The Neurofibromatosis Type 2 Gene Product, Schwannomin, Suppresses Growth of NIH 3T3 Cells1

[CANCER RESEARCH 55, 2270-2274, June l, 1W5] Advances in Brief

Mohini Lutchman and Guy A. Rouleau2

Centre for Research in Neitroscietices, Medii University and the Montreal General Hospital, Montreal, Quebec H3G IA4, Canada

Abstract Many lines of evidence support the hypothesis that SCH is a tumor suppressor. NF2 shares many features with retinoblastoma, the para Cancer Â¡samultistep process that involves the activation of oncogenes digm for a genetic disease caused by mutation of a tumor suppressor and the inactivation of antioncogenes. Recently, a new putative tumor (14). These include autosomal dominant mode of inheritance, inacti suppressor, the neurofibromatosis type 2 (NF2) gene, was mapped to vation of germline mutations, and the occurrence of multiple tumors chromosome 22, cloned, and found to encode for a new protein, merlin/ at a young age. In sporadic and A'F2-associated meningiomas and schwannomin, a member of the band 4.1 family of proteins. Members of this family have not been implicated previously in tumorigenesis. They schwannomas, loss of heterozygosity for chromosome 22 and a high possess significant homology in their MHz-terminal domain, which is frequency of inactivating mutations of the NF2 gene strongly support thought to be important in the binding of the plasma membrane to the the hypothesis that SCH is a tumor suppressor (3, 4, 15-25). underlying actin cytoskeleton. To determine whether schwannomin may To determine whether SCH can suppress growth, we transfected the affect cell growth, we transfected NIH 3T3 cells with the wild type and an gene into NIH 3T3 cells in culture. SCH expression significantly NF2 cDNA lacking 111 amino acids at the Ml, terminus. We observed slowed growth and caused morphological changes. Transfection with slowing of growth and changes in cellular morphology only in cells ex a mutant NF2 gene isolated from an NF2 patient did not cause any pressing the wild-type NF2 cDNA. This finding suggests that schwan phenotypic changes. These results confirm that SCH can act as a nomin can suppress growth directly and confirms its role in tumor sup tumor suppressor. This system will allow the dissection of key SCH pression. This system will provide a useful assay to identify important functional domains of the protein. domains. Introduction Materials and Methods NF23 is an autosomal dominant disease that predisposes patients to RNA Extraction and Reverse Transcription-PCR. The following cell the development of vestibular schwannomas, meningiomas, and other lines were analyzed for NF2 mRNA: P19 embryonic carcinoma cells; NG108 tumors of the neuroectoderm (1). The gene was mapped to chromo and SH5Y human neuroblastoma cells; and NIH 3T3 Swiss mouse fibroblasts. Total RNA was isolated with the use of the GIBCO-BRL (Gaithersburg, MD) some 22 (2), and more recently it was cloned (3, 4) and found to TRIzol reagent from 2 X Iff cells and was reverse transcribed for l h at 37Â°C encode a protein, SCH, which is a new member of the band 4.1 family with the use of primer 906 (GCAGAATATCCAGAGCTGTCTC). Primers of proteins. This family includes numerous structural proteins such as 840 (TGCTTGCTTGGAGTGGATG) and 906 were then used for PCR am ezrin, radixin, and moesin, as well as enzymes such as the protein plification [94Â°Cfor 2 min (hot start) and the addition of Taq polymerase, tyrosine phosphatases PTPH1 and PTPMEG (5). Protein band 4.1 is followed by 94Â°Cfor 1 min, 55Â°Cfor 30 s, and 72Â°Cfor 2 min, for 30 cycles]. an important structural protein that plays a key role in regulating The product was visualized on a 1% agarose gel. membrane physical properties, including mechanical stability and Transfection of Mouse Fibroblasts (NIH 3T3 Cells). The full-length deformability, by stabilizing spectrin-ankyrin interaction (6). Ezrin, 2046-bp wild-type cDNA was subcloned into the EcnRl site of the pcDNAHI radixin, and moesin appear to be expressed widely but have been expression vector (Invitrogen, San Diego, CA). The construct was cotrans- found to localize to various subcellular compartments (7-9). Ezrin (or fected with the ÃŸ-galactosidase gene into NIH 3T3 Swiss mouse fibroblasts that were cultured to 70% confluency. The GIBCO-BRL lipofectamine system cytovillin) is a microvillar cytoplasmic peripheral membrane protein, was used for transfection. A mock transfection was achieved with the use of with prominent expression in placenta! syncytiotrophoblasts and cer the pcDNAIII vector alone. The cells were allowed to recover for 2 days after tain human tumors (10). Radixin is an actin-barbed end-capping transfection, and at least 2 X 10'' cells were used to extract RNA for reverse protein that is highly concentrated in the undercoat of the cell-cell transcription-PCR and protein for Western analysis. The transfection effi adherens junction and the cleavage furrow of cells in the interphase ciency was determined with the use of X-galactosidase staining. For develop and mitotic phases (8, 11). Moesin is a membrane-organizing exten ment of a stably transfected cell line, 800 fig/ml of G418 (Geneticin; GIBCO- sion spike protein that is localized in cultured cells near the plasma BRL) were used in the selection protocol over a period of 2 months. membrane especially in microspikes, retraction fibers, blebs, filopo- Effect of Antisense Oligonucleotides. An antisense oligonucleotide (GGAAGCGATGGCCCGGCCAG) from the 5' end of the gene and crossing dia, and lamellopodia (7, 12). These proteins are all involved in the ATG was tested in cell lines transfected stably with the wild-type NF2 gene maintaining the focal contact points between the plasma membrane and cytoskeleton. It has been postulated that certain proteins in this and then observed for reversal of the growth changes. The same experiment was carried out using 80 JAMof the sense oligonucleotide (CCTCCCTAC- class may act as tumor suppressor genes (13). CGGGCCGGTC) in 3-h pulses every day for 6 days. Growth rate and thymidine uptake were assessed in treated cells. Received 2/15/95; accepted 4/20/95. Effect of Epidermal Growth Factor on NF2 Stable Transfectants. Ap The costs of publication of this article were defrayed in part by the payment of page proximately 2 X IO6 cells were plated in 10-cm tissue culture plates and grown charges. This article must therefore be hereby marked advertisement in accordance with in serum-free medium for fibroblasts (GIBCO-BRL) in the presence and 18 U.S.C. Section 1734 solely to indicate this fact. 1G. A. R. is funded by the Medical Research Council (Montreal, Quebec, Canada) and absence of 100 nM EGF. EGF at this concentration is known to stimulate the Fonds de Recherche en SantÃ©du QuÃ©bec. growth rate (26). The cells undergoing the different treatment were plated in 2 To whom requests for reprints should be addressed, at Montreal General Hospital, Room L7-224, 1650 Cedar Avenue, Montreal, Quebec H3G 1A4, Canada. triplicate. Morphological changes in the cells were assessed, and growth rate, 3 The abbreviations used are: NF2, neurofibromatosis gene; EOF, epidermal growth thymidine uptake, and protein content (27) were measured. Characteristics of factor; SCH, schwannomin; TBS, Tris-buffcred saline. the SCH protein were investigated by Western blotting. 2270

