.e., major constituents of the plasma membrane and phospholipid precursors. Furthermore, a number of hydroxylated lipids were identified in both

WT and Δlip2 backgrounds, suggesting that Lip2 could also be responsible for removal of these types of potentially damaging lipids.

A transcriptional profile of the WT strain and the lip2 mutant grown in glucose and oleic acid was also acquired as a part of this work. This RNA-Seq data revealed transcriptional regulation of many genes involved in carbon metabolism, including upregulation of genes with hydrolase activity associated with glycosyl bonds that could potentially free sugar molecules to be metabolized. In addition, there was also an upregulation of genes associated with the oxidative stress response and transporter activity in the Δlip2 mutant. This finding is consistent with the hypothesis that Lip2 plays a role in the response to oxidative stress and that deletion of this gene could result in a perturbation of membrane function.

Based on the evidence accumulated for the impact of loss of Lip2, it is feasible to hypothesize that this protein participates in as a protective mechanism upon infection of maize.

Colonization of plants by microbial pathogens triggers a host-defense response which includes rapid production of ROS [55]. Although U. maydis is effective in suppressing many host defenses, it is possible that it is still exposed to some level of ROS that could have damaging results due to membrane lipid peroxidation [6, 68, 69]. In the absence of Lip2, this damage 114

could have more significant effects on membrane structure, composition and function thus leading to reduced growth in planta.

The findings for Lip2 suggest many additional experiments to investigate the hypothesized role in defense against the plant immune response. A starting point for future work regarding Lip2 could include confirmation of RNA levels for candidate genes identified in the

RNA-Seq dataset. In particular, it would be possible to confirm the changes in expression of genes involved in the oxidative stress response and carbon metabolism using qRT-PCR. Once confirmed, some of these genes could potentially be mutated to assess their contributions to virulence and the response to stress. In the same regard, a targeted mass spectrometry approach could be employed to identify and confirm specific lipids that were identified in the lipidomic dataset to get a clearer idea of whether Lip2 could potentially process damaged lipids.

The purification and expression of recombinant Lip2 protein would also be valuable for understanding the functional aspects of the protein. Although this approach was attempted unsuccessfully with an E. coli expression system, it is possible that expression of Lip2 in a eukaryotic system such as the yeast Pichia pastoris or the baculovirus insect expression system would produce functional protein. This protein could then be used in biochemical assays to determine enzyme kinetics examine and substrate specificity in the context of the types of lipids that would accumulate in response to ROS damage.

It would also be possible to more thoroughly investigate lipid damage in the context of

Lip2 function by using a thiobarbituric acid reactive substance (TBARS) assay, to quantify relative levels of peroxidized lipids. If Lip2 is indeed responsible for the liberation of peroxidized lipids to alleviate membrane stress, it would be expected that Δlip2 strains contain higher levels of peroxidized lipids upon challenge with oxidative agents. 115

We hypothesize that the reduction in virulence that is observed with Δlip2 mutants is as a result of diminished ability to cope with elevated levels of ROS. As such, it would be reasonable to assume that co-inoculation of maize with Δlip2 mutants along with chemical scavengers of

ROS such as ascorbate or diphenyleneiodonium could rescue the virulence phenotype.

Conversely, it would also be possible that pre-damaging U. maydis membrane lipids with ROS could further exaggerate the reduced virulence phenotype observed in Δlip2 mutants.

Finally, for Lip2, determining the localization of the enzyme would also be very informative to understand the function of the protein. Strains expressing a Lip2-GFP fusion protein are currently being constructed and fluorescence microscopy should then reveal where this protein localizes and if its expression or localization change upon challenge with oxidative stress.

In addition to the discovery of a role for the PLA2 lip2 in virulence, the work presented in this thesis also revealed aspects of alternative carbon source utilization and the role of the protein

Acl1 in U. maydis. The significance of Acl in fungi has been characterized on numerous occasions, and this protein generally plays an important role in glucose utilization and the production of acetyl-CoA. Acl1 also influences vegetative growth, sexual and asexual development and virulence in a diverse range of fungi [108, 109, 111, 113, 114]. The work presented in Chapter 3 revealed that Acl1 is essential for pathogenic development and vegetative growth on glucose in U. maydis (Figure 16 and Figure 17). However, it would be interesting to further characterize the Δacl1 mutants to examine other aspects such as intracellular acetyl-CoA levels, changes in cellular protein acetylation and the response and morphology of these mutants when grown in fatty acids.

116

There is relatively little research regarding the use of acetate as a sole carbon source in fungi, however in general it does seem that acetate is an unfavourable carbon source. It is also capable of provoking massive metabolic reprogramming to alter carbon pathways for biosynthesis and energy production [94-96, 99]. The use of acetate is generally under tight control. For example, proteins required for the metabolism of acetate are repressed in the presence of glucose in S. cerevisiae and A. nidulans [86, 90, 91].

Acetate also appears to be an unfavourable carbon source in U. maydis. The experiments presented here show that growth in acetate leads to a reduction in virulence in maize seedlings and represses the filamentous growth required for pathogenesis (Figure 18 and Figure 19).

Transcriptional profiles of WT cells grown in glucose and acetate revealed major effects of carbon source on metabolism. Growth in acetate affected the expression of transcripts for numerous mitochondrial proteins, including those involved in energy production via the respiratory chain. In addition to this result, the observed down-regulation of transcripts for proteins involved in ribosome biogenesis and protein synthesis suggested that the cells in acetate may enter a state to conserve energy for longer-term viability (Table 21, Table 22 and Table 23).

Acetate also increased the expression of genes with transporter and glycosyl-hydrolase or - transferase functions, potentially as a means to import more favourable carbon molecules into the cell and to utilize reserve energy storage molecules (Table 18, Table 19 and Table 20).

Confirmation of the RNA-Seq data requires validation of RNA levels for candidate genes using qRT-PCR. It would also be interesting to determine the RNA levels for genes required for filamentous growth and mating during growth in acetate. Furthermore, examining the effect of acetate on U. maydis strains that are constitutively filamentous would be another means to further elucidate the repressive effects of this carbon source. It is possible that the observed 117

virulence defect associated with growth in acetate could be a result of a poor nutritional state prior to infection, which puts the fungus in a detrimental position as it colonizes the host.

Glycogen and trehalose are two major carbon storage molecules in fungi, and the intracellular levels of these molecules in U. maydis during growth in different carbon sources have yet to be determined.

In summary, fungal plant pathogens represent a significant threat to crop health and yield worldwide. Developing strategies to mitigate damage caused by fungi is a difficult challenge, but one that must be tackled. To do so, an understanding of the mechanisms utilized by these organisms to cause disease is required. The work presented here contributes to the knowledge of

U. maydis pathogenesis in two ways. First, the molecular genetic characterization of the lip2 gene further elucidated the complex interactions which occur between the plant and an invading pathogen by revealing a novel defensive aspect of host colonization. Second, this thesis work revealed that aspects of carbon metabolism relating to the production of acetyl-CoA and the use of acetate are important for the pathogenic development of U. maydis.

