Mismatch-Specific Thymine DNA Glycosylase and DNA Polymerase

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Natl. Acad. Sci. USA Vol. 87, pp. 5842-5845, August 1990 Biochemistry Mismatch-specific thymine DNA glycosylase and DNA polymerase P8 mediate the correction of GOT mispairs in nuclear extracts from human cells (DNA repair enzymes/cell-free extracts/cytosine deamlnation/5-methylcytosine) KARIN WIEBAUER* AND JOSEF JIRICNY* Friedrich Miescher Institute, P.O. Box 2543, CH-4002 Basel, Switzerland Communicated by Walter J. Gehring, May 21, 1990 ABSTRACT To avoid the mutagenic effect of spontaneous enzyme responsible for its removal from G-T mispairs would hydrolytic deamination of 5-methylcytosine, G-T inspirs, have to be, unlike the uracil and hypoxanthine glycosylases, arising in DNA as a result of this process, should always be fully inactive on single-stranded and matched double- corrected to G-C pairs. We describe here the identification of stranded substrates. It therefore seemed likely that a thymine a DNA glycosylase activity present in nuclear extracts from DNA glycosylase would have to act in conjunction with HeLa cells, which removes the mispaired thymine to generate another enzyme. We postulated two possible scenarios. In an apyrimidinic (AP) site opposite the guanine. We further the first, the glycosylase would be guided to the mispair by show, using a specific antibody and inhibitors, that the single a G-T mismatch binding protein, analogous to the MutS nucleotide gap, created upon processing of the AP site, is filled protein of E. coli (11). In the absence of this protein on the in by DNA polymerase (3. This rmding substantiates the DNA, the glycosylase would be inactive. In the second, a GOT proposed role of this enzyme in short-patch DNA repair. mismatch modifying enzyme would convert the mispaired T to a thymine derivative such as thymine glycol or hydroxy- Efficient correction of base-base mismatches, arising as er- methyluracil, which would then be removed by their respec- rors of DNA polymerase or through recombination, requires tive DNA glycosylase (12, 13). To provide experimental that the cellular machinery be able to direct the repair to the evidence supporting either of these two pathways, we de- strand carrying the original information. For this purpose, cided to analyze the in vitro G-T repair reaction in greater secondary signals such as adenine methylation or strand detail. nicks are used (for a comprehensive review, see ref. 1). The Our previous results have also shown that the processing GOT mispair is the only one that can arise also by an ofthe apyrimidinic (AP) site, arising in the DNA following the alternative pathway in "resting" (i.e., nonreplicating, non- removal ofthe mispaired thymine, leads to the appearance of recombining) DNA-through the spontaneous hydrolytic a single nucleotide gap opposite the guanine (10). We were deamination of 5-methylcytosine. In the correction of this interested in finding out which DNA polymerase is involved latter type of G-T mismatch, no strand discrimination is in the gap-filling reaction, as this information could provide required, as it should always be corrected to a G-C. Indeed, us with further insights into the mechanism of repair of this repair pathways thought to be dedicated to the correction of unique type of deamination damage, the G-T mismatch. the deamination-associated GOT mispairs have been identified in Escherichia coli (2-4) as well as in mammalian cells (5, 6). In all organisms studied to date, correction ofdeamination MATERIALS AND METHODS damage is mediated by base-specific glycosylases, which Synthesis of the Tritiated G-T Duplex. The 90-mer oligonu- remove the deaminated base from the sugar-phosphate back- cleotide A (15 pmol) and the 5'-phosphorylated 49-mer primer bone by cleaving the glycosylic bond. Uracdil DNA glycosyl- (10 pmol) (see Fig. 2) in 100 1.L of Sequenase buffer (40 mM ase and hypoxanthine DNA glycosylase remove the products Tris-HCI, pH 7.5/10 mM MgCl2/50 mM NaCl) were heated of cytosine and adenine deamination, uracil (U) and hypo- for 7 min at 800C and then allowed to stand at room temper- xanthine (H), respectively (for review, see refs. 7 and 8). ature for 10 min. To 50 jl ofthe annealed mixture was added Both enzymes are highly substrate specific and can remove 5 1ul of0.1 M dithiothreitol, 30 pmol of [methyl-3H]thymidine their respective substrates from matched (A-U and C-H) as 5'-triphosphate (43 Ci/mmol, 1 mCi/ml; 1 Ci = 37 GBq; well as mismatched (G-U and T.H) duplexes. As neither U Amersham) and the total volume was adjusted to 74 1Ld with nor H is a natural DNA base, their excision can be mediated water. One microliter of Sequenase (13 units/,ul; United by the base-specific