ine-conjugatcd antibody, was added at a dilution of 1:1(MH);the coverslips with cells were incubated for l h at 37Â°C.The coverslips were rinsed twice for 5 min in IX TBS at room temperature and mounted in Immunofluorc (ICN Biochemicals, Inc.. Cleveland, OH) mounting fluid. The slides were examined on the Polyvar microscope, and photographs were taken with the use of Tmax 3200 ASA film (Eastman Kodak Co.. Rochester, NY). Measurements of Growth Rate and Thymidine Uptake. Six different clones from each of the untransfected, mock transfccted, and stably transfccted cells (the wild-type NF2 gene and a deletion mutant) were grown lo confluency (2 X IO6) in %-well plates, and during the last 16 h of growth they were subjected to 50 mCi of ('H]thymidine. The cells were blotted onto Whatmann (Whatmann, Kent, UK) paper (triplicate for each), put into a 3-ml volume of scintillation fluid (Beckman Instruments, Fullerton, CA) in pony vials, and then counted with the use of a Beckman counter. In separate experiments, untransfected. mock transfected, stably A'F2-transfected. and mutant NF2- Ã¤2S*t| transfected NIH 3T3 cells were plated in triplicate with 2 X 10" cells/well in a 96-well plate. The cells were counted every 24 h for 5 days with the use of Sw&-Â§ g Â» a haemocytometer, and the results were plotted (Cricket graph). Image Analysis and Statistics. Tissue culture dishes containing cultures of the untransfected, mock transfected, and stably transfected NIH 3T3 cells were used for image analysis on an inverted light microscope attached to an IBAS computer (IBM) network. Cells (approximately 50 each) were selected, and the length of the cell process and the cell body diameters were measured. The ratio was taken and then compared with the use of the Student's / test (2-tailed), and significance was determined.

