Plant Physiol. (1997) 113: 1329-1 341

Characterization and Expression of NAD(H)-Dependent Glutamate Dehydrogenase Genes in Arabidopsis

Frank J.Turano*, Sona S. Thakkar, Tung Fang, and Jane M. Weisemann United States Department of Agriculture, Agricultura1 Research Service, Climate Stress Laboratory, Beltsville, Maryland 20705 (F.J.T., S.S.T., T.F.); and National Center for Biotechnology Information, National Library of Medicine, Building 38A, National lnstitutes of Health, 8600 Rockville Pike, Bethesda, Maryland 20894 (J.M.W.)

composed of six subunits of approximately 42 to 45 kD. Two distinct cDNA clones encoding NAD(H)-dependent gluta- Despite an extensive knowledge of the physical and bio- mate dehydrogenase (NAD[H]-CDH) in Arabidopsis thaliana were chemical characteristics of GDH, the physiological role of identified and sequenced. lhe genes corresponding to these cDNA the enzyme has not yet been established. The lack of un- clones were designated GDHl and GDHZ. Analysis of the deduced derstanding of the physiological role of GDH in plants can amino acid sequences suggest that both gene products contain be attributed to several factors, including: (a) increased putative mitochondrial transit polypeptides and NAD(H)- and interest in the enzymes GS and GOGAT due to the discov- a-ketoglutarate-binding domains. Subcellular fractionation con- ery of GOGAT in plants (Lea and Miflin, 1974); (b) appar- firmed the mitochondrial location of the NAD(H)-CDH isoenzymes. In addition, a putative EF-hand loop, shown to be associated with ent contradictions among results from different investiga- CaZ+ binding, was identified in the GDHZ gene product but not in tions; and (c) until recently, the lack of molecular tools the GDHl gene product. GDHl encodes a 43.0-kD polypeptide, (antibodies and cDNA probes) for analyses of GDH. designated a, and GDHZ' encodes a 42.5-kD polypeptide, desig- Prior to the isolation of GOGAT in plant leaves (Lea and nated p. The two subunits combine in different ratios to form seven Miflin, 1974), GDH was believed to be the primary route of NAD(H)-CDH isoenzymes. lhe slowest-migrating isoenzyme in a ammonia assimilation in plants. However, biochemical, native gel, CDH1, is a homohexamer composed of a subunits, and molecular, and genetic studies have shown that the en- the fastest-migrating isoenzyme, CDH7, is a homohexamer com- zymes GS and GOGAT function as the primary route for posed of /3 subunits. CDH isoenzymes 2 through 6 are heterohex- ammonia assimilation in plants (Miflin and Lea, 1980). amers composed of different ratios of a and p subunits. NAD(H)- CDH isoenzyme patterns varied among different plant organs and Furthermore, molecular studies have shown that under in leaves of plants irrigated with different nitrogen sources or photorespiratory conditions the gene encoding the chloro- subjected to darkness for 4 d. Conversely, there were little or no plast isoenzyme of GS was induced 4-fold (Edwards and measurable changes in isoenzyme patterns in roots of plants treated Coruzzi, 1989). These results support the earlier findings of with different nitrogen sources. In most instances, changes in isoen- Wallsgrove et al. (1987), which suggested that GS/GOGAT zyme patterns were correlated with relative differences in the level played a key role in the reassimilation of ammonia released of a and /3 subunits. Likewise, the relative difference in the level of during photorespiration. However, GDH may play a com- a or /3 subunits was correlated with changes in the level of GDHl plementary role to GS/GOGAT in the reassimilation of or GDHZ transcript detected in each sample, suggesting that excess ammonia released during stress conditions or dur- NAD(H)-CDH activity is controlled at least in part at the transcrip- ing specific stages of development (Yamaya et al., 1986; tional level. Rhodes et al., 1989; for review, see Stewart et al., 1980; Srivastava and Singh, 1987). Severa1 approaches have been used to determine the role GDH (EC 1.4.1.2) catalyzes a reversible reaction for the of GDH in nitrogen metabolism. In one study, a GDHl nu11 reductive amination of a-ketoglutarate to form Glu in the mutant of Zea, mays was fed 15N-labeled compounds (Ma- presence of the cofactor NAD(P)H. The enzyme has been galhaes et al., 1990). Root samples of the GDHl mutant had physically and biochemically characterized in several plant a 10- to 15-fold reduction in GDH activity and a 40 to 50% species (for review, see Stewart et al., 1980; Srivastava and decrease in the rate of "NH,+ assimilation into reduced Singh, 1987). GDH has numerous isoenzymic forms that nitrogen compared with root samples from the wild type. It are localized in chloroplasts and mitochondria. NAD(H)- appeared that the different rates of nitrogen assimilation GDH isoenzymes are localized in the mitochondria, between the mutant and wild-type plants could be attrib- whereas NADP(H)-GDH isoenzymes are associated with uted to variations in GDH activity. However, the authors chloroplasts. The number of distinct isoenzymes can vary cautioned against such an interpretation because no differ- in plant tissues during development and under different ences were observed between the wild type and mutants environmental conditions. NAD(H)-GDH isoenzymes have

~ ~ relative molecular masses ranging from 208 to 270 kD, each Abbreviations: Cat, catalase; GDH, glutamate dehydrogenase; GOGAT, glutamate synthase; GS, Gln synthetase; NAD(H)-GDH, * Corresponding author; e-mail fturano8asrr.arsusda.gov;fax NAD(H)-dependent glutamate dehydrogenase; NADP(H)-GDH, 1-301-504-7521. NADP(H)-dependent GDH. 1329 1330 Turano et al. Plant Physiol. Vol. 113, 1997