enzymes from both double- and single- States Biochemical) was added and the mixture was left for stranded DNA. 5 min at room temperature; 7.5 Al of dNTPs (2.5 mM each) In our previous studies, we reported that G-T mispairs, was then added and the reaction was allowed to proceed for incorporated in the simian virus 40 genome and transfected a further 5 min at 370C. The mixture was extracted with an into monkey CV-1 (5, 6) or human (9) cells, were corrected equal volume of phenol/chloroform and the oligonucleotide with high efficiency and mostly to G-C pairs. Our in vitro was recovered by ethanol precipitation. The dried pellet was experiments (10) demonstrated that in nuclear extracts from suspended in 4.5 jul of formamide loading dye, heated for 3 human (HeLa) cells, the mispaired thymidine was excised min at 950C, and applied on an 8% denaturing polyacrylamide from DNA to generate a single nucleotide gap. Preliminary gel. A duplicate experiment was carried out with a 5' 32p- evidence also suggested that the initial step of this repair labeled 49-mer (see Fig. 2), and this product mixture was process was mediated by a DNA glycosylase. This was an loaded in an adjacent lane as a radioactive marker. The band unexpected finding. Thymine is a natural DNA base and any migrating with the same Rf as the 32P-labeled control was cut The publication costs of this article were defrayed in part by page charge Abbreviation: AP, apyrimidinic. payment. This article must therefore be hereby marked "advertisement" *Present address: IRBM, via Pontina km 30,600, 00040 Pomezia, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Rome, Italy. 5842- Downloaded by guest on September 24, 2021 Biochemistry: Wiebauer and Jiricny Proc. NatL. Acad. Sci. USA 87 (1990) 5843 Sail Accl EcoRI Hinc Hind III 5. VW a.. ACGT TGTAAAACGACGGCCAGTGAAT TCCCGGGGATCCGTC R ACCTGCAGCCAAGCT TGGCGTAATCATGGTCATAGCTGT T TCCTGTGT TGCAACAT TT TGCTGCCGGTCACT TAAGGGCCCCTAGGCAG YTGGACGTCGGTTCGAACCGCAT TAGTACCAGTATCGACAAAGGACACA S. A" S. FIG. 1. Sequence of the synthetic 90-mer substrate. R, A or G; Y, C or T. Cleavage of the duplex G C, labeled at the 5' end of the C strand, with Sal I (v), Acc I (v), and HincII (v) produced the indicated marker bands. out and the tritiated 90-mer T was eluted into 300/A of0.5 M or whether it first modifies it to, for example, thymine glycol ammonium acetate/5 mM EDTA in the presence of 15 fig of or hydroxymethyl thymine, both ofwhich would be substrates tRNA by shaking at room temperature overnight. The oligo- for already characterized glycosylases (12, 13). For this pur- nucleotide was recovered by ethanol precipitation and sus- pose we synthesized a G-T 90-mer duplex (see Materials and pended in sterile water to a concentration of 0.05 pmol/4l. Methods), in which the mispaired thymine residue was labeled Tritiated 90-mer T (1 pmol) was annealed with 12 pmol of to a high specific activity with 3H (Fig. 2). This duplex was then either 90-mer A or 90-mer G in 30 Al of 10 mM Tris HCl/10 incubated with the HeLa nuclear extract. After a suitable mM MgCl2 by immersion in boiling water for 5 min and slow period oftime, an aliquot ofthe reaction mixture was analyzed cooling to room temperature to give duplexes APT and GOT, by TLC. As shown in Fig. 3a, the markers thymine (T), respectively, where the mispaired thymine is tritiated to high 2'-deoxythymidine (dT), and the oligonucleotides are well specific activity. EDTA was added to 10 mM to chelate the resolved in this eluent system. Furthermore, the most prob- free magnesium. able metabolites, thymine glycol and hydroxymethyl thymine, Glycosylase Activity Assay. The A-T or G-T duplexes (0.25 migrate with Rf values lower than that of thymine (data not pmol) were incubated with the HeLa nuclear extract (2 Al; 8 shown). Fig. 3b shows that incubation ofthe perfectly matched mg/ml) in binding buffer (25 mM Hepes-KOH, pH 7.9/0.5 duplex APT with the nuclear cell extracts failed to liberate any mM EDTA/0.01 mM ZnCl2/0.5 mM dithiothreitol) in a total free radioactivity from this oligonucleotide substrate. In con- volume of 20 /l for 15 hr at 30'C. Five microliters each of a trast, of the total saturated aqueous solution of thymine and thymidine was z17% radioactivity present in the starting added to the reaction mixture, and 5 Al was spotted on a silica G'T duplex was found to comigrate with the thymine marker gel TLC plate (4 x 8 cm; Polygram Sil G/UV254, Macherey (see also Fig. 3c). We thus conclude that the first step of the & Nagel) and eluted with chloroform/ethanol (8.5:1.5, vol/ repair reaction is mediated by an as yet uncharacterized DNA vol). The dried plate was photographed under UV (254 nm), thymine glycosylase.
Recommended publications
  • Dna Repair Mechanisms