118

References

1. Dean, R., et al., The Top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol, 2012. 13(4): p. 414-30. 2. Service, N.A.S., Crop Values 2013 Summary, U.S.D.o. Agriculture, Editor. 2014. 3. Bolker, M., M. Urban, and R. Kahmann, The a mating type locus of U maydis specifies cell signalling components. Cell, 1992. 68: p. 441-450. 4. Vollmeister, E., et al., Fungal development of the plant pathogen Ustilago maydis. FEMS Microbiol Rev, 2012. 36(1): p. 59-77. 5. Spellig, T., et al., Pheromones trigger filamentous growth in Ustilago maydis. EMBO J, 1994. 13(7): p. 1620-1627. 6. Brefort, T., et al., Ustilago maydis as a Pathogen. Annu Rev Phytopathol, 2009. 47: p. 423-45. 7. Heimel, K., et al., The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis. PLoS Pathog, 2010. 6(8): p. e1001035. 8. Banuett, F. and I. Herskowitz, Discrete developmental stages during teliospore formation in the corn smut fungus, Ustilago maydis. Development, 1996. 122: p. 2965-2976. 9. Zahiri, A., M. Babu, and B. Saville, Differential gene expression during teliospore germination in Ustilago maydis. Mol Gen Genomics, 2005. 273: p. 394-403. 10. Kamper, J., et al., Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature, 2006. 444(7115): p. 97-101. 11. Doehlemann, G., et al., Reprogramming a maize plant: transcriptional and metabolic changes induced by the fungal biotroph Ustilago maydis. Plant J, 2008. 56(2): p. 181-95. 12. Boyce, K.J., M. Kretschmer, and J.W. Kronstad, The vtc4 gene influences polyphosphate storage, morphogenesis, and virulence in the maize pathogen Ustilago maydis. Eukaryot Cell, 2006. 5(8): p. 1399-409. 13. Klose, J., M. Moniz de Sa, and J.W. Kronstad, Lipid-induced filamentous growth in Ustilago maydis. Mol Microbiol, 2004. 52(3): p. 823-35. 14. Lovely, C.B. and M.H. Perlin, Cla4, but not Rac1, regulates the filamentous response of Ustilago maydis to low ammonium conditions. Commun Integr Biol, 2011. 4(6): p. 670- 673. 15. Klose, J. and J.W. Kronstad, The multifunctional beta-oxidation enzyme is required for full symptom development by the biotrophic maize pathogen Ustilago maydis. Eukaryot Cell, 2006. 5(12): p. 2047-61. 16. Kretschmer, M., J. Klose, and J.W. Kronstad, Defects in mitochondrial and peroxisomal beta-oxidation influence virulence in the maize pathogen Ustilago maydis. Eukaryot Cell, 2012. 11(8): p. 1055-66. 17. Durrenberger, F., R.D. Laidlaw, and J.W. Kronstad, The hgl1 gene is required for dimorphism and teliospore formation in the fungal pathogen Ustilago maydis. Mol Microbiol, 2001. 41(2): p. 337-348. 18. Moniz de Sa, M. and J.W. Kronstad, Unpublished results. 19. Ghannoum, M.A., Potential Role of Phospholipases in Virulence and Fungal Pathogenesis. Clin Microbiol Rev, 2000. 13(1): p. 122-143.

119

20. Lipases and phospholipases: Methods and protocols, in Methods in Molecular Biology, G. Sandoval, Editor. 2012, Springer Science and Buisness Media: New Work. 21. Kohler, G.A., et al., Phospholipase A2 and phospholipase B activities in fungi. Biochim Biophys Acta, 2006. 1761(11): p. 1391-9. 22. Ibrahim, A.S., et al., Evidence implicating phospholipases as a virulence factor of Candida albicans. Infect Immun, 1995. 63(5): p. 1993-1998. 23. Leidich, S.D., et al., Cloning and Disruption of caPLB1, a Phospholipase B Gene Involved in the Pathogenicity of Candida albicans. J Biol Chem, 1998. 273(40): p. 26078-26086. 24. Hanel, H., et al., New systematically active antimycotics from the beta-blocker category. Mycoses, 1995. 38: p. 251-264. 25. Chen, S.C., et al., Identification of extracellular phospholipase B, lysophospholipase, and acyltransferase produced by Cryptococcus neoformans. Infect Immun, 1997. 65(2): p. 405-411. 26. Chen, S.C., et al., Phospholipase activity in Cryptococcus neoformans: A new virulence factor? JID, 1997. 175: p. 414-420. 27. Ganendren, R., et al., Phospholipase B activity enhances adhesion of Cryptococcus neoformans to a human lung epithelial cell line. Microbes Infect, 2006. 8(4): p. 1006-15. 28. Maruvada, R., et al., Cryptococcus neoformans phospholipase B1 activates host cell Rac1 for traversal across the blood-brain barrier. Cell Microbiol, 2012. 14(10): p. 1544-53. 29. Shen, D.K., et al., Characterisation and expression of phospholipases B from the opportunistic fungus Aspergillus fumigatus. FEMS Microbiol Lett, 2004. 239(1): p. 87- 93. 30. Birch, M., D.W. Denning, and G.D. Robson, Comparison of extracellular phospholipase activities in clinical and environmental Aspergillus fumigatus isolates. Med Mycol, 2004. 42(1): p. 81-86. 31. Li, X., et al., Disruption of the phospholipase D gene attenuates the virulence of Aspergillus fumigatus. Infect Immun, 2012. 80(1): p. 429-40. 32. Hube, B., et al., The role and relevance of phospholipase D1 during growth and dimorphism of Candida albicans. Microbiolgy, 2001. 147: p. 879-889. 33. Choi, J., et al., Differential roles of the phospholipase C genes in fungal development and pathogenicity of Magnaporthe oryzae. Fungal Genet Biol, 2011. 48(4): p. 445-55. 34. Farnoud, A.M., et al., Inositol phosphosphingolipid phospholipase C1 regulates plasma membrane ATPase (Pma1) stability in Cryptococcus neoformans. FEBS Lett, 2014. 35. Shea, J.M., et al., The cryptococcal enzyme inositol phosphosphingolipid-phospholipase C confers resistance to the antifungal effects of macrophages and promotes fungal dissemination to the central nervous system. Infect Immun, 2006. 74(10): p. 5977-88. 36. Henry, J., et al., Characterization of inositol phospho-sphingolipid-phospholipase C 1 (Isc1) in Cryptococcus neoformans reveals unique biochemical features. FEBS Lett, 2011. 585(4): p. 635-40. 37. Rosenson, R.S. and D.M. Stafforini, Modulation of oxidative stress, inflammation, and atherosclerosis by lipoprotein-associated phospholipase A2. J Lipid Res, 2012. 53(9): p. 1767-82. 38. Burke, J.E. and E.A. Dennis, Phospholipase A2 biochemistry. Cardiovasc Drugs Ther, 2009. 23(1): p. 49-59. 120

