DOCSLIB.ORG

Report Vacuoliting Megalencephalic Leukoencephalopathy With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Report Vacuoliting Megalencephalic Leukoencephalopathy With View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Am. J. Hum. Genet. 66:733–739, 2000 Report Vacuoliting Megalencephalic Leukoencephalopathy with Subcortical Cysts, Mapped to Chromosome 22qtel Meral Topc¸u,1 Corine Gartioux,5 Florence Ribierre,5 Cengiz Yalc¸inkaya,6 Erem Tokus,6 Nese O¨ ztekin,2 Jacques S. Beckmann,5 Meral Ozguc,3,4 and Eric Seboun5, 7 1Department of Pediatric Neurology, Hacettepe University Hospital and Institute of Neurological Sciences, Sihhiye, 2Neurology Department of SSK Hospital, and 3Department of Medical Biology and 4Tubitak DNA/Cell Bank, Hacettepe University Faculty of Medicine, Ankara; 5 Ge´ne´thon, Evry, France; 6Istanbul University Medical Faculty, Department of Child Neurology, Istanbul; and 7Division de Ge´ne´tique et de Microbiologie, Universite´ Pierre & Marie Curie, Paris Summary a new clinical entity called “vacuoliting megalencephalic leukoencephalopathy” (VL) [MIM 604004] recently has The leukodystrophies form a complex group of orphan been recognized. This disorder is distinct from the other genetic disorders that primarily affect myelin, the main leukodystrophies (i.e., Canavan disease [MIM 271900], constituent of the brain white matter. Among the leu- Alexander disease [MIM 203450], and GM1 ganglios- kodystrophies of undetermined etiology, a new clinical idosis [MIM 230500]) that exhibit progressive mega- entity called “vacuoliting megalencephalic leukoence- lencephaly. VL is characterized by a milder clinical phalopathy” (VL) was recently recognized. VL is char- course, which contrasts with severe abnormalities on acterized by diffuse swelling of the white matter, large magnetic-resonance-imaging analysis of the brain. The subcortical cysts, and megalencephaly with infantile on- supratentorial hemispherical white matter appears dif- set. Family studies in several ethnic groups have sug- fusely swelled, with bilateral subcortical cysts of typical gested an autosomal recessive mode of inheritance. We temporal location, whereas the gray-matter structures mapped the VL gene to chromosome 22qtel, within a 3- are preserved (van der Knaap et al. 1995; Goutieres et cM linkage interval between markers D22S1161 and al. 1996; Singhal et al. 1996; Mejaski-Bosnjak et al. n66c4 (maximum LOD score 10.12 at recombination 1997; Topc¸u et al. 1998). Consanguinity between the fraction .0, for marker n66c4; maximum multipoint parents of VL-affected children, which is suggestive of LOD score 17 for this interval) by genome scan of 13 an autosomal recessive mode of inheritance, has been Turkish families. Linkage analysis under the genetic-het- observed in several ethnic groups. We report the local- erogeneity hypothesis showed no genetic heterogeneity. ization of the VL gene to chromosome 22qtel, by genome No abnormalities were found in three tested candidate scan of 10 consanguineous families and 3 families with genes (fibulin-1 and glutathione S-transferases 1 and 2). no known relationship that originated from rural areas of central and southeastern Anatolia, in Turkey. The study was approved by the review board of Hac- ettepe University, Faculty of Medicine (Ankara). In- The leukodystrophies are a heterogeneous group of or- formed consent was obtained from family members. phan genetic disorders that primarily affect the white Twenty-one patients (9 boys and 12 girls) from 13 matter of the brain and its main constituent, myelin. different families were analyzed. Consanguinity was Among the leukodystrophies of undetermined etiology, known to have occurred in 10 families. Clinical and neurobiological features of 12 patients (from families Received July 26, 1999; accepted for publication November 29, MEG1, MEG3, MEG 4, MEG 6, MEG8, and MEG10) 1999; electronically published