Proc. Natl. Acad. Sci. USA Vol. 87, pp. 5842-5845, August 1990 Biochemistry Mismatch-specific thymine DNA glycosylase and DNA polymerase P8 mediate the correction of GOT mispairs in nuclear extracts from human cells (DNA repair enzymes/cell-free extracts/cytosine deamlnation/5-methylcytosine) KARIN WIEBAUER* AND JOSEF JIRICNY* Friedrich Miescher Institute, P.O. Box 2543, CH-4002 Basel, Switzerland Communicated by Walter J. Gehring, May 21, 1990

ABSTRACT To avoid the mutagenic effect of spontaneous enzyme responsible for its removal from G-T mispairs would hydrolytic deamination of 5-methylcytosine, G-T inspirs, have to be, unlike the uracil and hypoxanthine glycosylases, arising in DNA as a result of this process, should always be fully inactive on single-stranded and matched double- corrected to G-C pairs. We describe here the identification of stranded substrates. It therefore seemed likely that a thymine a DNA glycosylase activity present in nuclear extracts from DNA glycosylase would have to act in conjunction with HeLa cells, which removes the mispaired thymine to generate another enzyme. We postulated two possible scenarios. In an apyrimidinic (AP) site opposite the guanine. We further the first, the glycosylase would be guided to the mispair by show, using a specific antibody and inhibitors, that the single a G-T mismatch binding protein, analogous to the MutS nucleotide gap, created upon processing of the AP site, is filled protein of E. coli (11). In the absence of this protein on the in by DNA polymerase (3. This rmding substantiates the DNA, the glycosylase would be inactive. In the second, a GOT proposed role of this enzyme in short-patch DNA repair. mismatch modifying enzyme would convert the mispaired T to a thymine derivative such as thymine glycol or hydroxy- Efficient correction of base-base mismatches, arising as er- methyluracil, which would then be removed by their respec- rors of DNA polymerase or through recombination, requires tive DNA glycosylase (12, 13). To provide experimental that the cellular machinery be able to direct the repair to the evidence supporting either of these two pathways, we de- strand carrying the original information. For this purpose, cided to analyze the in vitro G-T repair reaction in greater secondary signals such as adenine methylation or strand detail. nicks are used (for a comprehensive review, see ref. 1). The Our previous results have also shown that the processing GOT mispair is the only one that can arise also by an ofthe apyrimidinic (AP) site, arising in the DNA following the alternative pathway in "resting" (i.e., nonreplicating, non- removal ofthe mispaired thymine, leads to the appearance of recombining) DNA-through the spontaneous hydrolytic a single nucleotide gap opposite the guanine (10). We were deamination of 5-methylcytosine. In the correction of this interested in finding out which DNA polymerase is involved latter type of G-T mismatch, no strand discrimination is in the gap-filling reaction, as this information could provide required, as it should always be corrected to a G-C. Indeed, us with further insights into the mechanism of repair of this repair pathways thought to be dedicated to the correction of unique type of deamination damage, the G-T mismatch. the deamination-associated GOT mispairs have been identified in Escherichia coli (2-4) as well as in mammalian cells (5, 6). In all organisms studied to date, correction ofdeamination MATERIALS AND METHODS damage is mediated by base-specific glycosylases, which Synthesis of the Tritiated G-T Duplex. The 90-mer oligonu- remove the deaminated base from the sugar-phosphate back- cleotide A (15 pmol) and the 5'-phosphorylated 49-mer primer bone by cleaving the glycosylic bond. Uracdil DNA glycosyl- (10 pmol) (see Fig. 2) in 100 1.L of Sequenase buffer (40 mM ase and hypoxanthine DNA glycosylase remove the products Tris-HCI, pH 7.5/10 mM MgCl2/50 mM NaCl) were heated of cytosine and adenine deamination, uracil (U) and hypo- for 