39. Schaloske, R.H. and E.A. Dennis, The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta, 2006. 1761(11): p. 1246-59. 40. Tjoelker, L.W., et al., Anti inflammatory properties of a platelet activating factor acetylhydrolase. Nature, 1995. 374: p. 549-553. 41. Stafforini, D.M., Biology of platelet-activating factor acetylhydrolase (PAF-AH, lipoprotein associated phospholipase A2). Cardiovasc Drugs Ther, 2009. 23(1): p. 73-83. 42. Stafforini, D.M., et al., Release of free F2-isoprostanes from esterified phospholipids is catalyzed by intracellular and plasma platelet-activating factor acetylhydrolases. J Biol Chem, 2006. 281(8): p. 4616-23. 43. Kriska, T., et al., Phospholipase action of platelet-activating factor acetylhydrolase, but not paraoxonase-1, on long fatty acyl chain phospholipid hydroperoxides. J Biol Chem, 2007. 282(1): p. 100-8. 44. Itabe, H., Oxidized phospholipids as a new landmark in atherosclerosis. Prog Lipid Res, 1998. 37(2/3): p. 181-207. 45. Steinbrecher, U.P. and P. P.H., Hydrolysis of phosphatidylcholine during LDL oxidation is mediated by platelet-activating factor acetylhydrolase. J Lipid Res, 1989. 30: p. 305- 315. 46. Kuniyasu, A., et al., Oxidized LDL and lysophosphatidylcholine stimulate plasminogen activator inhibitor-1 expression through reactive oxygen species generation and ERK1/2 activation in 3T3-L1 adipocytes. Biochim Biophys Acta, 2011. 1811(3): p. 153-62. 47. Vickers, K.C., F. Castro-Chavez, and J.D. Morrisett, Lyso-phosphatidylcholine induces osteogenic gene expression and phenotype in vascular smooth muscle cells. Atherosclerosis, 2010. 211(1): p. 122-9. 48. Foulks, J.M., et al., A yeast PAF acetylhydrolase ortholog suppresses oxidative death. Free Radic Biol Med, 2008. 45(4): p. 434-42. 49. Yazawa, H., et al., Toxicity of ricinoleic acid production in fission yeast Schizosaccharomyces pombe is suppressed by the overexpression of plg7, a phospholipase A2 of a platelet-activating factor (PAF) family homolog. Appl Microbiol Biotechnol, 2013. 97(18): p. 8193-203. 50. Yazawa, H., H. Kumagai, and H. Uemura, Secretory production of ricinoleic acid in fission yeast Schizosaccharomyces pombe. Appl Microbiol Biotechnol, 2013. 97(19): p. 8663-71. 51. Yazawa, H., et al., Suppression of ricinoleic acid toxicity by ptl2 overexpression in fission yeast Schizosaccharomyces pombe. Appl Microbiol Biotechnol, 2014. 52. Chen, D., et al., Global transcriptional responses of fission yeast to environmental stress. Mol Biol Cell, 2003. 14(1): p. 214-29. 53. Yu, C., et al., Biological role of Trichoderma harzianum-derived platelet-activating factor acetylhydrolase (PAF-AH) on stress response and antagonism. PLoS One, 2014. 9(6): p. e100367. 54. Abreu, I.A. and D.E. Cabelli, Superoxide dismutases-a review of the metal-associated mechanistic variations. Biochim Biophys Acta, 2010. 1804(2): p. 263-74. 55. Jones, J.D. and J.L. Dangl, The plant immune system. Nature, 2006. 444(7117): p. 323-9. 56. Shetty, N.P., et al., Roles of reactive oxygen species in interactions between plants and pathogens. Eur J Plant Pathol, 2008. 121: p. 267-280.

121

57. Huang, K., et al., Suppression of plant-generated reactive oxygen species is required for successful infection by the rice blast fungus. Virulence, 2011. 2(6): p. 559-562. 58. Bradley, D.J., P. Kjellbom, and C.J. Lamb, Elicitor- and wound-induced oxidative crosslinking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell, 1992. 70(1): p. 21-30. 59. Zurbriggen, M.D., et al., Chloroplast-generated reactive oxygen species play a major role in localized cell death during the non-host interaction between tobacco and Xanthomonas campestris pv. vesicatoria. Plant J, 2009. 60(6): p. 962-73. 60. Abuja, P.M. and R. Albertini, Methods for monitoring oxidative stress, lipid peroxidation and oxidation resistance of lipoproteins. Clin Chim Acta, 2001. 306: p. 1-17. 61. Heller, J. and P. Tudzynski, Reactive oxygen species in phytopathogenic fungi: signaling, development, and disease. Annu Rev Phytopathol, 2011. 49: p. 369-90. 62. Shichiri, M., The role of lipid peroxidation in neurological disorders. J Clin Biochem Nutr, 2014. 54(3): p. 151-160. 63. Farmer, E.E. and M.J. Mueller, ROS-mediated lipid peroxidation and RES-activated signaling. Annu Rev Plant Biol, 2013. 64: p. 429-50. 64. Negre-Salvayre, A., et al., Pathological aspects of lipid peroxidation. Free Radic Res, 2010. 44(10): p. 1125-71. 65. Jamieson, D.J., Oxidative stress responses of the yeast Saccharomyces cerevisiae. Yeast, 1998. 14: p. 1511-1527. 66. Basse, C.W., Dissecting defense-related and developmental transcriptional responses of maize during Ustilago maydis infection and subsequent tumor formation. Plant Physiol, 2005. 138(3): p. 1774-84. 67. Molina, L. and R. Kahmann, An Ustilago maydis gene involved in H2O2 detoxification is required for virulence. Plant Cell, 2007. 19(7): p. 2293-309. 68. Doehlemann, G., et al., Pep1, a secreted effector protein of Ustilago maydis, is required for successful invasion of plant cells. PLoS Pathog, 2009. 5(2): p. e1000290. 69. Hemetsberger, C., et al., The Ustilago maydis effector Pep1 suppresses plant immunity by inhibition of host peroxidase activity. PLoS Pathog, 2012. 8(5): p. e1002684. 70. Chi, M.H., et al., A novel pathogenicity gene is required in the rice blast fungus to suppress the basal defenses of the host. PLoS Pathog, 2009. 5(4): p. e1000401. 71. Huang, K., et al., HYR1-mediated detoxification of reactive oxygen species is required for full virulence in the rice blast fungus. PLoS Pathog, 2011. 7(4): p. e1001335. 72. Samalova, M., et al., Robust anti-oxidant defences in the rice blast fungus Magnaporthe oryzae confer tolerance to the host oxidative burst. New Phytol, 2013. 73. Guo, M., et al., The bZIP transcription factor MoAP1 mediates the oxidative stress response and is critical for pathogenicity of the rice blast fungus Magnaporthe oryzae. PLoS Pathog, 2011. 7(2): p. e1001302. 74. Guo, M., et al., The basic leucine zipper transcription factor Moatf1 mediates oxidative stress responses and is necessary for full virulence of the rice blast fungus Magnaporthe oryzae. Mol Plant Microbe Interact, 2010. 23(8): p. 1053-1068. 75. Fernandez, J., et al., Plant defence suppression is mediated by a fungal sirtuin during rice infection by Magnaporthe oryzae. Mol Microbiol, 2014. 94(1): p. 70-88.