February 1, 2000. have been reported elsewhere (Topc¸u et al. 1998). The Address for correspondence and reprints: Dr. Eric Seboun, Centre diagnostic criteria for selection of the other families were National de Ge´notypage, 2 rue Gaston Cre´mieux, CP 5721-91057 identical. All other causes of leukodystrophies have been Evry Cedex, France. E-mail: [email protected] ᭧ 2000 by The American Society of Human Genetics. All rights reserved. ruled out by an extensive biochemical analysis, including 0002-9297/2000/6602-0043$02.00 quantitation of lysosomal activities (of b-hexosamini- 733 734 Am. J. Hum. Genet. 66:733–739, 2000 dase, arylsulfatase A, b-galactosidase, and galactocere- CCGGCCAAAAATGACTTTTA and CTGGAAAGAG- brosidase b-galactoside). CAAGACCCTG, size 200–204 bp]), and n66c4 clone Because biochemical and enzymatic studies revealed [Genbank accession number AC000050] [motif: CA re- no known abnormalities, and because the high degree peat, primer set ACTCATCGCATACACTGTGTCC and of consanguinity between the parents of affected chil- CAGGGTGGATCACCAAGC, size: 266–274 bp]). The dren suggested an autosomal recessive mode of inheri- allele size was estimated by use of individual 134702 tance, we undertook a genome scan to map the VL gene. from the CEPH reference family. Two-point linkage DNA was isolated and purified from peripheral blood, analysis yielded a maximum LOD score (Zmax) of 10.12 by use of standard protocols. Genotyping was performed at a recombination fraction (v) of 0, for marker n66c4 with fluorescent end-labeled microsatellite markers from (table 1). This result is in agreement with the results of the Ge´ne´thon map (Vignal et al. 1993). Alleles were two-point linkage simulation (autosomal recessive mode separated by electrophoresis performed with ABI 373 of inheritance, full penetrance, five isofrequent marker sequencers. Genotyping data were processed with GEN- alleles, and disease-allele frequency .0001), performed OTYPER (ABI), GENSCAN (ABI), and MARKSYN with SLINK (Weeks et al. 1990), which yielded an av- (Ge´ne´thon) software. Two-point LOD-score analysis erage LOD score of 10 atv =.0 for this family set. was conducted with the FASTLINK program (Schaffer Multipoint linkage analysis performed with GENE- 1996), and multipoint LOD-score analysis was con- HUNTER (Kruglyak et al. 1996) yielded a Zmax of 17 ducted with the GENEHUNTER program (Kruglyak et (fig. 1). This result was confirmed by haplotype con- al. 1996); and an autosomal recessive mode of inheri- struction with D22S294, D22S1170, D22S1161, tance with full penetrance and true marker-allele fre- D22S922, D22S1169, ARSA/(CT)n, and n66c4/(CA)n, quencies was assumed. The disease-allele frequency was which places the VL gene within a 3-cM linkage interval set to .0001. This initial genome screening with the nine defined by D22S1161 (proximal) and n66c4 (distal) (fig. initially collected families (Topc¸u et al. 1998) genotyped 2). The map is based on the recently published sequence with 257 fluorescent end-labeled microsatellite Ge´ne´- of chromosome 22 (Dunham et al. 1999). Multipoint thon markers spaced at an average distance of 14 cM linkage analysis performed under the heterogeneity hy- (Weissenbach et al. 1992; Dib et al. 1996) failed to reveal pothesis revealed no genetic heterogeneity (data not linkage. A second genome search, with 300 additional shown). microsatellite markers (average spacing for the com- Three affected children were born from three mar- bined set of markers was 6.5 cM), was therefore per- riages that had no known consanguinity (i.e., families formed. Linkage analysis of D22S1160 and D22S1169, MEG6, MEG11, and MEG16). Haplotype analysis of two markers separated by 11 cM, yielded a multipoint family MEG11 showed an 11-cM homozygosity region, LOD score of 4. Four additional Turkish families suggesting that the parents were likely to be related. (MEG13, MEG14, MEG15, and MEG16) were col- Results