Results Reverse Transcription-PCR. Reverse transcription-PCR (Fig. 1) -1.4 kb was used to test several cell lines for the expression of the NF2 gene product. Confirmation of expression was carried out by Northern blot analysis (data not shown). The anti-SCH antibody was also used to

Fig. I. Reverse transcriplion-PCR of different cell lines tested for NF2 expression. The 1.4-kh product was detected in all cell lines except NIH 3T3 Swiss mouse contact- inhibited fihroblasts. This observation was also confirmed by Northern blotting analysis (data not shown).

Western Blots of Cell Lysates. The polyclonal antiserum used in this f 3 assay has been characterized previously.4 Cell lysates were collected from cultured cells by pelleting by centrifugation at 2500 rpm in a clinical centrifuge and then resuspcnding the pellet in 200 ml of NP40 buffer as described previously. Total protein extracted was quantified against a BSA standard. Equal volumes of protein (10 p.g) were loaded in duplicate on 8 and 10% 80- denaturing polyacrylamide gels electrophoresed at 100 mV for 1 h. After this time one gel was stained with Coomassie and the other was blotted onto nitrocellulose membrane for l h at 4Â°C.The gel was checked to ensure that the protein had transferred with the use of Ponceau-S staining (Sigma Chemical Co., St. Louis, MO). The membrane was preblocked for l h at room temper ature in TBS-10% milk-0.5% Tween, and then the SCH polyclonal antiserum was bound to the membrane for l h at room temperature (28). The filter was then washed once for 15 min and 3 times for 5 min at room temperature in TBS-5% milk and then bound to the goat anti-rabbit horseradish peroxidase (Sigma) secondary antibody for l h at room temperature. This was followed by one 15-min wash in TBS-5% milk-0.05% Tween, three 5-min washes in the same solution, followed finally by two 5-min washes in TBS. The signal was visualized with the use of the Amersham Enhanced Chemilumincscence (ECL; Amersham, United Kingdom) technique (see manufacturer's protocol). Immunofluorescence of Cultured Cells. Cells in log phase were trypsinized and plated onto 2-mm Corning glass coverslips. The cells were incubated overnight and then fixed with cold acetone (BDH, Germany) for 1 min. They were rinsed twice for 5 min at room temperature in I X TBS [25 mM TBS (8g NaCl, 0.2 g KO, 3 g Tris + 800 ml H2O), pH 7.4]-0.05% Tween. Fifty jbil of a solution containing DMEM-10% normal goat serum-l:100 . primary SCH antiserum were added to each coverslip and incubated for l h at Fig. 2. Western blot analysis of untransfected (nl), wild-type, and mutant (MuÃ)Nb'2 room temperature. The coverslips were rinsed twice for 5 min in l x TBS at stably transfected NIH 3T3 cells. In the NF2 stably transfected line the Mr 81UKH)SCH room temperature, and then the secondary antibody, goat anti-rabbit rhodam- protein was present. The protein was shown to be absent in the untransfected and altered by at least one-third of its size in the 111-amino acid deletion mutant. In this case there also appeared to be breakdown products, which are indicative of an unstable protein. 4 M. Lutchman and G. A. Rouleau, submitted for publication. Ordinale* molecular weight in thousands. 2271