122

76. Parker, D., et al., Metabolomic analysis reveals a common pattern of metabolic reprogramming during invasion of three host plant species by Magnaporthe grisea. Plant J, 2009. 59(5): p. 723-37. 77. Viefhues, A., et al., Redox systems in Botrytis cinerea: Impact on development and virulence. Mol Plant Microbe Interact, 2014. 27(8): p. 858-874. 78. Jiang, C., et al., FgSKN7 and FgATF1 have overlapping functions in ascosporogenesis, pathogenesis and stress responses in Fusarium graminearum. Environ Microbiol, 2014. 79. Sandai, D., et al., The evolutionary rewiring of ubiquitination targets has reprogrammed the regulation of carbon assimilation in the pathogenic yeast Candida albicans. MBio, 2012. 3(6). 80. Turcotte, B., et al., Transcriptional regulation of nonfermentable carbon utilization in budding yeast. FEMS Yeast Res, 2010. 10(1): p. 2-13. 81. Lohr, D., P. Venkov, and J. Zlatanova, Transcriptional regulation in the yeast GAL gene family: A complex genetic network. FASEB J, 1995. 9: p. 777-787. 82. Lavoie, H., H. Hogues, and M. Whiteway, Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi. Curr Opin Microbiol, 2009. 12(6): p. 655-63. 83. Bhat, P.J. and T.V.S. Murthy, Transcriptional control of the GAL/MEL regulon of yeast Saccharomyces cerevisiae: mechanism of galactose-mediated signal transduction. Mol Microbiol, 2001. 40(5): p. 1059-1066. 84. Pavlik, P., et al., The glycerol kinase (GUT1) Gene of Saccharomyces cerevisiae: Cloning and characterization. Curr Genet, 1993. 24: p. 21-25. 85. Ferreira, C., et al., A member of the sugar transporter family, Stl1p is the glycerol/H+ symporter in Saccharomyces cerevisiae. Mol Biol Cell, 2005. 16(4): p. 2068-76. 86. Casal, M., et al., The lactate-proton symport of Saccharomyces cerevisiae is encoded by JEN1. J Bacteriol, 1999. 181(8): p. 2620-2623. 87. Lodi, T. and L. Ferrero, Isolation of the DLD gene of Saccharomyces cerevisiae encoding the mitochondrial enzyme D-lactate ferricytochrome c oxidoreductase. Mol Gen Genet, 1993. 238: p. 315-324. 88. Askew, C., et al., Transcriptional regulation of carbohydrate metabolism in the human pathogen Candida albicans. PLoS Pathog, 2009. 5(10): p. e1000612. 89. Zampar, G.G., et al., Temporal system-level organization of the switch from glycolytic to gluconeogenic operation in yeast. Mol Syst Biol, 2013. 9: p. 651. 90. Vilela-Moura, A., et al., The impact of acetate metabolism on yeast fermentative performance and wine quality: reduction of volatile acidity of grape musts and wines. Appl Microbiol Biotechnol, 2011. 89(2): p. 271-80. 91. Lee, Y.J., et al., TCA cycle-independent acetate metabolism via the glyoxylate cycle in Saccharomyces cerevisiae. Yeast, 2011. 28(2): p. 153-66. 92. dos Santos, M.M., et al., Identification of In Vivo Enzyme Activities in the Cometabolism of Glucose and Acetate by Saccharomyces cerevisiae by Using 13C-Labeled Substrates. Eukaryot Cell, 2003. 2(3): p. 599-608. 93. Wolfe, A.J., The acetate switch. Microbiol Mol Biol Rev, 2005. 69(1): p. 12-50. 94. Orzechowski Westholm, J., et al., Gis1 and Rph1 regulate glycerol and acetate metabolism in glucose depleted yeast cells. PLoS One, 2012. 7(2): p. e31577.

123

95. Todd, R.B., et al., Molecular characterization of mutants of the acetate regulatory gene facB or Aspergillus nidulans. Fungal Genet Biol, 1997. 22: p. 92-102. 96. Davis, M.A., J.M. Kelly, and M.J. Hynes, Fungal catabolic regulation: molecular genetic analysis of the amdS gene of Aspergillus nidulans. Genetica, 1993. 90: p. 133- 145. 97. Georgakopoulos, P., R.A. Lockington, and J.M. Kelly, SAGA complex components and acetate repression in Aspergillus nidulans. G3, 2012. 2: p. 1357-1367. 98. Georgakopoulos, P., R.A. Lockington, and J.M. Kelly, The Spt-Ada-Gcn5 Acetyltransferase (SAGA) Complex in Aspergillus nidulans. PLoS One, 2013. 8(6): p. e65221. 99. Meijer, S., et al., Physiological characterisation of acuB deletion in Aspergillus niger. Appl Microbiol Biotechnol, 2009. 84(1): p. 157-67. 100. Gerstmeir, R., et al., Acetate metabolism and its regulation in Corynebacterium glutamicum. J Biotechnol, 2003. 104(1-3): p. 99-122. 101. Oh, M.K., et al., Global expression profiling of acetate-grown Escherichia coli. J Biol Chem, 2002. 277(15): p. 13175-83. 102. Oliver, D.J., B.J. Nikolau, and E.S. Wurtele, Acetyl-CoA—Life at the metabolic nexus. Plant Sci, 2009. 176(5): p. 597-601. 103. Strijbis, K. and B. Distel, Intracellular acetyl unit transport in fungal carbon metabolism. Eukaryot Cell, 2010. 9(12): p. 1809-15. 104. Vorapreeda, T., et al., Alternative routes of acetyl-CoA synthesis identified by comparative genomic analysis: involvement in the lipid production of oleaginous yeast and fungi. Microbiology, 2012. 158(Pt 1): p. 217-28. 105. Fatland, B.L., B.J. Nikolau, and E.S. Wurtele, Reverse genetic characterization of cytosolic acetyl-CoA generation by ATP-citrate lyase in Arabidopsis. Plant Cell, 2005. 17(1): p. 182-203. 106. Watson, J.A., M. Fang, and J.M. Lowenstein, Tricarballylate and hydroxycitrate: Substrate and inhibitor of ATP citrate oxaloacetate lyase. Arch Biochem Biophys, 1969. 135: p. 209-217. 107. Chypre, M., N. Zaidi, and K. Smans, ATP-citrate lyase: a mini-review. Biochem Biophys Res Commun, 2012. 422(1): p. 1-4. 108. Chen, H., et al., Physiological characterization of ATP-citrate lyase in Aspergillus niger. J Ind Microbiol Biotechnol, 2014. 41(4): p. 721-31. 109. Hynes, M.J. and S.L. Murray, ATP-citrate lyase is required for production of cytosolic acetyl coenzyme A and development in Aspergillus nidulans. Eukaryot Cell, 2010. 9(7): p. 1039-48. 110. Wellen, K.E., et al., ATP-citrate lyase links cellular metabolism to histone acetylation. Science, 2009. 324(5930): p. 1076-80. 111. Griffiths, E.J., et al., A defect in ATP-citrate lyase links acetyl-CoA production, virulence factor elaboration and virulence in Cryptococcus neoformans. Mol Microbiol, 2012. 86(6): p. 1404-23. 112. Nowrousian, M., et al., Cell differentiation during sexual development of the fungus Sordaria macrospora requires ATP citrate lyase activity. Mol Cell Biol, 1999. 19(1): p. 450-460.