treated with a GS inhibitor. The authors suggested that cobs, 1983) and maize (Pryor, 1979; Goodman et al., 1980; there could be other factors such as differences in shoot: Sakakibara et al., 1995); (b) different intracellular localiza- root ratios that could have contributed to the different rates tion of GDH isoenzymes (for review, see Stewart et al., of nitrogen assimilation. Data from feeding studies using 1980; Srivastava and Singh, 1987); or (c) posttranslational grape calli also suggest that NAD(H)-GDH may play a modifications as reported for GDH in Candida species role in nitrogen metabolism. Native PAGE analyses of pro- (Hemmings, 1980). To gain a greater understanding of the tein extracts from grape calli treated with ammonia or Gln structure and function of NAD(H)-GDH and the role of its contained NAD(H)-GDH isoenzymes of high electro- isoenzymes in plant nitrogen and / or carbon metabolism, phoretic mobility (Loulakakis and Roubelakis-Angelakis, we initiated a study of the isoenzymes and genes in A. 1991). Two-dimensional gel electrophoresis of these sam- thaliana. In this study we combined molecular biological ples revealed that they were composed of a single type of approaches with traditional isoenzyme analyses and im- subunit designated a. The authors suggested that the ele- munological techniques to identify the cDNA clones vated levels of ammonia or Gln favored the metabolism of and the proteinl polypeptide components they encode. We Glu (amination reaction) and the synthesis of the a subunit. also identified some environmental factors that altered Conversely, GDH isoenzymes with low electrophoretic NAD(H)-GDH isoenzyme patterns and gene expression in mobility in native polyacrylamide gels were abundant in A. thaliana. protein extracts from grape calli treated with Glu or nitrate, conditions that favored the catabolic (deamination) reac- MATERIALS AND METHODS tion and the synthesis of the /3 subunit. However, the most recent data from studies in grape Arabidopsis thaliana (L.) Heynh. ecotype Columbia (Col-O) suggest that the in vitro metabolic and catabolic activities seeds were obtained from the Arabidopsis Biological Re- of each of the seven isoenzymes are similar (Loulakakis source Center (The Ohio State University, Columbus). and Roubelakis-Angelakis, 1996); thus, it is unclear how a Plants were grown in (6- X 20- x 10-cm [height X width x particular isoenzyme could control metabolic or catabolic depth]) plastic pots either in a peat-vermiculite mix (Jiffy NAD(H)-GDH activity. Melo-Oliveira et al. (1996) used mix, Jiffy Products of America, Inc., Batavia, IL)' or in vermiculite. Plants grown in soil were watered as needed molecular biological techniques and characterized an Ara- by subirrigation throughout the experiment. Plants grown bidopsis thaliana GDHl mutant (gdhl-1)to demonstrate that in vermiculite were subirrigated with a complete mineral GDHl may play a unique role in ammonia assimilation nutrient solution with a different sole nitrogen source. The under conditions of excess inorganic nitrogen. The gene composition of the mineral nutrient solution with nitrate product for GDHl may be involved in Glu synthesis under (10 mM KNO,) was the same as that described by Cam- conditions of carbon and ammonia excess, but it may be maerts and Jacobs (1985). After 15 d, pots containing ver- involved in Glu catabolism under carbon-limiting miculite were flushed daily for 5 d with 25 mL of sterile, conditions. distilled water, and were then treated as described below Results from studies of GDH in carrot cell suspension for 4 d. Plants were irrigated daily with 25 mL of the cultures grown in limiting amounts of carbon also suggest mineral nutrient solution supplemented with either 10 mM that GDH is involved in the catabolism of Glu to form KNO,, 10 mM NH4C1, 5 mM NH4N0,, 5 mM Glu, 5 mM Gln, a-ketoglutarate (Robinson et al., 1991, 1992). GDH activity or 10 mM KNO, plus 3% SUC.The supplemented mineral increased in Suc-starved cells, and the addition of SUC nutrient solutions were filter-sterilized to control bacterial resulted in a rapid decrease in GDH activity. The derepres- and funga1 contamination. sion of GDH was positively correlated with Glu concentra- On d 24, leaf and root samples were collected for protein tions. Similar findings were reported with tobacco calli. and RNA extractions. Proteins were extracted from fresh Samples from carbon-starved calli had elevated specific tissue or from tissue frozen in liquid nitrogen and stored at activities of GDH, and GDH isoenzymes with low electro- -80°C. RNA was extracted from tissue frozen in liquid phoretic mobility were observed in these samples by native nitrogen and stored at -80°C. Similar experiments were PAGE (Masteri et al., 1991). These data suggest that the conducted in the dark with plants grown in mineral nutri- oxidation of Glu provides carbon skeletons for the TCA ent solution plus 10 mM KNO, or 10 mM KNO, plus 3% cycle and for energy production. SUC.Plants were grown under identical conditions, as de- Although recent findings in Arabidopsis demonstrated scribed above, for 20 d and then placed in the darkness for that the GDHl gene product may play a dual role in the 4 d prior to sample collection. Plants were maintained at 20 metabolism and catabolism of Glu, which are triggered by to 21"C, 60 to 70% RH under cool-white lights (120-140 specific environmental stimuli (excess nitrogen and dark- pmol PPFD m-' s-') in a 16-h light/8-h dark cycle. The ness), there are some apparent contradictions in the litera- experiments to determine the effects of supplemented ni- ture and several unknown factors, i.e. spatial and/or tem- trogen and carbon, described above, were also performed poral regulation, that may control Glu metabolism and without flushing the pots with water for 5 d. Instead, the catabolism by GDH isoenzymes. However, as suggested by Maestri et al. (1991), some of the apparent contradictions Mention of a trademark, proprietary product, or vendor does and uncertainties can be explained in one of several ways: not constitute a guarantee or warranty of the product by the U.S. (a) the existence of multiple loci or genes encoding GDH Department of Agriculture and does not imply its approval to the subunits, as shown for Arabidopsis (Cammaerts and Ja- exclusion of other products or vendors that may be suitable. NAD(H)-Glutamate Dehydrogenase Genes in Arabidopsis 1331 plants received the complete mineral nutrient solution with solution (50 mM Tes, pH 7.2, 2 mM EDTA, 1 mM MgCl,, 1 10 mM KNO, as the sole nitrogen source for 20 d prior to mM DDT, 0.4 M mannitol, and 0.2% BSA) and loaded onto initiating the treatments. The change in the protocol did a discontinuous SUCgradient (25, 34, and 51%). After cen- not significantly alter the results (data not shown). trifugation at 20008 for 20 min at 4"C, the chloroplast band at the 34/51% Suc interface was collected. The chloroplast Crude Protein Extractions suspension was diluted with 2 volumes of resuspension solution minus BSA. Chloroplasts were concentrated by Proteins were extracted from frozen or fresh samples. centrifugation at 50008 for 30 min. Frozen samples (approximately 500 mg) were ground to a Pure chloroplasts were resuspended in 1 mL of resus- fine powder with a mortar and pestle in liquid nitrogen. pension solution. Mitochondria and peroxisomes in the The powder was transferred to 1 mL of extraction buffer supernatant of the 1,5008 centrifugation described above (50 mM Tris-HC1, pH 8.0, 1 mM EDTA, 5% [v/v] glycerol, were concentrated by centrifugation at 18,OOOg for 30 min. 0.05% [v/v] Triton X-100, and 0.5% [w/v] PVP-40). Fresh The mitochondrial / peroxisomal pellets were resuspended PMSF was added to a final concentration of 1 mM in a11 in 6.5 mL of resuspension solution and loaded onto a extracts. The fresh samples (200 mg) were ground in 400 FL discontinuous Percoll (21, 26, 32, 47, and 60%) gradient. of extraction buffer as described above. The samples were After centrifugation at 45,0008 for 45 min at 4"C, the mito- incubated on ice for 15 to 30 min. Debris was removed from chondrial and peroxisomal bands were collected from the the sample by centrifugation at 13,0008 for 10 min. 32/47% and 47/ 60% Percoll interfaces, respectively. The peroxisomal suspension was diluted and concentrated as Protein Determinations and Enzyme Assays described above, except that the final centrifugation was at Protein concentrations were determined using a Bio-Rad 22,0008 for 30 min. The mitochondrial band was diluted or Pierce protein assay kit. The amination reaction was with 2 volumes of the resuspension solution, loaded onto a second discontinuous Percoll gradient 32, and 47%), used routinely to determine activity and the amount of (26, and centrifuged as described above. The mitochondrial GDH loaded onto gels as described by Turano et al. (1996). band was collected and concentrated by centrifugation, and the pure mitochondria were resuspended as described Cel Electrophoresis, Cel-Staining Procedures, and for the peroxisomes. The organelle preparations were as- lmmunoblot Analysis sayed for NADH-GDH activity and specific organelle Proteins were separated by native-PAGE or SDS-PAGE markers. Chlorophyll was determined as described by Bru- using a Mini-Protean I1 system (Bio-Rad).For native-PAGE insma (1961). The mitochondrial marker enzyme fumarase and SDS-PAGE, an equal amount of NADH-GDH activity and the peroxisomal / glyoxysomal marker enzyme Cat (0.250 unit) was added per lane. To identify different GDH were assayed as described by Hill and Bradshaw (1969) isoenzymes, proteins were separated in a native 5% poly- and Beers and Sizer (1952), respectively. acrylamide gel and stained for NAD-GDH activity as de- scribed by Turano et al. (1996). Identical gels were incu- Arabidopsis cDNA Library, Clone Identification, and DNA bated in the GDH stain solution minus Glu as negative Sequence Analysis controls. Immunoblot analysis was conducted as described by Turano et al. (1990); proteins were resolved in a SDS- An Arabidopsis ecotype Columbia (Col-O) cDNA library, polyacrylamide (8.0%) gel (Laemmli, 1970). Rabbit serum hPRL2 (Newman et al., 1994), and the expressed sequence raised against grape leaf NAD(H)-GDH was kindly pro- tag clones 137024T7 (T46178) and 188123T7 (H37750) were vided by Loulakakis and Roubelakis-Angelakis (1990b). obtained from the Arabidopsis Biological Resource Center. Rabbit serum raised against grape leaf NAD(H)-GDH Subcellular Localization (Loulakakis and Roubelakis-Angelakis, 1990b) was used to screen the cDNA expression library as described by Young Tissue, mainly leaves and some flower stalks, was col- and Davis (1983). Putative GDH clones were sequenced by lected from 24-d-old plants. The plant material was diced the dideoxy chain-termination method using modified T7 with a mechanical device equipped with 10 razor blades 2.5 DNA polymerase (Sequenase 2.0, United States Biochemi- mm apart in a Plexiglas trough chilled to 4°C for 10 min. cal) as described by the manufacturer. The data were ana- Cold extraction buffer containing 50 mM Tes, pH 7.2,2 mM lyzed with the IntelliGenetics program (IntelliGenetics, EDTA, 1 mM MgCl,, 1 mM DDT, 0.4 M mannitol, 0.5% Inc., Mountain View, CA) on a Sun system. (w/v) PVP-40, 4 mM Cys, and 0.2% BSA was used to suspend the diced plant material at a ratio of 1:1.5 (w/v). RNA lsolation and Cel Electrophoresis Fresh PMSF was added to a final concentration of 1 mM. Cellular debris was removed by filtration through four For the determination of organ-specific expression, total layers of cheesecloth and one layer of Miracloth (Calbio- RNA was isolated from roots, leaves, flower stalks, flowers, chem), followed by centrifugation at 50g for 15 min. Chlo- and siliques of 42-d-old Arabidopsis plants. To determine roplasts were removed from the supernatant by centrifu- the effects of nitrogen or darkness on NAD(H)-GDH, total gation at 15008 for 30 min. The supernatant was used for RNA was isolated from roots (in the nitrogen study only) mitochondria and peroxisome isolation. Chloroplasts in the and leaves of 24-d-old plants. Total RNA was isolated from 1500g pellet were resuspended in 8 mL of resuspension each organ, separated by gel electrophoresis using 1332 Turano et al. Plant Physiol. Vol. 113, 1997

atgaatgctttagctgcaacaaacagaaacttccgtcatgcatctcgaatcctgggtttggattcgaagatcgagagaagtcttatgatcccatttagagaaatcaaggttgagtgtacg METAsnAlaLeuAlaAlaThrAsnArgAsnPheArgHisAlaSerArgIleLeuGlyLeuAspSerLysIleGluArgSerLeuMETIleProPheArgGluIleLysValGluCysThr 40

attcctaaagacgatggcactctggtttcatacatcggatttagggttcaacatgacaatgctcgtggacccatgaaaggtggaatcagatatcatcctgaggttgatccagatgaagtt IleProLysAspAspGlyThrLeuValSerTyrIleGlyPheAtgValGlnHisAspAsnAlaArgGlyProMETLysGlyGlyIleArgTyrHisProGluValAspProAspGluVal 80

aacgcactagctcagctgatgacttggaagactgctgtagcagatattccatatggtg~gctaaaggtggaattggatgtagtcctcgtgacttgagtttgagcgagcttgagaggttg AsnAlaLeuAlaGlnLeuMETThrTrpLysThrAlaValAlaAspIleProTyrGlyGlyAlaLysGlyGlyIleGlyCysSerProArgAsPLeuSerLeuSerGluLeuGluArgLeu120

actcgtgtgtttacacagaagattcatgatcttatcggtattcataccgatgtgcctgctcctgatatgggcactaacgctcaaaccatggcttggattcttgatgagtactccaagttt ThrArgValPheThrGlnLysIleHisAspLeuIleGlyIleHisThrAspValProAlaProAspMETGlyThrAsnAlaGlnThrMETAlaTrpIleLeuAspGluTyrSerLysPhe 160

catggtcattcccctgctgttgtcactggaaagcccattgatcttggtggttcattaggtagggaagctgccacaggtcgtggtgtagtatttgccaccgaagctcttcttgctgagtac H~sGlyd~sSerProAlaValValThrGlyLysProIleAspLeuGlyGlySerLeuGlyArgGluAlaAlaThrGlyArgGlyValValPheAlaThrGluAlaLeuLeuAlaGluTyr 200