    Dna Repair Mechanisms

    DNA REPAIR MECHANISMS: A. P. NAGRALE DNA REPAIR •One of the main objectives of biological system is to maintain base sequences of DNA from one generation to the other. •DNA is relatively fragile, easily damaged molecule. •The DNA of a cell is subjected to damage from a variety of environmental factors like radiations (X-rays, UV-rays), chemicals mutagens, physical factors etc. •The survival of the cell depends on its ability to repair this damage. •DNA damage is of two types – Monoadduct and Diadduct. Monoadduct damage involves alterations in a single nitrogen base for example deamination reactions of chemical mutagen like HNO2. Diadduct damage are alterations involving more than one nitrogen base, for example Pyrimidine - Pyrimidine dimer produced by UV- radiations. •There are three principal types of repair mechanisms. •Light Repair (Enzymatic Photoreacivation) •Ultraviolet light causes the damage in DNA of bacteria and phages. UV-radiations (254 nm wavelength) cause the formation of covalent bond between adjacent pyrimidines to form dimer on the same strand of DNA (intrastrand bonding). •The UV- light forms abnormal structure Thymine dimmer (T=T) in DNA. As a result, DNA replication cannot proceed and gene expression is also prevented. •Damage to DNA caused by UV- light can be repaired after exposing the cells to visible light called photoreactivation or light repair. •This photoreactivation requires a specific enzyme that binds to the defective site on the DNA. •In this mechanism an enzyme DNA photolyase cleaves T=T dimmer and reverse to monomeric stage. •This enzyme is activated only when exposed to visible light. This enzyme absorbs the light energy, binds of cyclobutane ring to defective site of DNA and absorbed energy promotes the cleavage of covalent bond between two thymine molecules.
  • Structure and Function of Nucleases in DNA Repair: Shape, Grip and Blade of the DNA Scissors

    Structure and Function of Nucleases in DNA Repair: Shape, Grip and Blade of the DNA Scissors

    Oncogene (2002) 21, 9022 – 9032 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc Structure and function of nucleases in DNA repair: shape, grip and blade of the DNA scissors Tatsuya Nishino1 and Kosuke Morikawa*,1 1Department of Structural Biology, Biomolecular Engineering Research Institute (BERI), 6-2-3 Furuedai, Suita, Osaka 565-0874, Japan DNA nucleases catalyze the cleavage of phosphodiester mismatched nucleotides. They also recognize the bonds. These enzymes play crucial roles in various DNA replication or recombination intermediates to facilitate repair processes, which involve DNA replication, base the following reaction steps through the cleavage of excision repair, nucleotide excision repair, mismatch DNA strands (Table 1). repair, and double strand break repair. In recent years, Nucleases can be regarded as molecular scissors, new nucleases involved in various DNA repair processes which cleave phosphodiester bonds between the sugars have been reported, including the Mus81 : Mms4 (Eme1) and the phosphate moieties of DNA. They contain complex, which functions during the meiotic phase and conserved minimal motifs, which usually consist of the Artemis : DNA-PK complex, which processes a V(D)J acidic and basic residues forming the active site. recombination intermediate. Defects of these nucleases These active site residues coordinate catalytically cause genetic instability or severe immunodeficiency. essential divalent cations, such as magnesium, Thus, structural biology on various nuclease actions is calcium, manganese or zinc, as a cofactor. However, essential for the elucidation of the molecular mechanism the requirements for actual cleavage, such as the types of complex DNA repair machinery. Three-dimensional and the numbers of metals, are very complicated, but structural information of nucleases is also rapidly are not common among the nucleases.
  • Review DNA Repair Nucleases