124

113. Son, H., et al., ATP citrate lyase is required for normal sexual and asexual development in Gibberella zeae. Fungal Genet Biol, 2011. 48(4): p. 408-17. 114. Sakamoto, N., et al., Correlation of ATP citrate lyase and acetyl CoA levels with trichothecene production in Fusarium graminearum. Toxins, 2013. 5(11): p. 2258-69. 115. Waterhouse, A.M., et al., Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics, 2009. 25(9): p. 1189-91. 116. Krogh, A., et al., Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J Mol Biol, 2001. 305: p. 567-580. 117. Briesemeister, S., J. Rahnenfuhrer, and O. Kohlbacher, YLoc--an interpretable web server for predicting subcellular localization. Nucleic Acids Res, 2010. 38(Web Server issue): p. W497-502. 118. Petersen, T.N., et al., SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods, 2011. 8(10): p. 785-6. 119. Choi, J., et al., CFGP 2.0: a versatile web-based platform for supporting comparative and evolutionary genomics of fungi and Oomycetes. Nucleic Acids Res, 2013. 41(Database issue): p. D714-9. 120. Davidson, R.C., et al., A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology, 2002. 148: p. 2607-2615. 121. Hageage, G.J. and B.J. Harrington, Calcofluor White: A Review of its Uses and Applications in Clinical Mycology and Parasitology. Lab Med, 2003. 34(5): p. 361-367. 122. Falcon, S. and R. Gentleman, Using GOstats to test gene lists for GO term association. Bioinformatics, 2007. 23(2): p. 257-8. 123. Arai, H., et al., Platelet-activating factor acetylhydrolase (PAF-AH). J Biochem, 2002. 131: p. 635-640. 124. Wei, Y., et al., Structure of a microbial homologue of mammalian platelet-activating factor acetylhydrolases: Streptomyces exfoliatus lipase at 1.9 å resolution. Structure, 1998. 6(4): p. 511-519. 125. Rolain, J.M., P. Colson, and D. Raoult, Recycling of chloroquine and its hydroxyl analogue to face bacterial, fungal and viral infections in the 21st century. Int J Antimicrob Agents, 2007. 30(4): p. 297-308. 126. Farooqui, A.A., W.Y. Ong, and L.A. Horrocks, Inhibitors of brain phospholipase A2 activity: their neuropharmacological effects and therapeutic importance for the treatment of neurologic disorders. Pharmacol Rev, 2006. 58(3): p. 591-620. 127. Utaida, S., S. Auparakkitanon, and P. Wilairat, Synergism of antimalarial antibiotics with hydrogen peroxide in inhibiting Plasmodium falciparum growth in culture. SE Asian J Trop Med, 2014. 45(1): p. 1-5. 128. Ouyang, Q., et al., Effects of pristane alone or combined with chloroquine on macrophage activation, oxidative stress, and TH1/TH2 skewness. J Immunol Res, 2014. 2014: p. 613136. 129. Islahudin, F., et al., Cell wall perturbation sensitizes fungi to the antimalarial drug chloroquine. Antimicrob Agents Chemother, 2013. 57(8): p. 3889-3896. 130. Rhee, S.Y., et al., Use and misuse of the gene ontology annotations. Nat Rev Genet, 2008. 9(7): p. 509-15. 131. Hedden, P. and S.G. Thomas, Gibberellin biosynthesis and its regulation. Biochem J, 2012. 444(1): p. 11-25. 125

132. Colebrook, E.H., et al., The role of gibberellin signalling in plant responses to abiotic stress. J Exp Biol, 2014. 217(Pt 1): p. 67-75. 133. Bomke, C. and B. Tudzynski, Diversity, regulation, and evolution of the gibberellin biosynthetic pathway in fungi compared to plants and bacteria. Phytochemistry, 2009. 70(15-16): p. 1876-93. 134. Gomez-Roldan, V., et al., Strigolactone inhibition of shoot branching. Nature, 2008. 455(7210): p. 189-94. 135. Akiyama, K., K. Matsuzaki, and H. Hayashi, Plant sesquiterpenes induce hyphal branching in arbuscular mycorrhizal fungi. Nature, 2005. 435(7043): p. 824-7. 136. Nebenfuhr, A., C. Ritzenthaler, and D.G. Robinson, Brefeldin A: deciphering an enigmatic inhibitor of secretion. Plant Physiol, 2002. 130(3): p. 1102-8. 137. Rosa, P., et al., Monensin and Brefeldin A differentially affect the phosphorylation and sulfation of secretory proteins. J Biol Chem, 1992. 267(17): p. 12227-12232. 138. Sivaramakrishnan, V., et al., Constitutive lysosome exocytosis releases ATP and engages P2Y receptors in human monocytes. J Cell Sci, 2012. 125(Pt 19): p. 4567-75. 139. McLean, L.R., K.A. Hagaman, and W.S. Davidson, Role of lipid structure in the activation of phospholipase A2 by peroxidized phospholipids. Lipids, 1993. 28(6): p. 505- 509. 140. Sevanian, A., R.A. Stein, and J.F. Mead, Metabolism of epoxidized phosphatidylcholine by phospholipase a2 and epoxide hydrolase. Lipids, 1981. 16(11): p. 781-789. 141. Catala, A., Lipid peroxidation modifies the picture of membranes from the "Fluid Mosaic Model" to the "Lipid Whisker Model". Biochimie, 2012. 94(1): p. 101-9. 142. Greenberg, M.E., et al., The lipid whisker model of the structure of oxidized cell membranes. J Biol Chem, 2008. 283(4): p. 2385-96. 143. Bleijerveld, O.B., et al., Metabolipidomics: profiling metabolism of glycerophospholipid species by stable isotopic precursors and tandem mass spectrometry. Anal Biochem, 2006. 352(1): p. 1-14. 144. Kretschmer, M., J. Wang, and J.W. Kronstad, Peroxisomal and mitochondrial beta- oxidation pathways influence the virulence of the pathogenic fungus Cryptococcus neoformans. Eukaryot Cell, 2012. 11(8): p. 1042-54. 145. Holliday, R., Induced mitotic crossing-over in Ustilago maydis. Genet Res, 1961. 2(2): p. 231-248. 146. Wedlich-Soldner, R., et al., Dynein supports motility of endoplasmic reticulum in the fungus Ustilago maydis. Mol Biol Cell, 2002. 13(3): p. 965-77.

