Number 3 March 2013

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 17 - Number 3 March 2013

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Jérémy Cigna, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Louis Dallaire (Montreal, Canada) Education Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 17, Number 3, March 2013

Table of contents

Gene Section

FSTL3 (follistatin-like 3 (secreted glycoprotein)) 151 Michael Grusch GREB1 (growth regulation by estrogen in breast cancer 1) 155 Kevin C Knower, Chantal B Magne Nde, Kyren Lazarus, Sarah Q To, Zhe Zhao, Ashwini L Chand, Colin D Clyne SETBP1 (SET binding protein 1) 159 Ion Cristóbal, Laura García-Orti, María D Odero SLIT3 (slit homolog 3 (Drosophila)) 161 Kim Brussen ATF2 (activating transcription factor 2) 167 Jean-Loup Huret GNAS (GNAS complex locus) 178 Guiomar Pérez de Nanclares, Giovanna Mantovani, Eduardo Fernandez-Rebollo MIR449A (microRNA 449a) 190 Cristina Gallinas Suazo, Muriel Lizé MMP15 (matrix metallopeptidase 15 (membrane-inserted)) 193 Emiko Ito, Ikuo Yana, Nariaki Matsuura

Leukaemia Section inv(16)(p13q24) CBFA2T3/GLIS2 199 Jean-Loup Huret t(1;3)(q25;q27) GAS5/BCL6 201 Jean-Loup Huret t(3;6)(q27;q14) SNHG5/BCL6 203 Jean-Loup Huret t(3;9)(q27;p13) GRHPR/BCL6 204 Jean-Loup Huret t(5;12)(p13;p13) NIPBL/ETV6 206 Etienne De Braekeleer, Juan Ramón González García, Janet Margarita Soto Padilla, Carlos Cordova Fletes, Frédéric Morel, Nathalie Douet-Guilbert, Marc De Braekeleer

Solid Tumour Section

Breast: Ductal carcinoma 209 Cathy B Moelans, Paul J van Diest Head and neck: Thymus: Thymoma: an overview 221 Marius Raica, Domenico Ribatti

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Cancer Prone Disease Section

Bazex-Dupré-Christol syndrome (BDCS) 229 Jean-Loup Huret

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

FSTL3 (follistatin -like 3 (secreted glycoprotein)) Michael Grusch Medical University of Vienna, Department of Medicine I, Institute of Cancer Research, Borschkegasse 8a, A-1090 Vienna, Austria (MG)

Published in Atlas Database: September 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/FSTL3ID111ch19p13.html DOI: 10.4267/2042/48753 This article is an update of : Grusch M. FSTL3 (follistatin-like 3 (secreted glycoprotein)). Atlas Genet Cytogenet Oncol Haematol 2009;13(12):935-938.

Identity DNA/RNA Other names: FLRG, FSRP Description HGNC (Hugo): FSTL3 The human FSTL3 gene is comprised of five exons Location: 19p13.3 spanning 7004 bp on chromosome 19p13 and gives rise Local order: RNF126 (ring finger protein 126) - to a main transcript of 2525 bp. FSTL3 - PRSSL1 (protease, serine-like 1). The first exon encodes the signal peptide plus nine residues of the N-terminal domain, the second exon Note: The term follistatin-related protein has been used encodes the remainder of the N-terminal domain, the to refer to either FSTL3 (FSRP) or FSTL1 (FRP), third and the fourth exon each code for a follistatin which may cause some confusion. A search in module and the fifth exon encodes the C-terminus rich MEDLINE for FSTL3 will also retrieve several reports in acidic amino acids (Schneyer et al., 2001; Sidis et not mentioning FSTL3 but dealing with FRP/FSTL1 al., 2002). instead.

Intron/exon structure of the FSTL3 gene and domain architecture of FSTL3 protein. 1,2,3,4,5: exon number; SP: signal peptide; NTD: N-terminal domain; FSD 1: follistatin domain 1; FSD 2: follistatin domain 2; AT: acidic tail.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 151 FSTL3 (follistatin-like 3 (secreted glycoprotein)) Grusch M

Transcription cell lines, primary cells (Tortoriello et al., 2001) and tissue sections (Torres et al., 2007). Nuclear FSTL3 Transcription of FSTL3 mRNA was shown to be was glycosylated, albeit to a lower degree than secreted stimulated by TGF beta and activin A via Smad FSTL3, suggesting that it enters the nucleus after proteins (Bartholin et al., 2001; Bartholin et al., 2002), partial processing in the ER (Saito et al., 2005). which seems to be part of a negative feedback loop as FSTL3 can antagonize activin A (see below). In a Function different study it was found that GDF9 - another TGF Similar to follistatin, secreted FSTL3 was shown to beta superfamily cytokine - can suppress both basal and bind activin A and with lower affinity several other activin A-induced FSTL3 (and follistatin) mRNA and members of the TGF beta family including activin B, protein levels in cultured human granulosa-lutein myostatin and BMP2, BMP6, and BMP7 (but (hGL) cells from women undergoing in vitro excluding for instance TGF beta and BMP4) (Tsuchida fertilization (IVF) treatment (Shi et al., 2011). et al., 2000; Tortoriello et al., 2001; Sidis et al., 2002; In addition NF-kappaB responsive elements have been Hill et al., 2002; Schneyer et al., 2003). Affinity for identified in the FSTL3 promoter and are involved in BMPs, however, seems to be quite low and has been the cooperative stimulation of FSTL3 transcription by questioned by other studies (Sidis et al., 2006). FSTL3 TNF alpha and TGF beta (Bartholin et al., 2007). bound ligands are unable to activate their cognate Upregulation of FSTL3 mRNA was observed as a receptors and thus FSTL3 blocks signal transduction. response to hypoxia in human trophoblasts and a role Structural and biochemical data have implicated the N- for hypoxia inducible factor (HIF1 alpha) was terminal domain and the two FS domains in ligand suggested. In another study a combination of 17 beta binding and antagonism (Sidis et al., 2005; Stamler et estradiol and progesterone, but not either factor alone, al., 2008; Cash et al., 2012). stimulated FSTL3 expression in cultured human In contrast to follistatin, FSTL3 does not contain a endometrial stromal cells (Wang et al., 2003). An heparin binding motif and does not bind cell surface analysis of the murine FSTL3 promoter identified heparan-sulfate proteoglycans (Sidis et al., 2002). phorbol 12-myristate 13-acetate (PMA) but not cAMP In addition to binding TGF beta family ligands, FSTL3 as transcriptional activators. was demonstrated to interact with ADAM12 (a disintegrin and metalloprotease 12), an extracellular Protein protein that has been implicated in insulin-like growth factor (IGF) and epidermal growth factor (EGF) Description receptor signaling (Bartholin et al., 2005), as well as The FSTL3 protein precursor consists of 263 amino with fibronectin type 1, which could indicate a role of acids. Amino acids 1-26 form the signal peptide, which FSTL3 in cell adhesion (Maguer-Satta et al., 2006). is reponsible for directing the protein to the secretory Nuclear FSTL3 was shown to interact with AF10 pathway but not present in the mature secreted protein. (ALL-1 fused gene from chromosome 10) enhancing FSTL3 has been described to contain 2 follistatin (FS) its homo-oligomerization and transcriptional activity domains (aa 97-168 and 169-244) (Schneyer et al., (Forissier et al., 2007). 2001) characterized by a conserved arrangement of 10 FSTL3 knock-out mice had increased pancreatic island cysteine residues. The FS domains also have similarity number and size, enhanced insulin sensitivity and with the Kazal domains found in multiple serine hepatic steatosis suggesting a role of FSTL3 in glucose protease inhibitors. The FSTL3 protein contains two and fat homeostasis (Mukherjee et al., 2007). potential N-glycosilation sites on asparagines 73 and Combined knockout of FSTL3 and follistatin, however, 215. Peptide N-glycosidase F digestion reduced the size led to increased fat mass and insulin resistance despite of ectopically expressed FSTL3 from 33 to 27 kDa in elevated insulin production (Brown et al., 2011). Western analysis (Hayette et al., 1998). Homology Expression FSTL3 has a similar domain architecture as follistatin, FSTL3 is expressed in a wide variety of tissues and but harbours only two instead of three follistatin organs with the highest expression in placenta and modules (Tortoriello et al., 2001). Follistatin modules testis and low to absent expression in the hematopoietic are found in varying numbers in a wider set of secreted system (Hayette et al., 1998; Tortoriello et al., 2001). proteins including FSTL1, SPARC/osteonectin, or agrin (Ullman and Perkins, 1997). With respect to Localisation activin binding ability, functional homology among The signal peptide directs the nascent protein to the follistatin domain-containing proteins has only been secretory pathway and FSTL3 has been detected in cell demonstrated for FSTL3 and follistatin (Tsuchida et al., culture supernatants and in human serum (Hayette et 2000). Between different species FSTL3 is clearly al., 1998; Hill et al., 2002; Pryor-Koishi et al., 2007). In conserved (96% amino acid identity between mouse addition to its role as a secreted protein FSTL3 has also and rat and about 80% for either of these species been found in the cell nucleus in a number of different compared to human), albeit to a lesser degree than

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 152 FSTL3 (follistatin-like 3 (secreted glycoprotein)) Grusch M

follistatin, which has around 97% amino acid identity Endometrial adenocarcinoma between human, mouse and rat. Disease Downregulation of FSTL3 expression was found in Mutations human endometrial adenocarcinoma (Ciarmela et al., Somatic 2004). A t(11;19)(q13;p13) translocation has been described in Endometriosis a case of B-cell chronic lymphocytic leukemia. Disease The chromosomal breakpoint occurred about 7 kbp Ovarian endometriotic lesions showed a deranged upstream of FSTL3 leading to ectopic expression of the expression of FSTL3 as well as follistatin. While complete FSTL3 protein, likely as a consequence of follistatin expression was increased, FSTL3 mRNA and altered upstream cis-regulatory sequences (Hayette et protein expression were lower in ovarian endometriosis al., 1998). than in healthy eutopic endometrium (Torres et al., In the same study structural rearrangement of the 2007). FSTL3 locus has also been described in a case of non- Hodgkin lymphoma. Pre-eclampsia A deletion of about 1.2 Mb on chromosome 19p13.3 Disease was identified in a patient with cleft palate, hearing The mRNA and protein levels of FSTL3 were impairment, congenital heart malformation, keloid compared in placentas and maternal sera of women scarring, immune dysregulation, and mild learning with uncomplicated pregnancy and those with pre- difficulties. The deleted area encompasses about 60 eclampsia. genes including FSTL3 (Archer et al., 2005). FSTL3 was upregulated in syncytiotrophoblast cells of pre-eclamptic placental tissue and in maternal serum. Implicated in Its further evaluation as potential addition to existing diagnostic markers of pre-eclampsia was suggested Malignant blood disorders (Pryor-Koishi et al., 2007). Disease Heart disease Structural rearrangement of the FSTL3 locus has been described in malignant blood disorders (see above) and Disease it has been suggested that deregulated expression of FSTL3 (and FSTL1) were elevated in heart failure. FSTL3 could contribute to leukemogenesis (Hayette et FSTL3 expression correlated with markers of disease al., 1998). severity and returned to normal after recovery. The protein was localized to myocytes and endothelium Breast carcinoma and the expression profile of FSTL3 on microarrays Disease revealed an association with the nuclear compartment High expression of FSTL3 was observed in invasive and with genes involved in signal transduction and breast carcinoma compared to normal luminal epithelial transcription (Lara-Pezzi et al., 2008). In a mouse cells. model activin A and FSTL3 were upregulated in the SiRNA-mediated knock-down of FSTL3 expression in herat by ischemic injury. While activin A protected breast cancer cell lines lead to growth inhibition, smad2 myocytes from cell death, this effect was antagonized phosphorylation and increased transcription of activin by FSTL3 (Oshima et al., 2009). target genes (Razanajaona et al., 2007). These observations suggest that FSTL3 may contribute to References tumorigenesis by antagonizing growth limiting activin Ullman CG, Perkins SJ. The Factor I and follistatin domain effects. families: the return of a prodigal son. Biochem J. 1997 Sep In agreement with this notion another study reported 15;326 ( Pt 3):939-41 increased FSTL3 mRNA and protein levels in the Hayette S, Gadoux M, Martel S, Bertrand S, Tigaud I, Magaud epithelial compartment in infiltrating ductal carcinoma JP, Rimokh R. FLRG (follistatin-related gene), a new target of of the breast when compared to normal breast tissue chromosomal rearrangement in malignant blood disorders. (Bloise et al., 2009). Oncogene. 1998 Jun 4;16(22):2949-54 Tsuchida K, Arai KY, Kuramoto Y, Yamakawa N, Hasegawa Y, Hepatocellular carcinoma Sugino H. Identification and characterization of a novel Disease follistatin-like protein as a binding protein for the TGF-beta FSTL3 expression levels were increased in hepatocytes family. J Biol Chem. 2000 Dec 29;275(52):40788-96 in chemical hepatocarcinogenesis models in the rat but Bartholin L, Maguer-Satta V, Hayette S, Martel S, Gadoux M, decreased in hepatocellular carcinoma (HCC) in Bertrand S, Corbo L, Lamadon C, Morera AM, Magaud JP, Rimokh R. FLRG, an activin-binding protein, is a new target of humans (Grusch et al., 2006). TGFbeta transcription activation through Smad proteins. Oncogene. 2001 Sep 6;20(39):5409-19

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 153 FSTL3 (follistatin-like 3 (secreted glycoprotein)) Grusch M

Schneyer A, Tortoriello D, Sidis Y, Keutmann H, Matsuzaki T, and specificity for activin, myostatin, and bone morphogenetic Holmes W. Follistatin-related protein (FSRP): a new member proteins. Endocrinology. 2006 Jul;147(7):3586-97 of the follistatin gene family. Mol Cell Endocrinol. 2001 Jun 30;180(1-2):33-8 Bartholin L, Guindon S, Martel S, Corbo L, Rimokh R. Identification of NF-kappaB responsive elements in follistatin Tortoriello DV, Sidis Y, Holtzman DA, Holmes WE, Schneyer related gene (FLRG) promoter. Gene. 2007 May 15;393(1- AL. Human follistatin-related protein: a structural homologue of 2):153-62 follistatin with nuclear localization. Endocrinology. 2001 Aug;142(8):3426-34 Forissier S, Razanajaona D, Ay AS, Martel S, Bartholin L, Rimokh R. AF10-dependent transcription is enhanced by its Bartholin L, Maguer-Satta V, Hayette S, Martel S, Gadoux M, interaction with FLRG. Biol Cell. 2007 Oct;99(10):563-71 Corbo L, Magaud JP, Rimokh R. Transcription activation of FLRG and follistatin by activin A, through Smad proteins, Mukherjee A, Sidis Y, Mahan A, Raher MJ, Xia Y, Rosen ED, participates in a negative feedback loop to modulate activin A Bloch KD, Thomas MK, Schneyer AL. FSTL3 deletion reveals function. Oncogene. 2002 Mar 28;21(14):2227-35 roles for TGF-beta family ligands in glucose and fat homeostasis in adults. Proc Natl Acad Sci U S A. 2007 Jan Hill JJ, Davies MV, Pearson AA, Wang JH, Hewick RM, 23;104(4):1348-53 Wolfman NM, Qiu Y. The myostatin propeptide and the follistatin-related gene are inhibitory binding proteins of Pryor-Koishi K, Nishizawa H, Kato T, Kogo H, Murakami T, myostatin in normal serum. J Biol Chem. 2002 Oct Tsuchida K, Kurahashi H, Udagawa Y. Overproduction of the 25;277(43):40735-41 follistatin-related gene protein in the placenta and maternal serum of women with pre-eclampsia. BJOG. 2007 Sidis Y, Tortoriello DV, Holmes WE, Pan Y, Keutmann HT, Sep;114(9):1128-37 Schneyer AL. Follistatin-related protein and follistatin differentially neutralize endogenous vs. exogenous activin. Razanajaona D, Joguet S, Ay AS, Treilleux I, Goddard-Léon S, Endocrinology. 2002 May;143(5):1613-24 Bartholin L, Rimokh R. Silencing of FLRG, an antagonist of activin, inhibits human breast tumor cell growth. Cancer Res. Schneyer A, Schoen A, Quigg A, Sidis Y. Differential binding 2007 Aug 1;67(15):7223-9 and neutralization of activins A and B by follistatin and follistatin like-3 (FSTL-3/FSRP/FLRG). Endocrinology. 2003 Torres PB, Florio P, Ferreira MC, Torricelli M, Reis FM, May;144(5):1671-4 Petraglia F. Deranged expression of follistatin and follistatin- like protein in women with ovarian endometriosis. Fertil Steril. Wang HQ, Takebayashi K, Tsuchida K, Nishimura M, Noda Y. 2007 Jul;88(1):200-5 Follistatin-related gene (FLRG) expression in human endometrium: sex steroid hormones regulate the expression of Lara-Pezzi E, Felkin LE, Birks EJ, Sarathchandra P, Panse FLRG in cultured human endometrial stromal cells. J Clin KD, George R, Hall JL, Yacoub MH, Rosenthal N, Barton PJ. Endocrinol Metab. 2003 Sep;88(9):4432-9 Expression of follistatin-related genes is altered in heart failure. Endocrinology. 2008 Nov;149(11):5822-7 Ciarmela P, Florio P, Sigurdardottir M, Toti P, Maguer-Satta V, Rimokh R, Altomare A, Tosi P, Petraglia F. Follistatin-related Stamler R, Keutmann HT, Sidis Y, Kattamuri C, Schneyer A, gene expression, but not follistatin expression, is decreased in Thompson TB. The structure of FSTL3.activin A complex. human endometrial adenocarcinoma. Eur J Endocrinol. 2004 Differential binding of N-terminal domains influences follistatin- Aug;151(2):251-7 type antagonist specificity. J Biol Chem. 2008 Nov 21;283(47):32831-8 Archer HL, Gupta S, Enoch S, Thompson P, Rowbottom A, Chua I, Warren S, Johnson D, Ledbetter DH, Lese-Martin C, Bloise E, Couto HL, Massai L, Ciarmela P, Mencarelli M, Williams P, Pilz DT. Distinct phenotype associated with a Borges LE, Muscettola M, Grasso G, Amaral VF, Cassali GD, cryptic subtelomeric deletion of 19p13.3-pter. Am J Med Genet Petraglia F, Reis FM. Differential expression of follistatin and A. 2005 Jul 1;136(1):38-44 FLRG in human breast proliferative disorders. BMC Cancer. 2009 Sep 9;9:320 Bartholin L, Destaing O, Forissier S, Martel S, Maguer-Satta V, Jurdic P, Rimokh R. FLRG, a new ADAM12-associated Oshima Y, Ouchi N, Shimano M, Pimentel DR, Papanicolaou protein, modulates osteoclast differentiation. Biol Cell. 2005 KN, Panse KD, Tsuchida K, Lara-Pezzi E, Lee SJ, Walsh K. Jul;97(7):577-88 Activin A and follistatin-like 3 determine the susceptibility of heart to ischemic injury. Circulation. 2009 Oct Saito S, Sidis Y, Mukherjee A, Xia Y, Schneyer A. Differential 20;120(16):1606-15 biosynthesis and intracellular transport of follistatin isoforms and follistatin-like-3. Endocrinology. 2005 Dec;146(12):5052-62 Brown ML, Bonomi L, Ungerleider N, Zina J, Kimura F, Mukherjee A, Sidis Y, Schneyer A. Follistatin and follistatin Sidis Y, Schneyer AL, Keutmann HT. Heparin and activin- like-3 differentially regulate adiposity and glucose homeostasis. binding determinants in follistatin and FSTL3. Endocrinology. Obesity (Silver Spring). 2011 Oct;19(10):1940-9 2005 Jan;146(1):130-6 Shi FT, Cheung AP, Huang HF, Leung PC. Growth Grusch M, Drucker C, Peter-Vörösmarty B, Erlach N, Lackner differentiation factor 9 (GDF9) suppresses follistatin and A, Losert A, Macheiner D, Schneider WJ, Hermann M, Groome follistatin-like 3 production in human granulosa-lutein cells. NP, Parzefall W, Berger W, Grasl-Kraupp B, Schulte-Hermann PLoS One. 2011;6(8):e22866 R. Deregulation of the activin/follistatin system in hepatocarcinogenesis. J Hepatol. 2006 Nov;45(5):673-80 Cash JN, Angerman EB, Kattamuri C, Nolan K, Zhao H, Sidis Y, Keutmann HT, Thompson TB. Structure of Maguer-Satta V, Forissier S, Bartholin L, Martel S, Jeanpierre myostatin·follistatin-like 3: N-terminal domains of follistatin-type S, Bachelard E, Rimokh R. A novel role for fibronectin type I molecules exhibit alternate modes of binding. J Biol Chem. domain in the regulation of human hematopoietic cell 2012 Jan 6;287(2):1043-53 adhesiveness through binding to follistatin domains of FLRG and follistatin. Exp Cell Res. 2006 Feb 15;312(4):434-42 This article should be referenced as such: Sidis Y, Mukherjee A, Keutmann H, Delbaere A, Sadatsuki M, Grusch M. FSTL3 (follistatin-like 3 (secreted glycoprotein)). Schneyer A. Biological activity of follistatin isoforms and Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3):151-154. follistatin-like-3 is dependent on differential cell surface binding

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 154 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

GREB1 (growth regulation by estrogen in breast cancer 1) Kevin C Knower, Chantal B Magne Nde, Kyren Lazarus, Sarah Q To, Zhe Zhao, Ashwini L Chand, Colin D Clyne Cancer Drug Discovery Laboratory, Prince Henry's Institute, Clayton, Victoria, Australia (KCK, CBM, KL, SQT, ZZ, ALC, CDC)

Published in Atlas Database: September 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/GREB1ID40751ch2p25.html DOI: 10.4267/2042/48754 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

cell line) cDNA library, designated GREB1a, GREB1b Identity and GREB1c respectively (Ghosh et al., 2000). HGNC (Hugo): GREB1 The longest transcript variant is GREB1a, consisting of Location: 2p25.1 8482 bp spliced from 33 exons. GREB1b is 2521 bp in length and is spliced from 11 exons, whilst GREB1c is DNA/RNA 2432 bp long spliced from 10 exons. All three variants differ in their 5' and 3' UTRs and Description contain distinct c-terminus regions. In addition, up to 10 additional splice variants have The GREB1 gene is located on the short arm of been identified amongst clones from breast, uterus, chromosome 2, at 2q25.1, between the genomic sites prostate and brain (Dias Neto et al., 2000; Nagase et al., for E2F transcription factor 6 and neurotensin receptor 1998). 2 (Entrez gene 9687). It is encoded on the plus strand Expression of GREB1 variants have also been detected covering 108.68 kb from 11674242 to 11782912 in the ovary, prostate and pancreas (NCBI). (UCSC). The gene structure consists of 60 exons/alternative exons and 40 distinct introns. Protein Transcription The GREB1 gene contains a distal enhancer 20 kb Description upstream of the transcription start site containing 3 GREB1 protein has 7 isoforms containing a estrogen response elements (EREs), which bind transmembrane domain and/or N-myristoylation estrogen receptor α (ER α) in the presence of estrogen. domain. The three well documented isoforms of In breast cancer cells, the steroid receptor co-activator GREB1 protein, GREB1a, GREB1b and GREB1c SRC-3, phosphorylated RNA polymerase II and contain 1949, 457 and 409 amino acids, respectively actylated histones are also bound in the presence of (Table 1). estrogen. Chromatin loops link the three distal EREs They share N-terminus end region and containing and the transcription start site, indicating the distal diverging C-terminus end. enhancer plays a potent role in GREB1 estrogen The divergence between 1a and 1b start from 450 aa. responsiveness (Deschênes et al., 2007; Sun et al., GREB1c shares first 386 amino acids with GREB1a 2007). and differs from 387 to 409 amino acids (Ghosh et al., Three primary representative complete cDNA clones 2000). have been isolated from an MCF7 (ER+ breast cancer

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 155 GREB1 (growth regulation by estrogen in breast cancer 1) Knower KC, et al.

Figure 1. (a) The genomic location of GREB1 on the short arm of chromosome 2. (b) The 3 primary splice variants of GREB1, GREB1a, GREB1b and GREB1c. Green boxes represent exons, red lines introns. Numbers below exons indicate exon number. Numbers either side of variant indicate genomic location of the start and end of each transcript.

Expression Function GREB1 protein expression is found in both normal and The role of GREB1 is emerging as a hormone- cancerous tissues. Its regulation is not only correlated dependent mediator of tumour cell proliferation. with the presence of a subset of nuclear receptors such It has been reported to elicit estrogen and androgen- α as ER (Deschênes et al., 2007; Hnatyszyn et al., 2010; stimulated cell proliferation in breast and prostate Lin et al., 2004; Pellegrini et al., 2012), androgen tumours (Rae et al., 2006; Rae et al., 2005; Antunes et receptor (AR) (Rae et al., 2006) and Liver receptor al., 2012). Homolog 1 (LRH-1) (Chand et al., 2012) but also Whether the three variants have the same cellular depends on their activation. function is unclear and its precise mechanistic action In breast cancers, GREB1 protein is detected in within the cell has still not been demonstrated. ERalpha+ but not ERalpha-negative breast tumour The exact roles that GREB1 have in normal tissue are tissue (Hnatyszyn et al., 2010). poorly defined. In addition GREB1, regulated by androgens is expressed in proliferating prostatic tissue and prostate Homology cancer (Rae et al., 2006). GREB1 protein together with his paralogue GREB1- Localisation like located on chromosome 18 belong to the GREB1 family (Nagase et al., 2000). The GREB1 gene GREB1 protein expression is predominantly nuclear sequence is conserved in chimpanzee, dog, cow, with some cytoplasmic appearance (Hnatyszyn et al., mouse, chicken and monkey (HomoloGene). 2010).

Table 1. Isoforms of GREB1. 1=present, 0=absent.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 156 GREB1 (growth regulation by estrogen in breast cancer 1) Knower KC, et al.

significantly higher among patients with later stage Implicated in prostate cancers. Breast cancers Lung cancer Note Note A family of estrogen responsive genes discovered in Following exposure to 2R4F tobacco mainstream MCF7 cells were designated GREB (genes regulated smoke (MSS), GREB1 expression was elevated in by estrogen in breast cancer) (Ghosh et al., 2000). Of normal human bronchial epithelial (NHBE) cells these novel genes, GREB-1 was identified to have a (Parsanejad et al., 2008). Using human saliva samples strong correlation with ER α in breast cancer cells from 42 lung cancer patients and 74 healthy control (Ghosh et al., 2000; Rae et al., 2005). Interestingly, subjects, transcriptomes were analyzed by gene GREB-1 was significantly induced by E 2 in MCF-7 microarray and revealed that GREB1 was one of five cells and its suppression blocked E 2 induced growth biomarkers found to be elevated in lung cancer patients (Rae et al., 2005). Furthermore, the GREB-1 regulatory (Zhang et al., 2012). region was found to possess three crucial estrogen response elements (EREs) (Lin et al., 2004). In Ovarian cancer addition, ChIP analysis revealed the binding of ER α, Note the steroid receptor coactivator-3, acetylated histones To identify epigenetic changes associated with and phosphorylated RNA polymerase II to all three progression-free interval of ovarian cancer, 20 samples EREs in the presence of E 2 (Deschênes et al., 2007). of advanced ovarian cancer with a predominantly Subsequently, GREB-1 is now a well characterised serous papillary histological subtype were subjected to estrogen responsive gene used to identify ER α activity DNA methylation profiling. GREB1 promoter (Cai et al., 2011; Chand et al., 2012; Gupta et al., 2012; hypomethylation was associated with longer survival Liu et al., 2012; Rae et al., 2005; Sun et al., 2007; (Bauerschlag et al., 2011). Woodfield et al., 2010). Hnatyszyn, et al developed a Hypertension novel GREB-1 antibody which was used to detect GREB-1 protein expression in ER α+ve breast cancer Note cells and tissue (Hnatyszyn et al., 2010). A SNP, 45718A>G, was significantly associated with This positive correlation of GREB1 expression with hypertension and blood pressure level in men, and this ER α expression is validated in clinical cohorts (Ghosh SNP was in linkage disequilibrium with a SNP present et al., 2000). Another cohort of ER positive breast at the 3' splice site of intron 11 (Kamide et al., 2005). cancers in postmenopausal women (n=104) has shown a strong correlation of GREB-1 gene expression with References plasma E 2 levels (Dunbier et al., 2010). In a cohort of Nagase T, Ishikawa K, Miyajima N, Tanaka A, Kotani H, breast cancer patients (n=64) compared to healthy Nomura N, Ohara O. Prediction of the coding sequences of women (n=79) GREB-1 gene expression correlated unidentified human genes. IX. The complete sequences of 100 positively with serum E levels (Haakensen et al., new cDNA clones from brain which can code for large proteins 2 in vitro. DNA Res. 1998 Feb 28;5(1):31-9 2011). Furthermore in-vivo studies involving the transplantation of human breast tissue into female Dias Neto E, Correa RG, Verjovski-Almeida S, Briones MR, Nagai MA, da Silva W Jr, Zago MA, Bordin S, Costa FF, athymic mice (Balb/c nu/nu mice) has also Goldman GH, Carvalho AF, Matsukuma A, Baia GS, Simpson demonstrated the induction of GREB-1 in response to DH, Brunstein A, de Oliveira PS, Bucher P, Jongeneel CV, E2 treatment (Wilson et al., 2006). O'Hare MJ, Soares F, Brentani RR, Reis LF, de Souza SJ, Simpson AJ. Shotgun sequencing of the human transcriptome Prostate cancer with ORF expressed sequence tags. Proc Natl Acad Sci U S A. Note 2000 Mar 28;97(7):3491-6 High levels of GREB1 mRNA ,comparable to levels in Ghosh MG, Thompson DA, Weigel RJ. PDZK1 and GREB1 breast cancer MCF-7 cells, were found in prostatic are estrogen-regulated genes expressed in hormone- responsive breast cancer. Cancer Res. 2000 Nov tissues and prostate tumours (Rae et al., 2006). GREB1 15;60(22):6367-75 was found to be also expressed in the AR-positive cell line LNCaP but absent in the AR-negative cell line PC- Nagase T, Kikuno R, Hattori A, Kondo Y, Okumura K, Ohara O. Prediction of the coding sequences of unidentified human 3 (Rae et al., 2006). GREB1 expression was responsive genes. XIX. The complete sequences of 100 new cDNA clones to androgens via androgen response elements (ARE) from brain which code for large proteins in vitro. DNA Res. located ~3.3 kb upstream of the promoter. Knock-down 2000 Dec 31;7(6):347-55 of GREB1 in LNCaP cells led to the suppression of Lin CY, Ström A, Vega VB, Kong SL, Yeo AL, Thomsen JS, hormone-induced growth. Using microarray and qRT- Chan WC, Doray B, Bangarusamy DK, Ramasamy A, Vergara PCR analysis of 33 prostate cancer patients, GREB1 LA, Tang S, Chong A, Bajic VB, Miller LD, Gustafsson JA, Liu ET. Discovery of estrogen receptor alpha target genes and was found to be over-expressed 13-fold compared to response elements in breast tumor cells. Genome Biol. normal (Antunes et al., 2012). GREB1 transcript was 2004;5(9):R66

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 157 GREB1 (growth regulation by estrogen in breast cancer 1) Knower KC, et al.

Kamide K, Kokubo Y, Yang J, Tanaka C, Hanada H, Takiuchi Bauerschlag DO, Ammerpohl O, Bräutigam K, Schem C, Lin S, Inamoto N, Banno M, Kawano Y, Okayama A, Tomoike H, Q, Weigel MT, Hilpert F, Arnold N, Maass N, Meinhold- Miyata T. Hypertension susceptibility genes on chromosome Heerlein I, Wagner W. Progression-free survival in ovarian 2p24-p25 in a general Japanese population. J Hypertens. 2005 cancer is reflected in epigenetic DNA methylation profiles. May;23(5):955-60 Oncology. 2011;80(1-2):12-20 Rae JM, Johnson MD, Scheys JO, Cordero KE, Larios JM, Cai W, Kramarova TV, Berg P, Korbonits M, Pongratz I. The Lippman ME. GREB 1 is a critical regulator of hormone immunophilin-like protein XAP2 is a negative regulator of dependent breast cancer growth. Breast Cancer Res Treat. estrogen signaling through interaction with estrogen receptor α. 2005 Jul;92(2):141-9 PLoS One. 2011;6(10):e25201 Rae JM, Johnson MD, Cordero KE, Scheys JO, Larios JM, Haakensen VD, Bjøro T, Lüders T, Riis M, Bukholm IK, Gottardis MM, Pienta KJ, Lippman ME. GREB1 is a novel Kristensen VN, Troester MA, Homen MM, Ursin G, Børresen- androgen-regulated gene required for prostate cancer growth. Dale AL, Helland Å. Serum estradiol levels associated with Prostate. 2006 Jun 1;66(8):886-94 specific gene expression patterns in normal breast tissue and in breast carcinomas. BMC Cancer. 2011 Aug 3;11:332 Wilson CL, Sims AH, Howell A, Miller CJ, Clarke RB. Effects of oestrogen on gene expression in epithelium and stroma of Antunes AA, Leite KR, Reis ST, Sousa-Canavez JM, Camara- normal human breast tissue. Endocr Relat Cancer. 2006 Lopes LH, Dall'oglio MF, Srougi M. GREB1 tissue expression Jun;13(2):617-28 is associated with organ-confined prostate cancer. Urol Oncol. 2012 Jan-Feb;30(1):16-20 Deschênes J, Bourdeau V, White JH, Mader S. Regulation of GREB1 transcription by estrogen receptor alpha through a Chand AL, Wijayakumara DD, Knower KC, Herridge KA, multipartite enhancer spread over 20 kb of upstream flanking Howard TL, Lazarus KA, Clyne CD. The orphan nuclear sequences. J Biol Chem. 2007 Jun 15;282(24):17335-9 receptor LRH-1 and ER α activate GREB1 expression to induce breast cancer cell proliferation. PLoS One. 2012;7(2):e31593 Sun J, Nawaz Z, Slingerland JM. Long-range activation of GREB1 by estrogen receptor via three distal consensus Gupta N, Grebhardt S, Mayer D. Janus kinase 2--a novel estrogen-responsive elements in breast cancer cells. Mol negative regulator of estrogen receptor α function. Cell Signal. Endocrinol. 2007 Nov;21(11):2651-62 2012 Jan;24(1):151-61 Parsanejad R, Fields WR, Morgan WT, Bombick BR, Doolittle Liu J, Welm B, Boucher KM, Ebbert MT, Bernard PS. TRIM29 DJ. The time course of expression of genes involved in specific functions as a tumor suppressor in nontumorigenic breast cells pathways in normal human bronchial epithelial cells following and invasive ER+ breast cancer. Am J Pathol. 2012 exposure to cigarette smoke. Exp Lung Res. 2008 Feb;180(2):839-47 Oct;34(8):513-30 Pellegrini C, Gori I, Achtari C, Hornung D, Chardonnens E, Dunbier AK, Anderson H, Ghazoui Z, Folkerd EJ, A'hern R, Wunder D, Fiche M, Canny GO. The expression of estrogen Crowder RJ, Hoog J, Smith IE, Osin P, Nerurkar A, Parker JS, receptors as well as GREB1, c-MYC, and cyclin D1, estrogen- Perou CM, Ellis MJ, Dowsett M. Relationship between plasma regulated genes implicated in proliferation, is increased in estradiol levels and estrogen-responsive gene expression in peritoneal endometriosis. Fertil Steril. 2012 Nov;98(5):1200-8 estrogen receptor-positive breast cancer in postmenopausal women. J Clin Oncol. 2010 Mar 1;28(7):1161-7 Zhang L, Xiao H, Zhou H, Santiago S, Lee JM, Garon EB, Yang J, Brinkmann O, Yan X, Akin D, Chia D, Elashoff D, Park Hnatyszyn HJ, Liu M, Hilger A, Herbert L, Gomez-Fernandez NH, Wong DT. Development of transcriptomic biomarker CR, Jorda M, Thomas D, Rae JM, El-Ashry D, Lippman ME. signature in human saliva to detect lung cancer. Cell Mol Life Correlation of GREB1 mRNA with protein expression in breast Sci. 2012 Oct;69(19):3341-50 cancer: validation of a novel GREB1 monoclonal antibody. Breast Cancer Res Treat. 2010 Jul;122(2):371-80 This article should be referenced as such: Woodfield GW, Chen Y, Bair TB, Domann FE, Weigel RJ. Knower KC, Magne Nde CB, Lazarus K, To SQ, Zhao Z, Identification of primary gene targets of TFAP2C in hormone Chand AL, Clyne CD. GREB1 (growth regulation by estrogen responsive breast carcinoma cells. Genes Chromosomes in breast cancer 1). Atlas Genet Cytogenet Oncol Haematol. Cancer. 2010 Oct;49(10):948-62 2013; 17(3):155-158.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 158 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

SETBP1 (SET binding protein 1) Ion Cristóbal, Laura García-Orti, María D Odero Translational Oncology Division, Health Research Institute and Oncology Department, University Hospital "Fundacion Jimenez Diaz", Autonomous University of Madrid, E-28040 Madrid, Spain (IC), Division of Oncology, Center for Applied Medical Research (CIMA), University of Navarra, E-31008 Pamplona, Spain (LGO), Division of Oncology, Center for Applied Medical Research (CIMA), University of Navarra, E- 31008 Pamplona, Spain; Department of Genetics, School of Sciences, University of Navarra E-31008 Pamplona, Spain (MDO)

Published in Atlas Database: September 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/SETBP1ID44031ch18q12.html DOI: 10.4267/2042/48755 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Function SETBP1 overexpression promotes leukemogenesis by Other names: SEB enhancing full-length SET protein and then impairing HGNC (Hugo): SETBP1 the phosphatase activity of the tumor suppressor PP2A Location: 18q12.3 in acute myeloid leukaemia. In addition, defects in SETBP1 have been described as the cause of Schinzel- Local order: From centromere to telomere: SETBP1, Giedion syndrome. SMAD2, SMAD4, BCL2. Homology DNA/RNA The protein contains a region homologous to the dimerization domain of the SKI oncoprotein, six PEST Description sequences, three AT-hook DNA binding domains, a SETBP1 has two isoforms: transcript variant a spans SET-binding domain and three nuclear localization 387,61 kb on the genomic DNA and has 6 exons; signals. transcript variant b spans 197,24 kb on the genomic DNA and includes 4 exons. Mutations Transcription Somatic 9899 bp mRNA (isoform a); 1804 bp mRNA (isoform De novo mutations have been decribed in patients with b). Schinzel-Giedion syndrome: I871T (5 unrelated patients), D868N (4 unrelated patients), D868A (one Protein case), G870D (one case) and G870S (three unrelated Description patients) (Hoischen et al., 2010; Suphapeetiporn et al., 2011). Two isoforms: variant a (1596 amino acids); variant b (242 amino acids). Implicated in Expression Expressed in numerous tissues. Pediatric T-cell acute lymphoblastic leukemia (T-ALL) (Panagopoulos et al., Localisation 2007) Predominantly in the nucleus (Minakuchi et al., 2001; Cytogenetics Cristóbal et al., 2010). t(11;18)(p15;q12); only one case decribed so far.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 159 SETBP1 (SET binding protein 1) Cristóbal I, et al.

Hybrid/Mutated gene Oncogenesis 5' NUP98 - 3' SETBP1 SETBP1 overexpression promotes leukemogenesis by Abnormal protein enhancing full-length SET protein and then impairing The NUP98-SETBP1 fusion protein consists in the the phosphatase activity of the tumor suppressor PP2A exon 12 of NUP98 fused in-frame with exon 5 of through the formation of a SETBP1-SET-PP2A SETBP1. complex. Oncogenesis References SETBP1/NUP98 expression was not detected, suggesting that the NUP98/SETBP1 transcript is Minakuchi M, Kakazu N, Gorrin-Rivas MJ, Abe T, Copeland pathogenetically important. TD, Ueda K, Adachi Y. Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated Schinzel-Giedion syndrome leukemia-associated protein SET. Eur J Biochem. 2001 Mar;268(5):1340-51 Prognosis Panagopoulos I, Kerndrup G, Carlsen N, Strömbeck B, Defects in SETBP1 caused by the presence of the novo Isaksson M, Johansson B. Fusion of NUP98 and the SET mutations have been described as the cause of binding protein 1 (SETBP1) gene in a paediatric acute T cell Schinzel-Giedion midface retraction syndrome. lymphoblastic leukaemia with t(11;18)(p15;q12). Br J Haematol. 2007 Jan;136(2):294-6 Cytogenetics Normal karyotype. Cristóbal I, Blanco FJ, Garcia-Orti L, Marcotegui N, Vicente C, Rifon J, Novo FJ, Bandres E, Calasanz MJ, Bernabeu C, Acute myeloid leukemia (AML) Odero MD. SETBP1 overexpression is a novel leukemogenic mechanism that predicts adverse outcome in elderly patients Prognosis with acute myeloid leukemia. Blood. 2010 Jan 21;115(3):615- SETBP1 overexpression associates with worse overall 25 survival specially in the subgroup of elderly patients Hoischen A, van Bon BW, Gilissen C, Arts P, van Lier B, (older than 60 years). Steehouwer M, de Vries P, de Reuver R, Wieskamp N, Mortier G, Devriendt K, Amorim MZ, Revencu N, Kidd A, Barbosa M, Turner A, Smith J, Oley C, Henderson A, Hayes IM, Thompson EM, Brunner HG, de Vries BB, Veltman JA. De novo mutations of SETBP1 cause Schinzel-Giedion syndrome. Nat Genet. 2010 Jun;42(6):483-5 Suphapeetiporn K, Srichomthong C, Shotelersuk V. SETBP1 mutations in two Thai patients with Schinzel-Giedion syndrome. Clin Genet. 2011 Apr;79(4):391-3 Albano F, Anelli L, Zagaria A, Coccaro N, Casieri P, Minervini A, Specchia G. SETBP1 and miR_4319 dysregulation in primary myelofibrosis progression to acute myeloid leukemia. J Figure 1. Hematol Oncol. 2012 Aug 8;5:48 Cytogenetics This article should be referenced as such: The presence of a t(12;18)(p13;q12) has been describe in one case with AML secondary to myelodysplastic Cristóbal I, García-Orti L, Odero MD. SETBP1 (SET binding protein 1). Atlas Genet Cytogenet Oncol Haematol. 2013; syndrome (figure 1) (Cristóbal et al., 2010), and in one 17(3):159-160. case with AML secondary to primary myelofibrosis (Albano et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 160 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

SLIT3 (slit homolog 3 (Drosophila)) Kim Brussen Sanquin Research and Landsteiner Laboratory, Department of Hematopoiesis, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands (KB)

Published in Atlas Database: September 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/SLIT3ID50515ch5q34.html DOI: 10.4267/2042/48756 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

SLIT genes contain a large number of very small Identity exons, mostly encoding for one individual leucine rich Other names: MEGF5, SLIL2, SLIT1, Slit-3, slit2 repeat. HGNC (Hugo): SLIT3 This allows alternative splicing of the exons, without Location: 5q34 altering the frame (Little et al., 2002). 8 mRNA transcript variants were reported in ENSEMBL, of DNA/RNA which 3 transcript variants encode for a protein. The relevance of the differently spliced variants is Description unclear. Only one variant of SLIT3 was identified after 36 coding exons spanning 600 kb of the genome. All screening of a human fetal brain cDNA library or by SLIT genes contain CpG islands in their promoter nucleotide database searching (Little et al., 2002). regions and intron length and exon-intron boundaries are highly similar (Little et al., 2002; Dallol et al., Pseudogene 2005). None known. Transcription The leucine rich repeat regions of the three human

Genomic localization of SLIT3. The SLIT3 gene is shown in red, the surrounding genes in grey. The arrows indicate the direction of transcription (NCBI, version 27 nov 11). Adapted from NCBI map viewer.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 161 SLIT3 (slit homolog 3 (Drosophila)) Brussen K

Map of the SLIT3 gene, direction from 5'UTR till 3'UTR. The direction of transcription is indicated by the arrow. Exons are depicted as blue boxes. Within the first and the last exon, the 5'UTR and 3'UTR are depicted in yellow. The length of the exons and introns is roughly indicated, but is not up to scale. The size of the exons ranges from 72 base pairs up to 4950 base pairs, the size of the introns ranges from 605 base pairs up to 310141 base pairs. For clarity, the exons are depicted larger than the introns. Below is indicated which protein domains are encoded by particular exons. Based on ENSEMBL version 68 Juli 2012 transcript ENST00000519560. Information on protein domains encoded by particular exons was obtained from Little et al., 2002.