showed no homozygosity for the affected child lected, and the complete set of families was genotyped in each of families MEG6 and MEG16. However, anal- with four new Ge´ne´thon markers. Multipoint linkage ysis of the extended haplotypes showed that the unaf- analysis yielded a Zmax of 15. However, although mark- fected siblings had inherited different combinations of ers showed homozygosity (Lander and Botstein 1987) recombinant haplotypes (fig. 2). Taken together, these with fully informative families, several families remained results show that VL is linked to a single locus that spans partially or totally uninformative, raising the possibility a 3-cM region located on chromosome 22qtel. Whereas of genetic heterogeneity. this rare disorder was mapped in a set of Turkish families To increase informativity of these families, new mi- originating from small villages in a rural area, a founder crosatellite markers were developed. Sequences of ge- nomic clones spanning the telomeric region that were downloaded from The Sanger Center were computer Table 1 scanned for short tandem repeats. Three microsatellite Two-Point Linkage-Analysis Data, from an Autosomal Recessive sequences were identified, two in the vicinity of the genes Model with Full Penetrance encoding fibulin (FBLN-1) and arylsulfatase A (ARSA) LOD SCORE AT v = and one in the genomic clone n66c4. New markers were MARKER .00 .1 .2 .3 .4 Z v developed, and the 13 families were genotyped. Primer max max Ϫϱ sets flanking the microsatellite motifs were developed for D22S294 1.50 1.41 .93 .41 1.55 .132 D22S1170 Ϫϱ 2.99 2.00 1.00 .32 3.10 .069 FBLN1D/(CA)n (FBLN-1 [GenBank accession number D22S1161 Ϫϱ 6.01 4.05 2.30 .92 7.04 .026 Z95331] [motif: CA repeat, primer set GACCTACTA- D22S922 5.17 4.54 3.12 1.83 .76 5.47 .017 TGTGCCAGGAAGG and GGCTGAGGCACAAGAG- D22S1169 8.57 7.03 4.67 2.61 1.04 8.76 .010 ARSA 6.34 4.48 2.83 1.52 .58 6.34 .000 TTTC, size 300–300 bp]), ARSA(CT)n (ARSA [Genbank accession number U62317] [motif: CT repeat, primer set n66c4 10.12 7.41 4.84 2.64 .97 10.12 .000 Reports 735 Figure 1 Graphic representation of multipoint LOD-score analysis of the 22qtel chromosomal region linked to the VL gene. The multipoint LOD score was computed with GENEHUNTER (Kruglyak et al. 1996) by use of a recessive mode of inheritance, complete penetrance, and true marker-allele frequencies.
Load more

Recommended publications
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Efficient Analysis of Mouse Genome Sequences Reveal Many Nonsense Variants
    Efficient analysis of mouse genome sequences reveal many nonsense variants Sophie Steelanda,b,1, Steven Timmermansa,b,1, Sara Van Ryckeghema,b, Paco Hulpiaua,b, Yvan Saeysa,c, Marc Van Montagud,e,f,2, Roosmarijn E. Vandenbrouckea,b,3, and Claude Liberta,b,2,3 aInflammation Research Center, Flanders Institute for Biotechnology (VIB), 9052 Ghent, Belgium; bDepartment of Biomedical Molecular Biology, Ghent University, 9052 Ghent, Belgium; cDepartment of Internal Medicine, Ghent University, 9052 Ghent, Belgium; dDepartment of Plant Systems Biology, VIB, 9052 Ghent, Belgium; eDepartment of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Ghent, Belgium; and fInternational Plant Biotechnology Outreach, VIB, Ghent, Belgium Contributed by Marc Van Montagu, March 30, 2016 (sent for review December 31, 2015; reviewed by Bruce Beutler, Stefano Bruscoli, Stefan Rose-John, and Klaus Schulze-Osthoff) Genetic polymorphisms in coding genes play an important role alive, archiving them, and distributing mutant strains to in- when using mouse inbred strains as research models. They have terested users (4). been shown to influence research results, explain phenotypical Since Clarence Little showed in the early 20th century that the differences between inbred strains, and increase the amount of principle of inbreeding also applies to mice, several hundred interesting gene variants present in the many available inbred inbred mouse strains have been generated (5). Some of these lines. SPRET/Ei is an inbred strain derived from Mus spretus that strains display specific phenotypes that are the result of a mutant has ∼1% sequence difference with the C57BL/6J reference ge- gene, and in several cases have formed the basis for identifying nome.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]