126

Appendices

Appendix A

A.1 Strain List

Table 24: Strains Employed and Generated in This Study Strain name Background Mating Resistance Source Genotype Marker 001 001 a2b2 N/A [145] 002 002 a1b1 N/A [145] SG200 SG200 a1 mfa2 Phleomycin [10] bE1bW2 Δlip1 A12 001 a2b2 Nourseothricin This study Δlip1 C31 001 a2b2 Nourseothricin This study Δlip1 A2 002 a1b1 Nourseothricin This study Δlip1 A6A 002 a1b1 Nourseothricin This study Δlip2 A33 001 a2b2 Hygromycin B This study Δlip2 C33 001 a2b2 Hygromycin B This study Δlip2 A21 002 a1b1 Hygromycin B This study Δlip2 B11 002 a1b1 Hygromycin B This study Δlip1Δlip2 A42 001 a2b2 Nourseothricin This study Hygromycin B Δlip1Δlip2 C52 001 a2b2 Nourseothricin This study Hygromycin B Δlip1Δlip2 A32 002 a1b1 Nourseothricin This study Hygromycin B Δlip1Δlip2 C21 002 a1b1 Nourseothricin This study Hygromycin B Δlip2 A14 SG200 a1 mfa2 Hygromycin B This study bE1bW2 Δlip2 C41 SG200 a1 mfa2 Hygromycin B This study bE1bW2 FB1EG FB1 a1b1 Nourseothricin [146] Carboxin FB1GYpt1 FB1 a1b1 Carboxin [146] FB1EG Δlip2 FB1 a1b1 Nourseothricin This study Carboxin Hygromycin B FB1GYpt1 FB1 a1b1 Carboxin This study Δlip2 Hygromycin B FB1GYpt1 FB1 a1b1 Carboxin This study Δlip2 Hygromycin B

127

Strain name Background Mating Resistance Source Genotype Marker SG200 SG200 a1 mfa2 Phleomycin This study lip2::GFP A11 bE1bW2 Hygromycin B SG200 SG200 a1 mfa2 Phleomycin This study lip2::GFP B11 bE1bW2 Hygromycin B Δum00004 A31 001 a2b2 Nourseothricin This study Δum00004 A51 001 a2b2 Nourseothricin This study Δum00004 C3 001 a2b2 Nourseothricin This study Δum00004 A1 002 a1b1 Nourseothricin This study Δum00004 B2 002 a1b1 Nourseothricin This study Δum00004 C8 002 a1b1 Nourseothricin This study Δum00004 C11 SG200 a1 mfa2 Nourseothricin This study bE1bW2 Δum00004 C3 SG200 a1 mfa2 Nourseothricin This study bE1bW2 Δum11266 001 a2b2 Nourseothricin This study Δum11266 001 a2b2 Nourseothricin This study Δum11266 002 a1b1 Nourseothricin This study Δum11266 002 a1b1 Nourseothricin This study Δacl2 SG200 a1 mfa2 Phleomycin This study bE1bW2 Nourseothricin (generated by E. Griffiths) Δacl3 SG200 a1 mfa2 Phleomycin This study bE1bW2 Nourseothricin (generated by E. Griffiths) Δacl6 SG200 a1 mfa2 Phleomycin This study bE1bW2 Nourseothricin (generated by E. Griffiths)

128

A.2 Primers Used in This Study

Table 25: Primers Used in This Study Primer Name Sequence Comments umACTIN F TGGTTCGGGAATGTGCAAAG Forward primer used to amplify Actin housekeeping gene for qRT-PCR umACTIN R GACAATACCGTGCTCGATGG Reverse primer used to amplify Actin housekeeping gene for qRT-PCR GAPDH FWD CATAATGTCTCAGGTCAACATCG Forward primer used to amplify GAPDH housekeeping gene for qRT-PCR GAPDH REV GGATGTTGGAGGGGTCCT Reverse primer used to amplify GAPDH housekeeping gene for qRT-PCR um00004 PCR-F AGACGGCCTTGTTCCAGGAC Forward primer used to amplify gene um00004 for qRT-PCR um00004 PCR-R GACGAAGCTGGCGCAATACC Reverse primer used to amplify gene um00004 for qRT-PCR um00130 PCR-F TCTGCCGAATGCTCCCATCC Forward primer used to amplify gene um00130 for qRT-PCR um00130 PCR-R TGACTGAAGCCGCCTACCAC Reverse primer used to amplify gene um00130 for qRT-PCR um00133 F CGTCACGCGACAATTCGATG Forward primer used to amplify gene um00133 for qRT-PCR; used to screen for negative lip1 transformants um00133 R AATGCGGACTTTCGGACCAG Reverse primer used to amplify gene um00133 for qRT-PCR; used to screen for negative lip1 transformants um00370 PCR-F TAGGTGGACCCGTCGGACAGGT Forward primer used to amplify AAG gene um00370 for qRT-PCR um00370 PCR-R TGGATGCAGCACCAGCGATCCT Reverse primer used to amplify C gene um00370 for qRT-PCR um01017 F CGACCTCTGCTTGCGAAAC Forward primer used to amplify gene um01017 for qRT-PCR um01017 R TGCTCCGCCTGATAGACAC Reverse primer used to amplify gene um01017 for qRT-PCR um01035 PCR-F AAACAACACCGCCCACACC Forward primer used to amplify gene um01035 for qRT-PCR um01035 PCR-R GTCGTCAAGCCACCCACAAAG Reverse primer used to amplify gene um01035 for qRT-PCR 129