Artavanis-Tsakonas, 1992; Hohenester et al., 1999; Protein Nguyen-Ba-Charvet and Chedotal, 2002). SLIT Note proteins can be proteolytically cleaved within the EGF- The extracellular matrix protein SLIT was first like region, this has been shown to occur for SLIT2 and identified in a genetic screen for mutations that affected for SLIT3 (Brose et al., 1999; Patel et al., 2001; the dorsal-ventral patterning or the development of the Condac et al., 2012). Three different transcripts of central nervous system in Drosophila (Anderson et al., SLIT3, all containing 36 exons, encode for a protein. 1984; Seeger et al., 1993). SLIT homologues have These proteins are 1530, 1523, and 1472 amino acids since been found in C. elegans and in vertebrates, long (ENSEMBL ENSP00000430333, including mammals (Holmes et al., 1998; Itoh et al., ENSP00000332164, ENSP00000384890 respectively). 1998; Brose et al., 1999; Holmes et al., 2001; The protein of 1472 amino acids lacks the cysteine Vargesson et al., 2001; Gilthorpe et al., 2002). The knot, while the other two proteins contain all protein cognate receptor of the SLIT proteins is Roundabout or domains, although some domains differ slightly in ROBO (Kidd et al., 1999; Huminiecki et al., 2002). amino acid position and length. The SLIT3 protein of 1523 amino acids is the major expressed protein (NCBI Description accession AAQ89243). In mammals there are three SLIT genes which encode Expression large ECM glycoproteins of about 200 kDa, comprising a stretch of four leucine rich repeats (LRR) connected In humans, SLIT3 is expressed both during embryonic by disulphide bonds, seven to nine epidermal growth development and during adult life. During factor (EGF)-like domains, a domain named Agrin, embryogenesis, it is expressed in the fetal kidney, the Laminin, Perlecan and SLIT (ALPS) or laminin G-like fetal lung (Itoh et al., 1998) and to a lower extent in the module, and a C-terminal cystein knot (Rothberg and fetal brain and the fetal liver (Dickinson et al., 2004).

Domain organization of the SLIT protein from N-terminus to C-terminus. SS: N-terminal signal peptide; LRR: leucin-rich repeat; EGF-like: epidermal growth factor-like domain; Lam-G like: Agrin, Laminin, Perlecan and SLIT (ALPS) or laminin G-like module; Cystein knot: C-terminal cystein knot. The sciccors represent a proteolytic cleavage site. Adapted from figure created by dr. S.B. Geutskens (Leiden University Medical Center; Department of Immunohematology and Blood Transfusion & Einthoven laboratory for Experimental Vascular Medicine; Leiden; The Netherlands).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 162 SLIT3 (slit homolog 3 (Drosophila)) Brussen K

Thereafter, it is expressed in the kidney, the lung (Itoh proteins function as chemorepellents throughout the et al., 1998), the female reproductive tract central nervous system, thereby restricting the (endometrium, fallopian tube, ovaries, mammary gland, positioning of axons to their proper sites. Commisural placenta) ( Dickinson et al., 2004; Dickinson et al., axons defects have been reported in several studies. In 2008; Duncan et al., 2010; Dickinson et al., 2011), the Slit3 knockout mice, commisural axons stalled at the prostate (Dickinson et al., 2004), the heart, the lymph midline or projected aberrantly, although to a lesser nodes, the thyroid, the adrenal gland, the digestive tract extent as for the other Slit proteins (Unni et al., 2012). (stomach, small intestine, colon), the brain, the spinal In Slit1,2,3 triple knockout mice embryos, the cord (Itoh et al., 1998; Dickinson et al., 2004), the phenotype was more severe. 72% of the axons failed to spleen, the thymus, the skin and in bone marrow leave the midline and 20% recrossed the midline (Long stromal and endothelial cells (Dickinson et al., 2004; et al., 2004). Geutskens et al., 2012). Angiogenesis: In the early developing diaphragm, Localisation SLIT3 promotes vascular development. Slit3 homozygous knockout mice had reduced vascular SLIT is a secreted extra-cellular matrix protein that is density and branching points. These data are bound to the surface of the cell by the extracellular subtantiated by research on endothelial cell lines. In matrix, mainly by heparan sulfates (Liang et al., 1999; HUVECs, SLIT3 functioned as a chemoattractant that Ronca et al., 2001). It has been reported that both the induced endothelial cell chemotaxis and tube N-terminal part of SLIT2 (Hussain et al., 2006) and the formation, RhoGTPase activation and modulation of C-terminal part of SLIT2 and SLIT3 bind to heparin the actin cytoskeleton. The vascular defects in Slit3 and heparan sulfates (Ronca et al., 2001; Condac et al., homozygous knockout mice occured before the onset 2012). The interaction between SLIT proteins and of congenital diaphragmatic hernia (Zhang et al., 2009). heparan-sulfates is not only important for the binding Migration: SLIT is required for proper directional of SLIT proteins to the extracellular matrix, but can migration and for the regulation of proliferation and also increase the affinity of SLIT for ROBO (Hu et al., differentiation of various cell types during 2001). embryogenesis. SLITs not only regulate migration Removal of heparan sulfates from the cell surface during embryogenesis, but also during adult life. SLIT3 abolishes the response to SLIT2 (Hu et al., 2001; increases the migration of monocytes, macrophages Hussain et al., 2006). and endothelial cells both in vitro and in vivo (Tanno et Therefore, heparan-sulfates are considered as important al., 2007; Zhang et al., 2009; Geutskens et al., 2010), co-receptors in SLIT-ROBO signalling (Inatani et al., while it inhibits the migration of hematopoietic stem 2003; Steigemann et al., 2004; Hussain et al., 2006). and progenitor cells (HSPC) in vitro (Geutskens et al., The SLIT2 and the SLIT3 protein can be 2012). The differential response of cells to SLIT3 may proteolytically cleaved. Following proteolytic cleavage be explained by the level of ROBO1 expression; the of SLIT2, the 140kDa N-terminal fragment remains level of ROBO1 is lower in monocytes than in HSPC tightly associated to the cell surface, while the 50- (Geutskens et al., 2012). Cell-specific downstream 60kDa C-terminal fragment is more loosely attached signaling cues may also play a role. SLIT3 treatment of and can also be detected in conditioned medium (Brose monocytes activates the GTPase RhoA to enhance et al., 1999; Wang et al., 1999). migration (Geutskens et al., 2010). In contrast, SLIT3 Function inactivates RhoA in HSPC and inhibits their migration (Geutskens et al., 2012). HSPC that were pretreated The extra-cellular matrix protein SLIT binds to the with SLIT3 and transplanted into NOD-SCID mice transmembrane receptor Roundabout or ROBO and has showed increased homing to the bone marrow, which a conserved role in axon guidance in the central could be explained by modulation of SLIT/ ROBO nervous system (CNS), where SLIT functions as a signaling in the bone marrow environment. This is repellent for ROBO-expressing axons (Brose et al., supported by the fact that SLIT3 does not inhibit 1999; Kidd et al., 1999; Long et al., 2004). Outside the transendothelial migration of HSPC in vitro (Geutskens CNS, SLIT plays an important role during embryonic et al., 2012). development and in human pathology. Thus, the response to SLIT3 proteins may be dependent Neuronal guidance: Several types of axons and on the level of ROBO expression, downstream cell- neurons with different origins form a complex neuronal specific signaling cues and on the environment. circuitry that allows proper functioning of the brain. Vertebrate commissural neurons first arise in the dorsal Homology spinal cord. Their axons are directed to the midline/ A single slit gene was isolated in invertebrates, whereas floorplate by the chemoattractants netrin and sonic there are three SLIT genes in mammals. hedgehog. When these axons have reached the midline, The human SLIT3 protein shows 41,1% sequence they cross it and turn longitudinally on the opposite homology with Drosophila slit (Itoh et al., 1998; Brose side, growing right alongside the midline/ floor plate et al., 1999), 66% homology to human SLIT2 (NCBI (reviewed by Dickson and Gilestro, 2006). SLIT accession AAD25539.1, NCBI protein blast) and 60%

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 163 SLIT3 (slit homolog 3 (Drosophila)) Brussen K

homology to human SLIT1 (NCBI accession This was caused by a central tendon that remained BAA35184.1, NCBI protein blast). fused to the liver. In the defective tendon, the collagen fibers did not form tight bundles. Due to the herniation, Implicated in the orientation of the heart was twisted. The right ventricle faced ventrally and was enlarged Invasive ductal breast carcinoma (Liu et al., 2003). Note Disease Methylation of the 5'CpG islands in the SLIT3 gene Congenital diaphragmatic hernia is a rare anatomical was detected in 41% of breast tumor cell lines and in defect in the diaphragm. 16% of primary human breast tumors. The methylation As a result, abdominal organs can be herniated inside resulted in reduced SLIT3 expression. The methylation the thoracic cavity, which results in severe respiratory frequency was significantly lower than for SLIT2 complications. Malformations in the heart and the (Dickinson et al., 2004). Marlow et al. reported that vascular system are also commonly reported, resulting loss of SLIT2 and SLIT3 expression correlated with the in cardiovascular defects (reviewed in Tovar, 2012). upregulation of CXCR4 in human breast tumors. In Prognosis mouse mammary gland and in human MCF7 breast Congenital diaphragmatic hernia is associated with a cancer cells, this resulted in hyperplastic lesions and in high morbidity and a mortality rate of around 50% desmoplastic stroma. Overexpression of SLIT2 or (reviewed in Tovar, 2012). SLIT3 in human breast carcinoma MDA-MB-231 cells resulted in a down-regulation of CXCR4 expression, Renal agenesis reduced colony formation in vitro and in inhibition of Note tumor growth in a xenograft model in vivo. Inhibition In approximately 20% of Slit3 homozygous knockout of tumor growth and down-regulation of CXCR4 mice that were born and in 40% of homozygous mice expression in SLIT-expressing tumor cells was the that died before birth, unilateral or bilateral kidney and most prominent with overexpression of SLIT3 (Marlow ureter agenesis was found (Liu et al., 2003). et al., 2008). In addition, in one mouse one kidney was smaller than Glioma normal while the other kidney appeared normal in size. In another mouse, the kidneys were abnormally shaped Note and the left kidney extended to the right side and Methylation of the 5'CpG islands in the SLIT3 gene appeared to be connected with the right kidney (Liu et was detected in 29% of glioma tumor cell lines and in al., 2003). 35% of gliomas. 66,7% of the gliomas were classified as gliomblastoma multiforme, the rest was randomly Disease collected. No methylation was found in normal tissue During renal agenesis one (unilateral) or two (bilateral) from glioma patients (Dickinson et al., 2004). kidneys do not develop. Unilateral agenesis occurs more frequently than bilateral agenesis. Neurological diseases Unilateral renal agenesis is usually accompanied by an Hybrid/Mutated gene enlargement of cells in the developed kidney. When the It is not known whether the neuronal guidance defects kidney fails to develop, the ureter often also fails to cause neurological diseases in mice. However, it was develop. Alternatively, the ureter may be dilated reported that SLIT3 may be associated with (Mishra, 2007). neurological diseases in humans. Single nucleotide polymorphisms and duplications of the chromosomal References region harboring the SLIT3 gene were identified. Locus Anderson KV, Nüsslein-Volhard C. Information for the dorsal-- 5q35.1, encompassing the genes coding for SLIT3, ventral pattern of the Drosophila embryo is stored as maternal CCDC99 and DOCK2, had significant copy number mRNA. Nature. 1984 Sep 20-26;311(5983):223-7 variation in patients with major depressive disorder. In Rothberg JM, Artavanis-Tsakonas S. Modularity of the slit 0,7% of these cases, there was a duplication of 5q35.1 protein. Characterization of a conserved carboxy-terminal (Glessner et al., 2010). sequence in secreted proteins and a motif implicated in Furthermore, some of the SNPs located in introns and extracellular protein interactions. J Mol Biol. 1992 Sep exons of the SLIT3 gene showed significant association 20;227(2):367-70 with Schizophrenia in the Chinese Han population (Shi Seeger M, Tear G, Ferres-Marco D, Goodman CS. Mutations et al., 2004). affecting growth cone guidance in Drosophila: genes necessary for guidance toward or away from the midline. Congenital diaphragmatic hernia Neuron. 1993 Mar;10(3):409-26 Note Holmes GP, Negus K, Burridge L, Raman S, Algar E, Yamada Slit3 homozygous knockout mice suffered from T, Little MH. Distinct but overlapping expression patterns of two vertebrate slit homologs implies functional roles in CNS diaphragmatic hernia. development and organogenesis. Mech Dev. 1998 Dec;79(1- 2):57-72

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 164 SLIT3 (slit homolog 3 (Drosophila)) Brussen K

Itoh A, Miyabayashi T, Ohno M, Sakano S. Cloning and Dallol A, Morton D, Maher ER, Latif F. SLIT2 axon guidance expressions of three mammalian homologues of Drosophila slit molecule is frequently inactivated in colorectal cancer and suggest possible roles for Slit in the formation and suppresses growth of colorectal carcinoma cells. Cancer Res. maintenance of the nervous system. Brain Res Mol Brain Res. 2003 Mar 1;63(5):1054-8 1998 Nov 20;62(2):175-86 Inatani M, Irie F, Plump AS, Tessier-Lavigne M, Yamaguchi Y. Brose K, Bland KS, Wang KH, Arnott D, Henzel W, Goodman Mammalian brain morphogenesis and midline axon guidance CS, Tessier-Lavigne M, Kidd T. Slit proteins bind Robo require heparan sulfate. Science. 2003 Nov 7;302(5647):1044- receptors and have an evolutionarily conserved role in 6 repulsive axon guidance. Cell. 1999 Mar 19;96(6):795-806 Liu J, Zhang L, Wang D, Shen H, Jiang M, Mei P, Hayden PS, Hohenester E, Tisi D, Talts JF, Timpl R. The crystal structure Sedor JR, Hu H. Congenital diaphragmatic hernia, kidney of a laminin G-like module reveals the molecular basis of agenesis and cardiac defects associated with Slit3-deficiency alpha-dystroglycan binding to laminins, perlecan, and agrin. in mice. Mech Dev. 2003 Sep;120(9):1059-70 Mol Cell. 1999 Nov;4(5):783-92 Yuan W, Rao Y, Babiuk RP, Greer JJ, Wu JY, Ornitz DM. A Kidd T, Bland KS, Goodman CS. Slit is the midline repellent for genetic model for a central (septum transversum) congenital the robo receptor in Drosophila. Cell. 1999 Mar 19;96(6):785- diaphragmatic hernia in mice lacking Slit3. Proc Natl Acad Sci 94 U S A. 2003 Apr 29;100(9):5217-22 Liang Y, Annan RS, Carr SA, Popp S, Mevissen M, Margolis Wang B, Xiao Y, Ding BB, Zhang N, Yuan Xb, Gui L, Qian KX, RK, Margolis RU. Mammalian homologues of the Drosophila Duan S, Chen Z, Rao Y, Geng JG. Induction of tumor slit protein are ligands of the heparan sulfate proteoglycan angiogenesis by Slit-Robo signaling and inhibition of cancer glypican-1 in brain. J Biol Chem. 1999 Jun 18;274(25):17885- growth by blocking Robo activity. Cancer Cell. 2003 92 Jul;4(1):19-29 Wang KH, Brose K, Arnott D, Kidd T, Goodman CS, Henzel W, Astuti D, Da Silva NF, Dallol A, Gentle D, Martinsson T, Tessier-Lavigne M. Biochemical purification of a mammalian Kogner P, Grundy R, Kishida T, Yao M, Latif F, Maher ER. slit protein as a positive regulator of sensory axon elongation SLIT2 promoter methylation analysis in neuroblastoma, Wilms' and branching. Cell. 1999 Mar 19;96(6):771-84 tumour and renal cell carcinoma. Br J Cancer. 2004 Jan 26;90(2):515-21 Holmes G, Niswander L. Expression of slit-2 and slit-3 during chick development. Dev Dyn. 2001 Oct;222(2):301-7 Dickinson RE, Dallol A, Bieche I, Krex D, Morton D, Maher ER, Latif F. Epigenetic inactivation of SLIT3 and SLIT1 genes in Hu H. Cell-surface heparan sulfate is involved in the repulsive human cancers. Br J Cancer. 2004 Dec 13;91(12):2071-8 guidance activities of Slit2 protein. Nat Neurosci. 2001 Jul;4(7):695-701 Grieshammer U, Le Ma, Plump AS, Wang F, Tessier-Lavigne M, Martin GR. SLIT2-mediated ROBO2 signaling restricts Patel K, Nash JA, Itoh A, Liu Z, Sundaresan V, Pini A. Slit kidney induction to a single site. Dev Cell. 2004 May;6(5):709- proteins are not dominant chemorepellents for olfactory tract 17 and spinal motor axons. Development. 2001 Dec;128(24):5031-7 Long H, Sabatier C, Ma L, Plump A, Yuan W, Ornitz DM, Tamada A, Murakami F, Goodman CS, Tessier-Lavigne M. Ronca F, Andersen JS, Paech V, Margolis RU. Conserved roles for Slit and Robo proteins in midline Characterization of Slit protein interactions with glypican-1. J commissural axon guidance. Neuron. 2004 Apr 22;42(2):213- Biol Chem. 2001 Aug 3;276(31):29141-7 23 Vargesson N, Luria V, Messina I, Erskine L, Laufer E. Prasad A, Fernandis AZ, Rao Y, Ganju RK. Slit protein- Expression patterns of Slit and Robo family members during mediated inhibition of CXCR4-induced chemotactic and vertebrate limb development. Mech Dev. 2001 Aug;106(1- chemoinvasive signaling pathways in breast cancer cells. J 2):175-80 Biol Chem. 2004 Mar 5;279(10):9115-24 Dallol A, Da Silva NF, Viacava P, Minna JD, Bieche I, Maher Shi Y, Zhao X, Yu L, Tao R, Tang J, La Y, Duan Y, Gao B, Gu ER, Latif F. SLIT2, a human homologue of the Drosophila Slit2 N, Xu Y, Feng G, Zhu S, Liu H, Salter H, He L. Genetic gene, has tumor suppressor activity and is frequently structure adds power to detect schizophrenia susceptibility at inactivated in lung and breast cancers. Cancer Res. 2002 Oct SLIT3 in the Chinese Han population. Genome Res. 2004 15;62(20):5874-80 Jul;14(7):1345-9 Gilthorpe JD, Papantoniou EK, Chédotal A, Lumsden A, Steigemann P, Molitor A, Fellert S, Jäckle H, Vorbrüggen G. Wingate RJ. The migration of cerebellar rhombic lip Heparan sulfate proteoglycan syndecan promotes axonal and derivatives. Development. 2002 Oct;129(20):4719-28 myotube guidance by slit/robo signaling. Curr Biol. 2004 Feb Little M, Rumballe B, Georgas K, Yamada T, Teasdale RD. 3;14(3):225-30 Conserved modularity and potential for alternate splicing in Dallol A, Dickinson RE, Latif F.. DNA Methylation, Epigenetics mouse and human Slit genes. Int J Dev Biol. 2002;46(4):385- and Metastasis. Series: Cancer Metastasis – 91 Biology and Treatment, Vol. 7, DNA Methylation, Epigenetics Nguyen-Ba-Charvet KT, Chédotal A. Role of Slit proteins in the and Metastasis, 191-214. Esteller, Manel (Ed.) 2005, XII, 310 vertebrate brain. J Physiol Paris. 2002 Jan-Mar;96(1-2):91-8 p. Plump AS, Erskine L, Sabatier C, Brose K, Epstein CJ, Dickson BJ, Gilestro GF.. Regulation of commissural axon Goodman CS, Mason CA, Tessier-Lavigne M. Slit1 and Slit2 pathfinding by slit and its Robo receptors. Annu Rev Cell Dev cooperate to prevent premature midline crossing of retinal Biol. 2006;22:651-75. (REVIEW) axons in the mouse visual system. Neuron. 2002 Jan 17;33(2):219-32 Hussain SA, Piper M, Fukuhara N, Strochlic L, Cho G, Howitt JA, Ahmed Y, Powell AK, Turnbull JE, Holt CE, Hohenester E.. Dallol A, Krex D, Hesson L, Eng C, Maher ER, Latif F. A molecular mechanism for the heparan sulfate dependence of Frequent epigenetic inactivation of the SLIT2 gene in gliomas. slit-robo signaling. J Biol Chem. 2006 Dec 22;281(51):39693-8. Oncogene. 2003 Jul 17;22(29):4611-6 Epub 2006 Oct 24.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 165 SLIT3 (slit homolog 3 (Drosophila)) Brussen K

Werbowetski-Ogilvie TE, Seyed Sadr M, Jabado N, Angers- Dec;16(12):950-9. doi: 10.1093/molehr/gaq055. Epub 2010 Jul Loustau A, Agar NY, Wu J, Bjerkvig R, Antel JP, Faury D, Rao 22. Y, Del Maestro RF.. Inhibition of medulloblastoma cell invasion by Slit. Oncogene. 2006 Aug 24;25(37):5103-12. Epub 2006 Geutskens SB, Hordijk PL, van Hennik PB.. The Apr 24. chemorepellent Slit3 promotes monocyte migration. J Immunol. 2010 Dec 15;185(12):7691-8. doi: 10.4049/jimmunol.0903898. Mishra A.. Renal agenesis: report of an interesting case. Br J Epub 2010 Nov 15. Radiol. 2007 Aug;80(956):e167-9. Glessner JT, Wang K, Sleiman PM, Zhang H, Kim CE, Flory Tanno T, Fujiwara A, Sakaguchi K, Tanaka K, Takenaka S, JH, Bradfield JP, Imielinski M, Frackelton EC, Qiu H, Mentch F, Tsuyama S.. Slit3 regulates cell motility through Rac/Cdc42 Grant SF, Hakonarson H.. Duplication of the SLIT3 locus on activation in lipopolysaccharide-stimulated macrophages. 5q35.1 predisposes to major depressive disorder. PLoS One. FEBS Lett. 2007 Mar 6;581(5):1022-6. Epub 2007 Feb 12. 2010 Dec 1;5(12):e15463. doi: 10.1371/journal.pone.0015463. Andrews W, Barber M, Hernadez-Miranda LR, Xian J, Rakic S, Tseng RC, Lee SH, Hsu HS, Chen BH, Tsai WC, Tzao C, Sundaresan V, Rabbitts TH, Pannell R, Rabbitts P, Thompson Wang YC.. SLIT2 attenuation during lung cancer progression H, Erskine L, Murakami F, Parnavelas JG.. The role of Slit- deregulates beta-catenin and E-cadherin and associates with Robo signaling in the generation, migration and morphological poor prognosis. Cancer Res. 2010 Jan 15;70(2):543-51. doi: differentiation of cortical interneurons. Dev Biol. 2008 Jan 10.1158/0008-5472.CAN-09-2084. Epub 2010 Jan 12. 15;313(2):648-58. Epub 2007 Nov 13. Dickinson RE, Fegan KS, Ren X, Hillier SG, Duncan WC.. Dickinson RE, Myers M, Duncan WC.. Novel regulated Glucocorticoid regulation of SLIT/ROBO tumour suppressor expression of the SLIT/ROBO pathway in the ovary: possible genes in the ovarian surface epithelium and ovarian cancer role during luteolysis in women. Endocrinology. 2008 cells. PLoS One. 2011;6(11):e27792. doi: Oct;149(10):5024-34. doi: 10.1210/en.2008-0204. Epub 2008 10.1371/journal.pone.0027792. Epub 2011 Nov 23. Jun 19. Condac E, Strachan H, Gutierrez-Sanchez G, Brainard B, Marlow R, Strickland P, Lee JS, Wu X, Pebenito M, Binnewies Giese C, Heiss C, Johnson D, Azadi P, Bergmann C, Orlando M, Le EK, Moran A, Macias H, Cardiff RD, Sukumar S, Hinck R, Esmon CT, Harenberg J, Moremen K, Wang L.. The C- L.. SLITs suppress tumor growth in vivo by silencing terminal fragment of axon guidance molecule Slit3 binds Sdf1/Cxcr4 within breast epithelium. Cancer Res. 2008 Oct heparin and neutralizes heparin's anticoagulant activity. 1;68(19):7819-27. doi: 10.1158/0008-5472.CAN-08-1357. Glycobiology. 2012 Sep;22(9):1183-92. doi: 10.1093/glycob/cws087. Epub 2012 May 28. Prasad A, Paruchuri V, Preet A, Latif F, Ganju RK.. Slit-2 induces a tumor-suppressive effect by regulating beta-catenin Geutskens SB, Andrews WD, van Stalborch AM, Brussen K, in breast cancer cells. J Biol Chem. 2008 Sep Holtrop-de Haan SE, Parnavelas JG, Hordijk PL, van Hennik 26;283(39):26624-33. doi: 10.1074/jbc.M800679200. Epub PB.. Control of human hematopoietic stem/progenitor cell 2008 Jul 8. migration by the extracellular matrix protein Slit3. Lab Invest. 2012 Aug;92(8):1129-39. doi: 10.1038/labinvest.2012.81. Epub Dunwell TL, Dickinson RE, Stankovic T, Dallol A, Weston V, 2012 May 21. Austen B, Catchpoole D, Maher ER, Latif F.. Frequent epigenetic inactivation of the SLIT2 gene in chronic and acute Tovar JA.. Congenital diaphragmatic hernia. Orphanet J Rare lymphocytic leukemia. Epigenetics. 2009 May 16;4(4):265-9. Dis. 2012 Jan 3;7:1. doi: 10.1186/1750-1172-7-1. (REVIEW) Epub 2009 May 1. Unni DK, Piper M, Moldrich RX, Gobius I, Liu S, Fothergill T, Zhang B, Dietrich UM, Geng JG, Bicknell R, Esko JD, Wang L.. Donahoo AL, Baisden JM, Cooper HM, Richards LJ.. Multiple Repulsive axon guidance molecule Slit3 is a novel angiogenic Slits regulate the development of midline glial populations and factor. Blood. 2009 Nov 5;114(19):4300-9. doi: 10.1182/blood- the corpus callosum. Dev Biol. 2012 May 1;365(1):36-49. doi: 2008-12-193326. Epub 2009 Sep 9. 10.1016/j.ydbio.2012.02.004. Epub 2012 Feb 11.

Duncan WC, McDonald SE, Dickinson RE, Shaw JL, Lourenco This article should be referenced as such: PC, Wheelhouse N, Lee KF, Critchley HO, Horne AW.. Expression of the repulsive SLIT/ROBO pathway in the human Brussen K. SLIT3 (slit homolog 3 (Drosophila)). Atlas Genet endometrium and Fallopian tube. Mol Hum Reprod. 2010 Cytogenet Oncol Haematol. 2013; 17(3):161-166.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 166 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

ATF2 (activating transcription factor 2) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/ATF2ID718ch2q31.html DOI: 10.4267/2042/48757 This article is an update of : Lazo PA, Sevilla A. ATF2 (activating transcription factor 2). Atlas Genet Cytogenet Oncol Haematol 2008;12(1):33-34.

angiomatoid fibrous histiocytoma) harboring a Identity t(2;22)(q33;q12) or a t(12;22)(q13;q12) respectively Other names: CREB1, CRE-BP1, CREB2, CREBP1, (review in Huret, 2010). HB16, MGC111558, TREB7 HGNC (Hugo): ATF2 DNA/RNA Location: 2q31.1 Description Note Gene size: 96 Kb. ATF2 (2q31.1) is sometimes confused with CREB1 (2q33.3), because an alias of ATF2 is CREB1, also Transcription because they are both CREB-related proteins, a family Initiation codon located in exon 3. Normal message is of transcription factors of the bZIP superfamily, whose 1518 nucleotides. Numerous splice variants (24 members have the ability to heterodimerize with each according to Ensembl). other, and, finally, because CREB1, like ATF1 (but not A small isoform of ATF2, ATF2-small (ATF2-sm), ATF2 so far), is a fusion partner of EWSR1 in various with a calculated mass of 15 kDa, has no histone soft tissue tumors (clear cell sarcoma of the soft tissue, acetyltransferase (HAT) activity, but, still, has the ability to bind CRE-containing DNA.

ATF2 gene structure based on data available in the Ensembl release 44. Upstream non-coding exons (green). Coding exons (pink), 3' untranslated sequence (red). The size of the exons in nucleotides is indicated below each exon. Exon number is indicated within the exon.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 167 ATF2 (activating transcription factor 2) Huret JL

ATF2-sm is only composed of the first two and last two Expression exons of ATF2. Within the body of the uterus, ATF2 Ubiquitously expressed. High expression in brain and full length is expressed only in the lower segment, in regenerating liver (Takeda et al., 1991). whereas there is a gradient of expression of the ATF2- sm protein with the highest level in the upper segment. Localisation A significant number of genes are differentially Cytoplasmic and nuclear protein. The nuclear transport regulated by the ATF2-fl and ATF2-sm transcription signals (NLS and NES) contribute to the shuttling of factors (Bailey et al., 2002; Bailey and Europe-Finner, ATF2 between the cytoplasm and the nucleus. ATF2 2005). homodimers are localized in the cytoplasm, and prevent its nuclear import. Heterodimerization with JUN Protein prevents nuclear export of ATF2. JUN-dependent nuclear localization of ATF2 occurs upon stimulating Description conditions (retinoic acid-induced differentiation and ATF2 is one of 16 members of the ATF and CREB UV-induced cell death) (Liu et al., 2006). group of bZIP transcription factors, components of the Phosphorylation of ATF2 on Thr52 by PRKCE activating protein 1 (AP-1). The canonical form of (PKCE) promotes its nuclear retention and ATF2 is made of 505 amino acids, 54.537 kDa transcriptional activity (Lau et al., 2012). Stress- or according to Swiss-Prot. ATF2 comprises from N-term damage-induced cytosolic localization of ATF2 could to C-term a zinc finger (C2H2-type; DNA binding) be associated with cell death (Lau and Ronai, 2012). (amino acids 25-49), a transactivation domain (aa 19- When ATF2 translocates to the cytoplasm, it localizes 106, Nagadoi et al., 1999), two proline-rich domain, at the mitochondrial outer membrane (Lau et al., 2012). (involved in protein-protein interaction) (Pro202, 207, Function 210, 212, 214, 216, 222, 228, 231 and 243, 247, 251, 256, 259, 261, 263, 267, 269), two glutamine-rich - ATF2 is a transcription factor. ATF2 forms a domains (involved in transcriptional trans-activation) homodimer or a heterodimer with JUN (Hai and (Gln268, 271, 284, 285 and 306, 313, 316, 317), a basic Curran, 1991), or other proteins (see below). motif (amino acids 351-374), and a leucine zipper - Typically, it binds to the cAMP-responsive element domain (amino acids 380-408, and a nuclear export (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), a signal), making a basic leucine zipper required for sequence present in many cellular promoters (Hai et dimerization, and involved in CRE-binding (Kara et al., al.,1989). However, depending on the heterodimeric 1990 and Swiss-Prot.). ATF2 contains two canonical partner, ATF2 binds to different response elements on nuclear localization signals (NLS) in its basic motif, target genes. ATF2/JUN and ATF2/CREB1 bind the and two nuclear export signal (NES) in its leucine above noted concensus sequence. ATF2 is mainly a zipper, one of which in N-term: (1)MKFKLHV(7) (Liu transcription activator, but it also may be a et al., 2006; Hsu and Hu, 2012). transcription repressor (reviews in Bhoumik and Ronai,

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 168 ATF2 (activating transcription factor 2) Huret JL

2008; Lopez-Bergami et al., 2010; Lau and Ronai, "b-ZIP") of ATF2 enables homo- or hetero- 2012). dimerization. Activation of ATF2 The main dimerization partners of ATF2 are the ATF2 is activated by stress kinases, including JNK following: ATF2, BRCA1, CREB1, JDP2, JUN, JUNB, (MAPK8, MAPK9, MAPK10) and p38 (MAPK1, JUND, MAFA, NF1, NFYA, PDX1, POU2F1, TCF3 MAPK11, MAPK12, MAPK13, MAPK14) and is (Lau and Ronai, 2012). implicated in transcriptional regulation of immediate ATF2 homodimers have a low transcriptional activity. early genes regulating stress and DNA damage MAPKAP1 (SIN1) binds to the b-ZIP region of ATF2, responses (Gupta et al., 1995; van Dam et al., 1995) and also binds MAPK14, and is required for MAPK14- and cell cycle control under normal growth induced phosphorylation of ATF2 in response to conditions.(up-regulation of the CCNA2 (cyclin A) osmotic stress, and activates the transcription of promoter at the G1/S boundary) (Nakamura et al., apoptosis-related genes (Makino et al., 2006). 1995). In response to stimuli, ATF2 is phosphorylated In response to stress, ATF2 binds to POU2F1 (OCT1), on threonine 69 and/or 71 by JNK or by p38. NFI, and BRCA1 to activate transcription of GADD45. Phosphorylation on Thr69 and Thr71 of ATF2 and its The b-Zip region of ATF2 is critical for binding to dimerization are required to activate ATF2 BRCA1. ATF2 also binds and activates SERPINB5 transcription factor activity. Phosphorylation on Thr69 (Maspin) (Maekawa et al., 2008). occurs through the RALGDS-SRC-P38 pathway, and ATF2 also forms a heterodimer with JDP2, a repressor phosphorylation on Thr71 occurs through the RAS- of AP-1. JDP2 inhibits the transactivation of JUN by MEK-ERK pathway (MAPK1, MAPK3 (ERK1), ATF2 (Jin et al., 2002). MAPK11, MAPK12 and MAPK14) (Gupta et al., ATF2 target genes 1995; Ouwens et al., 2002). Under genotoxic stress, a study showed that 269 genes The intrinsic histone acetylase activity of ATF2 were found to be bound by ATF2/JUN dimers. promotes its DNA binding ability (Abdel-Hafiz et al., Immediate-early genes were a notable subset and 1992; Kawasaki et al., 2000). included EGR family members, FOS family members, Interaction of ATF2 with CREBBP (CREB-binding and JUN family members, but the largest group of protein, also called p300/CBP) is dependent upon genes belonged to the DNA repair machinery phosphorylation at Ser121 induced by PRKCA. ATF2 (Hayakawa et al., 2004, see below). and CREBBP cooperate in the activation of Among the ATF2 target genes are : transcription (Kawasaki et al., 1998; Yamasaki et al., - Transcription factors, such as JUN, ATF3, DDIT3 2009). (CHOP), FOS, JUNB, VRK1 activates and stabilizes ATF2 through direct - DNA damage proteins (see below), phosphorylation of Ser62 and Thr73 (Sevilla et al., - Cell cycle regulators (CCNA2, CCND1), see below, 2004). - Regulators of apoptosis (see below and Hayakawa et Down regulation of ATF2 al., 2004), Among other down regulation mechanisms, ATF2 is - Growth factor receptors and cytokines such as down regulated, by MIR26B in response to ionizing PDGFRA (Maekawa et al., 1999), IL8 (Agelopoulos radiation (Arora et al., 2011). and Thanos, 2006), FASLG (Fas ligand), TNF Transcriptionally active dimers of ATF2 protein are (TNFalpha), TNFSF10 family (Herr et al., 2000; Faris regulated by ubiquitylation and proteosomal et al., 1998), degradation (Fuchs et al., 1999); phosphorylation of - Proteins related with invasion such as MMP2 (Hamsa ATF2 on Thr69 and Thr71 promotes its ubiquitylation and Kuttan, 2012) and PLAU (UPA): ATF2/JUN and degradation (Firestein and Feuerstein, 1998). heterodimer binds to and activates PLAU (De Cesare et A cytoplasmic alternatively spliced isoform of ATF7, al., 1995), ATF7-4, is a cytoplasmic negative regulator of both - Cell adhesion molecules, such as SELE, SELP, and ATF2 and ATF7. It impairs ATF2 and ATF7 VCAM1 (Reimold et al., 2001), phosphorylation (ATF7-4 indeed sequesters the Thr53- - Proteins engaged in the response to endoplasmic phosphorylating kinase in the cytoplasm, preventing reticulum (ER) stress. ATF2/CREB dimers bind the Thr53 phosphorylation of ATF7) and transcriptional CRE-like element TGACGTGA of HSPA5 (Grp78) activity (Diring et al., 2011). and activates it (Chen et al., 1997), The activity of ATF2 is repressed by an intramolecular - Genes encoding extracellular matrix components interaction between the N-terminal domain and the b- seem to constitute an important subset of ATF2/JUN- ZIP domain (Li and Green, 1996). The N-terminal target genes (van Dam and Castellazzi, 2001). nuclear export signal (NES) of ATF2 negatively - PTEN, a negative regulator of the PI3K/AKT regulates ATF2 transcriptional activity (Hsu and Hu, signaling pathway, is positively regulated by ATF2 2012). (Qian et al., 2012). Dimerization of ATF2 - ATF1 and ATF2 regulate TCRA and TCRB gene The basic leucine zipper (basic motif + leucine zipper, transcription.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 169 ATF2 (activating transcription factor 2) Huret JL

Histones, Chromatin Under non-stressed conditions, ATF2 in cooperation UV treatment or ATF2 phosphorylation increases its with the ubiquitin ligase CUL3 promotes the histone acetyltransferase (HAT) activity as well as its degradation of KAT5 (Bhoumik et al., 2008a). transcriptional activities. Lys296, Gly297 and Gly299, Following genotoxic stress, 269 genes were found to be are essential both for histone acetyltransferase activity bound by ATF2/JUN dimers (see above), of which and for transactivation (Kawasaki et al., 2000). were 23 DNA repair or repair-associated genes Binding of ATF2 to the histone acetyltransferase (ERCC1, ERCC3, XPA, MSH2, MSH6, RAD50, RUVBL2 (TIP49b) suppresses ATF2 transcriptional RAD23B, MLH1, HIST1H2AC, PMS2, FOXN3 activity. RUVBL2's association with ATF2 is (CHES1), LIG1, ERCC8 (CKN1), UNG, XRCC6 phosphorylation dependent and requires amino acids (G22P1), TREX1, PNP, GTF2H1, ATM, FOXD1, 150 to 248 of ATF2 (Cho et al., 2001). DDX3X, DMC1, and the DNA repair-associated ATF2 interacts with the acetyltransferase domains of GADD45G), derived from several recognized DNA CREBBP. ATF2 b-ZIP could serve as an repair mechanisms (Hayakawa et al., 2004). acetyltransferase substrate for the acetyltransferase Cell Cycle domains of CREBBP. ATF2 is acetylated on Lys357 RB1 constrains cellular proliferation by activating the and Lys374 by CREBBP, which contributes to its expression of the inhibitory growth factor TGFB2 transcriptional activity (Karanam et al., 2007). (TGF-beta 2) through ATF2 (Kim et al., 1992). ATF2 and ATF4 are essential for the transcriptional CREB1 dimerizes with ATF2 to bind to the CCND1 activation of DDIT3 (CHOP) upon amino acid (cyclin D1) promoter, to increase CCD1 expression starvation. (Beier et al., 1999). ATF2 is essential in the acetylation of histone H4 and JUND dimerizes with ATF2 to repress CDK4 H2B, and thereby may be involved in the modification transcription, a protein necessary for the G1-to-S phase of the chromatin structure. An ATF2-independent HAT transition during the cell cycle, by binding to the activity is involved in the amino acid regulation of proximal region of the CDK4-promoter, contributing to ASNS transcription (Bruhat et al., 2007). the inhibition of cell growth. The physical interactions The histone variant macroH2A recruitement into of ATF2 with JUND implicates the b-ZIP domain of nucleosomes could confer an epigenetic mark for gene ATF2 (Xiao et al., 2010). repression. The constitutive DNA binding of the Heterodimerization of JUND with ATF2 activates ATF2/JUND heterodimer to the IL-8 enhancer recruits CCNA2 (cyclin A) promoter. CCNA2 is essential for macroH2A-containing nucleosomes in B cells, thus the control at the G1/S and the G2/M transitions of the inhibiting transcriptional activation (Agelopoulos and cell cycle. Thanos, 2006). In contrast, ATF4 expression suppresses the promoter Heat shock or osmotic stress induces phosphorylation activation mediated by ATF2 (Shimizu et al., 1998). of dATF2 (ATF2 in Drosophila), results in its release Apoptosis from heterochromatin, and heterochromatic disruption. ATF2/CREB1 heterodimer binds to the CRE element dATF2 regulates heterochromatin formation. ATF2 of the BCL2 promoter (Ma et al., 2007). may be involved in the epigenetic silencing of target ATF2 induces BAK upregulation (Chen et al., 2010). genes in euchromatin. The stress-induced ATF2- MAP3K5 (ASK1) activates ATF2 and FADD-CASP8- dependent epigenetic change was maintained over BID signalling, resulting in the translocation of BAX generations, suggesting a mechanism by which the and BAK, and subsequently mitochondrial effects of stress can be inherited (Seong et al., 2011). dysregulation (Hassan et al., 2009). DNA damage response ATF2/JUN heterodimers bind and activate CASP3, a Phosphorylation on Ser490 and Ser498 by ATM is key executor of neuronal apoptosis (Song et al., 2011). required for the activation of ATF2 in DNA damage Following death receptor stimulation, there is response. Phosphorylation of ATF2 results in the phosphorylation and binding of ATF2/JUN to death- localisation of ATF2 in ionizing radiation induced foci inducing ligands promoters (FASLG, TNF, TNFSF10), (in cells exposed to ionizing radiation (IR), several which allows the spread of death signals (Herr et al., proteins phosphorylated by ATM translocate and 2000). Neuronal apoptosis requires the concomitant colocalize to common intranuclear sites. The resulting activation of ATF2/JUN and downregulation of FOS IR-induced nuclear foci (IRIF) accumulate at the sites (Yuan et al., 2009). of DNA damage). ATF2 expression contributes to the Many drugs are currently being tested for their ability selective recruitment of MRE11A, RAD50, and NBN to inhibit cell proliferation and induce apoptosis (NBS1) into IRIF. ATF2 is required for the IR-induced through various pathways, including ATF2 pathway. S phase checkpoint, and this function is independant of In the cytoplasm, ATF2 abrogates formation of its transcriptional activity (Bhoumik et al., 2005). complexes containing HK1 and VDAC1, deregulating KAT5 (TIP60) is a histone acetyltransferase and mitochondrial outer-membrane permeability and chromatin-modifying protein involved in double strand initiating apoptosis. This function is negatively breaks (DSB) repair, interacting with and acetylating regulated phosphorylation of ATF2 by PRKCE, which ATM. ATF2 associates with KAT5 and RUVBL2. dictates its nuclear localization (Lau et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 170 ATF2 (activating transcription factor 2) Huret JL