gggaaatcgattcagggtttgacatttgttattcagggttttgggaatgttggaacatgggctgcgaagctgatccacgagaaaggcggtaaagtggttgcagtaagcgacattactggt GlyLysSerIleGlnGlyLeuThrPheValIleGlnGlyPheGlyAsnValGlyThrTrpAlaAlaLysLeuIleHisGluL~sGlyGlyLysValValAlaValSerAspIleThrGly 240

gcaatcaggaaccctgaaggtatcgacatcaacgctctcataaaacacaaggacgcaactggaagtctcaatgatttcaatggtggagacgctatgaattcagatgaattgctcattcat AlaIleArgAsnProGluGlyIleAspIleAsnAlaLeuIleLysHisL~sAspAlaThrGlySerLeuAsnAspPheAsnGlyGlyAspAlaMETAsnSerAspGluLeuLeuIleHis 280

gagtgtgatgttctcattccatgcgctcttggtggtgtcctgaacaaggaaaatgctggagatgtgaaggcaaagtttatagtagaggcagctaaccatccaacagatccagatgctgat GluCysAspValLeuIleProCysAlaLeuGlyGlyValLeuA~nLysGluAsnAlaGlyAspValLysAlaLysPheIleValGluAlaAlaAsnH~~PtoThrAspProA~pAlaAsp320

gagattctgtcgaagaaaggagtgattatacttccagatatctacgcaaacgcaggaggagtgacagtgagttacttcgagtgggtgcagaacattcaaggattcatgtgggaagaggaa GluIleLeuSerLysLysGlyValIleIleLeuProAspIleTyrAlaAsnAlaGlyGlyValThrValSerTyrPheGluTrpValGlnAsnIleGlnGlyPheM~TTrpGluGluGlu 360

aaagtgaacttggagctgcaaaaatacatgactcgagcctttcacaacatcaagacaatgtgccatactcattcttgcaacctccgtatgggagctttcactcttggagttaaccgagtc LysValAsnLeuGluLeuGlnLysTyrMETThrArgAlaPheHisAsnIleLysThrMETCysHisThrHisSerCysAsnLeuArgMETGlyAlaPheThrLeuGlyValAsnArgVal 400

gctcgagccacccagttgcgtggttgggaagcttaattcagttgaatcccccttatatactctgtttcttgcttgctctgttttccatttttttttttttggtttcattgttactgaaaa AlaArgAlaThrGlnLeuArgGlyTrpGluAlaxxx

tcattgagctttccgaaatggaaaaggaaacaaatggattgaataaaaactaacaaattggaataaaaaaaaaaaaaaaaaa Figure 1. The nucleotide sequence of the full-length cDNA clone corresponding to CDH2 is shown in the sense strand. Nucleotides are numbered from the putative start codon. formaldehyde-formamide gels, and blotted onto nitrocel- of RNA per lane. Data were quantified on a beta scanner lulose as described by Turano et al. (1992). (Betagen, IntelliGenetics, Mountain View, CA).

RESULTS Amplification and Radioactive Labeling of GDH Probes and Hybridization Clone ldentification and Sequence Analyses Individual Arabidopsis cDNA clones (full-length) were Two full-length cDNA clones were identified and se- used as a template in a PCR using a gene amplification kit quenced. The initial clone, GDH1, was a single clone iden- (Perkin-Elmer) and M13-forward and M13-reverse prim- tified from a screen of 3.0 X 105 plaques from an Arabi- ers. Gene amplification reactions were conducted as fol- dopsis cDNA expression library using immunodetection lows: 94°C for 30 s, 45°C for 30 s, and 72°C for 2 min, for 40 with rabbit antiserum against grape NAD(H)-GDH. The cycles. The amplified DNA fragments were gel-purified, cDNA clone is 1539 bp long and encodes a 411-amino acid amplified a second time, and used as gene-specific probes peptide. This clone was nearly identical to the cDNA clone for RNA blot analyses. Full-length cDNA probes were encoding GDHZ described by Melo-Oliveira et al. (1996). radioactively labeled with [CX-~~P]~CTP(New England Nu- There are two differences among the sequences, a G to A clear) using the random-primer method (Pharmacia). The transition at nucleotide 13 and an additional23 nucleotides gene-specific probes were hybridized against RNA blots. prior to the poly(A) tail in the GDHl sequence reported The filters were prehybridized in 430 mM NaPO, pH 7.2, here (data not shown). The other cDNA clone, designated 7% SDS, 0.5% BSA, and 20 mM EDTA at 50°C for 1 to 4 h. GDH2, was identified in the expressed sequence tag data- Labeled probe was added and the filters were hybridized bank by its homology with GDHl. The cDNA clone was at 50°C for 18 h. Final washes were in 0.2X SSC and 0.1% obtained from the Arabidopsis Biological Resource Center SDS at 55°C. A probe encoding for the 26s rRNA gene (F.J. and sequenced in both directions. The cDNA clone for Turano, unpublished data) was used as an interna1 control GDH2 is 1620 bp long and encodes a 411-amino acid pep- on RNA blots containing total RNA to ensure equal loading tide (Fig. 1). The nucleotide identity between GDHl and NAD(H)-Glutamate Dehydrogenase Genes in Arabidopsis 1333

GDH2 is 31% in the 5' noncoding region, 75% in the coding amino acids; (b) they generally lack acidic amino acids; (c) region, and 46% in the 3' noncoding region. The amino acid in most cases they have severa1 hydroxylated amino acids; identity between the two Arabidopsis clones is 81%. The and (d) they can fold into an amphiphilic a helix. The first deduced amino acid sequences of the two Arabidopsis 20 amino acids of the N termini of GDHl and GDH2 fit NAD(H)-GDH cDNA clones were aligned with the de- these criteria well. In GDHl there are 3 positively charged duced amino acid sequences of grape (Syntichaki et al., amino acid residues (1 Lys and 2 Arg), no acidic residues, 1996) and maize (Sakakibara et al., 1995) NAD(H)-GDH and 1 hydroxylated residue (Thr) in the N-terminal region. cDNA clones (Fig. 2). GDHl has 79 and 84% amino acid In addition, the a helix formed by the N-terminal 20 resi- identity with the grape and maize NAD(H)-GDH se- dues has positively charged amino acids on one face and quences, respectively. GDH2 has 86 and 81% amino acid hydrophobic residues on the other. These features are also identity with the grape and maize NAD(H)-GDH se- preserved in GDH2. There is a conservative change of quences, respectively. Both Arabidopsis peptides appear to Lys-12 to Arg and the addition of 1 Ser at position 15. In contain putative mitochondrial target sequences. The prop- both cases the sequence RXLG at positions 16 to 19 could fit erties of mitochondrial target sequences as described by the conserved sequence motif for cleavage of the target Hartl et al. (1989) are: (a) they are rich in positively charged peptide between residues 25 and 26 (Gavel and von Heijne, 1990; von Heijne, 1992). Severa1 regions and amino acids associated with meta- Putative mitochoiidrial Ir", plypeplldr bolic function of NAD(H)-GDH are conserved among the AtGDHl amino acid sequences deduced from plant cDNA clones.

maizeGDH As discussed by Sakakibara et al. (1995) and Melo-

grapeGDH Oliveira et al. (1996), the regions include the putative a-ketoglutarate-binding domain from Ile-96 to Pro-109, AtGDH2 I a-KG-bmdlngdomaro which includes the Lys-102 that has been shown to be AtGDHl 62 RGPMKGGIRYHpEVDPDEVNALAQIXTWKTA LLSISELERLTR IIIIIIIIIII 1IIlIllIIIIIII1IlII essential for enzyme function in Clostridium (Lilly and maizeGDH 62 RGPMKGGIRYHhEVOPOEVNA~Q~TWK Engel, 1992), and the putative NAD(H)-binding domain, IIIIIIIIIII llllllllllllllll I grapeGDH 62 RGPMKGGIRYHPEVDPDEVNALAQLMTWK from Phe-209 to Asp-237, which contains the nucleotide- lllllllllllllllllllllllllllll AtGDH2 62 RGPMKGGIRYHPEVDPDEVNALAQLMlWKTAVa DLSlSELERLTR binding motif G-X-G-X-X-G(A) (Britton et al., 1992). In addition, the amino acid residues Lys-90, Thr-169, and AtGDHl 123 VFTQKIHDLIGIHToVPAPDMGTg~T~WILDEYSKFHGYSPAW~~iDLGGSLGRDA II1I1IIIIIlI1I1I11IIIIl I1I1IlIlIlI1I1I1IIIlIII1I IIIIIIIIII Ser-344, which are involved in Glu binding according to meireGDH 123 VFTQKIHDLIGIHTDVPAPDMGTN~QT~WILDEYSKFHGYSPAWTGKPVDLGGSLG~A IIIIIIIIIII l1llIlIIIIII lllllllllllllll IIIIIIIII IIIIIII I Britton et al. (1992), are conserved. In the gene product for grapeGDH 123 VFTQKIHDLIGtHTDVPAPDMGTNAQT~WILDEYSKFHGHSPAWTGKPIaLGGSLGREA GDH2, the region Asp-265 to Glu-276 has similarity to an lililllllil lllllllllllllllllllllllllllllllllllllll lllllllll AtGDH2 123 VPMKIHDLIGiHTDVPRPDMGTN~T~WILDEYsKFHGHSPAW~~IdLGGSLGREA EF-hand loop motif, and these regions have been shown NAD(H)-bmdiog domam to be associated with Ca2+ binding in other proteins (Haiech and Sallantin, 1985).

