Gou et al. J Transl Med (2020) 18:284 https://doi.org/10.1186/s12967-020-02406-9 Journal of Translational Medicine
RESEARCH Open Access microRNA‑128 mediates CB1 expression and regulates NF‑KB/p‑JNK axis to infuence the occurrence of diabetic bladder disease Xin Gou1†, Jing Wu2†, Mingqing Huang3, Yuting Weng1, Tongxin Yang1, Tao Chen1, Guiqing Li1 and Kewei Fang1*
Abstract Background: Diabetic bladder disease is common complications of diabetes, its symptoms are diverse, can be due to diferent stages. In this study we investigate the mechanism of miR-128 targeting CB1 expression to mediate the occurrence of diabetic bladder disease. Methods: Bioinformatics analysis predicts related regulatory factors of miR-128 in diabetic bladder disease. Models of diabetic bladder lesions were constructed in male SD rats by intraperitoneal injection of streptozotocin at 65 mg/kg body weight. The expression of miR-128 and CB1 mRNA in bladder tissues of each group was detected by RT-qPCR, and CB1, NF-KB, p-JNK and Bcl2 protein expression was detected by Western Blotting. We tested the function of the bladder by urodynamics, detected the pathological characteristics of the ARTICLEbladder tissue by HE staining, and verifed the targeting relationship between miR-128 and CB1 through the prediction of the biological website, dual luciferase reporter gene assay and RIP. Results: miR-128 was highly expressed in the bladder tissue of diabetic rats. Inhibition of miR-128 could improve the occurrence of diabetic bladder lesions in rats. miR-128 could target the inhibition of CB1 expression, and high expres- sion of CB1 could antagonize miR-128 against diabetic bladder. In the diabetic bladder, miR-128 can regulate the expression of NF-KB and p-JNK through CB1 and afect the level of apoptosis. miR-128 regulates NF-KB/p-JNK through CB1, thus afecting the occurrence of diabetic bladder disease. Conclusion: The high expression of miR-128 can down-regulate the expression of CB1, promote the activation of NF-KB and p-JNK, increase the level of apoptosis and promote the occurrence of diabetic bladder disease. Keywords: microRNA-128, CB1, Diabetes, Bladder disease, NF-KB, P-JNK, Apoptosis
Background of bladder flling and weakened contractility changes in Diabetic bladder disease is common complications of urination characteristics, and may be complicated by uri- diabetes, its symptoms are diverse, can be due to difer- nary tract infection and bladder urination Tube refux, ent stages, but mainly manifested by impaired feeling hydronephrosis, kidney stones, and eventually uremia [1]. Te number of people with diabetes has continued to increase in recent years [2]. Diabetic cystitis (DCP) is a *Correspondence: [email protected] systemic disease associated with diabetes in the urinary †Xin Gou, and Jing Wu are co-frst authors system of humans and animals, accounting for more than 1 Department of Urology, The Second Afliated Hospital of Kunming Medical University, No. 374, Dianmian Dadao, Kunming, Yunnan 650101, 80% of people with diabetes [3]. Te pathogenesis of DCP People’sRETRACTED Republic of China is still unclear, it is a complex and has many incentives, Full list of author information is available at the end of the article and the course of the disease is closely related to time.
© The Author(s) 2020. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativeco mmons.org/licen ses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publi cdomain/ zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Gou et al. J Transl Med (2020) 18:284 Page 2 of 14
Myogenic, currently considered neurogenic and ure- regulatory genes. Te co-expression relationship of thral epithelial changes are the main causes of DCP [4, downstream genes was obtained through Chipbase v2.0 5]. Many studies have tried to elucidate the mechanism website (http://rna.sysu.edu.cn/chipbase/). of DCP, but it is still unclear. Terefore, the treatment of DCP is greatly restricted [6]. Establishment of Diabetic Mellitus (DM) rat model miRNAs are a group of highly conserved small RNA A total of 100 SPF male SD rats (purchased from the molecules that can regulate gene expression functions Experimental Animal Center of China Medical Univer- More and more studies show that miRNAs play an sity), weighing 180–250 g, were randomly divided into 3 important role in many physiological processes [7, 8]. groups after fasting for 12 h: normal control group (NC Mutations or disorders of miRNAs are related to a variety group, n = 16); Polyuria control group (PU group, n = 16), of human tumors. Over control protein coding to play a hypertonic polyuria induced with 5% sucrose water as role in promoting or suppressing cancer [9]. Studies have drinking water; diabetes group (DM group, n = 68), sin- shown that miR-128 expression in tumors of the nervous gle intraperitoneal injection of streptozotocin (STZ; system, breast and prostate cancer, tumor expression is dissolved at pH = 4.2 in 0.1 mol/L framic acid bufer; down-regulated [10], and through its target genes such as Sigma, St. Louis, MO) at 65 mg/kg body weight. Te the oncogene Bmi-1 [11], EGFR [12], p70S6K1 [13], E2F3 rats in the NC group and the PU group were intraperi- [14], miR-128 play a role in suppressing cancer. However, toneally injected with the same dose of normal saline. At level of miR-128a and its downstream regulated signals in 4 weeks after STZ injection, the blood glucose level was diabetes have not been reported. confrmed to be above 300 mg/dl, and the rats with urine Recent years more reports were focused on the role glucose test strip ++++ were diabetic rats. All rats were of miR-144, also like miR-128 carcinogenesis because free to eat and drink. At 6 and 12 weeks, 8 rats were ran- it is dysregulated and involved in the tumorigenesis of domly selected from each group, placed in a metabolic various cancer, such as lung cancer [15], osteosarcoma cage, and urine of rats was collected and weighed for [16], hepatocellular carcinoma [17], thyroid cancer [18], 24 h, and thenARTICLE performed with urodynamic experiments. bladder cancer [19] and colorectal carcinoma [20]. How- Tis experimental procedure and animal use protocol ever, the biological functions and underlying molecular have been approved by the Animal Ethics Committee mechanism of miR-144 in DCP are not yet described. of the Second Afliated Hospital of Kunming Medical Terefore, we investigate the biological role and poten- University. tial mechanism of miR-144 in DCP by several experi- ments in vitro and tumor growth of xenograft in vivo and Grouping and processing of experimental animals in vitro. Te rats in the NC group, the PU group, and the suc- cessfully modeled DM group were anaesthetized with Methods 200 g/L urethane (injection dose 1.5 g/kg) after 6 h of Bioinformatics analysis fasting. Ureter is inserted through the urethra to empty Trough bioinformatics website microT (http:// the urine after anesthesia. Te rats in the NC group and diana.imis.athena-innovation.gr/DianaTools/index the PU group were perfused with 0.2 ml of PBS solution .php?r=microT_CDS/), TargetScan (http://www.targe through the ureter. Tere were 56 of DM group success- tscan.org/vert_72/), miRWalk (http://mirwalk.umm.uni- fully modeled rats, and the modeling success rate was heidelberg.de/) and RNAInter (http://www.rna-socie 93.33%. Te modeled rats were divided into the following ty.org/rnainter/), the downstream target genes of miR- groups, 8 in each group: mimic NC group (urinary cath- 128 in rats were jointly predicted using diferent bind- eter perfusion with 0.2 mL mimic NC), miR-128 mimic ing site matching algorithms. We used the jvenn tool group (urinary catheter perfusion with 0.2 mL miR-128 (http://jvenn.toulouse.inra.fr/app/example.html) to take mimic), inhibitor NC group (urinary catheter perfusion the intersection of four predicted results for target gene with 0.2 mL inhibitor NC), miR-128 inhibitor group (uri- screening. Te interaction between genes was analyzed nary catheter perfusion with0.2 mL miR-128 inhibitor), through the STRING website (https://string-db.org/), mimic NC + oe-NC group (urinary catheter perfusion and theRETRACTED results of the interaction analysis were visual- with mimic NC and oe-NC lentivirus 0.2 mL), miR-128 ized using Cytoscape 3.5.1. In order to further predict the mimic + oe-NC group (urinary catheter perfusion with downstream regulatory factors of genes, we set the key- miR-128 mimic and oe-NC lentivirus 0.2 mL), and miR- word “diabetic bladder disease” through the GeneCards 128 mimic + oe-CB1 group (urinary catheter perfusion database (https://www.genecards.org/) to fnd related with miR-128 mimic and oe-CB1 0.2 mL each). miR-128 genes, and used the STRING website to analyze the gene mimic/inhibitor, oe-CB1 and nonsense NCs were pur- interactions. Te relationship predicted downstream chased from Shanghai GenePharma Co., Ltd. (Shanghai, Gou et al. J Transl Med (2020) 18:284 Page 3 of 14