7 min at 800C and then allowed to stand at room temper- xanthine (H), respectively (for review, see refs. 7 and 8). ature for 10 min. To 50 jl ofthe annealed mixture was added Both enzymes are highly substrate specific and can remove 5 1ul of0.1 M dithiothreitol, 30 pmol of [methyl-3H]thymidine their respective substrates from matched (A-U and C-H) as 5'-triphosphate (43 Ci/mmol, 1 mCi/ml; 1 Ci = 37 GBq; well as mismatched (G-U and T.H) duplexes. As neither U Amersham) and the total volume was adjusted to 74 1Ld with nor H is a natural DNA base, their excision can be mediated water. One microliter of Sequenase (13 units/,ul; United by the base-specific enzymes from both double- and single- States Biochemical) was added and the mixture was left for stranded DNA. 5 min at room temperature; 7.5 Al of dNTPs (2.5 mM each) In our previous studies, we reported that G-T mispairs, was then added and the reaction was allowed to proceed for incorporated in the simian virus 40 genome and transfected a further 5 min at 370C. The mixture was extracted with an into monkey CV-1 (5, 6) or human (9) cells, were corrected equal volume of phenol/chloroform and the oligonucleotide with high efficiency and mostly to G-C pairs. Our in vitro was recovered by ethanol precipitation. The dried pellet was experiments (10) demonstrated that in nuclear extracts from suspended in 4.5 jul of formamide loading dye, heated for 3 human (HeLa) cells, the mispaired thymidine was excised min at 950C, and applied on an 8% denaturing polyacrylamide from DNA to generate a single nucleotide gap. Preliminary gel. A duplicate experiment was carried out with a 5' 32p- evidence also suggested that the initial step of this repair labeled 49-mer (see Fig. 2), and this product mixture was process was mediated by a DNA glycosylase. This was an loaded in an adjacent lane as a radioactive marker. The band unexpected finding. Thymine is a natural DNA base and any migrating with the same Rf as the 32P-labeled control was cut

The publication costs of this article were defrayed in part by page charge Abbreviation: AP, apyrimidinic. payment. This article must therefore be hereby marked "advertisement" *Present address: IRBM, via Pontina km 30,600, 00040 Pomezia, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Rome, Italy. 5842- Downloaded by guest on September 24, 2021 Biochemistry: Wiebauer and Jiricny Proc. NatL. Acad. Sci. USA 87 (1990) 5843 Sail Accl EcoRI Hinc Hind III 5. VW a.. ACGT TGTAAAACGACGGCCAGTGAAT TCCCGGGGATCCGTC R ACCTGCAGCCAAGCT TGGCGTAATCATGGTCATAGCTGT T TCCTGTGT TGCAACAT TT TGCTGCCGGTCACT TAAGGGCCCCTAGGCAG YTGGACGTCGGTTCGAACCGCAT TAGTACCAGTATCGACAAAGGACACA S. A" S. FIG. 1. Sequence of the synthetic 90-mer substrate. R, A or G; Y, C or T. Cleavage of the duplex G C, labeled at the 5' end of the C strand, with Sal I (v), Acc I (v), and HincII (v) produced the indicated marker bands. out and the tritiated 90-mer T was eluted into 300/A of0.5 M or whether it first modifies it to, for example, thymine glycol ammonium acetate/5 mM EDTA in the presence of 15 fig of or hydroxymethyl thymine, both ofwhich would be substrates tRNA by shaking at room temperature overnight. The oligo- for already characterized glycosylases (12, 13). For this pur- nucleotide was recovered by ethanol precipitation and sus- pose we synthesized a G-T 90-mer duplex (see Materials and pended in sterile water to a concentration of 0.05 pmol/4l. Methods), in which the mispaired thymine residue was labeled Tritiated 90-mer T (1 pmol) was annealed with 12 pmol of to a high specific activity with 3H (Fig. 2). This duplex was then either 90-mer A or 90-mer G in 30 Al of 10 mM Tris HCl/10 incubated with the HeLa nuclear extract. After a suitable mM MgCl2 by immersion in boiling water for 5 min and slow period oftime, an aliquot ofthe reaction mixture was analyzed cooling to room temperature to give duplexes APT and GOT, by TLC. As shown in Fig. 3a, the markers thymine (T), respectively, where the mispaired thymine is