Primer Name Sequence Comments um01120 PCR-F AGGCGTAGAGATTCGAGAGTG Forward primer used to amplify gene um01120 for qRT-PCR um01120 PCR-R GCCGACCTTGAACCGTAATTG Reverse primer used to amplify gene um01120 for qRT-PCR um01927 F ATGTTCGGCACGCTGTTC Forward primer used to amplify gene um01927 for qRT-PCR; used to screen for negative lip2 transformants um01927 R ACCAATGGGCCTGTACTGTC Reverse primer used to amplify gene um01927 for qRT-PCR; used to screen for negative lip2 transformants um02255 F GATCGGCGCGTGAAATGGAG Forward primer used to amplify gene um02255 for qRT-PCR um02255 R ACCGAGCGCATCCAGGTAAG Reverse primer used to amplify gene um02255 for qRT-PCR um02599 PCR-F CGAGAACGGCAAGGATTGG Forward primer used to amplify gene um02599 for qRT-PCR um02599 PCR-R GCAACGTCGTGGATCACAG Reverse primer used to amplify gene um02599 for qRT-PCR um02847 PCR-F AGCCGTTCCAACCAATCGTC Forward primer used to amplify gene um02847 for qRT-PCR um02847 PCR-R AGCGTTCGCTGTTCCCATTC Reverse primer used to amplify gene um02847 for qRT-PCR um02982 PCR-F GCAAGGCGGGTAGTGAAAC Forward primer used to amplify gene um02982 for qRT-PCR um02982 PCR-R AGCGGTAGATGACGGTAGC Reverse primer used to amplify gene um02982 for qRT-PCR um04125 PCR-F GTTTGAGCGAAGGTGGAAACG Forward primer used to amplify gene um04125 for qRT-PCR um04125 PCR-R TTTACCGGATCGCAGACGAAG Reverse primer used to amplify gene um04125 for qRT-PCR um04859 PCR-F TAGGGTTGGCGGGCTGAATG Forward primer used to amplify gene um04859 for qRT-PCR um04859 PCR-R CTGCTCGTAGCGTGCTGATG Reverse primer used to amplify gene um04859 for qRT-PCR um05659 PCR-F AAAGGAATCAGCGCCAAACG Forward primer used to amplify gene um05659 for qRT-PCR um05659 PCR-R GAGAAAGTCGGCAAAGTCAACC Reverse primer used to amplify gene um05659 for qRT-PCR um05871 PCR-F AAGAACGCTCCGCCGACATC Forward primer used to amplify gene um05871 for qRT-PCR

130

Primer Name Sequence Comments um05871 PCR-R TGGGCAGCAAAGGGCAGTAG Reverse primer used to amplify gene um05871 for qRT-PCR um06066 PCR-F GACCAGGCAGGAGGCTATTAC Forward primer used to amplify gene um06066 for qRT-PCR um06066 PCR-R CGTGCGGCTTGTGAAAGAC Reverse primer used to amplify gene um06066 for qRT-PCR um10263 PCR-F GTTCTCAAACCACCCGGTCTG Forward primer used to amplify gene um10263 for qRT-PCR um10263 PCR-R GTTCCTGGCGAACTTGTCGTC Reverse primer used to amplify gene um10263 for qRT-PCR Hyg2693 F GCAGCGATTGAAGCACAGTT Used to amplify HygB resistance cassette Hyg2693 R CAGATGTGAGTCGTGTGCTA Used to amplify HygB resistance cassette NAT1438 F CACCATGGCGTGACAATTGC Used to amplify NAT resistance cassette NAT1438 R GGCCACTCAGGCCTATTAATG Used to amplify NAT resistance cassette Lip2 P1 CAGTCGCTCTCTCTTCTTCT Used to amplify 5’ upstream region of the Lip2 gene for knockout cassette construction Lip2 P2 AACTGTGCTTCAATCGCTGCGAT Used to amplify 5’ upstream GAAGTGGCAGACGAGAA region of the Lip2 gene for knockout cassette construction; contains overlap region to HygB marker Lip2 P3 TAGCACACGACTCACATCTGGC Used to amplify 3’ downstream GTAGCATCGAGAGCAACA region of the Lip2 gene for knockout cassette construction; contains overlap region to HygB marker Lip2 P4 AAGGCGAGAAGCGGCGAAGA Used to amplify 3’ downstream region of the Lip2 gene for knockout cassette construction Lip2 P5 GCTCTCTCTTCTTCTCGCAA Nested primers used to amplify Lip2 replacement construct during 3rd round PCR Lip2 P6 CGAGAAGCGGCGAAGAAGAA Nested primers used to amplify Lip2 replacement construct during 3rd round PCR Lip2L GAGGACGGCGTCGAACTGAT Screening primer for deletion of lip2

131

Primer Name Sequence Comments HygBL ATCAGTTCGGAGACGCTG Screening primer for deletion of lip2 Lip2 Probe FWD Used to amplify DNA probe GCACGGTAAAGTGAGGTAAC used in Southern blot Lip2 Probe REV Used to amplify DNA probe ATGAAGTGGCAGACGAGAAG used in Southern blot Nat-F-SacI TGGACTGAGCTCCACCATGGCG Used to amplify NAT cassette TGACAATTGC adding a 5’ SacI recognition site Nat-R-BamHI GATGCTGGATCCGGCCACTCAG Used to amplify NAT cassette GCCTATTAATG adding a 3’ BamHI recognition site um11266 P1 TAAGCCAAACGTCCAGATCG Used to amplify upstream region of the gene um11266 for knockout cassette construction um11266 P2-SacI CGATAGGAGCTCGCAGCACGGA Used to amplify upstream region TTTCTAGAGG of the gene um11266 for knockout cassette construction; adds SacI recognition site to 3’ end of amplicon um11266 P3- GTTACAGGATCCACCACTCGTGC Used to amplify downstream BamHI TAGTCTC region of the gene um11266 for knockout cassette construction; adds BamHI recognition site to 5’ end of amplicon um11266 P4 GGCCAAGATCGACTTTGC Used to amplify 5’ upstream region of the gene um11266 for knockout cassette construction Nested primer used to amplify um11266 P5-n CGTCGTCATAACCTTCTG um11266 deletion construct Nested primer used to amplify um11266 P6-n TTGCAGGCTCCTACTCAAAC um11266 deletion construct um00133 P1 AGCAGACGGGTAAGGATTGG Used to amplify upstream region of the Lip1 gene for knockout cassette construction um00133 P2 AGGTGCGGCCGCAATTGTCACG Used to amplify upstream region CCATGGTGCTAGCGAACAGCAC of the Lip1 gene for knockout ACCTTG cassette construction; contains overlap region to NAT marker um00133 P3 GTGCGGCCGCATTAATAGGCCT Used to amplify downstream GAGTGGCCAAACCACGCGGCTA region of the Lip2 gene for CGCTTTG knockout cassette construction; contains overlap region to NAT marker