  • Gene Annotation
    Gene Annotation Contributions from Carlo Colantuoni and Robert Gentleman What We Are Going To Cover Cells, Genes, Transcripts –> Genomics Experiments Sequence Knowledge Behind Genomics Experiments Annotation of Genes in Genomics Experiments Biological Setup Every cell in the human body contains the entire human genome: 3.3 Gb or ~30K genes. The investigation of gene expression is meaningful because different cells, in different environments, doing different jobs express different genes. Tasks necessary for gene expression analysis: Define what a gene is. Identify genes in a sea of genomic DNA where <3% of DNA is contained in genes. Design and implement probes that will effectively assay expression of ALL (most? many?) genes simultaneously. Cross-reference these probes. 1 Cellular Biology, Gene Expression, and Microarray Analysis DNA RNA Protein Gene: Protein coding unit of genomic DNA with an mRNA intermediate. ~30K genes DNA Sequence is a Necessity Probe START protein coding STOP mRNA AAAAA 5’ UTR 3’ UTR Genomic DNA 3.3 Gb From Genomic DNA to mRNA Transcripts EXONS INTRONS Protein-coding genes are not easy to find - gene density is low, and exons are interrupted by introns. ~30K >30K Alternative splicing Alternative start & stop sites in same RNA molecule RNA editing & SNPs Transcript coverage Homology to other transcripts Hybridization dynamics 3’ bias 2 Unsurpassed as source of expressed sequence Sequence Quality! Redundancy! Completeness? Chaos?!? From Genomic DNA to mRNA Transcripts ~30K >30K >>30K Transcript-Based Gene-Centered Information 3 Design of Gene Expression Probes Content: UniGene, Incyte, Celera Expressed vs. Genomic Source: cDNA libraries, clone collections, oligos Cross-referencing of array probes (across platforms): Sequence <> GenBank <> UniGene <> HomoloGene Possible mis-referencing: Genomic GenBank Acc.#’s Referenced ID has more NT’s than probe Old DB builds DB or table errors – copying and pasting 30K rows in excel … Using RefSeq’s can help.
    [Show full text]
  • Snps in Genes Coding for ROS Metabolism and Signalling in Association with Docetaxel Clearance
    The Pharmacogenomics Journal (2010) 10, 513–523 & 2010 Macmillan Publishers Limited. All rights reserved 1470-269X/10 www.nature.com/tpj ORIGINAL ARTICLE SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance H Edvardsen1,2, PF Brunsvig3, The dose of docetaxel is currently calculated based on body surface area 1,4 5 and does not reflect the pharmacokinetic, metabolic potential or genetic H Solvang , A Tsalenko , background of the patients. The influence of genetic variation on the 6 7 A Andersen , A-C Syvanen , clearance of docetaxel was analysed in a two-stage analysis. In step one, 583 Z Yakhini5, A-L Børresen-Dale1,2, single-nucleotide polymorphisms (SNPs) in 203 genes were genotyped on H Olsen6, S Aamdal3 and samples from 24 patients with locally advanced non-small cell lung cancer. 1,2 We found that many of the genes harbour several SNPs associated with VN Kristensen clearance of docetaxel. Most notably these were four SNPs in EGF, three SNPs 1Department of Genetics, Institute of Cancer in PRDX4 and XPC, and two SNPs in GSTA4, TGFBR2, TNFAIP2, BCL2, DPYD Research, Oslo University Hospital Radiumhospitalet, and EGFR. The multiple SNPs per gene suggested the existence of common Oslo, Norway; 2Institute of Clinical Medicine, haplotypes associated with clearance. These were confirmed with detailed 3 University of Oslo, Oslo, Norway; Cancer Clinic, haplotype analysis. On the basis of analysis of variance (ANOVA), quantitative Oslo University Hospital Radiumhospitalet, Oslo, Norway; 4Institute of