Subcellular Localization Subcellular components from leaf tissue were fraction- AtGDHl 245 kDGiDIpaLlKHtkEhrGvKGFdGaD~I~nSiLvEdcDiLvP~LGGVINr~~N~1~ II /I 1 II I I III I I I I I I I I/ 1 IIIIIIIII 111 IIII ated in discontinuous SUCor Perco11 gradients to determine miEeGBH 245 vDGLDIaqLvKHaaEa*Di~~I~~LLTEECDthe location of NAD(H)-GDH isoenzymes (Table I). Mito- IIII I I I IIII I IIJIIIIIIIIIIIIIIIIIIII grapeGDH 245 qnGLDIvdLlrHKeETGcLtnPEGODhMdPnELLTHECDVLIPC~~VL~ENA~D~ chondrial, peroxisomal, and chloroplast preparations were I I1 I 11 II I 1111 I I11 IIIIIIIIIIIIIIIIIIII IIIII AtGDH2 245 peGiDInaLikHKdaTGSLndFn~D~M~~~LLi~cDVLIPCAL~VL~NAgDVK~assayed for NADH-GDH, Cat, and fumarase activities, and for chlorophyll (Table I). Consistent with our sequence AtGDHl 306 fIIEAANHPTDPdRDEILSKRGVVILPDIyANSGGV~SYFE~QNIQGF~~EE~~L lllllllllll lI1l1lIllI IIIII llllllllllllllllllllll IIIII I1 data, NADH-GDH activity was observed only in mitochon- maizeGDH 306 YIIEAANHPTDPEADEILSKRGVlILPDIlANSOOVTVSYFEWVQNIQGF~~EKVN~EL lllllllllllllllllllll IIIII I/ /I1l/l/IIIII/l1llIl IIIII I1 drial preparations. The mitochondrial preparations had no grapeGDH 306 FIIEAANHPTDPEADEILSKROgVILPDIYANAGGVTVSYFEWVQNIQGF~EEE~Nn~L detectable levels of Cat activity or chlorophyll and con- I1 lllllllll lllllllll llllllllllllllllllllllllllllllllll II AtGDH2 306 FIVEAANHPTDPdADEILSKKGviILPDIYANA~vTVsYFEWVQNIQGF~EEE~lEL tained nearly 3-fold more fumarase activity than the per-

AtGDHl 367 kTYmTRsFkdlKeMCktHSCDLRMGAFTLGVNRVAqATiLRGWgA oxisomal preparation. A high percentage (92%) of the mi- I1 II I I I/ I1IlIlIIllI/I/I/I1 11 IIII I tochondria were intact. These data suggest that the NADH- maizeGDH 367 TTYiTRAFgNvKqMCrSHSCDLRMGAFTLGVNRVArAWLRGWEA I I I1 I I II I1 I IIIIIIII lllll I1 IIIIII GDH is associated with purified mitochondria. Protein grapeGDH 367 QKYMTkAFHNIKaMCqSHnCBLRMGRFTLaVNRVAcATtLRGWEA IIIil IIIIII i1 I I llllllll IIIII I1 illlll from crude cell lysates or purified mitochondria were sep- AtGDH2 367 QKYMTrAFHNIKtMChtHsCnLRMGAFTLgVNRVArATqLRGWEA arated on a 5% native polyacrylamide gel and stained for Figure 2. Comparison of the deduced amino acid sequences for NAD-GDH activity (Fig. 3). AI1 seven NAD(H)-GDH isoen- GDH1 (AtGDH1) and GDHZ (AtGDH2) with NAD(H)-GDH for zymes from Arabidopsis that were apparent in crude cell maize (Sakakibara et al., 1995; accession no. D49475) and grape lysates were also present in intact mitochondrial prepara- (Syntichaki et al., 1996; accession no. S54797). The mitochondrial tions. transit sequence, a-ketoglutarate (a-KG)-binding domain, and NAD(H)-binding domain are labeled and boxed. Amino acid resi- Organ Specificity dues associated with Clu binding are indicated with an asterisk above. The region homologous to an EF-hand motif in the GDHZ Specific activity, isoenzyme patterns, and immunoblot gene product is underlined. and RNA blot analyses were used to decipher the leve1 of 1334 Turano et al. Plant Physiol. Vol. 113, 1997

Table I. Subcellular localization of NAD(H)-GDH isoenzymes Subcellular components from leaf tissue were fractionate discontinuoun di r Percolo e sSu l gradients to determine the location of NAD(H)-GDH isoenzymes. Mitochondrial, chloroplast, and peroxisomal preparations were assayed for NADH-GDH, Cat, and fumurase activities, and for chlorophyll. Markers Location NADH-GDH Cat Chlorophyll Fumarase intact H tunolmg-' V-g mg~' /A/no/ mg~ ' protein protein protein protein Mitochondria 31.5 0 0 36.2 92 Chloroplasts 0 0 60.5 0 nda Peroxisomes 0 72.6 0 13.8 99 a nd, Not determined.

activity and/or transcript(s) of each NAD(H)-GDH isoen- different organs were separated by SDS-PAGE (8.0% poly- zyme in different plant organs (Fig. 4). The specific activ- acrylamide). Immunoblot analysis was used to determine ity of NADH-GDH was highest in flowers and lowest in the subunit composition of the NAD(H)-GDH isoen- older leaves (from 42-d-old plants). Each organ contained zymes. different amounts of the seven NAD(H)-GDH isoenzymes A 42.5-kD polypeptide was identified in protein samples that were readily separated by native-PAGE. The isoen- fro l organsmal , polypeptide baseth n do e migratioe th n i zymes were numbered GDH1 (lowest electrophoretic gel (highest electrophoretic mobility d followinan ) e gth mobilit r cathodal-moso y t isoenzyme) through GDH7 nomenclature syste f Loulakakio m d Roubelakisan s - (highest electrophoretic mobilit r anodal-moso y t isoen- Angelakis (1991). This subunit was designated as /3. A zyme), following the nomenclature of Loulakakis and 43.0-kD polypeptide (lowest electrophoretic mobility), des- Roubelakis-Angelakis (1990a), whic s basei h n theio d r samplee ignate identifieth s f o wa l , sda al excepn di t those migratio nativa n npolyacrylamidi % e5 e e rootsgelTh . , froe rootsmth uniquA . e 40.0-kD polypeptid- ob s wa e flower stalks, flowers, and siliques contained mainly an- served in roots (from 42-d-old plants) and, due to its tran- odal (fast-migrating) isoenzymes (GDH5-GDH7)t bu , sient appearance in gels throughout the study (see below), GDH s abundan7wa flowersn i t . Young leaves (fro- m24 remained undesignated. The j3 subunit was more abundant d-old plants) containe l seveal d n isoenzymes, witn a h than the a subunit in protein extracts from roots, flowers, abundance of cathodal isoenzymes (GDH1-GDH3). How- e anodad siliqueth an gelsS d lan SD ,s isoen n (Figi ) -.4B ever, protein extracts from leave f 42-d-olo s d plants con- zymes were more abundan thesn ti e samples (Fig. 4A)e .Th tained mainly cathodal isoenzymes, wit- de h o littln r eo |3 subunit was readily apparent in roots, but the a subunit tectable anodal isoenzymes. Protein extracts from was not detectable. The relative difference in the levels of a subunit3 | convenientle d b an n sca y expresse ratioa s da , i.e. e a:/th 3 subunit rati rootn i os <1:100 wa s , whereae th s ratio f a:jso 3 subunit flowern si siliqued an s d s an wer 3 e1: 1:2, respectively. Protein extracts from organs with a pre- dominance of cathodal isoenzymes had a high a:|3 subunit ratio r greater o n general i ;1 e a:/1: Th 3e rati.s th , owa subuni 42-d-old an t - ratio24 d n i leaves 2:1d s ,weran 1 e1: — 1 respectively (Table II). — 2 date Th a show that protein extracts containin abunn ga - danc f anodaeo l isoenzyme a:/w 3lo subunia d ha s t ratio, — 3 whereas extracts with an abundance of cathodal isoen- — 4 zymehiga d h ha sratio . However, protein extracts from flower stalks were an exception to this trend. Anodal isoen- —5 zymes were predominant in flower stalks, but the a:)3 — 6 subunit ratis nearlowa y 1.5:1 possiblA . e explanatior nfo the deviation of flower stalk protein extracts and other — 7 organs may be the relatively high occurrence of isoen- flowen i zyme6 o rt stalkss4 , which have higher numbers osubunita f s compared with samples ric anodan hi l isoen- Figur . Subcellula3 e r localizatio f NAD(H)-GDo n H isoenzymes. zymes, suc rootss ha , flowers siliquesd an , . Transcript lev- Subcellular components from leaf tissue were fractionated in discon- r Percolo tinuou e Su sl gradient o determint s e locatioth e f o n GDH1r elsfo were highes younn i t g leaves therd an , e were NAD(H)-GDH isoenzymes. Protein extracts from crude lysate (Crude significant level n root i sd flowers an s . Level f GDH1o s Lysate) or purified mitochondria (Mito) were separated in a 5% transcript were low in flower stalks, siliques, and older polyacrylamide gel and stained for NAD-GDH activity. An equal leaves. Transcript level GDH2r sfo were highes flowern i t s amoun f NADH-GDo t H activity (0.250 unitaddes r lanewa ) dpe . and siliques therd an , e were significant level rootn si d san NAD(H)-Glutamate Dehydrogenase Gene Arabidopsin si s 1335

bloA t RN analyse d an s were performe protein do d an n Spec. Act. 3.5 2.6 4.8 M.i 3.9 1.3 total RNA extracts from leaves (Fig. 5) and roots (Fig. 6). R YL FS F Si OL The specific activity of NADH-GDH increased in protein extracts from leave f plantso s treated with different nitro-

n sourcege s compare KNOM m 3d0 1 (controlwit e th h ) treatment (Fig. 5). The greatest increase was 2.9-fold in

leave f planto s s treate dNH M witm 4 NOh5 3 (Table III). NAD-GD polyacrylamidH% 5 stai a f no l showege s thal al t seven isoenzymes were present, and the cathodal isoen- zymes were readily detected in each sample. However, the cathodal isoenzymes were most abundant in samples B treated with 10 mM KNO3, 5 mM NH4NO3, and 5 mM Glu. Both a and /3 subunits were detected in all treatments. The levea subuni f o l t varied among nitrogen treatmentst bu , the level of /3 subunit remained constant. The a subunit was most abundant in 5 mM NH NO - and 5 mM Gin- GDHl 4 3 treated samplesa:/e th 3 ratiod an ,thos n si e samples were 4:1 and 3:1, respectively. When compared with controls (10