    Review DNA Repair Nucleases

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by RERO DOC Digital Library CMLS, Cell. Mol. Life Sci. 61 (2004) 336–354 1420-682X/04/030336-19 DOI 10.1007/s00018-003-3223-4 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review DNA repair nucleases T. M. Martia and O. Fleck b, * Institute of Cell Biology, University of Bern, Baltzerstrasse 4, 3012 Bern (Switzerland), Fax: +41 31 631 4684, e-mail: [email protected] a Present address: UCSF Comprehensive Cancer Center, University of California, 2340 Sutter Street, Box 0808, San Francisco, California 94143 (USA) b Present address: Department of Genetics, Institute of Molecular Biology, University of Copenhagen, Øster Farimagsgade 2A, 1353 Copenhagen K (Denmark), Fax: +45 35 32 2113, e-mail: [email protected] Received 12 June 2003; received after revision 29 July 2003; accepted 16 September 2003 Abstract. Stability of DNA largely depends on accuracy of DNA. Flap endonucleases cleave DNA flap structures of repair mechanisms, which remove structural anomalies at or near the junction between single-stranded and dou- induced by exogenous and endogenous agents or intro- ble-stranded regions. DNA nucleases play a crucial role in duced by DNA metabolism, such as replication. Most re- mismatch repair, nucleotide excision repair, base excision pair mechanisms include nucleolytic processing of DNA, repair and double-strand break repair. In addition, nucle- where nucleases cleave a phosphodiester bond between a olytic repair functions are required during replication to deoxyribose and a phosphate residue, thereby producing remove misincorporated nucleotides, Okazaki fragments 5′-terminal phosphate and 3′-terminal hydroxyl groups.
  • Identifying Functional Roles for Alkb in the Adaptive

    Identifying Functional Roles for Alkb in the Adaptive

    IDENTIFYING FUNCTIONAL ROLES FOR ALKB IN THE ADAPTIVE RESPONSE OF ESCHERICHIA COLI TO ALKYLATION DAMAGE SUNEET DINGLAY A thesis submitted for Ph.D.; 2000 Imperial Cancer Research Fund, Clare Hall Laboratories, Blanche Lane, South Mimms, Herts, EN6 3LD & University College London, Gower Street, London, WC1E 6BT ProQuest Number: 10608883 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 10608883 Published by ProQuest LLC(2017). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States C ode Microform Edition © ProQuest LLC. ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106- 1346 In loving memory of my Papa ji. ABSTRACT In 1977 a novel, inducible and error free DNA repair system in Escherichia coli came to light. It protected E. coli against the mutagenic and cytotoxic effects of alkylating agents such as N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) and methyl methanesulfonate (MMS), and was termed the ‘adaptive response of E. coli to alkylation damage’. This response consists of four inducible genes; ada, aidB, alkA and alkB. The ada gene product encodes an 06-methylguanine- DNA methyltransferase, and is also the positive regulator of the response. The alkA gene product encodes a 3-methyladenine- DNA glycosylase, and aidB shows homology to several mammalian acyl coenzyme A dehydrogenases.
  • Homing Endonucleases: from Microbial Genetic Invaders to Reagents for Targeted DNA Modification

    Homing Endonucleases: from Microbial Genetic Invaders to Reagents for Targeted DNA Modification