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 1995 American Association for Cancer Research. SCHWANNOMIN SUPPRESSES GROWTH the mutant cDNA as described in "Materials and Methods." The transfection efficiency was determined to be more than 50% by cotransfection with the ÃŸ-galactosidase gene. Western analysis using the SCH polyclonal antiserum of the untransfected, wild-type NF2- transfected, and mutant-transfected cells indicated that the cells ex pressed no, normal, or mutant protein, respectively (Fig. 2). Overex- pression of SCH in the wild-type /VF2-transfected cell lines was confirmed by immunofluorescence (Fig. 3). No distinct phenotypic differences were seen among untransfected cells, mock transfected cells, or cells transfected with the mutant NF2 gene. However, phenotypic changes were seen in cells transfected with the wild-type NF2 gene (Table 1; Fig. 4). There was a 3-fold decrease in the growth rate (Fig. 5) and morphological changes in the cells. Control cells are flattened and spindle shaped with short filopo-

Fig. 3. Immunofluorescence of transfected NIH 3T3 cells. NIH 3T3 cells were co- transfected with the ÃŸ-galactosidasegene and stained with X-galactosidase, and the image was seen through an inverted microscope to ensure the transfection had worked (a). The cells were then tested by light microscopy for expression, b, cells with a preabsorbed control of the anti-SCH antibody. The faint appearance of a cell can be seen as a white shadow, c, cells that were labeled throughout the nucleus and the cytoplasm with anti-SCH. X 500.

Table 1 Statistical analysis of the phenotypic changes seen in NIH 3T3 cells overexpressing the NF2 gene

Effect on ,VF2-transfected Parameter Significance cells NF2 transfected vs. unlransfected cells P < 0.001 Decreased growth NF2 transfected vs. vector transfected cells growth rate P < 0.001 Decreased growth diameterprocess length ratio" P < 0.0001 Increased ratio" NF2 transfected vs. W2-transfected cells P < 0.0001 Reversal of decreased treated with antisense oligonucleotide growth NF2 transfected vj. EGF-treated transfected Not significant No change cells " Ratio of cell body diameter versus length of extending processes. test for the presence of SCH protein. P19 (rat embryonic carcinoma cells), PC12 (mouse pheochromocytoma), and NG108 and S5HY (both are human neuroblastoma cells) were found to express the NF2 gene at about the same relatively high levels. NIH 3T3 Swiss mouse contact-inhibited cells were found to express the gene at extremely low levels. Therefore, these cells were used for the subsequent Fig. 4. Schwannomin-induced morphological changes. Phenotypic changes seen in experiments. mock transfected cells plated at high density (A) and mock transfected cells plated at low density (B) versus NF2 stably transfected cells (C). Notice the long extensions which Transfection Experiments. Confluent NIH 3T3 cells were trans project from the cell bodies of the transfected cells. Also notice the smaller diameter of fected with the vector only, the full length wild-type NF2 cDNA, or the cell body. 2272