tritiated to high 2'-deoxythymidine (dT), and the oligonucleotides are well specific activity. EDTA was added to 10 mM to chelate the resolved in this eluent system. Furthermore, the most prob- free magnesium. able metabolites, thymine glycol and hydroxymethyl thymine, Glycosylase Activity Assay. The A-T or G-T duplexes (0.25 migrate with Rf values lower than that of thymine (data not pmol) were incubated with the HeLa nuclear extract (2 Al; 8 shown). Fig. 3b shows that incubation ofthe perfectly matched mg/ml) in binding buffer (25 mM Hepes-KOH, pH 7.9/0.5 duplex APT with the nuclear cell extracts failed to liberate any mM EDTA/0.01 mM ZnCl2/0.5 mM dithiothreitol) in a total free radioactivity from this oligonucleotide substrate. In con- volume of 20 /l for 15 hr at 30'C. Five microliters each of a trast, of the total saturated aqueous solution of thymine and thymidine was z17% radioactivity present in the starting added to the reaction mixture, and 5 Al was spotted on a silica G'T duplex was found to comigrate with the thymine marker gel TLC plate (4 x 8 cm; Polygram Sil G/UV254, Macherey (see also Fig. 3c). We thus conclude that the first step of the & Nagel) and eluted with chloroform/ethanol (8.5:1.5, vol/ repair reaction is mediated by an as yet uncharacterized DNA vol). The dried plate was photographed under UV (254 nm), thymine glycosylase. and the positions ofthe markers were drawn on the plate with The Single Nucleotide Gap Is Filled In by Polymerase P. Due a soft pencil. The plates were then sprayed with EN3HANCE to the limitations ofour experimental system, we are unable to (NEN) and subjected to fluorography on a preflashed Hy- determine which AP endonuclease is involved in the process- perfilm (Amersham) for 14 days at -80TC. The regions ing ofthe AP site generated by the thymine glycosylase. What corresponding to thymine, thymidine, and the oligonucleo- we observed, however, was the appearance of a nick at the tide (baseline) were scraped off and counted in 5 ml of position ofthe HincII marker when the T strand ofthe 90-mer scintillation fluid. duplex was labeled at its 3' end (10) and a nick at the position Oligonucleotide Nicking Assay. The assay was carried out of the Acc I marker when the T strand was 5' labeled (Fig. 4, as described (10). The G*T 90-mer (40, resp. 50, fmol), labeled lane 1; ref. 10). This suggested that, after the removal of the with 32P at the 5' end ofthe T strand was incubated with HeLa mispaired thymine by the glycosylase, the remaining baseless nuclear extract (2.5 Al; 8 mg/ml) in binding buffer (see above) sugar-phosphate residue had been excised to generate a single at 30'C for the times indicated in the figure legends, in a total nucleotide gap in the T strand. We were interested in studying volume of 20, resp. 25, Al. After proteinase K treatment and the effects of added cofactors and specific DNA polymerase phenol/chloroform extraction, the samples were ethanol inhibitors on the filling in of this gap. Fig. 4 shows the effect precipitated and run on 12% denaturing polyacrylamide gels. of incubating the GOT duplex with the nuclear extracts in the Oligonucleotide Repair/Polymerase Assay. In these exper- presence of the listed cofactors, followed by digestion of the iments, the nicking assay mixtures were supplemented with recovered treated duplex with Sal I. As discussed previously 1 mM Mg2' and 1.5 mM ATP (neutralized with NaOH). In (10), the duplex could be cleaved with Sal I only after the gap some instances, specific DNA polymerase inhibitors were included, as indicated in the legend to Fig. 4. Aphidicolin a bc (Calbiochem) was dissolved in 83% dimethyl sulfoxide to give _ -tritiated 90-mer a 1 mM stock solution. The rabbit anti-rat polymerase /3 A antiserum (a kind gift of S. Wilson, National Institutes of Health) cross-reacts with the human enzyme [the two pro- teins are 95% homologous (14)], lighting up essentially only b P____ \_ a single protein band of40 kDa on a Western blot (S. Wilson, ______n