    [Show full text]
  • 1 Supplementary Information ADCK2 Haploinsufficiency Reduces
    Supplementary information ADCK2 haploinsufficiency reduces mitochondrial lipid oxidation and causes myopathy associated with CoQ deficiency.. Luis Vázquez-Fonseca1,8,§, Jochen Schäfer2,§, Ignacio Navas-Enamorado1,7, Carlos Santos-Ocaña1,10, Juan D. Hernández-Camacho1,10, Ignacio Guerra1, María V. Cascajo1,10, Ana Sánchez-Cuesta1,10, Zoltan Horvath2#, Emilio Siendones1, Cristina Jou3,10, Mercedes Casado3,10, Purificación Gutiérrez1, Gloria Brea-Calvo1,10, Guillermo López-Lluch1,10, Daniel M. Fernández-Ayala1,10, Ana B. Cortés- Rodríguez1,10, Juan C. Rodríguez-Aguilera1,10, Cristiane Matté4, Antonia Ribes5,10, Sandra Y. Prieto- Soler6, Eduardo Dominguez-del-Toro6, Andrea di Francesco8, Miguel A. Aon8, Michel Bernier8, Leonardo Salviati9, Rafael Artuch3,10, Rafael de Cabo8, Sandra Jackson2 and Plácido Navas1,10 1 Supplementary Results Case report The male index patient (subject II-3, Fig. S1A) presented to our clinic at 45 years of age with a 15-year history of slowly progressive muscle weakness and myalgia, which occurred at rest but worsened with exercise. Past medical history was unremarkable except for renal disease of unknown cause in childhood, which spontaneously improved. Family history was negative for neurological disease. On examination, moderate proximal symmetrical myopathy, more pronounced in the arms, was noted and the patient was unable to lift his arms above the horizontal position. The patient had a hyperlordotic, waddling gait and was only able to walk 100 meters without the aid of crutches. Bilateral scapular winging was present, and bilateral atrophy of the biceps, triceps, and quadriceps was noted, whilst the deltoid muscles were well preserved. Calf hypertrophy was present. The Trendelenburg sign was positive, and the patient was unable to rise from squatting.
    [Show full text]
  • Copy Number Variations in Saudi Family with Intellectual Disability and Epilepsy Muhammad I
    The Author(s) BMC Genomics 2016, 17(Suppl 9):757 DOI 10.1186/s12864-016-3091-6 RESEARCH Open Access Copy number variations in Saudi family with intellectual disability and epilepsy Muhammad I. Naseer1*, Adeel G. Chaudhary1, Mahmood Rasool1, Gauthaman Kalamegam1, Fai T. Ashgan1, Mourad Assidi1, Farid Ahmed1, Shakeel A. Ansari1, Syed Kashif Zaidi1, Mohammed M. Jan2 and Mohammad H. Al-Qahtani1 From 3rd International Genomic Medicine Conference Jeddah, Saudi Arabia. 30 November - 3 December 2015 Abstract Background: Epilepsy is genetically complex but common brain disorder of the world affecting millions of people with almost of all age groups. Novel Copy number variations (CNVs) are considered as important reason for the numerous neurodevelopmental disorders along with intellectual disability and epilepsy. DNA array based studies contribute to explain a more severe clinical presentation of the disease but interoperation of many detected CNVs are still challenging. Results: In order to study novel CNVs with epilepsy related genes in Saudi family with six affected and two normal individuals with several forms of epileptic seizures, intellectual disability (ID), and minor dysmorphism, we performed the high density whole genome Agilent sure print G3 Hmn CGH 2x 400 K array-CGH chips analysis. Our results showed de novo deletions, duplications and deletion plus duplication on differential chromosomal regions in the affected individuals that were not shown in the normal fathe and normal kids by using Agilent CytoGenomics 3.0.6.6 softwear. Copy number gain were observed in the chromosome 1, 16 and 22 with LCE3C, HPR, GSTT2, GSTTP2, DDT and DDTL genes respectively whereas the deletions observed in the chromosomal regions 8p23-p21 (4303127–4337759) and the potential gene in this region is CSMD1 (OMIM: 612279).