â€¢ Unirons in terminally differentiating cells. Perhaps SCH is important in the â€¢ Mocks organization and maintenance of myelin sheaths surrounding axons, as well as the dendrites of neurons and the extensions of melanocytes, cell types where SCH is expressed highly.4 Alternatively, SCH may be involved in the formation of growth cones. Moesin is important in the development of filopodial extensions, which are thought to be important in exploration, attachment, and the movement of cells in vitro, as well as events in epithelial-mesenchymal interactions during oncogenic transformation (5, 9). â€¢ NF2 Transfected cells were incubated in the presence of EGF to see whether there was any change in growth rate or size of the NF2 protein. No significant changes were observed. We conclude that SCH possibly differs from Ezrin where phosphorylation of Tyr 353 permits its translocation from the microvillar core to the membrane in the process of "ruffling of the membrane," as described by experiments in overexpressing A431 cells treated with EGF (26). Further experiments Time (hours) need to be done to determine whether SCH is phosphorylated. We conclude that overexpressing SCH results in a decreased Fig. 5. Growlh curve plots of the untransfected (UnIrans), mock transfected (Mocks), and NF2 stahly transfected cells. The graph illustrates that there is little difference among growth rate in NIH 3T3 cells. However, how this novel protein the growth rates of the untransfected, mock transfected, and mutant-transfccted (Mm) interacts, directly or indirectly, with the cell cycle needs to be deter cells. However, the growth rate was slowed almost 3-fold in the wild-type NF2- mined. The observed morphological changes suggest that SCH may transfected cells. be important in exploration and organization of membrane-cytoskeletal elements. In addition, this cell culture assay provides a means for studying the effects of mutations affecting different functional do dial extensions. However, transfected cells were round, globular (re mains of SCH. Results of these studies will provide clues to possible fractive cell bodies), and had long processes, which were 5-10 times interacting molecules such as growth factors, adhesion molecules, the diameter of the cell body. These changes were reversed by cytoskeletal elements, and signaling molecules, all of which may be subjecting the stably transfected clones to 80 JUMof an antisense important to SCH function and tumorigenesis. oligonucleotide designed to span the ATO of the NF2 gene. The sense oligonucleotide had no effect. Effect of EGF. Incubation of the stably transfected cell lines with Acknowledgments medium containing 100 nM resulted in no changes in cell growth rate We thank Drs. Jerry Pelletier, David Watkins, and Lisa McKerracher for or morphology (data not shown). Western analysis showed no change their advice and comments. in the size of the protein (data not shown).