Metabolic control and Insulin signalling JUNB dimerizes with either ATF2 or FOS to increased ATF2 has been implicated in the regulation of proteins CBFB promoter activity, and further expression of involved in metabolic control, including the control of MMP13, which suggests important role in the expression of UCP1, a protein involved in neovascularization (Licht et al., 2006). thermogenic response in brown adipose tissue (Cao et Epithelial mesenchymal transition al., 2004) and phosphoenolpyruvate carboxykinase (PEPCK), a protein regulating gluconeogenesis Note (Cheong et al., 1998). Epithelial mesenchymal transition (EMT) is Insulin activates ATF2 by phosphorylation of Thr69 characterized by the loss of the epithelial cell properties and Thr71 (Baan et al., 2006). and the development of mesenchymal properties of Co-expression of ATF2, MAFA, PDX1, and TCF3 cells, with altered cytoskeletal organization and results in a synergistic activation of the insulin enhanced migratory and invasive potentials. promoter in endocrine cells of pancreatic islets. ATF2, EMT is seen in embryonic development, MAFA, PDX1, and TCF3 form a multi-protein organogenesis, wound healing, and oncogenesis. TGF- complex to facilitate insulin gene transcription (Han et beta induces EMT, and is up-regulated by ATF2 (Bakin al., 2011). et al., 2002; Venkov et al., 2011; Xu et al., 2012). ATF2 target genes in insulin signalling are ATF3, JUN, Allergic asthma EGR1, DUSP1 (MKP1), and SREBF1. Deregulation of Note these genes is linked to the pathogenesis of insulin resistance, beta-cell dysfunction and vascular In a mouse model of allergic asthma, Aspergillus complications found in type 2 diabetes. Therefore, fumigatus provokes the secretion TNF (TNFalpha) by aberrant ATF2 activation under conditions of insulin A. fumigatus-activated macrophages. In response to resistance may contribute to the development of type 2 TNF, ATF2/JUN, RELA/RELA (p65/p65) and diabetes (Baan et al., manuscript in preparation). USF1/USF2 complexes are recruited to the PLA2G4C Iron depletion enhancer in lung epithelial cells (Bickford et al., 2012). Iron depletion induced by chelators increases the Autoimmune diseases phosphorylation of JNK and MAPK14, as well as the Note phosphorylation of their downstream targets p53 and SMAD3 and ATF2 are activated during Theiler's virus ATF2 (Yu and Richardson, 2011). (TMEV) infection (which may provoke an autoimmune demyelinating disease). Mutations SMAD3 and ATF2 activate IL-23 p19 promoter (Al- Note Salleeh and Petro, 2008). v-Rel-mediated transformation suggests opposing roles IL-23 consists of a p40 subunit IL12B coupled to the for ATF2 in oncogenesis. The increase in ATF2 p19 subunit IL23A, and has an essential role in the expression observed in v-Rel-transformed cells development of T cell-mediated autoimmune diseases promotes oncogenesis. On the other hand, enhanced (Inoue, 2010). expression of ATF2 inhibits transformation by v-Rel. Vascular homeostasis ATF2 can regulate signaling pathways in a cell type- specific and/or context-dependent manner. Differences Note were found in the stage at which ATF2 regulated the CD39 is a transmembrane protein expressed on the RAS/RAF/MAPK signaling pathway in fibroblast surface of vascular and immune cells. CD39 inhibits (where it blocked the activation of RAF, platelet activation, maintains vascular fluidity, and MAP2K1/MAP2K2, MAPK1/MAPK3) and in the provides protection from both cardiac and cerebral lymphoid DT40 B-cell line (where overexpression of ischemia and reperfusion injuries. cAMP regulates ATF2 increased HRAS activity and phosphorylated CD39 expression through ATF2, which binds a CRE- RAF. ATF2 exhibits both oncogenic and tumor like regulatory element lying 210 bp upstream of the suppressor properties (Liss et al., 2010). CD39 transcriptional start point (Liao et al., 2010). Somatic Bone development V258I in lung cancer cell lines (Woo et al., 2002). Note K105T in pancreatic cancer cell lines (Jones et al., ATF2 promotes chondrocyte proliferation and cartilage 2008). development through CCND1 upregulation in chondrocytes (Beier et al., 1999); mice carrying a Implicated in germline mutation in ATF2 have a defect in endochondral ossification (Reimold et al., 1996). Angiogenesis ATF2 regulates the expression of RB1, which regulates Note the G1- to S-phase transition by sequestering the E2F The basic leucine zipper (basic motif + leucine zipper, family members, necessary for cell cycle progression. When E2Fs are released, the cell is committed to

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 171 ATF2 (activating transcription factor 2) Huret JL

Table 1. Induction of activating transcription factors in the nucleus accumbens and their regulation of emotional behavior. (from Green et al., 2008). progress through the cell cycle, which is essential in ATF2/JUN heterodimers bind and activate CASP3, a regulating cell proliferation vs differentiation.of key executor of neuronal apoptosis, in cerebellar chondrocytes and endochondral bone growth (Vale- granule neurons (Song et al., 2011). Cruz et al., 2008). ATF2/JUN heterodimers bind and activate HRK (DP5, ATF2/CREB1 binds to CRE domain of TNFSF11 death protein 5/harakiri), a proapoptotic gene, (RANKL) promoter and TNFSF11 expression promoting the death of sympathetic neurons (Ma et al., stimulates osteoclastogenesis in mouse 2007; Towers et al., 2009), but also ATF2/JUN binds to stromal/osteoblast cells (Bai et al., 2005). two conserved CRE sites in the DUSP1 (MKP1) Binding of JUN CREB1, ATF1, and ATF2 complexes promoter; overexpression of DUSP1 inhibits JNK- are required for COL24A1 transcription, a marker of mediated phosphorylation of JUN and protect late osteoblast differentiation (Matsuo et al., 2006). sympathetic neurons from apoptosis (Kristiansen et al., Luteolin, a flavonoid, inhibits TNFSF11-induced 2010). osteoclastogenesis through the inhibition of ATF2 ATF2 overexpression in nucleus accumbens produces phosphorylation (Lee et al., 2009). increases in emotional reactivity and antidepressant- Brain like responses (Green et al., 2008), see Table 1. Note Skin and skin cancers ATF2 is expressed with large variations in intensity Note (and often highly expressed), according to the brain Inhibition of ATF2 with increased JNK/JUN and region examined. JUND induces apoptosis of melanoma cells (Bhoumik Altogether, ATF2 seems to play a fundamental role in et al., 2004). MITF downregulation is mediated by neuronal viability and in neurological functions in the ATF2/JUNB-dependent suppression of SOX10 normal brain and is down-regulated in the hippocampus transcription (Shah et al., 2010); MITF is a and the caudate nucleus in Alzheimer, Parkinson and transcription factor for tyrosinase (TYR) and plays a Huntington diseases (Pearson et al., 2005). role in melanocyte development. Mice carrying a germline mutation in ATF2 had a ATF2 attenuates melanoma susceptibility to apoptosis. reduced number of cerebellar Purkinje cells, atrophic ATF2 control of melanoma development is mediated vestibular sense organs, an ataxic gait, through its negative regulation of SOX10 and hyperactivity,and decreased hearing (Reimold et al., consequently of MITF transcription. The ratio of 1996). nuclear ATF2 to MITF expression is associated with A missense mutation in ATF2 in dogs has shown to poor prognosis (Shah et al., 2010). Assignment to the provoke an autosomal recessive disease with short low-risk group in stage II melanoma requires elevated stature and weakness at birth, ataxia and generalized levels of overall CTNNB1 (beta-catenin) and nuclear seizures, dysplastic foci consisting of clusters of CDKN1A (p21WAF1), decreased levels of fibronectin, intermixed granule and Purkinje cells, and death before and distributions that favor nuclear concentration for 7 weeks of age (Chen et al., 2008d). CDKN2A (p16INK4A) but cytoplasmic concentration ATF2 plays critical roles for the expression of the TH for ATF2 (Gould Rothberg et al., 2009). gene (tyrosine hydroxylase) and for neurite extension Phosphorylated ATF2 (p-ATF2) is significantly of catecholaminergic neurons (Kojima et al., 2008). overexpressed in cutaneous angiosarcoma (malignant Neuronal-specific ATF2 expression is required for tumor) and pyogenic granuloma (benign tumor) than in embryonic survival, ATF2 has a strong pro-survival normal dermal vessels (Chen et al., 2008a); p-ATF2 is role in somatic motoneurons of the brainstem, and loss also overexpressed in cutaneous squamous cell of functional ATF2 leads to hyperphosphorylated JNK carcinoma, Bowen's disease, and basal cell carcinomas, and p38, and results in somatic and visceral as compared to its expression in normal skin (Chen et motoneuron degeneration (Ackermann et al., 2011). al., 2008b). On the other hand, activated ATF2 promotes apoptosis p-ATF2 is also overexpressed in eccrine porocarcinoma of various brain cells, of which are cerebellar granule and eccrine poroma (Chen et al., 2008c). neurons (Ramiro-Cortés et al., 2011; Song et al., 2011).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 172 ATF2 (activating transcription factor 2) Huret JL

ATF2 mutant mice in which the ATM phosphoacceptor gland development, a function that may be crucial to its sites (S472/S480) were mutated (ATF2KI mice) are ability to suppress breast cancer. (Wen et al., 2011). more sensitive to ionizing radiation IR, exhibit ATF2/JUN binds to a potential CRE element of increased intestinal cell apoptosis, develop a higher FOXP3, and induces its expression. number of low-grade skin tumors (papillomas, FOXP3 acts as a transcriptional repressor of oncogenes squamous cell carcinomas, spindle cell carcinomas) (Li such as ERBB2 and SKP2, and is able to cause et al., 2010). A decrease of nuclear ATF2 and high apoptosis of breast cancer cells. CTNNB1 (beta-catenin) expression is seen in The use of this ATF2-FOXP3 pathway may be of squamous cell carcinoma and basal cell carcinoma, potential interest in future therapeutic approach of compared to normal skin, while the cytoplasmic ATF2 breast cancer. (Liu et al., 2009). expression was not significantly different in cancer and Aggressive basal-like breast cancer cells exhibit high normal skin (Bhoumik et al., 2008b). expression of FOSL1 (FRA1)/JUN dimers rather than A nuclear localization of ATF2 would be associated ATF2/JUN dimers (Baan et al., 2010). with its oncogenic properties, and a cytosolic localization with its tumor suppressor properties (Lau Uterus cancer and Ronai, 2012). Note High levels of ATF2/JUN dimers induce autocrine In PTEN-deficient endometrial cancers (which growth and primary tumor formation of fibrosarcomas represent 1/3 to 3/4 of endometrial cancers), ATF2 is in the chicken (van Dam and Castellazzi, 2001). activated, while ATF2 shows a reduced expression in Soft tissue sarcomas PTEN-positive endometrial cancers (Xiao et al., 2010). Note Prostate cancer In human and murine synovial sarcoma cells with Note t(X;18)(p11.2;q11.2) and a hybrid SS18-SSX, BCL2 Heparan-sulfate proteoglycans are required for expression is increased, but other anti-apoptotic genes, maximal growth factor signaling in prostate cancer including MCL1 and BCL2A1 are repressed via progression. HS2ST1 (heparan sulfate 2-O- binding of ATF2 to the cAMP-responsive element sulfotransferase, 2OST) is essential for maximal (CRE) in the promoters of these genes (Jones et al., proliferation and invasion. HS2ST1 is upregulated by 2012). ATF2 (Ferguson and Datta, 2011). Leukemias Lung cancer Note Note ATF2 was found to upregulate Fas/FasL in a human Patients with lung cancer showing high ANGPTL2 chronic myeloid leukemia cell line (Chen et al., 2009). expression in cancer cells had a poor prognosis. NFE2L2 (NRF2) is a transcription activator of the bZIP ANGPTL2 increases tumor angiogenesis, enhances family which binds to antioxidant response elements tumor cell motility and invasion in an (ARE) in the promoter regions of target genes in autocrine/paracrine manner, conferring an aggressive response to oxidative stress. metastatic tumor phenotype. NFATc (NFATC1 to NFE2L2 positively regulates the expression the AP-1 NFATC4 and NFAT5) function in tumor cell family proteins ATF2, JUN and FOS. NFE2L2/ARE development and metastasis. It has been found that pathway plays an important role in the induction of NFATc form a complex with ATF2/JUN heterodimers differentiation of myeloid leukemia cells by 1alpha,25- that bind to the CRE site of ANGPTL2 and enhances dihydroxyvitamin D3 (1,25D), a strong differentiation ANGPTL2 expression (Endo et al., 2012). agent (Bobilev et al., 2011). A crosstalk between Other cancers NFE2L2 and ATF2 has also been noted in prostate Note cancer cells (Nair et al., 2010). Increased expression of ATF2 and ATF1 in Breast cancer nasopharyngeal carcinoma cells was associated with Note clinical stages (Su et al., 2011). The loss of one copy of p53 in ATF2+/- mice led to mammary tumor development, which supports the References notion that ATF2 and p53 independently activate Hai TW, Liu F, Coukos WJ, Green MR. Transcription factor SERPINB5 and GADD45 expression (Maekawa et al., ATF cDNA clones: an extensive family of leucine zipper 2008). proteins able to selectively form DNA-binding heterodimers. Genes Dev. 1989 Dec;3(12B):2083-90 ATF2/JUN mediate increased BIM expression in response to MAPK14 (p38alpha) signaling in cells Kara CJ, Liou HC, Ivashkiv LB, Glimcher LH. A cDNA for a human cyclic AMP response element-binding protein which is detached from the extracellular matrix, indicating a distinct from CREB and expressed preferentially in brain. Mol contributing role for ATF2 in regulating acinar lumen Cell Biol. 1990 Apr;10(4):1347-57 formation, crucial for the development of mammary

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 173 ATF2 (activating transcription factor 2) Huret JL

Hai T, Curran T. Cross-family dimerization of transcription suppression by ATF4. Exp Cell Res. 1998 Feb 25;239(1):93- factors Fos/Jun and ATF/CREB alters DNA binding specificity. 103 Proc Natl Acad Sci U S A. 1991 May 1;88(9):3720-4 Beier F, Lee RJ, Taylor AC, Pestell RG, LuValle P. Takeda J, Maekawa T, Sudo T, Seino Y, Imura H, Saito N, Identification of the cyclin D1 gene as a target of activating Tanaka C, Ishii S. Expression of the CRE-BP1 transcriptional transcription factor 2 in chondrocytes. Proc Natl Acad Sci U S regulator binding to the cyclic AMP response element in central A. 1999 Feb 16;96(4):1433-8 nervous system, regenerating liver, and human tumors. Oncogene. 1991 Jun;6(6):1009-14 Fuchs SY, Ronai Z. Ubiquitination and degradation of ATF2 are dimerization dependent. Mol Cell Biol. 1999 Kim SJ, Wagner S, Liu F, O'Reilly MA, Robbins PD, Green May;19(5):3289-98 MR. Retinoblastoma gene product activates expression of the human TGF-beta 2 gene through transcription factor ATF-2. Maekawa T, Bernier F, Sato M, Nomura S, Singh M, Inoue Y, Nature. 1992 Jul 23;358(6384):331-4 Tokunaga T, Imai H, Yokoyama M, Reimold A, Glimcher LH, Ishii S. Mouse ATF-2 null mutants display features of a severe De Cesare D, Vallone D, Caracciolo A, Sassone-Corsi P, type of meconium aspiration syndrome. J Biol Chem. 1999 Jun Nerlov C, Verde P. Heterodimerization of c-Jun with ATF-2 and 18;274(25):17813-9 c-Fos is required for positive and negative regulation of the human urokinase enhancer. Oncogene. 1995 Jul 20;11(2):365- Nagadoi A, Nakazawa K, Uda H, Okuno K, Maekawa T, Ishii S, 76 Nishimura Y. Solution structure of the transactivation domain of ATF-2 comprising a zinc finger-like subdomain and a flexible Gupta S, Campbell D, Dérijard B, Davis RJ. Transcription subdomain. J Mol Biol. 1999 Apr 2;287(3):593-607 factor ATF2 regulation by the JNK signal transduction pathway. Science. 1995 Jan 20;267(5196):389-93 Fuchs SY, Tappin I, Ronai Z. Stability of the ATF2 transcription factor is regulated by phosphorylation and dephosphorylation. Livingstone C, Patel G, Jones N. ATF-2 contains a J Biol Chem. 2000 Apr 28;275(17):12560-4 phosphorylation-dependent transcriptional activation domain. EMBO J. 1995 Apr 18;14(8):1785-97 Herr I, Posovszky C, Di Marzio LD, Cifone MG, Boehler T, Debatin KM. Autoamplification of apoptosis following ligation of Nakamura T, Okuyama S, Okamoto S, Nakajima T, Sekiya S, CD95-L, TRAIL and TNF-alpha. Oncogene. 2000 Aug Oda K. Down-regulation of the cyclin A promoter in 31;19(37):4255-62 differentiating human embryonal carcinoma cells is mediated by depletion of ATF-1 and ATF-2 in the complex at the Bhoumik A, Ivanov V, Ronai Z. Activating transcription factor 2- ATF/CRE site. Exp Cell Res. 1995 Feb;216(2):422-30 derived peptides alter resistance of human tumor cell lines to ultraviolet irradiation and chemical treatment. Clin Cancer Res. Li XY, Green MR. Intramolecular inhibition of activating 2001 Feb;7(2):331-42 transcription factor-2 function by its DNA-binding domain. Genes Dev. 1996 Mar 1;10(5):517-27 Cho SG, Bhoumik A, Broday L, Ivanov V, Rosenstein B, Ronai Z. TIP49b, a regulator of activating transcription factor 2 Reimold AM, Grusby MJ, Kosaras B, Fries JW, Mori R, response to stress and DNA damage. Mol Cell Biol. 2001 Maniwa S, Clauss IM, Collins T, Sidman RL, Glimcher MJ, Dec;21(24):8398-413 Glimcher LH. Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice. Nature. 1996 Jan 18;379(6562):262-5 Mayr BM, Canettieri G, Montminy MR. Distinct effects of cAMP and mitogenic signals on CREB-binding protein recruitment Chen KD, Hung JJ, Huang HL, Chang MD, Lai YK. Rapid impart specificity to target gene activation via CREB. Proc Natl induction of the Grp78 gene by cooperative actions of okadaic Acad Sci U S A. 2001 Sep 11;98(19):10936-41 acid and heat-shock in 9L rat brain tumor cells--involvement of a cAMP responsive element-like promoter sequence and a Reimold AM, Kim J, Finberg R, Glimcher LH. Decreased protein kinase A signaling pathway. Eur J Biochem. 1997 Aug immediate inflammatory gene induction in activating 15;248(1):120-9 transcription factor-2 mutant mice. Int Immunol. 2001 Feb;13(2):241-8 Cheong J, Coligan JE, Shuman JD. Activating transcription factor-2 regulates phosphoenolpyruvate carboxykinase van Dam H, Castellazzi M. Distinct roles of Jun : Fos and Jun : transcription through a stress-inducible mitogen-activated ATF dimers in oncogenesis. Oncogene. 2001 Apr protein kinase pathway. J Biol Chem. 1998 Aug 30;20(19):2453-64 28;273(35):22714-8 Bailey J, Phillips RJ, Pollard AJ, Gilmore K, Robson SC, Faris M, Latinis KM, Kempiak SJ, Koretzky GA, Nel A. Stress- Europe-Finner GN. Characterization and functional analysis of induced Fas ligand expression in T cells is mediated through a cAMP response element modulator protein and activating MEK kinase 1-regulated response element in the Fas ligand transcription factor 2 (ATF2) isoforms in the human promoter. Mol Cell Biol. 1998 Sep;18(9):5414-24 myometrium during pregnancy and labor: identification of a novel ATF2 species with potent transactivation properties. J Firestein R, Feuerstein N. Association of activating Clin Endocrinol Metab. 2002 Apr;87(4):1717-28 transcription factor 2 (ATF2) with the ubiquitin-conjugating enzyme hUBC9. Implication of the ubiquitin/proteasome Bakin AV, Rinehart C, Tomlinson AK, Arteaga CL. p38 pathway in regulation of ATF2 in T cells. J Biol Chem. 1998 mitogen-activated protein kinase is required for TGFbeta- Mar 6;273(10):5892-902 mediated fibroblastic transdifferentiation and cell migration. J Cell Sci. 2002 Aug 1;115(Pt 15):3193-206 Kawasaki H, Song J, Eckner R, Ugai H, Chiu R, Taira K, Shi Y, Jones N, Yokoyama KK. p300 and ATF-2 are components of Jin C, Li H, Murata T, Sun K, Horikoshi M, Chiu R, Yokoyama the DRF complex, which regulates retinoic acid- and E1A- KK. JDP2, a repressor of AP-1, recruits a histone deacetylase mediated transcription of the c-jun gene in F9 cells. Genes 3 complex to inhibit the retinoic acid-induced differentiation of Dev. 1998 Jan 15;12(2):233-45 F9 cells. Mol Cell Biol. 2002 Jul;22(13):4815-26 Shimizu M, Nomura Y, Suzuki H, Ichikawa E, Takeuchi A, Ouwens DM, de Ruiter ND, van der Zon GC, Carter AP, Suzuki M, Nakamura T, Nakajima T, Oda K. Activation of the Schouten J, van der Burgt C, Kooistra K, Bos JL, Maassen JA, rat cyclin A promoter by ATF2 and Jun family members and its van Dam H. Growth factors can activate ATF2 via a two-step mechanism: phosphorylation of Thr71 through the Ras-MEK-

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 174 ATF2 (activating transcription factor 2) Huret JL

ERK pathway and of Thr69 through RalGDS-Src-p38. EMBO Matsuo N, Tanaka S, Gordon MK, Koch M, Yoshioka H, J. 2002 Jul 15;21(14):3782-93 Ramirez F. CREB-AP1 protein complexes regulate transcription of the collagen XXIV gene (Col24a1) in Woo IS, Kohno T, Inoue K, Ishii S, Yokota J. Infrequent osteoblasts. J Biol Chem. 2006 Mar 3;281(9):5445-52 mutations of the activating transcription factor-2 gene in human lung cancer, neuroblastoma and breast cancer. Int J Oncol. Bhoumik A, Lopez-Bergami P, Ronai Z. ATF2 on the double - 2002 Mar;20(3):527-31 activating transcription factor and DNA damage response protein. Pigment Cell Res. 2007 Dec;20(6):498-506 Ivanov VN, Bhoumik A, Ronai Z. Death receptors and melanoma resistance to apoptosis. Oncogene. 2003 May Bruhat A, Chérasse Y, Maurin AC, Breitwieser W, Parry L, 19;22(20):3152-61 Deval C, Jones N, Jousse C, Fafournoux P. ATF2 is required for amino acid-regulated transcription by orchestrating specific Bhoumik A, Jones N, Ronai Z. Transcriptional switch by histone acetylation. Nucleic Acids Res. 2007;35(4):1312-21 activating transcription factor 2-derived peptide sensitizes melanoma cells to apoptosis and inhibits their tumorigenicity. Karanam B, Wang L, Wang D, Liu X, Marmorstein R, Cotter R, Proc Natl Acad Sci U S A. 2004 Mar 23;101(12):4222-7 Cole PA. Multiple roles for acetylation in the interaction of p300 HAT with ATF-2. Biochemistry. 2007 Jul 17;46(28):8207-16 Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman BM, Collins S. p38 mitogen- Ma Q, Li X, Vale-Cruz D, Brown ML, Beier F, LuValle P. activated protein kinase is the central regulator of cyclic AMP- Activating transcription factor 2 controls Bcl-2 promoter activity dependent transcription of the brown fat uncoupling protein 1 in growth plate chondrocytes. J Cell Biochem. 2007 May gene. Mol Cell Biol. 2004 Apr;24(7):3057-67 15;101(2):477-87 Hayakawa J, Mittal S, Wang Y, Korkmaz KS, Adamson E, Ma C, Ying C, Yuan Z, Song B, Li D, Liu Y, Lai B, Li W, Chen English C, Ohmichi M, McClelland M, Mercola D. Identification R, Ching YP, Li M. dp5/HRK is a c-Jun target gene and of promoters bound by c-Jun/ATF2 during rapid large-scale required for apoptosis induced by potassium deprivation in gene activation following genotoxic stress. Mol Cell. 2004 Nov cerebellar granule neurons. J Biol Chem. 2007 Oct 19;16(4):521-35 19;282(42):30901-9 Sevilla A, Santos CR, Vega FM, Lazo PA. Human vaccinia- Al-Salleeh F, Petro TM. Promoter analysis reveals critical roles related kinase 1 (VRK1) activates the ATF2 transcriptional for SMAD-3 and ATF-2 in expression of IL-23 p19 in activity by novel phosphorylation on Thr-73 and Ser-62 and macrophages. J Immunol. 2008 Oct 1;181(7):4523-33 cooperates with JNK. J Biol Chem. 2004 Jun 25;279(26):27458-65 Bhoumik A, Ronai Z. ATF2: a transcription factor that elicits oncogenic or tumor suppressor activities. Cell Cycle. 2008 Bai XC, Lu D, Liu AL, Zhang ZM, Li XM, Zou ZP, Zeng WS, Aug;7(15):2341-5 Cheng BL, Luo SQ. Reactive oxygen species stimulates receptor activator of NF-kappaB ligand expression in Bhoumik A, Singha N, O'Connell MJ, Ronai ZA. Regulation of osteoblast. J Biol Chem. 2005 Apr 29;280(17):17497-506 TIP60 by ATF2 modulates ATM activation. J Biol Chem. 2008a Jun 20;283(25):17605-14 Bailey J, Europe-Finner GN. Identification of human myometrial target genes of the c-Jun NH2-terminal kinase Bhoumik A, Fichtman B, Derossi C, Breitwieser W, Kluger HM, (JNK) pathway: the role of activating transcription factor 2 Davis S, Subtil A, Meltzer P, Krajewski S, Jones N, Ronai Z. (ATF2) and a novel spliced isoform ATF2-small. J Mol Suppressor role of activating transcription factor 2 (ATF2) in Endocrinol. 2005 Feb;34(1):19-35 skin cancer. Proc Natl Acad Sci U S A. 2008b Feb 5;105(5):1674-9 Bhoumik A, Takahashi S, Breitweiser W, Shiloh Y, Jones N, Ronai Z. ATM-dependent phosphorylation of ATF2 is required Chen SY, Takeuchi S, Urabe K, Hayashida S, Kido M, for the DNA damage response. Mol Cell. 2005 May Tomoeda H, Uchi H, Dainichi T, Takahara M, Shibata S, Tu 27;18(5):577-87 YT, Furue M, Moroi Y. Overexpression of phosphorylated- ATF2 and STAT3 in cutaneous angiosarcoma and pyogenic Pearson AG, Curtis MA, Waldvogel HJ, Faull RL, Dragunow M. granuloma. J Cutan Pathol. 2008a Aug;35(8):722-30 Activating transcription factor 2 expression in the adult human brain: association with both neurodegeneration and Chen SY, Takeuchi S, Moroi Y, Hayashida S, Kido M, Chen neurogenesis. Neuroscience. 2005;133(2):437-51 SJ, Tomoeda H, Uenotsuchi T, Tu YT, Furue M, Urabe K. Overexpression of phosphorylated-ATF2 and STAT3 in Agelopoulos M, Thanos D. Epigenetic determination of a cell- cutaneous squamous cell carcinoma, Bowen's disease and specific gene expression program by ATF-2 and the histone basal cell carcinoma. J Dermatol Sci. 2008b Sep;51(3):210-5 variant macroH2A. EMBO J. 2006 Oct 18;25(20):4843-53 Chen SY, Takeuchi S, Urabe K, Kido M, Hayashida S, Baan B, van Dam H, van der Zon GC, Maassen JA, Ouwens Tomoeda H, Uchi H, Dainichi T, Takahara M, Shibata S, Furue DM. The role of c-Jun N-terminal kinase, p38, and extracellular M, Moroi Y, Tu YT. Overexpression of phosphorylated ATF2 signal-regulated kinase in insulin-induced Thr69 and Thr71 and STAT3 in eccrine porocarcinoma and eccrine poroma. J phosphorylation of activating transcription factor 2. Mol Dermatol Sci. 2008c Feb;49(2):170-3 Endocrinol. 2006 Aug;20(8):1786-95 Chen X, Johnson GS, Schnabel RD, Taylor JF, Johnson GC, Licht AH, Pein OT, Florin L, Hartenstein B, Reuter H, Arnold B, Parker HG, Patterson EE, Katz ML, Awano T, Khan S, O'Brien Lichter P, Angel P, Schorpp-Kistner M. JunB is required for DP. A neonatal encephalopathy with seizures in standard endothelial cell morphogenesis by regulating core-binding poodle dogs with a missense mutation in the canine ortholog of factor beta. J Cell Biol. 2006 Dec 18;175(6):981-91 ATF2. Neurogenetics. 2008d Feb;9(1):41-9 Liu H, Deng X, Shyu YJ, Li JJ, Taparowsky EJ, Hu CD. Mutual Green TA, Alibhai IN, Unterberg S, Neve RL, Ghose S, regulation of c-Jun and ATF2 by transcriptional activation and Tamminga CA, Nestler EJ. Induction of activating transcription subcellular localization. EMBO J. 2006 Mar 8;25(5):1058-69 factors (ATFs) ATF2, ATF3, and ATF4 in the nucleus accumbens and their regulation of emotional behavior. J Makino C, Sano Y, Shinagawa T, Millar JB, Ishii S. Sin1 binds Neurosci. 2008 Feb 27;28(9):2025-32 to both ATF-2 and p38 and enhances ATF-2-dependent transcription in an SAPK signaling pathway. Genes Cells. 2006 Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt Nov;11(11):1239-51 P, Mankoo P, Carter H, Kamiyama H, Jimeno A, Hong SM, Fu

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 175 ATF2 (activating transcription factor 2) Huret JL

B, Lin MT, Calhoun ES, Kamiyama M, Walter K, Nikolskaya T, Inoue N.. IL23A (interleukin 23, alpha subunit p19). Atlas Nikolsky Y, Hartigan J, Smith DR, Hidalgo M, Leach SD, Klein Genet Cytogenet Oncol Haematol. May 2010. URL : AP, Jaffee EM, Goggins M, Maitra A, Iacobuzio-Donahue C, http://AtlasGeneticsOncology.org/Genes/IL23AID44517ch12q1 Eshleman JR, Kern SE, Hruban RH, Karchin R, Papadopoulos 3.html N, Parmigiani G, Vogelstein B, Velculescu VE, Kinzler KW. Core signaling pathways in human pancreatic cancers Kristiansen M, Hughes R, Patel P, Jacques TS, Clark AR, Ham revealed by global genomic analyses. Science. 2008 Sep J.. Mkp1 is a c-Jun target gene that antagonizes JNK- 26;321(5897):1801-6 dependent apoptosis in sympathetic neurons. Neurosci. 2010 Aug 11;30(32):10820-32. doi: 10.1523/JNEUROSCI.2824- Kojima M, Suzuki T, Maekawa T, Ishii S, Sumi-Ichinose C, 10.2010. Nomura T, Ichinose H. Increased expression of tyrosine hydroxylase and anomalous neurites in catecholaminergic Li S, Ezhevsky S, Dewing A, Cato MH, Scortegagna M, neurons of ATF-2 null mice. J Neurosci Res. 2008 Feb Bhoumik A, Breitwieser W, Braddock D, Eroshkin A, Qi J, 15;86(3):544-52 Chen M, Kim JY, Jones S, Jones N, Rickert R, Ronai ZA.. Radiation Sensitivity and Tumor Susceptibility in ATM Maekawa T, Sano Y, Shinagawa T, Rahman Z, Sakuma T, Phospho-Mutant ATF2 Mice. Genes Cancer. 2010 Apr Nomura S, Licht JD, Ishii S. ATF-2 controls transcription of 1;1(4):316-330. Maspin and GADD45 alpha genes independently from p53 to suppress mammary tumors. Oncogene. 2008 Feb Liao H, Hyman MC, Baek AE, Fukase K, Pinsky DJ.. 14;27(8):1045-54 cAMP/CREB-mediated transcriptional regulation of ectonucleoside triphosphate diphosphohydrolase 1 (CD39) Vale-Cruz DS, Ma Q, Syme J, LuValle PA. Activating expression. J Biol Chem. 2010 May 7;285(19):14791-805. doi: transcription factor-2 affects skeletal growth by modulating pRb 10.1074/jbc.M110.116905. Epub 2010 Feb 23. gene expression. Mech Dev. 2008 Sep-Oct;125(9-10):843-56 Liss AS, Tiwari R, Kralova J, Bose HR Jr.. Cell transformation Chen KC, Chiou YL, Chang LS. JNK1/c-Jun and p38 alpha by v-Rel reveals distinct roles of AP-1 family members in MAPK/ATF-2 pathways are responsible for upregulation of Rel/NF-kappaB oncogenesis. Oncogene. 2010 Sep Fas/FasL in human chronic myeloid leukemia K562 cells upon 2;29(35):4925-37. doi: 10.1038/onc.2010.239. Epub 2010 Jun exposure to Taiwan cobra phospholipase A2. J Cell Biochem. 21. 2009 Oct 15;108(3):612-20 Lopez-Bergami P, Lau E, Ronai Z.. Emerging roles of ATF2 Gould Rothberg BE, Berger AJ, Molinaro AM, Subtil A, and the dynamic AP1 network in cancer. Nat Rev Cancer. Krauthammer MO, Camp RL, Bradley WR, Ariyan S, Kluger 2010 Jan;10(1):65-76. doi: 10.1038/nrc2681. HM, Rimm DL. Melanoma prognostic model using tissue microarrays and genetic algorithms. J Clin Oncol. 2009 Dec Nair S, Barve A, Khor TO, Shen GX, Lin W, Chan JY, Cai L, 1;27(34):5772-80 Kong AN.. Regulation of Nrf2- and AP-1-mediated gene expression by epigallocatechin-3-gallate and sulforaphane in Hassan M, Feyen O, Grinstein E. Fas-induced apoptosis of prostate of Nrf2-knockout or C57BL/6J mice and PC-3 AP-1 renal cell carcinoma is mediated by apoptosis signal-regulating human prostate cancer cells. Acta Pharmacol Sin. 2010 kinase 1 via mitochondrial damage-dependent caspase-8 Sep;31(9):1223-40. doi: 10.1038/aps.2010.147. Epub 2010 activation. Cell Oncol. 2009;31(6):437-56 Aug 23. Lee JW, Ahn JY, Hasegawa S, Cha BY, Yonezawa T, Nagai K, Shah M, Bhoumik A, Goel V, Dewing A, Breitwieser W, Kluger Seo HJ, Jeon WB, Woo JT. Inhibitory effect of luteolin on H, Krajewski S, Krajewska M, Dehart J, Lau E, Kallenberg DM, osteoclast differentiation and function. Cytotechnology. 2009 Jeong H, Eroshkin A, Bennett DC, Chin L, Bosenberg M, Dec;61(3):125-34 Jones N, Ronai ZA.. A role for ATF2 in regulating MITF and melanoma development. PLoS Genet. 2010 Dec Liu Y, Wang Y, Li W, Zheng P, Liu Y. Activating transcription 23;6(12):e1001258. doi: 10.1371/journal.pgen.1001258. factor 2 and c-Jun-mediated induction of FoxP3 for experimental therapy of mammary tumor in the mouse. Cancer Xiao L, Rao JN, Zou T, Liu L, Yu TX, Zhu XY, Donahue JM, Res. 2009 Jul 15;69(14):5954-60 Wang JY.. Induced ATF-2 represses CDK4 transcription through dimerization with JunD inhibiting intestinal epithelial Towers E, Gilley J, Randall R, Hughes R, Kristiansen M, Ham cell growth after polyamine depletion. Am J Physiol Cell J. The proapoptotic dp5 gene is a direct target of the MLK- Physiol. 2010 May;298(5):C1226-34. doi: JNK-c-Jun pathway in sympathetic neurons. Nucleic Acids 10.1152/ajpcell.00021.2010. Epub 2010 Feb 24. Res. 2009 May;37(9):3044-60 Xiao L, Yang YB, Li XM, Xu CF, Li T, Wang XY.. Differential Yamasaki T, Takahashi A, Pan J, Yamaguchi N, Yokoyama sensitivity of human endometrial carcinoma cells with different KK. Phosphorylation of Activation Transcription Factor-2 at PTEN expression to mitogen-activated protein kinase signaling Serine 121 by Protein Kinase C Controls c-Jun-mediated inhibits and implications for therapy. J Cancer Res Clin Oncol. Activation of Transcription. J Biol Chem. 2009 Mar 2010 Jul;136(7):1089-99. doi: 10.1007/s00432-009-0756-4. 27;284(13):8567-81 Epub 2010 Jan 20. Yuan Z, Gong S, Luo J, Zheng Z, Song B, Ma S, Guo J, Hu C, Ackermann J, Ashton G, Lyons S, James D, Hornung JP, Thiel G, Vinson C, Hu CD, Wang Y, Li M. Opposing roles for Jones N, Breitwieser W.. Loss of ATF2 function leads to cranial ATF2 and c-Fos in c-Jun-mediated neuronal apoptosis. Mol motoneuron degeneration during embryonic mouse Cell Biol. 2009 May;29(9):2431-42 development. PLoS One. 2011 Apr 21;6(4):e19090. doi: Chen KC, Liu WH, Kao PH, Chang LS. Calcium-stimulated 10.1371/journal.pone.0019090. mitogen-activated protein kinase activation elicits Bcl-xL Arora H, Qureshi R, Park AK, Park WY.. Coordinated downregulation and Bak upregulation in notexin-treated human regulation of ATF2 by miR-26b in γ-irradiated lung cancer cells. neuroblastoma SK-N-SH cells. J Cell Physiol. 2010 PLoS One. 2011;6(8):e23802. doi: Jan;222(1):177-86 10.1371/journal.pone.0023802. Epub 2011 Aug 25. Huret JL.. EWSR1 (Ewing sarcoma breakpoint region 1). Atlas Bobilev I, Novik V, Levi I, Shpilberg O, Levy J, Sharoni Y, Genet Cytogenet Oncol Haematol. August 2010. URL : Studzinski GP, Danilenko M.. The Nrf2 transcription factor is a http://AtlasGeneticsOncology.org/Genes/EWSR1ID85.html. positive regulator of myeloid differentiation of acute myeloid