mM KNO3), transcripts corresponding to GDHl and GDH2 D GDH2 increased approximatel d 5-foldan - 3 y, respectivelyn i , leaves treated wit NHh NHM eitheM 4m NO4m 5 C r 0 13ro 1 . e leve Th f GDHlo l transcript increase leaven di s treated with Glu but not in leaves of Gin-treated plants. Con- versely, the level of GDH2 transcript increased in leaves E t— 26S leaven i treatet f Glu-treateno o s t d bu witn hGi d plants. The level of GDHl and GDH2 transcripts corresponded to Figure 4. Specific NADH-CDH activity, isoenzyme patterns, immu- estimatee th d specific activit eacr yfo h treatment. Samples noblot analysis, and expression of CDH1 and CDH2 in different with specific activities of 2.7 or lower had low levels of organs of Arabidopsis. Protein or total RNA extractions were per- GDHl and/or GDH2 transcript. Conversely, samples with forme rootn do s (R), flower stalks (FS), flowers (F), siliques (Si)d ,an high specific activities, 3.8 or greater, had high levels of leave f 42-d-olso d plant leavese (OL)th d f 24-d-olso ,an d plants (YL). GDH GDH2d an l relative .Th e level f GDHl so GDHd an 2 Proteins were separate nativ% 5 n i ed polyacrylamide d gelan s transcript appeare correlato dt e wit relative hth e levelf so staine r NAD-GDfo d H activity (A)e position Th e seve. th f no s polypeptides3 / d an a e leaven th I . plantf so s grow soiln i , NAD(H)-GDH isoenzymes are indicated. For immunoblot analysis ratie th GDH1:GDH2f oo transcript approximatels swa y 2:1, (B), proteins were resolved in a SDS (8.0%) polyacrylamide gel, which is very similar to the ratio of a:j8 polypeptides at 3:1. blotted onto nitrocellulose d incubatean , d with antiserum raised against grape leaf NAD(H)-GDH (Loulakaki d Roubelakisan s - However, it is risky to base definitive conclusions on such Angelakis, 1990b). The positions of the a and ft subunits are indi- observations, eve nparametere thougth f o l hal s associated cated native-PAGr Fo . SDS-PAGEd Ean equan a , l amoun f NADHo t - with the hybridization experiments were identical. GDH activity (0.250 unit) was added per lane. Total RNA (10 /j.g) was The specific activity of NADH-GDH in protein extracts separate l electrophoresisge y b d , blotted onto nitrocellulosed an , from roots treated with different nitrogen sources was hybridized wit full-lengtha h prob r eitheefo r r CDH1CDH2o ) (C relatively unchanged except in samples from plants treated rRNS (D) 26 portioA .A e probth f use s controno a es wa d a ensuro t l e with 5 mM Gin (Fig. 6). In addition, the specific activity in equal loadin intf totaA glanee o oth RN l s result(E)e Th .repre e sar - extracts from roots of plants treated with different nitrogen sentative of two separate experiments. sources was 2 to 7 times greater than in leaf extracts from the same plants (Fig. 5). NAD-GDH stain of a 5% poly- acrylamide gel shows that anodal isoenzymes, especially GDH7, were abundant in all of the root samples (Fig. 6A). young leaves. Levels of GDH2 transcript were lowest in However, samples from plantsd treateha n Gi d witM m h5 flower stalks and siliques. more GDH5 and GDH6 compared with samples from other nitrogen treatments. Likewise subuni3 / e s visualth ,wa t - Effece Th f Differeno t t Nitrogen Source NAD(H)-GDn so H t detecte subunio samplesl izeno al e s th n di t n dwa ti bu , Plants were maintained in soil or vermiculite with com- any root sample (Fig. 6B). Root tissue from 24-d-old plants

plete nutrient solution and 10 mM KNO3 as the sole nitro- grow soin ni r vermiculit o l e treated with NHn Gi 4 Cr 1o gen source. After 20 d (see "Materials and Methods"), the contained a 40.0-kD polypeptide. The level of 40.0-kD pots containing vermiculite were treated with complete polypeptid NHn ei 4Cl-treated tissue equas swa thao t lf o t mineral nutrient solution containing either 10 mM KNO3, the /3 subunit, whereas the level of 40.0-kD polypeptide s a n Gi NH NHM M M m 4m C1 Glum 45 0 NO M 5 1 ,r m o , 35 / s negligiblwa rootn ei f plantso s grow soin ni r treate o l d sole th e nitrogen source. Determinatio specifif no c NADH- with Gin. Analysi blotA sRN shof so detectablo wn e level GDH activity and isoenzyme patterns, and immunoblot of GDHl rooe th transcriptf o samples y an n i t. After nor- 1336 Turano et al. Plant Physiol. Vol. 113, 1997

relativee TablTh . eII abundance f cathodalo anodald an NAD(H)-CDH isoenzymes ratioe f th o d an fi subunitsand a from various organs thalianaA. of The results presented in this table are representative of two separate experiments. Organ

NAD(H)-GDH Young Flower Old Roots Flowers Sihques leaves stalks leaves Cathodal isoenzymes (GDH1-GDH3) +b Anodal isoenzymes (GDH5-GDH7+ ) a:|3 Subunit (ratio) <1:100 1:1 1 2: 1.5:1 2 1: 1:3 a -, Absent. b +, Present.

probS malizatio26 ee date (datth t th shown)o at f a no no , Effece Th f Lighto t , NAD(H)-GDn Darknesso e Su d ,an H the level of GDH2 transcript in each sample remained Plants were growlighthe t nin (se e "Material Methsand - unchanged excep Glu-treaten i t d roots whicn i , levee hth l ods" for conditions) for 20 d in soil given deionized water decreased 70% (Table IV). The results from this experiment or in vermiculite watered with complete nutrient solution strongly suggest that GDH2 encode e ft th subuni r fo s d tan and 10 mM KNO as the sole nitrogen source. After 20 d, GDH1 encodes for the a subunit. 3 one-half of the plants were transferred to complete dark- othee th rd halan d f neswer4 r sfo e maintaine lighte th n d.i plantf o t se s e growOn vermiculitn ni treates ewa d wit0 h1 Spec8 . Act3. . 2.5 4.6 13 1.7 2.7 e th meithelighe n d Mi th 4 r KNOr o tn i r fo e 3 Su plu % s3 o" dark. The other two sets of plants were maintained in m either soil or 10 mM KNO for the 4-d light or dark treat- o 3 Tt 3 "3 z a 3G 3 e 1/3 * Z Z 3 O

Spec1 . Act8. . 13.1 11.4 8.S 10.2 17.7 d" f> u z 0 *T Tt '3 Z OB X 9 £ O3 * Z z 3 e>

B

C GDHl B

D — GDH2 GDHl

E 26S D — GDH2 Figure 5. Effect of various nitrogen treatments on NAD(H)-GDH in leave f Arabidopsisso . Plants were grow vermiculitn ni maind ean - taineenvironmentae th dn i l conditions describe Figurn di . Plante4 s were subirrigated with a mineral nutrient solution (see "Materials and E — 26S

Methods") containing nitrate (10 mM KNO3) for 20 d. The plants were

treated with either 10 mM KNO3, 10 mM NH4CI, 5 mM NH4NOj, 5 harvese priod th leavee 4 o th d t rr f tn o fo so n Gi mM Mm 5 Glu r o , Figur . Effece6 f variouo t s nitrogen treatment NAD(H)-GDn so Hn i 24. One set of plants was grown in soil and maintained as described roots of Arabidopsis. Plants were grown and maintained as described in Figure 4. Protein and RNA extractions were collected and ana- n Figuri extractionA . Proteie5 RN d nan s were collecte anad an d- lyzed as described in Figure 4. The specific activity, seven NAD(H)- lyze describes da specifiFigurn e di Th . e4 c activity, seven NAD(H)- GDH isoenzymes (A), a and j3 subunits (B), and the GDHl (C), GDH isoenzymes (A), a and /3 subunits (B), and the CDH1 (C), CDH2 (D), and 26S (E) transcripts are indicated. The results are CDH2 (D), and 26S (E) transcripts are indicated. The results are representative of two separate experiments. representative of two separate experiments. NAD(H)-Clutamate Dehydrogenase Genes in Arabidopsis 1337

Table 111. The effects of different nitrogen treatments on NAD(H)-GDH specific activity, the presence of cathodal and anodal NAD(H)-GDH isoenzymes, the ratio of a and p subunits, and the levels of GDHJ and GDH2 transcripts in leaves of A. thaliana The changes in specific activity and the levels of GDHl and GDHZ transcripts are presented as an increase (-fold) in the samples from various nitrogen treatments compared with the control, 10 mM KNO, treatment. All samples were obtained from 24-d-old plants. See Figure 5 or ”Materials and Methods” for the experimental procedure. The results presented in this table are representative of two separate experiments. Nitrogen Treatment