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Structure Review Homing Endonucleases: From Microbial Genetic Invaders to Reagents for Targeted DNA Modification Barry L. Stoddard1,* 1Division of Basic Sciences, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N., A3-025, Seattle, WA 98109, USA *Correspondence: [email protected] DOI 10.1016/j.str.2010.12.003 Homing endonucleases are microbial DNA-cleaving enzymes that mobilize their own reading frames by generating double strand breaks at specific genomic invasion sites. These proteins display an economy of size, and yet recognize long DNA sequences (typically 20 to 30 base pairs). They exhibit a wide range of fidelity at individual nucleotide positions in a manner that is strongly influenced by host constraints on the coding sequence of the targeted gene. The activity of these proteins leads to site-specific recombination events that can result in the insertion, deletion, mutation, or correction of DNA sequences. Over the past fifteen years, the crystal structures of representatives from several homing endonuclease families have been solved, and methods have been described to create variants of these enzymes that cleave novel DNA targets. Engineered homing endonucleases proteins are now being used to generate targeted genomic modifications for a variety of biotech and medical applications. Endonuclease enzymes are ubiquitous catalysts that are A series of studies conducted in several laboratories over the involved in genomic modification, rearrangement, protection, ensuing years led to the discovery of homing endonucleases and and repair. Their specificity spans at least nine orders of magni- mobile introns and inteins within a wide variety of additional tude, ranging from nonspecific degradative enzymes up to microbial genomes (reviewed in Belfort and Perlman, 1995).
  • Sequence Homology and Expression Profile of Genes Associated with DNA Repair Pathways in Mycobacterium Leprae

    Sequence Homology and Expression Profile of Genes Associated with DNA Repair Pathways in Mycobacterium Leprae

    [Downloaded free from http://www.ijmyco.org on Wednesday, February 6, 2019, IP: 131.111.5.19] Original Article Sequence Homology and Expression Profile of Genes Associated with DNA Repair Pathways in Mycobacterium leprae Mukul Sharma1, Sundeep Chaitanya Vedithi2,3, Madhusmita Das3, Anindya Roy1, Mannam Ebenezer3 1Department of Biotechnology, Indian Institute of Technology, Hyderabad, Telangana, 2Schieffelin Institute of Health Research and Leprosy Center, Vellore, Tamil Nadu, India, 3Department of Biochemistry, University of Cambridge, Cambridge CB2 1GA, UK Abstract Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: The genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M.
  • Molecular Responses of Giardia Lamblia to Gamma-Irradiation

    Molecular Responses of Giardia Lamblia to Gamma-Irradiation

    MOLECULAR RESPONSES OF GIARDIA LAMBLIA TO GAMMA-IRRADIATION Except where reference is made to the work of others, the work described in this dissertation is my own or was done in collaboration with my advisory committee. This dissertation does not include proprietary or classified information. ____________________________________ Scott Lenaghan Certificate of Approval: ____________________________ ____________________________ R. Curtis Bird Christine A. Sundermann, Chair Professor Professor Pathobiology Biological Sciences ____________________________ ____________________________ Nannan Liu James T. Bradley Associate Professor Mosley Professor Entomology Biological Sciences ____________________________ ____________________________ Michael E. Miller Christine C. Dykstra Research Fellow IV Associate Professor AU Research and Instrumentation Pathobiology Facility ___________________________ Joe F. Pittman Interim Dean Graduate School MOLECULAR RESPONSES OF GIARDIA LAMBLIA TO GAMMA-IRRADIATION Scott Lenaghan A Dissertation Submitted to the Graduate Faculty of the Auburn University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 9, 2008 MOLECULAR RESPONSES OF GIARDIA LAMBLIA TO GAMMA-IRRADIATION Scott Lenaghan Permission is granted to Auburn University to make copies of this dissertation at its discretion, upon request of individuals or institutions and at their expense. The author reserves all publication rights. _____________________________ Signature of Author _____________________________
  • Mismatch Repair Protein Mutl Becomes Limiting During Stationary-Phase Mutation