    [Show full text]
  • The Identification of a Novel Fucosidosis-Associated
    G C A T T A C G G C A T genes Article The Identification of a Novel Fucosidosis-Associated FUCA1 Mutation: A Case of a 5-Year-Old Polish Girl with Two Additional Rare Chromosomal Aberrations and Affected DNA Methylation Patterns Agnieszka Domin 1,†, Tomasz Zabek 2,† , Aleksandra Kwiatkowska 3,† , Tomasz Szmatola 2,4,† , Anna Deregowska 5, Anna Lewinska 5 , Artur Mazur 1,* and Maciej Wnuk 5,* 1 Department of Pediatrics and Pediatric Endocrinology and Diabetes, University of Rzeszow, Aleja Rejtana 16c, 35-959 Rzeszow, Poland; [email protected] 2 National Research Institute of Animal Production, Krakowska 1, 32-083 Balice, Poland; [email protected] (T.Z.); [email protected] (T.S.) 3 Laboratory of Exercise Physiology and Biochemistry, Institute of Physical Culture Studies, College of Medical Sciences, University of Rzeszow, Aleja Rejtana 16c, 35-959 Rzeszow, Poland; [email protected] 4 University Centre of Veterinary Medicine, University of Agriculture in Krakow, Al. Mickiewicza 24/28, 30-059 Krakow, Poland 5 Department of Biotechnology, University of Rzeszow, Aleja Rejtana 16c, 35-959 Rzeszow, Poland; [email protected] (A.D.); [email protected] (A.L.) * Correspondence: [email protected] (A.M.); [email protected] (M.W.) † These authors have contributed equally as first authors. Abstract: Fucosidosis is a rare neurodegenerative autosomal recessive disorder, which manifests Citation: Domin, A.; Zabek, T.; as progressive neurological and psychomotor deterioration, growth retardation, skin and skeletal Kwiatkowska, A.; Szmatola, T.; abnormalities, intellectual disability and coarsening of facial features. It is caused by biallelic muta- Deregowska, A.; Lewinska, A.; Mazur, α A.; Wnuk, M.
    [Show full text]
  • Association of Common Copy Number Variants at the Glutathione S
    Molecular Psychiatry (2010) 15, 1023–1033 & 2010 Macmillan Publishers Limited All rights reserved 1359-4184/10 www.nature.com/mp ORIGINAL ARTICLE Association of common copy number variants at the glutathione S-transferase genes and rare novel genomic changes with schizophrenia B Rodrı´guez-Santiago1, A Brunet2,3, B Sobrino4, C Serra-Juhe´ 1, R Flores1, Ll Armengol2, E Vilella5, E Gabau3, M Guitart3, R Guillamat3, L Martorell5, J Valero5, A Gutie´rrez-Zotes5, A Labad5, A Carracedo4, X Estivill2 and LA Pe´rez-Jurado1,6 1Unitat de Gene`tica, Universitat Pompeu Fabra, and Centro de Investigacio´n Biome´dica en Red de Enfermedades Raras (CIBERER), Barcelona, Spain; 2Genes and Disease Program, Center for Genomic Regulation (CRG-UPF) and Centro de Investigacio´n Biome´dica en Red de Epidemiologı´a y Salud Pu´blica (CIBERESP), Barcelona, Spain; 3Corporacio´ Sanita`ria Parc Taulı´, Sabadell, Spain; 4Grupo de Medicina Xenomica, CEGEN-IML, and Centro de Investigacio´n Biome´dica en Red de Enfermedades Raras (CIBERER), Universidad de Santiago de Compostela, Santiago de Compostela, Spain; 5Hospital Psiquia`tric Universitari Institut Pere Mata, IISPV, Universitat Rovira i Virgili, Reus, Spain and 6Programa de Medicina Molecular i Gene`tica, Hospital Vall d’Hebron, Barcelona, Spain Copy number variants (CNVs) are a substantial source of human genetic diversity, influencing the variable susceptibility to multifactorial disorders. Schizophrenia is a complex illness thought to be caused by a number of genetic and environmental effects, few of which have been clearly defined. Recent reports have found several low prevalent CNVs associated with the disease. We have used a multiplex ligation-dependent probe amplification-based (MLPA) method to target 140 previously reported and putatively relevant gene-containing CNV regions in 654 schizophrenic patients and 604 controls for association studies.