China) packaged with lentivirus, and the virus injection Sections were routinely dewaxed (3 times with xylene, 7 volume was 2 × 10 TU (Shanghai Gima Pharmaceutical 5 min/time) and hydrated (3 times with 100% alcohol, Technology Co., Ltd.). Te ureter was ligated after per- 90%, 80%, 70% alcohol once, 5 min/time), rinsed under fusion, and the bladder perfusate was retained for 2 h. running water. After 10 min of nucleus staining by hema- At 12 weeks after STZ injection, rats in each group were toxylin, the excess hematoxylin stain was washed away examined for urodynamics. All rats had free access to with tap water. And then the sections were separated by water and were fed on a standard diet. Tis experimental 1% hydrochloric acid alcohol for 5 s, returned to blue by procedure and animal use protocol have been approved 1% ammonia for 5 s, and then the sections were washed by the Animal Ethics Committee. with running water for 5 min. After Eosin staining for 3 min, the sections were treated with 80% ethanol and Urodynamic examination 90% ethanol for 5 s each, 100% ethanol 3 times for 5 min Urotan (1200 mg/kg body weight) was used for uro- each, xylene transparent treatment 3 times for 5 min dynamic examination under subcutaneous anesthesia. each, neutral gum seals, and then placed in a fume hood Te midline incision was taken to expose the bladder, at room temperature and observed by Microscopy. and a 27-gauge trocar was used to puncture the cath- eter through the top of the bladder. Te intravesical RT‑qPCR catheter was connected to a baroreceptor (-Nihon Koh- About 30 mg of bladder tissue was excised, and total den, Japan) and a microperfusion pump (-JMS, Japan) RNA was extracted by Trizol (15596026, Invitrogen, Car, through a three-way valve. Te bilateral ureters were sev- Cal, USA) method. RNA was reverse transcribed into ered near the entrance to the bladder and the distal ends cDNA according to the instructions of the PrimeScript were ligated. Use up your bladder. After 30 min of sta- RT reagent Kit (TaKaRa Bio, Japan) reverse transcription bilization, 37 °C physiological saline was infused into the kit. Primers were designed and synthesized by Shang- bladder at a rate of 0.08 ml/min, and a complete bladder hai Sangon Biotech (Table 1). Te reaction solution was manometry was performed. Record the bladder volume taken for real-timeARTICLE quantitative PCR operation. Te reac- (the volume of physiological saline perfused until urina- tion system was 20 μl: 10 μl SYBR Premix, 2 μl of cDNA tion), the volume of single urination (the volume of phys- template, 0.6 μl each of upstream and downstream prim- iological saline discharged through the urethral orifce), ers, and 6.8 μl of DEPC water. RT-qPCR experiments the maximum pressure in the bladder (the peak pressure were performed using a 7500-type fuorescent quantita- in the bladder during urination), bladder compliance tive PCR from American Applied Biosystems company. ∆∆Ct and disability urine volume (the amount of remaining 2− represented the doubling relationship of the tar- normal saline aspirated through an intravesical catheter get gene expression between the experimental group and the control group, the formula was as follows: ∆Ct CT after urination). Calculate urination rate = urination vol- = (target gene)-CT (internal reference), ∆∆Ct ∆Ct exper- ume × 100%/bladder volume. Te above indicators are = the average of 3 experiments. imental group-∆Ct control group. Ct is the number of difusion cycles that the real-time fuorescence inten- Bladder specimen processing and HE staining sity of the reaction reaches when the threshold is set. At After urodynamic examination, rats were euthanized by this time, the difusion increases in a logarithmic phase. 3% pentobarbital sodium (P3761, Sigma, USA) anesthe- Te expression of miR-128 and CB1 in the cells was sia, the bladder was removed, the surrounding fat and calculated. connective tissue were removed, used paper to dry the Western blotting bladder, and the bladder, was weighed. Te complete bladder specimen was cut into the longitudinal muscle About 100 mg of bladder tissue were lysed by RIPA lysate bundle of the bladder sidewall in Krebs bufer. Te mus- with a fnal concentration of 1 mM phenylmethylsulfonyl cle bundle specimens were sectioned about 1 mm into fuoride (PMSF). Protein quantifcation was performed 4% paraformaldehyde overnight, washed 3 times in PBS, using the Bio-Rad DC Protein Assay Kit (Guangzhou shaked vigorously to wash the residual paraformalde- hyde,RETRACTED and soaked in 70% alcohol solution overnight. After Table 1 Primer sequences used for RT-qPCR soaked in 80% and 90% alcohol solution for 1 h, sections were immerse 3 times in 100% alcohol for 1 h each time; Targets Forward primer (5′–3′) Reverse primer (5′–3′) xylene transparent 2 times for 8 min each time; immerse miR-128 CAGATCGTCACAGTGAACC \ the wax in the oven at 65 °C (pre-melted) for 3 h, CB1 CGTCTGAGGATGGGAAGGTA TCTTGACCGTGCTCTTGATG embed in parafn, and use Leica LM2300 Type parafn GADPH CTTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGAG microtome, cut into 5 μm thick cross sections. Gou et al. J Transl Med (2020) 18:284 Page 4 of 14
Yuwei Biotechnology Instrument Co., Ltd., Guangzhou, was washed and resuspended in 900 μL RIP Wash Bufer, China). Each sample was added SDS loading bufer. And and 100 μL of cell extract was added and incubated boiling in water for 10 min, the sample was load on a 10% overnight at 4 °C. Te sample was placed on a magnetic SDS–polyacrylamide gel and run at 120 V, 30 min, and holder to collect the magnetic bead-protein complex. 100 V for 90 min. Te protein was transferred from the Samples and Input were digested with proteinase K to gel to a PVDF membrane. Te membrane was immersed extract RNA for subsequent PCR detection. Ago2 was in 1 × TBST containing 5% skimmed milk powder and mixed at room temperature for 30 min, and IgG was used gently shaken at room temperature for 2 h to block as a negative control. non-specifc binding sites. PVDF membrane was wash Statistical analysis 1 × TBST 3 times, 5 min/time. Add primary antibodies (anti-CB1, rabbit, 1: 250; Anti-NF-kB p65, rabbit, 1: 1000; SPSS 21.0 (IBM Corp., Armonk, NY, USA) was used anti-p-JNK, rabbit, 1: 1000; Abcam), incubated at 4 °C for statistical analysis. Te measurement data were overnight, washed 3 times with 1 × TBST, 5 min/time, expressed by mean ± standard deviation, and the two and then added with secondary antibody IgG (Afnity sets of data were compared using an unpaired design Biosciences Bio, S0001, goat anti-rabbit, 1: 20000) respec- with normal distribution and uniform variance, and an tively and incubated 3 times with 1 × TBST at room tem- unpaired t test was used. Data comparison among mul- perature for 1 h. Development was performed with ECL. tiple groups was performed using one-way analysis of Te gray value of Western blotting experimental protein variance (ANOVA) and Tukey’s post hoc test. Data com- expression was determined by Image J software, and the parison between groups at diferent time points was per- experiment was repeated three times. formed using repeated measures ANOVA and post hoc testing was performed using Bonferroni. Te relationship Dual luciferase report detection between the two indicators was analyzed using Pearson Te biological prediction website was used to ana- correlation. Te diference was statistically signifcant at lyze the binding site of miR-128 and CB1, and obtain P < 0.05. ARTICLE the fragment sequence containing the action site. Te 3′UTR region of CB1 was cloned and amplifed into Results pmirGLO (E1330, Promega Corporation, USA), Lucif- miR‑128 is highly expressed in bladder tissues of DM erase vector named pWt-CB1. pMut-CB1 vector was modeled rats constructed, pRL-TK vector (E2241, Promega Corpora- At 6 W and 12 W after STZ injection, 8 rats were ran- tion, USA) expressing Renilla luciferase was constructed, domly selected from each group for physiological charac- and mimic NC and miR-128 mimic, sh-NC and sh-CB1 teristics observation. Compared with the NC group, the were co-transfected with reporter vector (CRL-1415, average blood glucose level of the rats in the DM group ATCC, USA) into bladder epithelial cells SV-HUC-1. was signifcantly increased (P < 0.05), while the blood Dual Luciferase Reporter Gene Assay Kit (GM-040502A, glucose level of the rats in the PU group was not signif- Qcbio Science&Technologies Co., Ltd., China) was used cantly changed (Fig. 1a), and that of the rats in the DM to measure the fuorescence intensity at 560 nm (Fire- group was signifcantly higher than that of the PU group fy