NAD(H)-GDH KNO, NH4CI NH4N03 Clu Gln (1 O mM; control) (10 mM) (5 mM) (5 mM) (5 mM) lncrease (-fold) in specific activity NADH-GDH X” 1.8 2.9 0.7 1 .o Cathodal isoenzymes (GDH1-CDH3) + +b +c ++ ++ + Anodal isoenzymes (GDH5-GDH7) + + ++ + + CY:~Subunit (ratio) 1 :4 1 :1 4:l 1 :3 3:l lncrease (-fold) in GDHJ transcript X 2.8 3.3 2.3 1.3 lncrease (-fold) in GDH2 transcript X 5.1 4.6 1 .o 2.9

a x, Control. ++, More abundant. +, Present. ment. On d 24, protein and total RNA extractions were which the abundance of cathodal isoenzymes in a protein conducted on leaf samples from light- and dark-grown extract corresponded to the detection of the a subunit by plants for various analyses (Fig. 7). immunoblot analysis. In addition, there was a strong cor- The specific activity of NADH-GDH in protein extracts relation with the increased expression of GDH2 and the from leaf samples of dark-treated plants was 2.2- to 2.5-fold increase in the specific enzyme activity from dark-treated greater than that from light-grown plants (Table V). Protein samples. The different ratios of the a:p subunits in dark- samples from plants grown in the light contained more compared with light-treated leaves can be partially ex- cathodal than anodal isoenzymes compared with leaf sam- plained by the relative differences in the levels of GDHZ ples from dark-treated plants, which contained more an- and GDH2 transcript. In dark-treated plants, GDHl in- odal isoenzymes. The a:p subunit ratios in leaves from creased only 2- to 3-fold and GDH2 increased approxi- light-grown plants were higher than the corresponding mately 18- to 25-fold, and therefore the ratio of a:p sub- samples from dark-treated plants. The ratios were 4:l and units decreased. 1:4, 1:4 and 1:>20, and 1:4 and 1:lO in samples from light- and dark-treated plants maintained in either soil, 10 mM KNO,, or 10 mM KNO, plus 3% SUC,respectively. The level DlSCUSSlON of GDHl transcript increased 2- to 3-fold in dark-treated plants maintained in either soil or 10 mM KNO, compared Two full-length cDNAs encoding NAD(H)-GDH in A. with similar samples from plants grown in the light. How- thaliana were identified and characterized. Our findings are ever, the level of GDHl transcript remained unchanged consistent with earlier genetic analyses conducted between among light- and dark-treated plants maintained in 10 mM two Arabidopsis ecotypes containing electrophoretic vari- KNO, plus 3% SUCfor 4 d. The level of GDH2 transcript ants of NAD(H)-GDH that suggested that the isoenzymes increased 18- to 25-fold in dark-treated plants maintained were controlled by two nonallelic genes (Cammaerts and in either soil, 10 mM KNO,, or 10 mM KNO, plus 3% SUC, Jacobs, 1983), and with molecular studies by Melo-Oliveira compared with similar samples from plants grown in the et al. (1996) that suggested that there was more than one light. These data suggest that GDHl and GDH2 are not GDH gene. The presence of a small NAD(H)-GDH family always coordinately expressed. Furthermore, these data appears to be common among plants. Genetic (Pryor, 1979; are consistent with earlier observations (Figs. 4 and 5) in Goodman et al., 1980) and molecular (Sakakibara et al.,

Table IV. The effects of different nitrogen treatments on NAD(H)-GDH specific activity, the presence of cathodal and anodal NAD(H)-GDH isoenzymes, and the level of GDHZ transcript in roots of A. thaliana The changes in specific activity and the level of GDH2 transcript are presented as an increase (-fold) in the samples from various nitrogen treatments compared with the control, 1 O mM KNO, treatment. All samples were obtained from 24-d-old plants. See Figure 6 or ”Materials and Methods” for the experimental procedure. The results presented in this table are representative of two separate experiments. The ratio of a and p subunits was not determined because the a subunit was not detected by immunoblot analysis (see Fig. 6). Likewise, the GDHl transcript was not detected by RNA blot analysis. Nitrogen Treatment NAD(H)-GDH KNO, (10 mM; control) NH4CI (10 mM) NH4NO3 (5 mM) GIu (5 mM) Gln (5 mM) lncrease (-fold) in specific activity NADH-GDH xa 0.9 0.6 0.8 1.4 Cathodal isoenzymes (GDH1-GDH3) - b - - - - Anodal isoenzymes (GDH5-CDH7) += + + + ++ lncrease (-fold) in GDHZ transcript X 1 .o 1 .o 0.7 1 .o a x, Control. -, Absent. +, Present. 1338 Turan. al t oe Plant Physiol. Vol. 113, 1997

KNO termini of each gene product, as described by Hartl et al. (1989), and the subcellular location of the NAD(H)-GDH isoenzyme s demonstratewa s fractionatioy db f cellulano r component discontinuoun i s d Percolan e lSu sgradients . All seven NAD(H)-GDH isoenzymes from Arabidopsis were presen intacn i t t mitochondrial preparations- mi e Th . tochondrial locatio e NAD(H)-GDth f o n H isoenzymes i s consistent with the subcellular location reported for most plant NAD(H)-GDH isoenzymes (for review, see Stewart et al., 1980; Srivastav Singhd aan , 1987). The seven NAD(H)-GDH isoenzyme Arabidopsin si e ar s compose subunito tw f do s that combin differenn ei t ratios B a manne n i r simila o thost r f grapo e e (Loulakakid san Roubelakis-Angelakis, 1991 d avocadan ) o (Loulakakit se al., 1994) NAD(H)-GDH isoenzymes; however, the subunit makeup of the anodal and cathodal isoenzymes in Arabi- GDH1— reverse dopsith e f thossar eo f grapeo avocadod ean n I . Arabidopsi slowest-migratine th s g isoenzym nativa n ei e gel, GDH1 homohexamea s i , r compose subunitsa f do d an , D — GDH2 the fastest-migrating isoenzyme, GDH7, is a homohexamer - f * compose subunits3 / f disoenzymeo H GD . througs2 e ar h6 heterohexamers compose f decreasino d o increasint g g numbers of a and /3 subunits, respectively. Conversely, in E 26S grap avocadd an e e slowest-migratinth o g isoenzymen i s native gels, GDH1, are homohexamers composed of /3 sub- e fastest-migratinth units d an , g isoenzymes, GDH7e ar , Figur . Effece7 f darknes treatmento te Su d san NAD(H)-CDn so Hn i homohexamers composed of a subunits. One plausible leave f Arabidopsisso . Plants were maintaine environmentae th dn i l explanatio e differenth r nfo t subunit/isoenzyme arrange- conditions describe dFigurn i . Plante4 s were grow vermiculitn i e and irrigated wit mineraha l nutrient solution (see "Materiald an s ments could be differential processing of the subunits in alteo t molecula e s ra th y sucwa ha r weigh polypepe th f o t - Methods") containine th , . Aftegd d KNO nitrat0 0 M r2 2 m r 0 3)fo e (1

vermiculite-grown plants were treated with KNO eithe0 M 1 m r 30 o r1 tide upon transport intmitochondrie oth varioue th n ai s

mM KNO3 plus 3% Sue for 4 d, and one-half of each set of plants was plant species. Because cDNAs that encode grape and/or maintained in the light and the other half was transferred into the avocado NAD(H)-GDH subunits have not been character- f plant o grow t s se swa soiln e i t ;On one-hal. se d e dar4 th r f kfo o f ized and the gene/subunit assignments have not been was maintaine othee th lighe d r transferre th hals an td n i wa f d inte oth completed, it is not possible to determine why there are dark for 4 d. All protein and RNA extractions were collected on d 24 differences among plant species. analyzed an describes da specifie Figurn i d Th . e4 c activity, seven proteil Inal n extracts subjecte immunobloo dt t analyses, NAD(H)-GDH isoenzymes (A), a and /3 subunits (B), and the CDH1 (C), CDH2 (D), and 26S (E) transcripts are indicated. The results are the samples either contained a 43.0-kD (a subunit) or a representativ separato tw f eo e experiments. 42.5-k subunit3 D(/ ) polypeptide. Occasionally 40.0-ka , D polypeptide was observed, but only in root samples. Sim- ilar results were reporte Loulakakiy db Roubelakisd san - 1995) findings in maize suggest that NAD(H)-GDH isoen- Angelakis (1991 protein )i n extracts from grape. The- yre zyme encodee sar mory db e thagenee non . Furthermore, ported the transient appearance of minor bands (at 30 and e presencth f multipleo e genes encodin r enzymegfo - in s immunoblotn o ) kD 5 3 s that cross-reacted wit antie hth - volved in nitrogen metabolism appears to be a common GDH serum. As explained by Loulakakis and Roubelakis- occurrence in A. thaliana, and small multigene families Angelakis (1991), the minor or transient bands may repre- encoding for GS (Peterman and Goodman, 1991), GOGAT sent breakdown product f NAD(H)-GDso Hr nonspecifio c (Lam et al., 1995a), Asn synthetase (Lam et al., 1995a, polypeptides that cross-reacted wit anti-GDe hth H serum; 1995b), and aspartate aminotransferase (Schultz and alternatively, these polypeptides may be encoded by Coruzzi, 1995; Wilkie et al., 1995) have been reported. Our unique polypeptide. The 40.0-kD peptide in Arabidopsis findings confirm the existence of a small gene family en- a breakdowdoe t appeae b no s o t r n a produc e th f o t coding NAD(H)-GDH. In addition, there is a distinct subunit ,s visibl sincwa t somn i ei e e root samples from NADP(H)-GDH gene in Arabidopsis, which brings the to- 24-d-old plant t havsno tha ed detectabltdi e level GDH1f so l numbeta f membero r e NAD(P)-GDth n si H familt a o yt transcript (Fig. 6). The results from experiments on roots least three (F.J. Turano and S.S. Thakkar, unpublished from 24-d-old plants were contrary to results observed in results). roots of 42-d-old plants (Fig. 4), in which a 40.0-kD peptide The mitochondrial location of the two NAD(H)-GDH was abundant and the GDH1 transcript was detected; gene products in Arabidopsis was suggested by the pres- therefore e cannow , t definitively state thae 40.0-kth t D enc f putativeo e mitochondrial target sequenceN e th t sa peptide was not a breakdown product of the a subunit. In NAD(H)-Glutamate Dehydrogenase Genes in Arabidopsis 1339