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 176 ATF2 (activating transcription factor 2) Huret JL

leukemia cells. Cancer Biol Ther. 2011 Feb 1;11(3):317-29. of group IVC phospholipase A2 in allergic asthma: Epub 2011 Feb 1. transcriptional regulation by TNF α in bronchoepithelial cells. Biochem J. 2012 Feb 15;442(1):127-37. doi: Diring J, Camuzeaux B, Donzeau M, Vigneron M, Rosa- 10.1042/BJ20111269. Calatrava M, Kedinger C, Chatton B.. A cytoplasmic negative regulator isoform of ATF7 impairs ATF7 and ATF2 Endo M, Nakano M, Kadomatsu T, Fukuhara S, Kuroda H, phosphorylation and transcriptional activity. PLoS One. Mikami S, Hato T, Aoi J, Horiguchi H, Miyata K, Odagiri H, 2011;6(8):e23351. doi: 10.1371/journal.pone.0023351. Epub Masuda T, Harada M, Horio H, Hishima T, Nomori H, Ito T, 2011 Aug 16. Yamamoto Y, Minami T, Okada S, Takahashi T, Mochizuki N, Iwase H, Oike Y.. Tumor cell-derived angiopoietin-like protein Ferguson BW, Datta S.. Role of heparan sulfate 2-o- ANGPTL2 is a critical driver of metastasis. Cancer Res. 2012 sulfotransferase in prostate cancer cell proliferation, invasion, Apr 1;72(7):1784-94. doi: 10.1158/0008-5472.CAN-11-3878. and growth factor signaling. Prostate Cancer. Epub 2012 Feb 16. 2011;2011:893208. doi: 10.1155/2011/893208. Epub 2011 Oct 23. Hamsa TP, Kuttan G.. Berberine inhibits pulmonary metastasis through down-regulation of MMP in metastatic B16F-10 Han SI, Yasuda K, Kataoka K.. ATF2 interacts with beta-cell- melanoma cells. Phytother Res. 2012 Apr;26(4):568-78. doi: enriched transcription factors, MafA, Pdx1, and beta2, and 10.1002/ptr.3586. Epub 2011 Sep 26. activates insulin gene transcription. J Biol Chem. 2011 Mar 25;286(12):10449-56. doi: 10.1074/jbc.M110.209510. Epub Hsu CC, Hu CD.. Critical role of N-terminal end-localized 2011 Jan 28. nuclear export signal in regulation of activating transcription factor 2 (ATF2) subcellular localization and transcriptional Ramiro-Cortes Y, Guemez-Gamboa A, Moran J.. Reactive activity. J Biol Chem. 2012 Mar 9;287(11):8621-32. doi: oxygen species participate in the p38-mediated apoptosis 10.1074/jbc.M111.294272. Epub 2012 Jan 24. induced by potassium deprivation and staurosporine in cerebellar granule neurons. Int J Biochem Cell Biol. 2011 Jones KB, Su L, Jin H, Lenz C, Randall RL, Underhill TM, Sep;43(9):1373-82. doi: 10.1016/j.biocel.2011.06.001. Epub Nielsen TO, Sharma S, Capecchi MR.. SS18-SSX2 and the 2011 Jun 12. mitochondrial apoptosis pathway in mouse and human synovial sarcomas. Oncogene. 2012 Jul 16. doi: Seong KH, Li D, Shimizu H, Nakamura R, Ishii S.. Inheritance 10.1038/onc.2012.247. [Epub ahead of print] of stress-induced, ATF-2-dependent epigenetic change. Cell. 2011 Jun 24;145(7):1049-61. doi: 10.1016/j.cell.2011.05.029. Lau E, Kluger H, Varsano T, Lee K, Scheffler I, Rimm DL, Ideker T, Ronai ZA.. PKC ε promotes oncogenic functions of Song B, Xie B, Wang C, Li M.. Caspase-3 is a target gene of c- ATF2 in the nucleus while blocking its apoptotic function at Jun:ATF2 heterodimers during apoptosis induced by activity mitochondria. Cell. 2012 Feb 3;148(3):543-55. doi: deprivation in cerebellar granule neurons. Neurosci Lett. 2011 10.1016/j.cell.2012.01.016. Nov 14;505(2):76-81. doi: 10.1016/j.neulet.2011.09.060. Epub 2011 Oct 1. Lau E, Ronai ZA.. ATF2 - at the crossroad of nuclear and cytosolic functions. J Cell Sci. 2012 Jun 15;125(Pt 12):2815- Venkov C, Plieth D, Ni T, Karmaker A, Bian A, George AL Jr, 24. doi: 10.1242/jcs.095000. Epub 2012 Jun 8. Neilson EG.. Transcriptional networks in epithelial- mesenchymal transition. PLoS One. 2011;6(9):e25354. doi: Qian J, Ling S, Castillo AC, Long B, Birnbaum Y, Ye Y.. 10.1371/journal.pone.0025354. Epub 2011 Sep 30. Regulation of phosphatase and tensin homolog on chromosome 10 in response to hypoxia. Am J Physiol Heart Yu Y, Richardson DR.. Cellular iron depletion stimulates the Circ Physiol. 2012 May 1;302(9):H1806-17. doi: JNK and p38 MAPK signaling transduction pathways, 10.1152/ajpheart.00929.2011. Epub 2012 Feb 24. dissociation of ASK1-thioredoxin, and activation of ASK1. J Biol Chem. 2011 Apr 29;286(17):15413-27. doi: Xu Y, Liu Z, Guo K.. The effect of JDP2 and ATF2 on the 10.1074/jbc.M111.225946. Epub 2011 Mar 5. epithelial-mesenchymal transition of human pancreatic cancer cell lines. Pathol Oncol Res. 2012 Jul;18(3):571-7. doi: Baan B, Wanga TAT, van der Zon GCM, Maassen JA , 10.1007/s12253-011-9476-6. Epub 2011 Nov 23. Ouwens DM.. Identification of insulin-regulated ATF2-target genes in 3T3L1 adipocytes and A14 fibroblasts. This article should be referenced as such: https://openaccess.leidenuniv.nl/bitstream/handle/1887/13861/ 05.pdf?sequence=8 Huret JL. ATF2 (activating transcription factor 2). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3):167-177. Bickford JS, Newsom KJ, Herlihy JD, Mueller C, Keeler B, Qiu X, Walters JN, Su N, Wallet SM, Flotte TR, Nick HS.. Induction

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 177 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

GNAS (GNAS complex locus) Guiomar Pérez de Nanclares, Giovanna Mantovani, Eduardo Fernandez-Rebollo Molecular (Epi)Genetics Laboratory, Research Unit, Hospital Universitario Araba-Txagorritxu, C/Jose Atxotegi s/n, Q2 Vitoria-Gasteiz, Alava, Spain (GP), Endocrinology Unit, Deparment of Clinical Sciences and Community Health, University of Milan, Fondazione IRCCS Ca' Granda Policlinico, Milan, Italy (GM), Diabetes and Obesity Laboratory, Endocrinology and Nutrition Unit, Institut d'Investigations Biomediques August Pi i Sunyer (IDIBAPS), Hospital Clinic de Barcelona, Spain (EFR)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/GNASID40727ch20q13.html DOI: 10.4267/2042/48758 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

In most cases, the methylation of the allele is the Identity imprinting mark (addition of methyl Other names: AHO, C20orf45, GNAS1, GPSA, GSA, groups on cytosine in the CpG dinucleotides), but other GSP, NESP, PHP1A, PHP1B, PHP1C, POH times, the imprinting mechanism remains unknown. HGNC (Hugo): GNAS DNA/RNA Location: 20q13.32 Note Description The gene encoding the Gs α protein gene GNAS The GNAS gene spans over 20-kilobase pair and (Guanine Nucleotide binding protein, Alpha contains thirteen exons and codifies the α-subunit of Stimulating) is located in one of the most complex the stimulatory G protein (Gs α) (Kozasa et al., 1988). locus of the human genome, the GNAS locus, on the long arm of chromosome 20 (20q13.32) (Gejman et al., Transcription 1991). The GNAS locus produces multiple gene products as it The complexity of this locus does not lie only in the has four alternative first exons (NESP55 (Ischia et al., four alternative first exons splicing onto common exons 1997), XL αs (Kehlenbach et al., 1994), A/B (Ishikawa 2 to 13, or the antisense transcript that resides in this et al., 1990; Swaroop et al., 1991) and E1-Gs α) that locus, but this locus also presents an elaborated splice onto a common exons 2 to 13. imprinting pattern. These first alternative exons lie within CpG islands and The genomic imprinting is an epigenetic process in are differently imprinted, while to increase its which a specific imprint mark is erased in primordial complexity this locus also has an antisense transcript to germ cells and then reestablished during oogenesis or NESP55, referred as NESPas (Hayward and Bonthron, spermatogenesis, resulting in suppression of gene 2000) (Figure 1). expression from one parental allele (Reik and Walter, Exon A/B or exon 1A, located 2.5 kb centromeric from 2001). Gs α exon 1, splices onto common exons 2-13, and is This differential gene expression may take whole methylated on the maternal allele. In this case, because lifetime or just a limited developmental stage, and can there is no consensus AUG translational start site in be generalized to all tissues that express the gene or exon A/B, it is thought that the resulting transcript is may be tissue dependent (Latham, 1995; Solter, 1998). not translated (Ishikawa et al., 1990; Liu et al., 2000).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 178 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Figure 1. Organization and imprinting of the GNAS complex locus. The general organization and imprinting patterns of the paternal (above) and maternal (below) GNAS alleles are shown, with the exons of sense transcripts (NESP55, XL, A/B, and G αs) depicted as black boxes, the common exons 2 to 13 represented as green boxes, the five exons of the antisense transcript (AS) represented as grey boxes and the eight exons of the STX16 gene represented as orange boxes. The active sense and antisense promoters (arrows), as well as the splicing patterns of their respective paternal (blue) and maternal (pink) transcripts, are shown above and below the paternal and maternal exons, respectively. The dotted arrow for the paternal G αs transcription indicates that the promoter is fully active in most tissues but is presumed to be silenced in some tissues, such as renal proximal tubules. Regions that are differentially methylated are represented as stars (red, methylated and white, unmethylated).

It has been suggested that this region has a negative neuroendocrine tissues and only from the maternal regulatory cis-acting element that suppresses the allele, due to methylation on the paternal allele paternal Gs α allele in a tissue specific manner (i.e. (Hayward et al., 1998b). renal proximal tubules) (Williamson et al., 2004; Liu et Regarding GNAS gene transcripts, by different splicing al., 2005). of exon 3 and/or use of two 5'splice sites of exon 4, two XL αs alternative first exon, is located about 35 kb long (Gs α-L) and two short (Gs α-S) transcript variants centromeric from Gs α exon 1, join exons 2-13 leading are created, which contain alternatively exon 3 and/or a a transcript that encodes the extra large protein (XL αs), CAG sequence, respectively (Figure 2) (Bray et al., an isoform of Gs α with similar functions but slightly 1986; Robishaw et al., 1986; Kozasa et al., 1988). It is longer, and its promoter is imprinted on the maternal not methylated on either allele (Kozasa et al., 1988; allele (Hayward et al., 1998b). Hayward et al., 1998a; Peters et al., 1999; Liu et al., Finally, the farthest alternative exon (49kb centromeric 2005). from exon 1), together with the other common exons 2- 13, makes the transcript encoding the protein NESP55, Pseudogene chromogranin-like protein that is expressed mostly in No pseudogenes have been identified.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 179 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Figure 2. Gs α protein isoforms. Two long (Gs α-1 and Gs α-2) and two short (Gs α-3 and Gs α-4) forms of Gs α result from alternative splicing of exon 3. Use of an alternative splice acceptor site for exon 4 leads to insertion of an extra serine residue in Gs α-2 and Gs α-4. Introns are represented as dash lines, exons as orange boxes; UTRs as black boxes, serine residue as blue hexagons and splicing pattern as a solid line.

Hayward et al., 2001; Weinstein, 2001; Mantovani et Protein al., 2002; Germain-Lee et al., 2002; Liu et al., 2003). Description Localisation The Gs α protein has 394 aminoacids with a mass of Cytoplasmatic membrane-associated. about 46 kDa. G α-subunits contain two domains: a GTPase domain that is involved in the binding and Function hydrolysis of GTP and a helical domain. Heterotrimeric G proteins are membrane bound The α subunit guanine nucleotide pocket consists of GTPases that are linked to seven-transmembrane five distinct, highly conserved stretches (G1-G5). The domain receptors (Kleuss and Krause, 2003). Each G G1, G4 and G5 regions are important for the binding of protein contains an alpha-, beta- and gamma-subunit GTP while the G2 and G3 regions determine the and is bound to GDP in the "off" state (Olate and intrinsic GTPase activity of the α subunit. The GDP- Allende, 1991). bound form binds tightly to bg and is inactive, whereas Ligand-receptor binding results in detachment of the G the GTP-bound form dissociates from bg and serves as protein, switching it to an "on" state and permitting G α a regulator of effector proteins. The receptor molecules activation of second messenger signalling cascades cause the activation of G proteins by affecting several (Cabrera-Vera et al., 2003). steps of the GTP cycle, resulting in the facilitation of Gs α mediates the simulation of adenylate cyclase the exchange of GTP for GDP on the α subunit (Lania regulated by various peptide hormones (PTH, TSH, et al., 2001; Cherfils and Chabre, 2003). gonadotropins, ACTH, GHRH, ADH, glucagon, calcitonin, among others) (Spiegel, 1999; Spiegel and Expression Weinstein, 2004). GNAS is biallelically expressed in most tissues studied Gs α-subunits contain two domains: a GTPase domain (Hayward et al., 1998a; Hayward et al., 1998b; Zheng that is involved in the binding and hydrolysis of GTP et al., 2001; Mantovani et al., 2004); however, in some and a helical domain that buries the GTP within the tissues (thyroid, renal proximal tubule, pituitary and core of the protein (Cabrera-Vera et al., 2003). ovaries) primarily maternal expression is observed Exon 5 is thought to codify the highly conserved leading to a parental-of-origin effect (Davies and domain of Gsa that interacts with adenylate cyclase, Hughes, 1993; Campbell et al., 1994; Yu et al., 1998; while exon 13 is responsible for the interaction with the receptor (Pennington, 1994).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 180 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Figure 3. Schematic representation of GNAS gene and Gs α protein. (A) Schematic scaled representation of the 13 coding exons for GNAS gene (Black rectangles represent the exons, grey rectangles the untranslated regions, and the black line the intronic region). (B) Schematic representation of Gs α protein, where the blue rectangles represents the 4 different domains located in the protein (exons 1 and 2 encode for the GTPase activity domain; exons 4 and 5 for the adenylyl cyclase activity domain; exon 9 for the GTP dependent conformational change domain; and exons 12 and 13 for the G-protein coupled receptor interaction domain). The figure also shows the localization of the activating mutations in exon 8 (R201) and exon 9 (Q227).

Homology abnormalities. The post zygotic mutation is responsible for the mosaic pattern of tissue distribution and the There are several types of G α proteins; Gs α, Gq α, extreme variability of clinical changes (Weinstein et Gi/o α and G α (Riobo and Manning, 2005). 12/13 al., 1991). Members of Gs α bind directly to adenylyl cyclase and Endocrine and non-endocrine tumors: Somatic stimulate its activity, whereas their effects on ion mutations of Arg201 or Gln227 have been identified in channel activity are restricted to selected cell types; human growth hormone-secreting pituitary adenomas, Gi/o α are involved in adenylyl cyclase inhibition, ion (Landis et al., 1989; Landis et al., 1990), ACTH- channel modulation and phosphatase activation. secreting pituitary adenomas (Williamson et al., 1995; Finally, G α family is implicated in processes of 12/13 Riminucci et al., 2002), nonfunctioning pituitary determination and cell proliferation. Subunits of the tumors (Tordjman et al., 1993), thyroid tumors (Suarez Gq/11 class are putative mediators of phospholipase C et al., 1991), Leydig cell tumor (Libe et al., 2012), activation (Landis et al., 1989; Lania et al., 2001). ovarian granulosa cell tumors (Kalfa et al., 2006a), renal cell carcinoma (Kalfa et al., 2006b), Mutations hepatocellular carcinoma (Nault et al., 2012) and Note myelodysplastic syndromes (Bejar et al., 2011). Both germinal and somatic, activating and inactivating, The mutation at codon 201 (Arg into Cys or His) is genetic and epigenetic alterations have been described more frequent that the mutation at 227 (Gln into Arg, at GNAS locus associated with different entities. His, Lys or Leu). Activating mutations: Mutations at Arg201 or Gln227 Fibrous dysplasia of the bone: Fibrous dysplasia (FD) inhibits the GTPase activity, maintaining Gs α in its is a benign intramedullary osteofibrous lesion that may active form. The mutant Gs α protein carrying these involve either one (monostotic FD) or several activating mutations is termed the gsp oncogene (polyostotic FD) bones. (Landis et al., 1989). FD may occur in isolation or as part of the McCune- In McCune-Albright syndrome, the somatic mutation at Albright syndrome or within Mazabraud's syndrome. Arg201, leading to its change into cysteine or histidine Some cases of FD have been found to have a somatic (even serine or glycine), occurs in early embryogenesis, GNAS mutation, mainly R201C and R201H resulting in widespread tissue distribution of (Riminucci et al., 1997), though R201S (Candeliere et

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 181 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

al., 1997) and Q227L (Idowu et al., 2007) has also been Progressive Osseous Heteroplasia (POH; MIM: reported. 166350) is defined by cutaneous ossification, Inactivating mutations: The first reports of germ-line characteristically presenting during childhood, that inactivating Gs α mutations were reported in 1990 progresses to involve subcutaneous and deep (Patten et al., 1990; Weinstein et al., 1990). Latter on, connective tissues, including muscle and fascia, in the many different mutations have been described in absence of multiple features of Albright hereditary literature and summarized in the Human Gene osteodystrophy (AHO) or hormone resistance (Kaplan Mutation Database at the Institute of Medical Genetics et al., 1994). Most cases of POH are caused by in Cardiff (www.hgmd.cf.ac.uk) as a cause of a heterozygous paternally-inherited inactivating hormonal disorder coupled to Gs α activity mutations of GNAS (Shore et al., 2002; Adegbite et al., characterized by PTH renal resistance called 2008). Pseudohypoparathyroidism (PHP). Epigenetic alterations: Loss of methylation at GNAS Mutation types include translation initiation mutations, exon A/B, sometimes combined with epigenetic defects amino acid substitutions, nonsense mutations, at other GNAS differentially methylated regions has inversions, splice site mutations, insertions or deletions been associated with pseudohypoparathyroidism type (even intragenic or encompassing the whole gene). Ib (PHP-Ib; MIM: 603233). The familial form of the Mutations are distributed throughout the Gs α coding disease has been shown to be mostly associated with an region. Although each mutation is usually associated to exon A/B-only methylation defect and a heterozygous a single kindred, a mutational hot-spot involving 20% 3-kb or 4.4-kb deletion mutation within the closely of all mutations so far described has been identified linked STX16 gene (Bastepe et al., 2003; Linglart et within exon 7 (Weinstein et al., 1992; Yu et al., 1995; al., 2005), although four families of AD-PHP-Ib Yokoyama et al., 1996; Ahmed et al., 1998; Mantovani associated with NESP55 and NESPas deletions have et al., 2000; Aldred and Trembath, 2000). It is a 4 bp also been described, the latter leading to the loss of all deletion which coincides with a defined consensus maternal GNAS imprints (Bastepe et al., 2005; sequence for arrest of DNA polymerase a, a region Chillambhi et al., 2010; Richard et al., 2012). The exon known to be prone to sporadic deletion mutations A/B region is known as an imprinting control region (Krawczak and Cooper, 1991; Yu et al., 1995). In most and is believed to be critical for the tissue-specific cases it has been found as a de novo mutation, thus imprinting of Gs α in the renal proximal tubules representing a recurring new mutation rather than a (Weinstein et al., 2001). The sporadic form of PHP-Ib founder effect. show complete loss of methylation at the NESPas, As mentioned above, in some tissues paternal GNAS XL αs and A/B regions, and no other changes in cis- or allele is silenced, leading to a parental-of-origin effect. trans-acting elements have been found to explain this In case of maternally inherited mutation, AHO is loss of methylation. In the scientific literature six cases associated with end-organ resistance to the Gs α- have been described in which there is an association mediated action of different hormones, primarily PTH, between the complete loss of methylation and partial or TSH, gonadotropin, and GHRH. AHO with complete paternal isodisomy of chromosome 20q endocrinopathy is then termed covering the GNAS locus (Bastepe et al., 2001; pseudohypoparathyroidism type Ia (PHP-Ia; MIM: Bastepe et al., 2010; Fernandez-Rebollo et al., 2010). 103580) or pseudohypoparathyroidism type Ic (PHP-Ic; And on the other hand, it has been recently published a MIM: 612462). In contrast, AHO due to paternally new trait of inheritance, an autosomal recessive form, inherited mutation transmission lacks biochemical explaining the molecular mechanism underlying the evidence of hormone resistance and is designated as sporadic PHP-Ib in five families (Fernandez-Rebollo et pseudopseudohypoparathyroidism (PPHP; MIM al., 2011). 612463) (Davies and Hughes, 1993; Campbell et al., 1994; Weinstein, 2001; Weinstein et al., 2004) (see Implicated in below for further details). An intriguing missense mutation (Iiri et al., 1994; McCune-Albright syndrome Nakamoto et al., 1996) localized within the highly Note conserved G5 region of the Gs α, has been identified in The McCune-Albright syndrome (MAS) is a rare, two unrelated males who presented with AHO, PTH sporadic disease characterized by a classical triad of resistance and testotoxicosis (Iiri et al., 1994). This clinical signs: polyostotic fibrous dysplasia (FD), skin substitution (A366S) leads to constitutive activation of hyperpigmentation (cafe-au-lait spots) and endocrine adenylyl cyclase by causing accelerated release of dysfunction. The major endocrine disorders include GDP, thus increasing the fraction of active GTP-bound autonomous hyperfunction of several endocrine glands, Gs α. However, while this mutant protein is stable at the such as gonads, thyroid, pituitary and adrenal cortex, reduced temperature of the testis, it is thermolabile at i.e. glands sensitive to trophic agents acting through 37°C, resulting in reduced Gs α activity in almost cAMP dependent pathway. Moreover, increasing data tissues and AHO phenotype. drive the attention to non-endocrine affections,

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 182 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

including hepatobiliary dysfunction and cardiac Oncogenesis disease, which are probably important risk factors for Activating mutations of the α subunit of the stimulatory early death. G protein (Gs α) gene (the gsp oncogene) leading to As mutation detection rates may vary considerably amino acid substitution of either residue Arg201 or according to the type of tissue analyzed and the Gln227. detection method used, sensitive and specific molecular These two residues are catalytically important for methods must be used to look for the mutation from all GTPase activity, their mutation thus causing available affected tissues and from easily accessible constitutive activation by disrupting the signalling turn- tissues, particularly in the presence of atypical and off mechanism. monosymptomatic forms of MAS (Weinstein, 2006; Growth and hormone release in many endocrine glands Chapurlat and Orcel, 2008). are stimulated by trophic hormones that activate Gsα- Prognosis cAMP pathways, therefore GNAS activating mutations The prognosis depends on the severity of each affect those glands sensitive to trophic agents acting individual endocrine and non-endocrine manifestation through the cAMP-dependent pathway, leading to and on the age at which each affection appears. autonomous hyperfunction in addition to Bisphosphonates are used in the treatment of FD to tumorigenesis. relieve bone pain and improve lytic lesions, but they Pseudohypoparathyroidism are still under clinical evaluation. Calcium, vitamin D and phosphorus supplements may Note be useful in some patients. Pseudohypoparathyroidism (PHP) is a term applied to a Surgery is also helpful to prevent and treat fracture and heterogeneous group of disorders whose common deformities. feature is end-organ resistance to parathyroid hormone Oncogenesis (PTH) (Mantovani, 2011). Postzygotic, somatic mutations at Arginine 201 of the PTH resistance, the most clinically evident GNAS gene that results in cellular mosaicism, thus abnormality, usually develops over the first years of leading to a broad spectrum of clinical manifestations. life, with hyperphosphatemia and elevated PTH generally preceding hypocalcemia. Renal function is Mazabraud syndrome conserved through life and so seems to be bone mineral Note density. Very rare association of fibrous dysplasia and Diagnostic Criteria for PHP: myxomas of the soft tissues (Biagini et al., 1987; - elevated PTH levels Dreizin et al., 2012). - hypocalcemia Various endocrine and non-endocrine - hyperphosphatemia - absence of hypercalciuria or impaired renal function tumors - reduced calcemic and phosphaturic response to Note injected exogenous PTH. Growth hormone-secreting pituitary adenomas (Landis Disease et al., 1989; Landis et al., 1990), ACTH-secreting PHP-Ia: in addition to PTH resistance, is characterized pituitary adenomas (Williamson et al., 1995; Riminucci by resistance to other hormones, including TSH, et al., 2002), nonfunctioning pituitary tumors gonadotrophins and GHRH. It is associated with (Tordjman et al., 1993), thyroid tumors (Suarez et al., Albright's hereditary osteodystrophy (AHO), which 1991), Leydig cell tumor (Libe et al., 2012), ovarian includes short stature, obesity, round facies, granulosa cell tumors (Kalfa et al., 2006a), ACTH- subcutaneous ossifications, brachydactyly, and other independent macronodular adrenal hyperplasia skeletal anomalies. (AIMAH) (Fragoso et al., 2003), renal cell carcinoma Some patients have mental retardation. (Kalfa et al., 2006b), hepatocellular carcinoma (Nault Laboratory studies show a decreased cAMP response to et al., 2012) and myelodysplastic syndromes (Bejar et infused PTH and defects in activity of the erythrocyte al., 2011). Gs protein (Mantovani, 2011). Activating GNAS mutations are a common feature of Pseudo-PHP (PPHP): is characterized by the physical the above-mentioned endocrine tumors with a findings of AHO without hormone resistance. maximum frequency in growth hormone-secreting Laboratory studies show a defect in Gs protein activity pituitary adenomas (about 30-40%) (Landis et al., in erythrocytes (Weinstein et al., 2001). 1989), while the same mutations have been only occasionally reported in the other cited tumors.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 183 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Table1. Legend: PHP, pseudohypoparathyroidism; PPHP, Pseudo-pseudohypoparathyroidism; AHO, Albright hereditary osteodystrophy; POH, Progressive Osseous Heteroplasia; Gn, gonadotropins; NA, not available.

PHP-Ib: is characterized clinically by isolated renal presence/evolution of specific AHO features (in PTH resistance. particular heterotopic ossifications and mental Patients usually lack the physical characteristics of retardation). Initial screening should include AHO and typically show no other endocrine radiological evaluation of brachydactyly. abnormalities, although resistance to TSH has been The long-term therapy of hypocalcemia, in order to reported. maintain normocalcemia, is with active vitamin D However, patients may rarely show some features of metabolites, preferentially calcitriol, with or without AHO. Laboratory studies show a decreased cAMP oral calcium supplementation. response to infused PTH and, most recently reported, Patients should be also routinely screened and sometimes defects in Gs protein activity similarly to eventually treated for any associated endocrinopathy, in PHP-Ia patients (Zazo et al., 2011; Mantovani et al., particular hypothyroidism and hypogonadism. 2012). Levothyroxine and sex hormones should be given PHP-Ic: is clinically indistinguishable from PHP-Ia, following the same criteria, doses and follow-up as in therefore being characterized by the association of any other form of hypothyroidism or hypogonadism. multi-hormone resistance and AHO. Laboratory studies There are no specific treatments for the various show a decreased cAMP response to infused PTH, but manifestations of AHO, even if subcutaneous typically no defect in activity of the erythrocyte Gs ossifications may be surgically removed when protein (Thiele et al., 2011). particularly large or bothersome. Progressive Osseous Heteroplasia (POH): is While prognosis of correctly treated hormone characterized by ectopic dermal ossification beginning disturbances is very good, POH may end up with in infancy, followed by increasing and extensive bone deeply invalidating lesions. formation in deep muscle and fascia. These patients typically do not show any endocrine abnormality References (Shore et al., 2002; Shore and Kaplan, 2010). Bray P, Carter A, Simons C, Guo V, Puckett C, Kamholz J, Prognosis Spiegel A, Nirenberg M. Human cDNA clones for four species In general, PHP patients should be monitored annually of G alpha s signal transduction protein. Proc Natl Acad Sci U for both blood biochemistries (PTH, calcium, S A. 1986 Dec;83(23):8893-7 phosphate, TSH) and urinary calcium excretion. Robishaw JD, Smigel MD, Gilman AG. Molecular basis for two Particular attention must be given in children to height, forms of the G protein that stimulates adenylate cyclase. J Biol Chem. 1986 Jul 25;261(21):9587-90 growth velocity and pubertal development. Increasing evidences suggest that, independently of growth curve, Biagini R, Ruggieri P, Boriani S, Picci P. The Mazabraud children should be screened with appropriate syndrome: case report and review of the literature. Ital J Orthop Traumatol. 1987 Mar;13(1):105-11 provocative tests for GH deficiency in order to eventually start treatment as soon as possible. Weight Kozasa T, Itoh H, Tsukamoto T, Kaziro Y. Isolation and characterization of the human Gs alpha gene. Proc Natl Acad and BMI should be checked in order to start Sci U S A. 1988 Apr;85(7):2081-5 dietary/exercise intervention when appropriate. Careful physical examination and, when necessary, specific Landis CA, Masters SB, Spada A, Pace AM, Bourne HR, Vallar L. GTPase inhibiting mutations activate the alpha chain of Gs psychological investigations should be performed and stimulate adenylyl cyclase in human pituitary tumours. annually in order to detect and follow the Nature. 1989 Aug 31;340(6236):692-6

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 184 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Ishikawa Y, Bianchi C, Nadal-Ginard B, Homcy CJ. Alternative Kehlenbach RH, Matthey J, Huttner WB. XL alpha s is a new promoter and 5' exon generate a novel Gs alpha mRNA. J Biol type of G protein. Nature. 1994 Dec 22-29;372(6508):804-9 Chem. 1990 May 25;265(15):8458-62 Pennington SR. GTP-binding proteins. 1: heterotrimeric G Landis CA, Harsh G, Lyons J, Davis RL, McCormick F, Bourne proteins. Protein Profile. 1994;1(3):169-342 HR. Clinical characteristics of acromegalic patients whose pituitary tumors contain mutant Gs protein. J Clin Endocrinol Latham KE. Stage-specific and cell type-specific aspects of Metab. 1990 Dec;71(6):1416-20 genomic imprinting effects in mammals. Differentiation. 1995 Dec;59(5):269-82 Patten JL, Johns DR, Valle D, Eil C, Gruppuso PA, Steele G, Smallwood PM, Levine MA. Mutation in the gene encoding the Williamson EA, Ince PG, Harrison D, Kendall-Taylor P, Harris stimulatory G protein of adenylate cyclase in Albright's PE. G-protein mutations in human pituitary hereditary osteodystrophy. N Engl J Med. 1990 May adrenocorticotrophic hormone-secreting adenomas. Eur J Clin 17;322(20):1412-9 Invest. 1995 Feb;25(2):128-31 Weinstein LS, Gejman PV, Friedman E, Kadowaki T, Collins Yu S, Yu D, Hainline BE, Brener JL, Wilson KA, Wilson LC, RM, Gershon ES, Spiegel AM. Mutations of the Gs alpha- Oude-Luttikhuis ME, Trembath RC, Weinstein LS. A deletion subunit gene in Albright hereditary osteodystrophy detected by hot-spot in exon 7 of the Gs alpha gene (GNAS1) in patients denaturing gradient gel electrophoresis. Proc Natl Acad Sci U with Albright hereditary osteodystrophy. Hum Mol Genet. 1995 S A. 1990 Nov;87(21):8287-90 Oct;4(10):2001-2 Gejman PV, Weinstein LS, Martinez M, Spiegel AM, Cao Q, Nakamoto JM, Zimmerman D, Jones EA, Loke KY, Siddiq K, Hsieh WT, Hoehe MR, Gershon ES. Genetic mapping of the Donlan MA, Brickman AS, Van Dop C. Concurrent hormone Gs-alpha subunit gene (GNAS1) to the distal long arm of resistance (pseudohypoparathyroidism type Ia) and hormone chromosome 20 using a polymorphism detected by denaturing independence (testotoxicosis) caused by a unique mutation in gradient gel electrophoresis. Genomics. 1991 Apr;9(4):782-3 the G alpha s gene. Biochem Mol Med. 1996 Jun;58(1):18-24 Krawczak M, Cooper DN. Gene deletions causing human Yokoyama M, Takeda K, Iyota K, Okabayashi T, Hashimoto K. genetic disease: mechanisms of mutagenesis and the role of A 4-base pair deletion mutation of Gs alpha gene in a the local DNA sequence environment. Hum Genet. 1991 Japanese patient with pseudohypoparathyroidism. J Mar;86(5):425-41 Endocrinol Invest. 1996 Apr;19(4):236-41 Olate J, Allende JE. Structure and function of G proteins. Candeliere GA, Roughley PJ, Glorieux FH. Polymerase chain Pharmacol Ther. 1991;51(3):403-19 reaction-based technique for the selective enrichment and analysis of mosaic arg201 mutations in G alpha s from patients Suarez HG, du Villard JA, Caillou B, Schlumberger M, with fibrous dysplasia of bone. Bone. 1997 Aug;21(2):201-6 Parmentier C, Monier R. gsp mutations in human thyroid tumours. Oncogene. 1991 Apr;6(4):677-9 Ischia R, Lovisetti-Scamihorn P, Hogue-Angeletti R, Wolkersdorfer M, Winkler H, Fischer-Colbrie R. Molecular Swaroop A, Agarwal N, Gruen JR, Bick D, Weissman SM. cloning and characterization of NESP55, a novel Differential expression of novel Gs alpha signal transduction chromogranin-like precursor of a peptide with 5-HT1B receptor protein cDNA species. Nucleic Acids Res. 1991 Sep antagonist activity. J Biol Chem. 1997 Apr 25;272(17):11657- 11;19(17):4725-9 62 Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman Riminucci M, Fisher LW, Shenker A, Spiegel AM, Bianco P, E, Spiegel AM. Activating mutations of the stimulatory G Gehron Robey P. Fibrous dysplasia of bone in the McCune- protein in the McCune-Albright syndrome. N Engl J Med. 1991 Albright syndrome: abnormalities in bone formation. Am J Dec 12;325(24):1688-95 Pathol. 1997 Dec;151(6):1587-600 Weinstein LS, Gejman PV, de Mazancourt P, American N, Ahmed SF, Dixon PH, Bonthron DT, Stirling HF, Barr DG, Spiegel AM. A heterozygous 4-bp deletion mutation in the Gs Kelnar CJ, Thakker RV. GNAS1 mutational analysis in alpha gene (GNAS1) in a patient with Albright hereditary pseudohypoparathyroidism. Clin Endocrinol (Oxf). 1998 osteodystrophy. Genomics. 1992 Aug;13(4):1319-21 Oct;49(4):525-31 Davies SJ, Hughes HE. Imprinting in Albright's hereditary Hayward BE, Kamiya M, Strain L, Moran V, Campbell R, osteodystrophy. J Med Genet. 1993 Feb;30(2):101-3 Hayashizaki Y, Bonthron DT. The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically Tordjman K, Stern N, Ouaknine G, Yossiphov Y, Razon N, expressed G proteins. Proc Natl Acad Sci U S A. 1998a Aug Nordenskjöld M, Friedman E. Activating mutations of the Gs 18;95(17):10038-43 alpha-gene in nonfunctioning pituitary tumors. J Clin Endocrinol Metab. 1993 Sep;77(3):765-9 Hayward BE, Moran V, Strain L, Bonthron DT. Bidirectional imprinting of a single gene: GNAS1 encodes maternally, Campbell R, Gosden CM, Bonthron DT. Parental origin of paternally, and biallelically derived proteins. Proc Natl Acad Sci transcription from the human GNAS1 gene. J Med Genet. 1994 U S A. 1998b Dec 22;95(26):15475-80 Aug;31(8):607-14 Solter D. Imprinting. Int J Dev Biol. 1998;42(7):951-4 Iiri T, Herzmark P, Nakamoto JM, van Dop C, Bourne HR. Rapid GDP release from Gs alpha in patients with gain and Yu S, Yu D, Lee E, Eckhaus M, Lee R, Corria Z, Accili D, loss of endocrine function. Nature. 1994 Sep 8;371(6493):164- Westphal H, Weinstein LS. Variable and tissue-specific 8 hormone resistance in heterotrimeric Gs protein alpha-subunit (Gsalpha) knockout mice is due to tissue-specific imprinting of Kaplan FS, Craver R, MacEwen GD, Gannon FH, Finkel G, the gsalpha gene. Proc Natl Acad Sci U S A. 1998 Jul Hahn G, Tabas J, Gardner RJ, Zasloff MA. Progressive 21;95(15):8715-20 osseous heteroplasia: a distinct developmental disorder of heterotopic ossification. Two new case reports and follow-up of Peters J, Wroe SF, Wells CA, Miller HJ, Bodle D, Beechey three previously reported cases. J Bone Joint Surg Am. 1994 Mar;76(3):425-36 CV, Williamson CM, Kelsey G. A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 185 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

mouse chromosome 2. Proc Natl Acad Sci U S A. 1999 Mar Slyper AH, Sugimoto T, Tsatsoulis A, Crawford JD, Jüppner H. 30;96(7):3830-5 Autosomal dominant pseudohypoparathyroidism type Ib is associated with a heterozygous microdeletion that likely Spiegel AM. Hormone resistance caused by mutations in G disrupts a putative imprinting control element of GNAS. J Clin proteins and G protein-coupled receptors. J Pediatr Endocrinol Invest. 2003 Oct;112(8):1255-63 Metab. 1999 Apr;12 Suppl 1:303-9 Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Aldred MA, Trembath RC. Activating and inactivating mutations Preininger A, Mazzoni MR, Hamm HE. Insights into G protein in the human GNAS1 gene. Hum Mutat. 2000 Sep;16(3):183-9 structure, function, and regulation. Endocr Rev. 2003 Hayward BE, Bonthron DT. An imprinted antisense transcript Dec;24(6):765-81 at the human GNAS1 locus. Hum Mol Genet. 2000 Mar Cherfils J, Chabre M. Activation of G-protein Galpha subunits 22;9(5):835-41 by receptors through Galpha-Gbeta and Galpha-Ggamma Liu J, Litman D, Rosenberg MJ, Yu S, Biesecker LG, Weinstein interactions. Trends Biochem Sci. 2003 Jan;28(1):13-7 LS. A GNAS1 imprinting defect in pseudohypoparathyroidism Fragoso MC, Domenice S, Latronico AC, Martin RM, Pereira type IB. J Clin Invest. 2000 Nov;106(9):1167-74 MA, Zerbini MC, Lucon AM, Mendonca BB. Cushing's Mantovani G, Romoli R, Weber G, Brunelli V, De Menis E, syndrome secondary to adrenocorticotropin-independent Beccio S, Beck-Peccoz P, Spada A. Mutational analysis of macronodular adrenocortical hyperplasia due to activating GNAS1 in patients with pseudohypoparathyroidism: mutations of GNAS1 gene. J Clin Endocrinol Metab. 2003 identification of two novel mutations. J Clin Endocrinol Metab. May;88(5):2147-51 2000 Nov;85(11):4243-8 Kleuss C, Krause E. Galpha(s) is palmitoylated at the N- Bastepe M, Lane AH, Jüppner H. Paternal uniparental terminal glycine. EMBO J. 2003 Feb 17;22(4):826-32 isodisomy of chromosome 20q--and the resulting changes in Liu J, Erlichman B, Weinstein LS. The stimulatory G protein GNAS1 methylation--as a plausible cause of alpha-subunit Gs alpha is imprinted in human thyroid glands: pseudohypoparathyroidism. Am J Hum Genet. 2001 implications for thyroid function in pseudohypoparathyroidism May;68(5):1283-9 types 1A and 1B. J Clin Endocrinol Metab. 2003 Hayward BE, Barlier A, Korbonits M, Grossman AB, Jacquet P, Sep;88(9):4336-41 Enjalbert A, Bonthron DT. Imprinting of the G(s)alpha gene Mantovani G, Bondioni S, Locatelli M, Pedroni C, Lania AG, GNAS1 in the pathogenesis of acromegaly. J Clin Invest. 2001 Ferrante E, Filopanti M, Beck-Peccoz P, Spada A. Biallelic Mar;107(6):R31-6 expression of the Gsalpha gene in human bone and adipose Lania A, Mantovani G, Spada A. G protein mutations in tissue. J Clin Endocrinol Metab. 2004 Dec;89(12):6316-9 endocrine diseases. Eur J Endocrinol. 2001 Nov;145(5):543-59 Spiegel AM, Weinstein LS. Inherited diseases involving g Reik W, Walter J. Genomic imprinting: parental influence on proteins and g protein-coupled receptors. Annu Rev Med. the genome. Nat Rev Genet. 2001 Jan;2(1):21-32 2004;55:27-39 Weinstein LS. The role of tissue-specific imprinting as a source Weinstein LS, Liu J, Sakamoto A, Xie T, Chen M. Minireview: of phenotypic heterogeneity in human disease. Biol Psychiatry. GNAS: normal and abnormal functions. Endocrinology. 2004 2001 Dec 15;50(12):927-31 Dec;145(12):5459-64 Weinstein LS, Yu S, Warner DR, Liu J. Endocrine Williamson CM, Ball ST, Nottingham WT, Skinner JA, Plagge manifestations of stimulatory G protein alpha-subunit mutations A, Turner MD, Powles N, Hough T, Papworth D, Fraser WD, and the role of genomic imprinting. Endocr Rev. 2001 Maconochie M, Peters J. A cis-acting control region is required Oct;22(5):675-705 exclusively for the tissue-specific imprinting of Gnas. Nat Genet. 2004 Aug;36(8):894-9 Zheng H, Radeva G, McCann JA, Hendy GN, Goodyer CG. Galphas transcripts are biallelically expressed in the human Bastepe M, Fröhlich LF, Linglart A, Abu-Zahra HS, Tojo K, kidney cortex: implications for pseudohypoparathyroidism type Ward LM, Jüppner H. Deletion of the NESP55 differentially 1b. J Clin Endocrinol Metab. 2001 Oct;86(10):4627-9 methylated region causes loss of maternal GNAS imprints and pseudohypoparathyroidism type Ib. Nat Genet. 2005 Germain-Lee EL, Ding CL, Deng Z, Crane JL, Saji M, Ringel Jan;37(1):25-7 MD, Levine MA. Paternal imprinting of Galpha(s) in the human thyroid as the basis of TSH resistance in Linglart A, Gensure RC, Olney RC, Jüppner H, Bastepe M. A pseudohypoparathyroidism type 1a. Biochem Biophys Res novel STX16 deletion in autosomal dominant Commun. 2002 Aug 9;296(1):67-72 pseudohypoparathyroidism type Ib redefines the boundaries of a cis-acting imprinting control element of GNAS. Am J Hum Mantovani G, Ballare E, Giammona E, Beck-Peccoz P, Spada Genet. 2005 May;76(5):804-14 A. The gsalpha gene: predominant maternal origin of transcription in human thyroid gland and gonads. J Clin Liu J, Chen M, Deng C, Bourc'his D, Nealon JG, Erlichman B, Endocrinol Metab. 2002 Oct;87(10):4736-40 Bestor TH, Weinstein LS. Identification of the control region for tissue-specific imprinting of the stimulatory G protein alpha- Riminucci M, Collins MT, Lala R, Corsi A, Matarazzo P, subunit. Proc Natl Acad Sci U S A. 2005 Apr 12;102(15):5513- Gehron Robey P, Bianco P. An R201H activating mutation of 8 the GNAS1 (Gsalpha) gene in a corticotroph pituitary adenoma. Mol Pathol. 2002 Feb;55(1):58-60 Riobo NA, Manning DR. Receptors coupled to heterotrimeric G proteins of the G12 family. Trends Pharmacol Sci. 2005 Shore EM, Ahn J, Jan de Beur S, Li M, Xu M, Gardner RJ, Mar;26(3):146-54 Zasloff MA, Whyte MP, Levine MA, Kaplan FS. Paternally inherited inactivating mutations of the GNAS1 gene in Kalfa N, Ecochard A, Patte C, Duvillard P, Audran F, progressive osseous heteroplasia. N Engl J Med. 2002 Jan Pienkowski C, Thibaud E, Brauner R, Lecointre C, Plantaz D, 10;346(2):99-106 Guedj AM, Paris F, Baldet P, Lumbroso S, Sultan C. Activating mutations of the stimulatory g protein in juvenile ovarian Bastepe M, Fröhlich LF, Hendy GN, Indridason OS, Josse RG, granulosa cell tumors: a new prognostic factor? J Clin Koshiyama H, Körkkö J, Nakamoto JM, Rosenbloom AL, Endocrinol Metab. 2006a May;91(5):1842-7

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 186 GNAS (GNAS complex locus) Pérez de Nanclares G, et al.