RLU) and 465 nm (Renal RLU), and the ratio of fre- (P < 0.05). Compared with the initial weight of the rats, fy RLU/renal RLU was used to determine the binding the body weight of rats in the DM group was signifcantly intensity. lower than that of the NC group and the PU group dur- ing the same period (P < 0.05), while there was no signif- RIP cant diference in rat weight (Fig. 1b). Urine was collected In the experiment, the binding of miR-128, CB1 and through a metabolic cage. Te results showed that com- Ago2 protein was detected according to the Magna RIP pared with the NC group, the daily urine output of the RNA-Binding Protein Immunoprecipitation Kit (Merck rats in the PU group and the DM group was signifcantly Millipore, USA). Lyse the cells with RIPA lysate for 5 min increased (P < 0.05), and there was no signifcant difer- in an ice bath, and centrifugated at 4 °C for 10 min to ence between the PU group and the DM group (Fig. 1c) removeRETRACTED the supernatant. Part of the cell extract was taken At the same time, there was no signifcant diference in as input, and part was incubated with antibodies for co- the 24-h mean urine volume between 6 W and 12 W precipitation. Te specifc steps were as follows: each after STZ injection. After urodynamic examination, the co-precipitation reaction system was washed with 50 μL bladder of each group was removed and weighed. As a magnetic beads, resuspended in 100 μL RIP Wash Bufer, result, compared with the NC group, the average weight and 5 µg of antibody was added according to the experi- of the bladder of rats in the PU group and the DM group mental grouping. Te magnetic bead-antibody complex increased signifcantly (P < 0.05). Tere was no diference Gou et al. J Transl Med (2020) 18:284 Page 5 of 14
a NC b NC c NC d NC PU PU PU PU DM DM DM DM 400 400 100 400 *# * ** *# * g) l) 80
g) 300 300 300 (m * * (m t( (mg/dl)
* ht
gh *# *# 60 * se 200 200
200 weig co olu me wei
lu 40 rv
Body 100 100 100 Ur in 20 Bladder Bloo dg
0 0 0 0 6 w12 w 0 w 6 w 12 w 6 w 12 w 6 w 12 w NC e NC f NC g NC h PU PU PU PU
3 ) 0.5 3 100 DM DM DM *# ml ) DM *# ml e( e( g) 0.4 * 80 # t( # * %) * 2 * um 2 ol 0.3 60 eigh at e(
* ev * #
* in * rw * gr
ur 0.2 40 1 *
icturition volum 1 * Vo idin
Bladde 0.1 em 20 Residual
0 0.0 Singl 0 0 6 w 12 w 6 w 12 w 6 w12 w 6 w 12 w i j k
) NC NC 2O PU DM 8 PU
mH ARTICLE 50 5 DM (o R-12 # 40 * mi 4 *
* of ladder b
30 on 3 # in * 20 2 expressi ressu re 10 100 μm 100 μm 100 μm 1
mp NC PU DM
mu 0 0 Relative xi 6 w 12 w 6 w 12 w Ma Fig. 1 Identifcation of a diabetic bladder disease model in rats. a Statistical chart of blood glucose levels in rats; b Statistical chart of body weight of rats; c Statistical chart of 24 h urine output in rats; d Statistical chart of rat bladder weight; e Statistical chart of rat bladder capacity; f Statistical chart of average residual urine volume in rats; g Statistical chart of single urine output in rats; h Statistical chart of average urine output in rats; i Statistical chart of maximum pressure in the rat bladder; j HE staining of bladder tissue sections ( 100); k RT-qPCR was used to detect the relative × expression level of miR-128 in bladder tissue. * indicates that compared with the NC group, P < 0.05, # indicates that compared with the PU group, P < 0.05. The above results are all measurement data, expressed as mean standard deviation. One-way ANOVA is used for comparison of data ± between multiple groups. Tukey’s post hoc test is performed, n 8 = between the PU group and the DM group, so was those was signifcantly increased (P < 0.05), and it was further at 6 W and 12 W after STZ injection (Fig. 1d). signifcantly increased at 12 W (P < 0.05) (Fig. 1f). At 6 W Te results of urodynamic testing under anesthesia and 12 W, diabetes was induced by STZ (Fig. 1g), the showed that when STZ induced DM at 6 W and 12 W single-time urine output of the rats in the PU group was (Fig. RETRACTED1e), compared with the NC group, the bladder more than that in the NC group (P < 0.05), and there was volume of the rats in the PU group and the DM group no signifcant diference compared with the single-time increased signifcantly (P < 0.05) with the higher in the urine output of the DM group. Te single-time urination DM group (P < 0.05). In contrast to the NC group, the volume at 6 W was signifcantly increased compared with average residual urine of the PU group and the DM group the NC group (P < 0.05), and the diference was not sig- rats was signifcantly increased (P < 0.05). Compared with nifcant at 12 W. Te average urination rate results were the PU group, the residual urine volume of the DM group shown in Fig. 1h. At 6 W, the average urination rate of Gou et al. J Transl Med (2020) 18:284 Page 6 of 14
rats in the DM and PU groups was not signifcantly dif- miR-128 inhibitor group was increased, and that in miR- ferent from that of the NC group. At 12 W, the average 128 mimic group was decreased compared with that of urination rate of the DM group was signifcantly lower the mimic NC group (P < 0.05) (Fig. 2b). than that of the NC group (P < 0.05). No signifcant dif- Urine was collected through a metabolic cage (Fig. 2c). ference was observed in the rate of urinary in the PU and Compared with the mimic NC group and inhibitor NC NC group. At the same time, at 6 W and 12 W, compared group, the daily urine output of rats in the miR-128 inhib- with the NC group, the maximum bladder pressure in itor group was signifcantly reduced, while increased in the DM group was signifcantly lower than that in the PU the miR-128 mimic group (P < 0.05). Te bladder function group, but no signifcant diference was observed in the of the mice in each group was subsequently examined PU group (Fig. 1i). by urodynamics, and the results showed that compared Te HE staining results showed that in rats of the with the mimic NC group, t in the miR-128 mimic group, NC group and the PU group, the muscle bundles of the bladder volume (Fig. 2d), average residual urine volume detrusor transverse and longitudinal cuts were neatly (Fig. 2e), and single urination volume (Fig. 2f) all sig- arranged, the muscle bundles were tightly structured, the nifcantly increased (P < 0.05), but mean urination rate gap was flled with connective tissue, the nerve bundles (Fig. 2g) and maximum bladder pressure (Fig. 2h) were were more common, and the smooth muscle cells were decreased in the 12th week of STZ injection (P < 0.05), arranged neatly with tight intercellular structure. In the while it was opposite in miR-128 inhibitor group in com- DM group, the detrusor muscle bundles was disordered, parison to the inhibitor NC group (P < 0.05). the structure was loose, the muscle bundles was bro- After urodynamic examination, the bladder weight of ken, the gap between muscle bundles was signifcantly each group of rats was excised and it was found (Fig. 2i) widened, edema, lymphocyte infltration, collagen fb- that compared with the mimic NC group and inhibi- ers between muscle bundles were reduced, small blood tor NC group, the bladder weight of rats in the miR-128 vessels were congested, nerve Te bundles were visible, inhibitor group was signifcantly reduced (P < 0.05), and muscle cells atrophied (Fig. 1j). that in ratsARTICLE in the miR-128 mimic group signifcantly In addition, RT-qPCR was used to detect the expres- increased (P < 0.05). Te results of HE staining showed sion of miR-128 in bladder tissues of rats in each group. that compared with the mimic NC or inhibitor NC Te results showed that, under the same treatment time, group, in the miR-128 mimic group, submucosal eosin- miR-128 mRNA expression in bladder tissues of rats in ophil infltration was visible in the bladder wall, Severe the PU group and NC exhibited no signifcant difer- mucous-like mucosa became smaller, swells, detrusor ence, while the expression of miR-128 in bladder tissue muscle cell morphology, size and disorder were arranged, of rats in the DM group was signifcantly higher than smooth muscle tissue showed a large amount of collagen that of the NC group (P < 0.05), and was signifcantly reduction and fber dialogue, and interstitial fbrous tis- higher at 12 W than at 6 W (P < 0.05) (Fig. 1k). Te above sue hyperplasia. In the miR-128 inhibitor group, detrusor results indicate that a rat diabetic bladder lesion model muscle cells were arranged in an orderly manner, no sig- and a corresponding control model have been success- nifcant degeneration of the myometrium was observed, fully constructed, and that miR-128 is highly expressed in and swelling was reduced (Fig. 2j). Te above results the bladder tissue of a diabetic bladder lesion model rat, indicate that overexpression of miR-128 can promote the which may play a role in the occurrence of the lesion. occurrence of diabetic bladder disease in rats.