Discussion References The NF2 tumor suppressor gene was cloned recently (3, 4) and 1. Eldridgc, R., Parry, D. M., and Kaiser-Kupfer, M. I. Neurofihromatosis 2: clinical heterogeneity and natural history in 39 individuals in 9 families and 16 sporadic cases. found to be highly homologous to the band 4.1 family (29), which Am. J. Hum. Genet., 49: 32, 19V1. encodes proteins involved in interaction of the plasma membrane with 2. Rouleau, G. R., Seizinger, B. R.. Martuza. R. L.. Superneau, D. W.. Conneally, P. M., and Gusella, J. F. Genetic linkage analysis of bilateral acoustic neurofihromatosis to the underlying actin cytoskeleton (6, 13). We have now shown that a DNA marker on chromosome 22. Nature (Lond.), 329: 246-248, 19X7. overexpression of the NF2 gene results in decreased growth rate and 3. Rouleau, G. A., Mere!, P., Lutchman, M., SansÃ³n, M., Zucman. J.. Marineau, C., altered morphology of N1H 3T3 cells. These phenotypic changes were Hoang-Xuan, K., Demczuk, S., Desmaze. C.. Plougaslel, B., Pulst, S. M.. Lenoir, G., not seen in mock transfected cells or cells transfected with an inacti Bijlsma, E., Fashold. R., Dumanski. J. P.. de Jong, P., Parry, D., Eldridge, R.. Aurias. A., Dclattre, O., and Thomas. G. Alteration in a new gene encoding a putative vated derivative of the NF2 gene. The phenotypic changes in stably membrane-organizing protein causes neurofibromatosis type 2. Nature (Lond.), 363: transfected cells could be reversed by exposure to an antisense oligo 515-521, 1993. 4. Trofatter, J. A., MacCollin, M. M., Rutter, J. L., Murrell, J. R.. Duyao, M., Parry, nucleotide designed to inhibit SCH translation. These results confirm D. M., Eldridge, R., Kley, N., Menon, A. G., Pulaski, K.. Haase, V., Ambrose, V. H., that growth suppression results from the overproduction of SCH and Munroe. D., Bove, C., Haines. J. L., Martuza. R. L., MacDonald, M. E.. Seizinger. provides direct evidence that this protein is a tumor suppressor. B. R.. Short, M. P., Buckler, A. J., and Gusella, J. F. A novel moesin-, ezrin-, radixin-like gene is a candidate for the neurofihromatosis type 2 gene. Cell, 7: Transfection of a deletion mutant failed to induce phenotypic 791-800, 1993. changes. Western analysis showed the presence of a truncated protein 5. Conboy, J., Yuet, W. K., Shohet, S. B., and Mohandas. N. Molecular cloning of of M, 50,000, the expected size given the 111-amino acid deletion. protein 4.1, a major erythrocyte membrane skeleton. Proc. Nati. Acad. Sci. USA, 83: 9512-9516. 1986. These results indicate that this mutant protein is inactive. The same 6. Luna. E. J., and Lilt, A. L. Cytoskeleton-plasma membrane interactions. Science mutation causes NF2 in a well studied kindred (3), suggesting that our (Washington DC), 258: 955-964, 1992. 7. Lankcs, W., and Furthmayr, H. Moesin: a member of the protein 4.1 talin-ezrin family assay might be a useful bioassay for other inactivating NF2 mu of proteins. Proc. Nati. Acad. Sci. USA, 88: 8297-8301, 1991. tations. This system will allow the rapid assessment of the effects 8. Sato, N., Yonemura, S., Obinata. T., Tsukita, S., and Tsukita, S. Radixin, a barbed end-capping actin-modulating protein, is concentrated in the cleavage furrow during of the missense and internal inframe deletion NF2 mutations on cytokinesis. J. Cell Biol., 113: 321-330, 1991. cell function, allowing the identification of key functional domains 9. Yang. 0-. and Tonks, N. K. Isolation of a cDNA clone encoding a human protein- of SCH. tyrosine phosphatase with homology to the cytoskelelal-associated proteins band 4.1, ezrin and talin. Proc. Nati. Acad. Sci. USA, 88: 5949-5943, 1991. Cells stably transfected with the NF2 gene alter their shape. This 10. Turunen, O., Winqvist, R., Pakkanen, R., Grzeschik. K-H., Wahlstrom, T., and may result from interactions between SCH and extracellular matrix Vaheri. A. Cytovillin, a microvillar M, 75.IXKI protein. J. Biol. Chem., 264: molecules via integrins, interactions that may lead to changes in 16727-16732. 1989. 11. Funayama, N., Nagafuchi, A., Salo, N., Tsukita, S., and Tsukita, S. Radixin is a novel morphology in the actin cytoskeleton. The filopodial extensions sug member of the band 4.1 family. J. Cell Biol., 115: 1039-1048, 1991. gest that SCH may play a role in this process, which is frequently seen 12. Furthmayr, H., Lankcs, W., and Amicva, M. Moesin. a new cytoskeletal protein and 2273