Kalfa N, Lumbroso S, Boulle N, Guiter J, Soustelle L, Costa P, an autosomal recessive form of PHP-Ib? J Bone Miner Res. Chapuis H, Baldet P, Sultan C. Activating mutations of 2011 Aug;26(8):1854-63 Gsalpha in kidney cancer. J Urol. 2006b Sep;176(3):891-5 Mantovani G. Clinical review: Pseudohypoparathyroidism: Weinstein LS. G(s)alpha mutations in fibrous dysplasia and diagnosis and treatment. J Clin Endocrinol Metab. 2011 McCune-Albright syndrome. J Bone Miner Res. 2006 Dec;21 Oct;96(10):3020-30 Suppl 2:P120-4 Thiele S, de Sanctis L, Werner R, Grötzinger J, Aydin C, Idowu BD, Al-Adnani M, O'Donnell P, Yu L, Odell E, Diss T, Jüppner H, Bastepe M, Hiort O. Functional characterization of Gale RE, Flanagan AM. A sensitive mutation-specific GNAS mutations found in patients with screening technique for GNAS1 mutations in cases of fibrous pseudohypoparathyroidism type Ic defines a new subgroup of dysplasia: the first report of a codon 227 mutation in bone. pseudohypoparathyroidism affecting selectively Gs α-receptor Histopathology. 2007 May;50(6):691-704 interaction. Hum Mutat. 2011 Jun;32(6):653-60 Adegbite NS, Xu M, Kaplan FS, Shore EM, Pignolo RJ. Zazo C, Thiele S, Martín C, Fernandez-Rebollo E, Martinez- Diagnostic and mutational spectrum of progressive osseous Indart L, Werner R, Garin I, Hiort O, Perez de Nanclares G. heteroplasia (POH) and other forms of GNAS-based Gs α activity is reduced in erythrocyte membranes of patients heterotopic ossification. Am J Med Genet A. 2008 Jul with psedohypoparathyroidism due to epigenetic alterations at 15;146A(14):1788-96 the GNAS locus. J Bone Miner Res. 2011 Aug;26(8):1864-70 Chapurlat RD, Orcel P. Fibrous dysplasia of bone and Dreizin D, Glen C, Jose J. Mazabraud syndrome. Am J Orthop McCune-Albright syndrome. Best Pract Res Clin Rheumatol. (Belle Mead NJ). 2012 Jul;41(7):332-5 2008 Mar;22(1):55-69 Libé R, Fratticci A, Lahlou N, Jornayvaz FR, Tissier F, Louiset Chillambhi S, Turan S, Hwang DY, Chen HC, Jüppner H, E, Guibourdenche J, Vieillefond A, Zerbib M, Bertherat J. A Bastepe M. Deletion of the noncoding GNAS antisense rare cause of hypertestosteronemia in a 68-year-old patient: a transcript causes pseudohypoparathyroidism type Ib and Leydig cell tumor due to a somatic GNAS (guanine nucleotide- biparental defects of GNAS methylation in cis. J Clin binding protein, alpha-stimulating activity polypeptide 1)- Endocrinol Metab. 2010 Aug;95(8):3993-4002 activating mutation. J Androl. 2012 Jul-Aug;33(4):578-84 Fernández-Rebollo E, Lecumberri B, Garin I, Arroyo J, Bernal- Mantovani G, Elli FM, Spada A. GNAS epigenetic defects and Chico A, Goñi F, Orduña R, Castaño L, de Nanclares GP. New pseudohypoparathyroidism: time for a new classification? mechanisms involved in paternal 20q disomy associated with Horm Metab Res. 2012 Sep;44(10):716-23 pseudohypoparathyroidism. Eur J Endocrinol. 2010 Dec;163(6):953-62 Nault JC, Fabre M, Couchy G, Pilati C, Jeannot E, Tran Van Nhieu J, Saint-Paul MC, De Muret A, Redon MJ, Buffet C, Shore EM, Kaplan FS. Inherited human diseases of Salenave S, Balabaud C, Prevot S, Labrune P, Bioulac-Sage heterotopic bone formation. Nat Rev Rheumatol. 2010 P, Scoazec JY, Chanson P, Zucman-Rossi J. GNAS-activating Sep;6(9):518-27 mutations define a rare subgroup of inflammatory liver tumors characterized by STAT3 activation. J Hepatol. 2012 Bastepe M, Altug-Teber O, Agarwal C, Oberfield SE, Bonin M, Jan;56(1):184-91 Jüppner H. Paternal uniparental isodisomy of the entire chromosome 20 as a molecular cause of Richard N, Abeguilé G, Coudray N, Mittre H, Gruchy N, pseudohypoparathyroidism type Ib (PHP-Ib). Bone. 2011 Mar Andrieux J, Cathebras P, Kottler ML. A new deletion ablating 1;48(3):659-62 NESP55 causes loss of maternal imprint of A/B GNAS and autosomal dominant pseudohypoparathyroidism type Ib. J Clin Bejar R, Stevenson K, Abdel-Wahab O, Galili N, Nilsson B, Endocrinol Metab. 2012 May;97(5):E863-7 Garcia-Manero G, Kantarjian H, Raza A, Levine RL, Neuberg D, Ebert BL. Clinical effect of point mutations in This article should be referenced as such: myelodysplastic syndromes. N Engl J Med. 2011 Jun 30;364(26):2496-506 Pérez de Nanclares G, Mantovani G, Fernandez-Rebollo E. GNAS (GNAS complex locus). Atlas Genet Cytogenet Oncol Fernández-Rebollo E, Pérez de Nanclares G, Lecumberri B, Haematol. 2013; 17(3):178-187. Turan S, Anda E, Pérez-Nanclares G, Feig D, Nik-Zainal S, Bastepe M, Jüppner H. Exclusion of the GNAS locus in PHP-Ib patients with broad GNAS methylation changes: evidence for

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 187 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR449A (microRNA 449a) Cristina Gallinas Suazo, Muriel Lizé Department of Molecular Oncology - University of Goettingen, Goettingen's Centre for Molecular Biosciences (GZMB), Ernst Caspari Haus, Justus-von-Liebig-Weg 11, D-37077 Goettingen, Germany (CG, ML)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR449AID50881ch5q11.html DOI: 10.4267/2042/48759 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

The whole cluster consists of three members in human: Identity miR-449a (MI0001648), miR-449b (MI0003673), and Other names: MIRN449, MIRN449A, hsa-mir-449 miR-449c (MI0003823), they are located in the second HGNC (Hugo): MIR449A intron of the Cdc20b gene and they share its promoter. Sequence miR-449a: uggcaguguauuguuagcuggu (22 Location: 5q11.2 bp) Sequence miR-449b: aggcaguguauuguuagcuggc (22 DNA/RNA bp) Description Sequence miR-449c: uaggcaguguauugcuagcggcugu (25 bp) The microRNA-449 family is a group of three small, They regulate gene expression post-transcriptionally by non-coding RNAs first identified in embryonic mice mRNA degradation or translational repression (Mineno et al., 2006; Wheeler et al., 2006) and highly (Esquela-Kerscher and Slack, 2006). conserved in different species.

A) Alignment of the mature sequences of the miR-34/449 family members. Modified from Lizé et al., 2010.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 188 MIR449A (microRNA 449a) Gallinas Suazo C, Lizé M

B) Genomic localization of miR-449 family on chromosome 5q11.2 (source: www.ncbi.nlm.nih.gov/gene/).

Transcription the induction of the CDK-inhibitor p21 (Yang et al., 2009; Lizé et al., 2010). miR-449's promoter is Transcription starts from chromosome 5: 54466360- repressed by Interleukin 13 (IL-13), leading to an 54466450 [-] in human. E2F1 is a transcriptional increase in Notch expression and mucociliary activator of the locus (Yang et al., 2009; Lizé et al., differentiation alteration (Solberg et al., 2012). MiR- 2010), IL-13 a repressor (Solberg et al., 2012). 449 targets: cyclin dependent kinase 6 (CDK6), cell The synthesis of miRNAs starts with the primary division cycle 25 homolog A (CDC25A); and histone transcription by the RNA polymerase II (Lee et al., deacetylase 1 (HDAC1), cyclin D1 (CCND1), cyclin 2004) in the nucleus of a capped and polyadenylated E2 (CCNE2), SIRT1, Delta-like 1 (DLL1), E2F precursor named pri-miRNA. transcription factor 5 (E2F5), Geminin (GMNN), MET The pri-miRNA of miR-449a is 91 base pairs long, the protooncogene (MET), v-myc avian myelocytomatosis one of miR-449b is 97 bp in and pri-miR-449c is 92 bp viral related oncogene, neuroblastoma derived (N- in. myc), Drosophila notch homolog 1 (Notch1) (Bommer The precursors are then further processed by the et al., 2007; Sun et al., 2008; Noonan et al., 2009; nucleases Drosha and Pasha, which are able to Redshaw et al., 2009; Yang et al., 2009; Lizé et al., recognize and cut the stem-loop structure to generate 2010; Bou Kheir et al., 2011; Buechner et al., 2011; the pre-miRNA. Lizé et al., 2011; Marcet et al., 2011). Finally, these pre-miRNAs are exported into the cytoplasm and are cleaved by the ribonuclease Dicer Localisation (Lund and Dahlberg, 2006) to get the mature 22-25 bp miR-449 is expressed at high levels in tissues miR-449. containing ciliated cells, especially choroid plexus The mature microRNA recognizes its target mostly via (Redshaw et al., 2009), lung, testis and trachea (Lizé et the "seed sequence", and when loaded into the RNA al., 2010; Marcet et al., 2011; Bao et al., 2012). induced silencing complex (RISC), they lead to the It is expressed specifically in multiciliated cells degradation or the inhibition of the translation of the (Marcet et al., 2011). targeted mRNA (Hammond et al., 2000). Function Expression miR-449 is a strong inducer of cell cycle arrest miR-449 expression is strongly induced during (including senescence) and apoptosis in tumor cell lines mucociliary differentiation (Lizé et al., 2010; Marcet et (Noonan et al., 2009; Yang et al., 2009; Lizé et al., al., 2011). 2010; Noonan et al., 2010; Bou Kheir et al., 2011). It is miR-449 is down-regulated in various cancers, most also involved in mucociliary differentiation (Lizé et al., probably through epigenetic silencing (Yang et al., 2010; Marcet et al., 2011). 2009; Noonan et al., 2009; Lizé et al., 2010; Noonan et miR-449 regulates several pathways (reviewed in Lizé al., 2010; Bou Kheir et al., 2011; Buurman et al., 2012; et al., 2011) including Notch (Capuano et al., 2011; Chen et al., 2012). Marcet et al., 2011), p53 (Lizé et al., 2010), E2F-Rb miR-449 is E2F1- and DNA damage responsive and (Redshaw et al., 2009; Yang et al., 2009; Lizé et al., negatively regulates the E2F pathway both through the 2010; Noonan et al., 2010; Bao et al., 2012), Wnt direct targeting of E2F transcription factors and (Iliopoulos et al., 2009) and the cell cycle (Noonan et indirectly through the downregulation of cyclin- al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan dependent kinases (CDKs) either directly or through et al., 2010; Bou Kheir et al., 2011).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 189 MIR449A (microRNA 449a) Gallinas Suazo C, Lizé M

A) Stem-loop structure of miR-449a. B) Stem-loop structure of miR-449b. C) Stem-loop structure of miR-449c. The sequence of the mature microRNAs is colored in green. (source: www.mirbase.org/).

miR-449 is strongly down-regulated in the lung Protein carcinoma cell line H1299 in comparison to normal Note lung tissue (Lizé et al., 2010). MicroRNAs are not translated into proteins. See DNA Prostate cancer for further description. Note Mutations In prostate cancer, miR-449 has a role in cell growth regulation by repressing the histone deacetylase 1 Note (HDAC-1) expression. The activation of HDAC1 by No mutation was described. the loss of miR-449 in prostate cancer cells is critical for their epigenetic evolution (Noonan et al., 2009). Implicated in Craniopharyngioma Various cancers Note The down-regulation of miR-449 may have a role in Oncogenesis the inhibition of the Wnt signaling pathway in MiR-449 functions as a tumor suppressor and is down- craniopharyngioma (Campanini et al., 2010). regulated in various cancer cells (Yang et al., 2009; Lizé et al., 2010; Ma and Tao, 2012) such as: lung Gastric cancer adenocarcinoma and squamous cell carcinoma (Liang Note 2008), prostate cancer (Noonan et al., 2009), miR-449 is down-regulated or even absent in mouse craniopharyngioma (Campanini et al., 2010), colon models of gastric cancer and in primary human gastric cancer cells (Wang et al., 2010), gastric cancer (Bou tumors (Wang et al., 2010; Bou Kheir et al., 2011). Kheir et al., 2011), hepatocellular carcinoma (Buurman Although the development of gastric cancer is et al., 2012), bladder cancer (Chen et al., 2012); while primarily related to H. Pylori infection, levels of gastrin it is up-regulated in endometrioid adenocarcinoma (Wu are also involved in gastric cancer. Studies of the miR- et al., 2009). 449b expression in Gastrin knockout mice and in mice Lung cancer infected by H. pylori showed that, in both cases, the miR-449b is down-regulated compared to the control Note mice. Moreover, ectopic expression of miR-449b in In silico studies reveal that miR-449 may be down- SNU638 cells affects their proliferation and leads to regulated in different kinds of lung cancer such as lung apoptosis and senescence. adenocarcinoma and squamous cell carcinoma (Liang, 2008).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 190 MIR449A (microRNA 449a) Gallinas Suazo C, Lizé M

Hepatocellular carcinoma Lund E, Dahlberg JE. Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. Cold Spring Harb Symp Note Quant Biol. 2006;71:59-66 MiR-449 is down-regulated in hepatocellular Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, carcinoma which results in high levels of histone Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. deacetylases, leading to increased c-MET. C-Met is the The expression profile of microRNAs in mouse embryos. receptor for hepatocyte growth factor in hepatocellular Nucleic Acids Res. 2006;34(6):1765-71 carcinoma cells (Buurman et al., 2012). Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T. Identification of new central nervous system specific mouse Bladder cancer microRNAs. FEBS Lett. 2006 Apr 17;580(9):2195-200 Note Bommer GT, Gerin I, Feng Y, Kaczorowski AJ, Kuick R, Love miR-449a is downregulated in bladder cancer cells as RE, Zhai Y, Giordano TJ, Qin ZS, Moore BB, MacDougald OA, compared to normal tissue. Reintroduction of miR-449 Cho KR, Fearon ER. p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr Biol. 2007 Aug in the bladder cancer cell lines T24 and 5537 lead 7;17(15):1298-307 rather to cell cycle arrest than to apoptosis. The Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. inhibition of the tumor growth by using liposome miRBase: tools for microRNA genomics. Nucleic Acids Res. encapsulated miR-449a in vivo was successful (Chen et 2008 Jan;36(Database issue):D154-8 al., 2012). Liang Y. An expression meta-analysis of predicted microRNA Endometrioid adenocarcinoma targets identifies a diagnostic signature for lung cancer. BMC Med Genomics. 2008 Dec 16;1:61 Note MiR-449 is up-regulated in endometrioid Sun F, Fu H, Liu Q, Tie Y, Zhu J, Xing R, Sun Z, Zheng X. Downregulation of CCND1 and CDK6 by miR-34a induces cell adenocarcinoma cells. The expression of the estrogen cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8 receptor gene, entailed in this cancer type, could be Iliopoulos D, Bimpaki EI, Nesterova M, Stratakis CA. regulated by miR-449 (Wu et al., 2009). MicroRNA signature of primary pigmented nodular Asthma adrenocortical disease: clinical correlations and regulation of Wnt signaling. Cancer Res. 2009 Apr 15;69(8):3278-82 Note Noonan EJ, Place RF, Pookot D, Basak S, Whitson JM, Hirata A common feature of asthma is the alteration of the H, Giardina C, Dahiya R. miR-449a targets HDAC-1 and airway epithelial cells. The analyses of asthmatic induces growth arrest in prostate cancer. Oncogene. 2009 Apr bronchial epithelium showed that interleukin 13 (IL-13) 9;28(14):1714-24 contributes to miR-449 repression in asthma. This leads Redshaw N, Wheeler G, Hajihosseini MK, Dalmay T. to an increase of the Notch expression, which results in microRNA-449 is a putative regulator of choroid plexus the reduction of ciliated cell and increase of mucous development and function. Brain Res. 2009 Jan 23;1250:20-6 cells (Solberg et al., 2012). Wu W, Lin Z, Zhuang Z, Liang X. Expression profile of mammalian microRNAs in endometrioid adenocarcinoma. Eur Primary pigmented nodular J Cancer Prev. 2009 Feb;18(1):50-5 adrenocortical disease Yang X, Feng M, Jiang X, Wu Z, Li Z, Aau M, Yu Q. miR-449a Note and miR-449b are direct transcriptional targets of E2F1 and miR-449 is up-regulated in primary pigmented nodular negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct adrenocortical disease (PPNAD) (Iliopoulos et al., 15;23(20):2388-93 2009). Campanini ML, Colli LM, Paixao BM, Cabral TP, Amaral FC, Machado HR, Neder LS, Saggioro F, Moreira AC, Antonini SR, References de Castro M. CTNNB1 gene mutations, pituitary transcription factors, and MicroRNA expression involvement in the Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA- pathogenesis of adamantinomatous craniopharyngiomas. directed nuclease mediates post-transcriptional gene silencing Horm Cancer. 2010 Aug;1(4):187-96 in Drosophila cells. Nature. 2000 Mar 16;404(6775):293-6 Lizé M, Pilarski S, Dobbelstein M. E2F1-inducible microRNA Griffiths-Jones S. The microRNA Registry. Nucleic Acids Res. 449a/b suppresses cell proliferation and promotes apoptosis. 2004 Jan 1;32(Database issue):D109-11 Cell Death Differ. 2010 Mar;17(3):452-8 Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. Lizé M, Herr C, Klimke A, Bals R, Dobbelstein M. MicroRNA- MicroRNA genes are transcribed by RNA polymerase II. 449a levels increase by several orders of magnitude during EMBO J. 2004 Oct 13;23(20):4051-60 mucociliary differentiation of airway epithelia. Cell Cycle. 2010 Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a Nov 15;9(22):4579-83 role in cancer. Nat Rev Cancer. 2006 Apr;6(4):259-69 Noonan EJ, Place RF, Basak S, Pookot D, Li LC. miR-449a Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, causes Rb-dependent cell cycle arrest and senescence in Enright AJ. miRBase: microRNA sequences, targets and gene prostate cancer cells. Oncotarget. 2010 Sep;1(5):349-58 nomenclature. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 191 MIR449A (microRNA 449a) Gallinas Suazo C, Lizé M

Wang XY, Wu MH, Liu F, Li Y, Li N, Li GY, Shen SR. of vertebrate multiciliogenesis by miR-449 through direct Differential miRNA expression and their target genes between repression of the Delta/Notch pathway. Nat Cell Biol. 2011 NGX6-positive and negative colon cancer cells. Mol Cell Jun;13(6):693-9 Biochem. 2010 Dec;345(1-2):283-90 Bao J, Li D, Wang L, Wu J, Hu Y, Wang Z, Chen Y, Cao X, Bou Kheir T, Futoma-Kazmierczak E, Jacobsen A, Krogh A, Jiang C, Yan W, Xu C. MicroRNA-449 and microRNA-34b/c Bardram L, Hother C, Grønbæk K, Federspiel B, Lund AH, function redundantly in murine testes by targeting E2F Friis-Hansen L. miR-449 inhibits cell proliferation and is down- transcription factor-retinoblastoma protein (E2F-pRb) pathway. regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29 J Biol Chem. 2012 Jun 22;287(26):21686-98 Buechner J, Tømte E, Haug BH, Henriksen JR, Løkke C, Buurman R, Gürlevik E, Schäffer V, Eilers M, Sandbothe M, Flægstad T, Einvik C. Tumour-suppressor microRNAs let-7 Kreipe H, Wilkens L, Schlegelberger B, Kühnel F, Skawran B. and mir-101 target the proto-oncogene MYCN and inhibit cell Histone deacetylases activate hepatocyte growth factor proliferation in MYCN-amplified neuroblastoma. Br J Cancer. signaling by repressing microRNA-449 in hepatocellular 2011 Jul 12;105(2):296-303 carcinoma cells. Gastroenterology. 2012 Sep;143(3):811- 20.e1-15 Capuano M, Iaffaldano L, Tinto N, Montanaro D, Capobianco V, Izzo V, Tucci F, Troncone G, Greco L, Sacchetti L. Chen H, Lin YW, Mao YQ, Wu J, Liu YF, Zheng XY, Xie LP. MicroRNA-449a overexpression, reduced NOTCH1 signals MicroRNA-449a acts as a tumor suppressor in human bladder and scarce goblet cells characterize the small intestine of cancer through the regulation of pocket proteins. Cancer Lett. celiac patients. PLoS One. 2011;6(12):e29094 2012 Jul 1;320(1):40-7 Hsu SD, Lin FM, Wu WY, Liang C, Huang WC, Chan WL, Tsai Ma YY, Tao HQ. Microribonucleic acids and gastric cancer. WT, Chen GZ, Lee CJ, Chiu CM, Chien CH, Wu MC, Huang Cancer Sci. 2012 Apr;103(4):620-5 CY, Tsou AP, Huang HD. miRTarBase: a database curates experimentally validated microRNA-target interactions. Nucleic Solberg OD, Ostrin EJ, Love MI, Peng JC, Bhakta NR, Hou L, Acids Res. 2011 Jan;39(Database issue):D163-9 Nguyen C, Solon M, Nguyen C, Barczak AJ, Zlock LT, Blagev DP, Finkbeiner WE, Ansel KM, Arron JR, Erle DJ, Woodruff Kozomara A, Griffiths-Jones S. miRBase: integrating PG. Airway epithelial miRNA expression is altered in asthma. microRNA annotation and deep-sequencing data. Nucleic Am J Respir Crit Care Med. 2012 Nov 15;186(10):965-74 Acids Res. 2011 Jan;39(Database issue):D152-7 Vergoulis T, Vlachos IS, Alexiou P, Georgakilas G, Maragkakis Lizé M, Klimke A, Dobbelstein M. MicroRNA-449 in cell fate M, Reczko M, Gerangelos S, Koziris N, Dalamagas T, determination. Cell Cycle. 2011 Sep 1;10(17):2874-82 Hatzigeorgiou AG. TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support. Nucleic Marcet B, Chevalier B, Coraux C, Kodjabachian L, Barbry P. Acids Res. 2012 Jan;40(Database issue):D222-9 MicroRNA-based silencing of Delta/Notch signaling promotes multiple cilia formation. Cell Cycle. 2011 Sep 1;10(17):2858-64 This article should be referenced as such: Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Gallinas Suazo C, Lizé M. MIR449A (microRNA 449a). Atlas Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Genet Cytogenet Oncol Haematol. 2013; 17(3):188-192. Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P. Control

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 192 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MMP15 (matrix metallopeptidase 15 (membrane - inserted)) Emiko Ito, Ikuo Yana, Nariaki Matsuura Department of Molecular Pathology, Graduate School of Medicine and Health Sciences, Osaka University, Suita, Osaka 565-0871, Japan (EI, IY, NM)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Genes/MMP15ID41392ch16q21.html DOI: 10.4267/2042/48760 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity DNA/RNA Other names: MT2-MMP, MTMMP2, SMCP-2 Description HGNC (Hugo): MMP15 This gene can be found on chromosome16 at location: Location: 16q21 58028573-58163296.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 193 MMP15 (matrix metallopeptidase 15 (membrane-inserted)) Ito E, et al.

Transcription Development 1) Branching morphogenesis The DNA sequence contains 10 exons and the MT2-MMP has been shown to be induced to the transcript length: 3530 bp translated to a 699 residues epithelia in migration, thereby speculated to be protein. involved in branching morphogenesis of salivery gland (Harunaga et al., 2011), and submandibular gland Protein (Rebustini et al., 2009). Description 2) Cardia valve development in endocardial cushion Cardiac valve is constituted by tissue-specific MT2-MMP belongs to which consist a gene family fibroblasts originated from endocardial cushion through over 25 different members in humans (refer to MT1- EMT. It has been demonstrated that MT2-MMP, which MMP). may play a key role in the valve formation, is likely Expression expressed at the period of EMT by Snail1-related signal Expression of MT2-MMP has been reported in many (Tao et al., 2011). cancers, such as glioblastomas, ovarian, urothelial, and 3) Placenta development (chorionic villus) breast. In addition, MT2-MMP is involved in It has been demonstrated by separate research groups endothelial tubulogenesis, malignant conversion of that MT2-MMP may play a important role in placental keratinocytes, and is an antiapoptotic factor. labyrinth formation at the period of embryogenesis or Both MT2-MMP and MT3-MMP were detected in menstrual cycle (Szabova et al., 2010; Plaisier et al., predominantly at the interface between the epithelium 2006). During the placenta development, MT2-MMP is and substantia propia in mice intracornea infected with induced at trophoblasts under TNF alpha-related signal. Pseudomonas aeruginosa. On the other hand, MT1- Homology MMP was mainly expressed at epithelium in the same MT2-MMP is supposed to be 72 kDa in molecular tissue (Dong et al., 2000). During pregnancy, MT2- weight with overall similarity to MT1-MMP by 73,9%. MMP is expressed in the invaded cytotrophoblasts where both MT1-MMP and gelatinase A are Implicated in extensively colocalized (Bjørn et al., 2000). Over all, MT2-MMP may plays an important and Cancer progression distinct role from MT1-MMP in normal physiological Note processes. Both MT1-MMP and MT2-MMP have potential to play Localisation important role in cancer either for proliferation or Plasma membrane. transmigration through extracellular matrix (ECM). Ota Function and his colleagues have suggested that membrane- localized proteolytic enzyme such as MT1/2-MMP can In a previous study with a cell line established from be induced and recruited towards the tumor cell surface MT1-MMP gene knocked-out mice, MT2-MMP has during epithelial-mesenchymal transition (EMT) been suggested to contribute alternatively to cell mediated by Snail1-related signal (Ota et al., 2009). invasion through fibrin rich matrices (Hotary et al., Other group has indicated that cancer cells, such as 2002). PANC-1, induce MT2-MMP under hypoxia in a HIF-1 Like as MT1-MMP, MT2-MMP may also play some dependent manner (Zhu et al., 2011). These data role in MMP-2 activation in microenvironment with suggest MT2-MMP may play some role in cancer TIMP-2 involvement (Morrison et al., 2001; Morrison progression against the physiological stress. It has not and Overall, 2006). been clarified, however, that MT2-MMP can entirely In corporation with the enzymatic action of MT1- substitute the function of MT1-MMP and vice versa. MMP, MT2-MMP can contribute to remodel basement Several IHS analyses with clinical samples suggested membrane (Hotary et al., 2000; Hotary et al., 2006).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 194 MMP15 (matrix metallopeptidase 15 (membrane-inserted)) Ito E, et al.

that MT2-MMP is expressed in several tumor types Koehler MR, Sauer CG, Reismann N, Steinlein C, Weber BH, which include esophageal (Chen et al., 2010), bladder Will H, Schmid M. Localization of the human membrane-type 2 matrix metalloproteinase gene (MMP15) to 16q12.1 near DNA (Mohammad et al., 2010), colorectal (Lyall et al., 2006), and urothelial carcinoma (Kitagawa et al., elements that are part of centromeric and non-centromeric heterochromatin of 11 human chromosomes. Chromosome 1998). In such reports for the colorectal and bladder Res. 1998 Apr;6(3):199-203 cancer, the expression of MT2-MMP was shown to be associated with disease prognosis (Lyall et al., 2006; Lampert K, Machein U, Machein MR, Conca W, Peter HH, Volk B. Expression of matrix metalloproteinases and their tissue Mohammad et al., 2010). inhibitors in human brain tumors. Am J Pathol. 1998 Idiopathic pulmonary fibrosis (IPF) Aug;153(2):429-37 Note Seldin MF, Gustavson MD, Apte SS. Mapping of two mouse membrane-type matrix metalloproteinase (MT-MMP) genes, IPF is a disease characterized by fibroblast expansion Mmp15 and Mmp16, to mouse chromosomes 8 and 4, and ECM accumulation in lung. A previous report respectively. Genomics. 1998 Jun 1;50(2):295-7 suggests MT1-MMP as well as MT2-MMP, was Théret N, Musso O, L'Helgoualc'h A, Campion JP, Clément B. expressed in alveolar epithelial cells, and active MMP- Differential expression and origin of membrane-type 1 and 2 2 was increased in bronchoalveolar lavage (BAL) matrix metalloproteinases (MT-MMPs) in association with fluids in IPF tissue. These MMPs possibly play roles in MMP2 activation in injured human livers. Am J Pathol. 1998 the pathogeny (García-Alvarez et al., 2006). Sep;153(3):945-54 Nakada M, Nakamura H, Ikeda E, Fujimoto N, Yamashita J, Sato H, Seiki M, Okada Y. Expression and tissue localization References of membrane-type 1, 2, and 3 matrix metalloproteinases in d'Ortho MP, Will H, Atkinson S, Butler G, Messent A, Gavrilovic human astrocytic tumors. Am J Pathol. 1999 Feb;154(2):417- J, Smith B, Timpl R, Zardi L, Murphy G. Membrane-type matrix 28 metalloproteinases 1 and 2 exhibit broad-spectrum proteolytic Bjørn SF, Hastrup N, Larsen JF, Lund LR, Pyke C. Messenger capacities comparable to many matrix metalloproteinases. Eur RNA for membrane-type 2 matrix metalloproteinase, MT2- J Biochem. 1997 Dec 15;250(3):751-7 MMP, is expressed in human placenta of first trimester. Kolkenbrock H, Hecker-Kia A, Orgel D, Ulbrich N, Will H. Placenta. 2000 Mar-Apr;21(2-3):170-6 Activation of progelatinase A and progelatinase A/TIMP-2 Dong Z, Ghabrial M, Katar M, Fridman R, Berk RS. Membrane- complex by membrane type 2-matrix metalloproteinase. Biol type matrix metalloproteinases in mice intracorneally infected Chem. 1997 Feb;378(2):71-6 with Pseudomonas aeruginosa. Invest Ophthalmol Vis Sci. Mattei MG, Roeckel N, Olsen BR, Apte SS. Genes of the 2000 Dec;41(13):4189-94 membrane-type matrix metalloproteinase (MT-MMP) gene Ellenrieder V, Alber B, Lacher U, Hendler SF, Menke A, Boeck family, MMP14, MMP15, and MMP16, localize to human W, Wagner M, Wilda M, Friess H, Büchler M, Adler G, Gress chromosomes 14, 16, and 8, respectively. Genomics. 1997 TM. Role of MT-MMPs and MMP-2 in pancreatic cancer Feb 15;40(1):168-9 progression. Int J Cancer. 2000 Jan 1;85(1):14-20 Sato H, Okada Y, Seiki M. Membrane-type matrix Hotary K, Allen E, Punturieri A, Yana I, Weiss SJ. Regulation metalloproteinases (MT-MMPs) in cell invasion. Thromb of cell invasion and morphogenesis in a three-dimensional type Haemost. 1997 Jul;78(1):497-500 I collagen matrix by membrane-type matrix metalloproteinases Shofuda K, Yasumitsu H, Nishihashi A, Miki K, Miyazaki K. 1, 2, and 3. J Cell Biol. 2000 Jun 12;149(6):1309-23 Expression of three membrane-type matrix metalloproteinases Kim MH, Albertsson P, Xue Y, Kitson RP, Nannmark U, (MT-MMPs) in rat vascular smooth muscle cells and Goldfarb RH. Expression of matrix metalloproteinases and characterization of MT3-MMPs with and without their inhibitors by rat NK cells: inhibition of their expression by transmembrane domain. J Biol Chem. 1997 Apr genistein. In Vivo. 2000 Sep-Oct;14(5):557-64 11;272(15):9749-54 Matsui K, Takeda K, Yu ZX, Travis WD, Moss J, Ferrans VJ. Tanaka M, Sato H, Takino T, Iwata K, Inoue M, Seiki M. Role for activation of matrix metalloproteinases in the Isolation of a mouse MT2-MMP gene from a lung cDNA library pathogenesis of pulmonary lymphangioleiomyomatosis. Arch and identification of its product. FEBS Lett. 1997 Feb 3;402(2- Pathol Lab Med. 2000 Feb;124(2):267-75 3):219-22 Miyamori H, Takino T, Seiki M, Sato H. Human membrane Ueno H, Nakamura H, Inoue M, Imai K, Noguchi M, Sato H, type-2 matrix metalloproteinase is defective in cell-associated Seiki M, Okada Y. Expression and tissue localization of activation of progelatinase A. Biochem Biophys Res Commun. membrane-types 1, 2, and 3 matrix metalloproteinases in 2000 Jan 27;267(3):796-800 human invasive breast carcinomas. Cancer Res. 1997 May 15;57(10):2055-60 Okada Y. Tumor cell-matrix interaction: pericellular matrix degradation and metastasis. Verh Dtsch Ges Pathol. Yasumitsu H, Shofuda K, Nishihashi A, Eki T, Koshikawa N, 2000;84:33-42 Mizushima H, Miyazaki K. Assignment of human membrane- type matrix metalloproteinase-2 (MT2-MMP) gene to 16q12 by Pap T, Shigeyama Y, Kuchen S, Fernihough JK, Simmen B, FISH and PCR-based human/rodent cell hybrid mapping panel Gay RE, Billingham M, Gay S. Differential expression pattern analysis. DNA Res. 1997 Feb 28;4(1):77-9 of membrane-type matrix metalloproteinases in rheumatoid arthritis. Arthritis Rheum. 2000 Jun;43(6):1226-32 Kitagawa Y, Kunimi K, Ito H, Sato H, Uchibayashi T, Okada Y, Seiki M, Namiki M. Expression and tissue localization of Sameshima T, Nabeshima K, Toole BP, Yokogami K, Okada membrane-types 1, 2, and 3 matrix metalloproteinases in Y, Goya T, Koono M, Wakisaka S. Glioma cell extracellular human urothelial carcinomas. J Urol. 1998 Oct;160(4):1540-5

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 195 MMP15 (matrix metallopeptidase 15 (membrane-inserted)) Ito E, et al.

matrix metalloproteinase inducer (EMMPRIN) (CD147) Levicar N, Nuttall RK, Lah TT. Proteases in brain tumour stimulates production of membrane-type matrix progression. Acta Neurochir (Wien). 2003 Sep;145(9):825-38 metalloproteinases and activated gelatinase A in co-cultures with brain-derived fibroblasts. Cancer Lett. 2000 Sep Chiba H, Nagai H, Ohdaira T, Yasuda Y, Saito K. 1;157(2):177-84 Immunohistochemical study of characteristics of bile duct dysplasia evaluated on the basis of expression of Yamanaka H, Makino K, Takizawa M, Nakamura H, Fujimoto metastasis/invasion-related factors and p53. J Hepatobiliary N, Moriya H, Nemori R, Sato H, Seiki M, Okada Y. Expression Pancreat Surg. 2004;11(6):409-16 and tissue localization of membrane-types 1, 2, and 3 matrix metalloproteinases in rheumatoid synovium. Lab Invest. 2000 Curran S, Dundas SR, Buxton J, Leeman MF, Ramsay R, May;80(5):677-87 Murray GI. Matrix metalloproteinase/tissue inhibitors of matrix metalloproteinase phenotype identifies poor prognosis Davidson B, Goldberg I, Berner A, Nesland JM, Givant-Horwitz colorectal cancers. Clin Cancer Res. 2004 Dec V, Bryne M, Risberg B, Kristensen GB, Tropé CG, Kopolovic J, 15;10(24):8229-34 Reich R. Expression of membrane-type 1, 2, and 3 matrix metalloproteinases messenger RNA in ovarian carcinoma cells Kobayashi K, Nishioka M, Kohno T, Nakamoto M, Maeshima in serous effusions. Am J Clin Pathol. 2001 Apr;115(4):517-24 A, Aoyagi K, Sasaki H, Takenoshita S, Sugimura H, Yokota J. Identification of genes whose expression is upregulated in lung Morrison CJ, Butler GS, Bigg HF, Roberts CR, Soloway PD, adenocarcinoma cells in comparison with type II alveolar cells Overall CM. Cellular activation of MMP-2 (gelatinase A) by and bronchiolar epithelial cells in vivo. Oncogene. 2004 Apr MT2-MMP occurs via a TIMP-2-independent pathway. J Biol 15;23(17):3089-96 Chem. 2001 Dec 14;276(50):47402-10 Kousidou OC, Roussidis AE, Theocharis AD, Karamanos NK. Ohnishi Y, Tajima S, Ishibashi A. Coordinate expression of Expression of MMPs and TIMPs genes in human breast membrane type-matrix metalloproteinases-2 and 3 (MT2-MMP cancer epithelial cells depends on cell culture conditions and is and MT3-MMP) and matrix metalloproteinase-2 (MMP-2) in associated with their invasive potential. Anticancer Res. 2004 primary and metastatic melanoma cells. Eur J Dermatol. 2001 Nov-Dec;24(6):4025-30 Sep-Oct;11(5):420-3 Sun YN, Li Y. Expression of mRNA for membrane-type 1, 2, Fortunato SJ, Menon R. Screening of novel matrix and 3 matrix metalloproteinases in human laryngeal cancer. metalloproteinases (MMPs) in human fetal membranes. J Chin Med Sci J. 2004 Sep;19(3):170-3 Assist Reprod Genet. 2002 Oct;19(10):483-6 Abraham R, Schäfer J, Rothe M, Bange J, Knyazev P, Ullrich Hotary KB, Yana I, Sabeh F, Li XY, Holmbeck K, Birkedal- A. Identification of MMP-15 as an anti-apoptotic factor in Hansen H, Allen ED, Hiraoka N, Weiss SJ. Matrix cancer cells. J Biol Chem. 2005 Oct 7;280(40):34123-32 metalloproteinases (MMPs) regulate fibrin-invasive activity via MT1-MMP-dependent and -independent processes. J Exp Bassi DE, Lopez De Cicco R, Cenna J, Litwin S, Cukierman E, Med. 2002 Feb 4;195(3):295-308 Klein-Szanto AJ. PACE4 expression in mouse basal keratinocytes results in basement membrane disruption and Lafleur MA, Handsley MM, Knäuper V, Murphy G, Edwards acceleration of tumor progression. Cancer Res. 2005 Aug DR. Endothelial tubulogenesis within fibrin gels specifically 15;65(16):7310-9 requires the activity of membrane-type-matrix metalloproteinases (MT-MMPs). J Cell Sci. 2002 Sep 1;115(Pt Kousidou OC, Mitropoulou TN, Roussidis AE, Kletsas D, 17):3427-38 Theocharis AD, Karamanos NK. Genistein suppresses the invasive potential of human breast cancer cells through Mahloogi H, Bassi DE, Klein-Szanto AJ. Malignant conversion transcriptional regulation of metalloproteinases and their tissue of non-tumorigenic murine skin keratinocytes overexpressing inhibitors. Int J Oncol. 2005 Apr;26(4):1101-9 PACE4. Carcinogenesis. 2002 Apr;23(4):565-72 Lafleur MA, Drew AF, de Sousa EL, Blick T, Bills M, Walker Norgauer J, Hildenbrand T, Idzko M, Panther E, Bandemir E, EC, Williams ED, Waltham M, Thompson EW. Upregulation of Hartmann M, Vanscheidt W, Herouy Y. Elevated expression of matrix metalloproteinases (MMPs) in breast cancer xenografts: extracellular matrix metalloproteinase inducer (CD147) and a major induction of stromal MMP-13. Int J Cancer. 2005 Apr membrane-type matrix metalloproteinases in venous leg 20;114(4):544-54 ulcers. Br J Dermatol. 2002 Dec;147(6):1180-6 Ogasawara S, Yano H, Momosaki S, Nishida N, Takemoto Y, Ohnishi Y, Ito Y, Tajima S, Ishibashi A, Arai K. Kojiro S, Kojiro M. Expression of matrix metalloproteinases Immunohistochemical study of membrane type-matrix (MMPs) in cultured hepatocellular carcinoma (HCC) cells and metalloproteinases (MT-MMPs) and matrix metalloproteinase-2 surgically resected HCC tissues. Oncol Rep. 2005 (MMP-2) in dermatofibroma and malignant fibrous Jun;13(6):1043-8 histiocytoma. J Dermatol Sci. 2002 Feb;28(2):119-25 Szabova L, Yamada SS, Birkedal-Hansen H, Holmbeck K. Daja MM, Niu X, Zhao Z, Brown JM, Russell PJ. Expression pattern of four membrane-type matrix Characterization of expression of matrix metalloproteinases metalloproteinases in the normal and diseased mouse and tissue inhibitors of metalloproteinases in prostate cancer mammary gland. J Cell Physiol. 2005 Oct;205(1):123-32 cell lines. Prostate Cancer Prostatic Dis. 2003;6(1):15-26 Yin CS, Lee HJ, Hong SJ, Chung JH, Koh HG. Microarray Goffin F, Munaut C, Frankenne F, Perrier D'Hauterive S, analysis of gene expression in chondrosarcoma cells treated Béliard A, Fridman V, Nervo P, Colige A, Foidart JM. with bee venom. Toxicon. 2005 Jan;45(1):81-91 Expression pattern of metalloproteinases and tissue inhibitors of matrix-metalloproteinases in cycling human endometrium. Zhang J, Sarkar S, Yong VW. The chemokine stromal cell Biol Reprod. 2003 Sep;69(3):976-84 derived factor-1 (CXCL12) promotes glioma invasiveness through MT2-matrix metalloproteinase. Carcinogenesis. 2005 Ishii Y, Nakasato Y, Kobayashi S, Yamazaki Y, Aoki T. A study Dec;26(12):2069-77 on angiogenesis-related matrix metalloproteinase networks in primary hepatocellular carcinoma. J Exp Clin Cancer Res. Do MS, Jeong HS, Choi BH, Hunter L, Langley S, Pazmany L, 2003 Sep;22(3):461-70 Trayhurn P. Inflammatory gene expression patterns revealed