Inhibition of miR‑128 can improve the occurrence miR‑128 targets CB1 expression of diabetic bladder disease in rats In order to study the targeting relationship of miR-128 In order to study the efect of miR-128 expression on in bladder epithelial cells, frst, we jointly predicted the bladder lesions in DM rats, we selected a rat model downstream target genes of miR-128 through the bio- injected with lentivirus. First, from the results of blood information website microT, TargetScan, miRWalk and glucose and weight measurement, it was found that com- RNAInter, and took the intersection of the four pre- pared with the mimic NC group and the inhibitor NC dicted results to obtain 51 candidate genes (Fig. 3a). Te group,RETRACTED the average blood glucose level of rats in the miR- STRING website was used to analyze the interactions 128 mimic group was increased (P < 0.05), while that of between 51 candidate genes and the results was visual- rats in the 128 inhibitor group was reduced. Tere was ized using Cytoscape 3.5.1. We found that ITPKC and no signifcant change in blood glucose levels between the CNR1 (CB1) were at the core of the interaction network mimic NC group and the inhibitor NC group (Fig. 2a). diagram (Fig. 3b). Trough the analysis of TargetScan Compared with the weight of rats in the mimic NC website, we found that miR-128 can target CB1 and pre- group and inhibitor NC group, the weight of rats in the dicted the binding site (Fig. 3c). Ten, the prediction Gou et al. J Transl Med (2020) 18:284 Page 7 of 14
a mimic-NC b mimic-NC c mimic-NC d mimic-NC miR-128 mimc miR-128 mimc miR-128 mimc miR-128 mimc inhibitor-NC inhibitor-NC inhibitor-NC inhibitor-NC miR-128 inhibitor miR-128 inhibitor miR-128 inhibitor miR-128 inhibitor 500 300 150 3 * #
* # ) ) ml 400 ) ml
(g * e(
(mg/d l) 100 2 200 * e( 300 se * # olum olum co weight rv lu # 200 rv 50 1 100 in dg # Body Ur ladde
100 B Bloo
0 0 0 0 0 w 12 w
e mimic-NC f mimic-NC g mimic-NC h mimic-NC miR-128 mimc miR-128 mimc miR-128 mimc miR-128 mimc
inhibitor-NC inhibitor-NC inhibitor-NC O) inhibitor-NC miR-128 inhibitor miR-128 inhibitor miR-128 inhibitor miR-128 inhibitor 3 H2 ) 0.5 * 150 60 (ml) * om # ml r(
e( 0.4 %) 2 100 # 40 e( olum 0.3 bladde at in ev # * gr in * in
ur 0.2 id # icturition volu me 1 50 20 Vo ressu re
0.1 em mp Residual
Singl 0
0.0 0 mu 0 xi
mimic-NC Ma ijmiR-128 mimc inhibitor-NC 500 miR-128 inhibitor *
g) 400 t( 300 eigh ARTICLE # rw 200
Bladde 100 100 μm 100 μm 100 μm 100 μm mimic-NC miR-128 mimc inhibitor-NC miR-128 inhibitor 0 Fig. 2 Inhibition of miR-128 improves the occurrence of diabetic bladder lesions in rats. a Statistical chart of blood glucose levels in rats; b Statistical chart of body weight of rats; c Statistical chart of 24 h urine output in rats; d Statistical chart of rat bladder capacity; e Statistical chart of average residual urine output in rats; f Statistical chart of single urine output of rats; g Statistical chart of average micturition rate of rats; h Statistical chart of maximum pressure in the bladder of rats; i Statistical chart of rat bladder weight). J Rat bladder tissue were observed by HE staining ( × 100). * Indicates that compared with the mimic NC group P < 0.05, # indicates that compared with the inhibitor NC group P < 0.05. The above results are measured data, expressed as mean standard deviation. One-way ANOVA is used to compare data between multiple groups. Tukey’s post hoc ± inspection, n 8 = result of dual luciferase reporter gene assay (Fig. 3d) DM rats (Fig. 3g). Subsequently, by interfering with the showed that compared with the mimic NC group, the expression of miR-128, we used RT-qPCR and Western luciferase activity of CB1 Wt 3′UTR was inhibited by blotting to detect the mRNA and protein expression of miR-128 (P < 0.05), while CB1 Mut 3′UTR exhibited no CB1 in the bladder tissues of rats in each group (Fig. 3h– change (P < 0.05). Te results of RIP experiments showed j). Compared with the mimic NC group, the mRNA and that compared with IgG, both miR-128 and CB1 bound protein expression levels of CB1 in the miR-128 mimic by Ago2 were signifcantly increased, indicating that group were signifcantly reduced (P < 0.05). Compared miR-128 can specifcally bind CB1′s 3′UTR region and to the inhibitor NC group, the mRNA and protein levels down-regulates CB1 gene expression at post-transcrip- of CB1 in the miR-128 inhibitor group were signifcantly tional levels (Fig. 3e). increased (P < 0.05). In diabetic bladder disease tissues, Ten,RETRACTED we used RT-qPCR to detect the expression of miR-128 can target down-regulation of CB1 expression. CB1 in the bladder tissues of each group of rats, and the results (Fig. 3f) showed that compared with the NC miR‑128 targets CB1 to regulate the occurrence of diabetic group and the PU group, CB1 was poorly expressed in bladder disease the bladder tissues of rats of the DM group. Moreover, To study the role of CB1 expression in the development correlation analysis showed that miR-128 was negatively of diabetic bladder disease, we divided the DM rats correlated with CB1 expression in bladder tissues of into the following three groups for injection treatment: Gou et al. J Transl Med (2020) 18:284 Page 8 of 14
abPlagl2 Xirp2
Bcorl1 Phf20
Galnt7 TargetScan miRWalk Samd10
Ulk1 Nln Stim2 Pkia
Klf3 Galnt3 521 4581 Ppif Fads1 microT RNAInter
127 Foxo4 Stk39 Arhgap12 Mme Itpkc 69 232 Csf1
Fbxo33 Spry2 Npr1 Rngtt 27 32 Btg2 Reln Hip1 Rnd3 147 522 Vcan Dcx Rai14 51 Ptpn4
Cnr1 Nxt2 Ptpn5 78 49
70 74 Kcnk2 Aplnr Nav2 Kcna4
Smpd3 95 Pitpnm2
Cct3
Sgms1 Gltp
Hnrnpf
anti-IgG c d mimic-NC e anti-Ago2 f NC PU 1.5 miR-128 mimic 25 Input 1.5 1 DM t CB
en 20 of activity * 1.0 1.0 15 miR-128-3p3’ UUUCUCUGGCCAAGUGACACU rase * fe enrichm CNR1 5’ AGUGUAUACUGUUAUCACUGUGG
luci 10 0.5 expression 0.5 * * # ve elative
R 5 lative Re 0.0 0 Relati 0.0 CB1-WT CB1-Mut miR-128CB1 NC PU DM g h i ARTICLEj n 4 mimic-NC 2.0 mimic-NC r = -0.782 1 miR-128 mimc miR-128 mimc p < 0.001 protei # 0.45 CB inhibitor-NC inhibitor-NC
1 # B1 of 3 miR-128 inhibitor miR-128 inhibitor
CB 1.5 fC of 0.40 CB1 no 2 1.0 0.35 xpression GAPDH expression ee 0.5
iv 1 expressio ve 0.30 * * inhibitor Relati Relat
0.25 mimic-NC lative 0 inhibitor-NC 0.0
2.53.0 3.54.0 4.5 miR-128 mimc Re Relative expression of miR-128 miR-128 Fig. 3 miR-128 targets CB1 expression. a Venn diagram of bioinformation website microT, TargetScan, miRWalk and RNAInter predicting the intersection of downstream target genes of miR-128; b STRING website analyzes the interaction relationship network diagram of 51 candidate genes, circled in the fgure Degree from large to small indicates the Degree of the gene, circle color from blue to orange indicates Degree from large to small, and the line in the middle of the circle indicates the co-expression relationship between genes; c Biology website predicts the binding position of miR-128 and CB1 Points; d Fluorescent activity detection results of miR-128 and CB1, * indicates comparison with the mimic NC group P < 0.05; e RIP experiments detect the binding of miR-128 and CB1 with Ago2, * indicates comparison with the anti-IgG group P < 0.05; f RT-qPCR detects the relative expression level of CB1 in bladder tissue, * indicates compared with NC group P < 0.05, # indicates compared with PU group P < 0.05; g miR-128 and CB1 correlation analysis; h RT-qPCR detection of each group Relative expression level of CB1 in rat bladder tissue; i Western blotting detection of CB1 protein expression level in rat bladder tissue in each group; j CB1 protein expression level statistical map. (h–j) * indicates that compared with the mimic NC group P < 0.05, # indicates that compared with the inhibitor NC group P < 0.05 The above results are measured data, expressed as mean standard deviation. Paired T test. One-way ANOVA was used to compare data between multiple groups. ± Tukey’s was used for post hoc tests