A -tritiated 5O-mer 49- mer personal communication). a M A RESULTS Repair of GOT Mispairs in Vitro Is Mediated by a Specific FIG. 2. Synthesis of the tritiated 90-mer T. Autoradiograph of an Glycosylase That Liberates Thymine. The substrate for the in 8% denaturing polyacrylamide gel. In this control experiment, the vitro mismatch reactions was a 49-mer primer was 5'-labeled with 32p to facilitate the visualization repair synthetic 90-mer oligo- ofthe extension reaction by autoradiography. The 50-mer and 90-mer nucleotide duplex (Fig. 1). Our earlier experiments (10) sug- bands in lanes b and c are thus doubly labeled. a, starting 49-mer; b, gested that the initial step of G-T mismatch repair in vitro 49-mer extended by 1 nucleotide with [3H]dTTP; c, full-length 90-mer involves a DNA glycosylase, which generates an AP site T produced by adding nucleotide chase to b. In the glycosylase assay, opposite the G. We wanted to establish whether this enzyme the 49-mer primer was phosphorylated with unlabeled phosphate to removes the mispaired thymine residue in its unmodified form avoid the interference of 32p in the fluorography. Downloaded by guest on September 24, 2021 5844 Biochemistry: Wiebauer and Jiricny Proc. NatL Acad. Sci. USA 87 (1990) a b c (cpm) 1000

800

600 - _ T dT- * - : dT 400 B

200

B- * 0 - A/T G/T A/T G/T A T G T

FIG. 3. Liberation of thymine from the tritiated 90-mer duplex G*T. The tritiated duplexes A-T and G-T were incubated with the extract and the reaction products were analyzed by TLC. (a) Photograph of the TLC silica gel plate illuminated with UV light (254 nm). The positions of the markers thymine (T), thymidine (dT), and the oligonucleotide species (B, baseline) are indicated. (b) Fluorograph of the same TLC plate sprayed with EN3HANCE. (c) Distribution of radioactivity among the three marker spots, as assayed by scintillation counting. had been filled with dCMP and after the remaining nick had (AP) site appeared to have been cleaved 3' from the baseless been ligated (e.g., see Fig. 4, lane 3). sugar. Thus the AP site could have been processed by a class The efficiency of nicking with the nuclear extracts can be I enzyme-catalyzed incision 3' from the AP site, and the considerably enhanced in the presence ofATP (compare lane observed single nucleotide gap could then have been gener- 2 with lane 1), although repair of the gap also requires Mg2" ated either by the action of a 3'-*5' exonuclease or by the (lane 3) and dNTPs (present in sufficient amounts even in the sequential action of a class II endonuclease to release the dialyzed extract). As shown in lane 5, the repair polymerase baseless sugar phosphate. Although we are unable to study can incorporate ddCTP into the nick, which can be efficiently this mechanism more closely in nuclear extracts, enzymes utilized by polymerases (3, 'y, and, to a lesser extent, 8 (15), that could be involved in these two processes-namely, AP but produces an unligatable nick that appears at the position of the HincII marker. The ddCTP incorporation, as well as 1 2 3 4 M 5 6 7 8 M the repair reaction can be inhibited with a rabbit anti-rat DNA AT P + + + + + + +

polymerase (3 antiserum (lanes 4 and 6), btit not with the Mg + + + 4 + + preimmune serum (data not shown), while the repair reaction remained unaffected by the addition of 25 ,uM aphidicolin, a aphidicolin + specific polymerase a (and polymerase 8) inhibitor (16) (lane ddCTP + 4 8). Taken together, these data demonstrate that the filling in anti - pol - 1 + of the single nucleotide gap is mediated by polymerase /3. - 90 - m e r DISCUSSION G T The results reported above, together with the data obtained in our previous experiments (10), show that in nuclear extracts from HeLa cells the initial step in the correction of G-T mispairs arising through the deamination of 5-meth- -Hincl1 ylcytosine is the removal ofthe mispaired thymine by a DNA -Acc Wt 4-p o glycosylase to generate an AP site opposite the guanine. Like mo SaI! all other