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 196 MMP15 (matrix metallopeptidase 15 (membrane-inserted)) Ito E, et al.

by DNA microarray analysis in TNF-alpha-treated SGBS Ota I, Li XY, Hu Y, Weiss SJ. Induction of a MT1-MMP and human adipocytes. Yonsei Med J. 2006 Oct 31;47(5):729-36 MT2-MMP-dependent basement membrane transmigration program in cancer cells by Snail1. Proc Natl Acad Sci U S A. English JL, Kassiri Z, Koskivirta I, Atkinson SJ, Di Grappa M, 2009 Dec 1;106(48):20318-23 Soloway PD, Nagase H, Vuorio E, Murphy G, Khokha R. Individual Timp deficiencies differentially impact pro-MMP-2 Plaisier M, Dennert I, Rost E, Koolwijk P, van Hinsbergh VW, activation. J Biol Chem. 2006 Apr 14;281(15):10337-46 Helmerhorst FM. Decidual vascularization and the expression of angiogenic growth factors and proteases in first trimester García-Alvarez J, Ramirez R, Sampieri CL, Nuttall RK, spontaneous abortions. Hum Reprod. 2009 Jan;24(1):185-97 Edwards DR, Selman M, Pardo A. Membrane type-matrix metalloproteinases in idiopathic pulmonary fibrosis. Rebustini IT, Myers C, Lassiter KS, Surmak A, Szabova L, Sarcoidosis Vasc Diffuse Lung Dis. 2006 Mar;23(1):13-21 Holmbeck K, Pedchenko V, Hudson BG, Hoffman MP. MT2- MMP-dependent release of collagen IV NC1 domains Hotary K, Li XY, Allen E, Stevens SL, Weiss SJ. A cancer cell regulates submandibular gland branching morphogenesis. Dev metalloprotease triad regulates the basement membrane Cell. 2009 Oct;17(4):482-93 transmigration program. Genes Dev. 2006 Oct 1;20(19):2673- 86 Shiryaev SA, Savinov AY, Cieplak P, Ratnikov BI, Motamedchaboki K, Smith JW, Strongin AY. Matrix Lamari FN, Zompra AA, Pateraki E, Kousidou OC, Magafa V, metalloproteinase proteolysis of the myelin basic protein Karamanos NK, Cordopatis P. Gonadotropin-releasing isoforms is a source of immunogenic peptides in autoimmune hormone analogues alter gene expression of multiple sclerosis. PLoS One. 2009;4(3):e4952 metalloproteinases and their tissue inhibitors in human breast cancer epithelial cells. Anticancer Res. 2006 Nov- Chen L, DI D, Luo G, Zheng L, Tan Y, Zhang X, Xu N. Dec;26(6B):4615-21 Immunochemical staining of MT2-MMP correlates positively to angiogenesis of human esophageal cancer. Anticancer Res. Lyall MS, Dundas SR, Curran S, Murray GI. Profiling markers 2010 Oct;30(10):4363-8 of prognosis in colorectal cancer. Clin Cancer Res. 2006 Feb 15;12(4):1184-91 Ito E, Yana I, Fujita C, Irifune A, Takeda M, Madachi A, Mori S, Hamada Y, Kawaguchi N, Matsuura N. The role of MT2-MMP Morrison CJ, Overall CM. TIMP independence of matrix in cancer progression. Biochem Biophys Res Commun. 2010 metalloproteinase (MMP)-2 activation by membrane type 2 Mar 5;393(2):222-7 (MT2)-MMP is determined by contributions of both the MT2- MMP catalytic and hemopexin C domains. J Biol Chem. 2006 Mao L, Yuan L, Slakey LM, Jones FE, Burow ME, Hill SM. Sep 8;281(36):26528-39 Inhibition of breast cancer cell invasion by melatonin is mediated through regulation of the p38 mitogen-activated Plaisier M, Koolwijk P, Hanemaaijer R, Verwey RA, van der protein kinase signaling pathway. Breast Cancer Res. Weiden RM, Risse EK, Jungerius C, Helmerhorst FM, van 2010;12(6):R107 Hinsbergh VW. Membrane-type matrix metalloproteinases and vascularization in human endometrium during the menstrual Mohammad MA, Ismael NR, Shaarawy SM, El-Merzabani MM. cycle. Mol Hum Reprod. 2006 Jan;12(1):11-8 Prognostic value of membrane type 1 and 2 matrix metalloproteinase expression and gelatinase A activity in Saunders WB, Bohnsack BL, Faske JB, Anthis NJ, Bayless KJ, bladder cancer. Int J Biol Markers. 2010 Apr-Jun;25(2):69-74 Hirschi KK, Davis GE. Coregulation of vascular tube stabilization by endothelial cell TIMP-2 and pericyte TIMP-3. J Szabova L, Son MY, Shi J, Sramko M, Yamada SS, Swaim Cell Biol. 2006 Oct 9;175(1):179-91 WD, Zerfas P, Kahan S, Holmbeck K. Membrane-type MMPs are indispensable for placental labyrinth formation and Hiden U, Wadsack C, Prutsch N, Gauster M, Weiss U, Frank development. Blood. 2010 Dec 16;116(25):5752-61 HG, Schmitz U, Fast-Hirsch C, Hengstschläger M, Pötgens A, Rüben A, Knöfler M, Haslinger P, Huppertz B, Bilban M, Xie M, Jiao T, Chen Y, Xu C, Li J, Jiang X, Zhang F. Kaufmann P, Desoye G. The first trimester human trophoblast EMMPRIN (basigin/CD147) is involved in the morphogenesis cell line ACH-3P: a novel tool to study autocrine/paracrine of tooth germ in mouse molars. Histochem Cell Biol. 2010 regulatory loops of human trophoblast subpopulations--TNF- May;133(5):585-94 alpha stimulates MMP15 expression. BMC Dev Biol. 2007 Dec 19;7:137 Chryssanthi DG, Dedes PG, Karamanos NK, Cordopatis P, Lamari FN. Crocetin inhibits invasiveness of MDA-MB-231 Hodgkinson LM, Duncan G, Wang L, Pennington CJ, Edwards breast cancer cells via downregulation of matrix DR, Wormstone IM. MMP and TIMP expression in quiescent, metalloproteinases. Planta Med. 2011 Jan;77(2):146-51 dividing, and differentiating human lens cells. Invest Ophthalmol Vis Sci. 2007 Sep;48(9):4192-9 Harunaga J, Hsu JC, Yamada KM. Dynamics of salivary gland morphogenesis. J Dent Res. 2011 Sep;90(9):1070-7 Ratel D, Mihoubi S, Beaulieu E, Durocher Y, Rivard GE, Gingras D, Béliveau R. VEGF increases the fibrinolytic activity Tao G, Levay AK, Gridley T, Lincoln J. Mmp15 is a direct of endothelial cells within fibrin matrices: involvement of target of Snai1 during endothelial to mesenchymal VEGFR-2, tissue type plasminogen activator and matrix transformation and endocardial cushion development. Dev metalloproteinases. Thromb Res. 2007;121(2):203-12 Biol. 2011 Nov 15;359(2):209-21 Asano T, Tada M, Cheng S, Takemoto N, Kuramae T, Abe M, Zhu S, Zhou Y, Wang L, Zhang J, Wu H, Xiong J, Zhang J, Takahashi O, Miyamoto M, Hamada J, Moriuchi T, Kondo S. Tian Y, Wang C, Wu H. Transcriptional upregulation of MT2- Prognostic values of matrix metalloproteinase family MMP in response to hypoxia is promoted by HIF-1α in cancer expression in human colorectal carcinoma. J Surg Res. 2008 cells. Mol Carcinog. 2011 Oct;50(10):770-80 May 1;146(1):32-42 Quick RE, Dunlap JA, Jessen JR. Expression analysis of Plaisier M, Koolwijk P, Willems F, Helmerhorst FM, van zebrafish membrane type-2 matrix metalloproteinases during Hinsbergh VW. Pericellular-acting proteases in human first embryonic development. Gene Expr Patterns. 2012 Aug- trimester decidua. Mol Hum Reprod. 2008 Jan;14(1):41-51 Sep;12(7-8):254-60

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 197 MMP15 (matrix metallopeptidase 15 (membrane-inserted)) Ito E, et al.

Saminathan A, Vinoth KJ, Wescott DC, Pinkerton MN, Milne This article should be referenced as such: TJ, Cao T, Meikle MC. The effect of cyclic mechanical strain on the expression of adhesion-related genes by periodontal Ito E, Yana I, Matsuura N. MMP15 (matrix metallopeptidase 15 ligament cells in two-dimensional culture. J Periodontal Res. (membrane-inserted)). Atlas Genet Cytogenet Oncol 2012 Apr;47(2):212-21 Haematol. 2013; 17(3):193-198. Tombuloglu H, Semizoglu N, Sakcali S, Kekec G. Boron induced expression of some stress-related genes in tomato. Chemosphere. 2012 Feb;86(5):433-8

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 198 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication inv(16)(p13q24) CBFA2T3/GLIS2 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: November 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv16p13q24ID1624.html DOI: 10.4267/2042/48761 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology Cytogenetics Disease Cytogenetics morphological Acute megakaryoblastic leukemia (AMKL) This inversion of chromosome 16 is cryptic. The Note CBFA2T3/GLIS2 chimeric gene resulted from simple Acute megakaryoblastic leukemia (AMKL) was so far balanced inversions in three cases and from a complex divided into three subgroups: AMKL arising in patients rearrangement in one case (Gruber et al., 2012). A with Down syndrome (DS-AMKL), AMKL with a complex karyotype was found in 8 of the 12 cases with t(1;22)(p13;q13) giving rise of a 5' OTT - 3' MAL data on chromosomes; 2 remaining cases exhibited an fusion gene, and "other" AMLKs, i.e. non Down apparently normal karyotype (Gruber et al., 2012). syndrome / non t(1;22). Two new categories have recently been individualized Genes involved and proteins from the subgroup "non Down syndrome / non t(1;22)": GLIS2 the inv(16)(p13q24) CBFA2T3/GLIS2, and the t(11;12)(p15;p13) NUP98/KDM5A (Gruber et al., Location 2012; Thiollier et al., 2012). 16p13.3 Epidemiology Protein Kruppel-like zinc-finger protein. Transcription factor; Fourteen patients with data on sex and age are repressor of the Hedgehog signaling pathway; repressor available; median age at diagnosis was 1 year - 1 year 4 of the Wnt signaling pathway. GLIS2 has also been months (range 6 months - 4 years 7 months). reported to localize to the primary cilium. A mutation The inv(16)(p13q24) CBFA2T3/GLIS2 was found in GLIS2 has been linked to the development of about 30% of non-Down syndrome pediatric AMKL nephronophthisis. Glis2 may act as a repressor of cases (in 13 of 48 cases in Gruber et al., 2012, and 7 of epithelial-mesenchymal transition (EMT) and EMT- 22 cases in Thiollier et al., 2012. So far, none of the 36 related gene expression (Lichti-Kaiser et al., 2012). adult AMKL cases under study contained the chimeric transcript. CBFA2T3 One patient had a Down syndrome (case Location SJAMLM7018 in Gruber et al., 2012), which shows 16q24.3 that DS-AMKL and inv(16)-AMLK categories are not mutually exclusive. Protein Member of the "ETO" family. Functions as a Prognosis transcriptional repressor via interaction with Subgroup of patients with a significantly worse overall corepressor complexes; do not directly bind DNA, but survival at 5 years as compared to patients with AMKL interacts with transcription factors such as BCL6, that lacked this chimeric transcript (28% versus 42% in PLZF, GFI1, ZNF651 and ZNF652 (Kumar et al., Gruber et al., 2012); fusion associated with treatment- 2010). refractory disease (Thiollier et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 199 inv(16)(p13q24) CBFA2T3/GLIS2 Huret JL

enhanced self-renewal in vitro (Gruber et al., 2012). Result of the chromosomal Aurora A kinase (AURKA) inhibitors can induce anomaly differentiation and inhibits proliferation of AMKL blasts (Thiollier et al., 2012). Hybrid gene Description References 5' CBFA2T3 - 3' GLIS2. Fusion between exon 10 of Kumar R, Cheney KM, Neilsen PM, Schulz RB, Callen DF. CBFA2T3 and exon 3 of GLIS2 in 6 cases (Gruber et CBFA2T3-ZNF651, like CBFA2T3-ZNF652, functions as a al., 2012); fusion between exon 11 of CBFA2T3 and transcriptional corepressor complex. FEBS Lett. 2010 Mar exon 3 of GLIS2 in 1 case (Thiollier et al., 2012); 5;584(5):859-64 fusion between exon 11 of CBFA2T3 and exon 1 of Gruber TA, Larson Gedman A, Zhang J, Koss CS, Marada S, GLIS2 in 1 case (Gruber et al., 2012). Ta HQ, Chen SC, Su X, Ogden SK, Dang J, Wu G, Gupta V, Andersson AK, Pounds S, Shi L, Easton J, Barbato MI, Mulder Fusion protein HL, Manne J, Wang J, Rusch M, Ranade S, Ganti R, Parker M, Ma J, Radtke I, Ding L, Cazzaniga G, Biondi A, Kornblau SM, Description Ravandi F, Kantarjian H, Nimer SD, Döhner K, Döhner H, Ley Retains the three CBFA2T3 N-terminal nervy TJ, Ballerini P, Shurtleff S, Tomizawa D, Adachi S, Hayashi Y, homology regions (NHR) that mediate protein Tawa A, Shih LY, Liang DC, Rubnitz JE, Pui CH, Mardis ER, Wilson RK, Downing JR. An Inv(16)(p13.3q24.3)-Encoded interactions and the five GLIS2 C-terminal domains CBFA2T3-GLIS2 Fusion Protein Defines an Aggressive (ZnF) responsible for interaction with DNA and Subtype of Pediatric Acute Megakaryoblastic Leukemia. transactivation. The MYND (myeloid, nervy, and Deaf- Cancer Cell. 2012 Nov 13;22(5):683-97 1 domain, class of zinc finger domain reported to Lichti-Kaiser K, ZeRuth G, Kang HS, Vasanth S, Jetten AM. interact with the N-CoR repressor complex) domain of Gli-similar proteins: their mechanisms of action, physiological CBFA2T3 is lost. functions, and roles in disease. Vitam Horm. 2012;88:141-71 Oncogenesis Thiollier C, Lopez CK, Gerby B, Ignacimouttou C, Poglio S, This fusion between two transcriptional regulators Duffourd Y, Guégan J, Rivera-Munoz P, Bluteau O, Mabialah V, Diop M, Wen Q, Petit A, Bauchet AL, Reinhardt D, results in aberrant expression of genes controlled either Bornhauser B, Gautheret D, Lecluse Y, Landman-Parker J, by CBFA2T3 or GLIS2 (Thiollier et al., 2012). Radford I, Vainchenker W, Dastugue N, de Botton S, Dessen There is an homogenous gene expression signature P, Bourquin JP, Crispino JD, Ballerini P, Bernard OA, Pflumio including a strong expression of CD56. Among the F, Mercher T. Characterization of novel genomic alterations and therapeutic approaches using acute megakaryoblastic differentially regulated genes are known targets of the leukemia xenograft models. J Exp Med. 2012 Oct Hedgehog pathway including BMP2, BMP4, GATA3, 22;209(11):2017-31 and CCND2. CBFA2T3/GLIS2 induces BMP signaling. Hedgehog and JAK-STAT pathways are This article should be referenced as such: significantly upregulated (Gruber et al., 2012; Thiollier Huret JL. inv(16)(p13q24) CBFA2T3/GLIS2. Atlas Genet et al., 2012). CBFA2T3/GLIS2 cells demonstrated Cytogenet Oncol Haematol. 2013; 17(3):199-200.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 200 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(1;3)(q25;q27) GAS5/BCL6 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: November 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0103q25q27ID1625.html DOI: 10.4267/2042/48762 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

KKYK motif (375-379), and six zinc finger at the C- Clinics and pathology term (518-541, 546-568, 574-596, 602-624, 630-652, Disease 658-681), responsible for sequence specific DNA binding. Transcription repressor; recognizes the Non Hodgkin lymphoma consensus sequence: TTCCT(A/C)GAA (Albagli- Epidemiology Curiel, 2003). Role in germinal centers of lymphoid Two cases to date: two male patients (one was aged 49- follicles. BCL6 prevents ATM and TP53 to induce years) with diffuse large B-cell lymphoma (Chenevix- apoptosis in response to DNA rearrangements such as Trench et al., 1988; Nakamura et al., 2008). somatic hypermutation and class switch recombination. Therefore essential for normal B cell development. Prognosis GAS5 The patient reported in Nakamura et al., 2008 was treated with chemotherapy, but died of progressive Location disease 7 months after the diagnosis. 1q25.1 Protein Cytogenetics GAS5 exons do not encode a polypeptide product (small nucleolar RNA (snoRNA) sequence) of the Additional anomalies 5'TOP gene family; role in the regulation of cell Non specific additional anomalies were present in both growth; provokes growth arrest; overexpression of cases. GAS5 transcripts is reported to induce apoptosis. Genes involved and proteins Result of the chromosomal Note anomaly The genes involved in the translocation were, indeed, described in the most recent report. Hybrid gene BCL6 Description The 5'-terminal oligopyrimidine sequence of GAS5 Location was fused to the whole coding sequence of BCL6: 3q27.3 GAS5 exon 3 was fused to BCL6 exon 2 (BCL6 exon 1 Protein is noncoding). 706 amino acids; composed of a NH2-term BTB/POZ domain (amino acids 1-130 (32-99 according to Swiss- References Prot) which mediates homodimerization and protein- Chenevix-Trench G, Brown JA, Tyler GB, Behm FG. protein interactions with other corepressors (including Chromosome analysis of 30 cases of non-Hodgkin's HDAC1 and NCOR2/SMRT to constitute a large lymphoma. Med Oncol Tumor Pharmacother. 1988;5(1):17-32 repressing complex, another transcription repression Albagli-Curiel O. Ambivalent role of BCL6 in cell survival and domain (191-386), PEST sequences (300-417) with a transformation. Oncogene. 2003 Jan 30;22(4):507-16

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 201 t(1;3)(q25;q27) GAS5/BCL6 Huret JL

Nakamura Y, Takahashi N, Kakegawa E, Yoshida K, Ito Y, This article should be referenced as such: Kayano H, Niitsu N, Jinnai I, Bessho M. The GAS5 (growth arrest-specific transcript 5) gene fuses to BCL6 as a result of Huret JL. t(1;3)(q25;q27) GAS5/BCL6. Atlas Genet Cytogenet t(1;3)(q25;q27) in a patient with B-cell lymphoma. Cancer Oncol Haematol. 2013; 17(3):201-202. Genet Cytogenet. 2008 Apr 15;182(2):144-9

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 202 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(3;6)(q27;q14) SNHG5/BCL6 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: November 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0306q27q14ID2133.html DOI: 10.4267/2042/48763 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology SNHG5 Location Disease 6q14.3 Non Hodgkin lymphoma Protein Clinics SNHG5 is also known as U50HG. SNHG5 exons do The t(3;6)(q27;q14) was found in a human diffuse large not encode a polypeptide product (small nucleolar B-cell lymphoma cell line (Tanaka et al., 2000), and in RNA (snoRNA) sequence). SNHG5 is composed of six a case of follicular lymphoma transformed to diffuse exons. It possesses an oligopyrimidine tract that is aggressive lymphoma, from a study with no individual characteristic of the 5'-terminal oligopyrimidine (5'TOP data (Akasaka et al., 2003). gene family) which have been shown to regulate cell growth. Genes involved and proteins Result of the chromosomal BCL6 anomaly Location 3q27.3 Hybrid gene Protein Description 706 amino acids; composed of a NH2-term BTB/POZ Breakpoint in BCL6 first intron. domain (amino acids 1-130 (32-99 according to Swiss- Prot) which mediates homodimerization and protein- References protein interactions with other corepressors (including Tanaka R, Satoh H, Moriyama M, Satoh K, Morishita Y, HDAC1 and NCOR2/SMRT to constitute a large Yoshida S, Watanabe T, Nakamura Y, Mori S. Intronic U50 repressing complex, another transcription repression small-nucleolar-RNA (snoRNA) host gene of no protein-coding domain (191-386), PEST sequences (300-417) with a potential is mapped at the chromosome breakpoint t(3;6)(q27;q15) of human B-cell lymphoma. Genes Cells. 2000 KKYK motif (375-379), and six zinc finger at the C- Apr;5(4):277-87 term (518-541, 546-568, 574-596, 602-624, 630-652, 658-681), responsible for sequence specific DNA Akasaka T, Lossos IS, Levy R. BCL6 gene translocation in follicular lymphoma: a harbinger of eventual transformation to binding. Transcription repressor; recognizes the diffuse aggressive lymphoma. Blood. 2003 Aug consensus sequence: TTCCT(A/C)GAA (Albagli- 15;102(4):1443-8 Curiel, 2003). Role in germinal centers of lymphoid Albagli-Curiel O. Ambivalent role of BCL6 in cell survival and follicles. BCL6 prevents ATM and TP53 to induce transformation. Oncogene. 2003 Jan 30;22(4):507-16 apoptosis in response to DNA rearrangements such as somatic hypermutation and class switch recombination. This article should be referenced as such: Therefore essential for normal B cell development. Huret JL. t(3;6)(q27;q14) SNHG5/BCL6. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3):203.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 203 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(3;9)(q27;p13) GRHPR/BCL6 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: November 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0309q27p13ID2132.html DOI: 10.4267/2042/48764 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Prot) which mediates homodimerization and protein- Clinics and pathology protein interactions with other corepressors (including Disease HDAC1 and NCOR2/SMRT to constitute a large repressing complex, another transcription repression Non Hodgkin lymphoma domain (191-386), PEST sequences (300-417) with a Clinics KKYK motif (375-379), and six zinc finger at the C- The t(3;9)(q27;p13) was found in a case of follicular term (518-541, 546-568, 574-596, 602-624, 630-652, lymphoma transformed to diffuse aggressive 658-681), responsible for sequence specific DNA lymphoma, from a study with no individual data binding. Transcription repressor; recognizes the (Akasaka et al., 2003), in a 71-year-old female patient consensus sequence: TTCCT(A/C)GAA (Albagli- with a diagnosis of diffuse large B-cell lymphoma Curiel, 2003). Role in germinal centers of lymphoid (DLBCL) of stomach, which evolved to a nodular follicles. BCL6 prevents ATM and TP53 to induce lymphocyte-predominant Hodgkin's lymphoma 3 years apoptosis in response to DNA rearrangements such as later, and to a nodal DLBCL nine years after the initial somatic hypermutation and class switch recombination. diagnosis (Wlodarska et al., 2004), in a 47-year-old Therefore essential for normal B cell development. male patient with Burkitt lymphoma, who died of GRHPR progressive disease 2 months after diagnosis (Bacher et Location al., 2011), and in a female patient with a follicular 9p13.2 lymphoma (Cheung et al., 2012). Note Cytogenetics GRHPR was found involved in the translocation reported in the Akasaka's case, and Wlodarska et al., Cytogenetics morphological 2004 also point to its possible involvement. The Burkitt lymphoma case showed the characteristic Protein t(8;14)(q24;q32) and a complex karyotype, the GRHPR is an enzyme which catalyzes the reduction of follicular lymphoma case showed the hydroxy-pyruvate to D-glycerate, glyoxylate to t(14;18)(q32;q21). In the DLBCL case, no specific glycolate and the oxidation of D-glycerate to translocation accompanied the t(3;9). hydroxypyruvate. Primary hyperoxaluria type 2 is an autosomal recessive disease caused by mutations in Genes involved and proteins GRHPR (Cramer et al., 1999). BCL6 Result of the chromosomal Location 3q27.3 anomaly Protein Hybrid gene 706 amino acids; composed of a NH2-term BTB/POZ Description domain (amino acids 1-130 (32-99 according to Swiss- Breakpoint in BCL6 first intron.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 204 t(3;9)(q27;p13) GRHPR/BCL6 Huret JL

predominant Hodgkin's lymphoma. Haematologica. 2004 References Aug;89(8):965-72 Cramer SD, Ferree PM, Lin K, Milliner DS, Holmes RP. The Bacher U, Haferlach T, Alpermann T, Kern W, Schnittger S, gene encoding hydroxypyruvate reductase (GRHPR) is Haferlach C. Several lymphoma-specific genetic events in mutated in patients with primary hyperoxaluria type II. Hum Mol parallel can be found in mature B-cell neoplasms. Genes Genet. 1999 Oct;8(11):2063-9 Chromosomes Cancer. 2011 Jan;50(1):43-50 Akasaka T, Lossos IS, Levy R. BCL6 gene translocation in Cheung KJ, Rogic S, Ben-Neriah S, Boyle M, Connors JM, follicular lymphoma: a harbinger of eventual transformation to Gascoyne RD, Horsman DE. SNP analysis of minimally diffuse aggressive lymphoma. Blood. 2003 Aug evolved t(14;18)(q32;q21)-positive follicular lymphomas 15;102(4):1443-8 reveals a common copy-neutral loss of heterozygosity pattern. Cytogenet Genome Res. 2012;136(1):38-43 Albagli-Curiel O. Ambivalent role of BCL6 in cell survival and transformation. Oncogene. 2003 Jan 30;22(4):507-16 This article should be referenced as such: Wlodarska I, Stul M, De Wolf-Peeters C, Hagemeijer A. Huret JL. t(3;9)(q27;p13) GRHPR/BCL6. Atlas Genet Heterogeneity of BCL6 rearrangements in nodular lymphocyte Cytogenet Oncol Haematol. 2013; 17(3):204-205.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 205 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(5;12)(p13;p13) NIPBL/ETV6 Etienne De Braekeleer, Juan Ramón González García, Janet Margarita Soto Padilla, Carlos Cordova Fletes, Frédéric Morel, Nathalie Douet-Guilbert, Marc De Braekeleer Cytogenetics Laboratory, Faculty of Medicine, University of Brest, France (ED, FM, NDG, MD), Division de Genetica. Centro de Investigacion Biomedica de Occidente. IMSS. Guadalajara, Jalisco, Mexico (JRG), Departamento de Hematologia. HUMAE-H. Pediatria. Centro Medico Nacional de Occidente. IMSS. Guadalajara, Jalisco, Mexico (JMS), Unidad de Biologia Molecular, Genomica y Secuenciacion, Centro de Investigacion y Desarrollo en Ciencias de la Salud, Universidad Autonoma de Nuevo Leon, Monterrey, Nuevo Leon, Mexico (CC)

Published in Atlas Database: November 2012 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0512p13p13ID1616.html DOI: 10.4267/2042/48765 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Clinics and pathology Evolution The patient relapsed 24 months later, alive 32 months Disease following diagnosis. Acute myeloid leukemia (AML-M7) Epidemiology Genetics This is a rare chromosomal rearrangement, only Note reported twice, without molecular characterization The t(5;12)(p13;p13) involves the ETV6 gene (12p13), (Sessarego et al., 1989; Shimizu et al., 1991). a transcription factor frequently rearranged in myeloid Clinics and lymphoid leukemias. A 5-year old girl seen for paleness, hypertrophic More than 30 ETV6 fusion gene partners have been amygdala, bilateral cervical adenopathies, described. splenomegaly, and anemia. Most translocations involving ETV6 generate fusion genes that lead to the activation of transcription factors Cytology or kinases but other mechanisms are also known (loss Blast morphology was indicative of acute of function of the fusion gene, affecting ETV6 and the megakaryoblastic leukemia; immunophenotype: CD7+, partner gene, activation of a proto-oncogene in the CD33+, CD34+. vicinity of a chromosomal translocation and dominant Pathology negative effect of the fusion protein over transcriptional repression mediated by wild-type ETV6) (De Bone marrow was hypercellular, with 100% blasts. Braekeleer et al., 2012). Treatment The patient received standard induction chemotherapy leading to complete remission followed by consolidation, then maintenance therapy.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 206 t(5;12)(p13;p13) NIPBL/ETV6 De Braekeleer E, et al.

GTG banding showing chromosomes 5 and 12 and the derivatives der(5) and der(12).

Cytogenetics NIPBL Location Cytogenetics morphological 5p13.2 t(5;12)(p13;p13) as the sole abnormality at diagnosis Note and relapse. Mutations in NIPBL (Nipped-B homolog (Drosophila), Cytogenetics molecular alias Scc2 "sister chromatid cohesion 2 homolog FISH showed that the breakpoint on 12p13 was located (yeast)") result in Cornelia de Lange syndrome, a in ETV6. To confirm the position of the breakpoint on disorder characterized by dysmorphic facial features, chromosome 5, BACs located at 5p13 were used as growth delay, limb reduction defects, and mental probes in FISH experiments. Analysis on BM cells of retardation (Krantz et al., 2004; Tonkin et al., 2004). the patient with RP11-140A7 showed that one signal DNA/RNA hybridized to the normal chromosome 5, and the other The NIPBL gene contains 47 exons spanning 188 kb, split and hybridized to both der(5) and der(12). with the coding sequence starting in exon 2. Two Co-hybridization with the RP11-140A7 clone and an different isoforms are generated by two transcript ETV6 probe showed two yellow fusion signals. RP11- variants. A first transcript, starting in exon 2, continues 140A7 contains the NIPBL gene. to exon 47 and the second transcript continues to an expanded variant of exon 46. Genes involved and proteins Protein The first transcript leads to a 2804 amino acids isoform ETV6 and the second transcript to a 2697 amino acids Location isoform. Both isoforms are identical from amino acid 1 12p13 to 2683 while the C-terminal ends are unrelated. The Protein NIPBL protein is a complex molecule containing, The ETV6 gene encodes a transcription factor among others, a nuclear localization signal, a nuclear frequently rearranged in myeloid and lymphoid export signal, 5 HEAT repeats and a DNA-binding leukemias (De Braekeleer et al., 2012). domain. The NIPBL protein is a subunit of the cohesin loading complex

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 207 t(5;12)(p13;p13) NIPBL/ETV6 De Braekeleer E, et al.

that mediates cohesion of sister chromatids (Ciosk et Tonkin ET, Wang TJ, Lisgo S, Bamshad MJ, Strachan T. al., 2000). NIPBL also represses promoter activity via NIPBL, encoding a homolog of fungal Scc2-type sister chromatid cohesion proteins and fly Nipped-B, is mutated in the recruitment of histone deacetylases (Jahnke et al., Cornelia de Lange syndrome. Nat Genet. 2004 Jun;36(6):636- 2008). 41 Jahnke P, Xu W, Wülling M, Albrecht M, Gabriel H, Gillessen- References Kaesbach G, Kaiser FJ. The Cohesin loading factor NIPBL recruits histone deacetylases to mediate local chromatin Sessarego M, Frassoni F, Defferrari R, Bacigalupo A, Miceli S, modifications. Nucleic Acids Res. 2008 Nov;36(20):6450-8 Mareni C, Ajmar F. Cytogenetic follow-up after bone marrow transplantation for Philadelphia-positive chronic myeloid De Braekeleer E, Douet-Guilbert N, Morel F, Le Bris MJ, leukemia. Cancer Genet Cytogenet. 1989 Oct 15;42(2):253-61 Basinko A, De Braekeleer M. ETV6 fusion genes in hematological malignancies: a review. Leuk Res. 2012 Shimizu S, Tsunematsu Y, Fujimoto J, Mizutani S, Kaneko Y. Aug;36(8):945-61 A case of mixed lineage acute non-lymphocytic leukemia with t(5;12)(p13;p13). Jpn J Clin Oncol. 1991 Aug;21(4):314-7 de Braekeleer E, Auffret R, García JR, Padilla JM, Fletes CC, Morel F, Douet-Guilbert N, de Braekeleer M. Identification of Ciosk R, Shirayama M, Shevchenko A, Tanaka T, Toth A, NIPBL, a new ETV6 partner gene in t(5;12) (p13;p13)- Shevchenko A, Nasmyth K. Cohesin's binding to chromosomes associated acute megakaryoblastic leukemia. Leuk depends on a separate complex consisting of Scc2 and Scc4 Lymphoma. 2013 Feb;54(2):423-4 proteins. Mol Cell. 2000 Feb;5(2):243-54 Krantz ID, McCallum J, DeScipio C, Kaur M, Gillis LA, Yaeger This article should be referenced as such: D, Jukofsky L, Wasserman N, Bottani A, Morris CA, Nowaczyk De Braekeleer E, González García JR, Soto Padilla JM, MJ, Toriello H, Bamshad MJ, Carey JC, Rappaport E, Cordova Fletes C, Morel F, Douet-Guilbert N, De Braekeleer Kawauchi S, Lander AD, Calof AL, Li HH, Devoto M, Jackson M. t(5;12)(p13;p13) NIPBL/ETV6. Atlas Genet Cytogenet LG. Cornelia de Lange syndrome is caused by mutations in Oncol Haematol. 2013; 17(3):206-208. NIPBL, the human homolog of Drosophila melanogaster Nipped-B. Nat Genet. 2004 Jun;36(6):631-5

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 208 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Solid Tumour Section Review

Breast: Ductal carcinoma Cathy B Moelans, Paul J van Diest Department of Pathology, University Medical Center Utrecht, Utrecht, Heidelberglaan 100, PO Box 85500, 3508 GA, Utrecht, The Netherlands (CBM, PJv)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Tumors/DuctCarcBreastID5593.html DOI: 10.4267/2042/48766 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity - Cribriform carcinoma: younger age, good prognosis. Other names Clinics and pathology Infiltrating/invasive ductal carcinoma (IDC) Carcinoma of no special type (NST) or not otherwise Disease specified (NOS) Carcinoma of the breast is more common in the left breast than in the right, in a ratio of 110/100. Classification Approximately 50% arise in the upper outer quadrant, 10% in each of the remaining quadrants, and 20% in Note the central or subareolar region. While the IDC represents 65 to 85 percent of all breast cancers. overwhelming majority of breast cancer cases in IDC originates in the transition between the breast's humans are women, men can also develop breast milk ducts and lobuli and invades surrounding breast cancer. tissue. Progression: One of the earliest detectable changes is Classification loss of normal regulation of cell growth and polarity, Invasive ductal carcinoma is a heterogeneous group resulting in early morphological changes such as with many different subtypes, some of them extremely atypical ductal hyperplasia (ADH) and columnar cell rare. Each of these variants is associated with another lesions (CCL). Next, genomic instability results in the pathological presentation and with a different prognosis formation of ductal carcinoma in situ (DCIS) lesions. compared to invasive ductal carcinoma of no special In the most popular model to explain the development type (NST). As shown in Figure 1, some of the most of IDC, low-grade DCIS lesions tend to progress to important subclassifications are: low-grade IDC, and high-grade DCIS tends to progress - Medullary carcinoma: younger age, association with to high-grade IDC by accumulation of fairly specific BRCA1 mutation, 1-5% of breast carcinomas, rarely chromosomal and gene alterations (Buerger et al., lymph node metastases, bad prognosis 2000; Hwang et al., 2004). - Metaplastic carcinoma: <1% of breast carcinomas, The majority of molecular changes that are observed in association with BRCA1 mutation, bad prognosis breast cancer seem to be already evident in the DCIS - Mucinous/colloid carcinoma: older age, 1-6% of stage (Mommers et al., 2001). breast carcinomas, better prognosis Also, epigenetic changes such as methylation and - Inverted papillary carcinoma: 1% of all breast microRNAs are believed to play role in the disease carcinomas, better prognosis, striking lymphovascular progression and occur early as well (O'Day and Lal, invasion 2010; Jovanovic et al., 2010). - Tubular carcinoma: younger age, about 5% of breast carcinomas, excellent prognosis

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 209 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Figure 1. Main breast cancer histological types. From top left to bottom right: ductal NST, medullary, tubular, cribriform, mucinous and (squamous) metaplastic breast cancer.

Etiology breast cancer can be found at the International Agency for Research on Cancer Globocan website and at the The etiology is multifactorial with three major SEER database of the U.S. National Cancer Institute. contributors to the development of breast cancer: 1) Based on rates from 2006-2008, 12.29% (1/8) of genetic factors, 2) hormonal influences and 3) women born today will be diagnosed with breast cancer environmental factors. Less than 10% of women with at some time during their lifetime. Breast cancer is breast cancer have a family history of the disease rarely found before the age of 25 years (except in (BRCA1/BRCA2 mutations, ATM, TP53). Hormonal familial cases). The incidence then increases with age, influences include early menstruation, late menopause, with most women being 60 years old when diagnosed. nulliparity, and late age at first childbirth. The main risk factors are genetic predisposition, Environmental risk factors include alcohol increasing age, proliferative breast disease, carcinoma consumption and dietary fat intake. Cigarette smoking of the contralateral breast or endometrium, radiation and caffeine consumption have not been implicated in exposure (Hodgkin lymphoma), geographic influences, breast cancer. race, length of reproductive life, parity, age of first Epidemiology child (older than 30 years), obesity, and exogeneous Worldwide, breast cancer is the most common invasive estrogens (hormonal replacement therapy, oral cancer in women. Incidence and mortality data on contraceptives).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 210 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Figure 2: Breast cancer biomarkers. Top left: ER α expression. Top right: HER2 receptor overexpression (3+). Bottom left: Ki67/MIB1 nuclear expression. Bottom right: lymph node metastasis.

Clinics the general health of the patient (Edge et al., 2010). Stages are subdivided as follows: Cancers of the breast are usually first discovered by - Stage 0: Ductal carcinoma in situ (DCIS) or lobular women or their physician as a solitary painless mass. carcinoma in situ (LCIS); 5-year survival rate 93% The use of mammography, sonography and MRI has - Stage 1: Invasive carcinoma 2 cm or less without increased the detection of ductal carcinoma in situ nodal involvement and no distant metastases; 5-year (DCIS) and small invasive tumors before they reach survival rate 88% palpable size. These non-palpable lesions can then be - Stage 2: Invasive carcinoma 5 cm or less with sampled by image-guided core needle biopsies. These involved but movable axillary lymph nodes and no lesions are usually <1 cm in size and less than 1/5th distant metastases, or a tumor > 5 cm without nodal will have axillary metastases. Palpable lesions, in involvement or distant metastases (5-year survival rate contrast, are usually 2-3 cm in size when first found, 74-81%) and approximately 1/3 has already spread to axillary or - Stage 3 (locally advanced): Breast cancer > 5 cm with other lymph nodes. Lymph node status is generally nodal involvement; or any breast cancer with fixed assessed through the sentinel node procedure. axillary nodes; or any breast cancer with involvement Clinical staging: of the ipsilateral internal mammary lymph nodes; or The American Joint Committee on Cancer (AJCC) any breast cancer with skin involvement, pectoral and staging system provides a strategy for grouping patients chest wall fixation, edema, or clinical inflammatory with respect to prognosis. Therapeutic decisions are carcinoma, if distant metastases are absent (5-year formulated in part according to staging categories but survival rate 41-67%) primarily according to tumor size, lymph node status, - Stage 4: any form of breast cancer with distant estrogen-receptor and progesterone-receptor levels in metastases (including ipsilateral supraclavicular lymph the tumor tissue, human epidermal growth factor nodes); 5-year survival rate 15%. receptor 2 (HER-2/neu) status, menopausal status, and

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 211 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Figure 3. Left: invasive breast carcinoma with HER2 amplification by CISH; Right: FISH showing invasive breast carcinoma with HER2 amplification (red) and CEP17 gain (green).

Pathology - Expression of certain oncogenes (HER2, MYC) or loss of tumor suppressor genes (TP53, CDH1). The pathologist assesses resection margins, lymph node status, tumor size, tumor grade, mitotic activity, histological subtype, lymphovascular invasion, Genetics hormonal receptor status (by immunohistochemistry) Note and HER2 status. Most breast cancer cases are sporadic, with many Treatment different oncogenes and tumor suppressor genes involved, while 5-10% are estimated to be due to an Surgery (mastectomy or lumpectomy, axillary node inherited predisposition. dissection), radiation, hormonal therapy, chemotherapy Autosomal dominant alterations in two genes, BRCA1 or combinations. A very important therapeutic strategy and BRCA2, are likely to account for most familial since 1998 is targeted therapy with trastuzumab, a cases of early-onset breast cancer, and for 3-4% of all humanized monoclonal antibody directed against the breast cancers. human epidermal growth factor receptor 2 (HER2, Mutations in several other genes, including TP53, amplified and overexpressed in 10-15% of breast PTEN, STK11/LKB1, CDH1, CHEK2, ATM, MLH1, cancers) (Romond et al., 2005). and MSH2, have also been associated with hereditary Prognosis breast tumors (Campeau et al., 2008; Walsh et al., Prognosis and survival rates vary greatly depending on 2006). cancer type, grade, proliferation rate (van Diest et al., 2004), staging and treatment. Prognosis of breast Cytogenetics tumors without distant metastases depends on a number of histopathological factors (upon distant metastases, Cytogenetics Molecular cure is unlikely): Although traditionally classical karyotyping and - Locally advanced disease (skin or skeletal muscle chromosome based comparative genomic hybridization invasion) (CGH) have yielded information on chromosomal loci - Presence and number of lymph node metastases, and genes involved in breast carcinogenesis, nowadays including the size of metastatic deposit and invasion molecular and cytogenetic techniques such as through the capsule fluorescence in situ hybridization (FISH, see Figure 3 - Tumor size right), (q)PCR, multiplex ligation-dependent probe - Histological subtype (NST/medullary/metaplastic vs. amplification (MLPA, see Figure 4), next generation tubular, cribriform, mucinous) sequencing, and array techniques for CGH, gene - Tumor grade (Bloom and Richardson grading system expression, methylation and microRNAs are frequently combines tubule formation, mitotic rate and nuclear used in breast cancer diagnostics and research. atypia) FISH, as well as its chromogenic counterparts - Hormonal receptor status (estrogen and progesterone C(hromogenic)ISH and S(ilver)ISH, but also MLPA receptor positivity confers better prognosis; 70-80% of are currently used to analyze HER2 gene amplification breast cancers are positive for ER/PR) status, an important prognostic factor and predictor of - Proliferative rate (mitotic index, Ki-67 staining) trastuzumab, chemotherapy and hormonal therapy response in breast cancer.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 212 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Figure 4. Top: HER2 non-amplified case by multiplex ligation-dependent probe amplification (MLPA). Bottom: HER2-amplified case by MLPA; notice the increased peak height for 5 probes (* = HER2 probes).