mimicRETRACTED NC + oe-NC group, miR-128 mimic + oe-NC bladder tissues of rats in the miR-128 mimic + oe-NC group and miR-128 mimic + oe-CB1 group. qPCR was group, the expression of miR-128 signifcantly used to detect the expression of miR-128 in bladder increased (P < 0.05) (Fig. 4a), and the mRNA and pro- tissues of rats in each group, qPCR and Western blot- tein expression of CB1 signifcantly decreased (P < 0.05) ting were used to detect the expression of CB1 mRNA (Fig. 4b, c). Compared with miR-128 mimic + oe-NC and protein in bladder tissues of rats in each group. group, miR-128 mimic + oe-CB1 group had no signif- Compared with the mimic NC + oe-NC group, in the cant change in miR-128 expression, and CB1 mRNA Gou et al. J Transl Med (2020) 18:284 Page 9 of 14
mimic NC + oe-NC mimic NC + oe-NC mimic NC + oe-NC a miR-128 mimic + oe-NC b miR-128 mimic + oe-NC c miR-128 mimic + oe-NC miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 8 4 1.5 c-MYC 1.0 1 rotein R-12 CB 1p
mi 0.8 3 * of GAPDH CB of 1.0
# of C C 0.6 N N B1 2 e- -C # o oe c + + 0.4 expression C + oe- i c 0.5 N m expression ic mi imi 1 ve expression * mim 128 0.2 * - -128 m elati R R miR mi 0 0.0 lative Relative 0.0 Re
mimic NC + oe-NC mimic NC + oe-NC mimic NC + oe-NC mimic NC + oe-NC d miR-128 mimic + oe-NC e miR-128 mimic + oe-NC f miR-128 mimic + oe-NC g miR-128 mimic + oe-NC miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 500 250 # 150 5 * # * l) ) /dl) 400 ) 200 * * 4 ml (m (g mg # * 100 e( ht me e( 300 150 # 3 # olum weig ucos
200 100 rv 2 gl 50 in Body 100 50 Ur 1 Bladder volu Blood
0 0 0 0 0 w 12 w
h mimic NC + oe-NC i mimic NC + oe-NC j mimic NC + oe-NC k mimic NC + oe-NC miR-128 mimic + oe-NC miR-128 mimic + oe-NC miR-128 mimic + oe-NC ) miR-128 mimic + oe-NC
miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 miR-128 mimic + oe-CB1 2O miR-128 mimic + oe-CB1 ) 4 100 ) 0.8
mH 50 ml *
* (o ml #
e( # e( 80 40
0.6 3 %) olum e(
olum # # 60 bladder 30 * nv at * in ev 0.4 2 gr in
in ARTICLE 40 ur 20 id cturitio mi 1 Vo
0.2 ressu re 20 10 mp Residual
Single 0 0 0.0 mu 0 xi
mimic NC + oe-NC Ma lmmiR-128 mimic + oe-NC miR-128 mimic + oe-CB1 500 *
) 400 # (g
ht 300
weig 200 Body 100 100 μm 100 μm 100 μm
0 mimic NC + oe-NC miR-128 mimic + oe-NCmiR-128 mimic + oe-CB1 Fig. 4 Promoting efects of high expression of CB1 on miR-128 on diabetic bladder disease. a qPCR detects the expression level of miR-128 in bladder tissues of each group of rats; b, c. qPCR and Western blotting detection of the level of CB1 mRNA and protein in bladder tissues of each group of rats; d Statistics of blood glucose levels in rats; e Rat weight statistics; f Rat 24 h urine volume statistics; g Rat bladder volume statistics; h Rat average residual urine volume; i Rat single urine output statistics j Statistical chart of average micturition rate in rats; k Statistical chart of maximum pressure in the rat bladder; l Rat bladder weight and bladder tissue section HE staining ( 100). * Indicates that compared with the mimic × NC oe-NC group P < 0.05, # indicates that compared with the miR-128 mimic oe-NC group, P < 0.05. The above results are all measurement data, + + expressed as mean standard deviation. Comparison of data between multiple groups using one-way ANOVA, Tukey’s post hoc test, n 8 ± =
and protein expression increased signifcantly (P < 0.05) (P < 0.05) (Fig. 4b). In the miR-128 mimic + oe-CB1 (Fig. RETRACTED4b, c). group, the blood glucose level of the rats was signifcantly According to the results of blood glucose and weight reduced (P < 0.05) (Fig. 4a), and the body weight was sig- measurement, it was found that compared with the mimic nifcantly increased (P < 0.05) (Fig. 4e). Urine was col- NC + oe-NC group, the average blood glucose level of lected through a metabolic cage, and the results showed rats in the miR-128 mimic oe-NC group was signif- + that compared with the mimic NC + oe-NC group, the cantly increased at the same experimental time (P < 0.05) daily urine output of rats in the miR-128 mimic + oe-NC (Fig. 4d), and the body weight was signifcantly reduced group was signifcantly increased (P < 0.05). And in the Gou et al. J Transl Med (2020) 18:284 Page 10 of 14
(See fgure on next page.) Fig. 5 miR-128 regulates NF-KB/p-JNK axis through CB1 to afect the occurrence of diabetic bladder disease. a STRING website analysis of gene interaction network diagram; b–d Western blotting detection of NF-KB and p-JNK and apoptosis in bladder tissue of three groups of NC, PU and DM rats Expression of related protein Bcl2, * indicates compared with NC group P < 0.05; e Western blotting detected NF-KB in rat bladder tissue of mimic NC group, miR-128 mimic group, inhibitor NC group and miR-128 inhibitor group, P-JNK and apoptosis-related protein Bcl2 expression, * indicates compared with mimic NC group P < 0.05, # indicates compared with inhibitor NC group P < 0.05; f Expression of NF-KB, p-JNK and apoptosis-related protein Bcl2 in bladder tissue of rats in each group by Western blotting, * indicates compared with the mimic NC oe-NC group + P < 0.05, # indicates compared with the miR-128 mimic oe-NC group P < 0.05. g qPCR was used to detect the expression level of miR-128 in + bladder tissue of rats in each group, * indicates compared with mimic NC DMSO group P < 0.05; h qPCR detection of CB1 expression in bladder + tissues of rats in each group, * indicates compared with mimic NC DMSO group P < 0.05; i Western blotting detection of CB1, NF-KB, p-JNK and + apoptosis-related protein Bcl2 in rat bladder tissue of each group Expression, * indicates compared with the mimic NC DMSO group P < 0.05, + # indicates compared with the miR-128 mimic DMSO group P < 0.05; j statistical map of blood glucose levels in rats; k statistical map of body + weights in rats; l 24 h urine volume statistics of rats; m bladder volume statistics of rats; n Statistics chart of average residual urine volume in rats; o Statistics chart of single urine output of rats; p Statistics chart of average urine output of rats; r Rat bladder weight statistics; s Bladder tissue section HE staining ( 100). Figure j–r, * indicates the comparison with mimic NC DMSO group P < 0.05, # indicates the comparison with miR-128 × + mimic DMSO group P < 0.05. The above results are all measurement data, expressed as mean standard deviation. One-way ANOVA and Tukey’s + ± post hoc test was used to compare data between multiple groups