glycosylases characterized to date, our enzyme has 1 2 34 M 56 7 8M no requirement for Mg2" or ATP. The product of the glyc- osylase action, as shown in our TLC analysis, is thymine and FIG. 4. Effect of the addition of cofactors and specific DNA not one of its possible hydroxylated metabolites. This sur- polymerase inhibitors on G-T mismatch repair. The G-T 90-mer, prising finding requires that the enzyme must be inactive on labeled at the 5' end of the T strand with 32p, was incubated with the single-stranded and matched double-stranded DNA. But how nuclear extract for 13 hr at 30°C. After the incubation and extraction does the enzyme differentiate between paired and mispaired steps, the probes were subjected to digestion with Sal I. The figure represents an autoradiogram ofa 12% denaturing polyacrylamide gel. thymines? One obvious possibility is that the repair process The band shown in lane 1, resulting from the incubation of the G-T proceeds according to the first scenario (see the Introduction) duplex in the standard reaction mixture, is indicative ofthe presence whereby the mispair is "tagged" by a G-T binding protein of a single nucleotide gap in the T strand of the duplex. Addition of that would then guide the glycosylase to its site ofaction and 1.5mM ATP to the standard reaction mixture (lane 2) led to enhanced without which the enzyme would be inactive. We have processing ofthe duplex but not to the sealing ofthe gap, which took recently identified a 200-kDa protein that binds to DNA place only in the presence of added 1.5 mM ATP and 1 mM MgCl2 containing G-T mispairs (17), but we cannot say yet whether (lane 3). Filling in and ligation of the gap was prevented by the it fulfills the "tagging" role described above. Thus, the addition of rabbit anti-rat polymerase (3 antiserum (final dilution, elucidation ofthe precise mechanism ofthe mode ofaction of 1:75) (lane 4). The presence of 50 tM ddCTP resulted in gap filling the thymine-specific glycosylase must await the purification but yielded an unligatable nick (lane 5). The incorporation of ddCTP and the could be abolished by the addition of polymerase ,B antiserum (lane of both the binding protein glycosylase. 6). Aphidicolin (25 AM) in dimethyl sulfoxide (lane 8) had no effect The second step of G'T correction should involve an AP on the filling-in and ligation reactions. [Dimethyl sulfoxide alone endonuclease that cleaves the sugar-phosphate backbone. (20%o) was also shown to have no effect (lane 7)]. Lanes M, marker Our initial findings suggested that this was accomplished by 90-mer G-C digested with the indicated enzymes. For the position of a class I AP endonuclease (10), such that the apyrimidinic the markers see Fig. 1. Downloaded by guest on September 24, 2021 Biochemistry: Wiebauer and Jiricny Proc. NatL. Acad. Sci. USA 87 (1990) 5845 endonucleases class I and II and DNase V, a bidirectional Zurcher and Franz Fischer for the oligonucleotides, and Jean-Pierre exonuclease-have already been isolated from human cells Jost and Melya Hughes for critical reading of the manuscript. (refs. 18-20; see ref. 21 for review). 1. Modrich, P. (1987) Annu. Rev. Biochem. 56, 435-466. The next stage ofthe G'T repair process involves the filling 2. Lieb, M. (1983) Mol. Gen. Genet. 191, 118-125. in of the single nucleotide gap. Linn and coworkers (20, 22) 3. Lieb, M. (1985) Mol. Gen. Genet. 199, 465-470. have shown that gaps generated by DNase V at sites of nicks 4. Zell, R. & Fritz, H.-J. (1987) EMBO J. 6, 1806-1815. produced by AP endonucleases are efficiently filled in by 5. Brown, T. C. & Jiricny, J. (1987) Cell 50, 945-950. DNA polymerase (3, which tends to associate with this 6. Brown, T. C. & Jiricny, J. (1988) Cell 54, 705-711. exonuclease. We decided to find out whether polymerase (3 7. Lindahl, T. (1982) Annu. Rev. Biochem. 51, 61-87. 8. Tomilin, N. V. & Aprelikova, 0. N. (1989) Int. Rev. Cytol. 114, is also involved in our repair process in vitro. To this end, we 125-179. made use of the available specific antibodies and inhibitors. 