constituent of filopodia: its role in cellular function. Kidney Int., 41: 665-670, 1992. 21. Ruttledge, M. H., Sarrazin, J., Rangaratnam, S., Phelan, C. M., Twist, E. C., Merei, 13. Algrain, M., Turunen, O., Vaheri, A., Louvard, D., and Arpin, M. Ezrin contains P., Delattre, O., Thomas, G., Nordenskjold, M., Collins, V. P., Dumanski, J. P., and cytoskeleton and membrane binding domains accounting for its proposed role as a Rouleau, G. A. Evidence for the complete inactivation of the NF2 gene in sporadic membrane-cytoskeletal linker. J. Cell Biol., 120: 129-139, 1993. meningiomas. Nature Genet., 6: 180-184, 1994. 14. Knudson, A. G. Mutation and cancer; statistical study of retinoblastoma. Proc. Nati. 22. Seizinger, B. R., Martuza, R., and Gusella, J. F. Loss of genes on chromosome 22 in Acad. Sci. USA, 68: 820-823, 1971. tumourigenesis of human acoustic neuroma. Nature (Lond.), 322: 644-647, 1986. 15. Bianchi, A. B., HarÃ¡,T., Ramesh, V., Gao, J., Klein-Szanlo, A. J. P., Morin, F., 23. Seizinger, B. R., Rouleau, G. A., Ozelius, L. J., Lane, A. H., St. George-Hyslop, P., Menon, A., Troffatter, J. A., Gusella, J. F., Seizinger, B. R., and Kley, N. Mutations Huson, S., Gusella, J. F., and Martuza, R., L. A common pathogenetic mechanism for in transcript isoforms of the neurofibromatosis 2 gene in multiple tumor types. Nature the three tumor types in bilateral acoustic neurofibromatosis. Science (Washington Genet., 6: 185-192, 1994. DC), 236: 317-319, 1987. 16. Irving, R. M., Moffat, D. A., Hardy, D. G., Barton, D. E., Xuereb, J. H., and MÃ¤her, 24. Twisl, E. C., Ruttledge, M. H., Rousseau, M., SansÃ³n, M., Papi, L., Merei, P., E. R. Somatic NF2 gene mutations in familial and non-familial vestibular schwan- noma. Hum. Mol. Genet., 3: 347-350, 1994. Delattre, O., Thomas, G., and Rouleau, G. A. The neurofibromatosis type 2 gene is inactivated in schwannomas. Hum. Mol. Genet., 3: 147-151, 1994. 17. Jacoby, L. B., MacCollin, M., Louis, D. N., Mohney, T., Rubio, M-P., and Pulaski, 25. Wolff, R. K. Frazer, K. A., Jackler, R. K., Lanser, M. J., Pitts, L. H., and Cox, D. R. K. Exon scanning for mutation of the NF2 gene in schwannomas. Hum. Mol. Genet., 3: 413-419, 1994. Analysis of chromosome 22 deletions in neurofibromatosis type 2 related tumors. Am. J. Hum. Genet., 51: 478-485, 1992. 18. Lekanne Deprez, R. H., Bianchi, A. B., Groen, N. A., Seizinger, B. R., 26. Bretscher, A. Rapid phosphorylation and re-organization of ezrin and spectrin ac Hagemeijer, A., van Drunen, E., Bootsma, D., KÃ¶per,J. W., Aveezaat, C. J. J., company morphological changes induced in A-431 cells by epidermal growth factor. Kley, N., and Zwarthoff, E. C. Frequent NF2 gene transcript mutations in sporadic J. Cell Biol., 108: 921-930, 1989. meningiomas and vestibular schwannomas mutations Am. J. Hum. Genet., 54: 1022-1029, 1994. 27. Lowry, O. H., Rosebrough, M. J., Fair, A. L., and Randall, R. L. Protein measurement 19. Pykett, M. J., Murphy, M., Harnish, P. R., and George, D. The neurofibromatosis 2 the folin phenol reagent. J. Biol. Chem., 193: 265-275, 1951. (NF2) tumor suppressor gene encodes multiple alternatively spliced transcripts. Hum. 28. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Mol. Genet., 3: 559-564, 1994. Manual, Ed. 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989. 20. Rubio, M-P., CorrerÃ , K. M., Ramesh, V., MacCollin, M. M., Jacoby, L. B., von 29. Bourn, D., Carter, S. A., Mason, S., Evans, D. G. R., and Strachan, T. Germline Demling, A., Gusella, J. F., and Louis, D. Analysis of the neurofibromatosis 2 gene mutations in the neurofibromatosis type 2 tumor suppressor gene. Hum. Mol. Genet., in human ependymomas and astrocytomas. Cancer Res., 54: 45-47, 1994. 3: 813-816, 1994.

2274

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 1995 American Association for Cancer Research. The Neurofibromatosis Type 2 Gene Product, Schwannomin, Suppresses Growth of NIH 3T3 Cells

Mohini Lutchman and Guy A. Rouleau

Cancer Res 1995;55:2270-2274.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/55/11/2270

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/55/11/2270. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.