miR-128 mimic + oe-CB1 group, the daily urine volume group, the detrusor muscle bundles were arranged neatly, of rats was signifcantly reduced (P < 0.05) (Fig. 4f). the structure was tight, the gap was flled with connective Subsequently, the bladder function of the mice in each tissue, the muscle cells were vacuolated and the lympho- group was examined by urodynamics. Te results showed cytes were infltrated (Fig. 4l). Te above results indicate that, compared with the mimic NC + oe-NC group, in that high expression of CB1 antagonizes the efect of the miR-128 mimic + oe-NC group at 12 weeks of STZ miR-128 on the development of diabetic bladder disease. injection, the mean maximum bladder volume, mean ARTICLE residual urine volume, and single voiding capacity all miR‑128 regulates NF‑KB/p‑JNK axis through CB1 to afect increased signifcantly (P < 0.05), and the maximum blad- the occurrence of diabetic bladder disease der pressure and mean micturition rate were signif- In order to further study the regulatory mechanism of cantly reduced (P < 0.05). Compared with the miR-128 miR-128 on the occurrence of diabetic bladder disease mimic + oe-NC group, the mean maximum bladder vol- through CB1, we found 414 genes related to diabetic ume (Fig. 4g), average residual urine volume (Fig. 4h), bladder disease through the GeneCards database, ana- and single micturition volume (Fig. 4i) in rats of the lyzed the gene interaction using the STRING website, 128 mimic + oe-CB1 group all signifcantly decreased and found the gene NF-KB (NFKB1) can regulate p-JNK (P < 0.05), and the maximum pressure in the bladder (MAPK8) to afect diabetic bladder disease (Fig. 5a). Te (Fig. 4j) and the mean micturition rate was signifcantly co-expression relationship between CB1 and NF-KB in increased (P < 0.05) (Fig. 4k). After urodynamic exami- blood was obtained through the website Chipbase v2.0 nation, the bladder weight of each group of rats was (Fig. 5b), and the co-expression relationship between excised and it was found that compared with the mimic NF-KB and p-JNK (Fig. 5c). We know from the litera- NC + oe-NC group, the miR-128 mimic + oe-NC group ture that CB1 can inhibit the activation of NF-KB [21], had signifcantly increased bladder weight (P < 0.05). and NF-KB can promote the occurrence of diabetic blad- Compared with the miR-128 mimic + oe-NC group, the der disease [22], and at the same time can promote the bladder weight of rats in miR-128 mimic + oe-CB1 group activation of JNK (p-JNK) [23] and activate JNK (p-JNK) was signifcantly reduced (P < 0.05). can promote the occurrence of diabetic bladder disease Te results of HE staining showed that compared by positively regulating apoptosis [24]. Terefore, we next with the mimic NC + oe-NC group, in the miR-128 explored that in the diabetic bladder, miR-128 regulates mimic + oe-NC group, the detrusor muscle bundles were the NF-KB/p-JNK axis through CB1. disordered and loose, the muscle bundles were broken, First, we detected the expression of NF-KB, p-JNK, and RETRACTEDthe gap between the muscle bundles was signif- and apoptosis-related protein Bcl2 in bladder tissue of cantly widened, and urinary muscle cells atrophy, diverse NC, PU, and DM groups by Western blotting. Te results morphology, lymphocyte infltration, a large number of showed that compared with the NC group, expressions vacuolar degeneration, a small amount of eosinophilic of NF-KB p50, p-JNK and Bcl2 in the bladder tissues of degeneration, and increased interstitial and collagen the rats in the PU group were not signifcantly changed, components were observed. Compared with the miR-128 but increased in the bladder tissues of rats in the DM mimic + oe-NC group, in the miR-128 mimic + oe- CB1 group (P < 0.05) (Fig. 5d). Western blotting revealed that Gou et al. J Transl Med (2020) 18:284 Page 11 of 14
abc
IL18 PPARG TLR4 AGER TLR2
IL1A IL1B CTSD TNF B2M HP IL6 EPO AKT1 APP
MAPK8 MTOR CXCL8 PIK3CA PIK3R1 NFKB1 IL23R SQSTM1 CASP8 RETN MAP2K1 SRC NRAS EP300
MAPK1 IKBKB
RAF1 HRAS TERT LCN2 KRAS NGF CD40LG TNFRSF1A NR3C1
mimic NC d NC e miR-128 mimic inhibitor NC NF-KB p65 PU NF-KB p65 2.5 DM 2.5 miR-128 inhibitor * p-JNK 2.0 * p-JNK 2.0 pressi on x xpression 1.5 Bcl2 1.5 ne
Bcl2 ne * * 1.0 1.0 protei GAPDH GAPDH protei * * ve ve ti 0.5 ti 0.5
NC PU DM la # la #
Re # 0.0 Re mimic NC 0.0 NF-KB p65 p-JNKBcl2 inhibitor NC NF-KB p65 p-JNKBcl2 miR-128 mimic miR-128 inhibitor
f NF-KB p65 mimic NC + oe-NC g mimic NC + DMSO h mimic NC + DMSO miR-128 mimic + oe-NC miR-128 mimic + DMSO miR-128 mimic + DMSO miR-128 mimic + oe-CB1 miR-128 mimic + PDTC miR-128 mimic + PDTC p-JNK 2.5 8 3 1.5 n * * 1 R-12 CB
2.0 mi Bcl2 of of xpressio 2 1.0
1.5 on ARTICLE
ne * GAPDH # 1.0 xpression protei * 1 e 0.5
# expressi
ve * ve
ti 0.5
la # Re 0 Relati
0.0 Relative 0.0 mimic NC + oe-NC NF-KB p65 p-JNKBcl2 miR-128 mimicmiR-128 + oe-NC mimic + oe-CB1 mimic NC + DMSO mimic NC + DMSO mimic NC + DMSO mimic NC + DMSO i miR-128 mimic + DMSO j miR-128 mimic + DMSO k miR-128 mimic + DMSO l miR-128 mimic + DMSO 2.0 miR-128 mimic + PDTC miR-128 mimic + PDTC miR-128 mimic + PDTC miR-128 mimic + PDTC n * 600 250 150 ) * # l) 1.5 ) 200 * (g (m xpressio (mg/dl 400 * 100 * ht 150 ne # se # # 1.0 * co olu me weig lu 100 rv
protei # 200 50 in dg ve
0.5 Body
# Ur ti * 50 la Bloo
Re 0.0 0 0 0 CB1NF-KB p65p-JNK Bcl2
mimic NC + DMSO mimic NC + DMSO mimic NC + DMSO mimic NC + DMSO m miR-128 mimic + DMSO n miR-128 mimic + DMSO o miR-128 mimic + DMSO p miR-128 mimic + DMSO miR-128 mimic + PDTC miR-128 mimic + PDTC 4 miR-128 mimic + PDTC miR-128 mimic + PDTC l) ) 1.0 4 80
* (m ml *
l) # e(
0.8 * me (m 3 3 60 %) um ol me # 0.6 e( at ev
olu # 2 2 40 in gr rv * ur 0.4 # in id icturition volu 1 1 0.2 Vo 20 em Bladde Residual
0 0.0 Singl 0 0 q rs
) mimic NC + DMSO mimic NC + DMSO
2O miR-128 mimic + DMSO miR-128 mimic + DMSO miR-128 mimic + PDTC miR-128 mimic + PDTC
mH 40 500 (o
) * # 400
30 mg t( adder l 300 #
20 * eigh einb RETRACTEDrw 200
ressur 10 100
Bladde 100 μm 100 μm 100 μm mp mimic NC + DMSO miR-128 mimic + DMSO miR-128 mimic + PDTC
mu 0 0 xi Ma Gou et al. J Transl Med (2020) 18:284 Page 12 of 14
compared with the inhibitor NC group, the expression and edema, and the detrusor muscle cells atrophied, with of NF-KB p50, p-JNK and Bcl2 in the bladder tissues of diverse morphology, lymphocyte infltration, and a large rats in miR-128 mimic group signifcantly increased, number of vacuolar degeneration observed. Compared but that in the miR-128 inhibitor group were decreased with the miR-128 mimic + DMSO group, in the miR-128 (P < 0.05) (Fig. 5e). Moreover, compared with the miR- mimic + PDTC group, detrusor muscle bundles were 128 mimic + oe-NC group, the expression of NF-KB p50, arranged more neatly, the structure was tight, and the gap p-JNK and Bcl2 were signifcantly decreased in the miR- was flled with connective tissue, with vascular degenera- 128 mimic + oe-CB1 group (P < 0.05) (Fig. 5f). Te above tion of muscle cells and a small amount of lymphocyte results indicate that miR-128 can regulate the expression infltration found (Fig. 5s). Te above results indicate that of NF-KB and p-JNK through CB1 in the diabetic bladder miR-128 regulates the NF-KB/p-JNK axis through CB1 and afect the level of apoptosis. and afects the occurrence of diabetic bladder disease. Further, after treated with miR-128 mimic, rats were simultaneously injected with NF-KB inhibitor PDTC, Discussion and Western blotting was used to detect NF-KB, p-JNK Many miRNAs have been found to play important roles and apoptosis-related protein Bcl2 in bladder tissues in DCP by regulating cytokines and then regulating of each group of rats expression. Rats were examined tumor cell proliferation, metastasis, invasion and apop- with urodynamics, and bladder tissue staining was per- tosis. Te role of miRNAs in cancer development has formed. Compared with the mimic NC + DMSO group, not been elucidated, and the role of miR-128a expres- in the bladder tissues rats in the miR-128 mimic + DMSO sion in diabetes is unclear, the corresponding regulatory group, the expression of miR-128 increased signifcantly mechanisms and downstream regulatory signals need (P < 0.05) (Fig. 5g), mRNA and protein expression of CB1 further study. Even though the study of HIV-1 found that was signifcantly reduced (P < 0.05) (Fig. 5h, i), and levels anti-miR-128 partially neutralized IFN-mediated HIV-1 of NF-KB, p-JNK and Bcl2 were signifcantly increased blockade and elucidated the mechanism by which miR- (P < 