    Mismatch Repair Protein Mutl Becomes Limiting During Stationary-Phase Mutation

    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Mismatch repair protein MutL becomes limiting during stationary-phase mutation Reuben S. Harris,1 Gang Feng,2 Kimberly J. Ross,1 Roger Sidhu, Carl Thulin, Simonne Longerich, Susan K. Szigety, Malcolm E. Winkler,2 and Susan M. Rosenberg1,3 Department of Biochemistry, University of Alberta Faculty of Medicine, Edmonton, Alberta T6G 2H7 Canada; 2Department of Microbiology and Molecular Genetics, University of Texas Houston Medical School, Houston, Texas 77030-1501 USA Postsynthesis mismatch repair is an important contributor to mutation avoidance and genomic stability in bacteria, yeast, and humans. Regulation of its activity would allow organisms to regulate their ability to evolve. That mismatch repair might be down-regulated in stationary-phase Escherichia coli was suggested by the sequence spectrum of some stationary-phase (‘‘adaptive’’) mutations and by the observations that MutS and MutH levels decline during stationary phase. We report that overproduction of MutL inhibits mutation in stationary phase but not during growth. MutS overproduction has no such effect, and MutL overproduction does not prevent stationary-phase decline of either MutS or MutH. These results imply that MutS and MutH decline to levels appropriate for the decreased DNA synthesis in stationary phase, whereas functional MutL is limiting for mismatch repair specifically during stationary phase. Modulation of mutation rate and genetic stability in response to environmental or developmental cues, such as stationary phase and stress, could be important in evolution, development, microbial pathogenicity, and the origins of cancer. [Key Words: Mismatch repair; MutL; mutation; adaptive mutation; genetic instability; evolution; stationary phase] Received April 4, 1997; revised version accepted July 18, 1997.
  • The Thymine Glycosylase MBD4 Can Bind to the Product of Deamination at Methylated Cpg Sites DNA-Bound Structures and Mutants

    The Thymine Glycosylase MBD4 Can Bind to the Product of Deamination at Methylated Cpg Sites DNA-Bound Structures and Mutants

    letters to nature 13. Fuentes-Prior, P. et al. Structure of the thrombin complex with triabin, a lipocalin-like exosite-binding inhibits activation by the thrombomodulin-thrombin complex without affecting activation by free inhibitor derived from a triatomine bug. Proc. Natl Acad. Sci. USA 94, 11845±11850 (1997). thrombin. J. Biol. Chem. 271, 22285±22288 (1996). 14. Zushi, M. et al. Aspartic acid 349 in the fourth epidermal growth factor-like structure of human 28. Vincenot, A., Gaussem, P., Pittet, J. L., Debost, S. & Aiach, M. Amino acids 225-235** of the protein C thrombomodulin plays a role in its Ca2+-mediated binding to protein C. J. Biol. Chem. 266, 19886± serine-protease domain are important for the interaction with the thrombin-thrombomodulin 19889 (1991). complex. FEBS Lett. 367, 153±157 (1995). 15. Campbell, I. D. & Bork, P. Epidermal growth factor-like modules. Curr. Opin. Struct. Biol. 3, 385±392 29. Parry, M. A. et al. The ternary microplasmin-staphylokinase-microplasmin complex is a proteinase- (1993). cofactor-substrate complex in action. Nature Struct. Biol. 5, 917±923 (1998). 16. Downing, A. K. et al. Solution structure of a pair of calcium-binding epidermal growth factor-like 30. Leslie, A. in Crystal. Computing V (eds Moras, D., Podjarny, A. D. & Thierry, J. C.) 27±38 (Oxford domains: implications for the Marfan syndrome and other genetic disorders. Cell 85, 597±605 Univ. Press, Oxford, 1991). (1996). 31. Collaborative Computational Project No. 4. The CCP4 suite: programs for protein crystallography. 17. Knobe, K. E. et al. Probing the activation of protein C by the thrombin-thrombomodulin complex Acta Crystallogr.
  • Influence of Very Short Patch Mismatch Repair on SOS Inducing Lesions After Aminoglycoside Treatment in Escherichia Coli

    Influence of Very Short Patch Mismatch Repair on SOS Inducing Lesions After Aminoglycoside Treatment in Escherichia Coli