ISH and MLPA are generally performed as a second- rearrangements in the MCF7 breast cancer cell line can line gene amplification test in tumors for which the be found here, and illustrates the complexity of the immunohistochemistry (protein expression) status for breast cancer genome. A series of recent next- HER2 is equivocal (so-called 2+). Amplification of generation sequencing manuscripts have further HER2 is usually determined as ratio of HER2 on underlined the genetic diversity of breast cancer. CEP17, the centromere of chromosome 17 (where Beyond confirming recurrent somatic mutations in HER2 resides), to correct for a phenomenon called PIK3CA, TP53, AKT1, GATA3 and MAP3K1, polysomy 17. However, several groups have questioned potential driver mutations were identified in several the value of CEP17 correction since it does not seem to new cancer genes including AKT2, ARID1B, CASP8, be correlated to chromosome 17 polysomy, which in CDKN1B, MAP3K1, MAP3K13, NCOR1, fact is very rare (Moelans et al., 2011). SMARCD1, TBX3, MTAP, PPP2R2A, CBFB and CGH has mainly been used in the research setting MAP2K3 (Stephens et al., 2012; Banerji et al., 2012; because of its high costs and difficulty of interpretation. Curtis et al., 2012). Next to recurrent mutations and Results of CGH have extensively been described here, deletions, recurrent fusion products have also been with most frequent alterations (mainly gains and shown (Banerji et al., 2012) to be more or less present amplifications) on chromosomes 8, 11 and 17. A in certain subtypes of breast cancer. Analysis of paired graphical representation of the chromosomal DNA-RNA profiles revealed novel subgroups with aberrations found in breast tumors can be found here. A distinct clinical outcomes (Curtis et al., 2012). possible application for CGH in diagnostics in the future could be the differential diagnosis Additional anomalies metastasis/new primary tumor. Genetic alterations in As for most human cancers, aneuploidy is frequently the primary tumor are believed to be fairly conserved present in breast tumors. The predictive value of throughout the metastatic process and as such, nuclear DNA content in mammary carcinoma is still comparison of the chromosomal profiles of primary under debate in spite of several reports indicating a tumors and metastases should show high similarity. relationship between DNA ploidy and prognosis. Sequencing projects provide us with more insight in Chromosomal translocations that form fusion products breast cancer genomic rearrangements (copy number and/or activate gene expression by promoter insertion alterations, breakpoints, intra- and inter-chromosomal are key events in hematological malignancies, but have rearrangements (Edgren et al., 2011). A graphical been reported to be less common in epithelial cancers (Circos plot) representation of chromosomal such as breast cancer. However, that view is currently

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 213 Breast: Ductal carcinoma Moelans CB, van Diest PJ

being challenged by array painting and next generation EGFR sequencing studies. Location Reciprocal and more complex balanced translocations 7p11 seem to be far more frequent than expected. The NRG1 gene on 8p12 seems to be translocated in 6% of breast Protein cancers (Huang et al., 2004; Chua et al., 2009) and The epidermal growth factor receptor 1 (EGFR, furthermore, several translocation break points are ERBB1) is one of the four members of the ErbB located within genes, including known cancer-critical family. EGFR is a receptor tyrosine kinase protein that genes such as EP300/p300 and CTCF (Howarth et al., binds to EGF. Binding to its ligand induces receptor 2008; Edwards, 2010). dimerization, tyrosine autophosphorylation and leads to One of the best known translocations in a specific cell proliferation. EGFR is amplified in a small subtype of breast cancer (secretory type) is a recurrent percentage (5-10%) of sporadic breast tumors but a chromosomal translocation t(12;15)(p13;q25), leading broad range of amplification frequencies has been to the formation of the ETV6-NTRK3 fusion gene reported in literature (7-65%) (Lambros et al., 2007). (Vasudev and Onuma, 2011). Another well-known EGFR amplification/overexpression is however more recurrent translocation in adenoid cystic carcinoma frequent in hereditary, triple negative (ER, PR and (ACC) of the breast, t(6;9)(q22-23;p23-24), resulting in HER2 negative) and basal-like breast tumors (Livasy et a fusion of the two transcription factor genes MYB and al., 2006; van der Groep et al., 2004). As for IGFR1 NFIB (Persson et al., 2009). The fusion results in loss (see below), one of the mechanisms of resistance to the of the 3'-end of MYB, including several conserved HER2-targeted antibody trastuzumab is cross-talk binding sites for microRNAs that regulate MYB between EGFR and HER2, which has lead to the expression negatively. development of a dual (oral) tyrosine kinase inhibitor of HER2 and EGFR, called lapatinib (Montemurro et Genes involved and proteins al., 2007). Note EMSY (C11orf30) The number of genetic alterations in breast cancer is Location immense and it is therefore not possible to elaborate on 11q13 all of them. Protein A selection was made based on the amount of evidence/literature present. Several of the Its protein can repress transcription, possibly via its genes/proteins involved in invasive ductal carcinoma interaction with a multiprotein chromatin remodeling have already been described in "Breast tumors: an complex that modifies the chromatin. Its interaction overview". These will not be repeated here (TP53, with BRCA2 suggests that it may play a central role in HER2/ERBB2, CCND1, FGFR1, BRCA1, BRCA2, the DNA repair function of BRCA2. It is amplified in BRCA3, PTEN, ATM, MSH2, MLH1, PMS1, MSH3, 7-13% of breast tumors (Hughes-Davies et al., 2003; CDH1, HRAS, NRAS and KRAS). Kirkegaard et al., 2008; Moelans et al., 2010). Co- amplification of CCND1 and EMSY was shown to be BIRC5 associated with an adverse outcome in ER-positive Location tamoxifen-treated breast cancers (Brown et al., 2010). 17q25 On the other hand, a recent study suggested that EMSY is unlikely to be a driver of the 11q13-q14 amplicon Protein and does not have a dominant role in modulating the The encoded protein (baculoviral IAP repeat containing response to agents targeting cells with defective 5), also called survivin, is an adapter molecule involved homologous recombination (Wilkerson et al., 2011). in signal transduction, cell communication and cell survival. It is a component of the chromosomal ESR1 passenger complex (CPC), a complex that acts as a key Location regulator of mitosis. The BIRC5 gene is a member of 6q25.1 the inhibitor of apoptosis (IAP) gene family, which Protein encodes negative regulatory proteins that prevent apoptotic cell death. Amplification of the BIRC5 region This gene encodes an estrogen receptor (ER alpha), a (in 15-30% of breast cancers) has been shown to ligand-activated transcription factor. Upon ligand predict distant recurrence (Davis et al., 2007) and an binding the estrogen receptor undergoes a altered cytoplasmic to nuclear ratio of BIRC5 was conformational change allowing dimerization to form shown to be an independent prognostic factor in breast either homo- or heterodimers. As a dimer, the estrogen cancer (Brennan et al., 2008). receptor binds to the estrogen response element (ERE) in the promoter region of target genes.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 214 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Initial reports showed an ESR1 amplification frequency MYC of 20.6% in breast cancer (Holst et al., 2007) but Location subsequent studies reported considerably lower 8q24 amplification frequencies, ranging between 5 and 10% (Albertson, 2008; Moelans et al., 2012). Studies have Protein been contradictory with respect to its correlation with c-myc is a nuclear protein that plays a role in cell cycle ER alpha protein overexpression, prognostic value as progression, apoptosis and cellular transformation. It well as predictive value (tamoxifen response or functions as a transcription factor that regulates resistance). ER alpha protein overexpression is present transcription of specific target genes. It is amplified in in 70-80% of breast cancers and is predictive of 9-15% of breast cancers but a broad range of response to endocrine therapy (Wolmark and Dunn, amplification frequencies has been reported (between 1 2001). and 94%) (Lambros et al., 2007; Jensen et al., 2009). MYC amplification has generally been associated with HIF1A a worse prognosis, with higher mitotic activity and Location larger tumor size (Moelans et al., 2010). In human 14q23.2 breast tumors, MYC amplification has been associated Protein with HER2 amplification and HER2-amplified breast This gene encodes the alpha subunit of transcription tumors were shown to have a 2.5-fold or greater factor hypoxia-inducible factor-1 (HIF-1), which is a increased likelihood of having MYC amplification (Al- heterodimer composed of an alpha and a beta subunit. Kuraya et al., 2004). Patients with MYC/HER2 co- HIF-1 functions as a regulator of cellular response to amplification were observed to have substantially hypoxia by activating transcription of many genes, worse outcomes than patients who had single-gene including those involved in energy metabolism, amplification, even after standard chemotherapy. angiogenesis and apoptosis. HIF-1 thus plays an However, it was subsequently shown that patients with essential role in tumor angiogenesis and survival MYC/HER2 co-amplification in their primary breast (Semenza, 2000). Although no amplifications are tumors benefited significantly more from trastuzumab involved (Vleugel et al., 2004), HIF1 alpha has been than did patients with only HER2 amplification. This shown to be overexpressed in sporadic breast cancer, could, however, not be confirmed in a later study and even more in BRCA1-related hereditary breast (Perez et al., 2011). cancer (van der Groep et al., 2008). Increased levels of NOTCH1 HIF1 alpha have been associated independently with Location poor prognosis in lymph node negative breast 9q34.3 carcinoma (Bos et al., 2003). Protein IGF1R Functions as a receptor for membrane-bound ligands Location Jagged1, Jagged2 and Delta1. Upon ligand activation 15q26.3 through the released NOTCH1 intracellular domain Protein (NICD) it forms a transcriptional activator complex. Its protein is a receptor with tyrosine kinase activity. NOTCH1 affects multiple cellular processes including IGFRs mediate their intracellular actions through the stem cell maintenance, cell fate, differentiation, PI3-K and RAS/RAF/MAPK signaling pathways. proliferation, motility and survival (Reedijk, 2012). Many tumors have altered expression of IGF1R and its Aberrant NOTCH1 activity influences breast cancer ligands and this constitutes an early event in progression through these processes and NOTCH1 tumorigenesis. IGF1R overexpression is predominantly activity seems to participate in cancer metastasis by seen in ER-positive breast tumors. The HER2 group modulating the EMT, angiogenesis, and anoikis- (ER/PR negative, HER2 positive) generally shows resistance of tumor cells (Hu et al., 2012). Aberrant reduced expression and the expression is somewhat NOTCH signaling can induce breast carcinoma in heterogeneous in the triple-negative group (ER, PR and transgenic mice, and high expression of NOTCH HER2 negative) (Bhargava et al., 2011). receptors and ligands has been linked to poor clinical One of the mechanisms of resistance to the HER2- outcomes in patients with breast cancer (Han et al., targeted antibody trastuzumab is cross-talk between the 2011). insulin-like growth factor-I receptor and HER2 (Jin and PIK3CA Esteva, 2008). In addition to its therapeutic potential in Location HER2-positive trastuzumab-resistant tumors, targeting 3q26.3 the IGF1R also shows therapeutic potential in basal- like breast cancers, a group of aggressive tumors of Protein poor prognosis for which there is no effective targeted PI 3-Kinases (phosphoinositide 3-kinases, PI3Ks) therapy currently available (Klinakis et al., 2009). coordinate a diverse range of cell functions including

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 215 Breast: Ductal carcinoma Moelans CB, van Diest PJ

proliferation, cell survival, degranulation, vesicular The RARB2 promotor region was shown to be trafficking and cell migration. PIK3CA activating methylated in 20-25% of breast cancers and mutations show a high prevalence in breast cancer methylation was shown to be an independent important (34%) (Cizkova et al., 2012) and are associated with determinant of breast cancer prognosis (Sharma et al., higher age at diagnosis, hormone receptor positivity, 2009; Cho et al., 2012). HER2 negativity, lower tumor grade and stage, and lymph node negativity. PIK3CA mutations have been RASSF1 associated with significantly longer metastasis-free Location survival, especially in the PR-positive and HER2- 3p21.3 positive subgroups (Cizkova et al., 2012). The majority Protein of mutations occur at three hotspots, making these ideal This gene encodes a protein similar to the RAS effector targets for therapeutic development. proteins. Loss or altered expression of this gene has PTEN been associated with a variety of cancers, which Location suggests a tumor suppressor function. The inactivation 10q23 of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. Protein The encoded protein was found to interact with DNA This gene was identified as a tumor suppressor that is repair proteins and was also shown to inhibit the mutated in a large number of cancers at high frequency. accumulation of cyclin D1, and thus induce cell cycle The protein encoded this gene is a arrest. The most important isoform for breast cancer phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase seems to be isoform A. The frequency of RASSF1A that antagonizes the PI3K-AKT/PKB signaling methylation in breast tumors is high (65%) and pathway and thereby modulates cell cycle progression methylation in tumor samples and fine-needle aspirate and cell survival. About 25-50% of women with washings was shown to be an independent predictor of Cowden disease, a syndrome associated with germ-line poor prognosis (Sharma et al., 2009; Buhmeida et al., mutations of the PTEN gene (at 10q23), develop breast 2011; Martins et al., 2011). RASSF1A methylation is cancer, but PTEN mutations have been found in only an attractive biomarker for early cancer detection and 5% of sporadic breast cancers. However, 29-48% of its methylation analysis is applicable to a range of body breast cancers display loss of heterozygosity in 10q23, fluids including serum and nipple fluid (Suijkerbuijk et about 40% of breast cancers show a decrease or al., 2008). absence of PTEN protein levels at the time of diagnosis (Garcia et al., 2004) and PTEN promoter SRC hypermethylation was reported to be a common event Location in sporadic breast cancer, occurring in 20-50% of 20q12-q13 breast cancers (Khan et al., 2004). Protein PTEN not only antagonizes tumorigenesis but also The protein encoded by this gene is a non-receptor sensitizes breast cancers to targeted therapy with protein tyrosine kinase that plays pivotal roles in trastuzumab (Pandolfi, 2004). Its loss has therefore numerous cellular processes such as proliferation, been associated with trastuzumab resistance (Nahta and migration, and transformation. Src kinases are key O'Regan, 2010). upstream mediators of both the PI3-K and MAPK RARB signaling pathways, and have been shown to have Location important roles in cell proliferation, migration and 3p24 survival. c-SRC (SRC) is a key modulator of trastuzumab response and a common node downstream Protein of multiple trastuzumab resistance pathways (Zhang et This receptor binds retinoic acid, the biologically active al., 2011). SRC is activated in both acquired and de form of vitamin A which mediates cellular signalling in novo trastuzumab-resistant cells and regulation embryonic morphogenesis, cell growth and involves dephosphorylation by PTEN. Increased SRC differentiation. RXR-RAR heterodimers act as ligand- activation conferred considerable trastuzumab dependent transcriptional regulators by binding to the resistance in breast cancer cells and correlated with specific retinoic acid response element (RARE) found trastuzumab resistance in patients. Targeting SRC in in the promoter regions of target genes. In the absence combination with trastuzumab sensitized multiple lines of a RAR agonist, RXR-RAR recruits co-repressor of trastuzumab-resistant cells to trastuzumab and proteins and associated factors such as histone eliminated trastuzumab-resistant tumors in vivo, deacetylases to maintain a condensed chromatin suggesting the potential clinical application of this structure. RAR agonist binding stimulates co-repressor strategy to overcome trastuzumab resistance (Zhang et release and co-activator complexes, such as histone al., 2011). Furthermore, early-phase clinical trials using acetyltransferase, are recruited to activate transcription. the src-inhibitors dasatinib and bosutinib have

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 216 Breast: Ductal carcinoma Moelans CB, van Diest PJ

suggested modest activity as monotherapy in breast Genetic relation of lobular carcinoma in situ, ductal carcinoma cancer, with potentially greater activity in combination in situ, and associated invasive carcinoma of the breast. Mol Pathol. 2000 Jun;53(3):118-21 regimens. Given the interaction between SRC and the estrogen receptor, ongoing trials are exploring Semenza GL. HIF-1: using two hands to flip the angiogenic combinations with endocrine therapy. The relationship switch. Cancer Metastasis Rev. 2000;19(1-2):59-65 between SRC and the vascular endothelial growth Mommers EC, Leonhart AM, Falix F, Michalides R, Meijer CJ, factor receptor also justifies investigation of Baak JP, Diest PJ. Similarity in expression of cell cycle proteins between in situ and invasive ductal breast lesions of combinations with angiogenesis inhibitors (Mayer and same differentiation grade. J Pathol. 2001 Jul;194(3):327-33 Krop, 2010). Wolmark N, Dunn BK. The role of tamoxifen in breast cancer TOP2A prevention: issues sparked by the NSABP Breast Cancer Prevention Trial (P-1). Ann N Y Acad Sci. 2001 Dec;949:99- Location 108 17q21-q22 Di Leo A, Gancberg D, Larsimont D, Tanner M, Jarvinen T, Protein Rouas G, Dolci S, Leroy JY, Paesmans M, Isola J, Piccart MJ. This gene encodes a DNA topoisomerase, an enzyme HER-2 amplification and topoisomerase IIalpha gene aberrations as predictive markers in node-positive breast that controls and alters the topologic states of DNA cancer patients randomly treated either with an anthracycline- during transcription. This nuclear enzyme is involved based therapy or with cyclophosphamide, methotrexate, and 5- in processes such as chromosome condensation, fluorouracil. Clin Cancer Res. 2002 May;8(5):1107-16 chromatid separation, and the relief of torsional stress Bos R, van der Groep P, Greijer AE, Shvarts A, Meijer S, that occurs during DNA transcription and replication. It Pinedo HM, Semenza GL, van Diest PJ, van der Wall E. catalyzes the transient breaking and rejoining of two Levels of hypoxia-inducible factor-1alpha independently predict strands of duplex DNA which allows the strands to prognosis in patients with lymph node negative breast carcinoma. Cancer. 2003 Mar 15;97(6):1573-81 pass through one another, thus altering the topology of DNA. It is amplified in 5-10 % of breast tumors but Hughes-Davies L, Huntsman D, Ruas M, Fuks F, Bye J, Chin amplification is not correlated with overexpression (Di SF, Milner J, Brown LA, Hsu F, Gilks B, Nielsen T, Schulzer M, Chia S, Ragaz J, Cahn A, Linger L, Ozdag H, Cattaneo E, Leo et al., 2002; Knoop et al., 2005; Moelans et al., Jordanova ES, Schuuring E, Yu DS, Venkitaraman A, Ponder 2010). TOP2A has been suggested to be a predictive B, Doherty A, Aparicio S, Bentley D, Theillet C, Ponting CP, marker of anthracyclin benefit (Nielsen et al., 2008) but Caldas C, Kouzarides T. EMSY links the BRCA2 pathway to subsequent studies were controversial (Bartlett et al., sporadic breast and ovarian cancer. Cell. 2003 Nov 26;115(5):523-35 2010). Schlotter CM, Vogt U, Bosse U, Mersch B, Wassmann K. C- TWIST1 myc, not HER-2/neu, can predict recurrence and mortality of Location patients with node-negative breast cancer. Breast Cancer Res. 2003;5(2):R30-6 7p21 Al-Kuraya K, Schraml P, Torhorst J, Tapia C, Zaharieva B, Protein Novotny H, Spichtin H, Maurer R, Mirlacher M, Köchli O, Zuber TWIST1 is a basic helix loop helix protein that plays a M, Dieterich H, Mross F, Wilber K, Simon R, Sauter G. role both in human development and in cancer Prognostic relevance of gene amplifications and coamplifications in breast cancer. Cancer Res. 2004 Dec biogenesis. It is an anti-apoptotic and pro-metastatic 1;64(23):8534-40 transcription factor that is known to repress E-cadherin expression in breast cancer (Vesuna et al., 2008) as García JM, Silva J, Peña C, Garcia V, Rodríguez R, Cruz MA, α Cantos B, Provencio M, España P, Bonilla F. Promoter well as ER expression thereby contributing to the methylation of the PTEN gene is a common molecular change development of hormone resistance (Vesuna et al., in breast cancer. Genes Chromosomes Cancer. 2004 2012). It is overexpressed in many epithelial cancers Oct;41(2):117-24 including breast cancer. Twist overexpression in breast Huang HE, Chin SF, Ginestier C, Bardou VJ, Adélaïde J, Iyer cancer cells can induce angiogenesis, correlates with NG, Garcia MJ, Pole JC, Callagy GM, Hewitt SM, Gullick WJ, chromosomal instability, and promotes an epithelial- Jacquemier J, Caldas C, Chaffanet M, Birnbaum D, Edwards PA. A recurrent chromosome breakpoint in breast cancer at mesenchymal-like transition (EMT) that is pivotal for the NRG1/neuregulin 1/heregulin gene. Cancer Res. 2004 Oct the transformation into an aggressive breast cancer 1;64(19):6840-4 phenotype (Mironchik et al., 2005). TWIST1 promoter Hwang ES, DeVries S, Chew KL, Moore DH 2nd, Kerlikowske methylation is significantly more prevalent in K, Thor A, Ljung BM, Waldman FM. Patterns of chromosomal malignant compared with healthy breast tissue and is alterations in breast ductal carcinoma in situ. Clin Cancer Res. therefore useful as a biomarker in breast cancer 2004 Aug 1;10(15):5160-7 diagnosis, although there is no direct correlation with Khan S, Kumagai T, Vora J, Bose N, Sehgal I, Koeffler PH, TWIST1 expression (Gort et al., 2008). Bose S. PTEN promoter is methylated in a proportion of invasive breast cancers. Int J Cancer. 2004 Nov References 10;112(3):407-10 Pandolfi PP. Breast cancer--loss of PTEN predicts resistance Buerger H, Simon R, Schäfer KL, Diallo R, Littmann R, to treatment. N Engl J Med. 2004 Nov 25;351(22):2337-8 Poremba C, van Diest PJ, Dockhorn-Dworniczak B, Böcker W.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 217 Breast: Ductal carcinoma Moelans CB, van Diest PJ

van der Groep P, Bouter A, van der Zanden R, Menko FH, cytoplasmic-to-nuclear ratio of survivin is a prognostic indicator Buerger H, Verheijen RH, van der Wall E, van Diest PJ. Re: in breast cancer. Clin Cancer Res. 2008 May 1;14(9):2681-9 Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst. 2004 May 5;96(9):712-3; Campeau PM, Foulkes WD, Tischkowitz MD. Hereditary breast author reply 714 cancer: new genetic developments, new therapeutic avenues. Hum Genet. 2008 Aug;124(1):31-42 van Diest PJ, van der Wall E, Baak JP. Prognostic value of proliferation in invasive breast cancer: a review. J Clin Pathol. Gort EH, Suijkerbuijk KP, Roothaan SM, Raman V, Vooijs M, 2004 Jul;57(7):675-81 van der Wall E, van Diest PJ. Methylation of the TWIST1 promoter, TWIST1 mRNA levels, and immunohistochemical Vleugel MM, Bos R, Buerger H, van der Groep P, Saramäki expression of TWIST1 in breast cancer. Cancer Epidemiol OR, Visakorpi T, van der Wall E, van Diest PJ. No Biomarkers Prev. 2008 Dec;17(12):3325-30 amplifications of hypoxia-inducible factor-1alpha gene in invasive breast cancer: a tissue microarray study. Cell Oncol. Howarth KD, Blood KA, Ng BL, Beavis JC, Chua Y, Cooke SL, 2004;26(5-6):347-51 Raby S, Ichimura K, Collins VP, Carter NP, Edwards PA. Array painting reveals a high frequency of balanced translocations in Knoop AS, Knudsen H, Balslev E, Rasmussen BB, Overgaard breast cancer cell lines that break in cancer-relevant genes. J, Nielsen KV, Schonau A, Gunnarsdóttir K, Olsen KE, Oncogene. 2008 May 22;27(23):3345-59 Mouridsen H, Ejlertsen B. retrospective analysis of topoisomerase IIa amplifications and deletions as predictive Jin Q, Esteva FJ. Cross-talk between the ErbB/HER family and markers in primary breast cancer patients randomly assigned the type I insulin-like growth factor receptor signaling pathway to cyclophosphamide, methotrexate, and fluorouracil or in breast cancer. J Mammary Gland Biol Neoplasia. 2008 cyclophosphamide, epirubicin, and fluorouracil: Danish Breast Dec;13(4):485-98 Cancer Cooperative Group. J Clin Oncol. 2005 Oct Kirkegaard T, Nielsen KV, Jensen LB, Campbell FM, Müller S, 20;23(30):7483-90 Tovey SM, Brown S, Cooke TG, Bartlett JM. Genetic Mironchik Y, Winnard PT Jr, Vesuna F, Kato Y, Wildes F, alterations of CCND1 and EMSY in breast cancers. Pathak AP, Kominsky S, Artemov D, Bhujwalla Z, Van Diest P, Histopathology. 2008 May;52(6):698-705 Burger H, Glackin C, Raman V. Twist overexpression induces Nielsen KV, Ejlertsen B, Møller S, Jørgensen JT, Knoop A, in vivo angiogenesis and correlates with chromosomal Knudsen H, Mouridsen HT. The value of TOP2A gene copy instability in breast cancer. Cancer Res. 2005 Dec number variation as a biomarker in breast cancer: Update of 1;65(23):10801-9 DBCG trial 89D. Acta Oncol. 2008;47(4):725-34 Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE Jr, Suijkerbuijk KP, van der Wall E, Vooijs M, van Diest PJ. Davidson NE, Tan-Chiu E, Martino S, Paik S, Kaufman PA, Molecular analysis of nipple fluid for breast cancer screening. Swain SM, Pisansky TM, Fehrenbacher L, Kutteh LA, Vogel Pathobiology. 2008;75(2):149-52 VG, Visscher DW, Yothers G, Jenkins RB, Brown AM, Dakhil SR, Mamounas EP, Lingle WL, Klein PM, Ingle JN, Wolmark Vesuna F, van Diest P, Chen JH, Raman V. Twist is a N. Trastuzumab plus adjuvant chemotherapy for operable transcriptional repressor of E-cadherin gene expression in HER2-positive breast cancer. N Engl J Med. 2005 Oct breast cancer. Biochem Biophys Res Commun. 2008 Mar 20;353(16):1673-84 7;367(2):235-41 Livasy CA, Karaca G, Nanda R, Tretiakova MS, Olopade OI, van der Groep P, Bouter A, Menko FH, van der Wall E, van Moore DT, Perou CM. Phenotypic evaluation of the basal-like Diest PJ. High frequency of HIF-1alpha overexpression in subtype of invasive breast carcinoma. Mod Pathol. 2006 BRCA1 related breast cancer. Breast Cancer Res Treat. 2008 Feb;19(2):264-71 Oct;111(3):475-80 Walsh T, Casadei S, Coats KH, Swisher E, Stray SM, Higgins Chua YL, Ito Y, Pole JC, Newman S, Chin SF, Stein RC, Ellis J, Roach KC, Mandell J, Lee MK, Ciernikova S, Foretova L, IO, Caldas C, O'Hare MJ, Murrell A, Edwards PA. The NRG1 Soucek P, King MC. Spectrum of mutations in BRCA1, gene is frequently silenced by methylation in breast cancers BRCA2, CHEK2, and TP53 in families at high risk of breast and is a strong candidate for the 8p tumour suppressor gene. cancer. JAMA. 2006 Mar 22;295(12):1379-88 Oncogene. 2009 Nov 19;28(46):4041-52 Davis LM, Harris C, Tang L, Doherty P, Hraber P, Sakai Y, Jensen LB, Bartlett JM, Witton CJ, Kirkegaard T, Brown S, Bocklage T, Doeden K, Hall B, Alsobrook J, Rabinowitz I, Müller S, Campbell F, Cooke TG, Nielsen KV. Frequent Williams TM, Hozier J. Amplification patterns of three genomic amplifications and deletions of G1/S-phase transition genes, regions predict distant recurrence in breast carcinoma. J Mol CCND1 and MYC in early breast cancers: a potential role in Diagn. 2007 Jul;9(3):327-36 G1/S escape. Cancer Biomark. 2009;5(1):41-9 Holst F, Stahl PR, Ruiz C, Hellwinkel O, Jehan Z, Wendland M, Klinakis A, Szabolcs M, Chen G, Xuan S, Hibshoosh H, Lebeau A, Terracciano L, Al-Kuraya K, Jänicke F, Sauter G, Efstratiadis A. Igf1r as a therapeutic target in a mouse model of Simon R. Estrogen receptor alpha (ESR1) gene amplification is basal-like breast cancer. Proc Natl Acad Sci U S A. 2009 Feb frequent in breast cancer. Nat Genet. 2007 May;39(5):655-60 17;106(7):2359-64 Lambros MB, Natrajan R, Reis-Filho JS. Chromogenic and Persson M, Andrén Y, Mark J, Horlings HM, Persson F, fluorescent in situ hybridization in breast cancer. Hum Pathol. Stenman G. Recurrent fusion of MYB and NFIB transcription 2007 Aug;38(8):1105-22 factor genes in carcinomas of the breast and head and neck. Proc Natl Acad Sci U S A. 2009 Nov 3;106(44):18740-4 Montemurro F, Valabrega G, Aglietta M. Lapatinib: a dual inhibitor of EGFR and HER2 tyrosine kinase activity. Expert Sharma G, Mirza S, Yang YH, Parshad R, Hazrah P, Datta Opin Biol Ther. 2007 Feb;7(2):257-68 Gupta S, Ralhan R. Prognostic relevance of promoter hypermethylation of multiple genes in breast cancer patients. Albertson DG. Conflicting evidence on the frequency of ESR1 Cell Oncol. 2009;31(6):487-500 amplification in breast cancer. Nat Genet. 2008 Jul;40(7):821-2 Bartlett JM, Munro AF, Dunn JA, McConkey C, Jordan S, Brennan DJ, Rexhepaj E, O'Brien SL, McSherry E, O'Connor Twelves CJ, Cameron DA, Thomas J, Campbell FM, Rea DW, DP, Fagan A, Culhane AC, Higgins DG, Jirstrom K, Millikan Provenzano E, Caldas C, Pharoah P, Hiller L, Earl H, Poole RC, Landberg G, Duffy MJ, Hewitt SM, Gallagher WM. Altered CJ. Predictive markers of anthracycline benefit: a prospectively

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 218 Breast: Ductal carcinoma Moelans CB, van Diest PJ

planned analysis of the UK National Epirubicin Adjuvant Trial Moelans CB, Reis-Filho JS, van Diest PJ.. Implications of rarity (NEAT/BR9601). Lancet Oncol. 2010 Mar;11(3):266-74 of chromosome 17 polysomy in breast cancer. Lancet Oncol. 2011 Nov;12(12):1087-9. doi: 10.1016/S1470-2045(11)70234- Brown LA, Johnson K, Leung S, Bismar TA, Benítez J, Foulkes 0. Epub 2011 Sep 6. WD, Huntsman DG. Co-amplification of CCND1 and EMSY is associated with an adverse outcome in ER-positive tamoxifen- Perez EA, Jenkins RB, Dueck AC, Wiktor AE, Bedroske PP, treated breast cancers. Breast Cancer Res Treat. 2010 Anderson SK, Ketterling RP, Sukov WR, Kanehira K, Chen B, Jun;121(2):347-54 Geiger XJ, Andorfer CA, McCullough AE, Davidson NE, Martino S, Sledge GW, Kaufman PA, Kutteh LA, Gralow JR, Edge SB, Byrd DR, Compton CC, et al.. Breast. AJCC Cancer Harris LN, Ingle JN, Lingle WL, Reinholz MM.. C-MYC Staging Manual. 7th ed. New York, NY; Springer. 2010;347-76. alterations and association with patient outcome in early-stage Edwards PA.. Fusion genes and chromosome translocations in HER2-positive breast cancer from the north central cancer the common epithelial cancers. J Pathol. 2010 Jan;220(2):244- treatment group N9831 adjuvant trastuzumab trial. J Clin 54. doi: 10.1002/path.2632. (REVIEW) Oncol. 2011 Feb 20;29(6):651-9. doi: 10.1200/JCO.2010.30.2125. Epub 2011 Jan 18. Jovanovic J, Ronneberg JA, Tost J, Kristensen V.. The epigenetics of breast cancer. Mol Oncol. 2010 Jun;4(3):242-54. Vasudev P, Onuma K.. Secretory breast carcinoma: unique, doi: 10.1016/j.molonc.2010.04.002. Epub 2010 Apr 29. triple-negative carcinoma with a favorable prognosis and (REVIEW) characteristic molecular expression. Arch Pathol Lab Med. 2011 Dec;135(12):1606-10. doi: 10.5858/arpa.2010-0351-RS. Mayer EL, Krop IE.. Advances in targeting SRC in the (REVIEW) treatment of breast cancer and other solid malignancies. Clin Cancer Res. 2010 Jul 15;16(14):3526-32. doi: 10.1158/1078- Wilkerson PM, Dedes KJ, Wetterskog D, Mackay A, Lambros 0432.CCR-09-1834. (REVIEW) MB, Mansour M, Frankum J, Lord CJ, Natrajan R, Ashworth A, Reis-Filho JS.. Functional characterization of EMSY gene Moelans CB, de Weger RA, Monsuur HN, Vijzelaar R, van amplification in human cancers. J Pathol. 2011 Sep;225(1):29- Diest PJ.. Molecular profiling of invasive breast cancer by 42. doi: 10.1002/path.2944. Epub 2011 Jul 7. multiplex ligation-dependent probe amplification-based copy number analysis of tumor suppressor and oncogenes. Mod Zhang S, Huang WC, Li P, Guo H, Poh SB, Brady SW, Xiong Pathol. 2010 Jul;23(7):1029-39. doi: Y, Tseng LM, Li SH, Ding Z, Sahin AA, Esteva FJ, Hortobagyi 10.1038/modpathol.2010.84. Epub 2010 May 14. GN, Yu D.. Combating trastuzumab resistance by targeting SRC, a common node downstream of multiple resistance Moelans CB, de Weger RA, van Blokland MT, van der Wall E, pathways. Nat Med. 2011 Apr;17(4):461-9. doi: van Diest PJ.. Simultaneous detection of TOP2A and HER2 10.1038/nm.2309. Epub 2011 Mar 13. gene amplification by multiplex ligation-dependent probe amplification in breast cancer. Mod Pathol. 2010 Jan;23(1):62- Banerji S, Cibulskis K, Rangel-Escareno C, Brown KK, Carter 70. doi: 10.1038/modpathol.2009.136. Epub 2009 Sep 18. SL, Frederick AM, Lawrence MS, Sivachenko AY, Sougnez C, Zou L, Cortes ML, Fernandez-Lopez JC, Peng S, Ardlie KG, Nahta R, O'Regan RM.. Evolving strategies for overcoming Auclair D, Bautista-Pina V, Duke F, Francis J, Jung J, Maffuz- resistance to HER2-directed therapy: targeting the Aziz A, Onofrio RC, Parkin M, Pho NH, Quintanar-Jurado V, PI3K/Akt/mTOR pathway. Clin Breast Cancer. 2010 Nov;10 Ramos AH, Rebollar-Vega R, Rodriguez-Cuevas S, Romero- Suppl 3:S72-8. doi: 10.3816/CBC.2010.s.015. (REVIEW) Cordoba SL, Schumacher SE, Stransky N, Thompson KM, Uribe-Figueroa L, Baselga J, Beroukhim R, Polyak K, Sgroi O'Day E, Lal A.. MicroRNAs and their target gene networks in DC, Richardson AL, Jimenez-Sanchez G, Lander ES, Gabriel breast cancer. Breast Cancer Res. 2010;12(2):201. doi: SB, Garraway LA, Golub TR, Melendez-Zajgla J, Toker A, 10.1186/bcr2484. Epub 2010 Mar 19. (REVIEW) Getz G, Hidalgo-Miranda A, Meyerson M.. Sequence analysis Bhargava R, Beriwal S, McManus K, Dabbs DJ.. Insulin-like of mutations and translocations across breast cancer subtypes. growth factor receptor-1 (IGF-1R) expression in normal breast, Nature. 2012 Jun 20;486(7403):405-9. doi: proliferative breast lesions, and breast carcinoma. Appl 10.1038/nature11154. Immunohistochem Mol Morphol. 2011 May;19(3):218-25. doi: Cho YH, Shen J, Gammon MD, Zhang YJ, Wang Q, Gonzalez 10.1097/PAI.0b013e3181ffc58c. K, Xu X, Bradshaw PT, Teitelbaum SL, Garbowski G, Buhmeida A, Merdad A, Al-Maghrabi J, Al-Thobaiti F, Ata M, Hibshoosh H, Neugut AI, Chen J, Santella RM.. Prognostic Bugis A, Syrjanen K, Abuzenadah A, Chaudhary A, Gari M, Al- significance of gene-specific promoter hypermethylation in Qahtani M, Dallol A.. RASSF1A methylation is predictive of breast cancer patients. Breast Cancer Res Treat. 2012 poor prognosis in female breast cancer in a background of Jan;131(1):197-205. doi: 10.1007/s10549-011-1712-y. Epub overall low methylation frequency. Anticancer Res. 2011 2011 Aug 12. Sep;31(9):2975-81. Cizkova M, Susini A, Vacher S, Cizeron-Clairac G, Andrieu C, Edgren H, Murumagi A, Kangaspeska S, Nicorici D, Hongisto Driouch K, Fourme E, Lidereau R, Bieche I.. PIK3CA mutation V, Kleivi K, Rye IH, Nyberg S, Wolf M, Borresen-Dale AL, impact on survival in breast cancer patients and in ERalpha, Kallioniemi O.. Identification of fusion genes in breast cancer PR and ERBB2-based subgroups. Breast Cancer Res. 2012 by paired-end RNA-sequencing. Genome Biol. 2011;12(1):R6. Feb 13;14(1):R28. doi: 10.1186/gb-2011-12-1-r6. Epub 2011 Jan 19. Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM, Dunning Han J, Hendzel MJ, Allalunis-Turner J.. Notch signaling as a MJ, Speed D, Lynch AG, Samarajiwa S, Yuan Y, Graf S, Ha G, therapeutic target for breast cancer treatment? Breast Cancer Haffari G, Bashashati A, Russell R, McKinney S; METABRIC Res. 2011 May 31;13(3):210. doi: 10.1186/bcr2875. (REVIEW) Group, Langerod A, Green A, Provenzano E, Wishart G, Pinder S, Watson P, Markowetz F, Murphy L, Ellis I, Martins AT, Monteiro P, Ramalho-Carvalho J, Costa VL, Dinis- Purushotham A, Borresen-Dale AL, Brenton JD, Tavare S, Ribeiro M, Leal C, Henrique R, Jeronimo C.. High RASSF1A Caldas C, Aparicio S.. The genomic and transcriptomic promoter methylation levels are predictive of poor prognosis in architecture of 2,000 breast tumours reveals novel subgroups. fine-needle aspirate washings of breast cancer lesions. Breast Nature. 2012 Apr 18;486(7403):346-52. doi: Cancer Res Treat. 2011 Aug;129(1):1-9. doi: 10.1007/s10549- 10.1038/nature10983. 010-1160-0. Epub 2010 Sep 15.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 219 Breast: Ductal carcinoma Moelans CB, van Diest PJ

Holst F, Moelans CB, Filipits M, Singer CF, Simon R, van Diest Fatima A, Miron P, Chin SF, Thomas G, Boyault S, Mariani O, PJ.. On the evidence for ESR1 amplification in breast cancer. Lakhani SR, van de Vijver M, van 't Veer L, Foekens J, Nat Rev Cancer. 2012 Jan 24;12(2):149. doi: Desmedt C, Sotiriou C, Tutt A, Caldas C, Reis-Filho JS, 10.1038/nrc3093-c3. Aparicio SA, Salomon AV, Borresen-Dale AL, Richardson AL, Campbell PJ, Futreal PA, Stratton MR.. The landscape of Hu YY, Zheng MH, Zhang R, Liang YM, Han H.. Notch cancer genes and mutational processes in breast cancer. signaling pathway and cancer metastasis. Adv Exp Med Biol. Nature. 2012 May 16;486(7403):400-4. doi: 2012;727:186-98. doi: 10.1007/978-1-4614-0899-4_14. 10.1038/nature11017. (REVIEW) Vesuna F, Lisok A, Kimble B, Domek J, Kato Y, van der Groep Reedijk M.. Notch signaling and breast cancer. Adv Exp Med P, Artemov D, Kowalski J, Carraway H, van Diest P, Raman Biol. 2012;727:241-57. doi: 10.1007/978-1-4614-0899-4_18. V.. Twist contributes to hormone resistance in breast cancer by (REVIEW) downregulating estrogen receptor-alpha. Oncogene. 2012 Jul Stephens PJ, Tarpey PS, Davies H, Van Loo P, Greenman C, 5;31(27):3223-34. doi: 10.1038/onc.2011.483. Epub 2011 Nov 7. Wedge DC, Nik-Zainal S, Martin S, Varela I, Bignell GR, Yates LR, Papaemmanuil E, Beare D, Butler A, Cheverton A, Gamble This article should be referenced as such: J, Hinton J, Jia M, Jayakumar A, Jones D, Latimer C, Lau KW, Moelans CB, van Diest PJ. Breast: Ductal carcinoma. Atlas McLaren S, McBride DJ, Menzies A, Mudie L, Raine K, Rad R, Genet Cytogenet Oncol Haematol. 2013; 17(3):209-220. Chapman MS, Teague J, Easton D, Langerod A; Oslo Breast Cancer Consortium (OSBREAC), Lee MT, Shen CY, Tee BT, Huimin BW, Broeks A, Vargas AC, Turashvili G, Martens J,