Table V. The effect of dark and Suc treatments on NAD(H)-GDH specific activity, the presence of cathodal and anodal NAD(H)-GDH isoen- zymes, the ratio of 01 and p subunits, and the levels of GDHl and GDH2 transcripts in leaves of A. thaliana The changes in specific activity and the levels of GDHl and GDH2 transcripts are presented as an increase (-fold) in samples from plants after treatment in the dark compared with control plants maintained in the light with the corresponding soil or nutrient treatment. All samples were obtained from 24-d-old plants. See Figure 7 or “Materials and Methods” for the experimental procedure. The results presented in this table are representative of two separate experiments. Treatment

NAD(H)-GDH Soil 10 mM KNO, 1 O mM KNO, PlUs 3% SUC Light Dark Light Dark Light Dark lncrease (-fold) in specific activity NADH-GDH Xa 2.2 X 2.5 X 2.4 Cathodal isoenzymes (GDH1-GDH3j +b + + + + + Anodal isoenzymes (GDH5-GDH7) + +/- + +/- + 01:p Subunit (ratioj 4:l 1 :4 1 :4 1 :>20 1 :4 1:lO lncrease (-fold) in GDHl transcript X 3 X 2 X 1 lncrease (-foldj in GDHZ transcript X 18 X 25 X 23

a x. Control. +. Present. -. Absent. addition, the possibility that the 40.0-kD peptide was a that the relative differences in the number of a and p sub- breakdown product of the p subunit cannot be ruled out at units were regulated solely by RNA abundance, but trans- this time. In the future, microsequence amino acid analysis lational modification cannot be ruled out at this point. of the 40.0-kD peptide can be used to determine its identity. Because the GDH2 transcript was readily detected in a11 Our data demonstrate that GDHZ encodes a 43.0-kD tissues tested, it appears that the gene is constitutively polypeptide (the a subunit) and GDH2 encodes a 42.5-kD expressed. These data suggest that GDH2 may play a vital polypeptide (the p subunit). The clearest example of this role in carbon and/ or nitrogen metabolism. Melo-Oliveira genelsubunit assignment are the data from the roots of et al. (1996) also suggested that GDH2 may play a vital plants treated with different nitrogen sources (Fig. 6), in role in plant metabolism, since they were not able to which both GDH2 and the /3 subunit were readily detected, identify an Arabidopsis mutant deficient in the GDH2 and GDHZ and the a subunit were not. Equally convincing product. The expression of GDH2 was inducible, i.e. the data for the gene/ subunit assignments were apparent in level of transcript increased 5- or 25-fold in leaf samples leaf samples from light- versus dark-treated plants (Fig. 7). from plants treated with ammonia or dark treatments, In the light, both a and p subunits were abundant and, respectively. Like GDH2 levels, levels of GDHZ transcript upon longer exposure, GDHZ and GDH2 transcripts were increased with ammonia or dark treatments, but the in- detectable. In the dark, the /3 subunit was abundant and in crease was only 3- and 2-fold, respectively. The two genes most cases the a subunit was undetectable, whereas the were not always coordinately expressed. In the present level of GDHZ transcript increased slightly (approximately study, GDH2 transcript was readily detected in root sam- 2-fold in plants maintained in soil and 10 mM KNO,) ples but the GDHZ transcript was not, although Melo- compared with corresponding samples from light-grown Oliveira et al. (1996) were able to detect a very low level plants. However, similar comparisons of GDH2 show that of GDHZ transcript in 21-d-old roots. Furthermore, the the level of transcript increased nearly 25-fold. These data level of GDHZ transcript increased in leaves treated with demonstrate that the abundance of anodal isoenzymes in a Glu but not in leaves of Gln-treated plants. Conversely, native gel were associated with increased detection of the p the level of GDH2 transcript increased in leaves treated subunit and the detection of GDH2 transcript on immuno- with Gln but not in leaves of Glu-treated plants. However, blots and RNA blots, respectively. the most striking difference between the expression of The changes in the specific activity of NAD(H)-GDH GDHZ and GDH2 was observed in leaf samples of dark- among the different organs and/ or treatments were corre- treated plants maintained on 10 mM KNO, plus 3% SUC lated with levels of GDHZ and/or GDH2 transcript(s). In for 4 d. In these samples GDHZ transcript decreased to a general, as the levels of GDHZ and/or GDH2 transcript(s) level similar to that of the corresponding light-grown increased 5-fold or more, the specific activity in that sample treatment, suggesting that GDHZ was suppressed by car- increased 3- to 5-fold. These data suggest that the specific bon. Similar observations were documented by Melo- NAD(H)-GDH activity is controlled at least in part by either Oliveira et al. (1996). Conversely, the level of GDH2 tran- increased stability of the transcript(s) and /or increased ex- script did not decrease when plants were maintained on pression of the gene(s). In most instances, the changes in 3% Suc in the dark for 4 d. In summary, the data suggest isoenzyme patterns were correlated with relative differences that GDHZ and GDH2 play distinct roles in carbon and in the levels of a and /3 subunits and the relative levels of nitrogen metabolism, since GDHZ and GDH2 are not co- GDHZ and GDH2 transcripts. Since the amount of total RNA ordinately expressed, and in some instances, i.e. in plants loaded per lane, the size of the GDH probes, the amount of maintained on ammonia for 4 d, the two genes are in- probe added to each hybridization reaction, and the hybrid- duced to different levels in samples subjected to the same ization conditions were constant, it is tempting to speculate treatment . 1340 Turano et al. Plant Physiol. Vol. 113, 1997

The presence of a putative EF-hand loop motif in the fold stimulation of soybean NADH-GDH activity in the GDH2 gene product and the absence of one in the GDHZ presence of 250 to 500 nM Ca2+ (F.J. Turano, unpublished gene product suggest that NAD(H)-GDH isoenzymes may results). In addition, a 2-fold increase in NADH-GDH ac- differentially bind Ca2+ and therefore could be differen- tivity by 1000 nM Ca2+ was reported in corn (Yamaya et al., tially stimulated by the ligand. If the Ca2+ site were func- 1984). Based on these findings, it is possible that Ca2+ tional and involved in the stimulation of NAD(H)-GDH in could stimulate the amination reaction and thus play a role Arabidopsis, the GDH7 isoenzyme, which is composed of p in the regulation of Glu catabolism and metabolism in subunits and is encoded by GDH2, would be expected to be plant mitochondria. sensitive to Ca2+ stimulation. Conversely, the GDHl isoen- zyme, which is composed of a subunits and is encoded by ACKNOWLEDCMENTS GDHZ, would be expected to be insensitive to Ca2+ stim- ulation. The authors would like to thank Drs. Benjamin F. Matthews, Dennis A. Schaff, Mark Tucker, and Kenneth G. Wilson for critica1 To our knowledge, there are not yet any experimental review of the manuscript. We appreciate the technical assistance of data on NAD(H)-GDH isoenzymes from Arabidopsis, but Aaliya Khan, a student from Eleanor Roosevelt High School there are data from other plant systems to support this (Greenbelt, MD). hypothesis. The activity of severa1 NAD(H)-GDH isoen- zymes has been shown to be stimulated by divalent cat- Received October 15, 1996; accepted December 24, 1996. ions, and is particularly sensitive to Ca2+ (Chou and Copyright Clearance Center: 0032-0889/97/ 113/ 1329/13. Splittstoesser, 1972; Joy, 1973; Garland and Dennis, 1977; The GenBank accession numbers for the sequences described in Yamaya et al., 1984; Itagaki et al., 1988; Loulakakis and this article are U37771 (GDH1)and U56635 (GDH2). Roubelakis-Angelakis, 1990a; F.J. Turano, unpublished re- sults). In most cases, e.g. pea (Joy, 1973; Garland and LITERATURE ClTED Dennis, 1977), corn (Yamaya et al., 1984), isoenzyme 1 of Beers PF, Sizer IW (1952) A spectrophotometric assay for measur- grape (Loulakakis and Roubelakis-Angelakis, 1990a), and ing the breakdown of hydrogen peroxide by catalase. J Biol GDH3 of soybean (F.J. Turano, unpublished results), Ca2+ Chem 195: 133-140 stimulation was observed only in the direction of the ami- Britton KL, Baker PJ, Rice DW, Stillman TJ (1992) Structural nation reaction. Furthermore, there appears to be an inter- relationship between the hexameric and tetrameric family of glutamate dehydrogenase. Eur J Biochem 209: 851-859 action between the leve1 of Ca2+ stimulation and NADH Bruinsma J (1961) A comment on the spectrophotometric deter- concentration, i.e. maximal Ca2+ stimulation was observed mination of chlorophyll. Biochim Biophys Acta 52: 576-578 with increased (from 50-160 mM) NADH concentrations in Cammaerts D, Jacobs M (1983) A study of the polymorphism and GDH isoenzymes from corn (Yamaya et al., 1984), grape the genetic control of the glutamate dehydrogenase isoenzymes in Arabidopsis thaliana. Plant Sci Lett 31: 65-73 (Loulakakis and Roubelakis-Angelakis, 1990a), and soy- Cammaerts D, Jacobs M (1985) A study of the role of glutamate bean (F.J. Turano, unpublished results). However, Lou- dehydrogenase in nitrogen metabolism of Arabidopsis thaliana. lakakis and Roubelakis-Angelakis (1990a) demonstrated Planta 163: 517-526 that Ca2+ stimulation at low (10 mM) NADH concentra- Chou KH, Splittstoesser WE (1972) Glutamate dehydrogenase from pumpkin cotyledons. Characterizationand isozymes. Plant tions varied among the grape NAD(H)-GDH isoenzymes. Physiol49: 550-554 GDH isoenzyme 1 was stimulated, whereas isoenzyme 7 Edwards JW, Coruzzi GM (1989) Photorespiration and light act in was not, by Ca2+ at low NADH concentrations. In addi- concert to regulate the expression of the nuclear gene for chlo- tion, each of the seven grape NADH-GDH isoenzymes roplast glutamine synthetase. Plant Cell 1: 241-248 were shown have different degrees Ca2+ stimulation Garland W, Dennis DT (1977) Steady-state kinetics of glutamate to of dehydrogenase from Pisum sativa L. mitochondria. Arch Bio- at low NADH concentrations. Similarly, different Ca2+- chem Biophys 182: 614-625 dependent stimulatory effects were observed in corn, in Gavel Y, von Heijne G (1990) Cleavage-site motifs in mitochon- which activity was not stimulated at low NADH concen- drial targeting peptides. Protein Eng 4: 33-37 trations (Yamaya et al., 1984), and in soybean, in which Goodman MM, Stuber CA, Newton K, Weissinger HH (1980) Linkage relationships of 19 loci in maize. Genetics 96 697-710 GDH3 was stimulated at low NADH concentrations (F.J. Haiech J, Sallantin J (1985) Computer search of calcium binding Turano, unpublished results). sites in a gene data bank: use of learning techniques to build an In summary, the results from these studies suggest that expert system. Biochimie 67 555-560 the different stimulatory effects of Ca2+ on NADH-GDH Hartl F, Smith BB, James CC (1989) Structure and function of mitochondrial transit polypeptide sequences. Biochim Biophys isoenzymes are consistent with the existence of two GDH Acta 988: 145 gene products with distinct and different affinities for Hemmings BA (1980) Purification and properties of the phospho Ca”. The in vitro Ca2+ stimulation of NADH-GDH may and dephospho forms of yeast NAD-dependent glutamate de- not be biologically significant, since estimates of Ca2+ con- hydrogenase. J Biol Chem 255: 7925-7932 Hill RA, Bradshaw RA (1969) Fumarase. Methods Enzymol 13: centrations in the matrix of plant mitochondria range from 91-99 60 to 100 nM in pea stem and from 400 to 600 nM in Itagaki T, Dry IB, Wiskich JT (1988)Purification and properties of Jerusalem artichoke tubers (Zottini and Zannoni, 1993), but NAD-glutamate dehydrogenase from turnip mitochondria. Phy- maximal stimulation of plant NADH-GDH isoenzymes by tochemistry 27: 3373-3378 Joy KW (1973) Control of glutamate dehydrogenase from Pisum Ca2+ occurs at 50 to 100 p~ (Yamaya et al., 1984; Itagaki et sativum roots. Phytochemistry 12: 1031-1040 al., 1988; Loulakakis and Roubelakis-Angelakis, 1990a; F. J. Laemmli UK (1970) Cleavage of structural proteins during the Turano, unpublished results). However, there was a 2.3- assembly of the head of bacteriophage T4. Nature 227 680-685 NAD(H)-Glutamate Dehydrogenase Genes in Arabidopsis 1341