0.05) (Fig. 5i), the mean blood glucose level was sig- 128 impairsARTICLE HIV-1 replication may provide new candi- nifcantly increased (P < 0.05) (Fig. 5j), weight was sig- dates for the development of therapeutic intervention nifcantly reduced (P < 0.05) (Fig. 5k), and the daily urine [25]. And studies have shown that miR-128 levels are output was signifcantly increased (P < 0.05) (Fig. 5l), and elevated in benign prostate epithelial cell lines compared the average maximum bladder volume (Fig. 5m), average to invasive prostate cancer cells. Knockdown of miR-128 residual urine volume (Fig. 5n), single urination volume can induce benign prostate epithelial cell infltration, (Fig. 5o) increased signifcantly (P < 0.05), mean mic- while overexpression of miR-128 attenuates infltration of turition rate (Fig. 5p) and maximum bladder pressure prostate cancer cells [26]. It has been reported that pro- (Fig. 5q) decreased signifcantly (Fig. 5m) (P < 0.05), the neuron miR-128 is a candidate miRNA for glioma tumor bladder weight increased signifcantly (P < 0.05) (Fig. 5r). suppressor. Reduced miR-128 expression is associated Compared with the miR-128 + DMSO group, in the miR- with aggressive human glioma subtypes. miR-128 has a 128 mimic + PDTC group, the expression of miR-128 tumor suppressive efect. miR-128 inhibits giNSC growth and CB1 were not signifcant changed in rat bladder, the by enhancing neuronal diferentiation. miR-128 inhibits expression of NF-KB, p-JNK and apoptosis-related pro- growth and mediates diferentiation by targeting onco- tein Bcl2 were signifcantly reduced (P < 0.05) (Fig. 5i), genic receptor tyrosine kinase (RTK) epithelial growth and the body weight of rats was signifcantly increased factor receptor and platelet-derived growth factor recep- (P < 0.05) (Fig. 5k), the average blood glucose level. Sig- tor alpha. [12] miR-128 is a glioma tumor suppressor that nifcantly decreased (P < 0.05) (Fig. 5j), daily urine out- targets RTK signaling to inhibit giNSC self-renewal and put was signifcantly reduced (P < 0.05) (Fig. 5l), average enhance diferentiation [27]. Tese results suggest that maximum bladder volume (Fig. 5m), average residual miR-128 plays a key role in DCP. urine volume (Fig. 5n), single urine output (Fig. 5o) were Te miR-128 precursor can promote cell proliferation signifcantly decreased (P < 0.05), mean urination rate and inhibit apoptosis. Compared with the lnc-LAMC2-1: (Fig. 5p) and maximum bladder pressure (Fig. 5q) were 1 rs2147578C allele, the G allele increases the risk of signifcantlyRETRACTED increased (P < 0.05), and bladder weight was ovarian cancer by reducing the binding between lnc- signifcantly reduced (P < 0.05) (Fig. 5r). LAMC2-1: 1 and miR-128-3p, thereby further reducing Te results of HE staining showed that compared with DCC and inhibition of apoptosis [28]. Myostatin (MSTN) the mimic NC + DMSO group, the detrusor muscle bun- inhibits excessive cardiac autophagy by blocking AMPK/ dles in the miR-128 mimic + DMSO group were disor- mTOR and miR-128/PPARγ/NF-κB signaling path- dered and loose, the muscle bundles were broken, the ways, at least partially signifcantly inhibiting pathologi- space between muscle bundles was signifcantly widened cal cardiac hypertrophy and dysfunction [29]. miR-128 Gou et al. J Transl Med (2020) 18:284 Page 13 of 14
can regulate the role and mechanism of glioma tumor miR-128 regulates the NF-KB/p-JNK axis through CB1 angiogenesis through the miR-128/p70S6K1 axis, and to afect the occurrence of diabetic bladder disease. miR-128 may become a potential therapeutic target for glioma in the future [13]. We predict that miR-128 tar- Conclusion gets the regulation of CB1 expression through bioinfor- In summary, we report for the frst time that miR-128 matics, and through our fndings, we found that miR-128 regulates the NF-KB/p-JNK axis through CB1 to afect is highly expressed in the bladder tissue of diabetic blad- the occurrence of diabetic bladder disease. We suggest der disease rats, and may play a role in the occurrence of further research on drugs with similar pharmacologi- lesions, And we found that by efectively inhibiting miR- cal characteristics to lay a theoretical foundation for an 128, we can improve the occurrence of diabetic bladder in-depth understanding of the pathogenesis of diabetic disease in rats. Tis is related to the abnormal expression bladder disease and for fnding new therapeutic targets. of miRNAs (such as miR-128 and miR-21) in gliomas. In addition, there are reports in the literature that miR-128 Abbreviations is related to the proliferation of glioma cells, and that it DCP: Diabetic cystitis; DM: Diabetic Mellitus; NC: Normal control; STZ: Strepto- reduces the expression of miR-10b [30], which can cause zotocin; PMSF: Phenylmethylsulfonyl fuoride; ANOVA: Analysis of variance. cell apoptosis. Existing studies have shown that miR-128 Acknowledgements is highly expressed in central nervous cells but low in We would like to acknowledge the reviewers for their helpful comments on malignant gliomas. MiR-128 is a direct-acting target of this study. P53 [31] and can interact with cyclins CDK6, BCL-2 and Authors’ contributions E2F3 form a complex that inhibits the translation of the XG and JW wrote the paper; MH and YW conceived and designed the experi- target gene or degrades the miRNA of the target gene, ments; TY and TC analyzed the data; GL and KF collected and provided the sample for this study. All authors read and approved the fnal manuscript. induces the cell cycle to stagnate in the S phase, result- ing in apoptosis and senescence [14]. Tese results sug- Funding gest that we have a deeper understanding of miR-128. This work was supportedARTICLE by the Yunnan Provincial Science and Technology Department (No. 2017FE467(-059)); National Natural Science Foundation We adopt miR-128 inhibition to signifcantly improve of China (No. 81860127); Medical Discipline Leaders of Health and Family the occurrence of diabetic bladder disease in rats and Planning Commission of Yunnan Province (No. D-201615); Young and Middle- we have found for the frst time that miR-128 can target Aged Academic and Technical Leaders Reserved Scholar of Yunnan Province (No. 2017FB038); the Engineering and Research Center of Yunnan College and the inhibition of CB1 expression. Previous studies have University for Female Pelvic Floor Disease Diagnosis and Treatment. shown that CB1 can cause Infammation, infammation plays an important role in the development of diabetes Availability of data and materials The authors confrm that the data supporting the fndings of this study are [27]. Our high expression of CB1 can antagonize the pro- available within the article. motion of miR-128 on the occurrence of diabetic blad- der disease. qPCR and Western blotting were used to Ethics approval and consent to participate This experimental procedure and animal use protocol have been approved detect the expression levels of CB1 mRNA and protein in by the Animal Ethics Committee of the Second Afliated Hospital of Kunming bladder tissue of rats in each group. Compared with the Medical University. mimic NC oe-NC group, miR-128 increased expres- + Consent for publication sion (Fig. 4a), CB1 mRNA and protein expression levels Not applicable. signifcantly decreased. CB1 mRNA and protein expres- sion levels decreased signifcantly (Fig. 4b, c), compared Competing interests The authors declare no conficts of interest. with miR-128 mimic + oe-NC group, bladder tissue of rat was no signifcant change in miR-128 expression, and Author details mRNA and protein expression levels of CB1 signifcantly 1 Department of Urology, The Second Afliated Hospital of Kunming Medical University, No. 374, Dianmian Dadao, Kunming, Yunnan 650101, People’s increased (Fig. 4b, c). CB1 and our results show that miR- Republic of China. 