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 220 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Solid Tumour Section Review

Head and neck: Thymus: Thymoma: an overview Marius Raica, Domenico Ribatti "Victor Babes" University of Medicine and Pharmacy, Department of Morphologic Microscopy, Angiogenesis Research Center Timisoara, Timisoara, Romania (MR), University of Bari, Department of Basic Medical Sciences, Neurosciences and Sensory Organs, Bari, Italy (DR)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Tumors/ThymomaID5403.html DOI: 10.4267/2042/48767 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

(scleroderma, Sjögren syndrome) or autoimmune Identity endocrine diseases (Boonen et al., 2000). Note Epidemiological data showed that in patients with Introduction thymoma the incidence of synchronous malignant Thymoma is the most frequent primary tumor of the tumors is higher than in other groups and it was anterior and superior mediastinum with an incidence reported in 28% of the cases in a series of 128 patients that ranges between 0.2 and 1.5% from all malignant with thymoma (Welsh et al., 2000). tumors (Schmidt-Wolf et al., 2003; Koppitz et al., Myasthenia gravis and thymoma 2012). Usually, it occurs in adults over 40 years and is In patients with myasthenia gravis the thymus shows a asymptomatic for long time. When the thymoma marked lymphoid follicle hyperplasia, as unique becomes invasive, it becomes clinically evident by morphologic abnormality in 65% of cases. In 10% of compression signs or/and respiratory symptoms. patients myasthenia gravis is associated with thymoma Almost half of the cases are detected by routine (with or without follicular hyperplasia) and there are thoracic X-ray examination and the majority has not found abnormalities in the other 25% of cases. This between 5 and 10 cm in their larger diameter. However, relation is also supported by the fact that 30 to 45% of any imagining criterion is specific for the diagnosis of patients with thymoma develop clinically evident thymoma (Strollo et al., 1997). myasthenia gravis (Raica et al., 1999). Until now, there The term "thymoma" is restricted to the tumor of the were not demonstrated ultrastructural or thymus that consists of epithelial cells, independently immunohistochemical differences between thymomas from the presence and number of lymphocytes. Almost with and without myasthenia gravis. Recent studies on all thymomas occur in the anterior and superior large series were not able to demonstrate that mediastinum of the adult, and occasionally, with other myasthenia is a prognostic element for the behavior of locations (latero-cervical, in the thyroid, in the hilus of thymoma. In all cases, myasthenia gravis is associated the lung). Typical thymoma is a solid, yellow-grayish with a defect of the nicotinic receptor for acetylcholine and lobulated tumor. In approximately 80% of cases (AchR). A similar (or even identical) protein was the tumor is encapsulated, and when it is large shows identified in the normal human thymus. This protein is many foci of cystic degeneration. Even apparently located in a subset of thymic cells that have similar encapsulated, the rate of recurrences is about 15%. immunophenotype as striated muscle cells (myoglobin Many "malignant" thymomas have a slow rate of and desmin positive), called myoid cells. In the non- proliferation, and the recurrence is noticed in 2% of the neoplastic thymus of patients with myasthenia gravis encapsulated and in 20 to 40% of the invasive were identified aggregates of myoid cells, infiltrating thymomas. Thymoma is frequently associated with the stroma. T cells activate AchR reactive B immune-mediated systemic diseases, like lymphocytes. Therefore, the process begins in the neuromuscular syndroms (myasthenia gravis, Lambert- thymus and than continues in the entire immune system Eaton syndrome, myositis), hypogammaglobulinemia by autoantibodies production. Surgical treatment is (12%), hematologic diseases (erythroid hypoplasia, more efficient if the thymus has follicular hyperplasia, erythrocytosis, leukemia), collagen diseases

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 221 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

and persistence of clinical signs is attributed to resting Classification thymic parenchyma. Classification of thymoma Classification of thymoma is one of the most elusive in Classification pathology, based on one hand on the reduced number of cases and on the difficulty to interpret histological Note findings on the other. The majority of the tumors of the Thymoma: general features thymus are thymomas and the term is restricted to the The large majority of thymomas consist of a mixture of epithelial proliferations of the thymic stroma. neoplastic epithelial cells and non-neoplastic The present classification of thymoma includes the type lymphocytes. The rate between these two cell A ("A", atrophic), type B ("B", bioactive), and C ("C", populations is variable from a case to another, or even carcinoma). in different areas of the same tumor. Neoplastic Over the years, there were proposed many systems, but epithelial cells may be polygonal, round, oval, and only two or three remained in use. Perhaps the most stellate or spindle in shape. Nuclei have a fine granular simple, but at the same time, the most subjective, is the chromatin, smooth outline, and nucleolus is often classification proposed by Lattes and Bernatz that take prominent (especially in round and polygonal shaped into account the predominant cell type, as follows: cells). Thymomas with epithelial predominance contain spindle thymoma, thymoma with lymphocyte prominent perivascular spaces with lymphocytes, predominance (over 66% lymphocytes), with epithelial proteinaceous fluid, red blood cells, and foamy predominance (over 66% epithelial cells), and macrophages. More rare are found rosette-like (without predominantly mix (epithelial cells between 34 and evident lumen) or glandular-like aspects or even 66%). Examination is extremely subjective, because abortive Hassall corpuscles. The presence of rosettes there are estimated two different cell types, as with well-defined lumen does not correlate with the demonstrated by immunohistochemistry. Moreover, diagnosis of thymoma, and usually is a character of a this classification brings nothing in the field of carcinoid tumor of the thymus. In some cases may be prognosis. noticed micro-cystic, tubular and pseudo-papillary In last years, the classification proposed by Muller- zones. In lymphocyte-rich thymoma areas with Hermelink had a strong impact, because it is medullary differentiation are frequently noticed. The histogenetic and correlates with prognosis. The major capsule of the tumor is thick, fibrous, and often criticism is related to the "well differentiated thymic calcified. It gives rise to fibrous septa that form carcinoma", included in the group of thymoma by all angulated lobules into the parenchyma of the tumor. It other publications (Rosai, 1999; Suster and Moran, is thought that extensive fibrosis in some cases is the 1999; Kuo, 2001). result of spontaneous tumor regression, but there are no This is the reason why many pathologists prefer the proofs to support this hypothesis. classification proposed by Juan Rosai (Rosai, 1999). Ultrastructurally, neoplastic epithelial cells contain Malignancy of thymoma is defined in terms of natural branched tonofilaments, form desmosomes, and have evolution. long cytoplasmic processes and a distinct basal lamina. Completely encapsulated thymomas were considered to Epithelial cells are arranged in sheets and cords that be benign, and invasive thymomas were considered contain lymphocytes, and the aspect is mimicry of the malignant. On this basis, Masaoka (1981) introduced medulla of the normal thymus. These characters are the "clinical" classification that found many adepts: I - useful to differentiate thymoma from other tumors of encapsulated at macroscopy, without microscopic the mediastinum (carcinoid, malignant lymphoma, invasion; II1 - macroscopic invasion in the adipose germ cell tumor or solitary fibrous tumor). The tissue or pleura; II2 - microscopic invasion of the presence of epithelial cells on ultrastructural capsule; III - macroscopic invasion in surrounding examination does not necessary mean thymoma. We organs; IVa - pleural or pericardial spread; IVb - distant must be aware especially on malignant lymphoma that metastasis. With few changes, this classification was included islands of normal thymus. incorporated in the TNM system, proposed by The tumor microenvironment was significantly less Yamakawa. investigated than neoplastic cells of thymoma. In part, The grade of thymoma is another unsolved problem tumor progression may be stimulated of inhibited by and a permanent subject of dispute. It was shown that changes in the tumor stroma, and it was found a thymoma without overt cytological atypia have better significant increase in the number and spatial prognosis (Yoneda et al., 2000), but exceptions from distribution of mast cells and high values for immature this rule were also reported. The grading system largely and intermediate blood vessels, which are accepted now is in fact a compromise: we have not a characteristics of tumor-associated angiogenesis (Raica better one! Therefore, the grade was in part overlapped et al., 2007; Raica et al., 2009; Raica et al., 2010). on the pathologic diagnosis. Actually, the histologic grade of thymoma in its present form has any impact on prognosis or therapy.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 222 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

Figure 1. Histological types of thymoma. Type A (A, H&E staining, x400). Type AB (B, Masson staining, x400). Type B1 (C, Masson staining, x400). Type B2 (D, H&E staining, x400). Type B3 (E, Masson staining, x400). Thymic carcinoma (F, H&E staining, x100).

proliferation is focally storiform, and may contain Clinics and pathology rosette-like structures Pathology and pseudo-glands close to the capsule. Hassall's corpuscles are rarely found. Nuclei of tumor cells have Pathologic diagnosis fine granular chromatin with small nucleoli. Not all - Thymoma type A (spindle cell, medullary) consists cells are spindles in shape. Some of them may be oval of cells that are spindle or oval in shape, without atypia, and form the large majority of the cell population. and lymphocytes are rare or even absent. The pattern of More than 95% of thymoma type A are encapsulated,

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 223 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

but some of them may invade the capsule, or vary rare, cells that are round or polygonal in shape. Atypical the lung. Exceptionally were reported cases with such a elements are mild or absent, but the epithelial thymoma with atypical cells, mitotic activity and component proliferates in large sheets and lymphocytes necrosis. It is often difficult to classify such a case: are reduced in number. Epithelial cells have small undifferentiated thymoma type A? Spindle cell variant nucleoli and mitotic figures are rare. The tumor of thymoma type B3? Or sarcomatoid carcinoma? Until preserves some characters of thymic differentiation: now, there are no data to help us. The presence of a lobulation, dual cell population, and perivascular reticular fiber network around individual cells and its spaces. The perivascular arrangement of epithelial cells absence around perivascular spaces would be in the and squamous differentiated areas are frequently found. favor of thymoma type A, but this observation was not This tumor is more frequently invasive than enough investigated to be used. There were described "conventional" thymoma, but it may co-exist with some "unusual" forms of thymoma type A: with thymoma B1, B2 or C. pseudo-sarcomatous stroma, haemangiopericytic, with There were described some unusual variants of rosettes, micronodular, basaloid, with papillar and thymoma with polygonal and round cells: microcystic, glandular structures. Anyway, we do not know yet what cystic, cribriform, with clear cells, rich in plasma cells, means "usual" thymoma type A. with myoid cells and starry sky. The classification of - Thymoma type AB (mix) is characterized by type A these forms is often based on the expression of areas and lymphocyte-rich areas. Between the two monoclonal cytokeratin to differentiate them from different patterns of the tumor may be a clear-cut edge thymic carcinoma with similar features. or the transition between them is gradual. Frequently, - Pathology of thymoma after the preoperative type A area is reduced, but it has the same aspects as treatment with corticosteroids. Corticosteroids are described above. The term "mix" is used to draw well-known inducers of thymic involution. It was attention on the dual cell population: neoplastic noticed that preoperative administration of epithelial and non-neoplastic lymphocytes. corticosteroids significantly reduces the diameter of the - Thymoma type B1 (lymphocyte-rich, lymphocytic, tumor. There are few studies on this subject, but data cortical) is similar to the normal functional thymus and are extremely useful for pathologist. There are consists of areas that are close in structure with the significant microscopic differences between the cortex (that predominate) and medulla. Differentiation biopsies before and after the treatment with from the normal thymus may be impossible at low corticosteroids. Tateyama et al. (2001) noticed power magnification. Medullary differentiated areas are reduction of the tumor mass between 5 to 70%, usually round and may be erroneously interpreted as depending the dose and length of the treatment. The germ center; on occasion, they may contain aggregates predominance of proliferating epithelial cells may of epithelial cells or Hassall bodies. Perivascular spaces change. In some cases the dominant cell population are rarely found and are less prominent than in other becomes spindle in shape, and in others were noticed forms of thymoma. glandular-like or haemangiopericytoma-like structures. - Thymoma type B2 (cortical) consists of isolated or in Atypical cells were rare or absent and many epithelial small groups arranged epithelial cells and many cells had acidophilic cytoplasm and condensed nuclei. lymphocytes. Usually, perivascular spaces are The number of lymphocytes dramatically decreased, numerous and large. Occasionally, epithelial cells are some of them showing fragmented nuclei. In tumors arranged in palisade around perivascular spaces. Foci with massive regression extensive fibrosis, foamy of medullary differentiation are less evident (with or macrophages, and necrosis are frequently noticed. without Hassall corpuscles) or they are absent. Perivascular palisade of epithelial cells, cystic Epithelial cells are polygonal in shape (thymoma with structures, and bizarre multinucleated giant cells, or large polygonal cells), more numerous than in giant cells with lobulated nucleus may be noticed in thymoma type B1, they have nuclei with fine granular some cases. In all cases published until now it was chromatin, prominent nucleoli, and rich cytoplasm. observed the transformation in thymoma with epithelial Lymphocytes may be immature, with large nuclei, predominance. visible cytoplasm and high mitotic activity (Ki67 index The presence of degenerative lesions does not over 80%). Opposite to thymoma B1, this tumor does necessary means regression of the tumor. It is thought not recapitulate the differentiation of the normal that epithelial cells degeneration is a consequence of thymus. depletion in immature T lymphocytes. - Thymoma type B3 (epithelial, atypical, well differentiated thymic carcinoma) consists of epithelial

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 224 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

Figure 2. High molecular weight cytokeratin expression in invasive thymoma (A). VEGF overexpression in thymic carcinoma (B). Magnification x400.

In these conditions, the knowledge of preoperative rarely B) in type. The most common form is the medication is essential to avoid a possible confusion squamous cell carcinoma (90% of cases), but there with well-differentiated carcinoma (as defined in were reported many other variants: lymphoepithelioma- Marino-Muller-Hermelink classification). like, sarcomatoid, clear cell, basaloid, papillary, and - Atypical thymoma: a distinct entity? Based on the anaplastic (Snover et al., 1982; Iezzoni and Nass, 1996; difficulties in the classification of thymoma, Suster and Shimosato and Mukai, 1997; Matsuno et al., 1998). The Moran (1999) proposed the term "atypical thymoma". prognosis of thymic carcinoma largely depends of the In this category were included all the cases that pathologic variant (better in cornified squamous cell preserve some organo-typical characters of thymic carcinoma). differentiation, but associated with a given grade of cell CD70, a member of the TNF family, is expressed by atypia. The cell population is predominant epithelial, many cases with thymic carcinoma and usually is with the tendency to squamous transformation at the negative in thymoma type B3, and therefore, the level of both architecture and individual tumor cells. method is useful for the differential diagnosis (Rosai, Frequently, tumor cells are arranged around 2004). Tumor cells also express Ki67 and p53, but the perivascular spaces, mimicking glandular prognostic relevance of these markers is not yet differentiation. This lesion is equivalent to the "well clarified. differentiated thymic carcinoma" from Marino-Muller- Differential diagnosis of thymoma and related tumors Hermelink classification. Atypical thymoma is more may represent itself the topic of a review: it includes frequently invasive than the conventional thymoma and malignant lymphomas, carcinoid, neuroendocrine can be found in association with typical areas of carcinoma, germ cell tumors, stromal tumor, and thymoma or/and thymic carcinoma. Although the cervical tumors with thymic derivates. Involution of the existence of this subtype is supported by some data, thymus should be also considered, particularly in the until now atypical thymoma was not included in case of small specimens taken by endoscopic WHO's classification. procedures. In this condition, aggregates of epithelial - Thymic carcinoma (former thymoma type C) is a cells can be over-interpreted as thymoma (Raica et al., rare tumor with poor prognosis in comparison with 2007). Actually, an extensive immunophenotyping is thymoma (Tomita et al., 2002), and is defined as an frequently needed. It is important to mention here epithelial proliferation whose individual cells show especially cervical tumors with thymic derivate that clear characters of malignancy. Opposite to include cervical ectopic thymoma, hamartomatous conventional thymoma, it is not associated with thymoma, spindle epithelial tumor with thymus like myasthenia gravis. The diagnosis is usually by elements (SETTLE) and carcinoma with thymus like exclusion, because there are not clear criteria to elements (CASTLE). differentiate this tumor from carcinoma developed in The ectopic cervical thymoma has a clear preference other organs. The thymic carcinoma shows no character for female, a benign behavior and the same features as of thymoma (perivascular spaces, abortive Hassall the mediastinal counterpart. bodies, a/o). The only major difference is the positive Ectopic hamartomatous thymoma occurs mainly in immunoreaction for CD5 in epithelial cells (this males, supraclavicular or suprasternal, and consists of immunoreaction is negative in typical thymoma and spindle shaped cells with mesenchymal aspect. The non-thymic carcinoma). Lymphocytes may be present, tumor lacks atypical aspects, necrosis and mitotic even in large number, but always they are mature T (or activity. One component of the tumor that may be

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 225 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

noticed only focal consists of solid squamous nests, expression of these molecules is noticed in thymoma anastomosed cords and cysts lined by epithelium. Small with polygonal or round tumor cells. Somehow strange, aggregates of adipose cells are found between epithelial cells from thymoma and thymic carcinoma neoplastic cells. Lymphocytes are scant, but present in express high levels of somatostatin receptor, but on this all cases. Some authors reported a concentration of finding is based the scintigraphic detection of myoid cells, but their significance is unknown. Despite mediastinal tumors or thymoma recurrence. such a tumor can rich large diameter, it has not a Vascular endothelial growth factor (VEGF) was less corresponding tumor in the mediastinum and is benign investigated in the normal thymus and thymoma. The (Zhao et al., 2000). immunohistochemical expression of VEGF is strong in Spindle epithelial tumor with thymus like elements the prenatal thymus and in the majority of cases with (SETTLE) is rare, occurs in younger and develops thymoma (Cimpean et al., 2008). Virtually, all around the thyroid. It is a biphasic tumor, one thymomas type B are positive, with the strongest component is spindle and shows mitotic activity, and intensity in type B3 and thymic carcinoma. In the other is cystic glandular. The natural evolution is experimental model it was shown that gene targeting of slow, and metastasis was reported after years or even VEGF-A in thymus epithelium disrupts the blood decades. vessel architecture (Muller et al., 2005). Extensive Carcinoma with thymus like elements (CASTLE) also studies on large series of patients could support the has the tendency to be present around or even within introduction of antiangiogenic therapy in cases with the thyroid. On the basis of conventional pathologic aggressive tumors of the thymus. Besides VEGF, other diagnosis, it cannot be differentiated from thymic growth factors involved in tumor-associated carcinoma. Despite local recurrences are frequent, the angiogenesis were detected in thymoma neoplastic long-term prognosis is good. cells, like platelet-derived growth factor and its cognate Genes receptors (Cimpean et al., 2011). Their clinical significance for tumor progression and metastasis of The molecular profile of thymoma thymoma is still uncertain. The immunohistochemical profile of epithelial cells is Epidermal growth factor receptor (EGFR) is expressed wide, and best studied are, of course, cytokeratins. in over 60 to 70% of thymomas (Henley et al., 2002), They also express the epithelial membrane antigen and but from these, only half showed correlation with gene carcino-embryonic antigen. Many data from the analysis. EGFR gene mutations were not detected in literature revealed the value of cytokeratin thymoma or thymic carcinoma (Suzuki et al., 2006). 8/cytokeratin 18 and high molecular weight cytokeratin EGFR immunohistochemical expression did not for the diagnosis of thymoma (Encica et al., 2004). correlate with conventional prognostic factor, but by The immunohistochemical expression of cytokeratin is detection by fluorescent in situ hybridization it was heterogeneous, excepting for cytokeratin 19 and high found a significant correlation with the type, invasion molecular weight. On the other hand, cytokeratin 7 is and clinical stage. EGFR immunoreactivity was positive in many cases, but it stains only few neoplastic associated with more aggressive thymoma types B2 epithelial cells. This is why it is strongly recommended and B3, but a definite correlation with thymic to use a pan-cytokeratin that contains clones 7, 8, 18 carcinoma was not established (Aisner et al., 2010). and 19. In such an instance, the immunoreaction is Based on this data, EGFR expression may be intense and homogeneous, excepting for spindle cell considered as an individual prognostic factor and a thymoma. The immunohistochemical method is useful possible target for therapy. not only in the diagnosis, but also in the classification Other molecular markers were also investigated to of thymoma. The epithelial membrane antigen is predict the outcome of thymoma, like c-kit or HER2 usually expressed only in pseudo-glandular area. protein. It was found that c-kit is expressed by tumor Collagen type IV and laminin are found in large cells in 38% of the cases with thymoma type B and the amount around individual spindle cells. It is well negative reaction is associated with better prognosis known that thymoma-associated lymphocytes are non- (Aisner et al., 2010). C-kit is expressed by 80% of the neoplastic, and specific immunophenotyping is not cases with thymic carcinoma, and together with CD5 necessary. Many T cells have not the characteristic positive reaction, it is a useful diagnostic tool profile for mature lymphocytes and express Ki67 (Nakagawa et al., 2005). The expression of c-kit in antigen. Thymoma also contains a S100 protein thymic carcinoma and invasive thymoma deserves positive cell population that consists of interdigitate, further investigations to establish a target-based and with lesser extent, Langerhans cells. Their number therapy. and distribution correlates with the microscopic variant, Recently, a molecular analysis of 34 patients with but their presence is not predictive for invasion. A thymoma showed a differential expression of the genes subset of interdigitate cells that co-express CD20 are related to both metastasis and stage and there were called "asteroid", and their significance is unknown. identified some potential candidates for the therapeutic Collagen IV and laminin are found in large amount strategy (Badve et al., 2012). around individual spindle tumor cells but only a slight

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 226 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

Prognosis Strollo DC, Rosado de Christenson ML, Jett JR.. Primary mediastinal tumors. Part 1: tumors of the anterior mediastinum. On one hand, the microscopic diagnosis of thymoma is Chest. 1997 Aug;112(2):511-22. (REVIEW) based on the architecture of the tumor (fibrous bands, Suster S, Rosai J.. Thymus. In: Histology for pathologists, perivascular spaces, lost of lobulation, lack of Sternberg SS Ed, Lippincott-Raven Publishers.1997;687-705. differentiation between cortex and medulla), Matsuno Y, Morozumi N, Hirohashi S, Shimosato Y, Rosai J.. morphology of epithelial cells, and the presence of a Papillary carcinoma of the thymus: report of four cases of a dual cell population. On the other hand, regarding the new microscopic type of thymic carcinoma. Am J Surg Pathol. prognosis, the morphologic diagnosis recognizes 1998 Jul;22(7):873-80. invasive and non-invasive thymoma. It is well known Hiroaki N, Hirotoshi H, Shojiroh M, Keiichi S.. Minimally the long-term prognosis in thymoma type A and AB, invasive thymoma with extensive intravascular growth. Jap J and the malignant behavior of thymoma type C. In the Clin Oncol.1999;1:630-2. case of thymoma type B the border between benign and Marx A, Muller-Hermelink HK.. From basic immunobiology to malignant is far to be fully characterized. Actually, the the upcoming WHO-classification of tumors of the thymus. The invasion of the capsule is the only accepted Second Conference on Biological and Clinical Aspects of Thymic Epithelial Tumors and related recent developments. microscopic marker of an aggressive tumor. The Pathol Res Pract. 1999;195(8):515-33. (REVIEW) invasion of the capsule has two stages: invasion without penetration and invasion with penetration and Suster S, Moran CA.. Primary thymic epithelial neoplasms: spectrum of differentiation and histological features. Semin invasion of the adipose tissue around the thymus Diagn Pathol. 1999 Feb;16(1):2-17. (REVIEW) (Hiroaki et al., 1999). Invasion must be checked on Boonen A, Rennenberg R, van der Linden S.. Thymoma- many step sections, because there were described cases associated systemic lupus erythematosus, exacerbating after with apparent intact capsule but containing neoplastic thymectomy. A case report and review of the literature. epithelial cells in capsular veins. Thus could be Rheumatology (Oxford). 2000 Sep;39(9):1044-6. (REVIEW) explained 15% of local recurrences in apparent Kuo TT.. Frequent presence of neuroendocrine small cells in encapsulated thymoma. thymic carcinoma: a light microscopic and Taken separately, anyone of these markers (excepting immunohistochemical study. Histopathology. 2000 for the invasion of the capsule) may define the Jul;37(1):19-26. prognostic status in tumors of the thymus. This is why Welsh JS, Wilkins KB, Green R, Bulkley G, Askin F, Diener- there are necessary additional studies on large series of West M, Howard SP.. Association between thymoma and patients with long-term follow-up. second neoplasms. JAMA. 2000 Mar 1;283(9):1142-3. The overall survival of patients with thymoma for all Yoneda S, Kawahara K, Okabayashi K, Shiraishi T, Iwasaki A, stages is 67% after 5-years follow-up (stage I and II 95- Shirakusa T, Kohno J, Kikuchi M.. Evaluation of the malignant grade of thymic epithelial tumors according to the epithelial 100% at 5 years and stages III and IV 33% at 3 years) subclassification. Surg Today. 2000;30(1):43-8. (Schmidt-Wolf et al., 2003). Studies performed on large series of patients showed no differences in overall Zhao C, Yamada T, Kuramochi S, Yamazaki K, Mukai M, Kameyama K, Hata J.. Two cases of ectopic hamartomatous survival between stages I and II, and it is suggested that thymoma. Virchows Arch. 2000 Dec;437(6):643-7. capsular invasion should not be used to define the stage Kuo TT.. Classification of thymic epithelial neoplasms: a (Asamura et al., 2004). Another critic of the actual controversial issue coming to an end? J Cell Mol Med. 2001 stage III is given by the lack in defining the degree of Oct-Dec;5(4):442-8. extension. The solution could be the aggregation of Tateyama H, Takahashi E, Saito Y, Fukai I, Fujii Y, Niwa H, stage I and II, and splitting the stage III based on the Eimoto T.. Histopathologic changes of thymoma preoperatively number of invaded organs. Therefore, the prognosis treated with corticosteroids. Virchows Arch. 2001 should be better reflected in survival and in accord with Mar;438(3):238-47. long-term overall survival. Wick MR.. The mediastinum. In. Diagnostic surgical pathology, Sternberg SS Ed, Raven-Lippincott. 2001. References Henley JD, Koukoulis GK, Loehrer PJ Sr.. Epidermal growth factor receptor expression in invasive thymoma. J Cancer Res Snover DC, Levine GD, Rosai J. Thymic carcinoma. Five Clin Oncol. 2002 Mar;128(3):167-70. Epub 2002 Jan 30. distinctive histological variants. Am J Surg Pathol. 1982 Jul;6(5):451-70 Hiroshima K, Iyoda A, Toyozaki T, Supriatna Y, Shibuya K, Shimamura F, Haga Y, Yoshida S, Fujisawa T, Ohwada H.. Chen FF, Yan JJ, Jin YT, Su IJ. Detection of bcl-2 and p53 in Proliferative activity and apoptosis in thymic epithelial thymoma: expression of bcl-2 as a reliable marker of tumor neoplasms. Mod Pathol. 2002 Dec;15(12):1326-32. aggressiveness. Hum Pathol. 1996 Oct;27(10):1089-92 Tomita M, Matsuzaki Y, Edagawa M, Maeda M, Shimizu T, Iezzoni JC, Nass LB. Thymic basaloid carcinoma: a case Hara M, Onitsuka T.. Correlation between tumor angiogenesis report and review of the literature. Mod Pathol. 1996 and invasiveness in thymic epithelial tumors. J Thorac Jan;9(1):21-5 Cardiovasc Surg. 2002 Sep;124(3):493-8. Shimosato Y, Mukai K.. Tumors of the Mediastinum. In Rosai Jenkinson WE, Jenkinson EJ, Anderson G.. Differential J.(ed.) Atlas of Tumor Pathology, series 3, fascicle 21, requirement for mesenchyme in the proliferation and Washington D.C., Armed Forces Institute of maturation of thymic epithelial progenitors. J Exp Med. 2003 Pathology.1997;33-273. Jul 21;198(2):325-32. Epub 2003 Jul 14.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 227 Head and neck: Thymus: Thymoma: an overview Raica M, Ribatti D

Schmidt-Wolf IG, Rockstroh JK, Schuller H, Hirner A, Grohe C, Jun;8(2):61-4. doi: 10.1007/s10238-008-0158-y. Epub 2008 Jul Muller-Hermelink HK, Huhn D.. Malignant thymoma: current 11. (REVIEW) status of classification and multimodality treatment. Ann Hematol. 2003 Feb;82(2):69-76. Epub 2003 Feb 11. (REVIEW) Cornea R, Cimpean AM, Raica M.. World Health Organization (WHO) histo-morphologic classification of thymomas. Encica S, Cimpean A, Scridon T, Birsan M, Raica M.. Pan- Timisoara Med J. 2009;29:371-7. cytokeratin and high molecular weight cytokeratin in diagnosis of thymomas. Radioter Oncol Med. 2004;10:27-33. Aisner SC, Dahlberg S, Hameed MR, Ettinger DS, Schiller JH, Johnson DH, Aisner J, Loehrer PJ.. Epidermal growth factor Raica M, Encica S, Mogoanta L, Suciu C, Cimpean AM, receptor, C-kit, and Her2/neu immunostaining in advanced or Margaritescu C.. Thymus and thymoma: what's new? Rom J recurrent thymic epithelial neoplasms staged according to the Morphol Embryol. 1999-2004;45:11-24. (REVIEW) 2004 World Health Organization in patients treated with octreotide and prednisone: an Eastern Cooperative Oncology Rosai J.. The thymus. In: Rosai and Ackerman's Surgical Group study. J Thorac Oncol. 2010 Jun;5(6):885-92. doi: Pathology. Mosby. 2004;462-84. 10.1097/JTO.0b013e3181d86a30. Muller SM, Terszowski G, Blum C, Haller C, Anquez V, Raica M, Cimpean AM, Nico B, Guidolin D, Ribatti D.. A Kuschert S, Carmeliet P, Augustin HG, Rodewald HR.. Gene comparative study of the spatial distribution of mast cells and targeting of VEGF-A in thymus epithelium disrupts thymus microvessels in the foetal, adult human thymus and thymoma. blood vessel architecture. Proc Natl Acad Sci U S A. 2005 Jul Int J Exp Pathol. 2010 Feb;91(1):17-23. doi: 10.1111/j.1365- 26;102(30):10587-92. Epub 2005 Jul 18. 2613.2009.00689.x. Epub 2009 Dec 4. Nakagawa K, Matsuno Y, Kunitoh H, Maeshima A, Asamura H, Raica M, Mogoanta L, Kondylis A, Cimpean AM.. Angiogenesis Tsuchiya R.. Immunohistochemical KIT (CD117) expression in in the human thymoma assessed by subclassification of tumor- thymic epithelial tumors. Chest. 2005 Jul;128(1):140-4. associated blood vessels and endothelial cells proliferation. Suzuki E, Sasaki H, Kawano O, Endo K, Haneda H, Yukiue H, Rom J Morphol Embryol. 2010;51(4):627-31. Kobayashi Y, Yano M, Fujii Y.. Expression and mutation Cimpean AM, Ceausu R, Encica S, Gaje PN, Ribatti D, Raica statuses of epidermal growth factor receptor in thymic epithelial M.. Platelet-derived growth factor and platelet-derived growth tumors. Jpn J Clin Oncol. 2006 Jun;36(6):351-6. Epub 2006 factor receptor-a expression in the normal human thymus and Jun 8. thymoma. Int J Exp Pathol. 2011 Oct;92(5):340-4. doi: Raica M, Cimpean AM, Encica S, Cornea R.. Involution of the 10.1111/j.1365-2613.2011.00777.x. Epub 2011 Jun 7. thymus: a possible diagnostic pitfall. Rom J Morphol Embryol. Badve S, Goswami C, Gokmen-Polar Y, Nelson RP Jr, Henley 2007;48(2):101-6. J, Miller N, Zaheer NA, Sledge GW Jr, Li L, Kesler KA, Loehrer Raica M, Cimpean AM, Encica S, Scridon T, Barsan M.. PJ Sr.. Molecular analysis of thymoma. PLoS One. Increased mast cell density and microvessel density in the 2012;7(8):e42669. doi: 10.1371/journal.pone.0042669. Epub thymus of patients with myasthenia gravis. Rom J Morphol 2012 Aug 13. Embryol. 2007;48(1):11-6. Koppitz H, Rockstroh JK, Schuller H, Standop J, Skowasch D, Cimpean AM, Raica M, Encica S, Cornea R, Bocan V.. Muller-Hermelink HK, Schmidt-Wolf IG.. State-of-the-art Immunohistochemical expression of vascular endothelial classification and multimodality treatment of malignant growth factor A (VEGF), and its receptors (VEGFR1, 2) in thymoma. Cancer Treat Rev. 2012 Aug;38(5):540-8. doi: normal and pathologic conditions of the human thymus. Ann 10.1016/j.ctrv.2011.11.010. Epub 2012 Jan 13. (REVIEW) Anat. 2008;190(3):238-45. doi: 10.1016/j.aanat.2007.05.003. Epub 2008 Feb 1. This article should be referenced as such: Raica M, Cimpean AM, Ribatti D.. Myasthenia gravis and the Raica M, Ribatti D. Head and neck: Thymus: Thymoma: an thymus gland. A historical review. Clin Exp Med. 2008 overview. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3):221-228.

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 228 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Cancer Prone Disease Section Short Communication

Bazex-Dupré-Christol syndrome (BDCS) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: October 2012 Online updated version : http://AtlasGeneticsOncology.org/Kprones/BazexDupreChristolID10096.html DOI: 10.4267/2042/48768 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity Clinics Other names Phenotype and clinics Bazex syndrome The phenotype, reviewed by Kidd et al., 1996 on about Follicular atrophoderma and basal cell carcinomas 120 cases, associates: Note - Follicular atrophoderma (ice pick depressions of the Bazex-Dupré-Christol syndrome (Bazex et al., 1964; skin) of the dorsa of hands and feet, extensor areas of Bazex et al., 1966) should not be confused with the elbows and knees, and face, presenting at birth or acrokeratosis paraneoplastica/Bazex syndrome, a developing early in life. paraneoplastic syndrome characterized by They are discrete areas of dilated hair follicules. It is psoriasisform cutaneous lesions with acral distribution found in 100% of the cases. (fingers, toes, nose and ear), most often associated with - Congenital hypotrichosis, found in 90% of the cases, a squamous cell carcinoma of the upper aerodigestive with hair shaft abnormalities such as pili torti and tract. trichorrhexis nodosa with spontaneous breakage, Inheritance jagged or absent cuticular scales. Bazex-Dupré-Christol syndrome is an X-linked - Hypohidrosis, either generalized or confined to the dominant genodermatosis, with a prevalence below 1/1 face, found in 60% of the cases. 000 000. - Multiple milia, predominating on the face, reported at The female to male ratio reaches the expected 2:1, and birth in some cases, and developing during childhood females appear to be less affected than males. in other cases; found in 90% of the cases. There is intrafamilial and interfamilial phenotypic - 'Pinched' nose with hypoplastic alae and prominent variability (Lacombe and Taïeb, 1995; Kidd et al., columella (Kidd et al., 1996). 1996). - And early onset of basal cell carcinomas, mainly Most cases are European patients. Oley syndrome confined to the face. (Oley et al., 1992) may be a variant of Bazex-Dupré- - Trichoepitheliomas can also be found (Castori et al., Christol syndrome (Vabres and de Prost, 1993; Kidd et 2009). al., 1996). Trichoepitheliomas derive from the trichoblast (i.e. the It has been suggested that Bazex-Dupré-Christol folliculo-sebaceous-apocrine germ). syndrome is a disorder of the hair follicle; it can be They are small skin-colored papules or nodules, with considered an ectodermal dysplasia, an heterogeneous nests of basaloid cells forming cysts containing horn group of inherited disorders resulting from abnormal cells (with keratin) (Lee et al., 2005). organogenesis of the skin and its appendages (Castori et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 229 Bazex-Dupré-Christol syndrome (BDCS) Huret JL

- Sweet glands have been reported to be absent in 9 atrophodermique generalise et des degenerescences cutanees cases in a study of 11 patients (Kidd et al., 1996). multiples (epitheliomas-basocellulaires). Bull Soc Franc Derm Syph. 1964;71:206. Comedones and hidradenitis suppurativa, flexural hyperpigmentation can also be found (Castori et al., Bazex A, Dupre A, Christol B.. [Follicular atrophoderma, baso- cellular proliferations and hypotrichosis]. Ann Dermatol 2009; Castori et al., 2012). Syphiligr (Paris). 1966 May-Jun;93(3):241-54. Differential Diagnosis Oley CA, Sharpe H, Chenevix-Trench G.. Basal cell The main differential diagnoses are : carcinomas, coarse sparse hair, and milia. Am J Med Genet. - Gorlin syndrome, an autosomal dominant disease 1992 Jul 15;43(5):799-804. associating multiple basal cell carcinomas, jaw Vabres P, de Prost Y.. Bazex-Dupre-Christol syndrome: a keratocysts, dyskeratotic palmar/plantar pits and possible diagnosis for basal cell carcinomas, coarse sparse hair, and milia. Am J Med Genet. 1993 Mar 15;45(6):786. skeletal malformations; - Rombo syndrome, a probably autosomal dominant Lacombe D, Taieb A.. Overlap between the Bazex syndrome disease that presents with cyanosis, vermiculate and congenital hypotrichosis and milia. Am J Med Genet. 1995 May 8;56(4):423-4. atrophoderma of the face and sun-exposed areas, telangiectasia, milia-like papules, and basal cell Vabres P, Lacombe D, Rabinowitz LG, et al.. The gene for Bazex-Dupre-Christol syndrome maps to chromosome Xq. J carcinomas; Invest Dermatol. 1995 Jul;105(1):87-91. - Generalized basaloid follicular hamartoma, an autosomal-dominantly inherited disorder associating Kidd A, Carson L, Gregory DW, de Silva D, Holmes J, Dean JC, Haites N.. A Scottish family with Bazex-Dupre-Christol disseminated milia, palmoplantar pits, hypotrichosis syndrome: follicular atrophoderma, congenital hypotrichosis, and basaloid follicular hamartomas (Wheeler et al., and basal cell carcinoma. J Med Genet. 1996 Jun;33(6):493-7. 2000); Wheeler CE Jr, Carroll MA, Groben PA, Briggaman RA, Prose - Schöpf-Schulz-Passarge syndrome, an autosomal NS, Davis DA.. Autosomal dominantly inherited generalized recessive disease in most cases (with a genetic basaloid follicular hamartoma syndrome: report of a new heterogeneity with a possible dominant variant), disease in a North Carolina family. J Am Acad Dermatol. 2000 characterized by multiple eyelid apocrine Aug;43(2 Pt 1):189-206. (REVIEW) hidrocystomas, palmo-plantar keratoderma, Lee DA, Grossman ME, Schneiderman P, Celebi JT.. Genetics hypodontia, hypotrichosis and nail dystrophy (Castori of skin appendage neoplasms and related syndromes. J Med Genet. 2005 Nov;42(11):811-9. (REVIEW) et al., 2008). Castori M, Ruggieri S, Giannetti L, Annessi G, Zambruno G.. Neoplastic risk Schopf-Schulz-Passarge syndrome: further delineation of the Basal cell carcinomas (BCC) develop in the second or phenotype and genetic considerations. Acta Derm Venereol. 2008;88(6):607-12. doi: 10.2340/00015555-0547. (REVIEW) third decade of life in patients with Bazex-Dupré- Christol syndrome (BDCS ), mostly in the sun-exposed Castori M, Castiglia D, Passarelli F, Paradisi M.. Bazex-Dupre- areas of the head and neck. Age at onset varies from 3 Christol syndrome: an ectodermal dysplasia with skin appendage neoplasms. Eur J Med Genet. 2009 Jul- years (Abuzahra et al., 2012) to 50 years. 3 out of 4 Aug;52(4):250-5. doi: 10.1016/j.ejmg.2008.12.003. Epub 2008 BDCS patients will experience BCCs. Predisposing Dec 25. inherited diseases with an increased risk of BCCs are Parren LJ, Abuzahra F, Wagenvoort T, et al.. Linkage the following: Bazex-Dupré-Christol, Gorlin, Rombo refinement of Bazex-Dupre-Christol syndrome to an 11.4-Mb syndromes, Xeroderma Pigmentosum, Bloom, Werner, interval on chromosome Xq25-27.1. Br J Dermatol. 2011 Rothmund-Thomson and Muir-Torre syndromes, Jul;165(1):201-3. doi: 10.1111/j.1365-2133.2011.10219.x. Brooke-Spiegler, Schöpf-Schulz-Passarge and Cowden Parren LJ, Frank J.. Hereditary tumour syndromes featuring syndromes, cartilage-hair hypoplasia and basal cell carcinomas. Br J Dermatol. 2011 Jul;165(1):30-4. epidermodysplasia verruciformis, oculocutaneous doi: 10.1111/j.1365-2133.2011.10334.x. Epub 2011 Jun 3. (REVIEW) albinism and Hermansky-Pudlak syndrome, and some epidermal nevus syndromes (review in Parren and Abuzahra F, Parren LJ, Frank J.. Multiple familial and pigmented basal cell carcinomas in early childhood - Bazex- Frank, 2011; Castori et al., 2012). Dupre-Christol syndrome. J Eur Acad Dermatol Venereol. 2012 Jan;26(1):117-21. doi: 10.1111/j.1468-3083.2011.04048.x. Genes involved and proteins Epub 2011 Mar 24. Note Castori M, Morrone A, Kanitakis J, Grammatico P.. Genetic skin diseases predisposing to basal cell carcinoma. Eur J The gene involved in BDCS is still unknown. It has Dermatol. 2012 May-Jun;22(3):299-309. doi: been mapped to Xq25-27.1 (Vabres et al., 1995; Parren 10.1684/ejd.2011.1633. (REVIEW) et al., 2011). This article should be referenced as such: References Huret JL. Bazex-Dupré-Christol syndrome (BDCS). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3):229-230. Bazex A, Dupre A, Christol B.. Genodermatose complexe de type indetermine associant une hypotrichose, un etat

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 230 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

Bazex-Dupré-Christol syndrome (BDCS) Huret JL

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(3) 232