Lam H-M, Coschigano K, Schultz C, Melo-Oliveira R, Tjaden G, EE Conn, eds, Plant Nitrogen Metabolism, Vol5. Plenum Press, Oliveira I, Ngai N, Coruzzi GM (1995a) Use of Arabidopsis New York, pp 191-206 mutants and genes to study amide amino acid biosynthesis. Robinson SA, Slade AP, Fox GG, Phillips R, Ratcliffe G, Stewart Plant Cell 7: 887-898 GR (1991) The role of glutamate dehydrogenase in plant nitro- Lam H-M, Peng SS-Y, Coruzzi GM (1995b) Metabolic regulation gen metabolism. Plant Physiol 95: 509-516 of the gene encoding glutamine-dependent asparagine syn- Robinson SA, Stewart GR, Phillips R (1992) Regulation of gluta- thetase in Arabidopsis thaliana. Plant Physiol 106 1347-1357 mate dehydrogenase activity in relation to carbon limitation Lea PJ, Miflin BJ (1974) Alternative route for nitrogen assimilation and protein catabolism in carrot cell cultures. Plant Physiol 98: in higher plants. Nature 251: 614-616 1190-1 195 Lilly KS, Engel PC (1992) The essential active-site lysines of Sakakibara H, Fujii K, Sugiyama T (1995) Isolation and charac- clostridial glutamate dehydrogenase: a study with pyridoxal-5'- terization of a cDNA that encodes maize glutamate dehydroge- phosphate. Eur J Biochem 207: 533-540 nase. Plant Cell Physiol 36: 789-797 Loulakakis KA, Roubelakis-Angelakis KA (1990a) Intracellular Schultz CL, Coruzzi GM (1995) The aspartate aminotransferase localization and properties of NAD(H)-glutamate dehydroge- family of Arabidopsis encodes isoenzymes localized to three nase from Vitis vinifera L.: purification and characterization of distinct subcellular compartments. Plant J 7: 61-75 the major leaf isoenzyme. J Exp Bot 41: 1223-1230 Srivastava HS, Singh RP (1987) The role and regulation of Loulakakis KA, Roubelakis-Angelakis KA (1990b) Immunochar- L-glutamate dehydrogenase activity in higher plants. Phyto- acterization of NADH-glutamate dehydrogenase from Vitis chemistry 26: 597-610 vinifera L. Plant Physiol 94: 109-113 Stewart GR, Mann AF, Fentem PA (1980) Enzymes of glutamate Loulakakis KA, Roubelakis-Angelakis KA (1991) Plant NAD(H)- formation: glutamate dehydrogenase, glutamine synthetase and glutamate dehydrogenase consists of two subunit polypeptides glutamate synthase. In BJ Miflin, ed, The Biochemistry of Plants, and their participation in the seven isoenzymes occurs in an Vol 5. Academic Press, New York, pp 271-327 ordered ratio. Plant Physiol 97: 104-111 Syntichaki KM, Loulakakis KA, Roubelakis-Angelakis KA Loulakakis KA, Roubelakis-Angelakis KA (1996) The seven (1996) The amino-acid sequence similarity of plant glutamate NAD(H)-glutamate dehydrogenase isoenzymes exhibit similar dehydrogenase to the extremophilic archaeal enzyme conforms anabolic and catabolic activities. Physiol Plant 96: 29-35 to its stress-related function. Gene 168: 87-92 Loulakakis KA, Roubelakis-Angelakis KA, Kanellis KA (1994) Turano Dashner Upadhyaya A, Caldwell CR (1996) Puri- Regulation of glutamate dehydrogenase and glutamine syn- FJ, R, thetase in avocado fruit during development and ripening. Plant fication of mitochondrial glutamate dehydrogenase from dark- Physiol 106: 217-222 grown soybean seedlings. Plant Physiol 112: 1357-1364 Maestri E, Restivo FM, Gulli M, Tassi F (1991) Glutamate dehy- Turano FJ, Jordan RL, Matthews BF (1990) Immunological char- drogenase regulation in callus cultures of Nicotiana plumbagini- acterization of in vitro forms of homoserine dehydrogenase from folia: effect of glucose feeding and carbon starvation on the carrot suspension cultures. Plant Physiol92 395400 isoenzymatic pattern. Plant Cell Environ 14613-618 Turano FJ, Weisemann JM, Matthews BF (1992) Identification and Ma alhaes JR, Ju GC, Rich PJ, Rhodes D (1990) Kinetics of a expression of a cDNA clone encoding aspartate aminotransfer- PNH4+ assimilation in Zea mays. Preliminary studies with glu- ase in carrot. Plant Physiol 100: 374-381 tamate dehydrogenase (GDH1) nu11 mutant. Plant Physiol 94 von Heijne G (1992) Cleavage-site motifs in protein targeting 647-656 sequences. Genet Eng 14: 1-11 Melo-Oliveira R, Oliveira IC, Coruzzi GM (1996) Arabidopsis Wallsgrove RM, Turner JC, Hall NP, Kendally AC, Bright SWJ mutant analysis and regulation define a nonredundant role for (1987) Barley mutants lacking chloroplast glutamine synthetase. glutamate dehydrogenase in nitrogen assimilation. Proc Natl Biochemical and genetic analysis. Plant Physiol 83: 155-158 Acad Sci USA 93: 4718-4723 Wilkie SE, Roper JM, Smith AG, Warren MJ (1995) Isolation, Miflin BJ, Lea PJ (1980) Ammonia assimilation. In BJ Miflin, ed, characterization and expression of a cDNA encoding plastid The Biochemistry of Plants, Vol 5. Academic Press, New York, aspartate aminotransferase from Arabidopsis thaliana. Plant Mo1 pp 169-202 Biol 27: 1227-1233 Newman T, de Bruijn FJ, Green P, Keegstra K, Kende H, McIntosh Yamaya T, Oaks A, Matsumoto H (1984) Characterization of L, Ohlrogge J, Raikhel N, Somerville S, Thomashow M, Reze1 E, glutamate dehydrogenase in mitochondria prepared from corn Somerville C (1994) Genes galore. A summary of the methods for shoots. Plant Physiol 76: 1009-1013 accessing results from large-xale partia1 sequencing of anony- Yamaya T, Oaks A, Rhodes D, Matsumoto H (1986) Synthesis mous Arabidopsis cDNA clones. Plant PhysiollO6 1241-1255 of ["Nlglutamate from [15N]H, and [15N]glycineby mitochon- Peterman TK, Goodman HM (1991) The glutamine synthetase gene dria isolated from pea and corn shoots. Plant Physiol 81: family of Arabidopsis thaliana: light-regulation and differential ex- 754-757 pression in leaves, roots and seeds. Mo1 Gen Genet 230: 145-154 Young RA, Davis RW (1983) Efficient isolation of genes by using Pryor AJ (1979) Mapping of glutamate dehydrogenase (Gdh) on antibody probes. Proc Natl Acad Sci USA 80 1194-1198 chromosome 1,ZO.l recombination units dista1 to Adhl. Maize Zottini M, Zannoni D (1993) The use of fura-2 fluorescence to Genet Coop News Lett 53: 25-26 monitor the movement of free calcium ions into the matrix of Rhodes D, Brunk DG, Magalhaes JR (1989) Assimilation of am- plant mitochondria (Pisum sativum and Helianthus tuberosus). monia by glutamate dehydrogenase? In JE Poulton, JT Romeo, Plant Physiol 102: 573-578