    Influence of very short patch mismatch repair onSOS inducing lesions after aminoglycoside treatment in Escherichia coli. Zeynep Baharoglu, Didier Mazel To cite this version: Zeynep Baharoglu, Didier Mazel. Influence of very short patch mismatch repair on SOS inducing lesions after aminoglycoside treatment in Escherichia coli.. Research in Microbiology, Elsevier, 2014, 165 (6), pp.476-80. 10.1016/j.resmic.2014.05.039. pasteur-01423361 HAL Id: pasteur-01423361 https://hal-pasteur.archives-ouvertes.fr/pasteur-01423361 Submitted on 2 Feb 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License 1 1 Influence of very short patch mismatch repair on SOS inducing lesions after 2 aminoglycoside treatment in Escherichia coli. 3 Zeynep Baharoglu1,2,*, Didier Mazel1,2, 4 1. Institut Pasteur, Unité Plasticité du Génome Bactérien, Département Génomes et Génétique, 25 rue 5 du docteur Roux 75015 Paris, France 6 2. CNRS, UMR3525, Paris, France 7 * To whom correspondence should be addressed. Zeynep Baharoglu Tel: +33 144389483; Fax: +33 145688834; 8 E-mail: [email protected] 9 2 10 Abstract (100 words max). 11 Low concentrations of aminoglycosides induce the SOS response in Vibrio cholerae 12 but not in Escherichia coli.
  • ABSTRACT QIU, RUOYI. Dynamics of DNA Mismatch Repair Initiation Complexes Revealed by Single Molecule Fluorescence

    ABSTRACT QIU, RUOYI. Dynamics of DNA Mismatch Repair Initiation Complexes Revealed by Single Molecule Fluorescence

    ABSTRACT QIU, RUOYI. Dynamics of DNA Mismatch Repair Initiation Complexes Revealed by Single Molecule Fluorescence. (Under the direction of Dr. Keith Weninger). Structural information about proteins and DNA can reveal the mechanism of their related biological functions. In this thesis, we examine conformational changes in the protein-DNA complexes that are essential in the early stage of DNA mismatch repair (MMR). These complexes, involving dimeric proteins MutS and MutL, are responsible for correcting DNA mismatched pairs that arise from polymerase misincorporation during DNA replication. Biochemical and X-ray crystallography studies of MMR proteins and protein-DNA complexes have formed a foundation for our understanding of repair initiation and signaling, but the exact mechanisms are still unclear due to the lack of a detailed, time-resolved picture. Here we use single molecule fluorescence spectroscopy and single molecule fluorescence resonance energy transfer (smFRET) to characterize the conformational dynamics of Thermus aquaticus (Taq) MutS during DNA scanning, mismatch recognition and sliding clamp formation. We find that the DNA binding domains of MutS dynamically interconvert among multiple conformations when protein is free and when it scans homoduplex DNA. Mismatch binding stabilizes MutS conformation to a single state. MutS transitions from mismatch recognition state to sliding clamp via two sequential conformational changes that are reported from smFRET involving the DNA binding domains: First a small change in smFRET while the protein remains at the mismatch site; and second larger smFRET changes accompanied with MutS commencing to slide on the DNA. In this thesis, we also examine the role of MutL in mismatch repair signaling. We find that MutL interacts with MutS at the mismatch site and inhibits MutS from sliding away.
  • On the Pathways to Fixing Dna Damage and Errors

    On the Pathways to Fixing Dna Damage and Errors

    DNA REPAIR − ON THE PATHWAYS TO FIXING DNA DAMAGE AND ERRORS Edited by Francesca Storici DNA Repair − On the Pathways to Fixing DNA Damage and Errors Edited by Francesca Storici Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright © 2011 InTech All chapters are Open Access articles distributed under the Creative Commons Non Commercial Share Alike Attribution 3.0 license, which permits to copy, distribute, transmit, and adapt the work in any medium, so long as the original work is properly cited. After this work has been published by InTech, authors have the right to republish it, in whole or part, in any publication of which they are the author, and to make other personal use of the work. Any republication, referencing or personal use of the work must explicitly identify the original source. Statements and opinions expressed in the chapters are these of the individual contributors and not necessarily those of the editors or publisher. No responsibility is accepted for the accuracy of information contained in the published articles. The publisher assumes no responsibility for any damage or injury to persons or property arising out of the use of any materials, instructions, methods or ideas contained in the book. Publishing Process Manager Alenka Urbancic Technical Editor Teodora Smiljanic Cover Designer Jan Hyrat Image Copyright suravid, 2011. Used under license from Shutterstock.com First published August, 2011 Printed in Croatia A free online edition of this book is available at www.intechopen.com Additional hard copies can be obtained from [email protected] DNA Repair − On the Pathways to Fixing DNA Damage and Errors, Edited by Francesca Storici p.