132

Primer Name Sequence Comments um00133 P4 AGCGGTCACTGCTTTGCATCG Used to amplify downstream region of the Lip2 gene for knockout cassette construction um00133 P5 AACAAGACGCCTTACCAGAC Nested primers used to amplify Lip1 replacement construct during 3rd round PCR um00133 P6 CATTGTACGAGCGCAAACAC Nested primers used to amplify Lip1 replacement construct during 3rd round PCR um00004 P1 ATTGCGTTCCCGCTTCTG Used to amplify upstream region of the um00004 gene for knockout cassette construction um00004 P2 AGGTGCGGCCGCAATTGTCACG Used to amplify upstream region CCATGGTGGCGATGCGATACGG of the um00004 gene for TTTG knockout cassette construction; contains overlap region to NAT marker um00004 P3 GTGCGGCCGCATTAATAGGCCT Used to amplify downstream GAGTGGCCCCCTGACCTGCCTCT region of the um00004 gene for TCTTGAC knockout cassette construction; contains overlap region to NAT marker um00004 P4 TCACGGAGCAGATCCACGTAG Used to amplify downstream region of the um00004 gene for knockout cassette construction um00004 P5 CAAAGCAAGGCTCGCCAAAC Nested primers used to amplify um00004 replacement construct during 3rd round PCR um00004 P6 AAGTGGTGTGCAGCCATACG Nested primers used to amplify um00004 replacement construct during 3rd round PCR UM_ACL1 AGGGCTGGTCTGGATTCTT Used to amplify upstream region of the acl1 gene for knockout cassette construction UM_ACL2 CACCATGGCGTGACAATTGC Used to amplify NAT resistance gene for knockout cassette construction UM_ACL3 GCAATTGTCACGCCATGGTGAG Used to amplify upstream region TTTTGGGGGCTTTGTCA of the acl1 gene for knockout cassette construction UM_ACL4 CATTAATAGGCCTGAGTGGCCT Used to amplify downstream GACAGGCAACGTAACCACT region of the acl1 gene for knockout cassette construction 133

Primer Name Sequence Comments UM_ACL5 GGCCACTCAGGCCTATTAATG Used to amplify NAT resistance gene for knockout cassette construction UM_ACL6 TGGAGCGCATCAAAGTCA Used to amplify downstream region of the acl1 gene for knockout cassette construction UM_ACL7 ACCCTGTCACCAACTCCATC Screening primer used to confirm transformants of acl1 gene deletion construct UM_ACL8 TTCGAGGTAGGCAAAGTGG Screening primer used to confirm transformants of acl1 gene deletion construct UM_ACL9 CGGCTTTTCGACTACAACTCT Screening primer used to confirm transformants of acl1 gene deletion construct

134

A.3 Deletion of lip1 and lip2 Does Not Affect Susceptibility to a Variety of Stressors

Figure 21: Deletion of lip1 and lip2 Does Not Alter Susceptibility to Various Stressors Spot assays were performed by placing 105 cells of WT and mutant strains in 10-fold serial dilutions from left to right onto MM+G plus the indicated chemicals. The plates were incubated at 30°C and growth was monitored for 2-5 days.

135

Figure 22: Deletion of lip1 and lip2 Does Not Affect Growth at Different pH Spot assays were performed by placing 105 cells of WT and mutant strains in 10-fold serial dilutions from left to right onto MM+G at the indicated pH. The plates were incubated at 30°C and growth was monitored for 2-5 days.

136

A.4 Deletion of lip2 Does Not Affect the Morphology of the Golgi Apparatus or

Endoplasmic Reticulum

Figure 23: Deletion of lip2 Does Not Affect the Structure of the Endoplasmic Reticulum Strains with a GFP-tagged ER marker in a WT (ER::GFP) or Δlip2 (ER::GFPΔlip2) background were grown in PDB and examined with fluorescence microscopy. Images were captured using differential interference contrast (DIC) or a GFP filter (GFP).

137

Figure 24: Deletion of lip2 Does Not Affect the Structure of the Golgi Apparatus Strains with a GFP-tagged Golgi apparatus marker in a WT (Golgi::GFP) or Δlip2 (Golgi::GFPΔlip2) background were grown in PDB and examined with fluorescence microscopy. Images were captured using differential interference contrast (DIC) or a GFP filter (GFP).

138

A.5 Deletion of lip2 Does Not Affect Host ROS Production

Figure 25: Deletion of lip1 or lip2 Does Not Affect Host Production of H2O2 Maize leaves were inoculated with 106 cells/ml of WT, Δlip1, Δlip2 or Δlip1Δlip2 strains, incubated for 24 hours, stained with 3-3-diaminobenzidine and bleached to detect host H2O2 production visible as brown spots. Areas of intense brown staining (visible in Δlip2 and Δlip1Δlip2) are parts of leaves damaged during handling and not indicative of U. maydis-induced

H2O2 production.

139

A.6 Deletion of lip2 Does Not Affect Growth on Alternative Carbon Sources

Figure 26: Deletion of lip2 Does Not Affect Growth on Alternative Carbon Sources Spot assays were performed by placing 105 cells of WT and mutant strains in 10-fold serial dilutions from left to right onto MM plus the indicated carbon source. The plates were incubated at 30°C and growth was monitored for 2-5 days.

140

A.7 Deletion of lip1 and lip2 Does Not Affect the Filamentous Response to Oleic Acid

Figure 27: Deletion of lip1 or lip2 Does Not Affect the Filamentous Response to Fatty Acids MM+O was inoculated with 2x105 cells/ml of WT, Δlip1, Δlip2 or Δlip1Δlip2 strains and filamentous growth was observed via DIC microscopy at 24h, 72h and 120h of growth. The number of yeast and filamentous cells were counted for three biological replicates. An average of 508 cells were counted for each strain at each time point. No statistical differences were observed using one-way ANOVA.

141

A.8 Deletion of the Candidate PLB Gene um11266 Does Not Affect Virulence or Mating

Figure 28: Deletion of the Candidate PLB Gene um11266 Does Not Affect the Virulence or Mating of U. maydis Virulence assays were performed with seven-day old maize seedlings infected with compatible mating cultures of WT or Δum11266 strains, including reciprocal WTxΔ crosses (left). Disease symptoms were scored 14 days post-infection. The disease index was calculated based on the frequency of symptoms that included plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease ratings and the total number of plants infected for each cross are indicated at the top. Cultures of solo haploids or compatible mating pairs were spotted onto charcoal- containing media and incubated at room temperature for 48 hours (right). Formation of a white fuzzy colony is indicative of filamentous growth and a compatible mating pair. The WT strain and the Δum11266 deletion strains are as indicated. 142

A.9 Deletion of the Candidate PLC Gene um00004 Does Not Affect Virulence or Mating

Figure 29: Deletion of the Candidate PLC Gene um00004 Does Not Affect the Virulence or Mating of U. maydis Virulence assays were performed with seven-day old maize seedlings infected with compatible mating cultures of WT or Δum00004 strains, including reciprocal WTxΔ crosses (left). Disease symptoms were scored 14 days post-infection. The disease index was calculated based on the frequency of symptoms that included plant death (dark red), large stem tumors (light red), small stem tumors (dark yellow), leaf tumors (light yellow), anthocyanin (beige) and healthy plants (green). The disease ratings and the total number of plants infected for each cross are indicated at the top. Cultures of solo haploids or compatible mating pairs were spotted onto charcoal- containing media and incubated at room temperature for 48 hours (right). Formation of a white fuzzy colony is indicative of filamentous growth and a compatible mating pair. The WT strain and the Δum00004 deletion strains are as indicated.

143