2 Department of Biochemistry and Molecular Biology, The 128 has signifcant regulatory role. Such results suggest Primary Medicine School of Kunming Medical University, Kunming 650101, that in the diabetic bladder, miR-128 may regulate the People’s Republic of China. 3 Department of Urology, The 2nd Hospital of Kun- ming Medical University, Kunming 650101, People’s Republic of China. expression of signaling pathways NF-KB and p-JNK by regulatingRETRACTED CB1. Previous studies have investigated the Received: 21 April 2020 Accepted: 5 June 2020 role of CB1 receptors in mediating 2-AG neuro protec- tion. Te fndings suggest that 2-AG exerts its neuropro- tective efect at least in part after CHI through the CB1 receptor-mediated mechanism, which involves inhibit- References 1. Yang S, Wang D, Cao X, Zhang X, Yuan X, Yang T, et al. Store operated ing intracellular infammatory signaling pathways [21]. calcium channels are associated with diabetic cystopathy in streptozo- Compared with previous studies, our research found that tocin induced diabetic rats. Mol Med Rep. 2018;17(5):6612–20. Gou et al. J Transl Med (2020) 18:284 Page 14 of 14
2. Cheng YJ, Imperatore G, Geiss LS, Wang J, Saydah SH, Cowie CC, et al. 19. Guo Y, Ying L, Tian Y, Yang P, Zhu Y, Wang Z, et al. miR-144 downregulation Secular changes in the age-specifc prevalence of diabetes among U.S. increases bladder cancer cell proliferation by targeting EZH2 and regulat- adults: 1988–2010. Diabetes Care. 2013;36(9):2690–6. ing Wnt signaling. FEBS J. 2013;280(18):4531–8. 3. Kaplan SA, Te AE, Blaivas JG. Urodynamic fndings in patients with dia- 20. Iwaya T, Yokobori T, Nishida N, Kogo R, Sudo T, Tanaka F, et al. Downregu- betic cystopathy. J Urol. 1995;153(2):342–4. lation of miR-144 is associated with colorectal cancer progression via acti- 4. Sasaki K, Chancellor MB, Phelan MW, Yokoyama T, Fraser MO, Seki S, vation of mTOR signaling pathway. Carcinogenesis. 2012;33(12):2391–7. et al. Diabetic cystopathy correlates with a long-term decrease in nerve 21. Panikashvili D, Mechoulam R, Beni SM, Alexandrovich A, Shohami E. CB1 growth factor levels in the bladder and lumbosacral dorsal root Ganglia. J cannabinoid receptors are involved in neuroprotection via NF-kappa B Urol. 2002;168(3):1259–64. inhibition. J Cereb Blood Flow Metab. 2005;25(4):477–84. 5. Hanna-Mitchell AT, Ruiz GW, Daneshgari F, Liu G, Apodaca G, Birder LA. 22. Li WJ, Shin MK, Oh SJ. Poly(ADP-ribose) polymerase is involved in the Impact of diabetes mellitus on bladder uroepithelial cells. Am J Physiol development of diabetic cystopathy via regulation of nuclear factor Regul Integr Comp Physiol. 2013;304(2):R84–93. kappa B. Urology. 2011;77(5):1265 e1–8. 6. Wang D, Yuan X, Hu C, Zhang B, Gao H, Wang D, et al. Endoplasmic reticu- 23. Liu J, Yang D, Minemoto Y, Leitges M, Rosner MR, Lin A. NF-kappaB is lum stress is involved in apoptosis of detrusor muscle in streptozocin- required for UV-induced JNK activation via induction of PKCdelta. Mol induced diabetic rats. Neurourol Urodyn. 2017;36(1):65–72. Cell. 2006;21(4):467–80. 7. Harfe BD. MicroRNAs in vertebrate development. Curr Opin Genet Dev. 24. Li WJ, Oh SJ. Diabetic cystopathy is associated with PARP/JNK/mitochon- 2005;15(4):410–5. drial apoptotic pathway-mediated bladder apoptosis. Neurourol Urodyn. 8. Ambros V. The functions of animal microRNAs. Nature. 2010;29(7):1332–7. 2004;431(7006):350–5. 25. Nascimento A, Mullerpatan A, Azevedo AM, Karande P, Cramer S. 9. Esquela-Kerscher A, Slack FJ. Oncomirs—microRNAs with a role in cancer. Development of phage biopanning strategies to identify afnity Nat Rev Cancer. 2006;6(4):259–69. peptide ligands for kappa light chain Fab fragments. Biotechnol Prog. 10. Li M, Fu W, Wo L, Shu X, Liu F, Li C. miR-128 and its target genes in tumori- 2019;35(6):e2884. genesis and metastasis. Exp Cell Res. 2013;319(20):3059–64. 26. Khan AP, Poisson LM, Bhat VB, Fermin D, Zhao R, Kalyana-Sundaram S, 11. Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G, et al. et al. Quantitative proteomic profling of prostate cancer reveals a role for Targeting of the Bmi-1 oncogene/stem cell renewal factor by micro- miR-128 in prostate cancer. Mol Cell Proteomics. 2010;9(2):298–312. RNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 27. Mehrpouya-Bahrami P, Miranda K, Singh NP, Zumbrun EE, Nagarkatti M, 2008;68(22):9125–30. Nagarkatti PS. Role of microRNA in CB1 antagonist-mediated regulation 12. Papagiannakopoulos T, Friedmann-Morvinski D, Neveu P, Dugas JC, Gill of adipose tissue macrophage polarization and chemotaxis during diet- RM, Huillard E, et al. Pro-neural miR-128 is a glioma tumor suppressor that induced obesity. J Biol Chem. 2019;294(19):7669–81. targets mitogenic kinases. Oncogene. 2012;31(15):1884–95. 28. Wang Q, Li XP, Zhou X, Yang CF, Zhu Z. A single-nucleotide polymorphism 13. Shi ZM, Wang J, Yan Z, You YP, Li CY, Qian X, et al. MiR-128 inhibits in lnc-LAMC2-1:1 interferes with its interaction with miR-128 to alter the tumor growth and angiogenesis by targeting p70S6K1. PLoS ONE. expression ofARTICLE deleted in colorectal cancer and its efect on the survival 2012;7(3):e32709. rate of subjects with ovarian cancer. J Cell Biochem. 2020. https://doi. 14. Zhang Y, Chao T, Li R, Liu W, Chen Y, Yan X, et al. MicroRNA-128 inhibits org/10.1002/jcb.29597. glioma cells proliferation by targeting transcription factor E2F3a. J Mol 29. Qi H, Ren J, Ba L, Song C, Zhang Q, Cao Y, et al. MSTN attenuates cardiac Med (Berl). 2009;87(1):43–51. hypertrophy through inhibition of excessive cardiac autophagy by block- 15. Chen S, Li P, Li J, Wang Y, Du Y, Chen X, et al. MiR-144 inhibits proliferation ing AMPK/mTOR and miR-128/PPARgamma/NF-kappaB. Mol Ther Nucleic and induces apoptosis and autophagy in lung cancer cells by targeting Acids. 2019;19:507–22. TIGAR. Cell Physiol Biochem. 2015;35(3):997–1007. 30. Madhyastha R, Madhyastha H, Nakajima Y, Omura S, Maruyama M. Micro- 16. Zhao M, Huang J, Gui K, Xiong M, Cai G, Xu J, et al. The downregulation RNA signature in diabetic wound healing: promotive role of miR-21 in of miR-144 is associated with the growth and invasion of osteosar- fbroblast migration. Int Wound J. 2012;9(4):355–61. coma cells through the regulation of TAGLN expression. Int J Mol Med. 31. Adlakha YK, Saini N. miR-128 exerts pro-apoptotic efect in a p53 2014;34(6):1565–72. transcription-dependent and-independent manner via PUMA-Bak axis. 17. Cao T, Li H, Hu Y, Ma D, Cai X. miR-144 suppresses the proliferation and Cell Death Dis. 2013;4:e542. metastasis of hepatocellular carcinoma by targeting E2F3. Tumour Biol. 2014;35(11):10759–64. 18. Guan H, Liang W, Xie Z, Li H, Liu J, Liu L, et al. Down-regulation of miR-144 Publisher’s Note promotes thyroid cancer cell invasion by targeting ZEB1 and ZEB2. Endo- Springer Nature remains neutral with regard to jurisdictional claims in pub- crine. 2015;48(2):566–74. lished maps and institutional afliations.
Ready to submit your research ? Choose BMC and benefit from:
• fast, convenient online submission • thorough peer review by experienced researchers in your field • rapid publication on acceptance RETRACTED• support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations • maximum visibility for your research: over 100M website views per year
At BMC, research is always in progress.
Learn more biomedcentral.com/submissions