9. Brown, T. C., Zbinden, I., Cerutti, P. A. & Jiricny, J. (1989) As we demonstrated above, the polymerase involved in our Mutant. Res. 220, 115-123. in vitro repair reaction can utilize dideoxynucleoside triphos- 10. Wiebauer, K. & Jiricny, J. (1989) Nature (London) 339, 234-236. phates as substrates, while remaining insensitive to aphidi- 11. Su, S.-S. & Modrich, P. (1986) Proc. Nat!. Acad. Sci. USA 83, colin (up to 100 ,uM; Fig. 3 and data not shown). Moreover, 5057-5061. 12. Demple, B. & Linn, S. (1980) Nature (London) 287, 203-208. as the process can be inhibited by the addition ofpolymerase 13. Cannon-Carlson, S. V., Gokhale, H. & Teebor, G. W. (1989)J. ,( antiserum, human polymerase (3 is most likely the gap- Biol. Chem. 264, 13306-13312. filling enzyme. These data agree with the findings of Matsu- 14. SenGupta, D. N., Zmudzka, B. Z., Kumar, F., Cobianchi, F., moto and Bogenhagen (23), who recently suggested that in Skowronski, J. & Wilson, S. H. (1986) Biochem. Biophys. Res. extracts from Xenopus laevis oocytes the repair of synthetic Commun. 136, 341-347. abasic sites in DNA is mediated by polymerase (3. 15. DiGiuseppe, J. A. & Dresler, S. L. (1989) Biochemistry 28, The involvement of polymerase (3 in the repair of G&T 9515-9520. 16. Hammond, R. A., Byrnes, J. J. & Miller, M. R. (1987) Bio- mismatches in HeLa extracts invites comparison with the chemistry 26, 6817-6824. very short patch repair system of E. coli, first identified by 17. Jiricny, J., Hughes, M., Corman, N. & Rudkin, B. B. (1988) Lieb (2), which was also shown to be specific for the Proc. Nat!. Acad. Sci. USA 85, 8860-8864. correction of GOT mispairs arising via the deamination of 18. Kane, C. M. & Linn, S. (1981) J. Biol. Chem. 256, 3405-3414. 5-methylcytosine. In both these processes, the filling in ofthe 19. Mosbaugh, D. W. & Linn, S. (1980) J. Biol. Chem. 255, short repair tract is carried out by a repair polymerase, 11743-11752. polymerase P3 and polymerase I, respectively (this work; refs. 20. Mosbaugh, D. W. & Linn, S. (1983) J. Biol. Chem. 258, 1 and 24). In contrast, the long-patch repair systems in these 108-118. which correct errors, appear to re- 21. Weiss, B. & Grossman, L. (1987) Adv. Enzymol. 1-34. organisms, replication 22. Randahl, H., Elliott, G. C. & Linn, S. (1988) J. Biol. Chem. quire the replicative polymerases, polymerase a (or poly- 263, 12228-12234. merase 6) and polymerase III, respectively (25, 26). This 23. Matsumoto, Y. & Bogenhagen, D. F. (1989) Mol. Cell. Biol. 9, similarity between the bacterial and mammalian systems 3750-3757. would appear to be oflittle significance. However, the recent 24. Lieb, M. (1987) J. Bacteriol. 169, 5241-5246. discovery of the mammalian rep-i gene by Linton et al. (27) 25. Holmes, J., Jr., Clark, S. & Modrich, P. (1990) Proc. Nat!. could add to its importance. The rep-i gene shares a high Acad. Sci. USA 87, 5837-5841. degree of sequence homology with mismatch-binding pro- 26. Lahue, R. S., Au, K. G. & Modrich, P. (1989) Science 245, teins MutS from Salmonella typhimurium and HexA from 160-164. is conceivable that the 27. Linton, J. P., Yen, J.-Y. J., Selby, E., Chen, Z., Chinsky, Streptococcus pneumoniae (28, 29). It J. M., Liu, K., Kellems, R. E. & Crouse, G. F. (1989) Mol. Rep-1 protein corresponds to the mismatch-binding activity Cell. Biol. 9, 3058-3072. described by Stephenson and Karran (30). Should this be the 28. Haber, L. T., Pang, P. P., Sobell, D. I., Mankovich, J. A. & case, mismatch correction could turn out to be one of a few Walker, G. C. (1988) J. Bacteriol. 170, 197-202. highly conserved pathways of DNA metabolism. 29. Priebe, S. D., Sheikh, H. M., Greenberg, B. & Lacks, S. A. (1988) J. Bacteriol. 170, 190-1%. We thank Silke Bienroth and Walter Kellerfor HeLa extracts, Sam 30. Stephenson, C. & Karran, P. (1989) J. Biol. Chem. 264, Wilson for the gift of the specific polymerase (3 antiserum, Werner 21177-21182. Downloaded by guest on September 24, 2021