    [Show full text]
  • Comparative Genomic Evidence for the Involvement of Schizophrenia
    Comparative genomic evidence for the involvement of schizophrenia risk genes in antipsychotic effects 1,2,8 1,2,8 1,2,3,4,8 5 1,2 1,2 1,2 1,2 Y Kim , P Giusti-Rodriguez , JJ Crowley , J Bryois , RJ Nonneman , AK Ryan , CR Quackenbush , MD Iglesias-Ussel , 6 2,7 2 1,2,3,5 PH Lee , W Sun , FP-M de Villena and PF Sullivan Genome-wide association studies (GWAS) for schizophrenia have identified over 100 loci encoding 4500 genes. It is unclear whether any of these genes, other than dopamine receptor D2, are immediately relevant to antipsychotic effects or represent novel antipsychotic targets. We applied an in vivo molecular approach to this question by performing RNA sequencing of brain tissue from mice chronically treated with the antipsychotic haloperidol or vehicle. We observed significant enrichments of haloperidol- regulated genes in schizophrenia GWAS loci and in schizophrenia-associated biological pathways. Our findings provide empirical support for overlap between genetic variation underlying the pathophysiology of schizophrenia and the molecular effects of a prototypical antipsychotic. Molecular Psychiatry (2018) 23, 708–712; doi:10.1038/mp.2017.111; published online 30 May 2017 INTRODUCTION MATERIALS AND METHODS A major goal of human genome-wide association studies (GWAS) The goal of this study was to evaluate the effects of chronic administration is to identify potential therapeutic targets for common, complex of the antipsychotic haloperidol versus vehicle in mice. We have shown that we can reliably administer human-like steady-state concentrations of diseases. While genomic regions that reach genome-wide – fi haloperidol.10 12 All experimental procedures were randomized to mini- signi cance explain only a small fraction of disease risk, many 13 nonetheless encode proteins that make effective drug targets.1 mize batch artifacts (for example, assignment to haloperidol or vehicle, cage, order of dissection, RNA extraction and assay batch).
    [Show full text]
  • Glutathione S-Transferase Copy Number Variation Alters Lung Gene Expression
    ERJ Express. Published on February 24, 2011 as doi: 10.1183/09031936.00029210 Glutathione S-transferase Copy Number Variation Alters Lung Gene Expression Marcus W. Butler1,2, Neil R Hackett1, Jacqueline Salit1, Yael Strulovici-Barel1, Larsson Omberg3, Jason Mezey1,3, and Ronald G. Crystal1,2 1Department of Genetic Medicine, 2Division of Pulmonary and Critical Care Medicine Weill Cornell Medical College New York, New York and 3Department of Biological Statistics and Computational Biology Cornell University Ithaca, New York Running head: Copy number and lung GST expression Correspondence: Department of Genetic Medicine Weill Cornell Medical College 1300 York Avenue, Box 96 New York, New York 10065 Phone: (646) 962-4363 Fax: (646) 962-0220 E-mail: [email protected] Copyright 2011 by the European Respiratory Society. Summary Background: The glutathione S-transferase (GST) enzymes catalyze the conjugation of xenobiotics to glutathione. Based on reports that inherited copy number variations (CNV) modulate some GST gene expression levels, and that the small airway epithelium (SAE) and alveolar macrophages (AM) are involved early in the pathogenesis of smoking-induced lung disease, we asked: do germline CNVs modulate GST expression levels in SAE and AM? Methods: Microarrays were used to survey GST gene expression in SAE and AM obtained by bronchoscopy from current smokers and nonsmokers, and to determine CNV genotypes. Results: Twenty six % of subjects were null for both GSTM1 alleles, with reduced GSTM1 mRNA levels seen in both SAE and AM . Thirty % of subjects had homozygous deletions of GSTT1 with reduced mRNA levels in both tissues. Interestingly, GSTT2B, exhibited homozygous deletion in blood in 27% of subjects and was not expressed in SAE in the remainder of subjects but was expressed in AM of heterozygotes and wild type subjects, proportionate to genotype.
    [Show full text]